File size: 2,006 Bytes
790be30 2e58141 790be30 |
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 61 62 63 64 |
---
license: apache-2.0
tags:
- pretrained
- mistral
- DNA
- virus (both rna and dna)
- biology
- genomics
---
# Model Card for Mistral-DNA-v1-138M-virus (mistral for DNA)
The Mistral-DNA-v1-138M-virus Large Language Model (LLM) is a pretrained generative DNA text model with 17.31M parameters x 8 experts = 138.5M parameters.
It is derived from Mistral-7B-v0.1 model, which was simplified for DNA: the number of layers and the hidden size were reduced.
The model was pretrained using around 15071 viruses > 1kb. Virus genomes were split into 1kb sequences.
Virus genome database was downloaded from https://www.ncbi.nlm.nih.gov/labs/virus/vssi/#/virus?SeqType_s=Genome&VirusLineage_ss=taxid:10239&SourceDB_s=RefSeq.
NB: the DNA sequence was used, not the RNA sequence.
For full details of this model please read our [github repo](https://github.com/raphaelmourad/Mistral-DNA).
## Model Architecture
Like Mistral-7B-v0.1, it is a transformer model, with the following architecture choices:
- Grouped-Query Attention
- Sliding-Window Attention
- Byte-fallback BPE tokenizer
## Load the model from huggingface:
```
import torch
from transformers import AutoTokenizer, AutoModel
tokenizer = AutoTokenizer.from_pretrained("RaphaelMourad/Mistral-DNA-v1-138M-virus", trust_remote_code=True) # Same as DNABERT2
model = AutoModel.from_pretrained("RaphaelMourad/Mistral-DNA-v1-138M-virus", trust_remote_code=True)
```
## Calculate the embedding of a DNA sequence
```
dna = "TGATGATTGGCGCGGCTAGGATCGGCT"
inputs = tokenizer(dna, return_tensors = 'pt')["input_ids"]
hidden_states = model(inputs)[0] # [1, sequence_length, 256]
# embedding with max pooling
embedding_max = torch.max(hidden_states[0], dim=0)[0]
print(embedding_max.shape) # expect to be 256
```
## Troubleshooting
Ensure you are utilizing a stable version of Transformers, 4.34.0 or newer.
## Notice
Mistral-DNA-v1-138M-virus is a pretrained base model for virus genomes.
## Contact
Raphaël Mourad. raphael.mourad@univ-tlse3.fr
|