diff --git "a/deduped/dedup_0603.jsonl" "b/deduped/dedup_0603.jsonl"
new file mode 100644--- /dev/null
+++ "b/deduped/dedup_0603.jsonl"
@@ -0,0 +1,69 @@
+{"text": "Literature on the spectrum of opportunistic disease in human immunodeficiency virus (HIV)-infected patients from developing countries is sparse. The objective of this study was to document the spectrum and determine the frequency of various opportunistic infections (OIs) and non-infectious opportunistic diseases, in hospitalised HIV-infected patients from north India.One hundred and thirty five consecutive, HIV-infected patients  admitted to a tertiary care hospital in north India, for the evaluation and management of an OI or HIV-related disorder between January 2000 and July 2003, were studied.Pneumocystis jiroveci pneumonia (PCP) (7.4%), cryptococcal meningitis and cerebral toxoplasmosis (3.7% each). Most of the cases of TB were disseminated (64%). Apart from other well-recognised OIs, two patients had visceral leishmaniasis. Two cases of HIV-associated lymphoma were encountered. CD4+ cell counts were done in 109 patients. Majority of the patients (82.6%) had CD4+ counts <200 cells/\u03bcL. Fifty patients (46%) had CD4+ counts <50 cells/\u03bcL. Only 50 patients (37%) received antiretroviral therapy. Twenty one patients (16%) died during hospital stay. All but one deaths were due to TB  and PCP .Fever (71%) and weight loss (65%) were the commonest presenting symptoms. Heterosexual transmission was the commonest mode of HIV-acquisition. Tuberculosis (TB) was the commonest OI (71%) followed by candidiasis (39.3%), A wide spectrum of disease, including both OIs and non-infectious opportunistic diseases, is seen in hospitalised HIV-infected patients from north India. Tuberculosis remains the most common OI and is the commonest cause of death in these patients. The first case of human immunodeficiency virus/acquired immunodeficiency syndrome (HIV/AIDS) in India was detected in 1986 in the state of Tamilnadu . Even moThough the majority of HIV-infected population lives in developing nations, there is a paucity of data on natural history, pattern of disease and survival of hospitalised patients with HIV/AIDS from these regions, especially India. It is well established that manifestations of AIDS are influenced by factors such as endemic infections and malnutrition that are widely prevalent in these regions . ConventWe describe a series of 135 consecutive patients with HIV/AIDS, aged 13 years and above, admitted to the All India Institute of Medical Sciences (A.I.I.M.S.) hospital, New Delhi during the period of January 2000 through July 2003. A.I.I.M.S. is a large tertiary level teaching hospital and referral centre located in north India, attending to HIV-infected patients apart from others. The catchment area of this hospital includes the New Delhi national capital territory and neighbouring states mainly, Uttar Pradesh, Bihar, Uttharanchal, Haryana, Punjab and Himachal Pradesh. All patients were under the care of a single unit, of the three units existing in the Department of Medicine. Decision to admit was taken by the treating physician and all patients were hospitalised for the evaluation and treatment of a suspected OI or HIV-related disorder. We have earlier reported the determinants of in-hospital mortality in this series .Diagnosis of HIV infection was made using methods described previously . All pat9/L; lymphocytopenia \u2013 absolute lymphocyte count (ALC) <1.2 \u00d7 109/L; decreased CD4+ \u2013 <500 cells/\u03bcL; thrombocytopenia \u2013 platelet count <150 \u00d7 109/L; elevated erythrocyte sedimentation rate (ESR) \u2013 >20 in the first hour; hypoalbuminaemia \u2013 albumin <35 g/L; hyperglobulinaemia \u2013 globulin >40 g/L; hyperbilirubinaemia \u2013 serum total bilirubin >20.5 \u03bcmol/L; elevated liver enzymes \u2013 >2 times the upper limits of normal ; hypoxaemia \u2013 PaO2 <12 kPa; increased arterial-alveolar oxygen gradient (A-a DO2) \u2013 >3.3 kPa, while breathing ambient air (FiO2 = 0.21).Various laboratory abnormalities were defined using cut-off values as follows: anaemia \u2013 haemoglobin <100 g/L; leucopenia \u2013 total leucocyte count (TLC) <4 \u00d7 10Mycobacterium tuberculosis in sputum culture; disseminated tuberculosis (DTB): clinical features suggestive of TB with concurrent involvement of at least two non-contiguous organs, in the presence of bacteriological and/or histopathological evidence of TB and improvement with anti-tuberculosis therapy; miliary tuberculosis (MTB): clinical presentation consistent with TB and bacteriological and/or histopathological evidence of TB and demonstration of bilateral miliary infiltrates on chest radiograph or high-resolution CT; tuberculosis meningitis (TBM): clinical and cerebrospinal fluid (CSF) features consistent with tuberculosis meningitis, with bacteriologic demonstration of M. tuberculosis in CSF or after exclusion of other aetiologies such as cryptococcus and syphilis, with evidence of tuberculosis elsewhere and/or improvement with anti-tuberculosis therapy; cryptococcal meningitis: in CSF, demonstration of Cryptococcus sp. yeast cells by India ink or antigen by latex agglutination or growth in culture; cerebral toxoplasmosis: demonstration of multiple ring-enhancing cerebral parenchymal lesions on contrast-enhanced CT or magnetic resonance imaging (MRI), in the presence of anti-toxoplasma antibody in serum and clinical response to anti-toxoplasma therapy; progressive multifocal leucoencephalopathy (PMLE): compatible clinical presentation with demonstration of characteristic cerebral white matter changes by MRI; Pneumocystis jiroveci pneumonia (PCP): bilateral, diffuse interstitial infiltrates on chest radiograph or high-resolution CT, with hypoxaemia (PaO2 <12 kPa) and sputum smears/cultures negative for aerobic bacteria and AFB and/or demonstration of Pneumocystis jiroveci in induced sputum [While genuine efforts were made to establish the diagnosis of an OI, patients at times were too sick to undergo invasive diagnostic procedures such as bronchoscopy or tissue biopsy and hence the following criteria were used to define an OI concerned. Pulmonary tuberculosis (PTB): clinical features suggestive of TB with radiological features compatible with TB on chest radiograph or computed tomographic scan (CT) and/or demonstration of acid-fast bacilli (AFB) in sputum smears or growth of d sputum .2 <9.3 kPa), corticosteroids were given in addition to oral co-trimoxazole. None of these patients received assisted ventilation. All patients were counselled and offered antiretroviral therapy, whenever indicated. Upon discharge from the hospital, patients were advised to follow-up as outpatients, on a regular and as needed basis.Patients received primary chemoprophylaxis for PCP and toxoplasmosis and received treatment for specific OIs followed by secondary prophylaxis, as per recommendations . For patEntry and analysis of all data were done using a statistical software package . Entered data were double-checked for discrepancies. Data are presented as mean \u00b1 standard deviation (SD) when distributed normally and as median with interquartile range (IQR), if the distribution was skewed. Frequency of various clinical and laboratory findings and the frequencies of individual OIs are expressed as proportions (%). The relation between ALC and CD4+ count was analysed by Pearson's product moment correlation. Paired-samples t-test was applied to assess the improvement in CD4+ cell counts following antiretroviral therapy.Over a period of about three and a half years, 135 patients with HIV/AIDS were admitted and all these patients were included in the study. Mean age of the study group was 34 \u00b1 10 (range: 13\u201373) years. Females constituted less than one fourth of the study group (17%). Details of other demographic characteristics and transmission categories are presented in Table-2) and generalised lymphadenopathy was present in a considerable proportion of patients (16.3%). Poor performance on mini mental status examination (MMSE score <23) was not uncommon (20.7%). Altered sensorium and focal neurologic deficit were encountered occasionally. Anaemia was present in about half of the patients (50.5%) and among those who where anaemic, 17 (21.8%) patients were on zidovudine. A considerable number of patients were leucopenic and in 22% of patients ALC was less than 1200/\u03bcL . Productive cough and dyspnoea were present in about a fourth of patients , followed by oral candidiasis (39.3%). Most of the cases of TB were disseminated  received antiretroviral therapy, of which three patients were taking protease inhibitor (PI) based regimens. All other patients received non-nucleoside reverse transcriptase inhibitor (NNRTI) based  triple-drug regimens. Follow-up CD4+ counts were done in 16 patients after three to six months of antiretroviral therapy. The mean CD4+ count increased to 224 \u00b1 178 cells/\u03bcL from a baseline mean of 131 \u00b1 122 cells/\u03bcL, which was statistically significant (P = 0.003). Myelosuppression during antiretroviral therapy developed in four patients, who were taking regimens containing zidovudine. One patient who was on didanosine developed acute pancreatitis Figure . AnotherTwenty one patients 15.6%) died in hospital, most of them due to TB (16 patients) and PCP (4 patients). All patients who died in hospital except for one, had CD4+ counts less than 200 cells/\u03bcL  are the major cause of morbidity and mortality in patients with HIV infection. In resource-limited settings, knowledge regarding the prevalence of various OIs might aid in making decisions regarding empirical treatment and would help to prioritise limited resources. To this end, we studied the frequency of various opportunistic conditions in this series of 135 HIV-infected patients. Nearly a half of these patients came from places other than New Delhi, being referred by medical practitioners or approached on their own. In India, HIV-infected patients are usually treated in tertiary level centres, due to lack of expertise and facilities in primary and district level hospitals. Moreover, for reasons of privacy patients and their kin prefer treatment at places far off from their home towns. This series comprises predominantly of patients from the northern states of India. Hence the findings of the present study may not apply to south India and north-east Indian states. Moreover, being a hospital based study, patients with severe illness causing rapid death and patients with milder symptoms who prefer treatment from local health facilities may not have been proportionately represented in the study group.Most of the patients were in the age group 21\u201340 years and males were predominantly affected. This is similar to nation-level statistics in which, of the 57781 cases of HIV/AIDS reported to the National AIDS Control Organisation (NACO), 89% of the cases were in the age group 15\u201344 years and 74% were males . This seThe three symptoms, namely fever, weight loss and diarrhoea were common presenting features. In this series of patients, all of whom had some opportunistic condition at presentation indicating advanced HIV disease, wasting is anticipated. The association of severe weight loss at presentation with TB in HIV-infected patients has been reported before . TB was Penicillium marneffei has been reported to be the third commonest OI in southeast Asia [P. marneffei endemicity. No case of P. marneffei infection was found in the present study. Kaposi's sarcoma, atypical mycobacterial infection and disseminated CMV disease were not seen, as has been observed by a previous study from south India [The frequencies of various OIs as observed in the present study are similar to those reported earlier from other parts of India ,9,14,15.ast Asia  and is kast Asia  which shth India . It is ath India ,24. In Ith India -27. As sth India . Apart fOverall in-hospital mortality in this series is considerable and is probably reflective of the advanced nature of disease at presentation. This is evidenced by the fact that more than 80% of patients had CD4+ counts less than 200 cells/\u03bcL and all but one deaths occurred in this group. However, as we had reported earlier, CD4+ cell counts do not determine the immediate outcome of patients with an OI, whereas the latter does . The proA wide spectrum of OIs is seen in hospitalised patients with HIV/AIDS from north India. Tuberculosis is the most common OI in this group of patients. Though uncommon, non-infectious opportunistic conditions also occur. Many patients suffer from more than one OI. Hospital mortality is significant, with TB and PCP being responsible for most of these deaths. Whenever a definite diagnosis is not established quickly, empirical treatment should be considered. Such an approach is likely to improve immediate outcome in hospitalised patients with HIV/AIDS.The author(s) declare that they have no competing interests.SKS conceived of the study, designed and coordinated the study and revised the manuscript critically for important intellectual content. TK participated in the design of the study and statistical analysis and drafted the manuscript. AB participated in the design of the study, performed the statistical analysis and revised the manuscript for important intellectual content. TG participated in the design of the study, collected the clinical data and contributed significantly to the content of the manuscript. IB participated in the design of the study, collected the clinical data and participated in drafting the manuscript. PKS participated in the design of the study and coordination and also contributed significantly to the content of the manuscript. All authors read and approved the final manuscript.The pre-publication history for this paper can be accessed here:"}
+{"text": "Hand-carried ultrasound (HCU) devices have been demonstrated to improve the diagnosis of cardiac diseases over physical examination, and have the potential to broaden the versatility in ultrasound application. The role of these devices in the assessment of hospitalized patients is not completely established. In this study we sought to perform a direct comparison between bedside evaluation using HCU and comprehensive echocardiography (CE), in cardiology inpatient setting.We studied 44 consecutive patients  who underwent bedside echocardiography using HCU and CE. HCU was performed by a cardiologist with level-2 training in the performance and interpretation of echocardiography, using two-dimensional imaging, color Doppler, and simple calliper measurements. CE was performed by an experienced echocardiographer (level-3 training) and considered as the gold standard.There were no significant differences in cardiac chamber dimensions and left ventricular ejection fraction determined by the two techniques. The agreement between HCU and CE for the detection of segmental wall motion abnormalities was 83% (Kappa = 0.58). There was good agreement for detecting significant mitral valve regurgitation (Kappa = 0.85), aortic regurgitation (kappa = 0.89), and tricuspid regurgitation (Kappa = 0.74). A complete evaluation of patients with stenotic and prosthetic dysfunctional valves, as well as pulmonary hypertension, was not possible using HCU due to its technical limitations in determining hemodynamic parameters.Bedside evaluation using HCU is helpful for assessing cardiac chamber dimensions, left ventricular global and segmental function, and significant valvular regurgitation. However, it has limitations regarding hemodynamic assessment, an important issue in the cardiology inpatient setting. Bedside echocardiography can bring important anatomical and hemodynamic information for the management of critically ill patients, and is often required in hospitalized patients for the assessment of left ventricular function. Standard echocardiographic equipments, while optimal, have large size and sometimes are difficult to maneuver in the emergency room or intensive care units. Recently, hand-carried ultrasound (HCU) devices have been demonstrated to broaden the versatility in ultrasound application. Due to their portability and low cost, HCU acts like a stethoscope, providing information beyond physical examination at the point-of-care ,2. AlthoWe studied 44 consecutive hospitalized patients with cardiovascular disorders. Patients were included in the study when their referring physicians asked for a bedside evaluation with conventional echocardiography. In all patients, we performed the echocardiography with both HCU and CE within a maximal interval of 24 hours. The clinical characteristics of patient population are shown in Table All patients underwent two echocardiographic evaluations. First, HCU was performed with the portable device OptiGo  and, consecutively, by a commercially available system  equipped with a 4-2 MHz transducer and second-harmonic imaging. HCU was performed by one same cardiologist with level 2-training in the performance and interpretation of echocardiography according to the specifications of the American Society of Echocardiography [OptiGo is equipped with a 2.5 MHz phased-array transducer and operates on a rechargeable Lithium ion battery, which facilitates its use at bedside. HCU was performed using two-dimensional imaging, color Doppler flow mapping, and simple caliper measurements. Images were frozen and scrolled for review and the measurements were performed on-line.CE evaluation included two-dimensional with second-harmonic imaging, M-mode, and both spectral and color Doppler flow mapping. Images were recorded on videotape or digitalized. The aorta, left atrium, left ventricular end-diastolic and end-systolic diameters, as well as interventricular septal and posterior wall thickness were measured according to the recommendations of the American Society of Echocardiography . The lefValve structure and function were analyzed. Dysfunctions were classified into mild, moderate, or severe degree according to the qualitative evaluation by HCU, and using both qualitative and quantitative parameters by CE . A signiThe intraobserver variability of CE findings was assessed in 15 randomly assigned patients, with analysis made at least 4 weeks apart. The interobserver agreement between the experienced echocardiographer and the level 2-trained cardiologist was assessed by the analysis of 15 CE recorded examinations.t test. Chi-square and Fisher Exact tests were used for categorical variables. Agreement between HCU and CE results were assessed by the Kappa statistics. Interobserver and interobserver variability was determined by intra-class correlation and linear regression. A two-tailed p value <0.05 was considered significant.Continuous data are expressed as mean \u00b1 one standard deviation (SD) and categorical data as proportions. Comparisons between groups for continuous variables were made using Student Imaging analysis was feasible with HCU and CE in all patients. The percentage of patients with good, regular and bad image quality using CE were 80%, 18% and 2%, respectively. HCU had a lower percentage of patients with good image quality (59%), and a higher percentage of patients with regular (27%) and bad (14%) image quality (p < 0.05 versus CE), as shown in Figure There were no significant differences in cardiac chamber dimensions obtained by HCU and CE, except for the posterior wall thickness, which was lower when assessed by HCU Table . Among tThe analysis of segmental wall motion was not possible by HCU in two patients, due to poor endocardial border delineation, and was deemed feasible in all patients using CE. In the remaining 42 patients, HCU correctly identified eight of the 11 patients with WMA by CE, and failed to identify three of them. These three false-negative results occurred in patients with bad image quality by HCU. On the other hand, among the 31 patients without WMA by CE, HCU correctly identified 27 patients, and had four false-positive results. Among these four cases, three patients had global left ventricular dysfunction and one had asynchronic movement of the interventricular septum. The agreement between HCU and CE for the detection of WMA was 83% .CE identified nine patients with pericardial effusion, one patient with a moderate effusion and the remaining eight patients with mild effusions. HCU correctly detected and classified pericardial effusion in seven patients, and failed to diagnose two patients with mild effusions, both localized posterior to the left ventricle.Significant mitral valve regurgitation was diagnosed by CE in 16 patients, and by HCU in 13 of them. The agreement between HCU and CE for detection of this abnormality was 93% . Significant aortic valve regurgitation was detected in three patients by CE and in two by HCU, and the agreement between the two techniques was 98% . Significant tricuspid regurgitation was detected by CE in 16 patients and by HCU in 12 of them. However, there was one additional case misdiagnosed by HCU as of significant degree. The agreement between HCU and CE for the detection of significant tricuspid regurgitation was 88% .Four patients (9%) had aortic valve stenosis, two cases of moderate, one of mild, and the other one of severe degree. Qualitative analysis of valve structure by HCU was capable to identify aortic stenosis in two of these patients, but the severity of these lesions was not determined. There were six (14%) patients with prosthetic valves and eight (18%) patients with pulmonary hypertension, in which estimation of transvalvar gradients or valvular areas were performed only by CE. A complete evaluation of these patients was not possible using HCU due to its technical limitations in determining hemodynamic parameters.The intraobserver agreement for detection of pericardial effusion, WMA, and significant valvular dysfunction was 100%, and the interobserver agreement was 91%. There was an excellent correlation between LVEF estimated in the first and second evaluation by the same observer . The correlation between LVEF estimated by the experienced echocardiographer and the cardiologist with level 2-training in echocardiography was r = 0.88 (p < 0.05).The present study describes the value of bedside evaluation of cardiac patients using HCU in comparison to CE. Our results demonstrate that HCU may be used for the assessment of cardiac chamber dimensions, estimation of left ventricular function, and detection of WMA. Moreover, we found a good agreement between HCU and CE for detecting significant valvular regurgitation. However, HCU presents important limitations regarding the assessment of prosthetic and stenotic valves, as well as for the evaluation of patients with pulmonary hypertension, due to the lack of spectral Doppler.Bedside echocardiography is a frequently used diagnostic tool in the cardiology inpatient setting and can affect the patient management, direct further diagnostic work-up, and modify therapeutic decisions. The recent development of portable ultrasound devices has the potential to allow quick and easy-to-use echocardiography at the point-of-care, although its value in hospitalized patients was not completely defined. In patients with cardiovascular disorders, HCU has been shown to increase the diagnostic accuracy over physical examination when performed by cardiologists with level-2 training in echocardiography . In the However, when considering the full spectrum of abnormalities in hospitalized patients, previous reports demonstrated that hand-carried bedside echocardiography failed to quantify valvular regurgitation and also missed findings relevant to clinical questions in a significant number of patients. These studies concluded that HCU falls far short of standard echocardiography in evaluation of critically ill patients ,12. We dIn the present study, we did not evaluate the effect of HCU on patient management. Agreement between CE and HCU for detection of WMA was analyzed in 42 patients, since two patients were initially excluded because of inadequate acoustic window. The specific issue of agreement between HCU and CE according to image quality was not addressed in the present study because of the limited number of patients in each group.We concluded that HCU is useful for bedside assessment of left ventricular global and segmental left ventricular function as well as for evaluation of significant valvular regurgitation. However, it has limitations regarding hemodynamic assessment, which is an important issue in the cardiology inpatient setting.Therefore, we emphasize that bedside echocardiography using HCU should be performed by cardiologist with at least level 2-training in echocardiography, and always complemented with CE when hemodynamic evaluation is necessary.The authors declare that they have no competing interests.JMT and WMJ designed the study, did the selection and recruitment of the patients, and wrote the text. RRM and JMC performed the echocardiograms and participated in the subsequent analysis of data. JLA and JFR analyzed the statistics and revised this manuscript."}
+{"text": "Pneumocystis pneumonia (PCP) is an increasing problem amongst patients on immunosuppression with autoimmune inflammatory disorders (AID). The disease presents acutely and its diagnosis requires bronchoalveolar lavage in most cases. Despite treatment with intravenous antibiotics, PCP carries a worse prognosis in AID patients than HIV positive patients. The overall incidence of PCP in patients with AID remains low, although patients with Wegener's granulomatosis are at particular risk.In adults with AID, the risk of PCP is related to treatment with systemic steroid, ill-defined individual variation in steroid sensitivity and CD4+ lymphocyte count. Rather than opting for PCP prophylaxis on the basis of disease or treatment with cyclophosphamide, we argue the case for carrying out CD4+ lymphocyte counts on selected patients as a means of identifying individuals who are most likely to benefit from PCP prophylaxis.Corticosteroids, lymphopenia and a low CD4+ count in particular, have been identified as risk factors for the development of PCP in adults with AID. Trimethoprim-sulfamethoxazole (co-trimoxazole) is an effective prophylactic agent, but indications for its use remain ill-defined. Further prospective trials are required to validate our proposed prevention strategy. Pneumocystis carinii was identified a hundred years ago by Chagas  and recoPneumocystis pneumonia is caused in humans by the recently renamed Pneumocystis jiroveci Frenkel 1999), previously known as Pneumocystis carinii and now thought to be related to fungi on the basis of DNA analysis, despite morphological similarities to protozoa . The org99, previPneumocystis pneumonia is almost always exclusive to immunocompromised hosts. Two thirds of cases occur in HIV positive patients and constitutes the initial manifestation of AIDS in 46% of these patients . A thirdP. jiroveci trophozoites proliferate and attach to type I alveolar pneumocytes causing desquamation, leading to a foamy eosinophilic exudate visible on hematoxylin-eosin staining and a \"honey comb\" appearance of lung tissue. Both antibody and cell mediated immunity have been postulated as being involved in host protection .HIV-negative patients with PCP are older (48\u201361 years) than HIV positive patients. Males are affected more often than females . The clinical course is typically more acute, with an average duration of 6\u201313 days. The most frequent clinical symptoms are dyspnoea (63\u2013100%), cough (55\u201374%), weakness (47%), loss of appetite (38%) expectoration 22\u201325%), sweating (19%), weight loss (13%), haemoptysis (9%) and thoracic pain (9%). Physical findings include fever >38\u00b0C (63\u201385%), r\u00e2les (55\u201366%), tachycardia (25%) and tachypnoea (22%). Chest radiography may show bilateral abnormalities (68\u201388%), interstitial opacities (64\u201380%) and alveolar opacities (31\u201347%), but may be normal (5\u20137%) -16,18,21\u201325%, sweP. jiroveci infection is diagnosed in most cases by bronchoalveolar lavage, which, depending on the staining method used, has been reported to have a sensitivity of 81 to 90% and a specificity of 90 to 100% . Other mTwo antibiotic regimes have been shown to work, co-trimoxazole and parenteral pentamidine isethionate. Efficacies are comparable, although side-effects are particularly common with co-trimoxazole in HIV associated PCP and affect up to 60% of such patients . These iThe prognosis of HIV negative PCP is worse than for those HIV positive, with intensive care admission in 31\u201360%; mechanical ventilation in 14\u201364%; overall mortality 19\u201347%, rising to 50\u201371% on intensive care, although some series suggest an improved mortality in recent years ,27. PoorWhile PCP in HIV positive patients has been associated with a high incidence of relapse after successful therapy, this has not been seen in patients with AID, even without secondary prophylaxis and despite ongoing immunosuppressive treatment. This is thought to be related to better clearance of organism, confirmed by repeat bronchoalveolar lavage .There is no specific surveillance system in the United Kingdom (UK) for PCP, other than in HIV infection. Although laboratories are invited to report isolates of P. jiroveci to the Communicable Disease Surveillance Centre, it is estimated that only a fifth of clinically diagnosed cases of PCP are reported . As the The overall incidence of PCP from 1990 to 1999 has declined in the UK , as a reAttempts have been made to characterise the incidence of PCP amongst patients with AID, usually by retrospective analysis of case records. Ward & Donald's review of 223 cases of PCP in AID is the largest series and covered 2.6 million hospitalisations over the period 1983 to 1994 . They foPneumocystis pneumonia in AID is unusual in the absence of steroid treatment. Corticosteroids have been recently administered in over 90% of cases in most series ,17,18,22A number of cytotoxic and other immunosuppressive agents commonly used in the treatment of AID are frequently associated with PCP, including cyclophosphamide, azathioprine, methotrexate and ciclosporin . Cycloph3) is almost a prerequisite, with 91% of patients exhibiting a low lymphocyte count. Fifty percent of such PCP patients have total lymphocyte counts of <400 cells/mm3 [3 was recorded in ten (83%) of 12 patients with PCP, but such a low lymphocyte count was recorded in 11 (34%) of 32 with Wegener's unaffected by PCP [3 which captured 4 out of 6 cases with PCP and SLE, but only 1 of 20 patients with SLE unaffected by PCP.Data on PCP associated with AID indicates lymphocytopenia  and have a particularly poor prognosis, as discussed earlier.Any method used to select patients for prophylactic treatment needs to be assessed against set standards and have a high sensitivity and specificity. The standards should address the percentage of PCP cases captured by the selection criteria  and the risk of the condition in the selected group (which should be significant). In HIV patients who meet the criteria for PCP prophylaxis as set out by the US Public Health Service , the ann3 would capture 91% of cases of PCP in all HIV negative patients, but would also include 39\u201346% of patients on systemic steroids, most of whom would be unaffected by PCP. Administering prophylaxis to such large numbers of patients would unnecessarily expose patients to drug side-effects and potentially encourage drug resistance. However, analysis of their data reveals that the subgroup of patients with AID who developed PCP had CD4+ counts of <250 cells/mm3 and six out of eight had counts <200 cells/mm3 [In the study by Mansharamani et al, their proposed cut off of <300 CD4+ cells/mmells/mm3 .Given the laboratory costs, we would argue in favour of performing CD4+ counts after one month's immunosuppression only on patients who satisfy the following three screening criteria:\u2022 Steroid dosage >15 mg prednisolone or equivalent/day\u2022 >three months corticosteroid treatment proposed3\u2022 total lymphocyte count <600 cells/mm3 might then warrant the use of prophylactic co-trimoxazole, if the annual risk of PCP in these patients is greater than 9%. Most cases of PCP in patients with AID would be captured by these criteria, according to published series.A CD4+ count <200 cells/mm3, information which is currently unavailable.Clearly, further prospective investigation is required to gather sufficient data to validate any selection method. To justify our proposed threshold for prophylaxis we would need to know the risk of PCP for patients on steroid-based immunosuppression for AID with CD4+ counts of <200 cells/mmP. jiroveci infection in HIV negative patients presents more acutely and has a worse prognosis. The incidence of PCP in patients with AID is low, although these patients still represent a considerable proportion of all HIV negative cases. It is important to have a high index of suspicion of PCP when treating AID with steroid based immunosuppressive regimes, as early treatment could improve prognosis. The risk of infection is related to treatment with systemic steroid, ill-defined individual variation in steroid sensitivity and CD4+ lymphocyte count. Effective and relatively safe prophylaxis is available. Rather than opting for PCP prophylaxis on the basis of disease or treatment with cyclophosphamide, we argue the case for carrying out CD4+ lymphocyte counts on selected patients as a means of identifying individuals who are most likely to benefit from PCP prophylaxis. Further prospective trials are required to validate our proposed prevention strategy.The authors declare that they have no competing interests.AJ Carmichael initiated the discussion, appraised results, lead departmental debates and helped revise the manuscript. ES carried out the literature search, presented at meetings and wrote the original manuscript. All authors read and approved the final manuscript.The pre-publication history for this paper can be accessed here:"}
+{"text": "Pneumocystis jiroveci pneumonia (PCP) is an important opportunistic infection among immunosuppressed patients, especially in those infected with human immunodeficiency virus (HIV). The clinical presentation of PCP in immunosuppressed patients have been well-reported in the literature. However, the clinical importance of PCP manifesting in the setting of an immunorestitution disease (IRD), defined as an acute symptomatic or paradoxical deterioration of a (presumably) preexisting infection, which is temporally related to the recovery of the immune system and is due to immunopathological damage associated with the reversal of immunosuppressive processes, has received relatively little attention until recently.10 copies/ml to 3.1 log10 copies/ml) was observed in HIV-positive patients who developed PCP. A similar upsurge in peripheral lymphocyte count was observed in our patients preceding the development of PCP, as well as in other non-HIV immunosuppressed patients reported in the literature.We aim to better define this unique clinical syndrome by reporting two cases of PCP manifesting acutely with respiratory failure during reversal of immunosuppression in non-HIV infected patients, and reviewed the relevant literature. We searched our databases for PCP cases manifesting in the context of IRD according to our predefined case definition, and reviewed the case notes retrospectively. A comprehensive search was performed using the Medline database of the National Library of Medicine for similar cases reported previously in the English literature in October 2003. A total of 28 non-HIV (excluding our present case) and 13 HIV-positive patients with PCP manifesting as immunorestitution disease (IRD) have been reported previously in the literature. During immunorestitution, a consistent rise in the median CD4 lymphocyte count (28/\u03bcL to 125/\u03bcL), with a concomitant fall in the median HIV viral load (5.5 logPCP manifesting as IRD may be more common than is generally appreciated. Serial monitoring of total lymphocyte or CD4 count could serve as a useful adjunct to facilitate the early diagnosis and pre-emptive treatment of this condition in a wide range of immunosuppressed hosts, especially in the presence of new pulmonary symptoms and/or radiographic abnormalities compatible with the diagnosis. Pneumocystis jiroveci (Pj) (previously known as Pneumocystis carinii f. sp. hominis) was first identified as a pathogen in premature infants suffering from interstitial plasma cell pneumonia in European countries during and after World War II, occasionally occurring in epidemics .-31.28-31PCP manifesting as a form of IRD is not a rare phenomenon. As shown in our previous study, it happens in 7 out of 10 (70%) of HIV-negative immunosuppressed hosts infected with Pj . HoweverRapid reduction of immunosuppressive therapy such as steroids has been implicated as a predisposing factor for the development of PCP in HIV-negative patients ,17,23,24Among HIV positive patients, PCP manifesting acutely during the initiation anti-retroviral therapy is a well-recognized phenomenon. The underlying immunopathological nature of this condition, which is reminiscent to IRD occurring in non-HIV infected patients, has been confirmed by histological examination of the lungs and transbronchial biopsy specimens, which demonstrated mixed inflammatory infiltrates including macrophages, neutrophils, lymphocytes, and plasma cells. Almost all infiltrating lymphocytes found in the tissues were of the T cell lineage, shown by immunophenotyping to be predominantly CD4 and CD8 cells . In anotIn our own experience, as well as from the review of published literature, it appears that a surge of absolute lymphocyte count, especially the CD4 lymphocyte count in HIV-positive patients, could potentially act as a surrogate marker for immunopathological damage during IRD in both HIV-negative and HIV-positive patients. In our recent publication , 7 out oFrom the result of this review, it appears that HIV-positive patients with PCP are at risk of clinical deterioration due to IRD if HAART therapy is started within 1 to 2 weeks after the initiation of treatment for PCP  declare that they have no competing interests.RAL and DSH were involved in the clinical evaluation and treatment of patients. BST and IFH helped with literature searching and review. AKW and VCC drafted and refined the manuscript. KYY conceived the study, participated in its design and coordination, and supervised the preparation of the manuscript. All authors have read and approved the final draft of the manuscript before submission.The pre-publication history for this paper can be accessed here:"}
+{"text": "The aim of the study was to investigate the relationship between an incremental shuttle walking test (ISWT) and two laboratory cycle tests in order to assess whether W peak could be estimated from an ISWT.In patients with COPD, both laboratory exercise tests and field walking tests are used to assess physical performance. In laboratory tests, peak exercise capacity in watts (W peak) and/or peak oxygen uptake (VO2 peak. Routine equations for conversion between cycle tests were used to estimate W peak from measured VO2 peak (CPET). Conversion equation for estimation of W peak from ISWT was found by univariate regression.Ninety-three patients with moderate or severe COPD performed an ISWT, an incremental cycle test (ICT) to measure W peak and a semi-steady-state cycle test with breath-by-breath gas exchange analysis (CPET) to measure VO2 peak by CPET.There was a significant correlation between W peak and distance walked on ISWT \u00d7 body weight . The agreement between W peak measured by ICT and estimated from ISWT was similar to the agreement between measured W peak (ICT) and W peak estimated from measured VOPeak exercise capacity measured by an incremental cycle test could be estimated from an ISWT with similar accuracy as when estimated from peak oxygen uptake in patients with COPD. Exercise testing in COPD varies from maximal laboratory tests, requiring advanced technical equipment, to simple field tests. Maximal laboratory tests are mostly constructed to measure peak exercise capacity (W peak), and/or peak oxygen uptake  [2 peak it is possible to estimate W peak [2 peak can be estimated from an ISWT [2 peak. However, using two conversion equations would make the results less reliable. Therefore, an estimation of W peak directly from the performance on ISWT would be preferable. This would be of clinical interest when expensive laboratory tests are not available.Singh et al compared two different walking tests (treadmill and ISWT) and it is unclear whether such a strong relationship would also be found between ISWT and cycle performance. In laboratory testing, the treadmill test evokes slightly higher ratings of VOle tests ,8, wherethe test -11. Bodyl level) ,13. Recel level) ,15. In pe W peak ,17, and The aim of the present study was to investigate whether W peak (assessed on a cycle ergometer) could be estimated from an ISWT in patients with moderate or severe COPD. For this purpose, comparisons of ISWT and two different cycle tests were made.Ninety-three subjects with moderate or severe COPD according to the British Thoracic Society  were con1) < 60% of predicted value and FEV1/VC  < 0.7 after bronchodilatation [Inclusion criteria were COPD with forced expiratory volume in one second  in accordance with the ATS guidelines . Swedish2), heart rate, peak expiratory flow (PEF), perceived exertion  [Incremental shuttle walking test (ISWT) was performed in a level corridor. Two cones were placed 9 m apart comprising a 10 m track as described by Singh et al . InstrucE-scale)  and dyspE-scale)  were reg2 (Optovent Respons) were registered every minute during exercise. Systolic blood pressure, subjective ratings of perceived exertion and dyspnoea were recorded every other minute [Symptom-limited incremental cycle ergometer test (ICT)  with continuous ECG-registration was conducted to measure peak work load (W peak). The subjects started pedalling at 20 W and the load was then increased by 10 W every fulfilled minute until exhaustion. Heart rate, breathing frequency and SpOr minute ,23. All 2 and ratings of perceived exertion and dyspnoea were made identically to the incremental cycle test. To enable measurement of VO2 peak, the subjects wore a mask with a turbine for gas exchange analysis . Additionally, VCO2(carbon dioxide), minute ventilation (VE), respiratory quotient (RQ) and breathing frequency were measured with readings every 30 seconds. After recording steady-state measurements at rest (approximately 4 min of registration at rest) the patient started pedalling at 20 W. The load was kept constant until the ventilation and oxygen uptake reached a plateau, on average 3\u20134 min at each level, then the load was increased. To keep testing time within reasonable limits the load was increased until exhaustion by 5, 10, 20 or 30 W depending on the outcome of the first test (ICT).A semi-steady-state cardiopulmonary exercise test with breath-by-breath gas exchange analysis (CPET) was performed, according to routines at our clinic, after resting for at least 30 min after the incremental cycle test . Measurements of heart rate, SpOThe reason for discontinuing the cycle tests and the ISWT was stated at the end of each test.The two different ergometer cycle tests were performed on the same day, but the lung function test and the ISWT were conducted on separate days. The three test days were separated by 1\u20133 resting days.2 peak on CPET by an equation derived from \u00c5strand [2 peak \u00d7 1000-1- 0.1517) \u00d7 0.0134-1. The equation from Singh et al for estimating VO2 from ISWT [W peak was estimated from the measured VO \u00c5strand :  or 95% confidence interval (CI). For simple correlations Pearson's correlation coefficient was calculated. ANOVA and Student's All 93 subjects accepted to participate and were enrolled in the study, 71 with severe disease according to the British Thoracic Society guidelines . There w2 on CPET was 973 (908\u20131038) ml/min. There was significantly lower peak heart rate, SpO2, ratings of perceived exertion and dyspnoea at the end of the walking test compared to the cycle tests  m. End-exercise work load was 62 (57\u201368) W on the incremental cycle test (i.e. W peak) and 46 (41\u201350) W on the CPET. Measured peak VO91\u2013336 m.Fifty-two subjects repeated the ISWT within a week. The difference between the two tests was not significant for any variable measured, mean difference in walking distance being 9 \u00b1 38 m or 3% \u00b1 12% (p = 0.09). All calculations were therefore based on the first ISWT. This subgroup did not differ from the larger group in any baseline characteristics.2 peak by the equation derived from \u00c5strand [2 peak  between ISWT distance \u00d7 body weight and the measured W peak from the incremental cycle test: W peak = 0.0025 \u00d7 distance (m) \u00d7 body weight (kg) + 10.19  [2 peak was underestimated compared to our measurements  which consequently resulted in an underestimation of W peak .To test whether W peak could be estimated by use of the equation by Singh et al , we estis above) . Using t2 is of clinical importance, as the ISWT is much simpler and cheaper than a laboratory cycle test.In the present study, ISWT distance \u00d7 body weight was a good predictor of W peak measured by an incremental cycle test in patients with moderate or severe COPD. The fact that W peak estimated from ISWT was as accurate as W peak estimated from VO2 and distance walked was almost identical with the findings of Singh et al [2 peak measured on a treadmill test has been found to be higher than [2 peak measured on a cycle test in patients with COPD, a regression equation derived from a treadmill test could be expected to overestimate VO2 peak on a cycle rather than the opposite.Our results confirm the findings of others that there is an excellent correlation between performance on ISWT and laboratory testing ,6,24. Algh et al , applyingh et al ,15. Howeher than  or equalher than  VO2 peakAll patients who were referred to pulmonary rehabilitation and fulfilled the inclusion criteria during the time of the study agreed to participate. Therefore, we conclude that the study is representative of a COPD-population referred to rehabilitation including physical training. The wide range of lung function impairment and age of the participants also enhances the relevance of our sample. In Sweden, women have caught up with men in the prevalence of and mortality in COPD . The majHeart rate, RPE- and CR-10-scores were significantly lower in ISWT than in the cycle tests. The cycle tests were mainly limited by breathlessness and/or exertion whereas the ISWT was, in most cases, limited by the incapability to increase the speed of walking. During walking it is difficult to increase walking speed above a certain level. Some treadmill test protocols are therefore constructed to increase inclination rather than speed .2 decreased more by walking than cycling in the current study, quite in line with previous findings [SpOfindings ,14,24. Ifindings . In spitWe used the first ISWT (no training test) for our analyses. Due to the patient's poor condition or because of time constraints it is often not feasible to perform a training test in clinical practice. Thus, it was clinically relevant to present our calculations based on the first ISWT. This was also supported by the finding that the walking distance did not increase at the second test performed within a week. Control calculations were done by using results (not shown) from the second ISWT (n = 52) in our material and no differences were found. Significant difference in walking distance has previously been found on repeated testing with ISWT in patients with COPD ,28. It iIt could be argued that the cycle tests should have been performed in random order. The present design was chosen because it enabled us to adjust the progressive pattern of the CPET to keep exercise time within reasonable limits when W peak from the incremental cycle test was known. Although all subjects rested between the tests, we can not rule out the possibility that the order of the tests could have influenced the results. However, as peak heart rate, CR-10 scores and ratings of perceived exertion (RPE) were almost identical in the two cycle tests, and W peak could be estimated from VO2 peak as expected , we consBeing able to estimate W peak by ISWT for clinical purposes does not make ISWT a perfect substitute for the incremental cycle test or other forms of laboratory tests. There is, of course, some variation between estimated and measured peak values on an individual basis, but most importantly the safety aspect of the laboratory tests is beyond the ISWT. Therefore, for COPD patients considered at increased risk for cardiovascular hazards, patients that have never had proper cardiologic assessment or patients with uncertain diagnosis, laboratory tests must be considered as the first choice. However, for COPD-patients of minor risk of cardiovascular incidents, and where laboratory tests are scarce, the ISWT could be used as an alternative for estimating W peak.Peak exercise capacity measured by an incremental cycle test could be estimated from an ISWT with similar accuracy as when estimated from peak oxygen uptake.The author(s) declare that they have no competing interests.All authors participated in the design of the study and writing the manuscript as well as approving the final manuscript. HH and RHA participated in data collection, RHA drafted the manuscript."}
+{"text": "To compare the adverse events after initiation of nevirapine-based ART among HIV-infected patients who did not receive fluconazole (group A), received fluconazole 400 mg/week (group B), and received fluconazole 200 mg/day (group C).A retrospective cohort study was conducted among HIV-infected patients who began NVP-based ART between December 2003 and September 2004. Patients were followed up for 6 months. Clinical hepatitis, elevated aspartate aminotransferase (AST) and alanine aminotransferase (ALT) (> 3 times from baseline), and skin rashes were studied.p = 0.016). Baseline median (IQR) CD4 cell counts were 85 (21\u2013159), 18 (7\u201348), and 16 (5\u201335) cell/mm3 in group A, B, and C, respectively (p < 0.001). Of 2/225 (0.9%), 4/392 (1.0%), and 0/69 (0%) patients in group A, B, and C developed clinical hepatitis (p = 0.705). There were no significant difference of elevated AST or ALT among the three groups (p > 0.05). By logistic regression, receiving fluconazole was not predictive of clinical hepatitis, elevated aminotransferase, or skin rashes. At 6 months after initiating NVP, 174 (77.3%) patients in group A, 309 (78.8%) patients in group B, and 58 (84.1%) patients in group C remained on NVP.There were 686 patients; 225, 392, and 69 patients in group A, B, and C, respectively. Baseline characteristics including age, previous opportunistic infections, use of antituberculous drugs, and baseline aminotransferase levels among the three groups were similar. Group C had a higher proportion of men (Initiation of NVP-based ART among Thais with advance HIV disease receiving fluconazole is safe and well-tolerated. nevirapine should not be contraindicated for patients receiving fluconazole for treatment or prophylaxis of cryptococcosis. Highly active antiretroviral therapy (HAART) has been widely used for the treatment of human immunodeficiency virus (HIV) infected patients with successful immune restoration and reductions in morbidity and mortality ,2. Howev3 in Thailand and some developing countries because of a high prevalence of cryptococcosis and the evidence of a survival benefit  than patients in group A.A total of 686 patients were eligible and included in the study. Of 686 patients; 225, 392, and 69 patients were classified into group A, B, and C, respectively. The baseline characteristics of patients prior to initiation of HAART are described and compared among the three groups as shown in Table p > 0.05). There was a significant difference among the groups in the prevalence of skin rashes (p = 0.016).One hundred and four of 255 (40.8%) in group A, 188 of 392 (48.0%) in group B, and 36 of 69 (52.2%) in group C had AST testing at 6 months after initiating NVP. Seventy one of 255 (29.4%), 95 of 392 (24.2%), and 22 of 69 (31.9%) in corresponding groups had ALT testing at 6 months after initiating NVP. The prevalence of patients who developed adverse events including clinical hepatitis, AST and ALT increase > 3 times from baseline, and skin rashes are shown in Table p = 0.025)  = 3.72, p = 0.592) and elevated ALT > 3 times from baseline  = 7.26, p = 0.298). Logistic regression analysis of skin rashes indicated that receiving anti-tuberculous drugs was a significant predictor of skin rashes  Table . Gender,es Table . Gender,s = 0.026, p = 0.491), skin rashes and AST , or skin rashes and ALT . The tolerability of NVP-based HAART is shown in Table Mycobacterium avium complex infection, and 3 wasting syndromes). No patient died from hepatitis.The results of correlation analyses show that there was no correlation between skin rashes and clinical hepatitis (r3 and 80% had CD4 cell counts < 100 cells/mm3). High CD4 cell count is a predictor of hepatotoxicity [3 are at a greater risk of hepatitis than women with CD4 cell counts > 250 cells/mm3) [et al reported that African women may have an increased likelihood of hepatotoxicity [In the present study, we have shown that the prevalence of clinical hepatitis and AST and ALT elevation 6 months after initiating HAART among HIV-infected patients who concurrently received NVP and fluconazole were not different from those who received NVP- based HAART without fluconazole. These findings suggest that administration of NVP-based HAART regimens in HIV-infected patients who receive fluconazole dose not increase the risk of hepatotoxicity. The prevalence of clinical hepatitis and aminotransferase elevations in our study was lower than that reported in studies conducted in African HIV-infected patients ,20. Thertoxicity ,19. Secotoxicity ,18. CD4 lls/mm3) ,21. Thirlls/mm3) ,17,18. Stoxicity -24. TherWhile logistic regression analyses in the present study show that receiving fluconazole was not predictive for any adverse events, receiving anti-tuberculous drugs was significantly predictive for both clinical hepatitis and skin rashes. The patients in our large cohort had overall 16% of concurrent tuberculosis and the results from the regression analyses can demonstrate this important issue. These findings point out that concurrent concomitant use of NVP and anti-tuberculous drugs may a cause of more concern. We suggest to closely monitoring liver function test in patients with concomitant use of NVP and anti-tuberculous drugs. Further well-designed prospective study is needed.Regarding NVP-associated skin rashes, the overall prevalence in the present study was similar to previous study in Thai patients with advanced HIV disease . The incOverall about 80% of the patients in our cohort continued on NVP-based HAART at six months. Although all patients were initiated with NVP 200-mg once-daily lead-in dose prior to escalation to 200 mg twice daily, skin rash was still the major adverse event led to discontinuation of NVP-based HAART. The previous studies using short-course prednisolone were failed to prevent NVP-associated skin rashes ,27. The NVP-based HAART is a common regimen which widely used for treatment of HIV-infected patients in resource-limited countries due to its affordability. Until the other options are more accessible, NVP-based HAART is still a key regimen to scale up treatment of HIV in resource-limited countries. Our study may provide the safety data of concomitant use of NVP and fluconazole and support the use of NVP in patients receiving fluconazole for treatment or prophylaxis of cryptococcal diseases.et al reported that there was no association between plasma NVP level and hepatotoxicity [The limitation of the present study is the nature of retrospective study that patients' clinical status may be underreported. First, not all patients had been checked for aminotransferase level during the first 6 months. Only 328 and 188 patients had been checked for AST and ALT levels, respectively. However, we had analyzed the demographics and adverse events between patients who had and did not have AST or ALT levels and found that there were no statistically significant differences. We did not have data of plasma NVP level in this cohort due to retrospective nature. However, Dailly In summary, receiving of fluconazole for treatment or prophylaxis of cryptococcosis does not increase the risk of hepatotoxicity, elevated aminotransferase, or skin rashes from NVP. Initiation of NVP-based HAART among HIV-infected patients receiving fluconazole is safe and well-tolerated. Use of anti-tuberculous drugs is predictive of clinical hepatitis and skin rashes. Initiation of NVP-based HAART in HIV-infected patients receiving anti-tuberculous needs closely monitoring and prompt management.HAART: Highly active anti-retroviral therapy, HIV: Human immunodeficiency virus, NVP: Nevirapine, NNRTI: Non-nucleoside reverse transcriptase inhibitor, AST: Aspartate aminotransferase, ALT: Alanine aminotransferaseThe author(s) declare that they have no competing interests.WM participated in the design of the study. NC performed statistical analysis. AC participated in the design of the study. SS participated in the design of the study and statistical analysis.The pre-publication history for this paper can be accessed here:"}
+{"text": "Development of managed care, characterized by limited provider choice, is believed to undermine trust. Provider choice has been identified as strongly associated with physician trust. Stakeholders in a competitive healthcare market have competing agendas related to choice. The purpose of this study is to analyze variables associated with consumer's satisfaction that they have enough choice when selecting their primary care provider (PCP), and to analyze the importance of these variables on provider trust.A 1999 randomized national cross-sectional telephone survey conducted of United States residential households, who had a telephone, had seen a medical professional at least twice in the past two years, and aged \u2265 20 years was selected for secondary data analyses. Among 1,117 households interviewed, 564 were selected as the final sample. Subjects responded to a core set of questions related to provider trust, and a subset of questions related to trust in the insurer. A previously developed conceptual framework was adopted. Linear and logistic regressions were performed based on this framework.Results affirmed 'satisfaction with amount of PCP choice' was significantly (p < .001) associated with provider trust. 'PCP's care being extremely effective' was strongly associated with 'satisfaction with amount of PCP choice' and 'provider trust'. Having sought a second opinion(s) was associated with lower trust. 'Spoke to the PCP outside the medical office,' 'satisfaction with the insurer' and 'insurer charges less if PCP within network' were all variables associated with 'satisfaction with amount of PCP choice' .This study confirmed the association of 'satisfaction with amount of PCP choice' with provider trust. Results affirmed 'enough PCP choice' was a strong predictor of provider trust. 'Second opinion on PCP' may indicate distrust in the provider. Data such as 'trust in providers in general' and 'the role of provider performance information' in choice, though import in PCP choice, were not available for analysis and should be explored in future studies. Results have implications for rethinking the relationships among consumer choice, consumer behaviors in making trade-offs in PCP choice, and the role of healthcare experiences in 'satisfaction with amount of PCP choice' or 'provider trust.' Development of managed care in recent years has resulted in cost-containment practices such as gatekeeping, utilization review, and physician payment incentives, which are believed to undermine patient-physician trust -4. TrustThe importance of trust and observation of declining trust ,16 in thHealthcare stakeholders have different agendas and conflicting goals in choice . ConsumeThe objectives of this study were to analyze domains that are predictive of provider choice satisfaction and to analyze the importance of variables that were categorized into these domains, including 'satisfaction with amount of PCP choice', on trust in the provider. A literature review driven conceptual framework that verified hypothetical domains predictive of provider choice satisfaction was adopted to identify variables for analyses . The fraThe specific aims of this study were: 1) to determine variables associated with the identified domains related to 'satisfaction with amount of PCP choice': consumer characteristics, information and decision, system and insurer trust, plan characteristics, and provider characteristics; 2) to determine the relative importance of each of these identified domains in predicting 'satisfaction with amount of PCP choice'; 3) to analyze the association between 'satisfaction with amount of PCP choice' and provider trust, after controlling for other provider choice satisfaction variables and potential confounders.Between April and June of 1999, data about trust in the physician, in the insurer, in the medical profession, and about patient satisfaction with health care and with the insurer were collected from 1,117 adult residential households (response rate 51.4%) in the United States. Inclusion criteria were having a telephone, aged \u2265 20 years, and had seen a medical professional at least twice in the past two years . The stuThe majority of the study sample (n = 564) comprised non-Hispanic whites (70.0%), female (67.0%), mean age 48.8 years (SD 17.0), who had a two or four year college degree (31.7%). In comparison, the majority of the U.S. population in July 1999  were Non-Hispanic white (71.9%), female (51.1%), mean age 36.4 (SD not available), and who had high school or more education (83.4%) ,41. In NData from the random national survey have been used to develop multi-item measures of trust and satisfaction, including the Wake Forest Physician Trust Scale (WFPTS) , the ScaStudy variables were examined for outliers, data distribution, frequencies, for variable recoding purpose, and to ensure that they met requirements for linear regression analyses. Variables with more than ten percent missing data were imputed. Simple independent t-tests were performed on each of these variables before imputation, to ensure no significant differences in the means of the outcome variable 'provider trust' between the groups with and without missing values . The oveAll descriptive and analytical statistics were conducted using the statistical software Intercooled STATA version 8.02. Variables were selected from the national dataset according to the five domains of the conceptual framework. To determine variables within each of the five domains (specific aim 1) and to determine if each domain was associated with the outcome of interest, a series of five logistic regression models (independent variables listed in Table To test whether the domains with significant variables (result of specific aim 1) were predictive of 'satisfaction with amount of PCP choice' after controlling for potential confounders (specific aim 2) another set of logistic regression analyses was conducted examining the relationship between variables found significant within the 5 domains and 'satisfaction with amount of PCP choice.' An unrestricted model which included all the predictors found to be significant in analyses pertaining to specific aim 1 and confounders was compared to a restricted model that included only the significant predictor variables. This is to differentiate the effects of confounding on the relationship between significant predictor variables and 'satisfaction with amount of PCP choice'.To analyze the association between 'satisfaction with amount of PCP choice' and provider trust, after controlling for other potential confounders (specific aim 3), multiple linear regression analyses were conducted at alpha = 0.01. 'Second opinion on the PCP' and 'years with the PCP' were included as confounding variables in the model because they were highly correlated with provider trust but were not items of the WFPTS that measured provider trust .Two variables, 'income' and 'insurer trust,' involved 14% and 22% missing values respectively. Nevertheless, these two variables were rejected in the variable selection processes within domains and excluded from subsequent analyses. The mean, standard error of the mean, and standard deviation of 'insurer trust' before and after imputation were 36.5 [range possible: 11\u201355] (SE 0.37) SD = 7.80 and 36.6 (SE 0.29) SD = 6.89 respectively.Table The 18 variables . Consumers who spoke to the PCP outside the medical office had 4.28 times  the odds of reporting 'satisfaction with amount of PCP choice' compared to those who did not. Consumers who felt that their PCP's care had been extremely effective had 4.02 times  the odds of reporting 'satisfaction with amount of PCP choice' compared to those who did not.Table In addition, consumers who reported satisfaction with their insurers and who reported insurer charged less if the provider was within network had 2.54 times  and 2.44 time  the odds respectively of reporting 'satisfaction with amount of PCP choice.' compared to those who did not. Consumers who reported they have enough insurer choice had 2.16 times  the odds of reporting 'satisfaction with amount of PCP choice' compared to those who did not. For each additional year with the PCP, consumers had 1.06 times  the odds of reporting 'satisfaction with the amount of PCP choice'. On the other hand, consumers who had dispute experience(s) with the PCP had a reduced odds of 74 percent  in reporting 'enough PCP choice' compared to those who did not. Consumers who experienced 'long waiting time to appointment' also had a reduced odds of 65 percent  in reporting 'satisfaction with amount of PCP choice' compared to those who did not.2 from 0.47 (p < .001) to 0.43 (p < .001) and would reduce the number of significant variables from eight to five in the full model. Table Table The full and reduced models (n = 564) accounted for 47 percent and 37 percent of the variations in 'provider trust' (p < .001) respectively. A significant F  = 19.68, p < .001 also indicated a linear relationship between the dependent and independent variables . The VarConsumers who felt that their 'PCP's care been extremely effective' was highly associated with provider trust . The experience of having a second opinion on the PCP was negatively associated with provider trust . 'Enough PCP choice' has a positive association with 'provider trust' . 'Dispute with the PCP' and 'long waiting time to appointment' were both negatively associated with provider trust . The consumer being female has some positive association with provider trust . Consumer's education level has some association with provider trust . 'Years with PCP' also has a slight association with provider trust .In this study, a total of 18 variables have been identified as associated with 'satisfaction with amount of PCP choice' when analyzed in each of the five domains of the conceptual framework. The 'system and insurer trust' domain was not fully tested due to data limitation and poor model fit. However, the variable 'trust in providers in general' of this domain had strong potential influence on interpersonal provider trust . It shouHaving 'enough insurer choice' was associated with 'satisfaction with amount of PCP choice' but not 'provider trust'. This appeared to be logical as plan choice preceded and necessarily impacted provider choice. Eighty-three percent of participants (n = 150) who reported enough insurer choice also reported enough PCP choice. Among participants who reported not enough insurer choice, 33 percent (n = 414) reported not enough PCP choice. 'Enough insurer choice' appeared to have some relationship with 'enough PCP choice.' 'Enough PCP choice', on the other hand, was found to be associated with provider trust. This confirmed the existing knowledge that enough or some amount of PCP choice was associated with provider trust.When a plan had the characteristic of charging less if the providers were within network, it was strongly associated with greater odds in the reporting of 'satisfaction with amount of PCP choice.' This result suggested that this plan characteristic, which has the connotation of cost saving, was relatively popular among consumer preferences. A plan characteristic and consumer preference match explained the greater odds reported. Early studies of consumer behavior in plan choice suggested consumers were cost sensitive  while ot'Years with the PCP' has some association with 'satisfaction with amount of PCP choice.' The duration of the patient-physician relationship indicated that the patient volunteered to stay with the provider for that length of time, or that they were required to stay with the provider for some reasons. Patients would have switched providers if the relationships were not good and they have a choice or a better choice. Nevertheless, involuntary provider switch behavior appeared to be more an issue of \"employer-imposed disruption\". Voluntary disenrollment from PCP practice was, however, associated with trust . In the 'Long waiting time to appointment' has some negative association with both 'satisfaction with amount of PCP choice' and 'provider trust.' The consumer might not know if a certain provider has a 'long waiting time to appointment' unless they had known the provider before or had made efforts to find out how long it normally takes to secure an appointment. The variable also reflected the consumer preference for access to prompt appointments. The association with 'provider trust' would likely be due to a patient's perception of the provider's level of control in providing efficient services. \"Control\" refers to the physician's autonomy in providing needed services to the patient in a timely manner, which is a building block of physician trust .The association of 'second opinion on the PCP' (due to concern of care) with lower provider trust involved a temporal issue of whether provider trust was already low at the time a second opinion was sought or if the second opinion confirmed the consumer's concern and hence decreased trust. This is a limitation of the cross-sectional study design not being able to measure the dynamic dimension of trust. Regardless of whether trust was low, declined before, after, or continued to decline after a second opinion on the PCP, the experience of having sought a second opinion on the PCP demarcated a decrease in trust.Eight variables associated with 'satisfaction with amount of PCP choice' were analyzed in the model of 'provider trust' with and without potential confounders. Consumers' perception of the PCP's care being extremely effective was strongly associated with both 'satisfaction with amount of PCP choice' and with 'provider trust'. This finding was consistent with the consumer preference for professionally qualified providers , for havContrary to the existing knowledge that minorities, especially Blacks and Hispanics, preferred a provider of the same ethnic background or who speaks the same language , this stVariables associated with 'satisfaction with amount of PCP choice' have never been explored before. This study identified eight variables that were associated with consumers' satisfaction with the amount of PCP choice. Having spoken to one's PCP outside of the medical office was strongly associated with reporting of enough PCP choice. Regardless of the contexts, interaction outside of the medical office may have created a sense of harmony with the PCP, such as having visited similar stores or lived in the same communities. Socialization out of the medical environment may also create a sense of friendship with the PCP. At the same time, the selected provider may just be the provider that the consumer preferred or knew from before. Nevertheless, interaction outside of the medical office was not associated with provider trust. This was most likely because this kind of interaction would not change the PCP's role as a healthcare agent, their autonomy and their competencies to take care of the patient.The perception of having enough insurer choice, the consumers' report of satisfaction with their insurers, and health plans that 'charged less if providers within network' were strongly associated with 'satisfaction with amount of PCP choice'. 'Insurer satisfaction' included satisfaction with plan characteristics and/or insurer services in medical claims. Consumers who preferred cost saving would find such plan characteristic attractive and be more ready to report 'satisfaction with amount of PCP choice'. In contrast, consumers who preferred PCP choice more than cost saving would feel this plan characteristic restricted their access to preferred providers, and would be less likely to report 'satisfaction with amount of PCP choice'. Thus the associated variables appeared to reflect on the cost sensitivity of consumers , and notConsumers who had upset/dispute experience(s) with PCPs, or who experienced long waiting time to get an appointment, had a moderately lower likelihood of reporting 'satisfaction with amount of PCP choice'. It was not clear how serious the dispute(s) were and how frequent the dispute(s) occurred. Respondents had responded to the 'enough PCP choice' survey item before they were asked the 'dispute with PCP' item. Unless recent dispute(s) or repeated disputes made the experiences into long-term memory, the dispute experiences should not be affecting participants' response to the item of 'enough PCP choice.' Furthermore, the lower reporting of 'satisfaction with amount of PCP choice' may be an indicator that the PCP profiles were poor matches with the consumer preferences. Long waiting time to get an appointment was not associated with provider trust. Quality of and/or duration of visit may have made up for the deficiency in appointment schedules and had slight influence on provider trust, if any.It was understood at the outset of the study that the evaluation of satisfaction with PCP choice may make a difference in responses depending on when the data was collected. It was interesting to discover that elements occurred after PCP choice or after PCP assignment may or may not \"compensate\" for an initial perception of the amount of PCP choice available. At the system level the implications of this study findings point to the direction of rethinking the consumerism of demanding more PCP choice. Is it necessary that consumers be given \"adequate\" amount of choice? Will it be better if consumers be assisted with information in selecting a PCP who best suits their preferences, or who is known to be very professional?Furthermore, it is possible that patients may have projected their experiences with the physicians into the reporting of 'satisfaction with amount of PCP choice'. Satisfaction is the evaluation of past events. The timing of when to measure satisfaction with PCP choice is not necessarily better at one time than another. However, the interpretations of satisfaction with the amount of PCP choice measured immediately after the choice was made or given will have to be different from that measured several years after the choice was made. This study found some plan characteristics variables associated with 'satisfaction with amount of PCP choice'. The associations prompted the reconsideration of whether giving patients more PCP choice  is an efficient or effective means of driving the healthcare market. The patient-physician experience may also have some influences on the perception of the adequacy in amount of PCP choice. In this study, patients had seen their PCPs at least twice in the past year, the experience with the PCP would inform the overall associations of medical encounters and thus 'satisfaction with amount of PCP choice' and 'provider trust.'A limitation of the study is that although the study sample was a random national sample, it did not match exactly the general U.S. population given the study inclusion criteria and racial differences in telephone subscription rate. The data was collected in 1999. It did not necessarily reflect all changes over the past few years in the healthcare market, such as voluntary or mandatory hospital or provider performance public reporting. Evolvement of healthcare in the past few years has included the shift towards greater consumer cost-sharing, and the popularity of PPO over HMO plans . Other tOther limitations of this study include those inherent with secondary data analysis. The lack of overlapping observations in the variable 'trust in providers in general' prohibited its application for analyses. The cross-sectional study design did not account for the longitudinal dimensions of choice and of trust, and for the dynamic dimension of trust. Evaluation of variables of 'satisfaction with amount of PCP choice' was retrospective. For consumers who have had their PCP for many years, it was debatable whether their experiences with their PCP currently and over the years might have influenced their perceptions and hence 'satisfaction with amount of PCP choice.' As in any cross-sectional study design, results of this study can only be viewed as associations among variables with the outcomes of interest rather than causality.Results suggested the adapted conceptual framework can be modified. Figure The provider's professionalism has never been explored as a predictor of provider trust before and it deserves attention in future studies. Future studies of healthcare public reporting, of provider specific information, and of trust in information available to assist choice will unveil the roles of information in consumer preferences, in consumer satisfaction, and in provider trust. If possible, examining all the known predictors of provider trust in one study may provide a holistic view of what is relatively important in predicting provider trust and in sustaining trust.Primary care provider (PCP)The author(s) declare that they have no competing interests.MYLC carried out the study including application of conceptual framework, design of the study, performance of statistical analyses, and drafting and revision of the manuscript. RB conceived of the study, participated in the design of the study, coordinated data access, critiqued the statistical methods, and helped revisions of the manuscript. All authors read and approved the final manuscript.The pre-publication history for this paper can be accessed here:"}
+{"text": "A regression equation relating distance walked on the 6MWT and peak work rate (Wpeak) on the incremental cycle test has been described. The aim of this study is to measure the physiological responses to constant load cycle exercise performed at an intensity of 60% Wpeak determined from the 6MWT in participants with stable COPD.Cycle training intensity for patients with chronic obstructive pulmonary disease (COPD) is normally based on an incremental cycle test. Such tests are expensive and not readily available to clinicians. The six-minute walk test (6MWT) has been proposed as an alternative to an incremental cycle test for this purpose, based on the findings of previous research that the peak oxygen consumption , dyspnoea and rate of perceived exertion (RPE) will be recorded. The VO2 measured at the end of cycle exercise will be compared to VO2peak of the 6MWT . Pearson's correlation coefficient will be calculated for the relationship between VO2bike and VO2walk. A one-way analysis of variance (ANOVA), with Bonferroni correction, will be performed to determine whether the ratio of VO2bike/VO2walk is affected by disease severity.This study is a prospective, repeated measures design. Thirty-five participants with stable COPD and mild to severe lung disease will be recruited from referrals to pulmonary rehabilitation. Subjects with co-morbidities limiting exercise performance will be excluded. Two 6MWTs will be performed. The better 6MWT will be used to calculate W2peak, performed at an intensity determined from the 6MWT in participants with COPD. Positive findings will enable clinicians to more precisely prescribe cycle training intensity by utilising a simple, reliable and inexpensive 6MWT, thus providing a better standard of care for patients with COPD referred to pulmonary rehabilitation.This novel study will measure the physiological responses to cycle exercise, in terms of VOACTRNO12606000496516 The icle test .The incremental cycle test is most commonly performed in a laboratory and requires sophisticated equipment and well-trained staff ,8. Howev2peak as the incremental cycle test in participants with COPD, validating the capability of the 6MWT to assess exercise capacity in this population [2peak [peak on the incremental cycle test in patients with COPD [peak in COPD [2peak) that would result in a training effect in patients with COPD. There have been no reports of cycle training exercise prescription from the 6MWT.An alternative test, a six-minute walk test, has been proposed as a basis for exercise prescription . The sixpulation ,11. In an [2peak ,12 and With COPD . From th in COPD . It is i2peak is regarded as sufficient to elicit training effects in subjects with COPD [2peak for cycle training intensity has not been reported [peak in COPD [An intensity that exceeds 50% VOith COPD , howeverreported . In term in COPD .peak, calculated from the results of the 6MWT, will produce a VO2 above 50% VO2peak when compared with peak VO2 from the 6MWT.The aim of this study is to measure the physiological responses to cycle exercise performed at an intensity determined from the 6MWT in participants with COPD. It is hypothesised that cycle exercise at 60% W1) of 60 to 80% predicted, moderate by FEV1 of 40% to 59% predicted and severe by FEV1 of less than 40% predicted [Participants with diagnosed stable COPD, as defined by the COPDX Guidelines , will beredicted . The stuParticipants will be excluded if they present with a fever or increased sputum; a hospital admission in the previous month; are unable to wear a facemask due to claustrophobia or are on long term oxygen therapy. Participants with cardiovascular, neurological and musculoskeletal co-morbidities that may limit exercise performance will also be excluded ,12.2peak between the 6MWT and the incremental cycle test to achieve a power of 0.80. We will enrol 39 participants to allow for 10% drop-out.Thirty-five participants will be required based on a calculation of a 95% confidence interval of 0.65 \u2013 0.95 for the predicted relationship of VO1; FEV1 percent predicted (FEV1 %pred); forced vital capacity (FVC); and FVC percent predicted (FVC %pred), will be performed prior to the walking and cycling tests [This study will use a prospective, repeated measures design Figure . All parng tests . Participeak has been chosen from the recommended range of 50% to 80% because it has been shown that this training intensity is achievable and produced physiological training adaptations for patients with moderate to severe COPD [The 6MWTs will be performed on a 32-metre continuous rectangular track with standardised instructions and encouragement given at every minute ,12. A seere COPD .2) falls below 85%.The cycle exercise will be performed on an electronically braked cycle ergometer . Participants will pedal between 50\u201360 rpm throughout the exercise . The int2), carbon dioxide production (VCO2), minute ventilation (VE), tidal volume (VT), frequency of breathing (fb) and respiratory quotient (R) will be measured during each test using a portable metabolic system . The participants will wear a small battery pack and portable gas analyser, weighing less than a kilogram, on their chests and will breathe through a flexible rubber facemask with the flowmeter attached to the system [2 will be measured using a portable heart rate monitor  and an adult articulated finger clip sensor , respectively. Data are either transmitted to a Windows-based computer by telemetry using the Cosmed patented software, or stored in its memory unit. The portable metabolic system has been previously utilised to measure responses during 6MWT in patients with COPD [Breath-by-breath values for oxygen consumption  at the beginning, and during each minute of cycle exercise or at the third minute of 6MWT, at the end of each test, and also after a minute of recovery .1 \u00d7 35.5 [E at the end of the constant-load cycle exercise will be compared to MVV, i.e. the ratio VE/MVV is expressed as a percentage to represent ventilatory reserve of each participant [Maximal voluntary ventilation (MVV) will be calculated from the equation, FEV1 \u00d7 35.5 . VE at tticipant .2 on the 6MWT and the incremental cycle test were not significantly different [2 on the 6MWT  will be equivalent to their VO2peak on an incremental cycle test. In order to determine the exercise intensity during constant-load cycle exercise, the VO2 measured from the cycle exercise (VO2bike) will be calculated as a percentage of VO2walk, i.e. VO2bike/VO2walk (%). In our study, VO2bike will represent the values of VO2 averaged for the last 20 seconds of the final three minutes of the cycle exercise. VO2walk will represent the peak VO2 on the 6MWT calculated from the mean of the last 20 seconds of the final minute.Based on earlier findings that peak VOifferent ,11, we w2bike and VO2walk.Results will be expressed in mean \u00b1 standard deviation (SD). Pearson correlation coefficients will be calculated for the relationship between VO2bike/VO2walk and the following parameters: a) body mass index; b) measures of lung function ; c) 6MWD; d) percentage of predicted 6MWD; e) dyspnoea; and f) RPE scores. These parameters will be investigated to determine their influence on the VO2 response to the prescribed cycle exercise intensity. A one-way analysis of variance (ANOVA) with a confidence interval (CI) of 0.95 will be performed in a post-hoc analysis with Bonferroni corrections to determine the effect of disease severity  on VO2bike/VO2walk, dyspnoea and RPE during cycle exercise. The level of significance will be set at p < 0.05.Correlation coefficients will also be calculated for the relationships between VOStatistical analyses will be performed on SPSS-Windows .peak, calculated from the results of the 6MWT, produces a VO2 above 50% VO2peak when compared with peak VO2 from the 6MWT, this simple and inexpensive method of cycle exercise prescription could be adopted by pulmonary rehabilitation centers or community health services in both metropolitan and rural settings. This study will also demonstrate if the exercise intensity prescribed is achievable by patients with varying levels of disease severity. If the study findings show that the prescribed intensity is too high or too low for participants with certain levels of disease severity, a titration of this intensity and/or a revision of the prediction equation may be needed. Although we recognise that it is difficult to define optimal training intensity, this study may bring clinicians closer to the definition by demonstrating the response, in terms of %VO2peak, which an exercise intensity of 60% Wpeak elicits. Similarly, patients with COPD referred to pulmonary rehabilitation will benefit from an individualised cycle training program that should be more effective in producing training outcomes, thus enhancing the standard of care. To our knowledge, the proposed research is the first study internationally that will provide a quantitative method for more precise, individualised prescription of cycle training intensity from a simple and inexpensive 6MWT in patients with COPD.The significance of the study pertains to the ability of clinicians to prescribe an appropriate level of cycle exercise for patients with COPD referred to pulmonary rehabilitation. If the intensity of cycle training at 60% WThe author(s) declare that they have no competing interests.JA had the original idea for the study. JA, MM and NL designed the study. MZ and DK contributed to refining the study design. MZ drafted the manuscript. All authors revised the manuscript and have approved the final version.The pre-publication history for this paper can be accessed here:"}
+{"text": "Oropharyngeal candidiasis may occur in up to 90% of human immunodeficiency virus (HIV)-infected patients during the course of the disease. This study is to determine the effect of prolonged highly active antiretroviral therapy (HAART) on oropharyngeal colonization with Candida species and oral candidiasis.Progressive cell-mediated immunodeficiency with decrease of CD4+ lymphocyte count to less than or equal to 200 cells/mmA prospective, longitudinal follow-up study in HIV-infected patients receiving HAART.3 and the proportion of patients whose CD4+ count less than 200 cells/mm3 decreased from 50.0% to 28.9% (p = 0.0003) in patients receiving HAART for at least 2 years. The prevalence of oral candidiasis decreased from 10.6% to 2.1% (p = 0.004). The decrease in Candida colonization was less impressive, falling from 57.8% to 46.5 % (p = 0.06). Of the 142 patients enrolled in at least two surveys, 48 (33.8%) remained colonized with Candida and 42 (29.6%) remained negative. In the remaining 52 patients, 34 switched from culture positive to negative, and an increase in CD4+ lymphocytes was noted in 91.2% of them. Among the 18 patients who switched from culture negative to positive, 61.1% also demonstrated an increase in CD4+ lymphocyte count (p = 0.01).The mean CD4+ count increased from 232.5 to 316 cells/mmCandida from the oropharynx.These findings indicate that HAART is highly effective in decreasing oral candidiasis in association with a rise in CD4+ lymphocyte counts, but only marginally effective in eliminating  Orophdidiasis ,3.Candida species. These three prospective longitudinal follow-up surveys  were designed to determine the effect of prolonged HAART on oropharyngeal candidiasis and colonization with Candida species in Taiwan.The introduction of highly active antiretroviral therapy (HAART) has led to a marked decrease in mortality and morbidity ,8 as welHIV-infected patients followed regularly at the acquired immune deficiency syndrome (AIDS) clinic at the National Taiwan University Hospital (NTUH) were enrolled in the study. The patients underwent three rounds of surveys for oral candidiasis in 1999, 2001, and 2002. A standardized case form was used to retrieve demographic information, CD4+ lymphocyte counts obtained from dates nearest to the survey culture dates and viral load. Hospitalization and receipt of antibiotics and anti-fungal drugs within three months of sampling were also recorded. For patients participated in all three surveys, the clinical data of 1999 and 2002 were used for analysis. Inclusion criteria consisted of continuous receipt of HAART, at least two complete clinical and laboratory observations during the study period and verbal informed consent. The institutional review board of the NTUH has approved the study.Cultures of the oropharyngeal and tonsillar regions were performed using a dry sponge swab  as described previously ,5. The sPlasma viral RNA load (PVL) and CD4+ lymphocyte count were usually determined at the baseline at the diagnosis of HIV infection and/or immediately before initiation of antiretroviral therapy. In those who did not initiate antiretroviral therapy, those tests were conducted on 4\u20136 month intervals; in those who did initiate the antiretroviral therapy, those tests were first conducted at 1 month after the beginning of the therapy, and then onto 4-month intervals regularly. When the therapy is to be changed due to virologic failure, testing protocol would be the same as those who initiated therapy for the first time. PVL were quantified using reverse transcriptase-polymerase chain reaction  with a detection limit of 400 copies/ml and CD4+ counts were determined using FACFlow (Becton Dickinson). Oropharyngeal candidiasis was characterized by painless, creamy white, plaque-like lesions on the buccal or oropharyngeal mucosa or tongue surface.All clinical and laboratory data were entered into a relational database designed for Microsoft Access 97 . The statistical significances of the differences in frequencies and proportions were determined by the Chi-square test with Mantel-Haenszel correction.3 to 316 \u00b1 197.0 cells/mm3. The proportion of patients whose CD4+ count was \u2264 200 cells/mm3 decreased from 50.0% to 28.9 % (p = 0.0003) , 83 patients only in the 2001 and 2002 surveys (group 2), and 48 patients in all three surveys. Upon follow-up, the mean CD4+ lymphocyte count rose from 232.5 \u00b1 180.1 cells/mmp = 0.004), while the change in prevalence of Candida colonization was less impressive, falling from 57.8% to 46.5 % (p = 0.06). Among the patients, 48 (33.8%) remained colonized with Candida and 42 (29.6%) remained negative. And in the remaining 52 patients, 34 switched from culture positive to negative alone with an increase in CD4+ cells in 91.2% of them. Among the 18 patients switching from culture negative to positive, 61.1% also demonstrated an increase in CD4+ counts. In the total 284 samplings, there were 65 with CD4+ counts \u2264 200 and were also culture-positive for Candida whereas there were 47 with CD4+ counts \u2264 200 but were culture-negative (p = 0.11). Thus, in addition to the CD4+ count, some other factors appear to have significant effects on oral colonization by Candida.In all, the prevalence of oral candidiasis decreased from 10.6 to 2.1 % (Candida and that a low CD4+ lymphocyte count (\u2264 200 cells/mm3) was a risk factor for developing oral candidiasis [Candida than healthy individuals [Candida, although close to significant (p = 0.06), was not as dramatically decreased. Possible explanations include poor compliance, failure to reduce the viral load and raise the CD4+ lymphocyte count or dissociation between colonization and infection. The most likely scenario is that most patients receiving HAART continue to be colonized by Candida, but do not develop oral candidiasis.We have previously shown that hospitalization and receipt of antibiotics were risk factors for oropharyngeal colonization by ividuals . Our curividuals ,8. It waCandida. Further studies are needed to better define the relationship between Candida colonization and infection in patients with AIDS.Increase of the CD4+ lymphocyte counts is required but not sufficient to protect HIV-infected patients from colonization by HIV, human immunodeficiency virus; HAART, highly active antiretroviral therapy; AIDS, acquired immune deficiency syndrome; NYUH, National Taiwan University Hospital; PVL, Plasma viral RNA load; RT-PCR, reverse transcriptase-polymerase chain reactionThe author(s) declared that they have no competing interests.YLY designed the study with contribution with HJL and CCH. YLY drafted the manuscript. HJL conducted the experiments with contribution from YL. CCH collected swabs and patients' information.The pre-publication history for this paper can be accessed here:"}
+{"text": "The aim of the study was to compare the prevalence and types of HIV-related oral lesions between children and adult Tanzanian patients on HAART with those not on HAART and to relate the occurrence of the lesions with anti-HIV drug regimen, clinical stage of HIV disease and CD4+ cell count.Participants were 532 HIV infected patients, 51 children and 481 adults, 165 males and 367 females. Children were aged 2\u201317 years and adults 18 and 67 years. Participants were recruited consecutively at the Muhimbili National Hospital (MNH) HIV clinic from October 2004 to September 2005. Investigations included; interviews, physical examinations, HIV testing and enumeration of CD4+ T cells.2 = 4.31; df = 1; p = 0.03) and parotid enlargement  between children and adults. Adult patients who were on HAART had a significantly lower risk of; oral lesions , oral candidiasis  and oral hairy leukoplakia . There was no significant reduction in occurrence of oral lesions in children on HAART . There was also a significant association between the presence of oral lesions and CD4+ cell count < 200 cell/mm3  and with WHO clinical stage . Oral lesions were also associated with tobacco smoking .A total of 237 HIV-associated oral lesions were observed in 210 (39.5%) patients. Oral candidiasis was the commonest (23.5%), followed by mucosal hyperpigmentation (4.7%). There was a significant difference in the occurrence of oral candidiasis (\u03c73.Adult patients receiving HAART had a significantly lower prevalence of oral lesions, particularly oral candidiasis and oral hairy leukoplakia. There was no significant change in occurrence of oral lesions in children receiving HAART. The occurrence of oral lesions, in both HAART and non-HAART patients, correlated with WHO clinical staging and CD4+ less than 200 cells/mm Most African studies on HIV associated oral lesions have been done during pre-HAART era -11. The As indicated earlier, most of the above-mentioned studies have been conducted in developed countries ,31. TherThe government of Tanzania, with assistance from international donor agencies, started providing HAART to HIV patients free of charge in July 2004 ,34. HoweA total of 532 HIV-infected patients, 367 (69%) females and 165 (31%) males participated in the study. There were 51 children aged between 2 and 17 years, with mean age of 7.6 (SD \u00b1 4.3) years and 481 adults aged 18\u201367 years, with a mean age of 38.2 (SD \u00b1 8.9) years. Participants were recruited consecutively at the Muhimbili National Hospital (MNH) HIV clinic in Dar es Salaam, from October 2004 to September 2005. The MNH is the largest referral hospital in Tanzania and serves as a teaching facility for the Muhimbili University College of Health Sciences (MUCHS), the largest medical school in the country.This was a cross sectional study. The sample size was estimated at 336, by assuming the prevalence of oral lesions in HIV infected individuals in Tanzania to be around 30%  and by sPatients were interviewed using a standard structured questionnaire to obtain information regarding social and demographic details, past medical history, family history and history of previous medication. Previous episodes of oral candidiasis, other medical conditions, use of traditional medicine, anti-tuberculosis drugs, antifungal agents, and use of antiretroviral and current treatments were all recorded. Current and previous episodes of opportunistic systemic diseases related to HIV were categorized and recorded as follows: tuberculosis, pneumonia, herpes zoster infection and cryptococcal meningitis.Clinical examination of all study patients was done by an independent physician, who categorized them in accordance with the World Health Organization (WHO) clinical staging criteria .An oral examination was carried out by a qualified dental surgeon without knowing the HIV clinical stage and CD4+ cell count level of the patient or whether the patient was on HAART or not. A standard oral examination method recommended by WHO  was usedBlood was collected in EDTA tubes from the patients. HIV serology was determined by Vironostika HIV Uni-Form II Ag/Ab  and reactive samples were retested by Vironostika HIV Uni-Form II Plus O . Samples reactive on both tests were considered to be positive for IgG anti HIV antibodies. Enumeration of CD4+ and CD8+ T cells was done using FACS count machine after staining patients' blood with monoclonal antibodies .In Tanzanian setting, a triple therapy consisting of 2 nucleoside reverse transcriptase inhibitors (NRTI) + 1 non-nucleoside reverse transcriptase inhibitors (NNRTI) or 2 NRTI + 1 Protease inhibitor (PI) is recommended. The first line includes four different combinations of drugs: stavudine + lamivudine + nevirapine; stavudine + lamivudine + effavirenz; zidovudine + lamivudine + nevirapine and zidovudine + lamivudine + effavirenz. The second line regimen includes the following drug combination: Abacavir + kaletra (lopinavir/ritonavir) + didanosine and abacavir + saquinavir/ritonavir + didanosine .The study protocol was approved by the ethics committees of the Muhimbili University College of Health Sciences and Muhimbili National Hospital, Dar es salaam, Tanzania. Informed verbal consent was sought from participants and from parents/or guardians in case of children below eighteen years. The following information was given to ensure that patients and parents/guardians have the information needed to make an informed choice: a complete description of the aims of the study, potential benefits and risks, blood collection procedures and assurance of confidentiality of any information given as well as test results. Study personnel provided any other requested additional information. All patients seen in this study received appropriate care and treatment according to national guidelines on care and treatment of HIV infected individuals. Patients who were found to have any oral lesions were referred to the Department of Oral Surgery and Oral Pathology of the Muhimbili National Hospital where appropriate management and follow-up were given. All patients' information and test results were confidentially kept.Data were coded, entered, cleaned, validated and analyzed using the SPSS version 12.0 . Patient3, with values ranging from 1 to 2007 cell/mm3. The median CD4+ cell count for children was 501 cells/mm3 and 134 cells/mm3 for adults. Majority 373 (70.1%) of children and adult patients were in the WHO clinical stages II to III. Among the participants, 298 (56%) patients were on HAART, consisting of nucleoside reverse transcriptase inhibitors (NRTIs), non-nucleoside reverse transcriptase inhibitors (NNRTIs) and protease inhibitors (PIs). Majority 531 (99.7%) were on the first line HAART combination, of whom 229 (76.8%) were on a combination of Stavudine/Lamivudine/Nevirapine, 32 (10.7%) on a combination of Zidovudine/Lamivudine/Effavirenz, 26 (8.7%) on Stavudine/Lamivudine/Effavirenz and 10 (3.4%) were on Zidovudine/Lamivudine/Nevirapine. One patient (0.3%) was on second line combination that included protease inhibitors (Abacavir/Lopinavir/Didanosine). Two hundred and thirty four (44%) patients were not receiving HAART. Sixty-two patients (11.7%) reported use of traditional medicines, of whom 36 (58%) were concomitantly using traditional medicines with HAART.A total of 532 HIV-infected patients, 367 (69%) females and 165 (31%) males participated in the study  and parotid enlargement  between children and adults. Pseudomembranous candidiasis was the most predominant type of oral candidiasis 66.4% (83/125) followed by a combination of pseudomembranous and erythematous 12% (15/125), erythematous candidiasis 9.6% (12/125), angular cheilitis 3.2% (4/125), combination of angular cheilitis with erythematous and hyperplastic variant were the least (1.6% each). Among 125 patients diagnosed with oral candidiasis 42 (33.6%) patients had previous history of oral candidiasis, 37 (29.6%) patients presented with esophageal symptoms such as dysphagia, odynophagia and chest pain at the time of examination.A total of 237 HIV-associated oral lesions were observed in 210 (39.5%) patients. Overall, oral candidiasis was the commonest oral lesion seen in 125 (23.5%) patients followed by mucosal hyper pigmentation 25 (4.7%), parotid gland enlargement 21 (3.9%) and oral Kaposi's sarcoma 17 (3.2%)  having been on treatment for one to six months. Patients on HAART for the duration of more than six months had significantly lower prevalence of oral lesions  and specifically oral candidiasis .+ cell count < 200 cells/mm3. Only a small minority (32.2%) of the patients on HAART were found to have CD4+ counts > 200 cells/mm3. Among those who were not on HAART 51.3% had CD4+ cell count < 200 cells/mm3 while the rest in the group had CD4+ cell count > 200 cells/mm3. However, the majority (70.3%) of adult patients on HAART had CD4+ cell count < 200 cells/mm3 while only minority (36.4%) of the children on HAART had CD4+ cell count < 200 cells/mm3. The mean difference of CD4+ cell counts between the adult and children on HAART and those not on HAART was statistically significant . In both HAART and non-HAART receiving children and adult patients oral lesions occurred more significantly among those with CD4+ cell count less than 200 cell/mm3 . There was a strong association between the WHO clinical stage of HIV disease with the presence of oral lesions , particularly oral candidiasis , oral Kaposi's sarcoma , and oral hairy leukoplakia .The mean CD4+ profiles of patients on HAART and those not on HAART are shown in Table 2 = 6.9; df = 1; p < 0.01) and oral candidiasis  but not other systemic diseases (P > 0.05). Oral lesions were not associated with any of the investigated socio-demographic features except for tobacco smoking .Eighty-four (15.8%) patients had current systemic diseases at the time of examination. Sixty-two (11.7%) patients had pulmonary tuberculosis (TB) and were on anti-tuberculosis treatment. Other systemic opportunistic diseases encountered at the time of examination were; pneumonia 14 (2.6%) patients and herpes zoster 8 (1.5%) patients. One hundred and thirty eight (25.9%) reported history of herpes zoster infection, 84 patients (15.8%) pneumonia while cryptococcal meningitis was reported by only 10 patients (1.9%). There was a significant association between occurrence of pulmonary TB with oral lesions  and children (41.2%), (p > 0.05). However, a significantly higher prevalence of enlargement of parotid glands in children and oral candidiasis in adults was observed, which is in keeping with the findings of Greenspan et al. 1992 .Mucosal hyperpigmentation, which was the second most prevalent oral lesions after oral candidiasis with a prevalence of 4.7%, occurred at higher, but non-significant magnitude, among adult patients who were on HAART. The reported prevalence of mucosal hyperpigmentation compares with a prevalence of 6% among HIV/AIDS patients in Kenya . The higLikewise, there was insignificant increase in oral papillomata [oral warts] in patients on HAART as compared to the non-HAART group. The increase in oral warts among patients on HAART has been associated with immune reconstitution ,23-25. TThere were no differences in the prevalence of other oral lesions including enlarged parotid glands, necrotizing ulcerative gingivitis, recurrent ulcers, Bell's palsy and herpes zoster of the face between HAART and non-HAART groups (p > 0.05). This could be explained by the fact that most of these lesions are classified as being less commonly associated with HIV  and therThe use of traditional medicine among our patients was high 11.7%), which is approximately one in eight patients, an observation that is in line with that reported earlier in Tanzania . Althoug1.7%, whiP < 0.01), and positive predictive values of any oral lesions and oral candidiasis in predicting TB of 87% (95% CI 73.0\u201394.6) and 67% (95% CI 51.9\u201380.0), respectively seem to imply that oral candidiasis might be used as an additional clinical marker for TB together with clinical presentation of weight loss with night sweats and chest symptoms. Majority (25.9%) reported history of herpes zoster infection, 84 patients (15.8%) pneumonia while cryptococcal meningitis was reported by only 10 patients (1.9%). However, there was no statistically significant difference between prevalence of oral lesions and history of opportunistic systemic diseases (P > 0.05). The limitation on this part of the study was dependency on patients to recall previous opportunistic disease.In this study, 15.8% of patients diagnosed to have systemic diseases such as tuberculosis, pneumonia and herpes zoster at the time of examination. However, the only significant association found was between pulmonary TB and oral lesions, specifically oral candidiasis (p <= 0.01) Table . This as3 and WHO clinical stage of HIV disease  declared that they have no competing interests.All authors were involved in designing the study. OJMH and FM took part in data collection, data handling and preparation of manuscript. MINM, ENMS, MJM, FHM, PEV and AJAM participated in preparation of the manuscript. EK participated in data analysis and preparation of the manuscript. Finally, all authors read and approved the final manuscript.The pre-publication history for this paper can be accessed here:"}
+{"text": "Pneumocystis jiroveci pneumonia (PCP) and substantial hypoxemia .The objective of this study was to review the effects of adjunctive corticosteroids on overall mortality and the need for mechanical ventilation in HIV-infected patients with We conducted a systematic search of the literature for randomised trials published up to December 2004. Selected trials compared adjunctive corticosteroids with placebo or usual care in HIV-infected patients with PCP and reported mortality data. Two teams of reviewers independently evaluated the methodology and extracted data from each primary study.Six studies were included in the meta-analysis. Risk ratios for overall mortality for adjunctive corticosteroids were 0.54  at 1 month and 0.67  at 3\u20134 months of follow-up. Numbers needed to treat, to prevent 1 death, are 9 patients in a setting without highly active antiretroviral therapy (HAART) available and 22 patients with HAART available. Only the 3 largest trials provided data on the need for mechanical ventilation with a risk ratio of 0.37  in favour of adjunctive corticosteroids.The number and size of trials investigating adjunctive corticosteroids for HIV-infected patients with PCP is small, but our results suggest a beneficial effect for patients with substantial hypoxemia. Pneumocystis jiroveci pneumonia (PCP) , 0%\u201378%]) whereas at 3\u20134 months treatment effects looked more homogenous  adjunctive corticosteroids that were published in full, i.e. excluding Clement et al. ). In further sensitivity analyses for the mortality endpoint at 1 month summary risk ratios were 0.55  in trials that reported concealed allocation [Risk ratios for overall mortality were significantly reduced for adjunctive corticoids at 1 month  and at 3\u20134 months  of follow-up .Reliable data on the need for mechanical ventilation was only available for the 3 largest trials ,16,19. AThis systematic review of 6 randomised controlled trials in HIV-infected patients with PCP and substantial hypoxemia found a significant relative risk reduction of death for adjunctive corticosteroids of 46% at 1 month and of 33% at3\u20134 months. The average-weighted mean mortality in control groups of included trials at one month was 25%. This initial mortality-rate of 25% can be assumed in settings where HAART is not available which is still the case for most developing countries . In thisOur study has several strengths and limitations. We conducted an extensive literature search to retrieve all eligible trials. However, formal testing for publication bias was not very powerful because of a relatively small number of included trials. Even with a symmetric looking funnel plot, such bias cannot be ruled out. Moreover, with a small number of included trials the uncertainty interval for the inconsistency among trials may not be very informative . We focuThere has been some concern among physicians treating patients with AIDS that further immunosuppression due to corticosteroid therapy could accelerate the onset of other HIV-related opportunistic complications ,23. HoweIt is possible that adjunctive corticosteroids are also beneficial for HIV-infected patients with mild hypoxemia due to PCP . HoweverThis meta-analysis confirmed and quantified the benefit of adjunctive corticosteroid therapy in HIV-infected patients with moderate-severe PCP. We estimated a relative risk reduction for overall mortality of 46% at 1 month and 33% at 3\u20134 months. We calculated numbers needed to treat of 9 patients for settings without HAART, and 22 patients with HAART available to prevent 1 death. Our results underline the conclusions of the early released consensus statement .The author(s) declare that they have no competing interests.MB and HCB conceived of the study and performed the literature search. MB, HCB, RB and HF checked eligibility and quality of trials, and extracted the necessary data. MB performed the statistical analyses and drafted the manuscript with the help of HCB, RB and HF. All authors read and approved the final version.The pre-publication history for this paper can be accessed here:Table with characteristics of excluded trials and reasons for exclusion.Click here for file"}
+{"text": "Staphylococcus aureus infections, with both methicillin-susceptible and methicillin-resistant (MRSA) strains. Possible explanations could include the high burden of colonization, the behavioral risk factors, and the frequent exposures to health care facilities of HIV-infected patients. The purpose of the study was to assess the risk factors for clinically- significant methicillin-resistant Staphylococcus aureus (CS-MRSA) infections in HIV-infected patients admitted to Infectious Diseases Units.HIV-infected subjects have high incidence rates of From January 1, 2002 to December 31, 2005, we conducted a retrospective case-control (1:2) study. We identified all the cases of CS-MRSA infections in HIV-infected patients admitted to the National Institute for Infectious Diseases (INMI) \"Lazzaro Spallanzani\" in the 4-year study period. A conditional logistic regression model was used to identify risk factors for CS-MRSA infection.We found 27 CS-MRSA infections, i.e. 0.9 CS-MRSA infections per 100 HIV-infected individuals cared for in our Institute. At multivariate analysis, independent predictors of CS-MRSA infection were cumulative hospital stay, invasive procedures in the previous year, and low CD4 cell count. Particularly, the risk for CS-MRSA increased by 14% per an increase of 5 days hospitalization in the previous year. Finally, we identified a low frequency of community-acquired MRSA infections  among HIV-infected patients.Clinicians should be aware of the risk for CS-MRSA infection in the clinical management of HIV-infected patients, especially in those patients with a low CD4 cell count, longer previous hospital stay, and previous invasive procedures. MRSA inound 24% ,4. Moreoound 24% .S. aureus infections [HIV-infected subjects have high incidence rates of fections -10 probafections ,11-14, tfections  and to ffections ,16.We have retrospectively reviewed the cases of CS-MRSA infections occurring among HIV-infected patients admitted to our Infectious Diseases hospital, with the aim to evaluate the clinical and epidemiological associated risk factors.We conducted a retrospective case-control study on HIV-infected patients admitted to our Institute for Infectious Diseases \"L. Spallanzani, Rome from January 1, 2002 to December 31, 2005. Approximately 3,000 HIV-infected patients were followed up in our outpatient facility in the 4-year study period. We collected all the microbiological reports yielding MRSA isolates from different body sites except stool with their respective antibiotic sensitivity tests reported at the computer database of our Institute's microbiological laboratory. Microbiological cultures were taken before empirical antibiotic treatment. Surveillance cultures for colonization were excluded from the study. Sensitivity testing at our laboratory was performed using Phoenix (Becton Dickinson) automated system. MRSA was defined as minimum inhibiting concentration \u2265 4 micrograms/milliliter for oxacillin.Medical records were reviewed to identify those patients who had a documented clinically-significant MRSA (CS-MRSA) infection at isolation time. The clinical significance of each MRSA isolate was settled on one or more of the following criteria: 1) a positive MRSA culture from a normally sterile body site; 2) documented clinical diagnosis of infection at isolation time (e.g. sputum isolates in patients with documented pneumonia). Moreover, information about the patient's demographic and clinical features  was ascertained. The MRSA isolates were classified according to the source of isolation, as follows: 1) skin, soft tissue isolates; 2) respiratory isolates including sputum, bronchoalveolar lavage fluid and pleural fluid; 3) blood isolates.10 HIV plasma viral load during past half year; 3) HIV clinical group according to Centers for Disease Control and Prevention (CDC), Atlanta; 4) any antiretroviral (ARV) therapy during past half year; 5) any cotrimoxazole prophylaxis in the previous 3 months; 6) peritoneal or haemodialysis or 7) surgery within 12 months before the MRSA infection; 8) presence of a percutaneous device or indwelling vascular catheter at the time of infection or placed in the past 12 months; 9) total number of hospital days and 10) total number of clinical visits to our outpatient facility in the previous year. Time period for ARV therapy and cotrimoxazole prophylaxis was arbitrarily selected according to previous studies [Further investigation was conducted through the hospital computer database and the past medical records review, to assess the following data concerning the patient's immunological, clinical and hospitalization history prior to CS-MRSA infection onset: 1) median CD4 cell count during past half year; 2) median log studies .CS-MRSA infection was defined either health care or community-associated, based on established criteria for definition of \"community-associated MRSA infection\" . In partA retrospective case control-study was performed, considering as cases those HIV-infected patients with MRSA infection identified during the hospital stay, and as controls those HIV-infected patients without MRSA infection, admitted to the same wards in the study period. Controls were randomized 1:2 and matched by sex and age.To assess potential risk factors for CS-MRSA infection, we used a conditional logistic regression model and results were exposed in terms of Odds Ratio (OR) with their respective 95% Confidence Interval (CI). We performed a univariate analysis by adjusting each variable for age at enrolment (< = 42 years and >42 years of age), in order to avoid any residual confounding due to the matching of the variables. All the covariates that were found to be significantly associated (p < 0.05) with CS-MRSA infection were included in a multivariate model, and afterwards, using a stepwise backward procedure, we selected the final model that included the following variables: age at the enrollment, total number of hospital days in the previous year (modeled as continuous variable), number of outpatient visits in the 12 months prior to MRSA diagnosis (0\u20131 visit and more than 1 visit), any submission to invasive procedures , and the median CD4 cell count in the previous six months. We also plotted the trend of OR according to total number of hospital days in the previous year, by dividing the patients with at least one day of hospitalization in three groups of approximately the same number of days , and performed a test to verify its significance.Since the data reported in our study was collected by patient's chart review, and no additional information or any other intervention was made for the purpose of the study, no specific ethical approval was requested according to the regulations of our institute.10 HIV plasma viral load \u2264 2.99 copies/milliliter (cp/ml). Four (14.8%) and 23 (85.2%) patients were classified as HIV group B, and C, respectively. Fifty-four controls were enrolled; males were 40 (74%), median age was 44 years (range 37\u201348). Thirty-two patients (59.2%) had CD4 \u2265 200/\u03bcl, 14 patients (26%) had median log10 HIV plasma viral load \u2264 2.99 cp/ml. Four (7.4%), 22 (40.7%), and 28 (51.8%) patients were respectively classified as CDC group A, B, and C. No significant differences were found according to HIV risk factors; particularly drug users were 55.6% among cases and 57.3% among controls.During the 4-year study period, 5,257 admissions of HIV-infected patients occurred at our Institute for Infectious Diseases \"Lazzaro Spallanzani\", Rome, Italy. The microbiological computer database found out a total of 28 HIV-infected patients yielding positive MRSA cultures; 27 patients had CS-MRSA infection, and accounted for 0.5% of total admissions of HIV-infected patients, and for 0.9% of total HIV-infected patients. Males were 20 (74%); median age was 43 years (range 38\u201348). Twenty out of them (74%) had median CD4 < 200/microliter (\u03bcl), and 9 (34.6%) had median logOf the 27 HIV-infected patients, primary sources of MRSA were distributed as follows: 11 (40.8%) blood, 8 (29.6%) skin and soft tissue, and 8 (29.6%) respiratory .Among the 27 patients with MRSA infection, 17 (63%) had a MRSA infection identified within 48 hours of admission ; 10 (37%) patients evidenced MRSA infection during the hospital stay . According to the above mentioned criteria, twenty-six out of 27 patients had health care-associated, and only 1 had community-associated MRSA infection. Neither cases nor controls were involved in any case clustering or outbreak during the study period.Univariate analysis revealed that the following variables were associated with the occurrence of CS-MRSA infection: longer cumulative hospital stay in the previous year, less than 2 outpatient visit in the previous year, invasive procedures in the previous year, and CD4 cell count < 200/\u03bcl. Moreover, the administration of cotrimoxazole prophylaxis in the previous 4 months was more common among cases (29.6%) than controls (9.3%), and close to significancy p = 0.051). At multivariate analysis, cumulative hospital stay, invasive procedures in the previous year, and CD4 cell count in the previous 6 months remained associated with CS-MRSA infection  ,16. Poss10 HIV plasma viral load > 2.99 cp/ml. Our findings are in contrast with those of Matthews et al. [In our study we identified a low frequency of CA-MRSA infection among HIV-infected patients. Indeed, only 1 out of 27 MRSA patients (3.7%) fulfilled CA-MRSA definition . This pas et al.  that reps et al. , 9 out os et al. , among nTo our knowledge, to date in the literature, only few cases of CA-MRSA infections have been described in Italy ,21 and iIn our retrospective study we found that length of cumulative hospital stay, submission to invasive procedures in the 12 months prior to MRSA infection onset, and low CD4 cell count were variables independently associated with CS-MRSA infection. These findings are in agreement with previous reports of the literature ,15,16,22In our study we also found that attendance to our outpatient clinic was less frequent in MRSA cases than controls. Possible explanations to this finding include the low invasive procedure rate in the HIV outpatient setting in our country, resulting in a low exposure rate to nosocomial organisms; moreover, the higher CD4 cell count we found among controls may be a protective factor for MRSA colonization according to data reported in literature,,23 and fMost of our HC-MRSA infections (63%) had a community onset, not far from the 50% rate found by Seybold et al. among 107 HC-MRSA . MoreoveOur study had some limitations, including the limited number of cases; however, in order to increase the potency of our study we enrolled two controls per each case. Furthermore, owing to the retrospective design of our study, no information is available on previous wide-spectrum antibiotic treatments, and on other potential risk factors reported in the literature ,13. We mFinally, we are aware that the total number of CS-MRSA infection diagnosis at our Institute especially in the outpatient settings could have been underestimated because of the following reasons: 1) our isolates were collected during hospital stay whereas in other studies, MRSA isolates were collected also during outpatient visits ,16; 2) sIn conclusion, our study represents an attempt to evaluate the potential clinical conditions associated with a CS-MRSA infection among HIV-infected patient; as recently proposed by Harbarth et al, these findings could be used to calculate a risk score at admission .In the clinical management of HIV-infected patients, especially in those admitted to hospital for clinical sepsis, and/or skin and soft tissue infections, clinicians should be aware of the risk factors associated with a MRSA infection, particularly low CD4 cell count, longer previous hospital stay and previous invasive procedures.Financial competing interests: NP is on the speakers' bureau for several companies including Merck Sharpe & Dohme, Aventis, Ethicon, GSK, Pfizer, AstraZeneca, Roche, Gilead. None of the other authors has financial competing interests.None of the authors has non financial competing interests to disclose.CMJD contributed to the study design, to the acquisition of clinical and microbiological data and to manuscript draft and final version.CA performed statistical analysis, and contributed to interpretation of data.AF contributed to acquisition of microbiological data, and to the manuscript draft.NP conceived the study, contributed to its design, and to the manuscript draft and final version.All authors read and approved the final manuscript.The pre-publication history for this paper can be accessed here:"}
+{"text": "Antiretroviral therapy (ART) with a generic fixed-dose combination (FDC) of stavudine (d4T)/lamivudine (3TC)/nevirapine (NVP) is widely used in developing countries. The clinical data of this FDC among very advanced HIV-infected patients is limited.3 and group B: \u2265 50 cell/mm3).A retrospective cohort study was conducted among ART-na\u00efve HIV-infected patients who were initiated a generic FDC of d4T/3TC/NVP between May 2004 and October 2005. Patients were categorized into 2 groups according to the baseline CD4 (group A: <50 cell/mm3 in group A and 139 (92\u2013198) cells/mm3 in group B. Intention-to-treat analysis at 48 weeks, 71.7% (86/120) of group A and 75.0% (63/84) of group B achieved plasma HIV RNA <50 copies/ml (P = 0.633). On-treatment analysis, 90.5% (87/96) in group A and 96.9% (63/65) in group B achieved plasma HIV RNA <50 copies/ml (P = 0.206). At 12, 24, 36 and 48 weeks of ART, mean CD4 were 98, 142, 176 and 201 cells/mm3 in group A and 247, 301, 336 and 367 cells/mm3 in group B, respectively. There were no differences of probabilities to achieve HIV RNA <50 copies/ml (P = 0.947) and CD4 increment at 48 weeks between the two groups (P = 0.870). Seven (9.6%) patients in group A and 4 (8.5%) patients in group B developed skin reactions grade II or III (P = 1.000). ALT at 12 weeks was not different from that at baseline in both groups (P > 0.05).There were 204 patients with a mean \u00b1 SD age of 37.1 \u00b1 8.9 years, 120 (58.8%) in group A and 84 (41.2%) in group B. Median (IQR) CD4 cell count was 6 (16\u201329) cells/mm3 has no different outcomes in terms of safety and efficacy. FDC of d4T/3TC/NVP can be effectively used in advance HIV-infected patients with CD4 <50 cells/mm3.Initiation of FDC of d4T/3TC/NVP in HIV-infected patients with CD4 <50 and \u2265 50 cells/mm Current antiretroviral treatment guidelines for HIV infection in adults and adolescents in the resource-limited settings recommend using two nucleoside reverse transcriptase inhibitors (NRTIs) plus one non-nucleoside reverse transcriptase inhibitor (NNRTI) as the first-line antiretroviral regimen ,2. RegimAlthough EFV-based ART is an NNRTI-based antiretroviral therapy (ART) of choice according to the recommendation of recent antiretroviral treatment guidelines ,2, NVP-bThere are some potential limitations of NVP-based ART including adverse drug reactions and low genetic barrier. Skin rash is the most frequently observed adverse event from NVP and manifests as a diffuse maculopapular rash or erythematous rash with or without constitutional symptoms. The risk of rash at any severity is greatest in the first six weeks . However3 and those who had CD4 cell counts \u226550 cells/mm3.To date, the data regarding safety and efficacy of the d4T/3TC/NVP FDC among advanced HIV-infected patients with very low CD4 is still limited. Patients in resource-limited settings usually present late with very low CD4 cell counts. We therefore conducted this retrospective cohort study to compare immunological and virological outcomes and adverse events of a generic FDC of d4T/3TC/NVP between HIV-infected patients who had baseline CD4 cell counts <50 cells/mmA retrospective cohort study was conducted among ART-na\u00efve HIV-infected patients who were initiated a generic FDC of d4T/3TC/NVP between May 2004 and October 2005 in Bamrasnaradura Infectious Diseases Institute, Ministry of Public Health, Nonthaburi, Thailand. The patients' identification numbers were identified from annual database of the institute. The data were extracted from the medical records. Inclusion criteria were as follows: (1) HIV-infected individuals \u2265 15 years old, (2) na\u00efve to ART prior to FDC of d4T/3TC/NVP, (3) were initiated with a generic FDC of d4T/3TC/NVP, (4) used separate tablet of NVP 200-mg once-daily lead-in dose during the first 2 weeks, prior to escalation to 200 mg twice daily, (5) followed up at least two clinic visit. Exclusion criteria were as follows: (1) baseline serum creatinine level > 2.0 mg/ml, (2) baseline liver aminotransferase >3 times of upper normal limit, (3) currently active major opportunistic infections (OIs), and (4) receiving medications that have drug-drug interactions with NVP, including rifampicin and fluconazole.3) and group B (CD4 cell counts \u2265 50 cells/mm3). Factors including demographics, previous OIs, CD4 cell counts, plasma HIV RNA were studied and compared between the two groups. Patients were followed up for 48 weeks after initiation of a generic FDC of d4T/3TC/NVP. The parameters including CD4 cell counts, plasma HIV RNA and ALT were assessed at baseline, 12, 24, 36 and 48 weeks of ART. The primary outcome of interest was the proportion of patients who achieved plasma HIV RNA <50 copies/ml after 48 weeks of ART. The secondary outcomes were as follows: 1) the probability to achieve plasma HIV RNA <50 copies/ml, 2) the increment of the number of CD4 cell counts at 48 weeks of ART from baseline value and 3) the incidences of NVP-associated adverse reactions including skin rashes and hepatotoxicity that lead to drug discontinuation.All eligible patients were categorized into two groups according to their baseline CD4 cell counts: group A  and plasma HIV RNA at baseline. Statistical calculations were performed using SPSS program version 11.5 . A two-sided P value of less than 0.05 was considered statistically significant. The study was approved from the institute review board.Mean (\u00b1 SD), median  and frequencies (%) were used to describe patients' characteristics in both groups. 3 in group A and 139 (92\u2013198) cells/mm3 in group B. Group A had more previous opportunistic infections, higher baseline HIV RNA, ALP and ALT than group B (P < 0.05). Any causes of discontinuation of ART are shown in Table P = 1.000).A total of 204 patients met entry criteria; mean (\u00b1 SD) age was 37.1 \u00b1 8.9 years and 60.3% were male. There were 120 (58.8%) patients in group A and 84 (41.2%) patients in group B. Table P = 0.947). The Cox proportional hazard model including factors of age, gender, body weight, previous OIs, baseline hemoglobin, baseline CD4 cell counts and baseline plasma HIV RNA showed that patients in group A had similar chance of undetectable plasma HIV RNA with the patients in group B . The other factors were not associated with undetectable plasma HIV RNA after 48 weeks of ART (P > 0.05).The results of the primary outcome are shown in Table 3 and group B patients had a median CD4 of 240, 280, 305 and 331 cells/mm3 at 12, 24, 36 and 48 weeks, respectively  cells/mm3, P = 0.870]. Eleven (9.2%) patients in group A and 12 (14.3%) patients in group B developed NVP-associated skin reactions grade II and III in which lead to the discontinuation of generic FDC of d4T/3TC/NVP (P = 1.000). Mean \u00b1 SD ALT when these 23 patients developed skin reaction was 31.5 \u00b1 21.1 U/l. No patients in the present study developed skin reactions grade IV. By repeated measurement analysis, there were no differences of ALT at 12 weeks from baseline value in both groups (P > 0.05). No patients developed clinical hepatitis. Three (2.5%) patients in group A and 5 (6.0%) patients in group B developed stavudine-associated peripheral neuropathy (P = 0.278). Stavudine-associated symptomatic lactic acidosis was observed in 2 patients during the 48-week study period. Four patients in group A and one patient in group B died during the study period. The causes of death of these 5 patients were as follows: disseminated histoplasmosis 1, E. coli sepsis 1, MAC infection 1 and wasting syndromes 2.Group A patients had a median CD4 cell count of 85, 125, 158 and 198 cells/mm3 had similar virological and immunological responses when compared to those who had baseline CD4 cell counts \u2265 50 cells/mm3. This finding can support the use of this generic FDC of d4T/3TC/NVP in very advanced HIV-infected patients in the resource-limited settings. According to the guideline for management of HIV-infected patients in Thailand, ART is recommended for all patients with history of AIDS-defining illness or asymptomatic patients with CD4 cells count less than 200 cell/mm3. Therefore, almost all patients in group B have baseline CD4 cell counts between 50 cells/mm3 and 200 cells/mm3. As expected, group A patients have a higher proportion of previous opportunistic infections and a higher level of plasma HIV RNA.The results from the present study demonstrate that HIV-infected patients who had baseline CD4 cell counts <50 cells/mm3), we found that 71% of patients achieved undetectable plasma HIV RNA after 48 weeks of ART. This number is comparable to the virological response in group B and similar to other studies that conducted in our country and in developed countries [The overall proportion of patients who achieved plasma HIV RNA <50 copies/ml was 73% 149 of 204) after 48 weeks of ART in an ITT analysis. Despite the fact that group A patients were severely immunocompromised  CD4 cell counts increase from 5 (3\u20137) cells/mm3 to 151 (92\u2013231) cells/mm3 in this subgroup (data not shown). This response would be continued for many years into effective antiviral effect of ART.Overall, CD4 cell counts rise with immune recovery from receiving ART. The increment of CD4 cell counts after 48 weeks of ART is not blunted with very low baseline CD4 cell counts as shown in Figure 3. Furthermore, no factors  were associated with skin rashes in the present study according to the results of logistic regression analysis (data not shown). These findings suggest that there is no clinical factor to predict the occurrence of rash from NVP in patients with very low CD4 cell counts. However, this should be interpreted with caution due to the limitation of sample size. It would be beneficial if there are any factors that can predict this adverse event. Further study to determine immunologic and genetic factors that associated with rash is encouraged.Regarding discontinuation of ART, NVP-associated skin rashes is an important reason for discontinuation. In the present of NVP 200-mg once-daily lead-in for 2 weeks, NVP may cause a mild skin rash in 15 to 20% of patients; 5 to 10% of which discontinue treatment . After 43 at the time of nevirapine initiation when compared with woman with CD4 cell counts of \u2264 250 cells/mm3 (11.0% vs 0.9%). An increased risk was also seen in men with baseline CD4 cell counts >400 cells/mm3 when compare with baseline CD4 cell counts \u2264 400 cells/mm3 (6.3% vs 1.2%) [Although there are limited data regarding the impact on hepatotoxicity, we decided to exclude the patients who concurrently received rifampicin and fluconazole from the study. These drugs may potentially increase incidence of hepatotoxicity -25. The vs 1.2%) -29. The vs 1.2%) . AdditioThe study has demonstrated the satisfactory clinical outcomes, the extent of immunological restoration and virological responses of a generic FDC of d4T/3TC/NVP in very advanced HIV-infected patients. These results provide the evidence of benefit from NVP-based ART in advanced HIV-infected patients. Thus, this may support the physicians to prescribe NVP-based ART regimen for these patients.3. It would be more interesting if we can compare clinical outcomes between these groups. Finally, the sample size may be not large enough to detect small difference of efficacy and low incidence of adverse events, particularly hepatitis.The present study has some limitations. The study design is a retrospective study, which is not the best study design to evaluate the efficacy of antiretroviral regimen. However, this study design is a comparative study that evaluated the efficacy NVP-based ART between the patients who had extremely low CD4 cell counts and those who had moderate level of CD4 cell counts. The results of the present study may provide useful clinical data for caring advanced HIV-infected patients in developing countries. In addition, some clinical data may be underestimated and some possible risk factors may not be included. Our study was based on a tertiary care center for HIV-infected patients. These study populations were cared by infectious diseases specialists and HIV-experienced medical team. Thus, the similar results might not be achieved in the general or community hospital in resource-limited setting. Liver enzymes were not performed during the first few weeks of ART. However, no patients developed clinical hepatitis during this period. Baseline hepatitis B and hepatitis C serology were not routinely performed prior to ART initiation. We did not have reference group of patients with CD4 cell counts greater than 200 cells/mm3 has no different outcomes in terms of safety and 48-week virological and immunological response. Generic FDC of d4T/3TC/NVP can be effectively used in advance HIV-infected patients with CD4 <50 cells/mm3.In conclusion, initiation of a FDC of d4T/3TC/NVP in HIV-infected patients with baseline CD4 cell count of <50 and \u2265 50 cells/mmHAART: Highly active anti-retroviral therapy, HIV: Human immunodeficiency virus, NRTIs: Nucleoside reverse transcriptase inhibitors, NVP: NNRTs: Non-nucleoside reverse transcriptase inhibitors, FDC: Fixed-dose combinations, Nevirapine, EFV: Efavirenz, d4T: Stavudine, 3TC: Lamivudine, ART: Antiretroviral therapy, OIs: Opportunistic infections, AST: Aspartate aminotransferase, ALT: Alanine aminotransferaseThe author(s) declare that they have no competing interests.WM participated in the design of the study and statistical analysis. SC participated in the design of the study. SL participated in the design of the study. SS participated in the design of the study and statistical analysis."}
+{"text": "The relationship between cardiac enzyme (CE) release following coronary artery bypass surgery (CABG) and medium term outcome is unclear. We sought to determine the relationship between post-operative CE release and one-year survival following isolated CABG.Over three years 3,024 consecutive patients underwent isolated CABG. Patient characteristics were prospectively recorded in a cardiac surgical database. CE release, taken as the highest single measurement recorded in the first 24 hours post-op, was abstracted from an electronic archive. All cause mortality was taken from a national registry of deaths.Data were complete for 2,860 (94.6%) patients. CK-MB isoenzyme (reference range 5\u201324 U/l) was recorded in 2,568 (89.8%), total CK in 292 (10.2%).CE release three or more times the upper limit of the reference range (ULR) were recorded in 498 (17.4%) patients, 163 (5.7%) patients had CE more than six times ULR. There were 122 deaths (4.3%). Cox proportional hazards analysis showed that CE release 3\u20136 times ULR  and CE release six or more times the ULR  were independently associated with increased one-year mortality.Cardiac enzyme release following CABG is associated with increased one-year all-cause mortality. The definition of peri-operative myocardial infarction following CABG should include elevation of CK-MB three or more times the upper limit of normal. Myocardial necrosis causing release of cardiac enzymes (CE) following otherwise uncomplicated percutaneous coronary intervention has been associated with increased medium term mortality ,2. MyocaDefining peri-operative myocardial infarction following cardiac surgery has proven problematic due to the difficulty in interpreting pain, electrocardiographic (ECG), and haemodynamic changes in the early post operative phase. Peri-operative ECG changes such as T wave inversion, left or right bundle branch block, and new Q waves have poor sensitivity and specificity for myocardial infarction -9, and aThe current consensus among cardiac surgeons and cardiologists is that post CABG CK-MB elevation of least 5 times the upper limit of reference range (ULR) marks the threshold of prognostic significance . HoweverWe sought to determine the association between CE release and survival at one-year, and to identify pre-operative predictor variables associated with increased CE release following isolated CABG.st January 1999 and 31st December 2001 at the Cardiothoracic Centre-Liverpool. Patients undergoing surgery that involved heart valve repair or replacement, resection of a ventricular aneurysm or other surgical procedure were not included. The study was approved by the local ethical committee.An observational cohort study was performed. Using a prospectively recorded cardiac surgical database we identified 3,024 consecutive patients, undergoing isolated CABG between 1All data were collected prospectively during the patient admission as part of routine clinical practice  and total CK . CE results for the first 24 hours post-op were taken from a routinely recorded electronic clinical biochemistry archive, blind to survival and other clinical data. When more than one CE result existed the highest value of CK-MB isoenzyme was selected in preference to the highest value of total CK.Patient records were linked to the National Strategic Tracing Service (NSTS), which records all-cause mortality in the United Kingdom. To establish current vital status, at one-year of follow-up, patients were matched to the NSTS based on patient name, National Health Service unique number, date of birth, gender, and postcode.Continuous variables were not normally distributed and are shown as median with 25th and 75th percentiles. Categorical data are shown as percentages. Deaths occurring as a function of time, at one-year of follow-up were described using the product limit methodology of Kaplan and Meier . Cox proPatient characteristic data were complete for all 3,024 patients Table . Follow th and 75th percentiles: 24 to 60 U/l). The median total CK was 248 U/l (25th and 75th percentiles: 213 to 285) for men, and 247 U/l (25th and 75th percentiles: 199\u2013283) for women. Four hundred and ninety eight (17.4%) patients had cardiac enzymes three or more times the ULR. Two hundred and twenty nine (8.0%) patients had CE five or more times the ULR. One hundred and sixty three (5.7%) patients had CE more than six times the ULR, while 59 (2.1%) had cardiac enzymes ten or more times the ULR.Among the 2,860 patients with CE results, 2,568 (89.8%) had CK-MB isoenzyme and 292 (10.2%) total CK only performed within the first 24 hours post-op. The median CK-MB iso-enzyme result was 36 U/l (25There were 122 (4.3%) deaths during the first post-operative year among the 2,860 patients with CE results. Cox proportional hazards analysis revealed that CE release >6 times the ULR (adjusted hazard ratio (HR) 5.0 [95% CI: 4.5 to 5.4], p < 0.001) and CE release 3 to 6 times the ULR  were independent predictors of increased mortality at one-year. The crude mortality was identical for cardiac enzymes 3 to 5 times, and 5 to 6 times the ULR at 4.8%. When CE release 3 to 5 times the ULR was offered to the model the magnitude of association with increased one-year mortality was not substantially changed  confirming that the association for the group of patients with CE release 3 to 6 times the ULR is not solely driven by the highest values of CK-MB in this band.Other independent risk factors for one-year mortality included poor ejection fraction (< 30%), increasing age, pre-operative renal dysfunction, peripheral vascular disease, prior cardiac surgery, emergency surgery, and female sex Table . Other vThe relationship between CE release and death within the first post-operative year are displayed in the risk adjusted survival curves Figure . The indAll the patient characteristics listed in Table This study shows a highly statistically significant, and clinically meaningful independent association between CK-MB release within the first 24 hours following isolated CABG surgery and increased mortality within the first post-operative year. Although the highest risk of death is associated with greater CE release we have demonstrated that the independent association between CE release and death is not confined to the few individuals with highest values of CE release. To the best of our knowledge this is the first study to show that modest levels of post-CABG CE release 3 to 6 times the ULR are independently associated with higher one-year mortality.CE release three or more times the ULR occurred in approximately one in six of the patients in this study. Such patients were more frequently female, had more target vessels, and peripheral vascular disease. These associations may be due to more challenging surgical anatomy , and morWe chose to use a CK-MB immuno assay as this had been historical practice at the Cardiothoracic Centre-Liverpool. Although CK-MB estimation remains the most widely used post revascularisation assay our results may have been strengthened had we used more sensitive and specific enzymes assays such as troponin T or I ,26. HoweEarlier studies suggested that the association between increased medium term mortality and peri-operative CE release following CABG surgery was confined to those individuals with CE release >5 times the ULR ,14,15, oBoth Klatte  and CostThe work by Brener and associates  implied Marso and colleagues  found siThe editorial by Mahaffey and Alpert  stressedThe message from this study is clear: myocardial necrosis following CABG is undesirable. We have demonstrated that levels of CE release previously thought to be innocuous are independently associated with increased one-year mortality. CK-MB release three or more times above the upper limit of reference range, measured within the first 24 hours following isolated CABG should be regarded as prognostically significant and may form the basis for a simplified definition of peri-operative myocardial infarction following coronary artery bypass surgery.N Newall designed the study, outlined the analytical approach, and wrote the manuscript. AY Oo, RH Stables, BM Fabri, DR Ramsdale amended the study design and data interpretation. ND Palmer, T Hine collated, and validated biochemical data blind to clinical outcome and contributed to data interpretation. AD Grayson performed the statistical analysis and co-wrote the manuscript. All authors contributed to interpretation of data and reviewed the final report.The author(s) declare that they have no competing interests.Dr Newall was funded by the Merseybeat Appeal and has received project grants from Bristol Myers Squibb/Sanofi Synthelabo. The funding source had no role in the design, data collection, interpretation and writing of the manuscript."}
+{"text": "The most pressing challenge to achieving universal access to highly active anti-retroviral therapy (HAART) in sub-Saharan Africa is the shortage of trained personnel to handle the increased service requirements of rapid roll-out. Overcoming the human resource challenge requires developing innovative models of care provision that improve efficiency of service delivery and rationalize use of limited resources.We conducted a time-series intervention trial in two HIV clinics in central Mozambique to discern whether expanding the role of basic-level nurses to stage HIV-positive patients using CD4 counts and WHO-defined criteria would lead to more rapid information on patient status (including identification of HAART eligible patients), increased efficiency in the use of higher-level clinical staff, and increased capacity to start HAART-eligible patients on treatment.3 increased over time , as did the total number of new patients initiating HAART . However, the intervention was not independently associated with either of these outcomes in multivariate analyses  for starting HAART in patients with CD4 counts of less than 200/mm3;  for the total number of new patients initiating HAART per month. No effect of the intervention was found in these outcomes when stratifying by site.Overall, 1,880 of the HAART-eligible patients were considered in the study of whom 48.5% started HAART, with a median time of 71 days from their initial blood draw. After adjusting for time, expanding the role of nurses to stage patients was associated with more rational use of higher-level clinical staff at one site . In multivariate analyses, the rate of starting HAART in patients with CD4 counts of less than 200/mmThe CD4 nurse intervention, when implemented correctly, was associated with a more rational use of higher-level clinical providers, which may improve overall clinic flow and efficient use of the limited supply of human resources. However, this intervention did not lead to an increase in the number of patients starting HAART or a reduction in the time to HAART initiation. Study month appears to play an important role in all outcomes, suggesting that general improvements in clinic efficiency may have overshadowed the effect of the intervention. The lack of observed effect in these outcomes may be due to additional health systems bottlenecks that delay the initiation of treatment in HAART-eligible patients. Since 2002 there has been a clear international commitment to expanding the availability of highly active antiretroviral therapy (HAART) in developing countries. The increased political and financial support have resulted in dramatic increases in the number of people in resource-poor countries initiating HAART, reaching over 1.3 million [HIV Care and treatment access is often limited in resource-constrained countries because the health systems in the process of scaling-up HAART are weak, and only recently became oriented toward providing care for chronic diseases. A lack of human resource capacity to handle the increased service requirements of roll-out plans is an important limitation of the public health sector -5. LogisIn 2004, Mozambique joined a growing number of resource-limited countries heavily affected by HIV/AIDS that began scaling-up national, public sector HIV care and treatment. As of January 2006, national targets were within reach, with over 67,779 individuals enrolled in the HIV-care system nationally, and over 20,805 individuals on HAART . This prPrevious to this study, all diagnostic and curative care within the specialized HIV clinics was provided by physicians or medical officers . Nurses performed baseline clinical assessments and ordered CD4 and other routine laboratory tests in compliance with the core competency guidelines developed for HIV service delivery by the WHO; however, they were not authorized to stage patients using WHO staging criteria or interpret CD4 lab results   to confirm HAART eligibility  and to approve initiation of therapy when appropriate.The CD4 nurse intervention was defined as changing the scope of work for nurses so that they were trained and authorized to evaluate patients' eligibility for HAART using CD4 counts and WHO staging criteria. All nurses participating in the intervention were basic-level nurses with two-years of initial training, and all had attended standardized training on staging HIV-positive patients using CD4 counts and WHO criteria. Prior to the intervention, all HAART and non-HAART eligible patients went through a triage nurse for baseline assessment and blood draws for CD4 counts and were then sent to a MD/MO for their CD4 results, clinical staging, and definition of their next care and treatment steps. After the intervention, all new patients went to the CD4 nurse for initial baseline assessments and blood draws, and then returned to the CD4 nurse to receive their results and undergo clinical staging. Based on the evaluations made by the CD4 nurse, patients were classified as HAART eligible or non-HAART eligible. Depending on their classification, they were then either sent on the 'HAART pathway'  or scheduled to return to the CD4 nurse for periodic monitoring until deemed HAART-eligible based on clinical and/or laboratory parameters.The theoretical model of this intervention Figure  posited Both sites formally introduced the 'CD4 nurse' intervention in December, 2004. Patients who enrolled at the HIV clinics, underwent initial CD4 testing, or started HAART during the 10-month period between 1 July 2004 and 30 April 2005 were included in the study, with the first five-month period constituting the 'before' period and the second five-month period constituting the 'after' period. During the 10-month period, inclusion in analysis was defined \u2013 depending on the study question \u2013 as either enrollment at the HIV clinic, starting HAART, or initial CD4 blood draw.All study subjects were adults of over 15 years of age. Pediatric patients were excluded from this analysis, as CD4 nurses were not authorized to screen this subset of the population.Study data were derived from existing databases that are maintained at each clinic site and include data routinely collected as part of patient care. These data include basic socio-demographic, clinical, laboratory and pharmacy information for all patients, including the dates of enrollment into the HIV clinic, the dates of all clinical appointments and CD4 tests and the dates of starting HAART.3) was used to determine if the intervention had the intended effect of limiting non-HAART eligible patient visits to MD/MOs. To calculate this indicator, we selected all adult patients who had initial visits with an MD/MO within 30 days of enrollment at the HIV clinic, and determined the proportion of these patients who were HAART-eligible at the time of their visit. Only patients newly enrolling in the HIV clinics were included in this analysis. Multivariate logistic regression was used to determine the effect of the intervention after adjusting for study month and site.For the first outcome, the proportion of first visits to MD/MOs made by HAART-eligible patients (those with CD4 counts lower than 200/mm3 or CD4 counts above 200/mm3) and whether a MD/MO visit was performed less than 30 days after enrollment. The sensitivity of appropriate referral was calculated among those with CD4 counts below 200/mm3 and specificity was calculated among those with CD4 counts that were above 200 or were unknown.We determined the sensitivity and specificity of appropriate referrals by nurses. Patients were categorized by their CD4 counts at their initial visit  hypothesized to potentially influence the rate of starting HAART. A multivariate Cox proportional hazards model was then created to estimate the independent effect of the CD4 nurse on the hazards of starting HAART after adjustment for study month and site.The final analysis determined whether the introduction of the CD4 nurse increased the monthly number of adult patients starting HAART. The outcome was the number of eligible patients started on HAART each month (count variable), compared before and after the intervention. We first evaluated the bivariate associations between the average number of patients starting HAART per month and the presence/absence of the CD4 nurse intervention using linear regression. We also evaluated the bivariate association between the number of patients starting HAART and the study month and site. We then used multivariate linear regression to determine the relationship between the number starting HAART and the presence or absence of the CD4 nurse after adjustment for both study site and study month. Given the time delay inherent in starting eligible patients on HAART, the intervention's effect on this outcome may not have been immediate.Covariates were considered based on their theoretical plausibility to affect the outcomes included in our analyses. On this basis four main variables were considered as covariates in adjusted analysis for each of the study questions, including the study site, the study month (a measure of the effect of time), the number of monthly MD/MO visits (a measure of MD/MO capacity), and the number of monthly new enrollees at the clinic (a measure of demand). However, we chose to include study month and study site in the final analyses since the number of monthly MD/MO visits and the number of monthly new enrollees did not improve model precision regarding the effect of the CD4 nurse. Study month was included to control for trends over time during the study period and was defined differently for each of the three analyses. For outcome 1 it was defined as the month of enrollment at the HIV clinic; in outcome 2 it was defined as month of initial CD4 blood draw; and in outcome 3 it was defined as month of HAART initiation. Interactions between the site and the CD4 nurse intervention and study month were also tested for each outcome.The study was approved by the institutional review boards of the National Health Institute, Maputo, Mozambique and the University of Washington, Seattle, USA. Data were analyzed using SPSS version 13.0  and EpiInfo6 .3 increased in both sites during the study period, although as a proportion of total enrollees this increase was only significant in Chimoio .Overall enrollment was generally higher in Beira and increased significantly over the study period Table . MD/MO S3 increased significantly between the before and after periods at both sites . Sensitivity decreased at both sites between the pre and post intervention periods . Of 3376 patients at both sites with initial CD4 counts under 200/mm3 or unknown, 2313 had no visit (specificity for appropriate visit = 0.69). Specificity increased at both sites over the study period, but the change was more dramatic in Beira (pre/post 0.62 vs. 0.87) than in Chimoio (pre/post 0.52 vs. 0.61).At both sites, 1551 new enrollees had initial CD4 counts under 200/mm3 during the study period, 911 (48.5%) started HAART by the end of December 2005 with a median time of 71 days from their initial CD4 test. In bivariate analyses, all predictors were significantly associated with starting HAART  patients that had medical visits lessened over the study period.In this study the CD4 nurse intervention was not positively associated with reduced time to HAART or increased number of adult patients starting HAART per month. However, our findings do suggest that the introduction of the CD4 nurse intervention, when implemented correctly, did increase the proportion of HAART-eligible patients seen by MD/MOs. While not affecting the other outcomes measured, the increased number of MD/MO appointments presumably improves the overall clinic flow and efficiency of these providers particularly where their availability is less. In addition, when sensitivity/specificity analyses were carried out we were able to conclude that the proportion of non-HAART eligible . The month-to-month random variation in outcomes due to these external factors may have obscured the impact of the intervention. In addition, the data demonstrate that the overall workload is increasing at both sites, as the proportion of visits with new patients reduces and providers are increasingly inundated with 'old' (previous) patients. With increasingly larger numbers of 'old patients' being seen, the rate of starting new patients on HAART (outcome 2) and the monthly mean number of new patients put on HAART (outcome 3) will slow down as the system becomes overburdened. One solution for this inundation will be the eventual opening of new treatment sites in the vicinity which will be able to absorb some of the overflow.Another important limitation of the study is due to differential implementation of the intervention itself. The results from the first outcome (the proportion of visits with HAART-eligible patients) suggest that the implementation of the intervention may have occurred differently at the two study sites. Discussions with clinic staff after the data analysis was completed revealed that the complete implementation of the intervention was delayed in Chimoio due to the absence of a key clinic advisor. This delay may explain the differences between the effect of the intervention in Chimoio and Beira.Also, additional steps that occur after patient staging and prior to HAART initiation may independently affect the study outcomes and were not considered for this study. These steps to initiate HAART include 1) attending several sequential visits with social workers and other care providers, 2) passing through adherence building interventions such as mandatory cotrimoxazole prophylaxis regimens, and 3) case review and approval by a multidisciplinary committee designed to improve coordination and quality assurance. Delays at any of these steps may mitigate the positive time gains resulting from the increased MD/MO availability due to the CD4 nurse intervention.Finally, having the nurse interpret CD4 results and stage patients only reduces visits to the MD/MO for patients with high CD4 counts. For patients with low CD4 counts the new system actually increases the number of patient visits, since the patient must return to the MD/MO and begin the further screening process. Therefore, a greater positive effect may only be seen to the extent that the patient population enrolls earlier on in their disease progression. As HAART continues to roll out in Mozambique and the health system matures, a greater proportion of earlier stage patients may enroll at treatment sites, which may allow for sicker patients to more rapidly receive care and treatment (through a more rapid movement from HIV care enrollment to HAART initiation).Further research is needed to address these aspects of the study and confirm the effect of the CD4 nurse intervention on clinic functioning and rate of HAART-eligible patients initiating treatment. Future studies of this type should be initiated only after the rate of starting patients on HAART is stable to more clearly differentiate the impact of the intervention from additional factors that may affect the study outcomes. In addition, implementing this study in sites with less MD/MO availability may be more able to demonstrate improved efficiencies related to the intervention. Future research should also endeavor to simultaneously improve training and ongoing supervision for new interventions like the CD4 nurse as well as quantify undefined system bottlenecks that contribute to significant delays in initiating HAART for eligible patients. Although many of these potential bottlenecks are designed to assure quality and coordination of the care team, and improve patient readiness for initiating HAART, they may have the unintended consequence of significantly delaying access to antiretroviral medicines.The author(s) declare that they have no competing interests.SOGS was responsible for the initial conception and design of the data, participated in the data analysis and drafted the original text. MAM participated in the data analysis and made significant comments on progressive drafts. MAM was supported in part through an STD/AIDS Research Training Grant at the time that this study was completed (NIH T32 AI 07140). KHGS participated in the design of the study and made significant comments on progressive drafts. KHGS is a Doris Duke Charitable Foundation (ORACTA) grant recipient. TK provided input on the design of the study and provided comments on progressive drafts of the manuscript. JPH and KKT provided critical input in the data analysis and both made substantive comments on progressive drafts. JP gave input on the development of the discussion section and helped in the revision of final drafts. SSG was instrumental in the initial design of the study question and provided input on subsequent drafts. All authors read and approved the final manuscript."}
+{"text": "A sizeable number of HIV-infected patients receiving HAART do not maintain prolonged virologic suppression. We evaluated long-term HIV viral load (VL) responses to HAART as a risk factor for AIDS events (AE) that is independent of CD4 responses.3 who had CD4 and VL measurements for > one year after receiving HAART at a university clinic were prospectively enrolled. Cox proportional multivariate regression model was used to determine whether CD4 and VL responses were independently associated with new AE.A cohort of patients with pre-therapy CD4 < 200/mm3, VL = 219,000 c/mL and follow-up duration 42.3 months (range 13\u201372 months). A new AE occurred in 56 patients; CD4 cell count response to HAART that remained < 200/mm3 throughout the study period was a significant risk factor for new AE . Similarly, VL responses that remained > 5,000 c/mL during this period was also a significant risk factor  that was independent of CD4 response adjusted for <> 200/mm3.The patient (N = 214) mean baseline CD4 = 92/mmMaintaining adequate long-term virologic responses to HAART provides a clinical benefit independent of CD4 responses. Further3 -14, the It is important to evaluate whether maintaining adequate responses to long-term HAART treatment has clinical significance for several reasons. First, evaluating whether long-term virologic response is an independent predictor of new AE has relevance for the sizeable number of patients receiving HAART who do not maintain prolonged virologic suppression -4,15. Al3 before initiating a HAART regimen. The study began on January 31, 1996; patients were enrolled into this prospective cohort from the time therapy was initiated if they received at least twelve months of HIV therapy and were followed to January 1, 2005. The definition of HAART for this study was guided by DHHS guidelines [We identified HIV-infected patients treated at the University of Michigan HIV/AIDS Treatment Clinic (UMHATC) who had a baseline CD4 cell count < 200 cells/mmidelines . PatientData on markers of response to HAART , as well as occurrence of a new AE (1993 CDC AIDS Surveillance definition) [To compare baseline characteristics between patients who developed an AE and those who did not, we used histograms to examine distributions of variables that were collected. Appropriate transformations were applied on variables found asymmetric in the following analysis. Baseline quantitative characteristics of patients  were described using mean and standard deviation, and qualitative characteristics  using proportion. A t test was used to compare quantitative characteristics between patients who developed an AE and those who did not. A Chi-square test was used to compare qualitative characteristics between groups.To determine probabilities of occurrence of a new AE from HAART initiation, we measured time to first AE and used Kaplan-Meier curves. To determine averaged VL trends after initiating HAART we used lowess smooth curves fitted to all patients, as well as to those who developed an AE and those who did not. We then determined VL values for the entire study period, as well as for four specified periods: 1\u201312 months, 13\u201324 months, 25\u201336 months and 37\u201348 months after initiating HAART.3) into separate categories to determine whether a particular VL category was independently associated with presence of a new AE. The relative risks of new AE for patients in specified VL categories were based on the fitted proportional hazard model and 95% confidence intervals were estimated. All statistical tests were two-sided, and a p-value less than 0.05 was considered statistically significant. Statistical software R 1.7.0 was used for all statistical analysis.To determine risk factors for developing a new AE, we used a Cox proportional hazard multivariate regression model. The proportional hazard assumption was then examined by plotting the complementary log-log transformation of the survival functions separately within subgroups. Pre-treatment factors that were examined as predictors for a new AE included demographic factors (e.g. age and gender), prior NRTI use, and presence of AE at baseline. For a given VL measurement at a particular time point after initiation of HAART, persons were considered at risk for newly diagnosed AE for 1\u20136 months after the time the measurement was made. For each time period, we classified VL responses to HAART  were included in the analysis. Table Mycobacterium avium complex (MAC) infection (13 patients), Pneumocystis jiraveci pneumonia , Kaposi's sarcoma (6), candida esophagitis and non Hodgkin's lymphoma (5 each) were the most common AEs. Three of these AEs represented a recurrence of an AE that was present at baseline prior to initiating HAART: PcP (1 patient), MAC (1) and CE (1). 77% of patients in whom MAC was diagnosed were receiving prophylaxis with a macrolide agent, and 88% of those with PcP were receiving pneumocystis prophylaxis. Others included mycobacterial and cryptococcal infections (4 patients each), progressive multifocal leukoencephalopathy and cryptosporidiosis (3 each), HIV encephalopathy and recurrent bacterial infections (2 each), and chronic Herpes simplex infections and histoplasmosis (1 each).Fifty-six of the 214 patients (26%) developed a new AE; the mean time from HAART initiation to AE was 26.5 \u00b1 21.2 (range 1 \u2013 84 months). Four patients, all of whom had experienced a new AE, died during the study period. Figure 3 in a significantly higher proportion of patients with a new AE, 85% (48/56 patients), than those without an AE, 8% (13/158 patients) (p < 0.001). Table 3 was a significant risk factor for developing new AE for each 12 month interval after initiating HAART .Figure 3, a VL response > 5,000 c/mL was a significant risk factor for developing a first new AE for each 12 month interval after initiating HAART   declare that they have no competing interests.PK was responsible for study design, data collection, data analysis, and preparation of manuscript.KA participated in data collection and data analysis.MB participated in statistical design and analysisWW participated in statistical design, statistical analysis, and preparation of the manuscript."}
+{"text": "The clinical data of plasma NVP level, safety and efficacy of antiretroviral therapy (ART) for the concurrent use of nevirapine (NVP)-based ART and fluconazole (FLU) is scanty.A retrospective study was conducted in patients who were initiated NVP-based ART between October 2004 and November 2005. The objectives were to compare NVP levels, adverse events, and 36-week efficacy of NVP-based ART between patients who did not receive FLU (group A) and those who received FLU 200 mg/day or 400 mg/day (group B).3 in group A and 19 (8\u201333) cell/mm3 in group B (P = 0.102). Baseline characteristics between the two groups were similar. Mean \u00b1 SD NVP levels were 6.5 \u00b1 3.0 mg/L in group A and 11.4 \u00b1 6.1 mg/L in group B(P < 0.001). One (2.4%) patient in group B developed clinical hepatitis (P = 0.336). Six (7.4%) patients in group A developed NVP-related skin rashes (P = 0.096). There were no differences in term of 36-week antiviral efficacy between the two groups (P > 0.05).There were 122 patients with mean \u00b1 SD age of 36 \u00b1 9 years; 81 in group A and 41 in group B. Median (IQR) baseline CD4 cell count was 29 (8\u201379) cell/mmCo-administration of NVP and daily dosage of FLU (200 mg/day and 400 mg/day) results in markedly increased trough plasma NVP level when compared to the administration of NVP alone. The concurrent use of NVP and FLU in very advanced HIV-infected patients is well-tolerated. The immunological and virological responses are favorable. Cryptococcal meningitis has been a leading cause of mortality and morbidity among AIDS patients particularly in developing countries . Before 3 [Cryptococcal meningitis is a major opportunistic infection in HIV-infected patients, especially those who had CD4 count of less than 100 cells/mm3 . Current3 . After c3 -10. In a3 .Regarding ART, nevirapine (NVP)-based ART is an alternative non-nucleoside reverse transcriptase inhibitor (NNRTI)-based ART ,13. The Nonetheless, the potential drug-drug interaction between NVP and FLU is a major concern. NVP induces cytochrome P450 isoenzymes in the liver while FLU inhibit the activity of this enzyme -22. A prA retrospective study was conducted among antiretroviral-na\u00efve HIV-infected patients who were initiated NVP-based ART with a fixed-dose combination of d4T, 3TC and NVP 200 mg (GPO-VIR) between October 2004 and November 2005 at Bamrasnaradura Infectious Diseases Institute, Ministry of Public Health, Nonthaburi, Thailand. The clinical data were retrospectively reviewed and retrieved from case records. Inclusion criteria were as follows: (1) HIV-infected patients >15 years of age, (2) na\u00efve to antiretroviral therapy, (3) were initiated with a NVP-based ART regimen, (4) used NVP 200-mg once-daily lead-in dose during the first 2 weeks, prior to escalation to 200 mg twice daily i.e. patients received a fixed-dose combination tablet in the morning time and then received separate tablet of d4T and 3TC in the evening at 12 hours apart.The patients were excluded if baseline creatinine level was higher than 2.0 mg/ml; baseline liver aminotransferase enzyme was higher than five times of upper normal limit, or receiving a medication that has drug-drug interactions with NVP or FLU, or FLU dosage was changed during the first six weeks of antiretroviral treatment. Each eligible patient was categorized into one of the two groups according to whether the patient received FLU or not as follows: did not receive FLU (group A) or received FLU 200 mg/day or 400 mg/day (group B). The trough plasma NVP levels were performed after six weeks of NVP-based ART. All patients in group B did not have the dosages of FLU changed before measurement of NVP level. Liver enzymes were monitored at 12 weeks of ART and when patients developed clinical signs and symptoms suggested for clinical hepatitis.Regarding treatment of cryptococcosis, patients received an 8-week induction of FLU 400 mg/day after 2-week amphotericin B; and followed with FLU 200 mg/day for maintenance treatment. The patients in group B who were initiated NVP-based ART while receiving 400 mg/day had trough plasma NVP levels performed before FLU dose reduction. The others who were initiated NVP-ART while receiving FLU 200 mg/day had received both drug through the end of the study. All patients were followed for 36 weeks after initiating NVP-based ART.The primary objective was to compare the mean trough plasma NVP levels between the two groups. The secondary objectives of interest were as follows: 1) to compare the frequencies of clinical hepatitis, skin rashes and elevated liver function test including alkaline phosphatase (ALP), aspatate aminotransferase (AST), alanine aminotransferase (ALT) and total bilirubin at three months after initiation of NVP-based ART and 2) to compare immunological and virological response between the two groups.Blood samples for NVP level were obtained 12 hours (by patients observed taking dosing) after drug administration to analyze NVP levels at the HIV Netherlands-Australia-Thailand (HIV-NAT) Research Pharmacokinetic Laboratory located at Chulalongkorn Medical Research Center (Chula MRC) by high performance liquid chromatography (HPLC) assay. The assay was developed in Department of Clinical Pharmacology at the University Medical Centre Nijmegen, the Netherlands. The HPLC system consisted of a model P4000 solvent delivery pump, a model AS3000 autosampler, a model UV2000 programmable UV detector wavelength 251 nm and the computing integrator for HPLC model SN4000 system. The units were all from Thermo Finnigan . The analytic column was an Omnisher 5 C18 column  protected by a Chromguard RP column \u2013 both of which were from Varian . Analytic column runs were processed by Millennium32 software from Water . The NVP retention time was 1.8 minutes. The NVP calibration curve was linear over a range of 0.055 to 15.700 mg/l. The lower limit of quantification for NVP was 0.05 mg/l. Recovery after extraction from plasma was 101.8 \u00b1 4.6%. Accuracy in plasma ranged from 102% at 0.083 mg/L, 101% at 0.829 mg/l and 103% at 4.149 mg/l (n = 15). Within-day precisions ranged from 6.40% at 0.083 mg/l, 4.97% AT 0.830 mg/l and 2.69% at 4.149 mg/l. Between-day precisions ranged from 3.65% at 0.083 mg/l, 0% at 0.830 mg/L and 0% at 4.149 mg/l.P value less than 0.05 was considered statistically significant. The study was approved by the ethical review board of the institute.Mean , median  and frequencies (%) were used to describe patients' characteristics in each treatment groups. Chi-square test and Mann-Whitney test were used to compare categorical and continuous variables respectively between the two treatment groups. Paired T-test was used to compare liver function test between baseline and three months after initiating NVP. All analyses were performed using SPSS program version 11.5. A There were 199 patients who were initiated NVP-based ART during the period of study. Among these patients, 72 cases and 5 cases were excluded from the study due to receiving medications that have drug-drug interactions and having high baseline liver transaminase enzymes, respectively. A total of 122 patients with a mean \u00b1 SD age of 36 \u00b1 9 years and 55% male were eligible and included in the study. Of 122 patients, 81 and 41 patients were classified into group A and B, respectively. The patients' baseline characteristics between the two groups are shown in Table P < 0.001). Of 41 patients in group B, 14 patients were receiving FLU 200 mg/day and 27 patients were receiving FLU 400 mg/day when NVP levels were performed. Mean trough NVP level was 9.8 \u00b1 4.3 mg/l in the patients receiving FLU 200 mg/day and 12.2 \u00b1 6.8 mg/l in the patients receiving FLU 400 mg/day (P = 0.255). Mean trough plasma NVP level in group A was also significantly lower than that in each subset of group B patients (P < 0.001).The distributions of trough plasma NVP levels are shown in Figure P = 0.073). The causes of death among 7 patients were not related to the adverse events. All causes of death were related to opportunistic infections or HIV infection, including cerebral toxoplasmosis, Mycobacterium avium complex infection, CMV radiculomyelitis, sepsis and wasting syndrome.Seventy patients in group A  and 33 patients in group B  continue to follow-up until 36 weeks of ART. There was a higher tendency of drug discontinuation from all causes in group B (P = 0.549). Group A patients had median CD4 cell counts of 104, 152 and 192 cells/mm3 at week 12, 24 and 36, respectively. Group B patients had median CD4 cell counts of 94, 119 and 161 cells/mm3 at the corresponding periods. There was no difference of CD4 change from week 0 to week 36 between the two groups (P = 0.869). Median (IQR) CD4 cell count changes at 36 weeks from baseline were 155 \u00b1 95 cells/mm3 in group A and 152 \u00b1 134 cells/mm3 in group B (P = 0.869).CD4 cell count and plasma HIV RNA were not performed in 7 patients (3 in group A and 4 patients in group B). Therefore, 67 patients in group A and 29 patients in group B were evaluated for virological and immunological response by on-treatment analysis. After 36 weeks of ART, 61 of 67 (91.04%) patients in group A and 26 of 29 (89.66%) in group B achieved undetectable plasma HIV RNA (P > 0.05). By repeated measurement analysis, ALP and ALT levels after 12 weeks of NVP-based ART were not different from baseline in both groups (P > 0.05). The frequencies of adverse events including clinical hepatitis and skin rashes are shown in Table Liver enzymes at 12 weeks of ART between the two groups are shown in Table 3 and plasma NVP level of 10.2 mg/l. He developed symptoms of nausea and vomiting after five weeks of NVP. Liver function test showed combined cholestasis and hepatotoxicity. The other potential causes of hepatitis were excluded. Serology of hepatitis B virus and hepatitis C virus were negative. NVP, d4T and 3TC were discontinued; clinical symptoms and liver function test results turn to be normal within three weeks. d4T, lamivudine and efavirenz were then prescribed. He could tolerate this second regimen well.A 31-year old male in group B who developed clinical hepatitis had a baseline CD4 cell count of 17 cells/mmIn the present study, we demonstrate that co-administration of NVP and daily dosage of FLU (200 mg/day and 400 mg/day) results in markedly increased trough plasma NVP level when compared to the administration of NVP alone. From the MEDLINE database, the present study is the first study to date documenting plasma NVP levels among advanced HIV-infected patients who concurrently received NVP and FLU versus those who did not received FLU.As we know that cryptococcosis occurs in advanced HIV-infected patients who are vulnerable to other opportunistic infections. ART should not be delayed when cryptococcal diseases are improved. NVP-based ART is most affordable ART regimen in resource-limiting countries. Some physicians may somewhat reluctant to initiate NVP-based ART while the patients are receiving FLU for treatment or prophylaxis of cryptococcosis. Deference of ART may increase the risk of disease progression and intervening opportunistic infections. From these reasons, we attempted to determine the plasma NVP levels and adverse events while the patients were concurrently receiving FLU.3 who received FLU 200 mg/day [The plasma half-life of either FLU or NVP are approximately 30 hours after oral administration . The ste0 mg/day . Seventy0 mg/day . In addiLiver toxicity is an important complication among HIV-infected patients who receive NVP-based ART. This drug can increase potential for liver toxicity through either hypersensitivity reaction during the early period of ART or dose-dependent effect . The res3. In a published analysis of NVP-associated hepatotoxicity, sex-dependent CD4 cell count was found to be predictive of hepatitis [A previous study indicated that when the higher plasma NVP level is achieved, the higher frequency of adverse events occurred . Howeverepatitis . High CDepatitis . Thus, cRegarding NVP-associated skin rashes, there was a trend toward higher prevalence of skin rashes in the patients who received NVP-based ART alone than another group. This may be explained by the random variation of the study. Notably, although the patients in group B had significantly higher plasma NVP levels, they had a low rate of skin rashes. Thus, NVP level is not a predictive factor for this adverse event that correspond to the previous study . To dateP = 0.549). In addition, CD4 cell counts change at week 36 from baseline value was not different (P = 0.869), CD4 cell count at week 36 was significantly higher than at baseline value (P < 0.001), Therefore, NVP-based ART showed effective antiviral efficacy among very advanced HIV-infected patients in both study groups. This result corresponds to the previous studies that conducted in Thais [Regarding antiviral efficacy, there was no difference in term of virological outcome between the two treatment groups after 36 weeks of ART  declare that they have no competing interests.WM participated in the design of the study, performed statistical analysis and draft the manuscript. CA participated in the design of the study. SU participated in the design of the study. TP participated in the design of the study. SS participated in the design of the study and helped to draft the manuscript. All authors read and approved the final manuscript.The pre-publication history for this paper can be accessed here:"}
+{"text": "Co-infection with hepatitis B virus (HBV) and human immunodeficiency virus (HIV) is not infrequent as both share same route of exposure. The risk of developing chronic hepatitis B virus is 6%, in general population but can reach 10\u201320% in HBV/HIV co-infected patients. When compared to general population, the response rate to HBV vaccine in HIV-infected patients is diminished, so previous studies have tried to improve this response using variety of schedules, doses and co-administration of immunomodulators. The purpose of this study was to evaluate two doses of recombinant HBV vaccine (10 or 40 \u03bcg), IM at 0, 1 and 6 months. Vaccination response was measured 30\u201350 days after last dose; titers of >9.9 IU/L were considered positive.4 count <200 cel/mm3 were significantly associated with non serologic response (p = 0.003). None other variables such as gender, age, risk exposure for HIV, viral load, type or duration of HAART or AIDS-defining illness, were asociated with seroconversion.Seventy-nine patients were included, 48 patients (60.7%) serconverted. Thirty-nine patients (49.3%) received 10 \u03bcg vaccine dose, 24 patients (61.5%) seroconverted. Forty patients (50.7%) received 40 \u03bcg vaccine dose, 24 (60%) seroconverted. There were no differences between two doses. A statistically significant higher seroconversion rate was found for patients with CD4 cell counts at vaccination \u2265 200 cel/mm3 , compared with those with CD4 < 200 cel/mm3 , , there were no differences between two vaccine doses. Using the logistic regression model, CD3, we suggest this threshold at which HIV patients should be vaccinated.In this study, an increase dose of HBV vaccine did not show to increase the rate of response in HIV infected subjects. The only significant findings associated to the response rate was that a CD4 count \u2265 200 cel/mm Hepatitis B virus (HBV) is one of the major causes of acute and chronic hepatitis worldwide that can be prevented by immunization ,2.Co-infection with HVB and human immunodeficiency virus (HIV) is frequent as both share the same routes of transmission . In geneWhen compared to general population, the response rate to HBV vaccine in HIV-infected patients, is diminished (40\u201360% vs 60\u201380%) ,13. ThisIn previous studies including patients under hemodialysis, the rate of response to HBV vaccine has been significantly augmented by increasing dose, giving a fourth dose of the vaccine or using immunomodulators agents such as levamisole ,16. In H4 counts at the time of vaccination.Currently, there are no data to determine the best HBV vaccine schedule for HIV-infected patients. With the aim to evaluate the rate of response to two different concentration of HBV vaccine in HIV-infected patients, we conducted a controlled, randomized, clinical trial. We also evaluated HIV viral load and CDRecombivax, HB, Merck, Sharp &Dohme, USA), in two groups of HIV-infected patients stratified by CD4 count at time of vaccination (< 200 or \u2265 200 cel/mm3) attending an HIV/AIDS Clinic at the Instituto Nacional de Ciencias M\u00e9dicas y de la Nutrici\u00f3n Salvador Zubir\u00e1n and at the Instituto Nacional de Cancerolog\u00eda in Mexico City. The study was reviewed and approved by the Institutional Committee of Human Biomedical Investigation .We conducted a double blind, randomized, controlled trial using two different concentrations of HBV vaccine 10 or 40 \u03bcgs  under antiretroviral treatment and AIDS-defining event.A technician who ignored vaccine dose, administered the vaccine and collected a serum sample 40 \u00b1 10 days after third-dose application.\u00ae Anti-HBs New, Organon Tecknika, The Netherlands) was performed. Negative samples for quality assurance were included. All sera were tested simultaneously. Response to vaccination was considered when there was a rise in anti-HBs titers \u2265 10 IU/L. The absolute count of CD4 lymphocytes was determined by a fuorescence-activate cell analyzer, using monoclonal antibodies. The quantization of HIV-1 RNA was measured by AMPLICOR HIV-1 MONITOR\u00ae test was from 40 to 750,000 RNA copies/mL.Quantitative anti-HBs test by IU/L  with 95% confidence interval (95% CI). P values \u2264 0.05 were considered statistically significant.We calculated seroconversion rate for each vaccine dose by mean \u00b1 standard deviation for Student Univariate analysis was used to test for associations between independent  and dependent variable (seroconversion). A logistic regression model and a Cox model were performed.Patients were recruited between April 1999 and May 2000. Eighty four patients were included. Five (6%) were lost during follow-up [two (2.4%) in 10 \u03bcg dose and three (3.6%) in 40 \u03bcg dose]. Characteristics of subjects who completed the study and those who dropped out were similar.Non significant differences were found among demographic variables between the two groups. Age, gender, CD4 count at vaccination, HIV viral load, history of an AIDS defining event and antiretroviral therapy for each group are depicted in Table The overall seroconversion rate after HBV vaccination was 60.7% (48 of 79 patients). For 10 \u03bcg vaccine dose, 24 of 39 patients (61.5%) seroconvert; and for 40 \u03bcg vaccine dose, 24 of 40 patients (60%). Non significant difference was found between two different vaccine concentrations .Stratified by CD4 count, 33 of 38 patients (86.8%) with CD4 \u2265 200 cel/mm3 seroconverted, compared with 15 of 41 patients with < 200 cel/mm3 (36.5%), . Stratified by viral load, 12 of 15 patients with < 400 copies/mL seroconverted (80%), and 30 of 51 patients with \u2265 400 copies/mL (58.8%), .Patients with CD4 < 200 cel/mm3 and viral load < 400 copies/mL, showed higher seroconversion rates, but only CD4 count was statistically significant. No diference was observed with two different vaccine doses.Variables included in the logistic regression model were vaccine dose, CD4 count, viral load, HAART treatment, AIDS-defining illness, gender and risk factor for HIV infection. Only CD4 count <200 cel/mm3 was associated with non seroconversion.3 compared with those with CD4 < 200 cel/mm3 .Mean anti-HBs titers were 137.3 \u00b1 56.7IU/L for the 10 \u03bcg vaccine dose and 144.1 IU/L \u00b1 56.7 for the 40 \u03bcg vaccine dose (p=ns). Titers post-vaccination are shown in Figure HBV vaccine was well tolerated by all patients; two patients reported pain at the injection site, one with erythema. No serious adverse events were registered.Approximately 90\u201397% of healthy adults will show protective anti-HBs titers after vaccination with recombinant HBV vaccine ,19. As p4 count <200 cel/mm3. Previous studies with other antigens  have shown lesser response asocciated with lower CD4 counts [Risk factors significantly associated to failure of vaccination in previously reports, were the degree of immunosuppression and clinical markers of advanced HIV disease like CD4 count at vaccination and history of an AIDS-defining event. We found that the factor most strongly associated with non seroconversion and lower anti-HBs titers was CD4 counts ,15.3 and low HIV viremia, with no differences between two different vaccine doses in patients with CD4 < 350 cel/mm3 [There are numerous reports describing a variety of dose schedules, limited success and markers associated with impaired response to HBV vaccine in these individuals. Most studies have been small in size sample making it difficult to draw conclusions within and between studies. Recently Fonseca et al, found higher serconversion with double vaccine dose in those patients with CD4 count \u2265 350 cel/mm cel/mm3 .3) of patients whose CD4 increase with HAART over \u2265 200 had a similar rate of response when compared to patients with persistent CD4\u2265 200 cel/mm3(data not presented); this finding should be interpreted with caution, it could be related to the small sample size. One interesting point is to investigate in the future the duration of this increase to achieve best rate of response in HIV-infected patients receiving HAART.This study was performed with a smaller sample that initially calculated as we found trouble in getting non vaccinated or non infected HBV patients. Because of the small size, the power to determine differences between the two dosages of vaccine is low resulting in the possibility of a type II error. We found that the CD4 nadir  declare that they have no competing interests.PCJ- Participated in the design of the study, collected data, wrote the manuscriptPVF- Revising the manuscript, statistical analysisKEL- Carried out immunoassaysDVC- Statistical analysis and revising the manuscriptGRP- Revising the manuscript critically for important intellectual contentLESR- Analysis and interpretation of data, revising the manuscript critically for important intellectual contentAll authors read and approved the final manuscript."}
+{"text": "Presentation with simultaneous bilateral pneumothorax is uncommon and usually in the context of secondary spontaneous pneumothorax. The association of pneumothorax and silicosis is infrequent and most cases are unilateral. Bilateral pneumothorax in silicosis is very rare with just a few reports in medical literature. Involvement of pleura in silicosis is rare and secondary spontaneous pneumothorax (SSP) is the only recognized pleural complication of silicosis. SSP occurs late in the course of disease and may prove a fatal complication along with underlying grossly compromised pulmonary function. SSP is uncommon with acute and accelerated silicosis. The inci23, Polymorphs \u2013 75 %, Lymphocytes \u2013 24 %, Eosinophills \u2013 1 %. Patient was non reactive for serum HIV. Chest radiograph showed bilateral diffuse reticulonodular shadows with bilateral pneumothorax [2O; he improved clinically. Computerized tomography, planned to rule out any other underlying comorbid condition, revealed bilateral well defined nodular masses particularly in upper lung field with bilateral pneumothorax [A 24-year-old male presented with acute breathlessness, bilateral chest pain and dry cough of two days duration. He complained of progressive exertional dysponea for last three years. Occupational history revealed that he had been working in the stone cutting industry for four years with an exposure to stone dust six hours a day. There was no history of haemoptysis, fever, skin rashes and joint pain. The patient was non-smoker. There was no history of contact with tuberculosis or antitubercular treatment. On examination, breath sounds were decreased in the upper chest areas with hyperresonant note and fine crepitations bilaterally. Laboratory findings were as follows Hb-12 gm%, total Leucocyte -1200 mmmothorax . As patimothorax . Sputum mothorax . Follow-The occurrence of occupational lung disease is decreasing due to improvement in occupational health in recent years, however, silicosis and its complications remain important occupational health problems. SilicosiDepending upon the intensity and duration of exposure, inhaled silica evokes three different types of reactions. The firsComplications which occur in silicosis include lung infection, lung cancer, spontaneous pneumothorax and broncholithiasis. Crystalline silica, alpha quartz, less than 1\u00b5m in diameter is believed to be the most deadly pathogen. Aerodyna3Secondary spontaneous pneumothorax (SSP) is a rare complication in the course of silicosis and usually unilateral. SSP is s2The predictive factors for development of SSP in patients with silicosis have not been extensively described in literature. In one study a strong association was found between the occurrence of SSP and presence of bullae. Silicosis is also associated with emphysematous changes in lungs, independent of smoking. In advanced silicosis coalescence of perinodular emphysematous regions may lead to formation of macroscopic blebs which rupture causing pneumothorax.Among the infections, tuberculosis is an important consideration in diagnosis and management of silicosis. It significantly contributes to the morbidity and mortality of patients with silicosis. The life time risk of tuberculosis is about 20\u201325% in patients of silicosis. Free silica impairs macrophage and microphage functions leading to increased chances of mycobacterial infections. It may also contribute to the development of progressive massive fibrosis in patients of silicosis. Because of strong association between silicosis and tuberculosis concurrent tubercular infection should be considered in patients with silicosis with relatively rapid clinical deterioration. The diagnosis of active tuberculosis in patient with silicosis demands high degree of clinical suspicion. Positive tuberculin test and cavitatory nodule are usually indicative of tuberculosis. CT scan of chest is also helpful in detection of concurrent tubercular infection. The treatment for concurrent tubercular infection in patients of silicosis requires prolonged duration.58Nowadays, the diagnosis of silicosis is presumptive and based on combination of typical radiological features in chest radiograph, CT of thorax and occupational exposure followed by suitable latency period. The invasive procedures such as lung biopsy are taken only to exclude malignancy, rheumatoid nodules or infection.The cause of pneumothorax in our case was probably due to rupture of bleb, as there was no evidence of infection particularly tubercular. High degree of clinical suspicion in patients of silicosis when presenting with dysponea of acute onset should be investigated for this complication. The time of presentation and intervention may greatly reduce the morbidity and mortality and help patients lead purposeful and productive lives."}
+{"text": "Poor adherence to highly active antiretroviral therapy (HAART) may result in treatment failure and death. Most reports of the effect of adherence to HAART on mortality come from studies where special efforts are made to provide HAART under ideal conditions. However, there are few reports of the impact of non-adherence to HAART on mortality from community HIV/AIDS treatment and care programmes in developing countries. We therefore conducted a study to assess the effect of adherence to HAART on survival in The AIDS Support Organization (TASO) community HAART programme in Kampala, Uganda.3. Kaplan Meier curves and Cox proportional hazards regression models were used in the analysis.The study was a retrospective cohort of 897 patients who initiated HAART at TASO clinic, Kampala, between May 2004 and December 2006. A total of 7,856 adherence assessments were performed on the data. Adherence was assessed using a combination of self-report and pill count methods. Patients who took \u2264 95% of their regimens were classified as non-adherent. The data was stratified at a CD4 count of 50 cells/mm3 had a higher mortality  compared to patients with a CD4 count equal to or greater than 50 cells/mm3 .A total of 701 (78.2%) patients had a mean adherence to ART of > 95%. The crude death rate was 12.2 deaths per 100 patient-years, with a rate of 42.5 deaths per 100 patient-years for non-adherent patients and 6.1 deaths per 100 patient-years for adherent patients. Non-adherence to ART was significantly associated with mortality. Patients with a CD4 count of less than 50 cells/mmOur study showed that good adherence and improved survival are feasible in community HIV/AIDS programmes such as that of TASO, Uganda. However, there is need to support community HAART programmes to overcome the challenges of funding to provide sustainable supplies particularly of antiretroviral drugs; provision of high quality clinical and laboratory support; and achieving a balance between expansion and quality of services. Measures for the early identification and treatment of HIV infected people including home-based VCT and HAART should be strengthened. The introduction of HAART has greatly improved the survival of HIV/AIDS infected people. HAART reduces morbidity and mortality by suppression of viral replication, restoration and preservation of immune function, and prevention of drug resistance -4. MortaAdherence to HAART is critical to the survival of HIV/AIDS infected people. A pooled analysis of North American studies reported adherence of 55% (95% CI 49%\u201362%) while for African studies adherence was 77% (95% CI 68%\u201385%). Non adhGiven this complexity, the effect of adherence to HAART on survival has been reported mainly in clinical trials or other controlled environments ,3,12,16.3; WHO stage 3 or 4 disease; or a history of recurrent herpes zoster [The study was carried out in The AIDS Support Organization (TASO) Mulago clinic Kampala, Uganda. HIV/AIDS patients are identified through voluntary counselling and testing, and registered at TASO if found to be HIV positive. The criteria for HAART entry are: a CD4 cell count below 200 cells/mms zoster . Before There are routine clinic visits after enrolment when HAART drugs are dispensed and adherence assessed: at two weeks; two months; and thereafter at six months. The distribution of follow-ups depends on the patient's performance in terms of improvement and adherence exhibited. The follow-ups are carried out by trained and experienced counsellors and field staff. TASO provides medical care through its clinics which are held twice a week. Pill count adherence is monitored by asking patients to retain any missed doses in their pill boxes, and pill boxes are checked when medicines are re-filled by the home visitors for patients on the home care programme and at the clinic for patients on the facility based treatment and care programme. Adherence is assessed as pill count (PCA) which is the number of pills actually taken as a percentage of the number of pills delivered for the home based treatment programme or dispensed for the facility based programme. Self reported adherence measurement technique is used by asking the patients the number of times they have missed taking their pills. The adherence levels from the two measures are compared. The higher level is recorded as the patient's adherence level for that assessment and the lower level, if less or equal to 95%, forms the basis for the patient's follow up for adherence support through adherence counselling.All HIV/AIDS patients at TASO Mulago clinic, who were aged at least 15 years, initiated antiretroviral treatment in the period from May 2004 to December 2005, and whose records were readily available, were included in this analysis. We used combined inferences from multiple imputations to impute for the missing data in the important variables of study interest. The mean adherence to HAART for each eligible record was computed and the records were divided into two categories: adherent (average adherence greater than 95%) and non-adherent (\u2264 95% adherence). Death was confirmed from death notification filled by the TASO medical team. Analysis was based on all-cause mortality.Data was cleaned and coded using STATA release 9.0 . Background characteristics between adherent and non-adherent patients were compared by logistic regression. The outcome of interest was survival time as measured from the date of HAART initiation to the reported date of death for patients who died, or the date of the last recorded visit for patients who were censored. Kaplan Meier plots, and log rank tests were used to illustrate survival in different groups. Cox proportional hazards regression models were used to investigate factors associated with survival. Interactions between factors were also investigated. Age, sex and predictor variables found to be significant (p < 0.05) in univariable analyses were considered as candidate regressors in the Cox models. The proportional hazards assumption was tested using Schoenfeld residuals.The study was approved by Makerere University Clinical Epidemiology Unit (CEU), Makerere University Faculty of Medicine Research and Ethics Committee, The AIDS Support Organisation (TASO) Research and Ethics Committee, and the Uganda National Council for Science and Technology.The funding sources had no role in the design, conduct, or reporting of the study findings or the decision to submit the manuscript for publication.A total of 897 patients were eligible for the study and 7,856 adherence assessments were reviewed. Of these assessments, 6,527 (83%) recorded adherence > 95%. Out of the 897 patients studied, 196 (21.9%) patients had a mean adherence of 95% or less, and 701 (78.2%) patients had overall mean adherence of greater than 95% (Table 3 or more. Most patients (96.5%) had been married while 82.5% had attained at least primary education.The majority of the patients were females (75.3%), reflecting TASO's patient distribution ratio of males to females of approximately 1:3 Table . The meaThe total patient-time contributed was 1,343.4 patient-years. During the study period, 164 patients (18.3%) died giving a crude death rate of 12.2 per 100 patient-years  , and those with >95% adherence . Kaplan Meier survival curves are shown for the significant variables  Table .Our study showed that the majority of the patients attending TASO Mulago clinic, Kampala, had good adherence to HAART with 78.2% of the patients achieving a mean adherence of greater than 95%. Comparison of adherence to HAART between studies is fraught with many obstacles including differences in study population and design, definition and measurement of adherence, as well as differences in sample size and type of HAART. Nevertheless, the adherence rate in our study was similar to that reported in previous studies in sub-Saharan Africa . The hig3 the patients in our study were initiated late on HAART (<200 cells/mm3), though it is the policy of Ministry of Health. This late initiation on HAART may have increased the mortality in our study. We also excluded participants who had been on HAART for less than one year in an effort to capture mortality that occurred only after HAART was deemed to be effective. By so doing however we may have inadvertently excluded early mortality and yet several studies have reported that mortality among HAART patients is greatest in the first three months of treatment [The overall mortality was 12 per 100 person-years but the estimate may have been affected by four major factors. Compared to settings where HAART is initiated at CD4 counts of <350 cells/mmIn our study, there were difficulties in ascertaining the cause of death. The cause of death was determined by the TASO medical team and was mostly in the form of verbal autopsy which classifies deaths in broad categories but does not permit assignment of a specific cause of death . Thus thNon-adherent participants had a mortality of 42.5 deaths per 100 person-years and, after adjusting for age, sex and education level, were two times as likely to die as adherent participants. These findings are consistent with other studies that have reported that non-adherence is associated with increased mortality ,27,29. N3 non-adherence increased the risk of mortality four fold, whereas in patients with a CD4 count of 50 cells/mm3 or above at baseline, non-adherence doubled the risk of mortality. Previous studies have reported that CD4 counts at the initiation of HAART independently modify survival with decrease in CD4 count being associated with increased mortality [In our study we found overwhelming evidence of a statistical interaction between baseline CD4 count and non-adherence i.e. baseline CD4 count modified the effect of non-adherence. In patients with a CD4 count <50 cells/mmortality ,12,27. AThe findings of this analysis have important policy implications particularly for HAART programmes in developing countries. Our study has shown that good adherence to HAART and improved HIV survival are feasible in a community HIV/AIDS treatment and care programme. Uganda, like many developing countries, has limited capacity to provide HAART through the government health care system. Accordingly, there is increasing need to provide HAART through non governmental programmes including home or community care programmes. As of June 2007, of the more than 100,000 people in Uganda taking HAART, 14% received their drugs through home or community care programmes, mostly through TASO.The success of the TASO community HAART programme can be attributed to a number of factors including the personalized patient-centred approach; the continuity of care and follow up through home visits; total patient and family care and support; and free access to services. These factors have contributed to the high adherence rates in TASO that are critical for improved survival of HIV infected people. The major challenges of the TASO community HAART programme include the provision of high quality clinical and laboratory services (e.g. CD4 cell counts) to support HAART; funding to provide sustainable provision of antiretroviral drugs and other supplies; and the need to balance the expansion of the TASO community HAART programme to meet increasing demand without losing the personal touch that has over the years ensured the quality of services and success of TASO.Our study highlighted the poorer outcomes in HIV infected people with low CD4 counts and echoes the need to identify and treat eligible HIV infected people early and for intensive adherence interventions to target HIV-1 infected patients with the lowest CD4 counts . The homThe principal limitation of our study was the study design. The study was a retrospective cohort, and therefore we did not control for all the potential confounders that could confound the association between non-adherence to antiretroviral therapy and patients' survival, such as viral load and opportunistic infections at initiation of HAART. Viral loads were not recorded by TASO, while there was no precise information on opportunistic infections at the time of initiation of antiretroviral therapy. This situation may have resulted in an under or over estimate of the association between non adherence and survival. However, random error was unlikely to have biased our findings because the study needed to observe 121 deaths to show a significant effect in survival but we observed 164 deaths.The measurement and definition of adherence to antiretroviral therapy may have introduced bias. There is no gold standard for measuring adherence to antiretroviral therapy . The appIn our study, the adherence assessments for non-adherent and adherent patients were unequal. One interpretation of this finding is that unequal assessment of adherence between the adherent and the non adherent patients may have introduced bias in our estimates. However, an alternative and more plausible explanation is that differences in adherence levels between patients especially in the clinic-based programme may instead have lead to differences in adherence assessments between the adherent and non adherent patients since the adherence assessments were based on patient visits to the TASO clinic. The type of regimen patients were taking could have had an impact on their survival and hence distorted our estimates. As already mentioned, we could not control for the type of regimen patients were taking. While our findings may have been affected by such factors, we believe that our overall conclusions are robust.In conclusion, our study showed that good adherence to HAART and improved survival are feasible in community HIV/AIDS treatment and care programmes such as that of TASO, Uganda. However, there is need to support community HIV/AIDS HAART programmes to overcome the challenges of funding to provide sustainable supplies particularly of antiretroviral drugs; provision of high quality clinical and laboratory support; and achieving a balance between expansion and maintenance of quality of services. Measures for early identification and treatment of HIV infected people including home-based VCT and HAART should be strengthened.The authors declare that they have no competing interests.AMA participated in the conception, design, and implementation of the study, statistical analysis, interpretation and drafting of manuscript. JNK and JT participated in study design, statistical analysis, interpretation and drafting of manuscript. JL participated in the statistical analysis and interpretation of the study. KE participated in the design, statistical analysis and interpretation of the study. EO participated in the conception, design, and interpretation of the study. CASK participated in study conception, design, interpretation and drafting of manuscript. All authors read and approved the final manuscript.The pre-publication history for this paper can be accessed here:"}
+{"text": "To estimate loss to follow up (LTFU) between initial enrolment and the first scheduled return medical visit of a pre-antiretroviral therapy (ART) care program for patients not eligible for ART.The study was conducted at a public-sector HIV clinic in Johannesburg. We reviewed records of all patients newly enrolled in the pre-ART care program and not yet eligible for ART between January 2007 and February 2008. Crude proportions of patients completing their first return medical visit stratified by patient characteristics were calculated. A modified-Poisson approach was used to estimate directly relative risks of returning for their first return medical visit within 1 year adjusting for patient characteristics as potential confounders.A total of 356 patients were identified. Two-thirds had a CD4 count > 350 cells/\u03bcl  and were scheduled to return in 6 months for a first medical visit. Seventy-four percent of these patients did not return within one year for this visit. The remaining 36% of all patients had a baseline CD4 count 251\u2013350 cells/\u03bcl and were scheduled to return in 3 months. Only 6% of these patients returned within 4 months; 41% returned within one year. Relative risks were positively associated with a patient being employed and negatively associated with the baseline CD4 count.Given the high rate of LTFU immediately after enroling in pre-ART care, it is clear that care programs are not expediting the timely initiation of ART. Significantly improved adherence to pre-ART care and monitoring for patients not yet eligible for ART is required for South Africa to achieve its AIDS strategy goals and reduce the problem of late presentation and initiation of ART. Most HIV-infected individuals in developing countries present for HIV/AIDS care and treatment late in disease progression, with very low CD4 counts . \u2018Late pTurning late presenters into \u2018early presenters\u2019\u2013 patients who enrol in pre-ART care and monitoring programs before becoming eligible for ART \u2013 requires a sequence of linked services and high retention of patients at each transition phase. This sequence starts with HIV testing, continues to CD4 testing and referral to a care program for those not ART eligible, proceeds to the patient making regular clinic visits for monitoring, and ends at ART initiation. Loss to follow up (LTFU) at any of these steps results in late presentation for treatment. We have estimated the rate of LTFU between initial enrolment in pre-ART care for patients not yet eligible for ART (baseline CD4 > 250 cells/\u03bcl) and their first scheduled return visit at one of South Africa's largest HIV/AIDS treatment facilities. This analysis complements related studies that address lost to follow up for patients who are eligible for ART but do not initiate ART (Themba Lethu Clinic (TLC) is the HIV/AIDS Comprehensive Care Management and Treatment (CCMT) facility at Helen Joseph Hospital (HJH) in Johannesburg. As of May 2009, >13 000 patients were actively on ART at TLC. The clinic is funded by the Gauteng Department of Health, with additional support from the President's Emergency Plan for AIDS Relief (PEPFAR) and the United States Agency for International Development (USAID) through Right to Care, a South African non-governmental organization (NGO).At the time of initiating ART at TLC, patients had a median CD4 count of 98 cells/\u03bcl during 2007\u20132008, with 25% having a CD4 count <34 cells/\u03bcl . These figures are consistent with findings reported for other sites in South Africa and sub-Saharan Africa .In South Africa's public sector, ART eligibility is defined as a CD4 count \u2264200 cells/\u03bcl or a WHO Stage IV condition. At the site, patients with CD4 counts \u2264200 cells/\u03bcl are referred to the ART treatment program as well as patients with CD4 counts between 201 and 250. Those with higher counts (CD4 > 250) are not referred for treatment but instead are referred to the pre-ART care and monitoring program. Patients who enrol in pre-ART care have already made at least two visits to the clinic or elsewhere for HIV-related services\u2013one for HIV testing and CD4 count and a second for receiving CD4 count results.At TLC, enrolment in pre-ART care occurs for patients with a baseline CD4 count >250 cells/\u03bcl upon returning to the clinic for a day of wellness counselling that provides information on a range of topics including living with HIV, information on available social services, and nutrition. The clinic records a new patient's first visit to the wellness program in a logbook. The next step in pre-ART care is to return to the clinic for a first follow-up medical visit with a primary health care nurse. Patients are scheduled to return for this visit at 3 months if their enrolment CD4 count is 250\u2013350 cells/\u03bcl or at 6 months if their enrolment CD4 count is >350 cells/\u03bcl.Wellness logbooks were reviewed to identify all new patients enroling in pre-ART care at TLC from January 2007 to February 2008. Patient records were reviewed in June 2009 to determine whether each subject returned for their first medical visit. Visit dates and demographic information from patient records were also recorded. Censoring of the dataset in June 2009 provided a minimum follow-up of 15 months for all subjects. Patients with a baseline CD4 count \u2264 250 cells/\u03bcl were not included in this analysis because they are managed differently in preparation for ART initiation.The study received ethical approval from Boston University and the University of the Witwatersrand.Patients with CD4 counts of 250\u2013350 cells/\u03bcl were scheduled to return at 12 weeks. For these patients, we defined two primary outcomes: whether or not the subject returned to TLC (1) within 4 and 40 weeks of their scheduled return appointment . We also defined two primary outcomes for patients with CD4 counts >350 who were scheduled to return at 24 weeks: whether or not the subject returned to TLC within 12 and 28 weeks of their scheduled return appointment . Crude proportions of patients completing their first return medical visit based on these primary outcomes were calculated.We estimated directly relative risks of returning for CD4 results within 1 year using the modified Poisson approach developed by A total of 544 patients were newly enrolled in the TLC pre-ART care program during the study period. We excluded 41 patients who enrolled in the program but did not have an enrolment CD4 count and 147 patients indicated in the log book as not yet eligible for ART, but who were later found to have a CD4 count \u2264250 cells/\u03bcl at enrolment as these patients were not early presenters. This left 356 patients for analysis.The other 228 patients (64%) enrolled with a CD4 count >350 cells/\u03bcl (median [IQR] = 458 [394\u2013585]) and were counselled to return within 6 months for their initial medical visit. Of these, 33  completed the visit within 9 months, 26  within a year and the remaining 169  did not return within a year .vs. unemployed patients.Relative risks based on the modified Poisson model are reported in In this study, 69% of patients enrolled in pre-ART care failed to return for their first medical visit within 1 year of enrolment. This highlights the need for greater investment in patient retention from the beginning of HIV care, not just after ART begins.Our data, combined with a previous analysis of post-voluntary counseling and testing (VCT) rates of CD4 testing at the same site (HIV/AIDS and STI Strategic Plan for South Africa, 2007\u20132011 (According to the 007\u20132011 , South AThis study had several limitations. It was conducted at only one facility in South Africa, albeit one of the largest, so it is possible that experience differs at other sites. Importantly, there is no medical information system in South Africa that allows patients to be tracked from one facility to another. We cannot therefore rule out the possibility that some of our subjects transferred to a care program elsewhere, though this is unlikely to explain more than a fraction of the high level of attrition we observed. Finally, we do not know why the subjects in our study did or did not return. It is possible that some patients with low CD4 counts who should have returned within 3 months but instead waited 9\u201310 months, returned because they were sick and needed medical care. Patients like these, who can no longer accurately be labelled \u2018early presenters,\u2019 may cause our results to overestimate the proportion of patients who adhered to the program schedule.None of these limitations is sufficient to alter the core finding of this study, which is that the majority of patients are lost from pre-ART care between enrolment and their first return visit. Future research is needed to examine why patients are LTF in pre-ART care and what interventions are feasible and effective for reducing such losses. We suspect that barriers to returning for pre-ART program visits are similar to barriers to ART adherence in general, which include, but are not limited to, costs and/or time for transport, lost earnings, lack of financial resources, stigma, lack of family support, perceived need and psychological issues . Employe"}
+{"text": "Pneumocystis jirovecii, formerly named Pneumocystis carinii, is one of the most common opportunistic infections in human immunodeficiency virus (HIV)-infected patients.Pneumocystis jirovecii pneumonia with trimethoprim/sulfamethoxazole.We encountered two cases of spontaneous pneumomediastinum with subcutaneous emphysema in HIV-infected patients being treated for P. jirovecii pneumonia. The newly formed bronchiectasis and cyst formation that were noted in follow up high resolution computed tomography (HRCT) but were not visible on HRCT at admission could be risk factors for the development of pneumothorax or pneumomediastinum with subcutaneous emphysema in HIV-patients.Clinicians should be aware that cystic lesions and bronchiectasis can develop in spite of trimethoprim/sulfamethoxazole treatment for  Pneumocystis jirovecii, formerly named Pneumocystis carinii, is one of the most common opportunistic infections in human immunodeficiency virus (HIV)-infected patients  and corticosteroids were co-administered with trimethoprim/sulfamethoxazole. On hospital day 4 the patient developed sudden chest pain radiating to the shoulder and neck. Chest X-ray, electrocardiography, and arterial blood gas analysis were performed. The chest X-ray revealed air lining the cardiac border, indicating development of pneumomediastinum. HRCT revealed newly developed cystic changes, bronchiectatic change, and parenchymal tear  in both lungs [P. jirovecii is not yet known. However, various mechanisms have been proposed including direct lung destruction by P. jirovecii, over-distension of the lungs caused by obstructive bronchiolitis acting as a ball-valve , interstitial emphysema and abnormal remodeling of pulmonary architecture due to interstitial fibrosis, and release of elastase and other proteolytic enzymes [P. jirovecii contributes to the development of pneumomediastinum is unknown.The overall incidence of  therapy . Howeveradequate . The mosth lungs . Atypicath lungs -10. The  enzymes ,10-12. A enzymes . Other m enzymes . HoweverP. jirovecii pneumonia [Spontaneous pneumothorax occurs in as many as 35% of patients with active cystic neumonia . Even thneumonia ,16.Staphylococcus aureus that was cultured in the second case may have attributed to the development of pneumomediastinum [Staphylococcus aureus without the need for an additional antibiotic [P. jirovecii pneumonia may have been an underlying cause to the development of pneumomediastinum. Therefore, the standard trimethorpim/sulfamethoxazole was analyzed as a treatment failure warranting a change of antibiotics to pentamidine.In relation to the aforementioned risk factors, a 22 pack-year history of smoking was noted in one of our two patients. Pneumatoceles or cysts were not seen on the chest X-rays or HRCT scans taken on admission in either patient. However, cystic lesions and bronchiectasis developed de novo in spite of the standard trimethoprim/sulfamethoxazole treatment, and they are presumed to have developed into pneumomediastinum with subcutaneous emphysema . Staphyliastinum . Howevertibiotic . Treatmetibiotic . HoweverP. jirovecii pneumonia in HIV-infected patients with HAART. However, administration of HAART therapy early in the acute phase of P. jirovecii pneumonia was done in both patients as improved survival rates in HIV-infected patients with severe P. jirovecii pneumonia was associated with HAART therapy [P. jirovecii infected HIV-patients receiving HAART therapy[P. jirovecii pneumonia due to immune reconstitution inflammatory syndrome [There is no guideline regarding the treatment of the acute phase of  therapy ,22. AlthT therapy. The possyndrome . HRCT ofP. jirovecii pneumonia might assist in predicting the development of pneumothorax or pneumomediastinum. Our findings suggest that clinicians should be aware of the clinical importance of newly formed cystic lesions and bronchiectasis for the development of pneumomediastinum and pneumothorax in P. jirovecii pneumonia.The occurrence of newly formed cystic lesions or bronchiectasis despite treatment may be risk factors for the development of pneumothorax or pneumomediastinum with subcutaneous emphysema in HIV-patients. Therefore close follow up with HRCT in HIV-patients with P. jirovecii pneumonia. Newly formed bronchiectasis and cyst formation may be risk factors for the development of pneumomediastinum with subcutaneous emphysema.In conclusion, clinicians should be aware that cystic lesions and bronchiectasis can develop in spite of trimethoprim/sulfamethoxazole treatment for The authors declare that they have no competing interests.Ju-Yeon Cho took care of the patient in the ICU and drewup the first draft of the report, Yong Eun Kwon, Sung Ho Yoon, and Seung Il Lee, consultant pulmonologists, made a substantial contribution to draft the manuscriptand revised the draft all over the course of submission, Dong-Min Kim conceivedof the study, participated in its design and coordination and drafted the manuscript. All authors read and approved the final manuscript.The pre-publication history for this paper can be accessed here:http://www.biomedcentral.com/1471-2334/9/171/prepub"}
+{"text": "Substantial resources and patient commitment are required to successfully scale-up antiretroviral therapy (ART) and provide appropriate HIV management in resource-limited settings. We used pharmacy refill records to evaluate risk factors for loss to follow-up (LTFU) and non-adherence to ART in a large treatment cohort in Nigeria.3) >350 and <100 were at a higher risk of LTFU compared to patients with baseline CD4 counts of 100\u2013200. The adjusted GEE analysis showed that patients aged <35 years (p\u200a=\u200a0.005), who traveled for >2 hours to the clinic (p\u200a=\u200a0.03), had total ART duration of >6 months (p<0.001), and CD4 counts >200 at ART initiation were at a higher risk of non-adherence. Patients who disclosed their HIV status to spouse/family (p\u200a=\u200a0.01) and were treated with tenofovir-containing regimens (p\u22640.001) were more likely to be adherent.We reviewed clinic records of adult patients initiating ART between March 2005 and July 2006 at five health facilities. Patients were classified as LTFU if they did not return >60 days from their expected visit. Pharmacy refill rates were calculated and used to assess non-adherence. We identified risk factors associated with LTFU and non-adherence using Cox and Generalized Estimating Equation (GEE) regressions, respectively. Of 5,760 patients initiating ART, 26% were LTFU. Female gender (p<0.001), post-secondary education (p\u200a=\u200a0.03), and initiating treatment with zidovudine-containing (p\u200a=\u200a0.004) or tenofovir-containing (p\u200a=\u200a0.05) regimens were associated with decreased risk of LTFU, while patients with only primary education (p\u200a=\u200a0.02) and those with baseline CD4 counts (cell/mlThese findings formed the basis for implementing multiple pre-treatment visit preparation that promote disclosure and active community outreaching to support retention and adherence. Expansion of treatment access points of care to communities to diminish travel time may have a positive impact on adherence. Nigeria is home to the second highest number of people living with HIV in the world and the highest in West Africa, with an estimated 2.6 million infected at the end of 2007Although substantial rates of LTFU have been shown in ART programs in resource limited settingsSeveral studies in Africa have shown a high level of medication adherenceLack of adherence to antiretroviral medications and attrition from health services contribute to poorer health outcomes and waste limited resources. Identifying patient characteristics that are associated with these outcomes could be used for making evidence-informed decisions to improve patient care and programmatic outcomes. In this paper, we describe risk factors for LTFU and non-adherence to antiretrovirals in a large antiretroviral therapy program in Nigeria.In 2005, the AIDS Care and Treatment in Nigeria (ACTION) project was created as a joint initiative between the Institute of Human Virology of the University of Maryland School of Medicine, the Institute of Human Virology Nigeria, the Nigerian Federal Ministry of Health, and local partner treatment facilities. The goals of ACTION are to implement a multidisciplinary program of primary HIV prevention, and HIV care and support that employs an evidence-based approach using robust strategic information systems to monitor performance and evaluate quality in order to continually improve program sustainability.This is a retrospective analysis of existing data and was determined to be exempt from oversight after review by the National Health Research Ethics Committee of Nigeria and the University of Maryland Baltimore Institutional Review Board. Patients were included in the analysis if they were non-pregnant treatment-naive adults initiating first-line ART between March 2005 and July 2006 at five tertiary hospitals in Nigeria. Among the first in Nigeria to provide large-scale ART access through support from PEPFAR, the local partner treatment facilities included were the University of Abuja Teaching Hospital (UATH), the University of Benin Teaching Hospital (UBTH), the Aminu Kano Teaching Hospital (AKTH), the Nnamdi Azikwe University Teaching Hospital (NAUTH), and the University of Calabar Teaching Hospital (UCTH). All WHO clinical stage 4 patients, stage 3 patients with a CD4 cell count <350 cells/ul, and stage 1 and stage 2 patients with a CD4 cell count <200 ul were eligible for ART in accordance with the Nigerian National GuidelinesAt clinic enrollment, patients underwent a history and physical examination and were interviewed by staff in order to complete an intake record which included demographic data. During this period, adherence counseling was routinely provided to patients, but a regimented intensive HIV treatment preparation program was not offered as part of routine clinical care. Six first-line treatment regimens were prescribed: (stavudine [d4T] + lamivudine [3TC] + nevirapine [NVP]/efavirenz[EFV]), (zidovudine [ZDV] + 3TC + NVP/EFV), and (tenofovir [TDF] + 3TC + NVP/EFV). Although physicians were trained to prescribe ZDV as a first choice, with TDF used if anemia was present and utilize EFV with concomitant anti-tuberculosis treatment with exception for child-bearing age women, choice of regimen was at the discretion of the physician. Patients were scheduled for a follow-up visit one month after ART was first dispensed and then every two or three months at the discretion of the physician. A sufficient supply of ART was dispensed to last until the next scheduled visit. At each follow-up visit, patients underwent a history and physical and any side effects reported were recorded by the physician on a clinical encounter form. A pharmacy order form, which includes the date ART was dispensed, the formulations dispensed, and the quantity of each formulation dispensed, was completed by the physician at each visit and presented to the pharmacist for ART dispensing.Form data were entered in real-time into the CAREWare health management information system. Originally developed for the US domestic HIV treatment and care program under the Ryan White CARE Act, the system has been adapted by the US Department of Health and Human Services Health Resources and Service Administration for resource-limited setting through PEPFAR and was deployed by the ACTION project.For the LTFU analysis, time-to-event analytical method was used. Patients were considered LTFU when they did not return to the clinic more than 60 days from their last expected visit. The risk of LTFU was determined using Cox proportional hazard regression with ART initiation as time zero. The proportional hazards assumption was assessed with log-log plots and regression of the Schoenfeld residualsFor the non-adherence to ARV analysis, pharmacy dispensing records over the duration of ARV therapy for each patient were reviewed. Each patient was required to have been receiving ART for a minimum of 90 days to be included in the analysis. Days of medication dispensed between visits was calculated. A pharmacy refill adherence rate (Rx) was then calculated (days of medication dispensed/days between visits multiplied by 100). For each visit interval when the Rx is less than 95% (i.e. an episode of Rx<95%), a binary outcome of 1 was designated . Given the longitudinal nature of the outcome, the risk factor analysis for Rx<95% within the first 12 months of initiating ART were modeled as the odds of having Rx<95% at any given visit using Generalized Estimating EquationIn both of these primary regression analyses of LTFU and non-adherence to ARV, potential covariates were first examined in unadjusted models. Factors associated at the p<0.05 level with the outcome and known risk factors for LTFU and non-adherence regardless of their level of significance were then evaluated in multivariate models. To control for confounding, variables that altered any significant relative hazards or odds ratios by \u226520% were retained. To account for missing data that may have not occurred at random, multiple imputations for missing data were performed using Markov chain Monte Carlo method (SAS Proc MI). The analyses of the complete-data obtained through the imputation did not change the results; therefore, only the primary regression results are shown.In order to model the effect of time since ART initiation as a continuous risk factor on the outcome of Rx<95%, we fitted a cubic polynomial model using the GEE method to obtain the predicted values of the proportion of individuals with the outcome from the associated \u03b2 coefficients. Similar to the procedure used in the multivariate analyses above, the model with the smallest QIC value was chosen as the best model of time since ART initiation.Statistical analyses were performed using STATA 10.0  for the LTFU analysis and SAS 9.2  for the GEE analysis.th\u201375th percentile: 29\u201341 years) \u2013 3 with 76% of the patients having had CD4\u2264200 cells/mm3. The majority of the patients (51%) lived within 1 hour of travel time to the clinic. At the time of this analysis, the median time on ART was 215 days (25th\u201375th percentile: 110\u2013361 days) with 44% of patients on ART for less than or equal to 6 months, 32% on ART between 6 and 12 months, and 24% on ART for between 12 and 18 months. There were a total of 44,571 person-months of follow-up. The majority of the patients were initiated on zidovudine-containing or stavudine-containing first-line regimens . The patient volume was highest at the University of Abuja Teaching Hospital  and lowest at the University of Calabar Teaching Hospital (n\u200a=\u200a398 patients).The study population included 5,760 patients; 2,385 (59%) were female and the median age at time of enrollment was 35 years  patients became LTFU Figure 13) and those in the lowest category (<100 cells/mm3) at ART initiation had higher risk of LTFU  relative to patients with CD4 between 100 and 200 cells/mm3. Use of a ZDV-containing first-line regimen was associated with decreased risk of LTFU compared with a d4T-containing regimen . The findings, specifically the increased risk of LTFU associated with being male, CD4 at initiation of ART <100 and >350, and with d4T-containing first-line regimen, remain significant when the analyses were stratified by site (data not shown). There was no difference in LTFU risk between EFV-containing and NVP-containing regimens . In the adjusted Cox Regression analysis of 4,177 (72.5%) patients with complete data variables, risk of LTFU remained associated with gender, educational level, CD4 at the time of ART initiation and types of first-line regimen. After adjusting for these covariates, younger age at clinic enrollment was associated with increased risk of LTFU.The characteristics associated with LTFU are shown in For the analysis of pharmacy refill rates, 4529 patients who returned for further visits beyond 90 days of ART initiation were included. Of these, 3362 (74.2%) had a pharmacy refill rate <95% at any time during follow-up. A total of 1747 (38.5%) had a summary pharmacy refill at the last visit <95%; of which 15.8% had Rx<50%, 33.6% with Rx of 50\u201379%, and 50.6% with Rx of 80\u201395%. In the bivariate analyses of those characteristics associated with pharmacy refill rate <95% Table 3,3 . Longer travel time to the clinic (>2 hours) was associated with increased odds of Rx<95% . Increased odds of Rx<95% was also associated with increasing time on ART.In the multivariate GEE regression which included 3,135 (70.4%) patients with complete data and adjusting for ART duration, decreased odds of Rx<95% remained associated with TDF-containing regimen (OR\u200a=\u200a0.73) and disclosure of HIV status to spouse or family member (OR\u200a=\u200a0.85). Compared to patients with CD4 cell counts between 100 and 200, patients with CD4 above 200 were at increased odds of Rx<95%; OR\u200a=\u200a1.18 (95%CI: 1.06\u20131.32) for patients with CD4 cell counts between 200 and 350 and OR\u200a=\u200a1.25 (95%CI: 1.05\u20131.49) for patients with CD4 cell counts greater than 350. There was no difference in Rx<95% between patients with CD4<100 and those with CD4 between 100 and 200 cells/mmIn the regression model where time since ART initiation was modeled as a continuous risk factor, the best fitting model included a cubic polynomial model for time. Modeled probabilities of Rx<95% across each time-points and 95% confidence intervals for the final best-fitting model are shown in In a large antiretroviral therapy program in Nigeria, approximately 1 in 4 patients were LTFU between March 2005 and July 2006; this is very similar to findings from other HIV treatment programs in sub-Saharan AfricaThe finding that a higher proportion of women initiated on ART remained in follow-up care in this cohort mirrors findings from other treatment cohorts in AfricaAlthough the majority of the patients had a CD4 level within the range of requiring ART according to the National and WHO guidelinesNearly half of patients LTFU never returned after receiving their first prescription of ARVs. This figure is much larger than previously reported across different ART programs in AfricaIn the analysis of the impact of various first-line regimens, patients initiated on a stavudine-containing first-line regimen had higher risk of LTFU compared to other regimens containing either zidovudine or tenofovir. Stavudine has been shown to be associated with peripheral neuropathyAt the end of the analysis time, more than one third of the cohort had an overall Rx<95%. There was a concordance between the proportion of patients with at least one visit interval with Rx<95% (i.e. an episodic Rx<95%) and the proportion of patients with an overall summary Rx<95%, suggesting that once patients demonstrate poor adherence in the course of follow-up, the behavior is likely to continue and intensive adherence support should be initiated immediately for this group of patients. The vast majority of episodes of adherence <95% were simply due to the patient not returning to the health care facility for pharmacy refill in a timely matter. Periodic discontinuation (\u226548 hours) of a non-nucleoside-based ART regimen is particularly concerning for the development of resistance due to the long half-life of these agentsGood adherence was associated with disclosure of HIV status to either spouse or family member and with a tenofovir-containing first-line regimen. The protective effect of disclosure on non-adherence is the first finding from a large treatment program in Nigeria and speaks to the importance of stigma as a barrier to effective life-long treatment adherence as also reported from South AfricaWhile our program did not collect information on religion, interestingly, patients with Q'uranic education were at increased risk of being non-adherent. Studies on understanding the cultural context of health care maintenance and adapting HIV treatment and care services to local customs are important for ensuring optimal clinical outcomes in various patient populations. This finding also underscores the importance of religious organizations and community leaders in further supporting people living with HIV/AIDS.Patients who spent considerable time traveling to the treatment facilities were at increased risk of non-adherence. Although the number of treatment facilities in Nigeria continue to increase, patients may continue avoid accessing care from facilities within their communities because of stigma. As a result, scale up of treatment facilities must be coupled with support from the communities. Beyond the standard and simple public health approach to ART and based on the data presented herein, the ACTION project has initiated a treatment support structure with emphasis on multiple visit pre-treatment preparation, promotion of disclosure, and treatment companions. The ACTION project is also implementing different models of comprehensive care delivery such as task-shifting, expanding development of ART points of service at the local primary health center level, home-based careOur findings should be interpreted in light of several caveats. First, the retrieved data were based on a clinical cohort rather than a \u201cclassical\u201d structured cohort that resulted in a variable interval of follow-up time for patients. We accounted for these variations in the analysis using the GEE approachIn summary, although rapid scale-up of ART in Nigeria has been remarkable, issues such as patient retention and adherence are likely to remain critical factors in patient-level and program-level success. A variety of models of service delivery such as availability of ART services at the primary health center level, home-based care, and task-shifting are being piloted and evaluated to enhance treatment adherence support. Our findings formed the basis for implementing multiple pre-treatment visit preparation that promote disclosure and active community outreaching to support retention and adherence. Keeping patients on treatment should be considered as important a factor as boosting the numbers of patients initiation ART. Coupled with expansion of treatment access points of care to communities to diminish travel and to create an environment that reduces stigma may further have a positive impact on adherence."}
+{"text": "Protozoan infections are the most serious among all the superimposed infections in HIV patients and claim a number of lives every year. The line of treatment being different for diverse parasites necessitates a definitive diagnosis of the etiological agents to avoid empirical treatment. Thus, the present study has been aimed to elucidate the associations between diarrhoea and CD4 counts and to study the effect of HAART along with management of diarrhoea in HIV positive patients. This study is the first of its kind in this area where an attempt was made to correlate seasonal variation and intestinal protozoan infestations.The study period was from January 2006 to October 2007 wherein stool samples were collected from 366 HIV positive patients with diarrhea attending the ART centre, inpatient department and ICTC of S.S. hospital, I.M.S., B.H.U., Varanasi. Simultaneously, CD4 counts were recorded to assess the status of HIV infection vis-\u00e0-vis parasitic infection. The identification of pathogens was done on the basis of direct microscopy and different staining techniques.Cryptosporidium spp. was detected followed by Microsporidia spp. (26.7%). The highest incidence of intestinal infection was in the rainy season. However, infection with Cyclospora spp. was at its peak in the summer. Patients with chronic diarrhea had lower CD4 cell counts. The maximum parasitic isolation was in the patients whose CD4 cell counts were below 200 cells/\u03bcl.Of the 366 patients, 112 had acute and 254 had chronic diarrhea. The percentages of intestinal protozoa detected were 78.5% in acute and 50.7% in chronic cases respectively. Immune restoration was observed in 36.6% patients after treatment on the basis of clinical observation and CD4 counts. In 39.8% of HIV positive cases Cryptosporidium spp. was isolated maximum among all the parasites in the HIV patients. The highest incidence of infection was seen in the rainy season.There was an inverse relation between the CD4 counts and duration of diarrhea.  Since the beginning of the AIDS pandemic, opportunistic infections (O.I.'s) have been recognized as common complications of HIV infection. The spectrum of O.I.'s in the HIV infected subjects varies from one region to another . Of thesThere have been reports regarding frequency of various pathogens causing diarrhea from different parts of India -5. HowevThus, the present study was conducted to isolate and identify the protozoans causing diarrhoea in HIV patients so as to give an accurate diagnosis to avoid empirical treatment. An attempt was made to elucidate the associations between diarrhoea and CD4 counts and to study the effect of HAART as well as anti diarrhoeal treatments in these patients. For the first time an analysis of the seasonal variations in the occurrence of intestinal protozoan infections was also made as it holds epidemiological significance.This study was conducted from January 2006 to October 2007 in the Department of Microbiology and ART centre of S.S. Hospital, I.M.S., B.H.U., Varanasi, India. Being a tertiary care hospital, it caters to the patients from the neighbouring areas of U.P., M.P., Bihar, Jharkhand, Chattisgarh and Nepal. The study was a part of PhD work. For all assignments of this type institute ethical committee first review the protocol and approves it.The stool samples were collected from 366 HIV positive patients attending the Anti Retroviral Therapy (ART) centre, inpatient department and the ICTC (Integrated Counselling and Testing Centre). All these patients came with the presenting complaint of diarrhoea and were investigated for the enteric protozoan as and when they reported. These patients were mostly promiscuous by habit.The subjects who were HIV negative and without diarrhoea were not included in the study.Stool samples from 200 cases were collected from the non-HIV positive family members of the patients who had diarrhoea and were obviously from similar environmental, social and economic background.A questionnaire was prepared to document the age, sex, route of transmission of infection and the demographic profile.We also studied the effect of HAART and anti diarrhoeal preparations in these patients, as they were potential culprits for HAART and anti diarrhoeal treatment. All the patients on HAART were being treated with Ziduvudine, Lamivudine, Efavirenz and Nevirapine. The antiparasitic drugs prescribed were ornidazole, metrogyl, nitazoxamide and albendazole.The patients were defined HIV seropositive if they tested positive for HIV infection by ELISA test  and a rapid test  .The CD4 cell count estimations were done by FACS Count . Each time the patients provided their stool samples, their most recent CD4 count was recorded for analysis. The CD4 cell counts were taken post therapy also in order to assess the immune restoration for case management.The duration and episodes of recurrent diarrhoea were recorded thus classifying it as acute if it lasted for less than a month and chronic if it lasted for more than a month.Microsporidia spores was done with the help of Calcoflour White staining method and identified on the basis of their size [Stool samples were collected in wide-mouthed disposable containers and processed immediately. If there was delay in processing the samples, they were preserved at 4\u00b0C. The consistency of the stool samples was recorded. A small portion of the sample was emulsified in a drop of saline and lugol's iodine on the slide and observed under the microscope. The samples were concentrated by Modified formol ether technique . Thereafeir size .During parasitological analysis we correlated the occurrence of the parasites with the route of HIV transmission in the patients. The study was divided into three parts depending on the seasons viz. summer, rainfall and winter to correlate and study the possible role of seasonal variation in protozoan diarrhoea.In the study we observed that there was a male preponderance 271/366, (74.0%) in the age group 31\u201340 years. Maximum patients (95%) belonged to Varanasi and the rural areas of Eastern UP.A total of 366 patients were screened and of these 134(36.6%) patients, showed immune restoration, which clinically indicated positive response to HAART.Of the 366 HIV positive patients with diarrhoea, 112 patients had episodes of acute and 254 had chronic diarrhoea. The details are given in a flowchart  was the most commonly found parasite in the HIV positive patients followed by Microsporidia spp. (26.7%). There were (25.1%) cases of mixed infections. Of the mixed infections 7.65% cases showed presence of helminths like Hookworm, H. nana and Trichuris trichiura along with the enteric coccidian. The remaining 17.45% were mixed infections of Cryptosporidium spp., Cyclospora spp. and Microsporidia spp. The samples taken from the controls showed a predominance of helminthic infestation with Ascaris lumbricoides (22.0%) leading the list followed by Hookworm (20%). The data is shown in the ensuing table.  had acquired the infection through homosexual route and 315/366 (86.0%) through heterosexual route. Sixteen out of 25 (64%) homosexual men had diarrhea due to The CD4 levels were inversely proportional to the duration of diarrhoea. Patients with chronic diarrhoea had lower CD4 counts than those who had acute diarrhoea. Table Cyclospora spp. was found to be associated with increasing ambient temperatures. Of all the Cyclospora spp. isolated 63.6% were obtained from the patients in the summer season. A direct correlation was found between increased rainfall and isolation of Cryptosporidium oocysts (76.0%) and Giardia cysts (56.7%) in the stool samples collected from the patients having diarrhoea. However, no seasonal variation was observed in the occurrence of diarrhoea caused by Microsporidia spp. and other parasites. . Predominance of male cases may be due to their migration to the metropolitan cities in search of work. Staying away from the families for longer periods and males being promiscuous by habit resulted in them, acquiring HIV infection.The drugs of choice for diarrhoea for practising clinician were ornidazole, metrogyl, nitazoxamide and albendazole. However, Sengupta et al observed that paramomycin was effective against cryptosporidiosis . HoweverIn this study we came across patients ranging from initial to advanced stages of the disease. There were 69.3% patients with chronic and 30.6% patients with acute diarrhea (p < 0.05). Recurrent episodes and presence of diarrhea even at higher CD4 levels can be attributed to reduced intestinal mucosal immunity .The percentage of parasite isolation in our study was 78.5% in acute and 50.7% in chronic cases. A similar study conducted in the same set up by Attili et al showed lower isolation rates . This diIn this study it was observed that probability of finding a pathogen from watery and semi formed stools was four times greater as compared to formed stools . This caCryptosporidium spp. isolated from both the groups indicated water as the main source of infection, which highlighted poor sewage disposal practices and sewage spills. Presence of Hookworm indicated lack of sanitation and low socio-economic status of the cases coming from rural areas.Samples collected from the controls coming from the same environmental background helped in tracing the source of infection. Parasite like Cryptosporidium spp. (39.8%) was the most commonly isolated protozoan followed by Microsporidia spp. (26.7%). As compared to the controls, the observed incidence of these organisms in HIV patients was significantly higher (p < 0.05). Another study conducted by Samantaray et al, also showed similar isolation rates in HIV patients [Cryptosporidium spp. (9%) were isolated [Microsporidia spp. in HIV patients as 17.18% [Microsporidia spp. This increase in isolation rates could be due to the fact that the numbers of cases studied were much higher in our study as compared to the study of Siddhartha et al [Isospora belli (0.5%) was lower in our study [Entamoeba spp. isolated were presumably that of Entamoeba histolytica. This screening method was adopted due to lack of facilities for isoenzyme analysis and other tests to differentiate it from Entamoeba dispar [H. nana and Trichuris trichiura co-existed with protozoa. These were probably flushed from the intestine because of diarrhoea or expelled after treatment. Therefore, we reported their presence as and when we came across the helminths during stool examination.patients  whereas,isolated . A studys 17.18% . On the ha et al . When cour study . This dia dispar . AlthougGiardia spp. (64%) was present more in this group of people as compared to those who had heterosexual practice. Our findings are in accordance with Curry et al [It was found that 6.8% patients had acquired the HIV through homosexual route. Cryptosporidium spp. was found to be the most commonly acquired protozoa causing chronic diarrhoea. The isolation rates decreased with the increase in the CD4 cell counts. This finding is in accordance with the study conducted by Attili et al. They also found an inverse correlation between CD4 counts and isolation rates of parasites from diarrhoea patients [The maximum parasitic isolation was in the group of patients who had CD4 cell counts below 200 cells/\u03bcl and patients .Cryptosporidium spp. at the top of the list followed by Giardia spp. (p < 0.05). We observed that isolation rate of Cyclospora spp. peaked during the summer and was significantly higher as compared to in the other seasons (p < 0.05). This is because sporulation or maturation of the immature oocysts excreted in the faeces depends on warm temperatures [Key climatic variables, particularly humidity and temperatures have always had a relationship to waterborne diseases. The Milwaukee episode of 1993, which affected 403,000 people, is a commonly quoted waterborne Cryptosporidiosis outbreak . The adveratures .1. Immune restoration as detected by CD4 counts was clinically assessed.Microsporidia spp. is merely a screening method. However, the authors have plans to carry out identification techniques like Chromotrope 2R staining to confirm the results.2. Calcoflour White staining for 3. The study was done as and when the symptoms of diarrhoea appeared and accordingly they were categorised season wise. It is difficult to establish the time period of initiation of infection.From this study it appears that the CD4 counts and prevalence of the protozoal infection in a particular geographic area should be considered before instituting empirical therapy to the AIDS patients attending the ART centre.The authors declare that they have no competing interests.All the authors read and approved the final manuscript. LT designed the study, performed the experimental work, conceived and drafted the manuscript. AKG provided the CD4 cell count data and helped to edit the manuscript, SS participated in coordination of the study and provided the clinical data and TMM supervised the study design, coordination of the study and helped to edit the manuscript.The pre-publication history for this paper can be accessed here:"}
+{"text": "Pneumocystis pneumonia (PCP) remains a leading cause of morbidity and mortality in HIV-infected persons. Epidemiology of PCP in the recent era of highly active antiretroviral therapy (HAART) is not well known and the impact of HAART on outcome of PCP has been debated.To determine the epidemiology of PCP in HIV-infected patients and examine the impact of HAART on PCP outcome.We performed a retrospective cohort study of 262 patients diagnosed with PCP between January 2000 and December 2003 at a county hospital at an academic medical center. Death while in the hospital was the main outcome measure. Multivariate modeling was performed to determine predictors of mortality.Overall hospital mortality was 11.6%. Mortality in patients requiring intensive care was 29.0%. The need for mechanical ventilation, development of a pneumothorax, and low serum albumin were independent predictors of increased mortality. One hundred and seven patients received HAART before hospitalization and 16 patients were started on HAART while in the hospital. HAART use either before or during hospitalization was not associated with mortality.Overall hospital mortality and mortality predictors are similar to those reported earlier in the HAART era. PCP diagnoses in HAART users likely represented failing HAART regimens or non-compliance with HAART. Pneumocystis pneumonia (PCP) was documented in the HAART era, PCP remains the leading AIDS-defining opportunistic infection in the United States [The introduction of highly active antiretroviral therapy (HAART) led to dramatic declines in morbidity and mortality of HIV-infected patients ,2. Althod States -6. Mortad States . For patd States -10. Certd States ,11-15. HThe relationship of HAART use to outcome of PCP is also not well-defined. A previous study found that intensive care unit (ICU) patients receiving HAART during hospitalization had improved mortality . This stWe studied patients with PCP at Los Angeles County-University of Southern California (LAC-USC) hospital from 2000 to 2003 to determine the epidemiology of PCP and investigate the association of HAART and mortality.Subjects were HIV-infected adults who were discharged from or died in LAC-USC with a diagnosis of PCP between January 1, 2000 and December 31, 2003. We conducted a computerized hospital records search using ICD-9 codes to identify those patients with either a microscopically-confirmed or an empiric diagnosis of PCP. Repeat admissions occurring more than two weeks after hospital discharge were considered as separate admissions. Readmissions within two weeks of discharge were considered as single admissions. The University of Southern California Institutional Review Board approved the study.Data were collected by standardized chart review using pre-determined definitions and included demographic information, medical history, laboratory data, and medication use. A PCP diagnosis was considered definitive if organisms were visualized on either induced sputum or bronchoscopic samples. A diagnosis was considered empiric if subjects presented with a compatible clinical course, were treated for PCP, and received a discharge diagnosis of PCP. The development of complications including pneumothorax and need for ICU admission or mechanical ventilation (data on non-invasive modes of ventilation were not available) was recorded. HAART was defined as the use of at least three drugs from at least two classes. Details of HAART use included both pre-admission treatment and initiation or continuation of HAART during hospital admission. Number of days a patient received HAART while in the hospital and missed doses were also noted. In-hospital mortality was the primary outcome measure.Stata 9.0  was used for all analyses, and statistical significance determined for a p-value of \u2264 0.05. Demographic and clinical data were described using mean and standard deviation or median and range depending on normality of the data. Dichotomous variables were described using percentages. Plasma HIV RNA viral level values were log-transformed. Analyses including CD4 cell counts and HIV RNA viral levels were limited to patients who had values available within six months of admission. Clinical characteristics of subjects were compared according to HAART use. Univariate analyses were performed to determine predictors of mortality. For continuous variables, either Wilcoxon rank sum or Student's t-test was used to compare groups. Differences in categorical variables for survivors and non-survivors were assessed using the chi-square test or Fisher's exact and p-values adjusted for multiple comparisons as appropriate. These analyses were repeated for subjects with a definitive diagnosis of PCP and those with an empiric diagnosis. Stepwise forward and backward multivariate logistic regression was performed to determine variables predictive of in-hospital mortality. The robust standard errors method was used to account for repeat admissions. Variables were included in the model if they reached a significance level of p < 0.1 in univariate analysis. Univariate predictors were similar for both definitive and empiric PCP diagnoses; therefore, these groups were combined in multivariate analyses to improve power. Because we were specifically interested in the effect of HAART use, we performed several Cox proportional hazard models adjusting for relevant variables examining differing aspects of HAART use and impact on survival time.284 HIV-infected adults had 355 admissions for PCP at LAC-USC during the study period. A total of 292 admissions for 262 patients were available for review. Clinical data for the remaining 63 admissions were unavailable due to random loss in medical records. Analyses were repeated including only initial PCP admissions and results were essentially unchanged. Number of patients hospitalized for PCP and number of patients with PCP admitted to the ICU over the course of the study are shown in Figure Clinical characteristics of subjects are shown in Table Two hundred and forty-five subjects (83.9%) were initially treated with trimethoprim/sulfamethoxazole (TMP/SMX). Approximately five percent (n = 14) had a change in PCP regimen. Reasons noted for treatment change were development of adverse effects  or treatment failure . Treatment decisions and dosing regimens were not standardized and were based on physician preference. The majority of subjects  received steroids. Of those with arterial blood gas data available, 84.7% of patients meeting clinical criteria received steroids. There was no association of mortality with appropriate steroid use, likely because there were a small number of patients who did not receive steroids when indicated.Pneumocystis treatment. Patients who had an empiric diagnosis differed from those in whom a definitive diagnosis was pursued (Table One hundred and twenty seven (43.5%) diagnoses were made empirically based on clinical presentation and response to anti-ed Table . Black sThirty-four patients (11.6%) died during hospitalization. ICU mortality was 29.0%. Univariate analyses to determine clinical variables associated with increased in-hospital mortality found that the need for mechanical ventilation , development of a pneumothorax , high serum lactate dehydrogenase (LDH), and high alveolar-arterial oxygen gradient  predicted increased mortality (Table One hundred and seven patients (36.6%) received HAART prior to hospital admission. Duration of HAART use was available in 35 subjects (32.7%). Of those with a known duration, 51.4% had started HAART within one month of admission and 11.4% had started it within one to six months. Subjects receiving HAART prior to admission were similar to those not receiving HAART in age, gender, race/ethnicity, and HIV risk factor  continued using HAART during admission. Sixteen patients (5.5%) started HAART during admission. HAART was started a median of 16 days after hospital admission (range 2\u201366) and a median of 9 days before discharge (range 2\u201328). Patients who continued or started HAART received it for a median of six days during admission (range 1\u201321). Approximately 15% of patients had at least one dose held during hospitalization. Reasons cited were the need to stop oral intake, development of side effects, or interaction with other medications.Mortality was comparable for those on HAART at hospital admission and those not on HAART . Cox proportional survival modeling did not demonstrate any difference in survival to hospital discharge in those continued on HAART during hospitalization, those started on HAART while hospitalized, or these groups combined.This study demonstrated that in-hospital mortality of HIV-infected patients with PCP admitted to LAC-USC hospital from 2000 to 2003 was 11.6% and ICU mortality was 29.0%. The need for mechanical ventilation, development of a pneumothorax, and low serum albumin were found to be independent predictors of mortality. In contrast to our previous work [As seen in previous studies of PCP, the majority of our patients were not using PCP prophylaxis. Although many should have been taking PCP prophylaxis based on clinical criteria, we cannot determine from chart review whether they were non-compliant with prescribed therapy, did not have therapy prescribed by their provider, or were not in care despite a known diagnosis of HIV infection. As also seen in previous studies, the admission with PCP was often the subject's first diagnosis of HIV infection. PCP diagnoses in HAART users may have represented failing HAART regimens or non-compliance with HAART. Immune reconstitution inflammatory syndrome (IRIS) might also have accounted for some of these diagnoses, although we were unable to distinguish these possibilities from chart review .In our study, there were a large number of empirically-diagnosed patients who differed from those in whom definitive diagnosis was pursued. Those with an empiric diagnosis were more likely to have known HIV, a past history of PCP, and to be receiving HAART. Empiric diagnosis was associated with improved mortality, but this association did not persist after adjustment for severity of illness. Parada and colleagues also found that patients with an empiric diagnosis of PCP had comparable mortality to those with definitive diagnoses . In contInterestingly, empirically-diagnosed patients were much more likely to be black, which was the only characteristic independently associated with an empiric diagnosis. The reasons for this are unclear, but studies of the effects of race on invasive procedures in the non-HIV-infected population have found that blacks are less likely to undergo bronchoscopy when seriously ill, less likely to have cardiac catheterization when having an acute myocardial infarction, and less likely to have lung surgery when diagnosed with lung cancer -21. OtheDue to the heterogeneity of patient populations, differing admission standards, influence of decisions to withdraw care, and variable clinical practices, it is difficult to compare our mortality results to previous studies. Reported hospital mortality of HIV-infected patients with PCP prior to HAART ranged from 13% to 25% ,24. In tMortality of PCP patients requiring intensive care ranged from 60 to 76% in the pre-HAART era, but improved somewhat in the early HAART era ,25,26. ASimilar to another study which included the later HAART years , our stuThe predictors of mortality that we identified were consistent with previous studies. Mechanical ventilation, development of a pneumothorax, and low serum albumin were associated with a poor outcome. These factors have all been previously found to predict outcome in patients with PCP or in those with HIV infection ,13,14,27One potential factor that could influence current mortality is the use of HAART. A previous study demonstrated that PCP patients who received HAART during their ICU admission had a mortality rate of only 25% compared to 63% for those who did not . In contThe current study adds to previous work by examining a larger group of patients, by including both patients with and without HAART use as well as those not requiring ICU care, and by performing detailed analyses of HAART use. Overall, there was no significant relationship between HAART and survival. We found no mortality effect in patients who started HAART or who had it continued in the hospital. Our subjects started HAART, on average, more than two weeks after hospital admission and received it only for an average of six days, which likely would not be long enough to see a beneficial effect. Patients in the previous study reporting a beneficial effect of HAART might have received it for a longer time or more quickly after hospital admission than the current patients, but these data were not collected . Other eAnother area of controversy has been whether patients receiving HAART present differently from those not receiving HAART at admission. Although HAART patients generally had similar serum albumin and LDH levels, they were less likely to have a pneumothorax and tended to be less likely to require mechanical ventilation or ICU admission and thus seemed to have had less severe illness. This finding might be due to a tendency for subjects who were in care and with known HIV status to seek medical attention at an earlier point in the disease or there might be some differences in the presentation of the disease in HAART users. In addition, HAART use prior to admission was associated with a shorter length of stay, possibly reflecting more stable housing situations or perhaps indicating a beneficial effect of HAART separate from any effects on mortality. Patients who reported using HAART at admission did not actually have lower HIV viral RNA levels than those not on HAART. There are several potential explanations of the detectable viral levels in these patients. First, they may not have been compliant with the regimens as approximately one-third of subjects reported not taking their medications as prescribed. Also, of the subjects in whom length of HAART use was known, many had recently started HAART and might not have had sufficient time to see benefit. Finally, HAART might not have been effective in these selected patients as those with successful HAART use would not be expected to develop PCP.There are several limitations of this study. First, it is retrospective and from a single center. Different populations or different hospitals could be expected to have different results. Factors such as criteria for ICU admission and views of limitations of care could influence outcomes. Another difficulty is that our analysis of the effects of HAART on mortality might be altered by the fact that patients selected to start HAART either before or during admission may differ from those not interested in or not offered the therapy. Also, pre-hospital data regarding markers of HIV infection and prognosis were not available for a number of subjects, limiting our ability to analyze the effect of these factors on in-hospital outcome. Finally, we might have lacked sufficient power to detect a difference in subjects on HAART. Larger, prospective studies would be needed to determine the effects of initiating HAART during hospitalization for acute PCP.In summary, overall hospital mortality for PCP is similar to that reported earlier in the HAART era, but ICU mortality appears to be lower than that previously reported at other centers. Whether current ICU mortality represents improvements in general ICU care or changes in the HIV-infected population is unknown, but should provide clinicians with justification and optimism for continued ICU care of these patients. Predictors of mortality have not changed in the recent HAART era and need for mechanical ventilation, development of a pneumothorax, and low serum albumin still portend a poor outcome. PCP diagnoses in HAART users likely represented failing HAART regimens or non-compliance with HAART. Administration of HAART during hospitalization or continuation of a potentially failing HAART regimen was not associated with a decrease in mortality, but larger, prospective studies are needed to confirm the true relationship of HAART to outcome of PCP.Pneumocystis pneumoniaAIDS: acquired immunodeficiency syndrome; HAART: highly active antiretroviral therapy; HIV: human immunodeficiency virus; ICU: intensive care unit; IRIS: immune reconstitution inflammatory syndrome; LAC-USC: Los Angeles County-University of Southern California; LDH: lactate dehydrogenase; PCP: The authors declare that they have no competing interests.SR carried out data acquisition, performed statistical analyses, and drafted the manuscript.TA participated in data acquisition.MU participated in data acquisition.SS participated in data acquisition.AM conceived of the study, participated in its design and coordination, and revised the manuscript.All authors read and approved the final manuscript.The pre-publication history for this paper can be accessed here:"}
+{"text": "Studies of antiretroviral therapy (ART) programs in Africa have shown high initial mortality. Factors contributing to this high mortality are poorly described. The aim of the present study was to assess mortality and to identify predictors of mortality in HIV-infected patients starting ART in a rural hospital in Tanzania.This was a cohort study of 320 treatment-na\u00efve adults who started ART between October 2003 and November 2006. Reliable CD4 cell counts were not available, thus ART initiation was based on clinical criteria in accordance with WHO and Tanzanian guidelines. Kaplan-Meier models were used to estimate mortality and Cox proportional hazards models to identify predictors of mortality.9/L; AHR 2.30; 95% CI 1.33\u20133.99) and severe malnutrition . Estimated one year mortality was 55.2% in patients with severe anemia, compared to 3.7% in patients without anemia (P < 0.001).Patients were followed for a median of 10.9 months (IQR 2.9\u201319.5). Overall, 95 patients died, among whom 59 died within 3 months of starting ART. Estimated mortality was 19.2, 29.0 and 40.7% at 3, 12 and 36 months, respectively. Independent predictors of mortality were severe anemia , moderate anemia , thrombocytopenia (platelet count <150 \u00d7 10Mortality was found to be high, with the majority of deaths occurring within 3 months of starting ART. Anemia, thrombocytopenia and severe malnutrition were strong independent predictors of mortality. A prognostic model based on hemoglobin level appears to be a useful tool for initial risk assessment in resource-limited settings. The introduction of highly active antiretroviral therapy in 1996 dramatically improved the prognosis for HIV-infected patients in the industrialized world . Until rFew studies have examined the effect of ART in rural Africa, and experiences from Europe and North America are not necessarily applicable to such settings. However, early reports from ART programs in resource-limited settings have been promising, with virological efficacy comparable to industrialized countries . NeverthA better knowledge of prognostic factors would allow closer follow-up and more targeted interventions in high-risk patients, thus reducing excess mortality. The aim of the present study was to assess mortality and to identify predictors of mortality in HIV-infected patients starting ART in a rural African hospital.Tanzania is a low-income country in East Africa with 38.3 million inhabitants and estimated adult HIV prevalence at 6.5% . Life exPatients were considered eligible for ART if they were in WHO stage IV irrespective of CD4 cell count, WHO stage III with CD4 \u2264 350 cells/\u03bcL, or had CD4 \u2264 200 cells/\u03bcL regardless of clinical stage, in accordance with WHO and Tanzanian guidelines . HoweverThe present study is a prospective, observational cohort study of treatment-na\u00efve patients aged 15 years or older who started ART in Haydom Lutheran Hospital between October 3, 2003, and November 5, 2006. Women who were pregnant at the time of ART initiation were excluded from the study, as were lactating mothers in WHO stage I or II, who started ART exclusively to prevent vertical transmission. Follow-up data was collected through May 5, 2007. Patients gave written consent to participate in the study. Ethical approval was obtained from the Medical Research Coordinating Committee of the National Institute for Medical Research in Tanzania and Regional Committee for Medical Research Ethics in Norway.First-line treatment comprised stavudine (d4T) or zidovudine (ZDV), combined with lamivudine (3TC), and either nevirapine (NVP) or efavirenz (EFV). Regimen choice was subject to availability, with use of a generic fixed-dose combination of d4T, 3TC and NVP whenever possible. Second-line treatment in case of treatment failure was not available until December 2006. Patients with CD4 \u2264 200 cells/\u03bcL or WHO stage III or IV disease were given co-trimoxazole prophylaxis 960 mg thrice weekly or 480 mg daily. After the initial 2 weeks of daily drug administration, antiretroviral drugs were dispensed on a monthly basis.A standardized form was used for the baseline evaluation, which included socio-demographic information, medical history, physical examination, and laboratory investigations. Clinical staging was performed using the 2003 revision of the WHO clinical staging system . Routine2), mild malnutrition (BMI 17\u201318.4 kg/m2), moderate malnutrition (BMI 16\u201316.9 kg/m2), and severe malnutrition (BMI < 16 kg/m2). Anemia was defined as a hemoglobin level of <12 g/dL for women and <13 g/dL for men  3.1), mean hemoglobin 10.1 g/dL (SD 2.1), mean TLC 1.4 \u00d7 109/L (SD 0.8) and mean platelet count 266 \u00d7 109/L (SD 131).Patients on ART were followed for a median of 10.9 months (interquartile range 2.9\u201319.6). Summary statistics of baseline characteristics are given in table At ART initiation, 210 patients (65.6%) had clinical AIDS (WHO stage IV). For comparison, 401 (51.5%) of 779 had clinical AIDS at enrollment into the HIV program. The most common WHO stage IV conditions among patients who started ART were: wasting syndrome (89.0%), oesophageal candidiasis (13.3%), extrapulmonary TB (5.2%) and Kaposi's sarcoma (4.8%).Overall, 95 patients (29.7%) died during the follow-up period, among whom 59 died within 3 months of starting ART. Thirty-five patients (10.9%) were transferred to another health facility, 31 (9.7%) were lost to follow-up and 7 (2.2%) self-stopped treatment. Estimated mortality was 19.2, 24.5, 29.0, 35.2 and 40.7% at 3, 6, 12, 24 and 36 months, respectively.In univariable analysis male sex, ART start year, WHO stage IV, severe malnutrition, anemia, lymphopenia and thrombocytopenia were all associated with progression to death. No such associations were found for age, tribe, religion, education level, hepatitis B, syphilis or active TB. As described in table P < 0.001, Figure P < 0.001). A similar trend was observed with decreasing BMI. Estimated one year mortality was 13.7% in patients with normal nutritional status, 21.0% in mild to moderate malnutrition, and 46.8% in severe malnutrition  was comparable to other African studies ,13, dataThe main strength of our study is that it was carried out in a rural African hospital with use of national staff and inclusion of all eligible patients. Most other African ART studies have been performed in urban areas -11,13-15We found high mortality among patients starting ART in this rural Tanzanian hospital, with the majority of deaths occurring within 3 months of ART initiation. Many patients enrolled with advanced immunodeficiency, and priority should be given to identify HIV-infected individuals and start ART earlier in the course of their illness. Anemia, thrombocytopenia and severe malnutrition were strong independent predictors of mortality. A simple prognostic model based on hemoglobin level appears to be a useful tool for initial risk assessment in resource-limited settings.The author(s) declares that they have no competing interests.AJ analyzed the data and drafted the manuscript. EN and BJN collected the data. LS performed the statistical analysis and helped to draft the manuscript. MIM participated in the conception of the study. HEA participated in the data collection and design of the study. SGG and JNB conceived the study, and participated in its design and coordination. All authors read and approved the final manuscript.The pre-publication history for this paper can be accessed here:"}
+{"text": "To identify the patients of bronchial asthma (suspected or proven), not responding to optimal therapy, for the presence of vocal cord dysfunction (VCD) and to compare the diagnostic ability of flow volume (FV) loop and impulse oscillometry (IOS).Fifty one patients of suspected/proven bronchial asthma not responding to optimal therapy were included for the study. Each patient was subjected to both FV loop and IOS studies. Direct visualization of the vocal cords with flexible fiberoptic bronchoscope for the presence of inspiratory vocal cord adduction during quiet respiration, with speech, and while performing provocative maneuvers was carried out. All patients were subjected to simple pulmonary function tests and recording of FV loop. IOS was performed on each patient to look for the site of obstruction and upper airway influence. The observations of both FV loop and IO studies were compared.P < 0.005).Among 51 patients participated, 12 (23.53%) had bronchoscopical evidence of VCD and were labeled as VCD-positive group and rest 39 were designated VCD negative. No statistically significant difference in pulmonary function test (prereversibility) results between the VCD-positive and VCD-negative patients was found. Reversible airway obstruction was observed in 75% of the patients of VCD-positive group and 67.65% of the patients in the VCD-negative group. Only one patient in the VCD-positive and none in VCD-negative group had inspiratory limb flattening of FV loop. Upper airway influence was evident by IOS in 58.3% of patients in the VCD-positive group and in 15.4% of patients in the VCD-negative group. This difference was statistically significant (VCD was a common finding in patients with symptoms suggestive of asthma and frequently coexists with asthma. IOS was found to be a useful screening test for VCD and was more sensitive than FV loop. Vocal cord dysfunction (VCD) is characterized by paradoxical closure of the vocal cords with resultant airflow limitation at the level of the larynx.24The symptoms of VCD mimic a variety of upper and lower airway diseases.131Making the diagnosis of VCD other than with direct visualization of the vocal cords can be difficult.41Flow volume (FV) loop in patients with VCD may demonstrate the truncation of the inspiratory limb, suggestive of variable extrathoracic obstruction.The \u2018gold standard\u2019 for the diagnosis of VCD is the direct observation of the paradoxical inspiratory vocal cord closure while the patient is in the midst of an attack.18Zrs) is partitioned into a \u2018real\u2019 (or resistance) Rrs and \u2018imaginary\u2019 (or reactance) Xrs component. The Rrs and Xrs are determined for several frequencies of oscillations. Various lower and upper airway disorders produce characteristic changes in Rrs and Xrs over the frequency spectrum used.10Rrs and Xrs.10Cm). During the ongoing other project on IOS at our center, we realized that Cm may influence the observations. Therefore, we attempted to use this shunt as diagnostic tool to diagnose VCD and coined the term as upper airway influence.Impulse oscillometry (IOS) is based on the forced oscillation technique (FOT) which is a convenient method of determining the impedance of total respiratory system.The study was conducted in the division of Pulmonary Medicine of a tertiary referral and teaching institution. This consisted of 51 patients of suspected/proven bronchial asthma, not responding to optimal therapy. Those more than 12 years of age and either sex, attending the medical OPD, chest clinic, or emergency department were included. Academic review board of the institution approved the study protocol. Written and informed consent was sought from all participants.Patients who either required high doses of oral steroids for the control of asthma symptoms or had an inconsistent response to bronchodilator therapy were taken for study. Subjects who had history suggestive of COPD, interstitial lung disease, chest wall deformities, and significant fibrosis or volume loss of lungs were excluded. Those with organic upper airway obstruction  or with identifiable cause of VCD  were also excluded.1), forced expiratory flow after exhalation of 50% and 75% of vital capacity , peak expiratory flow (PEF), and FV loop using an electronic spirometer . For all these parameters, the actual/predicted ratio was computed. The criterion used for the diagnosis of airway obstruction was a FEV1/FVC ratio of less than 75%, and reversibility was carried out by using inhaled bronchodilators.All participants underwent a complete history and physical examination. They were subjected to pulmonary function tests with recording of forced vital capacity (FVC), forced expiratory volume in first second  and peripheral resistance (Rp), Zrs versus volume (Z\u2013V) graph, resistance and reactance versus frequency spectra, and the visual interpretation graph (Lung Model) based on the seven element model of \u2018lung of Mead\u2019. The interpretation graph was the graphically expressed form of the interpretation of the impedance spectrum. In the present study, the appearance of oropharyngeal compliance (Cm) on the visual interpretation of graph was considered as upper airway influence.IOS study was performed on the Master screen diffusion, JAEGER, Germany. The output from IOS included tidal volume, resonance frequency, Each patient underwent bronchoscopy using a flexible fiberoptic bronchoscope. Topical 2% lignocaine was used to anesthetize the nares. The posterior pharynx was specifically not anesthetized to avoid medication of the vocal cords. The bronchoscope was directed to the posterior pharynx several centimeters above the glottis to prevent the stimulation of the vocal cords to induce their adduction. The motion of the vocal cords was documented with speech and any abnormal motion of the vocal cords was looked for with panting, sniffing, and deep breathing maneuvers each lasting for ten seconds. The observation of VCD was made in patients who showed adduction of vocal cords with one or more of these maneuvers during bronchoscopy.t-test/ Mann-Whitney test was used for assessing the difference between the two groups for the continuous variables, while Pearson chi square test was used for assessing the difference among discrete variables.For statistical analysis, patients were divided into two groups, VCD positive and VCD negative depending on the presence or absence of VCD, respectively, on bronchoscopy. The Of 51 patients studied, 12 patients (23.53%) had evidence of VCD on bronchoscopy and were grouped as VCD positive. The remaining 39 patients were classified as the VCD-negative group. A comparison of the PFT, FV loop, and IOS observations of both groups was computed.Seven (58.3%) of the patients were women, while rest were men. In the VCD-positive group the mean age was 32.92 \u00b1 12.42 years (range 17\u201357 years). In the VCD-negative group, the mean age was 32.87 \u00b1 10.928 years and 24 (61.5%) were females.In the VCD-negative group, five patients could not perform the spirometry, while in the VCD-positive group all could do. Patients, who could perform, were included for the purpose of statistical analysis of spirometry parameters. The diagnosis of asthma was confirmed spirometrically in nine (75%) of the patients in the VCD-positive group and 26 (67.65%) of the patients in the VCD-negative group, as evidenced by significant reversibility of airway obstruction. There was no significant difference between the VCD-positive and VCD-negative groups in the spirometric parameters. Only one patient in the VCD-positive group and none among VCD-negative had inspiratory limb flattening of the FV loop.P < 0.005).In the present study, upper airway influence  was evidVCD is increasingly being identified as a cause of recurrent episodes of cough and wheezing. Patients with VCD often receive a diagnosis of poorly controlled asthma with suboptimal response to therapy with \u03b22-agonists and corticosteroids.1The majority of literature concerning VCD consists of small retrospective series and case reports. The only prospective study that evaluated VCD in a cohort of patients with complaints of exertional dyspnea reported 15% prevalence of VCD.Our data showed the prevalence of 23.53% (12 out of 51 patients) of VCD. This high figure is at variance with the existing literature, which described VCD as a relatively rare differential diagnosis of asthma. This observation may be the first true reflection of the prevalence of VCD among asthmatics. Nine of these 12 (75%) patients with VCD fulfilled the spirometric criteria for reversible airway obstruction. These results support the earlier view that VCD and asthma more often coexist.1There was no significant difference between the VCD-positive and VCD-negative groups in the spirometric parameters. The observations of the PFT parameters of this study agreed with the findings of other studies.1P < 0.005). We took the appearance of the oropharyngeal compliance Cm on visual interpretation graph as evidence of upper airway influence. The major problem of the FOT is that its results are influenced by the shunt characteristics of the upper airway. Part of the oscillations applied at the level of mouth is \u2018lost\u2019 in movements of the cheeks and floor of mouth. This shunt does not influence markedly the measurements in healthy individuals, but will play a progressively larger role when the impedance of the respiratory system is abnormally large.Rrs and Xrs in patients of upper airway obstruction and COPD, but in latter case, a shunt is also operating at the level of intrathoracic central airways.1112In our study, the upper airway influence was evident on IOS in seven (58.3%) of patients in the VCD-positive group and in six (15.4%) of patients in the VCD-negative group. This difference was statistically very significant (Cm. VCD is a cause of upper airway obstruction and oral shunt plays a role in such patients.Hence, oral shunt is the only shunt operational in upper airway obstruction. In the Mead's model of lung , this orIOS has not been used in the evaluation of VCD until now. Our results indicate that IOS can be a useful screening tool for suspected VCD cases. In addition, IOS offers certain advantages over spirometry as it is effort independent, consumes less time, and requires minimal patient cooperation.In conclusion, VCD should be considered as a common differential diagnosis in young adult females who are being treated for asthma, especially if the symptoms respond suboptimally to optimal therapy. Spirometry in patients of VCD usually demonstrates reversible airway obstruction due to the underlying asthma, which often coexists with VCD. FV loop infrequently demonstrates the characteristic inspiratory limb flattening. IOS is a useful screening tool for the presence of VCD in patients of asthma. The definitive diagnosis, however, depends on direct visualization of the paradoxical vocal cord adduction on inspiration either during quiet respiration or with provocative maneuvers."}
+{"text": "Non-nucleoside reverse transcriptase inhibitor (NNRTI) with stavudine and lamivudine is widely used as the first-line antiretroviral therapy (ART) in resource-limited settings. Lipodystrophy is common and options for switching ART regimen are limited; this situation can lead to patients' poor adherence and antiretroviral resistance. Treatment interruption (TI) in patients with high CD4 cell counts, lipodystrophy, and limited options may be an alternative in resource-limited settings. This study aimed to determine time to resume ART after TI and predictors for early resumption of ART in a resource-limited setting.3, and willing to interrupt ART. CD4 cell count, HIV-1 RNA, lipid profile, and lipodystrophy were assessed at baseline and every 3 months. ART was resumed when CD4 declined to <250 cells/mm3 or developed HIV-related symptoms. Patients were grouped based on ART regimens [NNRTI or protease inhibitor (PI)] prior to TI.A prospective study was conducted in January 2005 to December 2006 and enrolled HIV-infected patients with HIV-1 RNA <50 copies/mL, CD4 > 350 cells/mm3, respectively. Median CD4 change at 3 months after TI were -259 (NNRTI) and -105 (PI) cells/mm3 (p = 0.038). At 13-month median follow-up, there was no AIDS-defining illness; 38% (NNRTI) and 29% (PI) of patients developed HIV-related symptoms. ART was resumed in 51% (NNRTI) and 36% (PI) of patients (p = 0.022). By Kaplan-Meier analysis, median time to resume ART was 5.5 (NNRTI) and 14.2 (PI) months . By Cox's regression analysis, NNRTI-based ART , nadir CD4 <100 cells/mm3  and baseline CD4 <500 cells/mm3  were predictors for early ART resumption.There were 99 patients, 85 in NNRTI group and 14 in PI group. Mean age was 40.6 years; 46% were males. Median duration of ART was 47 months. Median nadir CD4 and baseline CD4 were 151 and 535 cells/mmTI of NNRTI-based ART leads to rapid CD4 decline and high probability of early ART resumption and should be avoided. It is necessary to scale-up the options for HIV-infected patients with lipodystrophy in resource-limited settings. Highly active antiretroviral therapy (HAART) has dramatically changed the course of human immunodeficiency virus type 1 (HIV-1) disease, with a substantial reduction in morbidity and mortality . New antPrior to the publcation of the Strategy for Management of Antiretroviral Therapy (SMART) study , several3, and 4) willing to interrupt ART. All patients continued dual NRTIs for a further 7-day duration after TI of nevirapine-based regimens and a 10-day duration for efavirenz-based regimens. Lipid lowering agents were continued in patients who had been receiving these drugs prior to participate in this study.A prospective study was conducted in HIV-1-infected patients who had high CD4 cell counts and complete HIV-1 suppression (<50 copies/mL) at a medical-school hospital. Participants were enrolled between January 2005 and December 2005 and were followed through the end of December 2006. Inclusion criteria were as follows: 1) HIV-1-infected patients > 15 years of age, 2) receiving an NNRTI-based or PI-based ART as an initial regimen, 3) had undetectable HIV-1 RNA (<50 copies/mL), 4) had CD4 cell count >350 cells/mmCD4 cell count, HIV-1 RNA, glucose and lipid profile including total cholesterol (TC), LDL-C, HDL-C, and triglycerides (TG) were monitored at baseline and in every 3 months. Lipodystrophy was defined by a change in body fat distribution reported by the patients and assessed by the same investigator (SS) who was trained for this assessment at baseline and in every 3-month clinic visit.3 or developed HIV-related symptoms. After report of the SMART study in November 2006, the participated patients were notified the results of SMART study and decided to resume ART or continued TI with closed follow-up. CD4 cell count was monitored every 6 weeks in patients who decided to continue TI. Patients were grouped based on their ART regimens prior to TI, NNRTI-based regimens (NNRTI group) or PI-based regimens (PI group). The study was approved by the Institutional Review Board and written informed consent was obtained from all participants.ART was resumed when CD4 cell count declined to <250 cell/mmThe primary objective of the study was to determine the time to resume ART after TI of NNRTI-based regimens. The secondary objectives were to: i) compare time to resume ART after TI between NNRTI group and PI group, ii) define the predictors for early resumption of ART, iii) compare change of CD4 and HIV-related symptoms after TI between NNRTI group and PI group, and iv) determine changes of lipid profile and lipodystrophy after TI.P value of less than 0.05 was considered statistically significant.Median  and frequencies (%) were used to describe patients' characteristics in both groups. Chi-square (or Fisher exact test where appropriate) and Mann-Whitney U tests were used to compare categorical and continuous variables between the two study groups, respectively. The Kaplan-Meier test was used to estimate the median time to resume ART between the two groups. The patients were censored when they resumed ART or at the end of study. Log-rank test was used to compared the median time to resume ART between groups. Statistical calculations were performed using SPSS program version 13.0 . A two-sided 3 (79%), developed symptoms (18%), and patients' decision (3%).A total of 99 patients participated in this study, 85 (86%) patients in NNRTI group and 14 (14%) patients in PI group. The mean (SD) age was 40.6 (9.1) years old and 46% were males. Baseline characteristics of patients in both groups are shown in Table 3  and baseline CD4 <500 cells/mm3  were predictors for early ART resumption. Duration of ART was not associated with early ART assumption.By Kaplan-Meier analysis, median time to resume ART was 5.6 months in NNRTI group and 15.0 months in PI group . In contrast, there were no significant differences of TC , LDL-C , and HDL-C  from baseline. Only two patients had high fasting plasma glucose at baseline and there was no significant change of mean plasma glucose after TI. Of 82 patients who had lipodystrophy at baseline, five (6%) patients had improved lipodystrophy. All these five patients had TI >12 months.The primary results from the present study has demonstrated that TI of NNRTI-based regimens is associated with a rapid CD4 decline when compared to PI-based regimens. When compared to the results from SMART study , the ove3 in Staccato and < 250 cells/mm3 in TRIVACAN), one major difference between these two studies is ART regimen in study patients; 80% of patients in Staccato received PI-based regimens whereas 90% of patients in TRIVACAN study had NNRTI-based regimens. Although SMART and TIBET [Interestingly, Staccato  and TRIVnd TIBET  study innd TIBET . This ma3 and baseline CD4 <500 cells/mm3 were significant predictors for early ART resumption. These findings were concordant with the results from previous studies [We also found that nadir CD4 <100 cells/mm studies -15,17,21In resource-limited settings where NNRTI with stavudine and lamivudine is widely used as the first-line ART, using stavudine in first-line ART should be reconsidered. Given a large amount of patients in developing countries currently receive a regimen of stavudine, lamivudine, and nevirapine, it is necessary to scale-up the options for HIV-infected patients who develop lipodystrophy in resource-limited settings. National ART access program in developing countries is needed to be better prepared.The present study has some limitations. First, the study was small according to the limited budget. The second phase of study was not granted after the report of SMART study. Second, the proportion of patients in PI group was much smaller than that of NNRTI group. This could be explained by the fact that the majority of patients in developing countries taking NNRTI-based ART. However, the sample size of the present study was enough to demonstrate the different outcomes of TI from NNRTI-based and PI-based ART. Third, there was a high proportion of patients with lipodystrophy in the present study. According to the inclusion criteria that we enrolled patients who were willing to have TI, those with lipodystrophy were more likely to participate in the study. The results of improved TG levels in the present study may not be applicable for other population with a lower prevalence of lipodystrophy and dyslipidemia.In conclusions, TI of NNRTI-based ART leads to rapid CD4 decline and the need for early ART resumption. TI is not a safe alternative for patients with lipodystrophy and limited options in resource-limited settings and, therefore, should be avoided. It is necessary to scale-up the options for HIV-infected patients with lipodystrophy in resource-limited settings. Other strategies to manage with limited resources, as well as reconsideration of using stavudine in the first-line ART regimen in developing countries, should be evaluated.ART: Antiretroviral therapy;HAART: Highly active antiretroviral therapy; HIV: Human immunodeficiency virus; NNRTI: Non-nucleoside reverse transcriptase inhibitors. The author(s) declare that they have no competing interests.SS participated in the design of the study, clinical assessment of study patients, performed statistical analysis, and drafting the manuscript. SK participated in clinical assessment of patients and drafting the manuscript. AA participated in drafting the manuscript. KM participated in clinical assessment of study patients. SW participated in clinical assessment of patients and drafting the manuscript. BS participated in clinical assessment of patients and drafting the manuscript. All authors read and approved the final manuscript."}
+{"text": "Previous studies showed higher early mortality rates among patients treated with antiretroviral drugs in settings with limited resources. One of the reasons was late presentation of patients to care. With improved access to HIV services, we expect improvements in disease stage at presentation. Our objective was to assess the effect of improved availability of HIV services on patient presentation to care and subsequent pre-ART and on-ART outcomes.At Arba Minch Hospital in Ethiopia, we reviewed baseline characteristics and outcomes of 2191 adult HIV patients. Nearly a half were in WHO stage III at presentation. About two-thirds of the patients (1428) started ART. Patients enrolled in the early phase , men , and those aged 45 years and above  were at higher risk of being in advanced clinical stage at presentation. The pre-treatment mortality rate was 13.1 per 100 PYO, ranging from 1.4 in the rapid scale-up phase to 25.9 per 100 PYO in the early phase. A quarter of the patients were lost to follow-up before starting treatment. Being in less advanced stage , being in the recent cohort , and rural residence  were independent predictors of pre-ART loss to follow-up. Of those who started ART, 13.4% were lost to follow-up and 15.4% died. The survival improved during the study. Patients with advanced disease, men and older people had higher death rates.Patients started to present at earlier stages of their illness and death has decreased among adult HIV patients visiting Arba Minch Hospital. However, many patients were lost from pre-treatment follow-up. Early treatment start contributed to improved survival. Both pre-ART and on-ART patient retention mechanisms should be strengthened. Early diagnosis, timely initiation of treatment, and retention in care depend both on patient characteristics and health systems factors. The Ethiopian Ministry of Health (MOH) introduced ART in 2003 on subsidized, fee-based scheme, and ART became freely available since 2005. Further, ART was decentralized to health centres in 2006, which marked the rapid scale-up phase in the history of the Ethiopian ART programme. Not all patients who present at earlier stage of their illness are eligible for ART. Even when they are eligible for ART, prompt initiation of treatment will depend on several factors including availability of medicines and trained health workers. It is therefore likely that in settings with high disease burden and limited resources, some patients will either default from treatment or will even die before they are started on ART. Such pre-ART patient outcomes including death and loss rates are not adequately documented, as most of the literature has focused on outcomes after ART initiation. Here, we present data on stage shifting and pre-ART outcomes from a district hospital in southern Ethiopia. Our objective was to assess whether there had been a shift in disease stage at presentation and determine pre-ART and on-ART patient outcomes among patients enrolled in care over a six-year period.We did this study at Arba Minch Hospital, located 500 Km south of Addis Ababa. The hospital started providing ART in August 2003 with financial support from the Norwegian Lutheran Mission. When Ethiopia launched the \u2018free\u2019 ART programme in 2005, the hospital became part of the national scheme for ARV delivery. Since 2005, the MOH supplied ARVs and other HIV related commodities. In close coordination with the routine work and with technical support from the University of Bergen, Norway, we set up an HIV research cohort described in detail elsewhere. Patients received care according to the national HIV treatment guidelines During the early phase of ART in Ethiopia, generic combinations of stavudine (d4T), lamivudine (3TC), nevirapine (NVP), zidovudine (ZDV/AZT), and Efavirenz (EFV) were approved for useStavudine was given as 40 mg or 30 mg (depending on body weight) twice daily until the last 3 months (from the study closure) when the 40 mg became obsolete because of an increased toxicityTwo data clerks maintained both paper-based and electronic records of patient information. Using a data abstraction form as a guide, we recorded date of HIV testing, date of pre-ART enrolment, WHO clinical stage, CD4 count, total lymphocyte count (TLC), history of tuberculosis, pregnancy, age, sex, and place of residence for all patients directly into an SPSS data file. To ensure the inclusion of all relevant information in the database, we did thorough cleaning of the data, cross-checked with the paper records and included additional relevant variables between April and December, 2009. One of the investigators (ZM) supervised the cohort updating.We defined pre-ART patient outcome as: (a) \u2018still under pre-ART care\u2019-if patient was registered with the ART clinic of the hospital, had regular follow-up with the clinic and was not having follow-up at another health facility; (b) \u2018lost to follow-up, \u2018-if patient did not have follow-up visit at least 30 days after the last date of the next clinic appointment; (c) \u2018put on ART\u2019-if patient was started on ART in the hospital clinic; (d), \u2018died before starting ART\u2019-if patient was known to be dead as reported by treating clinicians or community health agents; and (e), \u2018transferred out\u2019-if patient moved to another health facility with confirmed written documentation of transfer out.In patients who were started on ART, we defined patients as lost to follow up if they did not attend the hospital within the previous 30 days. For lost to follow up patients we did an \u2018extended follow up\u2019 in 2009. \u2018Extended follow up\u2019 involved home visit or phone call using community health agents. The community health agents had completed high school education and received extra training on HIV/AIDS. After each visit, they reported the status of each patient to the data clerks.We defined the patient status after extended follow-up as: \u2018Died\u2019: if a family member, neighbour or community leader reported death of the patient. \u2018Under follow up at another health facility\u2019: if the patient was on treatment at any health facility in the region as reported by family, neighbours or community leaders. \u2018Stopped treatment but alive\u2019: if patient did not take ARVs for more than 1 month and the patient was alive and did not get ART elsewhere. \u2018On traditional treatment\u2019: if the patient reported that he or she used traditional medicines instead of ART. \u2018Left the region\u2019: if patient left the region as reported by family, neighbours or community leaders. Unknown (\u2018true loss\u2019): if no information was available about patient.In this study, we included all adult [age greater than 14 yrs], treatment-na\u00efve patients enrolled in the cohort from January 2003 through 31 December, 2008. The AMH HIV cohort was ethically cleared by the National Ethics Review Committee in Ethiopia. Patients gave informed written consent for HIV testing. Some of these patients were included in previously published prospective studies for which informed written consent was obtained. We used SPSS version 16 for data entry and analysis. In this analysis, we stratified the patient enrolment period into three phases: (i) January 2003-August 2006 (Early phase); (ii) September 2006-August 2007 ; and (iii) September 2007-December 2008 (Recent phase). We used this categorization based on the chronology of Ethiopia's ART scale-up To find out the risk factors for presenting at advanced disease stage, we used the logistic regression method. In the logistic regression analysis, we used WHO clinical stage dichotomized into advanced (Stages III and IV combined) vs. less advanced (Stages I&II combined) stages as the main outcome variable. Since CD4 testing was not available during the early phase, we did not use CD4 count cut-off points in this analysis. We included age, marital status, sex, and phase of enrolment in the final model, and reported the results as odds ratio (OR) with 95% confidence interval (CI).Then we estimated time to death and loss to follow-up using Kaplan-Meier and Cox regression methods. We then calculated the mortality and loss to follow up rates by dividing the total number of deaths and losses by the person-year of observation (PYO) for the three time periods mentioned above.Between January 2003 and 31 December 2008, we recruited and followed 2391 patients. After excluding children and treatment-experienced adults, 2191 patients were eligible for analysis see . Their mThe median time between HIV diagnosis and pre-ART enrolment was 1 day  with 49% of the patients being enrolled within same day of testing. The median time from pre-ART enrolment to ART initiation was 16 days . When stratified by year of enrolment, there was significant decline in the duration of pre-ART waiting time: 125.5 days in the early phase, 9 days in the rapid scale-up phase, and 15 days in the recent cohort .Patients with WHO stage III disease constituted 49.2%, stage II 19.4%, stage I 18.2%, stage IV 13.3% at the time of presentation to care. The recent cohort had the largest proportion of patients in stage II (33.9%) and the smallest in stage IV. Patients in the oldest cohort were more likely to be in advanced clinical stage compared with those in the recent cohort . Similarly, men compared to women , those aged 45 years and above versus younger ones  as well had higher risk of being in advanced WHO clinical stage. Also, being divorced, widowed or separated as compared with being married was associated with higher risk of being in advanced clinical stage. 3 , and 649 (62.5%) patients had CD4 values less than 200 cells/mm3. In 1288 patients with baseline TLC, the median value was 1300 cells/mm3 .The 1428 treatment na\u00efve patients who started ART contributed 2422.4 person years of observation (PYO). More than a half were women (53.6%), the mean age was 34 (SD \u200a=\u200a +/\u22128.8) years, over a half (53.2%) were married, and most (84.7%) were from urban areas. Baseline CD4 was available for 1037 patients  of the indications to start ART followed by TLC and clinical stage in 29.7% (424 Patients), CD4 only in 26.2% (374 patients), and clinical stage only in 3.6% (52 patients) of patients.As first line regimen, 606 patients (42.4%) received d4t/3TC/NVP and 564 patients (39.5%) received d4t/3TC/EFV. 136 patients (9.5%) received AZT/3TC/EFV, 110 patients (7.7%) received AZT/3TC/NVP and the remaining 12 patients (0.8%) received a TDF containing regimen.Overall, 2191 patients contributed 777.8 person-years of observation (PYO). The median time between enrolment and pre-ART outcome was 31 days . The pre-ART mortality rate was 13.1 per 100 PYO (102 deaths/777.8 PYO), with the highest mortality being during the early phase (84 deaths/323.9 PYO\u200a=\u200a25.9 per 100 PYO) and the lowest rate (4 deaths/287.8 PYO\u200a=\u200a1.4/100 PYO) during the rapid scale-up phase. Some increment in mortality was seen in the recent cohort (14 deaths/166 PYO\u200a=\u200a8.4 per 100 PYO).In adjusted Cox- regression analyses controlling for WHO stage, TLC, and Hgb, patients enrolled during the early phase were more likely to die compared with those in the rapid scale-up phase . Also, patients in advanced WHO stage compared to those in less advanced stage  and those having TLC less than or equal to the median value were more likely to die  during the pre-ART period. A quarter of the patients were lost to follow-up. Being in less advanced WHO clinical stage , being in the recent cohort compared to being in early phase , and being a rural resident  were independent predictors of loss to follow-up. Age, sex and marital status were not associated with being lost to follow-up. The median follow-up time was 17.7  months. At the end of the follow-up, 901 (63.1%) patients were alive and under follow-up, 191 (13.4%) were lost to follow up, 171 (12%) were transferred out, 161 (11.3%) had died, and four (0.3%) patients had stopped treatment .The loss to follow up rate was 8.2 per 100 PYO (191 patients per 2315 PYO). Of these 191 patients, we were able to trace 143 patients (response rate of 143/191 (75%)). Of the 143 patients, 58 (40.6%) patients had died, 29 (20.3%) were under follow up at another health institution, 20 (13.9%) had stopped treatment and were alive, 14 (9.8%) had left the region, 13 (9.1%) used traditional treatment, and in 9 (6.3%) patients the outcome remains unknown. We also traced and found the four patients who stopped treatment. Of these, one later restarted treatment, one had died and two patients were alive but did not restart treatment.The overall mortality rate was 9.1 per100 PYO (220 deaths per 2422.4 PYO). The survival of patients on ART improved during the study period  and 5 anHigher mortality was associated with advanced clinical stage at start of treatment , age over 45 years at presentation  and men had higher mortality rates than women  .3 died [7.9 deaths per 100 PYO] compared with 13 (2.7%) deaths in patients with CD4 count 200\u2013350 cells/mm3 .Mortality varied with baseline CD4 count: 67 (10.4%) patients with CD4 counts less than 200 cells/mmPatients now present themselves with less advanced disease than during the early years, and our data suggest that earlier treatment start is the main reason for improved survival. However, patients in the recent cohort, rural residents and those in less advanced disease stage were more likely to default before starting treatment. This is in addition to the already high on-ART loss to follow-up rate, which we confirmed in this long-term follow-up.The high pre-ART loss to follow-up rate is a worrying phenomenon. Of particular concern is the higher loss rate among patients with less advanced clinical stage who are likely to be engaged in risky sexual practices. Part of the underlying reasons for the high rate of loss among patients with less advanced disease stage could be lack of means for engaging them in care. Such patients often do not need treatment and prophylaxis for opportunistic infections. Prophylactic interventions such as isoniazid preventive therapy (IPT) are not widely implemented in the study setting, as is elsewhere in Ethiopia. Also, there was no mechanism for pre-ART patient tracing.There is limited data on trends in immune status at presentation among patients followed in settings with limited resources. In a cohort followed in a well-resourced setting in the US, there was no improvement in immune status at presentation after 16 years of follow-up. High rates of pre-ART mortality and loss to care were reported from South Africa, Uganda, and Cambodia. There are explanations for the higher mortality rate among the oldest cohort. Between January 2003 and August 2003, patients were followed without ART as there was none in the country. Ethiopia did not have a policy on ARV drug use until July 2002. Pre-ART loss to follow-up is a common but less clearly defined challenge in settings with limited resources. In Uganda, inadequate post-test counselling and competition from holistic and less stigmatizing traditional/spiritual healers were cited as the main reasons for pre-ART loss. Our on-ART loss to follow up rates are high, but comparable to findings from 10 African and Asian countries reported in a recent meta-analysis In our study about 20% of those lost to follow up were found to be receiving care in another health institution, suggesting that self-transfer of patients to ART centres of their preference is common. There is a need for strengthening communication between health institutions.The on-ART mortality rate (9.1 per 100 PYO) in our study is higher than rates from China (5.9 per100 PYO) As expected, we found that patients with advanced clinical disease or low CD4 count have higher risk of mortality. Possible causes of higher mortality rates among the older patients could be because older patients respond poorly to ART and experience more rapid clinical progression. Older patients are also at a higher risk of complications such as cancer and cardiovascular disease because of the combined effect of ageing, HIV infection and antiretroviral treatment In conclusion, patients visiting Arba Minch Hospital for HIV treatment have started to present at less advanced disease stages. This was accompanied by a decline in patient mortality rate. However, high rate of pre-ART loss to follow up especially among well-looking and rural patients appears to be a growing challenge. This suggests the need for strengthening the pre-ART phase of HIV care. Also, we documented high rate of loss to follow up of patients on ART. Thus, there is an urgent need to enhance the community tracing of patients defaulting. The country now uses adherence supporters (most of whom are PLHIV) as adherence counsellors and defaulter tracers.Health care workers in similar settings should pay more attention to clients who are likely to default during the pre-ART phase. More targeted counselling and follow-up is needed. Also, existing interventions such as IPT and management of other opportunistic infections could be used as incentives to engage patients in care."}
+{"text": "Risk of pneumocystosis after discontinuation of primary or secondary prophylaxis among HIV-infected patients before CD4 counts increase to \u2267200 cells/\u03bcL (early discontinuation) after receiving highly active antiretroviral therapy (HAART) is rarely investigated.Medical records of 660 HIV-infected patients with baseline CD4 counts <200 cells/\u03bcL who sought HIV care and received HAART at a university hospital in Taiwan between 1 April, 1997 and 30 September, 2007 were reviewed to assess the incidence rate of pneumocystosis after discontinuation of prophylaxis for pneumocystosis.The incidence rate of pneumocystosis after HAART was 2.81 per 100 person-years among 521 patients who did not initiate prophylaxis or had early discontinuation of prophylaxis, which was significantly higher than the incidence rate of 0.45 per 100 person-years among 139 patients who continued prophylaxis until CD4 counts increased to \u2267200 cells/\u03bcL . Among the 215 patients who had early discontinuation of prophylaxis after achievement of undetectable plasma HIV RNA load, the incidence rate of pneumocystosis was reduced to 0.31 per 100 person-years, which was similar to that of the patients who continued prophylaxis until CD4 counts increased to \u2267200 cells/\u03bcL .Compared with the risk of pneumocystosis among patients who continued prophylaxis until CD4 counts increased to \u2267200 cells/\u03bcL after HAART, the risk was significantly higher among patients who discontinued prophylaxis when CD4 counts remained <200 cells/\u03bcL, while the risk could be reduced among patients who achieved undetectable plasma HIV RNA load after HAART. Pneumocystis jirovecii pneumonia (formerly P. carinii pneumonia), disseminated Mycobacterium avium complex infection, and cytomegalovirus diseases, have significantly declined in patients receiving HAART [With the widespread use of highly active antiretroviral therapy (HAART) after 1996, HIV-related mortality and the risks of several major opportunistic infections, such as ng HAART . For exang HAART , which dng HAART . In the ng HAART .In the guidelines recommended by the National Institutes of Health, the Centers for Disease Control and Prevention, and the HIV Medicine Association of the Infectious Diseases Society of America , HIV-infProphylaxis or treatment with TMP-SMX is not without problem, however. Skin rashes and fever are the most common adverse effects of TMP-SMX in HIV-infected patients in addition to neutropenia, gastrointestinal intolerance or Stevens-Johnson syndrome . Due to In this study, we aimed to assess the risk of pneumocystosis among HIV-infected patients with baseline CD4 counts of <200 cells/\u03bcL who discontinued primary or secondary prophylaxis before their CD4 counts increased to \u2267200 cells/\u03bcL after receipt of HAART.Between 1 April, 1997 and 30 September, 2007, consecutive HIV-infected patients who sought HIV care at the National Taiwan University Hospital were enrolled in an observational study to assess the impact of HAART on the incidences of AIDS-defining opportunistic illnesses. The study protocol has been described before ,13. In bTo assess the impact of HAART on the incidence rate of pneumocystosis, we identified patients who had baseline CD4 counts of <200 cells/\u03bcL and had been followed up for more than 3 months. Patients who were lost to follow-up or died within 3 months of enrollment were excluded Figure .In Taiwan, HIV-infected patients are provided free-of-charge access to HIV care, including HAART that was introduced on 1 April, 1997, at several designated hospitals around Taiwan. HAART consists of two nucleoside reverse-transcriptase inhibitors plus non-nucleoside reverse-transcriptase inhibitors or protease inhibitors; or triple nucleoside reverse-transcriptase inhibitors. TMP-SMX (80/400 mg) has been the recommended treatment and prophylaxis for pneumocystosis. For those patients who are unable to tolerate TMP-SMX, prophylaxis or treatment is replaced with clindamycin plus primaquine . AtovaquAfter initiation of HAART, patients received follow-up at an interval of 1 to 3 months. Each visit included a medical history taking, a general physical examination, and laboratory tests including complete blood counts with differential count and blood biochemistry. CD4 count and PVL were determined before and 1 month after HAART and every 3-4 months thereafter. A chest radiograph and microbiological investigations were performed when patients presented with respiratory symptoms or a history of prolonged fevers or wasting.Pneumocystosis was confirmed when cytology or histopathology of respiratory specimens disclosed cysts or trophozoites by special stains; pneumocystosis was considered presumptive if the patients presented with typical symptoms , plus radiographic manifestations of interstitial pneumonitis who responded to any of the standard recommended treatments for pneumocystosis.Other than pneumocystosis, we also assessed the incidence of bacterial infection and parasitic infection after discontinuation of primary or secondary prophylaxis. A diagnosis of bacterial infection was made on microscopy and cultures of relevant clinical specimens and a compatible clinical history that included an acute onset of symptoms, with a response to anti-bacterials that have no known activity against pneumocystosis. Parasitic infections of interest were amebiasis, giardiasis, cryptosporidiosis, isoporiasis, cyclosporiasis, and toxoplasma encephalitis. The study was approved by Research Ethics Committee of the National Taiwan University Hospital on 25 July, 2001 (reference number: 19011). The study was conducted through periodic review of medical records retrospectively and was waived for informed consent.The observation duration for occurrence of pneumocystosis was estimated from the date of discontinuation of primary or secondary prophylaxis to the date of diagnosis of pneumocystosis, loss to follow-up at this hospital, or death, or the end of the study on 31 December, 2007, whichever occurred first. For patients who discontinued primary or secondary prophylaxis before the CD4 counts increased to 200 cells/\u03bcL (early discontinuation), the end date of observation was the mid-point between the last date when the patient's CD4 count was <200 cells/\u03bcL and the first date when the patient's CD4 count increased to \u2267200 cells/\u03bcL.2 by Fisher exact test (2-tailed). The incidence rate for each group was calculated as the number of cases of pneumocystosis, bacterial infection or parasitic infection per 100 PY of observation. Exact 95% confidence intervals (95% CI) for incidence rates were calculated on the basis of the Poisson distribution.All statistical analyses were performed using statistical software programs . Categorical variables were expressed as proportions and compared using \u03c7Between April 1997 and September 2007, 660 patients fulfilled the inclusion criteria  and had a lower baseline CD4 count , while both groups of patients had similar baseline PVL . Forty-seven (16.8%) patients were lost to follow-up in this group.Among the 279 patients who received primary prophylaxis for pneumocystosis, 211 (75.6%) had early discontinuation of prophylaxis, and 68 (24.4%) continued prophylaxis until CD4 increased to \u2267200 cells/\u03bcL (Table P = 0.006), had a lower baseline CD4 count  and had a lower baseline PVL   had early discontinuation of prophylaxis, and 71 (32.9%) continued prophylaxis until CD4 increased to \u2267200 cells/\u03bcL . Although CD4 counts continued to increase with HAART (data not shown), the median CD4 count of patients who had early discontinuation of prophylaxis at the end of observation was significantly lower than that of the patients who continued prophylaxis until CD4 increased to \u2267200 cells/\u03bcL (200 vs. 376 cells/\u03bcL) (table The median duration of secondary prophylaxis for pneumocystosis was significantly shorter for the 145 patients who had early discontinuation of prophylaxis than for the 71 patients who continued prophylaxis until CD4 increased to \u2267200 cells/\u03bcL (2.7 vs. 4.0 months). The median CD4 count of the patients who had early discontinuation of prophylaxis at the end of observation was also lower than that of the patients who continued prophylaxis until CD4 increased to \u2267200 cells/\u03bcL (200 vs. 426 cells/\u03bcL)  after follow-up for 7.6 months while they continued HAART.P < 0.001). The types of bacterial infections of the former group included skin and soft tissue infections (34 cases), community-acquired pneumonia (7), urinary tract infection (5) and bacteremia due to methicillin-resistant Staphylococcus aureus, non-tuberculous mycobacteria or non-typhoid Salmonella (7). Two episodes of parasitic infection (toxoplasmosis), with an incidence rate of 0.54 per 100 PY , occurred in the patients who had early discontinuation of primary prophylaxis.The crude incidence of adverse effects of primary prophylaxis with TMP-SMX was estimated 23.3%, which included skin rashes (13.3%), leucopenia (6.8%), gastrointestinal intolerance (2.9%), and Stevens-Johnson syndrome (0.4%). Among the 211 patients who had early discontinuation of primary prophylaxis, 11 cases of pneumocystosis were diagnosed after an observation duration of 366 PY . These 11 episodes of presumptive diagnosis of pneumocystosis occurred in patients with a median CD4 count of 33 cells/\u03bcL  after a median observation of 13.7 months  in the absence of primary prophylaxis. Those episodes occurred in patients with frequent losses to follow-up for more than 1 year (9 patients) or poor compliance with HAART (2). Among the 68 patients who discontinued primary prophylaxis after CD4 counts increased to \u2267200 cells/\u03bcL, 1 case of pneumocystosis was diagnosed with an incidence rate of 0.43 per 100 PY . In the meantime, 53 episodes of bacterial infections were diagnosed in patients who had early discontinuation of primary prophylaxis, yielding an incidence rate of 14.48 per 100 PY , while 13 episodes were diagnosed in the patients who discontinued primary prophylaxis after CD4 counts increased to \u2267200 cells/\u03bcL, yielding an incidence rate of 5.56 per 100 PY  . Two episodes of parasitic infections (one amebiasis and one giardiasis), occurred in patients who had early discontinuation of secondary prophylaxis, yielding an incidence rate of 0.83 per 100 PY .Forty-seven patients 21.8%) developed adverse effects that prompted discontinuation of secondary prophylaxis; those adverse effects included skin rashes (17.6%), gastrointestinal intolerance (2.3%) and leucopenia (1.9%). Among the 145 patients who had early discontinuation of secondary prophylaxis, 6 cases of pneumocystosis were diagnosed with an incidence rate of 2.49 per 100 PY  .The incidence rate of pneumocystosis in 165 patients with baseline CD4 counts of <200 cells/\u03bcL who did not receive either primary or secondary prophylaxis for pneumocystosis was 2.88 per 100 PY  (Table P = 0.03) after adjustment for age, sex, risk for HIV transmission, and baseline CD4 and PVL.When patients who did not initiate prophylaxis or had early discontinuation of prophylaxis for pneumocystosis were analyzed together, 20 cases of pneumocystosis developed after a total observation duration of 711 PY, with an incidence rate of 2.81 per 100 PY . Among the 139 patients who continued primary or secondary prophylaxis after CD4 counts increased to \u2267200 cells/\u03bcL after HAART, 2 cases of pneumocystosis developed after a total observation duration of 444 PY, with an incidence rate of 0.45 per 100 PY . The risk of pneumocystosis was significantly higher in the former group of patients than in the latter group, with a risk ratio of 5.32  when the risk of these patients compared to that of the patients who discontinued primary or secondary prophylaxis after CD4 counts increased to \u2267200 cells/\u03bcL.Among the 215 patients who achieved undetectable PVL and had early discontinuation of primary of secondary prophylaxis for pneumocystosis, only one patient developed pneumocystosis after a total observation duration of 323 PY . The adjusted risk ratio for pneumocystosis was 0.63 (95% CI, 0.03, 14.89; In this study, we have found that, compared with the patients who continued primary or secondary prophylaxis for pneumocystosis until CD4 counts increased to \u2267200 cells/\u03bcL after HAART, patients who had early discontinuation of prophylaxis were at a significantly higher risk for pneumocystosis, especially among those patients who did not adhere to HAART. In the subgroup analysis, the risk of pneumocystosis could be significantly reduced if the patients who had early discontinuation of prophylaxis complied with HAART and achieved undetectable PVL.The incidence rate of pneumocystosis following discontinuation of primary and secondary prophylaxis among HIV-infected patients when their CD4 counts increased to \u2267200 cells/\u03bcL after receiving HAART in published studies ranges from 0 to 2.27 cases per 100 PY of follow-up, depending on the types of study design and observation duration ,11,15-25Discontinuation of prophylaxis before CD4 counts increase to \u2267200 cells/\u03bcL after HAART has been performed in some selected patients in published observational studies ,15,17. IEarlier discontinuation of TMP-SMX or other alternatives in the patients with increasing CD4 counts may reduce pill burden, risk for adverse effects of TMP-SMX that was noted in one fourth of our patients, and risk for emergence of drug-resistant bacteria -28. HoweOur findings that most of the cases of pneumocystosis occurred in patients who did not have good adherence to HAART and HIV care should alert clinicians and patients with respect to the risk for pneumocystosis if decision of early discontinuation of prophylaxis has to be made in the face of adverse effects of antibacterial agents. For those who have to discontinue primary or secondary prophylaxis due to intolerance or adverse effects, adherence to HAART can not be overemphasized. Reinstitution of prophylaxis should be considered once immunologic failure occurs after virologic failure to HAART due to poor compliance and emergence of HIV that is antiretroviral-resistant.There are several limitations of our study and interpretation of our study should be cautious. First, this is not a clinical trial to compare the risk for pneumocystosis between patients who discontinue primary or secondary prophylaxis when their CD4 counts remain < 200 cells/\u03bcL and those who discontinue prophylaxis when their CD4 counts increase to \u2267200 cells/\u03bcL. Second, the decision of discontinuation of prophylaxis was made by treating physicians based on individualized assessment, which may be affected by uncontrolled factors. By medical record review, we were not able to know the reasons why the treating physicians discontinued prophylaxis earlier before CD4 increased to the recommended cut-off value by the guidelines. Third, the diagnosis of pneumocystosis was based on clinical suspicion and an appropriate response to any of the recommended standard treatments and the absence of evidence of bacterial pneumonia. All of our diagnoses were presumptive, not definitive. Fourth, the results of this study of early discontinuation of pneumocystosis prophylaxis may not be generalized to the patients with virologic and immunological failure or the patients with limited access to HAART and HIV care. Last, the benefits of TMP-SMX in resource-limited settings are multiple in addition to its low cost, and continuation of TMP-SMX can protect patients from several bacterial or parasitic infections -33. In sThe overall risk of pneumocystosis in patients on HAART was low in Taiwan. Patients who had early discontinuation of prophylaxis for pneumocystosis were associated with a higher risk of pneumocystosis and bacterial infections than those who continued prophylaxis until CD4 increased to \u2267200 cells/\u03bcL after HAART. The risk of pneumocystosis was lower in those patients who had early discontinuation of prophylaxis while achieving complete virologic response to HAART.95% CI: 95%confidence interval; HAART: highly active antiretroviral therapy; HIV: human immunodeficiency virus; PVL: plasma HIV RNA load; 100 PY: 100 person-years; TMP-SMX: trimethoprim-sulfamethoxazoleThe authors declare that they have no competing interests.CYC, MYC, and CCH conceived of the study, and participated in its design and coordination. CYC, WHS, WCL, and CCH reviewed the medical records. CYC, WHS, HYS, YCL analyzed and interpreted the data. CYC, SMH, CCH drafted the manuscript. All authors read and approved the final manuscript.The pre-publication history for this paper can be accessed here:http://www.biomedcentral.com/1471-2334/10/126/prepub"}
+{"text": "The rising temperature of the world's oceans has become a major threat to coral reefs globally as the severity and frequency of mass coral bleaching and mortality events increase. In 2005, high ocean temperatures in the tropical Atlantic and Caribbean resulted in the most severe bleaching event ever recorded in the basin.Satellite-based tools provided warnings for coral reef managers and scientists, guiding both the timing and location of researchers' field observations as anomalously warm conditions developed and spread across the greater Caribbean region from June to October 2005. Field surveys of bleaching and mortality exceeded prior efforts in detail and extent, and provided a new standard for documenting the effects of bleaching and for testing nowcast and forecast products. Collaborators from 22 countries undertook the most comprehensive documentation of basin-scale bleaching to date and found that over 80% of corals bleached and over 40% died at many sites. The most severe bleaching coincided with waters nearest a western Atlantic warm pool that was centered off the northern end of the Lesser Antilles.Thermal stress during the 2005 event exceeded any observed from the Caribbean in the prior 20 years, and regionally-averaged temperatures were the warmest in over 150 years. Comparison of satellite data against field surveys demonstrated a significant predictive relationship between accumulated heat stress  and bleaching intensity. This severe, widespread bleaching and mortality will undoubtedly have long-term consequences for reef ecosystems and suggests a troubled future for tropical marine ecosystems under a warming climate. Satellite-based sea surface temperature (SST) observations from the U.S. National Oceanic and Atmospheric Administration (NOAA) NOAA's Coral Reef Watch (CRW) developed and maintains a suite of operational satellite sea surface temperature (SST)-based products that provide coral bleaching nowcasts and alerts NOAA measured sustained thermal stress in 2005 that exceeded 16\u00b0C-weeks in some regions, far greater than the thresholds that have usually been associated with the onset of mass coral bleaching (DHW \u200a=\u200a4\u00b0C-weeks) and mortality (DHW \u200a=\u200a8\u00b0C-weeks) The timeline for the geographic spread of the 2005 Caribbean thermal stress was decomposed into seven major phases as identified in i.e., states, territories) in 22 countries  deployed throughout the region to monitor the bleaching event as it developed, and subsequently to monitor coral mortality. Coral bleaching, other disease conditions, and mortality extended across the entire Caribbean \u2013 bleaching was especially intense along the Antilles , and wasountries . After qMillepora alcicornis and Montastraea cavernosa colonies; and the first reported mass bleaching of Acropora palmata in Virgin Islands National Park (VINP), a species listed as threatened under the US Endangered Species Act (ESA) since 2006 Several species and sites were reported to bleach for the first time, including: the first known bleaching at Saba; the first documented mass bleaching of the Flower Garden Banks, including at least partial bleaching of all Surveys conducted from the peak of thermal stress through January 2007 were analyzed to assess coral mortality. Detailed and repeated monitoring revealed that a combination of bleaching and other disease outbreaks killed coral colonies stressed by high temperatures A. palmataA. palmata also revealed that bleached corals suffered greater disease-associated mortality than unbleached colonies, indicating that disease severity was dependent on host susceptibility Montastraea annularis species complex, which are now under consideration for ESA protection In the Florida Keys in 2005, bleaching was less severe than in the Caribbean proper. However, increased temperatures were quickly followed by a loss of resistance to pathogenic disease and an increased abundance of microbial pathogens in e.g., hydrodynamics, light, community composition). Consistent with CRW's previously established bleaching levels, significant coral bleaching began near 4\u00b0C-weeks . Despite local variability, thermal stress values exceeding approximately 8\u00b0C-weeks successfully predicted significant mortality. Thermal stress of this magnitude should be weighed carefully by reef managers. In 2005, little mortality was seen below 8\u00b0C-weeks of thermal stress while above it there was an ecologically important 1-in-3 risk of mortality. The slow rate of recovery seen in Caribbean reefs In the areas where thermal stress levels were less than 8\u00b0C-weeks, significant mortality was rare  was attributable to monotonic climate change, while only 0.2\u00b0C was attributable to the weak 2004\u201305 El Ni\u00f1o, and even less to the Atlantic Multi-decadal Oscillation (<0.1\u00b0C). Despite the lack of strong tropical forcing, 2005 fell among the warmest years on record Unlike many past Caribbean bleaching years, strong tropical climate forcing was only a minor driver of Caribbean SSTs in 2005. In their analysis of temperature anomalies across the tropical North Atlantic in 2005, Trenberth and Shea Dennis, Emily, Katrina, Rita, Wilma) were strong enough to reduce the Caribbean-average HotSpots  thermal stress products used in this study were based on nighttime-only Advanced Very High Resolution Radiometer (AVHRR) sea surface temperature (SST) data from sensors aboard operational NOAA Polar-Orbiting Environmental Satellites (POES), produced in near-real-time at 0.5-degree (50-km) spatial resolution. SST anomalies compared the measured temperature with the expected value at that time of year for each pixel. HotSpots were computed as positive anomalies above the mean temperature of the climatologically warmest month at each satellite data pixel, based on the NOAA operational climatology from years 1985\u20131990 and 1993. Degree Heating Weeks (DHWs) for any given time accumulated HotSpot values \u22651\u00b0C over the preceding 12-week period The DHW map  includedCRW operational products were first made available on 12-Sep-2000. The 22-year time series of annual maximum DHW  was prodn) and total number of colonies surveyed (N), or both; and/or 2) measures of coral mortality as coral cover dead (%), number of coral colonies dead (n) and total number of colonies surveyed (N), or both; 3) average observation depth (m); 4) observation date; and 5) observation location, including latitude, longitude, and reef site name. Data were quality controlled to exclude observations that met any of the following criteria: 1) bleaching observations taken before the onset of thermal stress ; 2) bleaching observations taken after subsidence of thermal stress, defined as the 90th day following the date of the last No Stress alert in 2005; and 3) mortality observations taken before the maximum DHW value occurred in 2005. Multiple observations (quadrats or transects) taken at any reef site on the same date and depth (\u00b15 m) were combined into a single survey of either means of percent cover data or proportion of the number of colonies surveyed. The 2575 bleaching surveys used in this analysis  measures of coral bleaching as coral cover bleached (%), number of coral colonies bleached . Given the variability of monitoring techniques employed, sampling errors within each technique, and local factors at individual reef sites , the explicative power of the satellite metric  supported the predictive relationship between the thermal stress monitored by CRW satellite products and the observed bleaching during this event. However, it was clear that inclusion of other information, including higher spatial resolution SST-based products, may further refine bleaching predictions in the future.Operational satellite products from the co-located (or next-nearest) satellite pixel were compared with all field observations . A lineai.e., the maximum DHW) within a pixel and were analyzed against the maximum thermal stress . Surface temperatures in this region remained above climatological values throughout the May-December period, with no respite from thermal stress  averaged across the 0.5-degree pixels that contained or were nearest Caribbean reef locations . The \u2018+\u2019 symbols indicate the average climatological temperature during each month and the dashed line shows the maximum of these, an indication of the expected warmest  temperature. The SST trace shows that, on average, temperatures around Caribbean reefs exceeded climatological values by close to 1\u00b0C for a period of more than four months. The magnitude and extended duration of the basin-wide thermal anomaly resulted in widespread coral bleaching and lowered the ability of corals to resist other disease conditions.(0.69 MB ZIP)Click here for additional data file.Figure S2Animation of the development of thermal stress during the 2005 Caribbean bleaching event, measured using NOAA Coral Reef Watch Degree Heating Week product from 4 June 2005 to 14 February 2006 with a pause during the peak of the event at 28 October 2005.(5.54 MB TIF)Click here for additional data file.Figure S3Locations of 2575 bleaching surveys submitted from sites across the greater Caribbean region. Colors denote number of surveys at each of the 1212 sites. See (0.18 MB TIF)Click here for additional data file.Figure S42\u200a=\u200a0.26; colonies slope \u200a=\u200a3.43, intercept \u200a=\u200a29.46, df \u200a=\u200a304, p<0.0001, r2\u200a=\u200a0.24) and indicated no difference in slopes, suggesting comparable results.Comparison of bleaching survey methods. All observations of percent coral colonies (gray circles) and cover (black diamonds) are plotted versus observed Degree Heating Week (DHW). Linear regressions for colonies (gray line) and cover (black line) were highly significant Click here for additional data file.Table S1Complete data record for all survey data used in the analyses. Multiple observations from the same reef site, date and depth (\u00b15 m) were combined as either means of percent cover data or proportion of the number of colonies surveyed to provide 2575 bleaching surveys and 1077 mortality surveys.(0.17 MB PDF)Click here for additional data file."}
+{"text": "MicroRNAs (miRNAs) are a category of small RNAs that constitute a new layer of complexity to gene regulation within the cell, which has provided new perspectives in understanding cancer biology. The deregulation of miRNAs contributes critically to the development and pathophysiology of a number of cancers. miRNAs have been found to participate in cell transformation and multiplication by acting as tumour oncogenes or suppressors; therefore, harnessing miRNAs may provide promising cancer therapeutics. Another major function of miRNAs is their activity as critical regulatory vehicles eliciting important regulatory processes in anti-tumour immunity through their influence on the development, differentiation and activation of various immune cells of both innate and adaptive immunity. This review aims to summarise recent findings focusing on the regulatory mechanisms of the development, differentiation, and proliferative aspects of the major immune populations by a diverse profile of miRNAs and may enrich our current understanding of the involvement of miRNAs in anti-tumour immunity. MicroRNAs (miRNAs) are a group of small non-coding RNA molecules that play a central role in a number of biological processes through the post-transcriptional regulation of gene expression. This class of molecules provides the relevant regulation epigenetically in addition to the major categories of DNA methylation, histone deacetylation, chromatin remodelling, gene imprinting, and noncoding RNA regulation .miRNAs have been shown to be critical contributors in the pathogenesis of many diseases including cancer. On one hand, miRNAs present as potential future diagnostic and prognostic markers and as viable therapeutic targets for cancer treatment \u20134. On thThere are two major arms of the immune system, known as the innate and adaptive immune responses, which work in a complementary manner to help the body maintain its healthy status. The major players of the innate immune system that provide the first line of defence are natural killer (NK) cells, \u03b3\u03b4 T cells and macrophages. These cells, together with some inflammatory cytokines, critically defend the barriers at the mucosal and cutaneous levels. In the adaptive immune system, specificity and memory are the two key characteristics that are absent in the innate immune system. Dendritic cells (DC), B cells and T cells are the three cooperating major cell types that constitute the adaptive immune system.Some lineage-specific miRNAs have been found to play a key role in regulating various developmental stages of the lineage development of the two major arms and thus affect different cell types in the mature state and their progenitor counterparts . miRNAs One of the important cell types for the first line of defence of the immune system is the epithelial cell population that expresses some pathogen pattern recognition receptors, including the Toll-like receptors (TLRs), which recognise pathogen-associated molecular patterns and can induce strong pro-inflammatory responses . In the Another major cell population of the innate immune response is the macrophages. Tissue macrophages detect pathogens through TLRs and after phagocytosing these pathogens, initiate the innate immune responses . MacrophMacrophage subsets include the \u2018classically activated\u2019 pro-inflammatory (M1) and \u2018alternatively activated\u2019 anti-inflammatory (M2) cells . The tramiRNAs, such as miR-222 and miR-339, have also been implicated in the expression of adhesion and costimulatory molecules, including the intercellular adhesion molecule 1 (ICAM1), which is essential in the interactions of innate immune cells . miR-125et al.[NK cells are essential innate immune components with potent cytotoxicity and type I IFN (INF-\u03b1) initiation capability. Wang et al. reportedAnother important cytokine produced by NK cells is TNF-\u03b1. The up-regulation of miR-30c-1* is now known to trigger the overexpression of transmembrane TNF-\u03b1, which in turn enhances NK cell cytotoxicity against the hepatoma cell lines SMMC-7721 and HepG2 by targeting the transcriptional repressor gene HMBOX1 ,24. In cmiRNAs play an important role in the early differentiation of B cells and act as regulators of the immune response by T cells and DCs in adaptive immunity. Great efforts have been made to demonstrate the role of miRNAs in adaptive immune cells in recent years. The expression of the transcription factors for B-cell development has been found to be precise and time-specific under the influence of a few miRNAs on B cells at various maturation stages. It is evident that the alteration of miRNA expression may lead to important functions in cellular differentiation and be associated with the activation status of the mature B cells in the immune system . The rolThe expression of miR-150 was shown to block the transition from the pro-B to pre-B stage, likely through the down-regulation of c-MYB \u201330. miR-The association of miR-155 with the primary transcript of the host gene BIC was observed in preleukaemic pre\u2013B-cell proliferation in the spleen and bone marrow of transgenic mice ,32. The et al.[The over-expression of miR-21 has been found in a number of tumour types. Medina et al. demonstret al.. miR-125et al.[in situ hybridisation technique. Several miRNAs were elevated in GC B cells, such as miR-17-5p, miR-106a and miR-181b, whereas the gradual decrease in the staining intensity of these three miRNAs from the dark to light zone was observed in GC. miR-150 was the most abundant in all three B-cell subsets.The deregulation of miR-181a, miR-181b, miR-107 and miR-424 was found to lead to the subsequent overexpression of the oncogenic transcription factor pleomorphic adenoma gene 1 (PLAG1) in a number of chronic lymphocytic leukaemia (CLL) cases ,37. CLL et al. characteIn a study of the expression of a panel of 15 miRNAs in some DLBCL cases, the expression of miR-17-5p was significantly higher in central nervous system diffuse large B cell lymphoma (DLBCL) than in testicular DLBCL, and miR-127 was found to be highly expressed in testicular DLBCL compared with central nervous system DLBCL .et al.[Iqbal et al. identifiet al..et al.[et al.[The PI3K/PTEN/AKT pathway is one of the key signalling pathways involved in the regulation of cell growth. The frequent dysregulation of the PI3K/PTEN pathway in human cancer demonstrates that this pathway is an appropriate target for cancer therapeutics . Hafsi eet al. suggesteet al.. A commol.[et al. demonstrin vivo.miRNAs have been shown to be involved in the regulation of T-cell responses, with a dynamic expression pattern relative to the various stages of T cell development. miR-135b was reported to mediate nucleophosmin-anaplastic lymphoma kinase (NPM-ALK)-driven oncogenicity and induce the immunophenotype of IL-17 in anaplastic large cell lymphoma (ALCL). Oncogene NPM-ALK strongly promoted miR-135b expression through the activation of transducer and activator of transcription (STAT) 3, and the elevated miR-135b targets FOXO1, a transcription factor regulating gluconeogenesis and glyconeogensis via insulin signalling in ALCL cells. Chemosensitivity in Jurkat cell line was found to be decreased by miR-135b . FurtherNKG2D, encoded by the KLRK1 gene, is one of the activating immunoreceptors found on CD8 T cells and NK cells, and its ligands are stress-inducible proteins, including ULBP1, that enable the recognition and lysis of tumour cells. Some miRNAs were shown to be involved in the post-transcriptional regulation of ULBP1 expression in Jurkat and HeLa cells. Among these miRNAs, miR-140-5p, miR-409-3p, miR-433-3p and miR-650 are involved in the regulation of ULBP1 expression [DCs are found in almost all peripheral tissues and in primary and secondary lymphoid organs. The antigen presentation of DC controls immunity and tolerance, is linked with almost all types of immune cells and plays major roles in regulation of immune responses .et al.[Cubillos-Ruiz et al. took advet al.. Thus, t+ CD4+ T regulatory cell differentiation were shown in BMDCs by the transfection of miR-23b, likely through the inhibition of the transmembrane protein family member NOTCH1 and the NF-\u03baB signalling pathway [Concerning the tolerogenic property of DCs, miR-23b may be one of the entry points in targeting the therapeutic management of allergies. The upregulation of miR-23b could be observed in bone marrow DCs (BMDCs) by ovalbumin in a murine model. Increased IL-10 levels, decreased IL-12 levels and an enhancement of the FOXP3 pathway . Similaret al.[Some miRNAs, such as miR-146a and miR-155, may act as checkpoints in the cellular differentiation aspect of the immune system [et al. demonstret al.. miR-511et al..Cancer, as a result of a complicated multi-step process, involves the accumulation of sequential genomic alterations, including those of miRNAs, and can be characterised by uncontrolled proliferation, invasion and metastasis . IncreasCancers are the major causes of mortality and morbidity in industrialised countries. Some concepts related to the mechanisms of the modulation of both innate and adaptive immune cells leading to anti-tumour effects will contribute to the regulation of carcinogenic processes and associated inflammatory effects. The strong balance between anti-tumour immunity and proinflammatory activity caused by the tumour in the tumour microenvironment niche may weaken anti-tumour immunity. The modulation of immune cells targeted for therapeutic intervention in malignant diseases may restore the sensitivity of cancer cells to chemotherapies. miRNAs should be analysed with nuclear factors, such as NF-\u03baB, that serve as molecular links between inflammation and tumour progression .With an increasing number of studies showing that miRNAs could function as oncosuppressors, the exploration of miRNA-based anticancer therapies was conducted to improve the response to current targeted cancer treatments. This improvement will provide the essential enhancement of the capability of targeting multiple effectors in pathways involving cancer cell proliferation and survival .Some malignant diseases are developed in association with tumour viruses, and a number of studies have illustrated miRNAs as critical regulators of tumour pathways in which the dysregulation of cellular miRNA expression could promote tumour formation. Tumour viruses encode their own miRNAs, which manipulate the expression of cellular miRNAs to modulate the host cellular environment and in turn facilitate their respective infection cycles. The modulation of miRNA expression might influence the signal transduction cascades that favour tumourigenesis .Dicer-mediated expression of miR-222 and miR-339 demonstrated the promoting effect on the immunoresistance of cancer cells through the regulation of the intercellular adhesion molecule ICAM1. miR-222 and miR-339 were found to be specifically down-regulated by the alteration of dicer expression in both colorectal and glioblastoma cell lines , suggestin vitro and in vivo through the inhibition of tumour cell proliferation and the induction of apoptosis, which was found to be associated with the IL-23-induced up-regulation of miR-15a expression and the consequent down-regulation of BCL-2 protein expression in paediatric B-ALL cells [miRNA expression has been found to be associated with the clinical outcome of patients and with drug resistance, which was described in B-CLL, lung cancer  and B-ALLL cells . A similLL cells .in vivo by regulating PTEN and BIM [ALL and AML were demonstrated to have different miRNA expression patterns . Moreove and BIM .miRNAs are involved in gynaecological disorders affecting the ovary or uterus, frequently affected by endometriosis, which is classified as a tumour lesion, and in malignant gynaecological diseases including endometrial, cervical and ovarian cancers. Emerging evidence has shown that deregulated miRNA expression might be involved in the multifactorial and polygenic diseases of endometriosis and that miRNAs appear to be potent regulators of gene expression in endometriosis, resulting in the prospect of using miRNAs as biomarkers or therapeutic measures for these cancers .et al.[A significant decrease in the expression of miR-424 was observed in a number of cervical cancer tissue samples, which was positively correlated with poor prognostic clinicopathological parameters. The tumour suppressive role of miR-424 in the progression of cervical cancer via the up-regulated expression of CHK1 and p-CHK1 suggested miR-424 as a probable anticancer therapeutic target for cervical cancer patients . Similaret al. also foumiR-206 was found to be significantly down-regulated in laryngeal squamous cell carcinoma (LSCC) tissue, and its transfection decreases the expression of vascular endothelial growth factor (VEGF) in LSCC cells, contributing to the tumour suppression function of miR-206 .The high level of expression of miR-92  and overin vitro and in vivo, most likely via targeting the transcription factor gene SP1 directly and the apoptosis regulator gene BCL-W indirectly [in vitro, most likely via the pro-metastatic gene radixin (RDX) [A relatively higher expression of miR-21 was exhibited in gastric cancer tissue. miR-21 might be involved in the initiation and development of gastric cancer by regulating the PTEN expression level . miR-223directly . miR-409in (RDX)  and the in (RDX) .Down-regulation of miR-155 was observed in gastric cancer cell lines. miR-155 might act as a tumour suppressor through the repression of its target gene SMAD2, which encodes a signal transducer and transcription modulator protein involved in multiple signalling pathways . SimilarThe exploration of deregulated miRNAs in gastrointestinal tumours could contribute essential data for the possible development of novel cancer gene therapies .The over-expression of miR-519d was found to have an oncogenic role in hepatocellular carcinoma (HCC) with promoting effects on cell proliferation, invasion and apoptotic impairment by directly targeting the tumour suppressor gene PTEN, insulin regulating gene AKT3 and endothelial suppressing gene TIMP2 . In addimiR-330 was found to act post-transcriptionally by regulating deoxycytidine kinase (DCK) mRNA expression, which is essential for the phosphorylation of natural deoxyribonucleosides and their nucleoside analogues, which are widely used as anticancer compounds, including gemcitabine and cytarabine . Elevateet al.[miRNAs are involved in the pathogenesis of prostate cancer, and their roles as oncogenes, tumour suppressors and metastasis regulators lead to the hope that they might be molecularly targeted as diagnostic or prognostic markers for the treatment of prostate cancer . Fuse etet al. demonstret al.. Figure Emerging evidence has shown that miRNAs are important modulators in cancer pathogenesis within the bigger picture of how cells are transformed into malignant cells and multiply in an uncontrolled manner, followed by tissue invasion and metastasis. Equally, research has also indicated that miRNAs can be effective inhibitors as anti-tumour agents. In this regard, an example such as the antisense-based inhibition of a specific miRNA has been found to be useful due to the enhancement of the corresponding anti-tumour immunity .The development of plasma-circulating miRNA detection and expression profiles, which have been found in association with a range of tumour types, can also be used in therapeutic strategies ,106 and Mechanisms of resistance in anticancer treatment have been postulated to be associated with the altered expression of the ATP-binding cassette family of transporters involved in cell membrane transportation. Thus, the emerging role of miRNAs as key gene expression regulators in drug resistance can be the specific mechanism involved in combating the resistance to tyrosine kinase inhibitors in chronic myeloid leukaemia . An undeTechniques that restore the activity of tumour suppressor miRNAs by the inhibition of oncogenic miRNAs using single-stranded antisense oligonucleotides or antimiR have been recently employed for the development of miRNA-based cancer therapeutics \u2013113. In in vivo in a xenograft model [in vitro in a number of cellular models [To target miRNAs in cancer, one strategy involves hindering the oncomir from expression or rebuilding the corresponding tumour suppressor miRNA that might have lost in the cancer. The apoptosis of leukaemic MEG01 could be induced through the reintroduction of miR-15a and miR-16-1, which were shown to inhibit tumour growth ft model , and silr models . Althougr models ,118, nevr models .The quantification of extracellular miRNAs in the blood circulation of both healthy and diseased patients was discovered to be confined to the lipid or lipoprotein complexes, such as microvesicles, exosomes or apoptotic bodies, which were highly stable . These cDifferent studies have reported conflicting findings or inconsistencies regarding miRNAs from the same tumour, as shown in"}
+{"text": "Helicobacter pylori (H. pylori) infection is the main cause of gastritis, gastro-duodenal ulcer, and gastric cancer. MicroRNAs (miRNAs) are small noncoding RNAs that function as endogenous silencers of numerous target genes. Many miRNA genes are expressed in a tissue-specific manner and play important roles in cell proliferation, apoptosis, and differentiation. Recent discoveries have shed new light on the involvement of miRNAs in gastric malignancy. However, at the same time, several miRNAs have been associated with opposing events, leading to reduced inflammation, inhibition of malignancy, and increased apoptosis of transformed cells. The regulation of miRNA expression could be a novel strategy in the chemoprevention of human gastric malignancy. In this article, the biological importance of miRNAs in gastric malignancy is summarized. Helicobacter pylori (H. pylori) infection is one of the most prevalent infectious diseases worldwide, and is estimated to affect 40%\u201350% of the world population . Th. ThmiR-1miR-25, miR-93, miR-106b, and miR-130 inhibit apoptosis by preventing the expression of the pro-apoptotic protein, Bim  and anti-apoptotic  proteins from the Bcl-2 (B cell lymphoma 2) superfamily. Some miRNAs overexpressed in gastric cancer function as oncogenic miRNAs by targeting members of the pro-apoptotic proteins. ein, Bim  14]..miR-25, miR-15b, miR-16, miR-34, miR-181b, miR-181c, and miR-497) target anti-apoptotic Bcl-2. These miRNA clusters are downregulated in gastric cancer cells, leading to increased expression of Bcl-2 and inhibition of apoptosis. The miR-200bc/429 cluster is downregulated in H. pylori-infected gastric mucosa, and these miRNAs directly target Bcl-2 and XIAP (x-linked inhibitor of apoptosis) [miR-101 and miR-515-5p target Mcl-1, which are downregulated in gastric cancer, lead to increased levels of Mcl-1 and an anti-apoptotic phenotype (Tumor suppressor miRNAs (henotype .miR-21 targets PTEN (phosphatase and tensin homolog), a tumor suppressor and negative regulator of the PI3K/Akt signaling pathway. miR-21 is upregulated in gastric cancer, and its overexpression shifts the balance between proliferation and apoptosis, by increasing cellular proliferation and inhibiting apoptosis.In addition to targeting proteins directly involved in the intrinsic and extrinsic cell death pathways, miRNAs target other factors that ultimately lead to apoptosis inhibition and increased proliferation. miR-375 targets 3-phophoinositide dependent protein kinase (PDK1), a kinase that directly phosphorylates Akt, thereby regulating the PI3K/Akt signaling pathway. Overexpression of miR-375 reduces cell viability and miR-375 is downregulated in gastric cancer . The upregulation of miR-181b may play an important role in the progression of gastric cancer and miR-181b may be a potential molecular target for gastric cancer therapies.Some miRNAs that are known to regulate cell cycle progression and apoptosis pathways are also involved in invasion and metastasis.  tissues . Cell prmiR-218 is reduced significantly in gastric cancer tissues, H. pylori-infected gastric mucosa, and H. pylori-infected AGS cells [miR-218, a tumor suppressor miRNA, is downregulated in gastric cancer, which correlates with increased metastasis and cancer invasion [miR-21 also targets RECK , a tumor and metastasis suppressor that inhibits tumor metastasis and angiogenesis through modulation of matrix metalloproteinases. Recently, Li et al. indicated that miR-21, miR-218, and miR-223 may be potential biomarkers for gastric cancer detection [invasion . This domiR-148a is downregulated in gastric cancer. The protein interaction network regulated by miR-148a is associated with metastasis-related function, such as integrin-mediated signaling, cell-matrix adhesion, and blood coagulation [gulation . A singlet al. reported that miR-10b was silenced in gastric cancer cells by promoter methylation. miR-10b targets the oncogene that encodes microtubule-associated protein, RP/EB family member 1. After 5-aza-2\u2032-deoxycytidine treatment of gastric cancer cells, miR-10b methylation is significantly decreased, and the expression of miR-10b is restored. The modulation of miR-10b may represent a therapeutic approach for treating gastric cancer [miRNAs are promising molecular targets for anticancer therapeutics in gastric cancer. Kim c cancer .et al. reported that miR-130b expression is upregulated in gastric cancer, and this is inversely associated with Runx3 hypermethylation. miR-130b overexpression increases cell viability, reduces cell death, and decreases the expression of Bim in TGF-beta mediated apoptosis, subsequent to the downregulation of Runx3 protein expression. The attenuation of Runx3 protein levels by miRNA may reduce the growth suppressive potential of Runx3 and contribute to tumorigenesis [et al. reported that miR-301a is upregulated in gastric cancer, and directly downregulates Runx3 expression [Runx3 is an important tumor suppressor that is inactivated in gastric cancer, and promoter hypermethylation of Runx3 is frequent . 5-aza-2igenesis . Wang etpression .miR-29c is significantly downregulated in gastric cancer tissues relative to non-tumor gastric mucosa [miR-29c is significantly activated by celecoxib in gastric cancer cells (AGS) [miR-29c induces suppression of the oncogene Mcl-1, a target of miR-29c and apoptosis in gastric cancer cells. These results suggest that the downregulation of the miR-29c tumor suppressor plays a critical role in the progression of gastric cancer. As such, selective COX-2 inhibitors may be a clinical option for the treatment of gastric cancer via restoration of miR-29c.The selective cyclooxygenase-2 (COX-2) inhibitor celecoxib is a potential drug for the treatment of gastrointestinal tumors. We investigated the role of miRNAs in gastric carcinogenesis and the feasibility of a new therapeutic approach for gastric cancer . miRNA mH. pylori-positive gastric MALT lymphoma regresses after H. pylori eradication. The t  translocation is associated with API2-MALT1 fusion, and this translocation responds only rarely or not at all to H. pylori eradication.Gastric B-cell lymphoma of the mucosa-associated lymphoid tissue (MALT lymphoma) develops in the chronically inflamed mucosa of patients infected with the bacterial pathogen. In 60%\u201380% of these cases, the miR-142, and an oncogenic miRNA, miR-155, are overexpressed in MALT lymphoma lesions [miR-142-5p and miR-155 suppress the proapoptotic gene TP53INP1 as their target [miR-142-5p and miR-155 are significantly increased in MALT lymphomas that do not respond to H. pylori eradication [miR-142-5p and miR-155 are associated with the clinical courses of gastric MALT lymphoma cases and these miRNAs may have a potential application as novel biomarkers for gastric MALT lymphoma.We previously reported that a hematopoietic-specific miRNA,  lesions . miR-142r target . The expdication . The expet al. reported the strong downregulation of the putative tumor suppressor miRNA, miR-203, in human MALT lymphoma samples, which results from extensive promoter hypermethylation of the miR-203 locus and coincides with the deregulation of its target, ABL1. Treatment of lymphoma B cells with demethylating agents leads to increased miR-203 expression and concomitant downregulation of ABL1, confirming the effectiveness of epigenetic regulation of this miRNA. These results show that the transformation from gastritis to MALT lymphoma is epigenetically regulated by miR-203 promoter methylation and identifies ABL1 as a novel target for treatment [Craig reatment .et al. reported that Myc overexpression is detected in 80% of gDLBCLs, but only 20% of MALT lymphomas are spotted on a tissue microarray. FoxP1 overexpression is detectible in gDLBCL, but not in gastric MALT lymphoma. miR-34a is downregulated in malignant lymphoma, as are the targets of miR-34a, Myc and FoxP1 and miR-34a shows strong antiproliferative properties when overexpressed in DLBCL cells. miR-34a replacement therapy is therefore a promising strategy in lymphoma treatment [Although generally considered an indolent disease, MALT lymphoma may have the ability to transform into gastric diffuse large B-cell lymphoma (gDLBCL). Craig reatment .As we are just beginning to understand the relationship between miRNAs and gastric malignancies and the number of identified miRNA genes is increasing, there is a potential for a large number of therapeutic targets and biomarkers in this area. Further studies are necessary to investigate whether miRNA-oriented therapy is an effective strategy for the chemoprevention of gastric malignancies."}
+{"text": "Increasing evidence demonstrated that inactivation of tumor suppressor genes (TSGs) by aberrant promoter methylation is an early event during carcinogenesis. Aiming at developing early diagnostic or prognostic tools for various tumors, we took an EBV-associated tumor, nasopharyngeal carcinoma (NPC), as a model and developed a powerful assay based on \u201cmultiplex methylation specific-PCR (MMSP)\u201d. The MMSP assay was designed to detect tumor-specific methylation status of several NPC-related genes and was capable of acquiring multiplex information simultaneously through a single PCR reaction with the tiny tumor DNA derived from the direct body fluid close to the primary tumor. In this study, we collected paired nasopharyngeal (NP) swabs and NPC biopsies from 49 NPC patients and twenty noncancerous controls. A panel of markers including two EBV, and two cellular TSG markers were applied in this NPC-specific-MMSP assay. We optimized the working condition of MMSP so that it provides information equal to that from the corresponding separate PCRs. The results showed that MMSP patterns of NPC swab were largely consistent with those of corresponding biopsies and significantly distinguished themselves from those of 20 noncancerous volunteers. Among the 69 samples , the sensitivity of detecting NPC from NP swabs is 98%. The specificity is as high as 100%. In conclusion, being characterized by its noninvasiveness, high reproducibility and informativeness, MMSP assay is a reliable and potential diagnostic tool for NPC. It paves the way for the development of population screening and early diagnosis approaches for various tumor types. Nasopharyngeal carcinoma (NPC) is the second most common cancer in southern China and constitutes the main menace in this area. Patients in stage I and II disease have a significantly longer overall survival compared with those in stage III and IV. The 5-year survival rate for stage III or IV patients was only 54.5%, while it could be as high as 95% for stage I or II patients As a 100% Epstein-Barr virus (EBV)-related tumor, the attempts for early diagnosis of NPC have been largely associated with the characteristics of EBV infection. Elevated serum titers of IgA antibodies to viral capsid antigen (VCA) and early antigen (EA) have been the most commonly used markers for screening and monitoring of the disease p16 gene and 6-MGMTO gene can already be detected from the patients with squamous cell lung carcinoma three years prior to clinical diagnosis Epigenetic silencing of tumor suppressor genes (TSGs) by promoter methylation is an early event in the multi-step process of carcinogenesis. Aberrant methylation of EBNA1 gene was amplified as an evidence of EBV infection of tumor cell. 2) The expression status of EBV-encoded oncogenic latent membrane protein (LMP1). LMP1 is the main EBV transforming protein in NPC. It could be unequivocally detected in 65% of NPC patients LMP1 promoter always express LMP1 protein. 3) The methylation status of two cellular candidate TSGs: Ras association domain family protein 1, isoform A (RASSF1A) and Death-associated protein kinase (DAPK) genes. These two genes have been shown to be heavily methylated in 84% and 80% in NPC biopsies respectively, but with few exceptions not in normal NP epithelia In order to develop a method which is both informative and starting-material-saving, we designed an assay named multiplex methylation PCR (MMSP), by doing which we were aiming at getting methylation-based tumor-suggestive information from an optimal panel of markers including TSGs and EBV genes for the early detection of NPC. The MMSP assay was designed to provide the following information. 1) EBV infection. It helps to distinguish EBV-related tumors from EBV-unrelated tumor or normal cells. In this MMSP assay, a fragment of The aim of the present study is to evaluate the capability of MMSP assay of detecting multiplex information and feasibility for diagnosis of NPC using tumor cells from NP swab as material. The MMSP assay demonstrated here is capable of simultaneously detecting methylation status of multiple genes, which are key regulators of diverse fundamental pathways. The informativeness and amenability of MMSP makes it suitable for clinical use.RASSF1A and DAPK were demonstrated to be methylated in Namalwa cells according to our data. It was used as a positive control to test the robustness of MMSP technique in this study. It was cultured in RPMI medium at 37\u00b0C with 5% CO2. Human NPC cell lines CNE1, CNE2  and TW03  EBV-positive latency III Burkitt lymphoma cell line, Namalwa 2O and two volumes (40 \u00b5l) of 2% low melting point agarose was added into it. Thirty \u00b5l agarose/DNA mixtures were pipetted into two tubes containing 100 \u00b5l of chilled mineral oil to form agarose bead. Each bead was placed in an individual tube to which 200 \u00b5l of 5 M bisulphate solution  was then added. The reaction mixture was incubated in darkness for 16 h at 50\u00b0C. Treatment was stopped by equilibration against 1 ml of TE buffer followed by desulphonation in 500 \u00b5l of 0.2 M NaOH. Finally, the beads were washed with 1 ml of H2O, and then used directly in PCRs.Homogenized biopsies and swab cell pellets were treated with TE buffer containing 0.5% SDS and 50 \u00b5g/ml proteinase K  for 3 hours at 56\u00b0C. High molecular weight genomic DNA was obtained by conventional phenol/chloroform and ethanol extraction. The bisulfite modification procedure was slightly modified according to the protocol of Alexander Olek et al 6\u2013107 cell equivalents/brush and is quite reproducible per individual brush according to the study by Stevens et al The average amount of DNA equals 10EBNA1, unmethylated LMP1 (U-LMP1), and methylated RASSF1A (M-RASSF1A) and DAPK (M-DAPK). A house-keeping gene \u03b2-ACTIN was also included in the MMSP assay to monitor the quality and quantity of input template DNA and the efficiency of bisulfite conversion. Corresponding single MSPs were also performed to confirm the accurateness and density of amplicons. The sequences of PCR primer sets specific for methylated and unmethylated alleles of expected PCR product are summarized in 2, 100 pmol deoxynucleotide triphosphates, primers (100 pmol each per reaction) and one unit of AmpiTaq Gold . PCR amplification was performed at 95\u00b0C for 10 min, then followed by 34 cycles at 94\u00b0C for 30 s, 55\u00b0C for 45 s, and 72\u00b0C for 90 s. PCR products were analyzed by 3% agarose gel electrophoresis stained with ethidium bromide.A cocktail of gene-specific primers was used to co-amplify In order to test the feasibility of MMSP to achieve the same readout as those from single MSPs, we used Namalwa cell line as a testing material. All markers in the MMSP system were supposed to show positive bands for bisulfite-treated Namalwa DNA. We compared the specificity and efficiency of MMSP assay using the corresponding five single MSPs as control. As shown in LMP1 promoters as confirmed by Western blot and bisulfite sequencing. The other five cell lines: CNE1, CNE2, HONE1, SUNE1 and HK1, are all EBV negative NPC cell lines EBNA1, could be detected in the C666-1 cell line and the EBV-positive xenograft C15. Unmethylated-LMP1 could only be detected in LMP1 expressing xenograft, C15. All the rest of cell lines, which were EBV-negative, did not demonstrate bands for EBNA1 and LMP1 markers but they all showed aberrant methylation on at least one of the two TSGs included in the MMSP assay. The pattern for these five markers in separate MSP reactions was invariably reproduced in all the samples tested by the MMSP system, which further validate the robustness of MMSP assay.A series of NPC cell lines and xenografts were included in this study to further validate the reproducibility of MMSP assay. Among these seven NPC cell lines/xenografts, C666-1 and C15 are the only EBV-positive ones. C15 is also an LMP1 non-expressing cell line with heavily-methylated To evaluate the sensitivity of the MMSP assay, a serial dilution of DNA from certain number of Namalwa cells was performed. The serial diluted DNA was equal to DNA extracted from 640 cells, 160 cells, 40 cells, 10 cells, 2.5 cells and 1.25 cells was then bisulfite modified respectively and used as templates for MMSP assays. As shown in \u03b2-ACTIN gene in our MMSP analysis, indicating sufficient yields of genomic DNA and successful bisulfite conversion. Presence of EBV latent infection in the biopsy and swab samples was confirmed by amplifying EBV-encoded EBNA1 gene in the MMSP reaction. EBV DNA was detected in 100% (49 of 49) of NPC primary tumors and 98%(48 of 49) of their paired swab samples, but in none of the noncancerous controls. Sixty-three percent of NPC primary tumors and 55% of their corresponding swab samples showed unmethylated-LMP1 bands in the MMSP assay, suggesting LMP1 is expressed in these samples. The ratio of U-LMP1 in NPC samples is quite close to the reported ratio of LMP1 expression by western blot (65%) in NPC. The frequencies of promoter hypermethylation of RASSF1A and DAPK were 79.6% (39 of 49) and 67.3% (33 of 49) in NPC biopsy samples, while methylated in 57.2% (29 of 49) and 55.1% (27 of 49) respectively in the corresponding swabs.Forty-nine NPC biopsies and their corresponding nasopharynx swabs were included in this study to examine the reliability of NP swabs as the origin of material for MMSP assay. Twenty paired NP biopsies and swabs from noncancerous volunteers were also included as normal control. The results were summarized in In swab samples of NPC patients, 18.4% (9 of 49) exhibited tumor suggestive signal (positive PCR band) from all the four markers, 34.7% (17 of 49) from three of the four markers, 42.9%(21 of 49) from two markers and 2.0% (1 of 49) from one marker only. The MMSP pattern of 42.9% NP swabs (21 of 49) matched exactly with those of corresponding biopsies. If we regard the presence of EBV DNA with tumor suggestive information from any one of the other three markers as a diagnostic criterion for NPC, we reached a sensitivity of 98% in detecting NPC, which covers all the stages of NPC patients. No EBV or methylated markers were ever found in swabs of the noncancerous controls, suggesting a specificity of 100% .Gaining sufficient and high-quality tumor DNA is critical for the early diagnosis of cancer. A variety of body fluids and sampling methods have been attempted for the non-invasive diagnosis of NPC, such as serum or plasma from peripheral circulation, buffy coat, and NP swab. The quantity and integrity of cell-free DNA fragments from peripheral circulation specimens such as serum and plasma are usually compromised. Thus, the detection rates of methylated DNA from serum or plasma were proved to be very low et al has shown that a panel of three to four markers could define an abnormality in 70\u201390% of each cancer type through detecting their aberrant methylation EBNA1, a nuclear antigen encoded by EBV, was used as a marker for the evidence of EBV infection. The primers for EBNA1 were designed to amplify bisulfite-converted EBV genome, but do not distinguish methylated and unmethylated CpGs. The intensity of this marker for EBV presence has the potential of being semi-quantified for EBV load using Namalwa cell as reference. Few malignancies express the EBV-encoded onco-protein, LMP1. The LMP1 primers used in the assay specially amplified bisulfite-converted unmethylated alleles. Knowledge of LMP1 expression status in a specific NPC will help to further increase the specificity of MMSP and potentially provide information about the prognosis of NPC. In addition, the primers for two cellular genes were designed to amplify their methylated alleles only. RASSF1A is a strong candidate TSG for NPC. The RASSF1A protein could interact with DNA repair system and also induce cell cycle arrest. It has been shown to be frequently methylated in NPC biopsies and the aberrant methylation is tightly correlated with loss of expression of RASSF1A in NPC DAPK aberrant methylation is one of the most frequent epigenetic inactivation events detected in NPC. It has also been demonstrated to be associated with aggressive and metastatic phenotype in many human cancers \u03b2-ACTIN serves as a quality control. It was amplified by primers based on the same strategy as EBNA1 gene. This marker could provide information if the bisulfite treatment is complete and if the template is of good quality. Recently, Hutajulu et al DAPK1-promoter in NPC samples from Indonesia and The Netherlands. They also found some methylation of this promoter in healthy controls from the same area. One source of variation might depend on geographical and population-related differences in exposure to environmental factors. These differences may be reflected in different methylation patterns also in the control population. Ultimately one would of course like to identify promoters that can be discriminated based on methylation and can be used world-wide for screening. This aim can only be reached by studying many different populations. Hutajulu et al used different amplicon. We have screened 13 pairs of methylation primers located at different CpG sites of DAPK1 promoter including primers published and the detection of methylation varied (data not shown). As methylation found in healthy subjects can be rather low, the variable results might also be affected by experimental conditions, sensitivity and cut-offs.A study by Esteller EBNA1) plus tumor suggestive signal from at least one of the other three markers as a positive criteria, we achieved a diagnostic rate of 98% in 49 NPCs. Noticeably, we successfully detected all of eight T1 NPC patients included in this MMSP study, suggesting that the alternation of panel markers reflects changes on the early stage of nasopharyngeal carcinogenesis. It will pave the way to develop MMSP as a population-based screening tool. Pattern and timing of methylation status in certain genes are demonstrated to be associated with defined biological behaviors Taking EBV presence marker .Screening of high risk population with serologic methods, notably IgA anti-VCA has proven to be a very useful method to identify persons at high risk and early cases. Identification of persons with high IgA anti-VCA titers would be an important approach to identify the methylation pattern of promoters in early cases. Unfortunately at this stage we did not have access to such material from our study area. All our patients with suspicion of NPC have been tested for VCA-IgA by ELISA, before taking swab and biopsy. Almost all of the patients were EBV-VCA-IgA positive by ELISA. However in the patient records these ELISA results were only reported as positive or negative, without any indication of the titer level.In future studies it would be highly relevant to combine EBV-serology with MMSP to test enhancement of sensitivity and specificity in order to find early cases and persons at high risk.In summary, we developed a method which can simultaneously detect the presence of EBV DNA and assesses multiple gene methylation status using only picograms of tumor DNA from NP swabs. The method is easy to be handled in clinic and requires only routine equipments. We demonstrated the sensitivity and specificity of 98% and 100% respectively in detecting 49 NPC which include 19 early-stage patients. Further studies are required to testify the feasibility of MMSP assay as a population-based screening tool in NPC high-risk population as well as a way of monitoring tumor recurrence. Furthermore, the theoretical basis of MMSP may generate a new criterion for tumor classification from a molecular perspective. It will open the way to a host of innovative diagnostic, preventive and therapeutic strategies."}
+{"text": "A topical review is presented focusing on the recent developments in synchrotron radiation macromolecular crystallography. The review covers source and beamline developments, and applications including spin-offs into other areas of science and the impact upon industrial interests. A current overview of synchrotron radiation (SR) in macromolecular crystallography (MX) instrumentation, methods and applications is presented. Automation has been and remains a central development in the last decade, as have the rise of remote access and of industrial service provision. Results include a high number of Protein Data Bank depositions, with an increasing emphasis on the successful use of microcrystals. One future emphasis involves pushing the frontiers of using higher and lower photon energies. With the advent of X-ray free-electron lasers, closely linked to SR developments, the use of ever smaller samples such as nanocrystals, nanoclusters and single molecules is anticipated, as well as the opening up of femtosecond time-resolved diffraction structural studies. At SR sources, a very high-throughput assessment for the best crystal samples and the ability to tackle just a few micron and sub-micron crystals will become widespread. With higher speeds and larger detectors, diffraction data volumes are becoming long-term storage and archiving issues; the implications for today and the future are discussed. Together with the rise of the storage ring to its current pre-eminence in MX data provision, the growing tendency of central facility sites to offer other centralized facilities complementary to crystallography, such as cryo-electron microscopy and NMR, is a welcome development. Compared with laboratory-based X-ray sources, the synchrotron properties of high spectral brightness and tuneability have enabled higher-resolution structure determinations, a greater use of multiple-wavelength anomalous dispersion (MAD) phasing techniques, studies of much larger molecular weight structures, the use of small crystals and time-resolved structural studies. Thus, a great deal of flexibility and adaptability of the technique to the needs of biological research now exists. An extensive summary up to 2010 of SR macromolecular crystallography (MX) and the anticipated future of X-ray lasers in structural biology is given by Duke & Johnson (2010Synchrotron radiation (SR) has had a profound impact on the field of protein crystallography, with approximately 90% of X-ray single-crystal structure determinations being from synchrotrons  depositions over the decades, reporting that the appearance of third-generation facilities, beginning with the ESRF  in 1994, has helped to maintain PDB data-deposition rates which otherwise might well have slowed down as more and more complex \u2018molecular machines\u2019 were studied. The last four years have seen the maturing of MX data collection and data processing at third-generation synchrotron beamlines into a high-throughput and largely automated technique. This is the culmination of a long period of development in hardware and software, and in user community culture, leading to the success of synchrotron-based MX. This success has led to further Nobel prizes in the field.Recently, Abad-Zapatero 2014 undertoo2.ESRF Foundation Phase Report \u2018Red Book\u2019, published in 1987, described specifications for the first third-generation source, the European Synchrotron Radiation Facility (ESRF) in Grenoble, France at 5 then 6\u2005GeV. Proposals for the USA machine, the Advanced Photon Source  at 7\u2005GeV, and the Japanese 8\u2005GeV SPring-8 machine  followed. The initial instruments for MX at the ESRF were a shared undulator high-flux (later relabelled high-brilliance) beamline well suited to virus crystallography, a shared microfocus beamline, a shared time-resolved beamline for Laue protein crystallography and a dedicated bending-magnet MAD beamline, BM14. A great expansion in beam time on an undulator came with the ESRF\u2019s Quadriga beamline complex  through the enhanced stability of the beam.et al., 1995The last few years have seen efforts directed at developing storage rings towards the ultimate very low emittance (near diffraction-limited) ring design (Einfeld i.e. instantaneous) spectral brightness some ten orders of magnitude larger than storage-ring-based sources, which have a higher integrated flux delivery. These two sets of advanced source developments at synchrotrons and XFELs have overlaps and complementarities for user science [see the topical review in this issue by Weckert  have been constructed at SLAC  and at SPring-8 (SACLA), with the European facility (EuroXFEL) under construction at DESY in Hamburg. These machines, based upon long linear accelerators and undulator sections, have pulse lengths of \u223c10\u2005fs and a peak , SOLEIL  and the SLS  is a key point in the continued rise of synchrotron crystallography. These robotic developments and smart software pipelines, with their database and data-delivery frameworks, are having a major impact. Reliable sample changers and automated intelligent software are routine at every synchrotron MX beamline. In Europe, the SPINE hardware standard gives consistent sample-mounting pins and bases. A new generation of pins is being developed under the banner of another European project, BioStructX, for the transport of a larger number of samples per cryo-dewar. This is needed as sample cycle times are now down to as little as a few minutes, meaning efficient users, locally or in remote-access mode, can process hundreds of samples per shift. This represents many cryo-dewars of frozen crystals needing to be transported. The higher number density is required to allow the new generation of mail-in dedicated automated beamlines like ESRF\u2019s MASSIF (massively automated sample selection integrated facility) to have tenable logistics.ISPYB and EDNA software permit sample, data and results tracking, and protected data delivery to users  \u2013 a considerable bottleneck and still largely done by hand. This may be changing with new laser-cutting based harvesting. The CrystalDirect system developed at EMBL-Grenoble  for industry. As an illustration, the approach taken by SERCAT  to the synchrotron to single-shift \u2018pop-ins\u2019 where users, and again especially industrial users, have shorter individual visits to ensure a continual data-stream delivery into projects.3.2.Nature recently  and the proceedings will be published in Acta Crystallographica Section D.As samples become smaller, they yield fewer diffraction data before radiation damage renders the sample of no use. Which partial data sets can be realistically combined depends on how similar the samples are. Hierarchical cluster analysis, a method introduced by Wayne Hendrickson and co-workers  to capture the diffraction data whilst operating in vacuo. To obtain high-quality data, this will be coupled with X-ray computed tomography to obtain the crystal sample shape and volume for an analytical sample absorption correction.Longer wavelengths up to \u223c5\u2005\u00c5 are under active development for MX at both Diamond and NSLS\u00a0II. The long-wavelength (1.5\u20134\u2005\u00c5) Diamond I23 project will be just such a user facility to enhance and optimize the anomalous signals from low atomic number elements. These include sulfur in proteins and/or phosphorus in RNA/DNA crystals, which are needed where protein labelling to introduce anomalous scatterers, such as that involving selenomethionine ls Fig.\u00a02. The ideet al., 2011K edge  and ultra-short (\u223c0.3\u2005\u00c5) wavelengths, high storage-ring energies yield a copious flux output. To date, these have been used for applications such as high-pressure MX, where the restricted aperture of the diamond anvil cell is less of a limitation with shorter wavelengths ; for a review, see Ren  al. 1999. More co3.5.There are several topics which, in the last few years, have continued to attract attention and development. Room-temperature crystallography is a growing biological crystallography research activity and is a reminder that cryo-derived MX structures do show structural differences. Structural changes occur mostly in the dynamics, as shown by the increased proportion of split-occupancy side-chains at cryo-temperatures. Radiation damage at room temperature used to be the norm for MX in the pre-ribosome crystallography days and damage was mitigated by modest cooling to, typically, 4\u00b0C. As mentioned above, serial femtosecond crystallography is generally undertaken at room temperature in any case and \u2018the diffraction outruns the damage\u2019. Neutron MX is damage-free and room temperature is routinely employed. However, cryotechniques have other advantages than simply radiation-damage mitigation, namely, under well chosen conditions, improved order and freeze trapping of structural intermediates, provided they are longer lived than the freezing time.et al., 2014via molecular dynamics simulations of protein vibrations, which now extend over time periods as long as 1\u2005\u00b5s  than \u2018routine-sized\u2019 crystals   which delivers kinase structural data, Bio-Xtal (France), Shamrock Structures (US) and VivaBiotech (China), amongst many others. The wholesale uptake and acceptance of structural biology, and thus of SR MX, for drug discovery by the pharma\u00adceutical industry, and the maturation of automation, have led to such enterprises having tenable business cases. High-throughput SR MX has assisted in the viability of the fragment-based drug discovery industry .via industrial use and the occasional patent or university spin-off based on structural data, but also in the transfer of technology and knowledge to instrumentation suppliers who then sell the MX instrumentation worldwide. Examples of this include diffractometers, sample-changer robots and sample pins.The exploitation of SR MX facilities for economic value is achieved not only 4.2.e.g.http://www.stfc.ac.uk/3388.aspx). Government funding agencies closely monitor the \u2018high-impact\u2019 publications that research produces. MX is a principal contributor to demonstrating success by these metrics. A clearly helpful factor over the years has been the award of Nobel Prizes for structural biology for which the research required SR MX. Thus, there was the Nobel Prize to John Walker (shared) for F1ATPase (SRS); to Rod McKinnon for the potassium ion channel ; to Roger Kornberg for RNA polymerase (SSRL); to Venki Ramakrishnan, Tom Steitz and Ada Yonath for ribosomal structure studies ; and to Brian Kobilka (shared) for GPCRs (APS and ESRF). These and other crystallography-derived Nobel Prizes are described in the book by Olovsson et al.  in recent years. An interesting initiative for a combined MX and bioSAXS beamline at the ALS in Berkeley is described by Classen et al.  within which the question, \u2018How did we arrive at such excellence as modern beamlines now offer MX?\u2019 was posed. That lecture charted our progress from the situation in 1979 with the SRS, which had a horizontal source size of \u223c14\u2005mm with which one had to plan an instrument (SRS 7.2) to focus down to an X-ray beam of 0.3\u2005mm, up to today, where we routinely seek focused X-ray beams of 5\u2005\u00b5m, and where we are also now seeing the first X-ray diffraction MX experiments at the sub-micron crystal sample size level. Whilst everything in 1979 was done manually, remote access and the routine use of robots are now the mode of data collection for SR MX users. Diffraction data volumes today are already challenging, and the projected volumes expected from the ESRF Upgrade and the similar facility evolutions being programmed worldwide take us from Big Data to \u2018Massive Data\u2019.The speed of routine MX data collection, facilitated by such brilliant X-ray beams and the new generation of pixel detectors, is now minutes per data set, benefitting the entire academic and industrial user community for high-throughput fragment-based drug discovery or simply for selecting the best diffracting sample out of many. One of us (JRH) delivered an IUCr Montreal Keynote Lecture  these new techniques join the automated SR MX we know today as a component of the biology tool box that academia and industry use routinely.10.1107/S205225251402795X/fs5088sup1.pdfSummary of abbreviations. DOI: 10.1107/S205225251402795X/fs5088sup2.pdfMontreal talk. DOI: Click here for additional data file.10.1107/S205225251402795X/fs5088sup3.pptxMontreal talk. DOI:"}
+{"text": "Danio rerio) are increasingly used to translate findings regarding drug efficacy and safety from in vitro-based assays to vertebrate species, including humans. However, the limited understanding of drug exposure in this species hampers its implementation in translational research. Using paracetamol as a paradigm compound, we present a novel method to characterize pharmacokinetic processes in zebrafish larvae, by combining sensitive bioanalytical methods and nonlinear mixed effects modeling. The developed method allowed quantification of paracetamol and its two major metabolites, paracetamol-sulfate and paracetamol-glucuronide in pooled samples of five lysed zebrafish larvae of 3 days post-fertilization. Paracetamol drug uptake was quantified to be 0.289\u2009pmole/min and paracetamol clearance was quantified to be 1.7% of the total value of the larvae. With an average volume determined to be 0.290\u2009\u03bcL, this yields an absolute clearance of 2.96\u2009\u00d7\u2009107 L/h, which scales reasonably well with clearance rates in higher vertebrates. The developed methodology will improve the success rate of drug screens in zebrafish larvae and the translation potential of findings, by allowing the establishment of accurate exposure profiles and thereby also the establishment of concentration\u2013effect relationships.Zebrafish larvae ( A highly sensitive liquid chromatography-mass spectrometry (LC-MS/MS)-based method was developed to accurately measure concentrations of paracetamol and its metabolites in zebrafish larvae. The obtained data were subsequently analyzed with nonlinear mixed effects modeling techniques.To characterize the PK of paracetamol in zebrafish larvae, two experiments were performed. At day 3 postfertilization (dpf), hatched larvae were transferred to 24-well plates, with each well containing five larvae in 2\u2009mL of embryo medium (pH\u2009=\u20097.9) with 1\u2009mM paracetamol. In experiment 1, 150 zebrafish larvae were used to determine the absorption of paracetamol by continuous drug exposure and in experiment 2, 60 zebrafish larvae were used to study the elimination of paracetamol after the larvae were transferred from drug-containing to drug-free medium. All measurements in the experiments were carried out in triplicates, and the measured drug and drug metabolite amounts are expressed per larva, but represent mean values obtained from five larvae simultaneously.zfin.org). Embryos were collected from family crosses of AB/TL wild-type strain and grown at 28\u00b0C in embryo medium  in the dark.Zebrafish larvae were handled in compliance with the local animal welfare regulations and maintained according to standard protocols  water/methanol solution, after which excessive medium was removed. The samples were subsequently prepared for analysis as described below. Additionally, samples from the incubation medium were collected to study the excreted amounts of the metabolites. Larvae in control groups were exposed to the drug solution for a few seconds and to determine drug adherence to the skin.Larvae were exposed to the drug-containing medium for 1\u2009h, washed with fresh medium to remove the residual drug solution, and then transferred to a drug-free medium. After 0, 1, 2, and 3\u2009h of incubation, three replicates of five larvae were collected and washed twice in 80/20 (v/v) water/methanol solution after which excessive medium was removed and the samples were subsequently prepared for analysis as described below. Samples from the incubation medium were also collected at each time point.This experiment was repeated a second time with three washing steps before transfer to drug-free medium, as the first time unchanged drug and metabolites appeared to have been transferred to the fresh medium. The second time, the duration of this experiment was also extended with sample collection up to 4\u2009h after transfer to the drug-free medium. Data on paracetamol, paracetamol-sulfate, and paracetamol-glucuronide concentrations in the incubation medium from the first time the experiment was performed were excluded from the analysis as contamination was suspected.4 internal standard . Lysis was performed by snap-freezing each sample in liquid nitrogen followed by 2\u20133\u2009min sonication. This procedure was repeated until all larvae were lysed and the sample was homogenous. The lysed samples were centrifuged for 10\u2009min at 16,000 g at 4\u00b0C. Ninety microliter of supernatant was collected in a microcentrifuge tube, after which 72\u2009\u03bcL water was added, yielding a sample of 50/50 methanol/water solution, which was injected to the LC-MS/MS system directly.The five zebrafish larvae of 3\u2009dpf from a single well were added to 100\u2009\u03bcL lysis buffer containing 90/10 (v/v) methanol/water solution with 45\u2009ng/mL paracetamol-DThe medium samples (2\u2009mL) from each well were collected in new eppendorf tubes and concentrated by speedvac. After reconstitution in 150\u2009\u03bcL of 50/50 methanol/water solution, samples were injected to the LC-MS/MS system directly.4 internal standard. On the day of analysis, the standard working solutions were further diluted to five additional calibration points and mixed with the internal standard solution to final concentrations of 9, 18, 45, 90, 180, and 270\u2009ng/mL for paracetamol and its metabolites and 45\u2009ng/mL for the internal standard. All calibration points were prepared in a composition similar to the lysis buffer (90/10 methanol/water). For constructing a matrix-matched calibration curve, 100\u2009\u03bcL of each calibration point was spiked into a sample of five zebrafish larvae of 3\u2009dpf and followed similar extraction procedure as described for the sample preparation above.Paracetamol, paracetamol-sulfate, and paracetamol-glucuronide were purchased from Sigma-Aldrich Chemie B.V. Individual stock solutions at 1\u2009mg/mL were prepared using methanol. Standard working solutions of 1000\u2009ng/mL were prepared for these three compounds and for the paracetamol-DAnalyses were performed on an ultra performance liquid chromatography (UPLC) system  coupled to a quadrupole-time of flight (QTOF) mass spectrometer  with an electrospray ionization (ESI) source. Positive ionization mode was used for the analysis of paracetamol and negative mode for the analysis of the paracetamol-sulfate and paracetamol-glucuronide metabolites.Chromatography was performed at 40\u00b0C on a Waters Acquity UPLC HSS T3 column  using as aqueous mobile phase a 0.01% formic acid solution (A) and acetonitrile (B) as organic modifier at a flow rate of 0.4\u2009mL/min. The run time was 5\u2009min, with the gradient at 100% A for the first 0.3\u2009min, then B was linearly increased to 100% for the next 3\u2009min and held for 0.5\u2009min and finally the system was equilibrated to the initial conditions for 1.2\u2009min. Injection volume was 5\u2009\u03bcL and autosampler temperature was set to 10\u00b0C.The MS method operated in both positive and negative polarities with separate injections in each polarity includes an MS scan function with a scan time of 0.2\u2009s operated at a trap cell collision energy of 4\u2009eV and a transfer cell collision energy of 2\u2009eV. ESI voltage was set at 0.9\u2009kV both for positive and negative modes. Cone voltage was set at 30\u2009V and source offset at 80\u2009V. The source temperature was set at 150\u00b0C with desolvation temperature at 500\u00b0C. Nitrogen was used for the cone, desolvation and nebuliser gases with settings of 50, 1000\u2009L/h and 6 bar, respectively. Data were collected in continuum mode with a scan range of 50\u2013850\u2009m/z using the QTOF detector in high-resolution mode . About 0.1\u2009mg/L Leucine enkephalin solution (acetonitrile: water 50:50 with 0.1% v/v formic acid) infused at a constant flow of 10\u2009\u03bcL/min was used as the lock mass, a single point scan was collected every 10\u2009s and averaged over three scans to perform mass correction (556.2771\u2009m/z). The instrument was calibrated for both positive and negative polarities before analysis using sodium formate.Masslynx 4.1 SCN916 (Waters) was used to acquire all the data and Targetlynx application to perform the quantitative analysis. The quantification of paracetamol and its metabolites was achieved by correcting the peak area response of paracetamol and its metabolites by the peak area response of the internal standard. The quantified values are expressed in terms of amount/larva. The developed method was sensitive with limits of quantification as low as 0.02\u2009pmole/larva for paracetamol, 0.008\u2009pmole/larva for paracetamol-sulfate, and 0.05\u2009pmole/larva for paracetamol-glucuronide.12 facilitated with Pirana13 and PsN.15 The First Order Conditional Estimation method was used in NONMEM. R 3.0.0 was used for graphical analysis and model diagnostics.The nonlinear mixed effects modeling of paracetamol was performed using NONMEM 7.3 software ,In a pooled analysis of the paracetamol concentrations in the larvae, a 0-order absorption rate was estimated to quantify the uptake of paracetamol from the incubation medium. A first-order clearance rate was estimated to quantify the elimination of paracetamol from the larvae. Both one and two-compartment models were tested to describe the distribution of paracetamol within the larvae. For both distribution models, the total distribution volume was fixed to 1, which meant for the two-compartment model that both compartments were expressed as fraction of the total volume of one larva. To quantify the residual variability an additive and a proportional error were tested, and a combination of both. Due to the destructive nature of the measurements, inter-individual variability in the PK processes could not be quantified.2-distribution, a decrease in OFV of more than 3.84 points, corresponding to a significance level of p\u2009<\u20090.05 with one degree of freedom, was considered to be statistically significant. Precision of parameter estimates was evaluated based on standard errors obtained from the NONMEM output tables. Furthermore, the model fit was assessed by visual inspection of goodness-of-fit plots, these included plots of predicted versus observed paracetamol amounts in the zebrafish larvae, and of conditional weighted residuals16 versus time after start of the experiment and conditional weighted residuals versus predicted paracetamol amounts.The likelihood ratio test, based on the objective function value (OFV) in NONMEM was used for model selection. Assuming a \u03c7To enable the expression of paracetamol clearance in zebrafish larvae in absolute rather than relative terms, the average volume of the larvae was determined. For this, samples of 10, 20, 30, 40, 50, and 100 larvae at 3\u2009dpf were placed onto parafilm M(R) (Bemis NA) with a transfer pipette after which the excessive water was removed with variable volume pipettes and filter paper. Subsequently, the weight of each sample was measured with a Mettler AE240 analytical balance. The average wet weight of the zebrafish larvae was determined using linear regression. To derive the average volume of the larvae, their density was assumed to be equal to the density of water at 25\u00b0C (0.997\u2009g/mL).A search was performed in PUBMED using \u201cparacetamol\u201d OR \u201cacetaminophen\u201d AND \u201cclearance\u201d. Total paracetamol clearance values (CL) reported over the past 10 years in various vertebrate species were collected together with mean bodyweights (BWs) of the individuals included in a study. When detailed information on BW was not provided, average BW values from the species were obtained from literature. Data from disease models, combined drug formulation, or obese individuals were excluded. Distinctions were made between data collected in mature or immature individuals of a species.All obtained CL were plotted versus BW on a double log scale. A linear model was fitted through the logarithm of the CL versus the logarithm of the BW in R (version 3.3.1) to obtain the parameters in the allometric equation below that describes the relationship between BW and paracetamol clearance .\\documeThe fit was based only on CL from the higher vertebrates, excluding the zebrafish larvae.In both experiments, the amount of excreted paracetamol-glucuronide in the incubation medium was below the lower limit of quantification (0.5\u2009pmole excreted per larva) throughout the experiment. In the first experiment, excreted sulfate metabolite was detected after 3\u2009h of continuous exposure, but the level remained close to the limit of quantification (0.4\u2009pmole excreted per larva). For the second experiment, excreted amounts of sulfate metabolite that were close to the limit of quantification were detected in the medium 3\u2009h after the larvae were transferred from the drug-containing medium, to the drug-free medium. The excreted amounts are relatively low compared to the total amount of paracetamol and metabolites measured in the larvae, from which it can be concluded that a significant portion of the elimination of paracetamol is covered by measuring the sulfate and glucuronide metabolite in the larvae. Moreover, control experiments confirmed that paracetamol does not adhere to the skin of the zebrafish larvae, ratifying that paracetamol amounts quantified in the zebrafish larvae samples at 3\u2009dpf indeed represent drug amounts taken up by the larvae.The time course of paracetamol amounts in zebrafish larvae at 3\u2009dpf was best described by a standard one-compartment distribution model, with 0-order absorption, and linear first-order elimination. It was found that the zebrafish larvae in a medium with a 1\u2009mM paracetamol concentration take up 0.289\u2009pmole paracetamol per minute. Every minute, the amount of paracetamol in 1.70% of the volume of the zebrafish larvae was cleared; this includes both metabolism and excretion of the unchanged drug. The obtained parameter values including the relative standard error of these estimates are provided in www.liebertpub.com/zeb).The relative standard errors in the obtained model parameter estimates were below 20%, indicating good precision of the parameter estimates. 7 L/h.The average wet weight of the zebrafish larvae at 3\u2009dpf was found to be 0.291\u2009mg, and from this an average volume of 0.290\u2009\u03bcL was derived. This yields absolute paracetamol clearance in zebrafish larvae at 3\u2009dpf of 2.96\u2009\u00d7\u200910Paracetamol CL reported over the past 10 year in vertebrate species, including humans of different ages, were obtained from literature. r2\u2009=\u20090.902). The obtained relationship is depicted in r2\u2009=\u20090.835). The allometric equation that was fit to the data of mature individuals of the different species had an estimated exponent of 0.781  species. Given that 70% of human genes have at least one obvious zebrafish ortholog18 the potential for a strong resemblance between humans and zebrafish larvae regarding disease manifestation and drug response is high. The zebrafish larvae has, for instance, already been proven useful in studying drug effects in diseases like tuberculosis17 and cancer.2Quantification of PK processes in zebrafish larvae will be invaluable for drug screening procedures in drug discovery and early drug development. This is because it has been recognized in higher species and humans that drug concentrations rather than drug doses are driving drug effects, screening studies in zebrafish larvae generally ignore drug PK, or if these aspects are considered, drug concentrations are measured at a single time point, ignoring the full time course of drug and/or metabolite exposure.In addition to improving the translation potential of drug effects from zebrafish larvae to higher vertebrate species, it was investigated to what extent PK studies in zebrafish larvae could serve as a convenient translational platform for studies on drug metabolism as well. The comparison of our findings on paracetamol clearance in zebrafish larvae at 3\u2009dpf and reported CL in higher vertebrates in 19\u201321 Previous studies using different probes in zebrafish larvae, also suggest quantitative similarities in metabolite formation between zebrafish larvae and humans.22\u201324 Our quantitative results on the metabolism of paracetamol in zebrafish larvae at 3\u2009dpf do, however, not closely resemble observed metabolic profiles in adult humans. As the graphs in 25\u201327 Our experiments in the zebrafish larvae of 3\u2009dpf were also performed before maturity in this species is reached. Although the dissimilarities in metabolic profiles between human adults and zebrafish larvae do not limit the applicability of our developed methodology in characterizing drug PK and determining accurate drug exposure in these larvae, it would be of interest to investigate if older larvae resemble metabolic profiles of human adults more closely. This is part of future investigations, and investigations on the clearance rates of other compounds in the zebrafish larvae.Zebrafish expresses phase II metabolizing genes similar to mammalian uridine glucuronosyltransferases and sulfotransferases isoforms throughout early development.In conclusion, we have successfully developed a feasible methodology for PK studies in zebrafish larvae at 3\u2009dpf. The quantification of PK processes in these larvae by using a combination of ultra-sensitive LC-MS/MS-based analytical methods and nonlinear mixed effects modeling will allow the extraction of more information from experiments in zebrafish larvae during drug discovery and early drug development, which may yield advantages regarding the inter-species translation potential of findings on drug effects in these experiments."}
+{"text": "On 6 January 2016, the Democratic People\u2019s Republic of Korea announced to have conducted its fourth nuclear test. Analysis of the corresponding seismic waves from the Punggye-ri nuclear test site showed indeed that an underground man-made explosion took place, although the nuclear origin of the explosion needs confirmation. Seven weeks after the announced nuclear test, radioactive xenon was observed in Japan by a noble gas measurement station of the International Monitoring System. In this paper, atmospheric transport modelling is used to show that the measured radioactive xenon is compatible with a delayed release from the Punggye-ri nuclear test site. An uncertainty quantification on the modelling results is given by using the ensemble method. The latter is important for policy makers and helps advance data fusion, where different nuclear Test-Ban-Treaty monitoring techniques are combined. The Comprehensive nuclear Test-Ban-Treaty (CTBT) has been open for signature since 1996 by the United Nations and aims to ban atmospheric, underwater and underground nuclear explosions. Although the Treaty has not yet entered into force, preparations are being made on the scientific, technical and political level. Compliance with the Treaty will be observed by the International Monitoring System (IMS). The IMS will measure infrasound, hydroacoustic and seismic waves globally to detect atmospheric, underwater and underground explosions. To discriminate nuclear explosions from conventional explosions, 80 stations will measure airborne radionuclides. To date, 84% of the network has been installed. Furthermore, the Treaty foresees the possibility to conduct on-site inspections once it has entered into force.131mXe, 133mXe, 133Xe and 135Xe, further on called radioxenon) that are created during a nuclear explosion. These noble gases are of interest since they are more likely to be released to the atmosphere after an underground or underwater nuclear explosion compared to particulates and reactive gasses. Additionally, they are not subject to deposition or chemical reactions in the atmosphere, which is beneficial from both an observational and modelling point of view. Finally, the half-lives of these isotopes are long enough to be captured by the IMS radionuclide stations, but short enough to avoid accumulation in the atmosphere over time 1.At least half of the 80 stations that will measure airborne radionuclide particles, will also be able to detect certain radioactive noble gases  and nuclear power plants8 (NPPs) also release radioxenon. These civil sources create a background of radioxenon that can be measured by the network10 and could mask the signatures of a nuclear explosion11. Elevated 133Xe concentrations were measured at RN38 , but none of these could be linked to the DPRK.If radioxenon is observed by the noble gas component of the IMS stations, atmospheric transport models can help with the determination of the location, release period and release amount of the source. In the past, radioxenon signatures have been linked to previous nuclear tests conducted by the DPRK12. Since the explosion took place underground, it is not sure if and what amount of radioactivity has been released to the atmosphere - assuming the explosion was nuclear. Six weeks later, elevated 133Xe concentrations were measured at the IMS noble gas station RN38  that can best explain the observed concentrations conc measured at  between times tstart and tstop (Methods). Both the release and detections are assumed to take place in the lowest model layer of Flexpart, extending from the surface to 100\u2009m above. Furthermore, we assume that a single point source with releases bounded between Qmin and Qmax is responsible for the observed concentrations (Methods). Once such an optimal source has been found, the corresponding concentrations can be calculated and compared with the observed concentrations. To quantify the deviation between the measured concentrations and the calculated concentrations that come from the optimal source term Q, a quadratic cost function is used:The inverse modelling technique involves finding a source term 133Xe concentrations measured at RN38. The inverse modelling should make use of as much as possible observations to decrease network ambiguity13. However, several civil sources all over the world leave their mark on the network10, so that the inclusion of observations outside the region of interest or outside the time period considered could lead to worse results. With these considerations in mind, we have selected 50 observations from three certified IMS noble gas stations  of the European Centre for Medium-Range Weather Forecasts (Methods) with horizontal grid spacings of 0.5\u00b0. For every EDA member, a new Flexpart run was started. We have obtained 51 sources and corresponding cost function values for each grid point.The atmospheric transport and dispersion simulations were realized with the Lagrangian particle model Flexpartmax\u2009=\u20091012\u2009Bq/day, which is a reasonable assumption for the maximum release of civil sources in Eurasia5. For the second hypothesis, we increase Qmax to include possibly high radioxenon releases from an underground nuclear explosion. The 133Xe inventory associated with a 10 kton nuclear explosion is about 5 * 1014\u2009Bq after 41 days of decay29. For the simulations, we take Qmax\u2009=\u20091013\u2009Bq/day since it is unlikely that all available 133Xe would be released at once after an underground nuclear explosion. Maps of the cost function values for both hypotheses are shown in Fig.\u00a0For the inverse modelling, two hypotheses are considered: the xenon originated from (i) a single civil source and (ii) the Punggye-ri test site where an underground explosion took place six weeks earlier. For the first hypothesis, we take Q12\u2009Bq/day was responsible for the observed 133Xe concentration.For the civil source assumption, the lowest values of the cost function can be found in a narrow area northwest of RN38 up to the northeast of the People\u2019s Republic of China Fig.\u00a0. HoweverFor the nuclear explosion assumption Fig.\u00a0, a much The inverse modelling Fig.\u00a0 discrimimax\u2009=\u20091013\u2009Bq/day. Note that for the deterministic simulation  values at the Punggye-ri nuclear test site for all 50 samples with the corresponding uncertainty obtained from the ensemble. The colours in Fig.\u00a0133Xe in the sample . The SRS values corresponding with the elevated radioxenon samples taken at RN38  release at all. The days before the peak, the inverse modelling suggests that there could have been a 133Xe release of about 1012\u2009Bq/day.Figure\u00a010. Since it is very challenging to accurately simulate the radioxenon background33, we simply assume that all observed 133Xe concentrations equal to or below 0.3\u2009mBq/m3 are coming from one or multiple civil sources. These concentrations were reset to zero, but were still used in the inverse modelling; the other 133Xe concentrations are decreased with 0.3\u2009mBq/m3. A value of 0.3\u2009mBq/m\u00b3 was chosen, since this corresponds roughly with the average activity concentration measured at IMS stations , with a median of 6.78 * 1012\u2009Bq. Without the background correction, the 97.5% quantile is 1.1 * 1013\u2009Bq. Taking into account 41 days of decay, a crude estimate of the minimal initial 133Xe inventory is 1.5 * 1015\u2009Bq, which is about 1.3% of the full 133Xe inventory for a 10 kton nuclear explosion .As already stated, civil sources also emit radioxenon that can be detected by the IMS noble gas stations networkeak Fig.\u00a0. We have131mXe allow to study radioxenon isotopic ratios with the aim to discriminate between a nuclear explosion and civil sources34. However, no other radioxenon isotopes have been observed in the samples containing high amounts of 133Xe. Given the shorter half-lives of 133mXe and 135Xe, only 131mXe is eligible for detection, besides 133Xe. We now assess whether the non-detection of 131mXe is compatible with a possible release of 131mXe at the Punggye-ri site.The presence of other radioxenon isotopes such as 133Xe inventory (based on the ensemble median) at the Punggye-ri site, we can estimate the minimum 131mXe inventory. We take a cumulative fission yield of 0.06%29. We assume an identical release fraction for 131mXe as for 133Xe. The estimated 131mXe release is 7.0 * 1011\u2009Bq. The calculated 131mXe activity concentrations at RN38 are listed in Table\u00a0131mXe fall below the minimum detectable concentration.From the calculated minimum 133Xe concentrations observed by the IMS noble gas station RN38 six weeks after the announced nuclear test by the DPRK. Results show that no single civil source, operating under normal circumstances, can explain all radioxenon detections and non-detections. Although we cannot exclude the possibility that a local civil source35 is responsible for the observed xenon at RN38 , it is unlikely since high xenon concentrations were detected in five consecutive samples rather than in a single sample. On the other hand, results are consistent with a release from the Punggye-ri nuclear test site in the DPRK , which corresponds to about 1.3% of the full inventory of a 10 kton nuclear explosion.We have assessed whether the Punggye-ri site is a plausible source of the elevated PRK Fig.\u00a0. An enseerm Fig.\u00a0. Taking 36. In the assessment of the third announced nuclear test by the DPRK, it was shown that the likely release at the Punggye-ri nuclear test site coincided with low atmospheric pressure4. It is not clear if and to what extent the low air pressure influenced the release of radioxenon, although the principle of atmospheric pumping is well known39. Although an assessment on the cause of the delayed xenon release is outside the scope of this paper, we plot the air pressure obtained from ECMWF analyses for the Punggye-ri site and see that the possible release period coincides with an episode of low air pressure  of ECMWF to quantify this uncertainty. EDA makes use of 4D variational assimilation (known as \u201c4D-Var\u201d) to combine observations and a short-range forecast in an optimal way and is run twice every day. The ensemble consists of 50 perturbed realisations or \u201cmembers\u201d and a control member, which is not perturbed. Perturbations are generated by perturbing the assimilated observations28, the sea-surface temperature field43 and the model physics tendencies44. By construction, every member is equally likely to occur and the spread between the members contains information about the uncertainty of the simulation. The model extends to a depth of 0.01 hPa and has 137 vertical hybrid \u03c3-levels, which follow the earth\u2019s surface in the lower-most troposphere, but gradually follow surfaces of constant pressure aloft. Three-hourly global model data with 0.5\u00b0 horizontal grid spacing have been used for the Flexpart simulations. The boundary layer height is calculated in Flexpart using the critical Richardson number45.The Lagrangian particle model Flexpart version 9.02 has been used for the atmospheric transport and dispersion simulations. Flexpart requires numerical weather prediction data as input, which have been extracted from the MARS server of ECMWF using the extraction software available at the Flexpart website46. As a consequence, we assume that the elevated radioxenon observations are originating from a single grid box source. For every grid box  in the lowest model layer, the cost function in Eq. . This is done with a quasi-Newton method . In Flexpart, the concentrations scale linearly with the source, so there is no need to call Flexpart for every iteration of the minimization.The relevant radioxenon sources  can be considered as point sources for long-range atmospheric transport problems. It is well known that the concentrations in any geotemporal point are, most of the time, dominated by a single source lying upstream on the trajectory of the atmospheric transport. Furthermore, the Punggye-ri test site is remote from known civil sources, so that its plume can remain relatively distinctn in Eq.  is minimmin and Qmax, the latter to prevent unrealistically high source terms. The minimum release Qmin is equivalent to Qmin\u2009=\u20090\u2009Bq/h for long-range atmospheric transport due to the large dilution factors in the atmosphere and the noble gas station minimum detectable concentration.The source term is bounded between a minimum and maximum value QMind that the transport between the Punggye-ri test site and the IMS stations Fig.\u00a0 takes pl26, the SRS fields obtained by running Flexpart in backward mode used for the inverse modelling can also be considered as perfect. The concentrations at receptor stations were averaged over 12\u2009h and 24\u2009h time periods corresponding to the collection period of the IMS stations22, and rounded to 0.1\u2009mBq/m\u00b3 (roughly the absolute uncertainty on the measured 133Xe concentrations). This implies a loss of information, and therefore, despite the use of perfect SRS fields and quasi-perfect observations, no exact match can be expected between the calculated source and the true source. In total, 50 pseudo-observations have been constructed for the stations RN38, RN45 and RN77.The inverse modelling method using observations from certified IMS noble gas stations has been validated by reconstructing three fictitious sources at the Punggye-ri nuclear test site in mid-February 2016, using the deterministic model. Perfect pseudo-observations were constructed with Flexpart in forward mode. Since Flexpart is self-adjointmin\u2009=\u20095 * 109\u2009Bq/h and Qmax\u2009=\u20095 * 1012\u2009Bq/h. For each fictitious source, three different source terms have been calculated: (i) a time independent source term (1 unknown), (ii) a time dependent source term with intervals of roughly two days (5 unknowns) and (iii) a time dependent source term with intervals of roughly one day (10 unknowns). Results are shown in Supplementary Figs\u00a0For each fictitious source, we have assessed whether (i) the Punggye-ri nuclear test site is a possible source and (ii) given the correct source location, the true source term can be reconstructed. For the optimisation, we have used the bounds Q133Xe release of 1011\u2009Bq/h. We have applied the inverse modelling method assuming a time-independent source term"}
+{"text": "Acute cellular rejection (ACR) has a reversible effect on graft and its survival.To evaluate the relation between ACR and clinical factors in recipients of liver transplant allografts. 47 consecutive liver recipients were retrospectively studied. Their data were extracted from records and analyzed.38 (81%) of the 47 recipients experienced ACR during a 24-month follow-up. The rate of rejection was associated with none of the studied factors\u2014recipient\u2019s blood group, sex, age, familial history of disease, drugs and blood products received, type of donor, and Child score and class.During a limited follow-up period, we did not find any association between ACR and suspected risk factors. Nowadays, liver transplantation is an accepted treatment for end-stage liver diseases in pediatric patients . The firThe incidence of ACR in children following liver transplantation was reported differently from <20% to 50% based on age of recipient (in older children it is more frequent); it can occur at any time after the transplantation . SuspiciBecause of reversibility and the impact of ACR on long-term graft function as well as graft loss, this study was conducted to evaluate the impact of pre-transplantation, concomitant and post-transplantation factors of ACR in recipients of allograft liver.Between 2012 and 2015, 318 pediatric patients with congenital hepatic disease received liver transplantation in Nemazi Hospital affiliated to Shiraz University of Medical Sciences. Complete records of 47 consecutive pediatric patients with ACR were collected and followed for data on sex, age, weight, age at ACR, age at liver transplantation, Child score, blood group, family history of transplantation, operation data, and its complication; also post-transplantation treatment and their circumstances were collected. In this study, the including criteria were having age between 1 and 18 years, having a biopsy-proven ACR, and presence of no other complications. The exclusion criteria were presence of other explanations for the signs, no history of previous liver transplantation, and secondary liver malignancy. Histological characteristics for ACR were lymphocytic portal inflammation, bile duct inflammation, and endotheliitis.Statistical AnalysisThe crude and adjusted associations between potential risk factors and acute rejection were estimated using univariate and multivariate  poisson regression models. All statistical analyses were performed with Stata SE ver 11. A p value <0.05 was considered statistically significant.A total of 47 patients who underwent liver transplantation was followed for a maen\u00b1SD of 1.8\u00b11.9 years. The mean\u00b1SD age of participants was 9.6\u00b19.6 years; 25 (53%) patients were female; 33 (72%) received transplant from dead donors, the remaining received transplants from their live parents.Characteristics of patients with ACR are shown in et al, conducted a retrospective study for evaluation of ACR risk factors on 110 consecutive liver recipients and found a significant relation between recipients age and ACR. Their explanation for this association was a higher CD8 lymphocyte count in younger patients [et al, performed a prospective study on records of 413 patients who received graft from living donors. They concluded that autoimmune liver diseases are associated with higher risk for ACR and its relapse [In this study, we observed 47 cases of ACR among 318 liver transplant recipients. We found that ACR was not associated with any of the factors investigated before and after the surgery. Multivariate analysis, showed that only receiving irradiated packed red cells before surgery had a borderline significant association with ACR\u2014receiving irradiated packed red cells caused approximately a four-fold increase in the risk of rejection. Wang,  relapse .et al, compared the incidence and severity of ACR between living-donor and cadaveric liver transplant recipients. They found no significant difference between groups; also, HLA mismatch and cold ischemic time had no impact on the incidence and severity of ACR [et al, evaluated the immunological advantage of living-related liver transplantation compared with cadaveric transplants in 100 pediatric liver recipients. They confirmed a comparable incidence of ACR between groups in the first 24 months of transplantation. However, ACR episodes after one year were significantly lower in living-related liver recipients [et al, ACR and graft survival rates were not related to donor types  [et al, in their study on 114 pediatric patients reported a higher incidence of ACR in maternal grafts with sex mismatch [Fan, y of ACR . These fcipients . Similardaveric) . Sandra,mismatch , which wKinpan and his colleagues retrospectively investigated the information of 778 liver recipients to assess the impact of clinical factors on ACR incidence. They concluded that old age, chronic hepatitis B, living donor, and use of iterleukin-2 receptor agonists were associated with lower incidence of ACR . UnfortuIn conclusion, our study did not find any risk factors for liver transplant rejection. Further multicenter cohorts with larger sample size and longer follow-up period are required to identify the independent risk factors of transplant rejection after liver transplantation."}
+{"text": "Prostate cancer is one of the most commonly diagnosed malignancy and the fifth leading cause of cancer mortality in men. Despite the broad use of prostate-specific antigen test that resulted in an increase in number of diagnosed cases, disease management needs to be improved. Proteomic biomarkers alone and or in combination with clinical and pathological risk calculators are expected to improve on decreasing the unnecessary biopsies, stratify low risk patients, and predict response to treatment. To this end, significant efforts have been undertaken to identify novel biomarkers that can accurately discriminate between indolent and aggressive cancer forms and indicate those men at high risk for developing prostate cancer that require immediate treatment. In the era of \u201cbig data\u201d and \u201cpersonalized medicine\u201d proteomics-based biomarkers hold great promise to provide clinically applicable tools, as proteins regulate all biological functions, and integrate genomic information with the environmental impact. In this review article, we aim to provide a critical assessment of the current proteomics-based biomarkers for prostate cancer and their actual clinical applicability. For that purpose, a systematic review of the literature published within the last 10 years was performed using the Web of Science Database. We specifically discuss the potential and prospects of use for diagnostic, prognostic and predictive proteomics-based biomarkers, including both body fluid- and tissue-based markers. One million men are diagnosed with Prostate Cancer (PC) worldwide and over 300,000 are dying annually of the disease . This coWhich patient needs a first or a repeated biopsy?Which patient needs immediate treatment?Who is likely to benefit from the indicated treatment?On a global scale, the rate of PC incidence varies more than 25-fold, with highest age-standardized rates in Australia/New Zealand, North America, as well as Western and Northern Europe . This isTo address these points and improve the current care for patients with PC, several tests have become commercially available: (1) tests approved by U.S. Food and Drug Administration (FDA) and (2) tests available via Clinical Laboratory Improvement Amendments (CLIA)\u2014certified laboratories ,5. The fIn parallel to gene-based approaches, extensive research has been conducted to develop protein-based tests, with some of them being also commercially available. Proteins are responsible for the regulation of biological functions and their investigation at the global level becomes possible due the advancements in Mass Spectrometry (MS)-based technologies. The proteome, which is defined as a complete set of proteins in cell, tissue, or organism that are expressed at a certain point in time, has a highly dynamic nature and contains information on molecular disease determinants. Thus, the investigation of the individual proteome and identification of proteins associated with disease enable to identify biomarkers. For that reason, proteomics approaches have been broadly applied to investigate diagnostic, prognostic, and predictive biomarkers.The main aim of this review is to provide an overview on the currently available proteomics biomarkers that were developed to address the clinical needs for PC, emphasizing their clinical implementation. As proteomics-derived markers have still not been routinely applied in clinical practice, challenges, and some potential solutions, to further support clinical implementation are discussed in the outlook.A systematic literature search was performed through the Web of Science platform on 6 June 2018. Records were retrieved from all databases based on the following search criteria: (1) TOPIC: (biomarker* or marker*) AND TOPIC: (proteome*) AND TOPIC: (\u201cprostate cancer\u201d or \u201cprostate adeno*\u201d) and (2) Timespan: 2008-2018. The search resulted in retrieval of 1256 manuscripts, as presented in A broad range of proteomics platforms has been applied to investigate body fluid-based  and tissue-based biomarkers for PC. Based on the literature search and also in agreement with the general consensus in the field, biomarker discovery is typically performed using platforms that allow for global assessment of protein alterations, including both gel-based and gel-free methods; whereas validation of the selected biomarkers is based mostly on classical immuno-based assays and targeted MS. An overview on the advantages and disadvantages of proteomics approaches is provided in a past paper . The mosDiscovery of proteomics biomarkers in the context of PC was carried out using both gel-based  and two-dimensional difference gel electrophoresis (2D-DIGE) in combination with MS for protein identifications) as well as gel-free approaches (liquid chromatography coupled with tandem mass spectrometry (LC-MS/MS), capillary electrophoresis coupled to mass spectrometry (CE-MS)), with LC-MS/MS being most frequently applied. Gel-based techniques, like 2DE and 2D-DIGE (modification of 2DE), involve separation of the proteins using isoelectric focusing based on their charge, followed by separation in sodium dodecyl sulfate (SDS)- polyacrylamide gel based on their mass. As a result, a two-dimensional map of proteins is generated where separated proteins appear as \u201cspots\u201d. The main difference between 2DE and 2D-DIGE is the use of fluorescent cyanine dyes  to label the proteins prior to isoelectric focusing. This allows for simultaneous separation of three samples, usually representing a control group, a case group, and an internal standard . Compared to classical 2DE, 2D-DIGE decreases gel-to-gel variability and improves quantification and mapping of spots across different gels. However, neither 2DE nor 2D-DIGE provide a direct link to protein identity. For that purpose, spots of interest are excised from the gel, proteins are then digested (in-gel digestion) using trypsin, and the peptide extracts are analyzed by MS.With the advancements of MS, new gel-free approaches have been developed and applied to comprehensively investigate the proteome. Particularly LC-MS/MS analysis has been most frequently applied to identify novel markers for PC. The proteins are initially digested into peptides, followed by chromatographic separation. Frequently, considering the high complexity of the protein/peptide extracts, additional steps are required to decrease the sample complexity and improve on the identification rate of low abundant proteins. This includes among others (a) depletion of most abundant proteins, (b) enrichment of the sample in the proteins or peptides of interest , or (c) multidimensional separation of peptides through combined chromatographic strategies prior to MS analysis. Subsequent MS/MS analysis includes peptide ionization and separation of precursor ions based on mass over change ratio (MS1 level) and its fragmentation (MS2 level), with the latter used as a basis for determination of peptide sequences. This analysis generates data of high complexity, especially when multiple samples are analyzed in the context of a single experiment. Quantification of MS-based proteomics findings is performed by either a metabolic or a chemical labeling (label-based) or without labeling by using spectral counting or intensity-based method (label-free approaches).Another approach, CE-MS, is based on the analysis of low molecular weight proteins and peptides (<20 kDa) that are present in body fluids. In this analysis, molecules are separated in an uncoated fused silica capillary. As in LC-MS/MS, the molecules are ionized and then analyzed by MS. Through this approach several biomarker patterns for urogenital malignancies have been already developed ,45,46,47Most of the platforms that are applied for validation are based on antibodies to detect protein biomarkers . This inProteomics approaches have been widely employed in PC biomarker research, reflected by the numerous studies that have been published over the last 10 years. The research focus is on the development of urinary, blood, seminal plasma, and tissue-derived biomarkers in the context of diagnosis, risk stratification, and prediction of treatment response. An overview of the types of clinical samples applied in the context of PC biomarker development, along with main advantages, disadvantages and context of use is provided in Body fluids are the preferable source of noninvasive or minimally invasive biomarkers, due to the limited associated side effects from sampling. These biomarkers are promising for patients with PC, for which invasive biopsy is the current \u201cgold standard\u201d of clinical care.Due to noninvasive collection, urinary biomarkers are an ideal alternative to regular extensive biopsy procedures for diagnostic purposes and for disease monitoring. To identify urinary biomarkers for PC, both full urine and urine collected after digital rectal examination (DRE) has been analyzed. Prostate massage performed during DRE enriches the urine samples with PC-originated material such as cancer cells and prostatic fluids , making A.\u2003Biomarkers for cancer detectionNumerous urinary-based proteomics multimarker panels for cancer detection have been identified. Davalieva et al. investigated the urinary proteome from patients with PC (n = 8) and benign prostatic hyperplasia  using 2D-DIGE in combination with matrix assisted laser desorption ionization combined with tandem time of flight MS (MALDI-TOF/TOF) . Comparap < 0.001). Further improvement was observed after integration of PSA in the panel ) [Jedinak et al. applied 8-plex isobaric tags for relative and absolute quantitation (iTRAQ) labeling  followed by multidimensional chromatographic separation and MALDI-TOF/TOF to discriminate between localized PC and BPH  and iden 0.001)) .p = 0.023). Moreover, cost-effectiveness of the proposed biomarkers to guide biopsy in patients with suspicious PSA test was supported [CE-MS was applied to investigate naturally occurring urinary peptides as plausible biomarkers to guide prostate biopsy ,47. In tupported .p = 0.010), compared to PSA only (AUC = 0.65) [Few exploratory studies were performed to evaluate biomarkers identified in previous investigations. Zinc-\u03b12-glycoprotein (AZGP1) , Flotill = 0.65) . Interes = 0.65) .Wang et al. measured selected urinary exosomal proteins using immuno-based assays (WB and ELISA) . Based oSequeiris et al. applied SRM to validate 64 proteins, retrieved from in-house proteomics investigations and literature ,66,67, ip < 0.05) was observed [p = 0.009) [p = 0.011). Initial ROC analysis resulted in an AUC of 0.76 (p = 0.027) for detection of PC as well as an AUC of 0.86  for detection of PC with a GS \u2265 7 [The proteome of urinary EVs was investigated by Fujita et al.  using iTobserved . These p= 0.009) . FABP5 la GS \u2265 7 . Increasa GS \u2265 7 , in linep = 0.083) it was inferior to PSA  [Casanova-Salas et al. identified Aldehyde dehydrogenase 1A3 (ALDH1A3) as a potential PC biomarker by investigation of miR-187 targets using 2D-DIGE analysis of PC-3 cell lines transfected with a miR-187 precursor and miRNA mimicking negative controls . Analysi= 0.036) .B.\u2003Biomarkers for risk stratification to guide therapeutic intervention.p = 0.0375) (manuscript submitted).Only few urine-based proteomics studies reported on the identification of biomarkers for risk stratification. Similarly, to the CE-MS studies for cancer detection (as outlined above), naturally occurring urinary peptides were investigated for their potential to detect clinically significant PC. A CE-MS based panel, consisting of 19 peptide markers was established in a cohort of 823 PC patients with low PSA levels (<15 ng/mL). Validation in an independent test set of 280 PC patients resulted in an AUC value of 0.79. Combination with age and the European Randomized study of Screening for Prostate Cancer (ERSPC) risk calculator resulted in an AUC value of 0.81, significantly higher compared to the ERSPC alone  proteomics biomarkers for PC have been extensively investigated, mostly aiming at diagnostic purposes. However, proteomic analysis of blood is challenging, due to its high complexity and the broad range of protein concentration. As such, decreasing of the samples\u2019 complexity by the application of depletion or enrichment strategies or multidimensional chromatographic separation of peptides prior MS has been applied. The most promising blood-based biomarker studies are presented in the following subsections.A.\u2003Biomarkers for detection of cancerp = 0.013). ROC analysis for individual markers showed an AUC of 0.68 for PSA (p = 0.006), 0.60 for SAA1 (p = 0.117), and 0.61 for TSR1 (p = 0.081) in discriminating nonmalignant  from malignant samples. Combination of TSR1 and PSA improved the diagnostic performance (AUC = 0.73) [Larkin et al. applied iTRAQ labeling in combination with multidimensional LC-MS/MS to investigate serum proteome in patients with T1-T2 PC (n = 20), T3-T4 PC (n = 20), benign disease (n = 15), and healthy controls (n = 20) . The sam = 0.73) .In a study by Byrne et al. immuno-depleted serum samples from 12 PC patients undergoing RP  were analyzed using 2D-DIGE followed by LC-MS/MS . Among tBurgess et al. identified Heat shock protein 90 alpha (HSP90\u03b1) through the investigation of proteins associated with serum Alpha-2 macroglobulin using immunoaffinity enrichment and LC-MS/MS  . HSP90\u03b1 Potential biomarkers were also identified using cell lines or animal models, followed by validation in clinical specimens. Sardana et al. analyzed conditioned media from PC cell lines  using two-dimensional LC-MS/MS . FurtherOne of these proteins, SPON2, was also highlighted in a study by Qian et al. , investiExosomes were isolated from the conditioned media of androgen-dependent (LNCaP) and androgen-independent  cell lines . The exoCima et al. analyzed N-linked glycoproteins in serum and tissue samples from wild type and phosphatase and tensin homolog (PTEN)-null mice using LC-MS/MS . A totalParallel proteomics and transcriptomics analysis of a very small set of tissue samples  was also applied to discover serological biomarkers for PC . Cross-cUeda et al. analyzed the low-molecular weight plasma proteome using LC-MS/MS . AnalysiB.\u2003Biomarkers for risk stratification to guide therapeutic intervention.Proteomics approaches have also been applied to identify biomarkers for risk stratification. Rehman et al. applied a 4-plex iTRAQ-based quantification methodology to assess pooled serum samples from patients with localized PC (incl. 10 patients defined as \u2018nonprogressing\u2019 and 10 \u2018progressing\u2019 based on the change of PSA level over the 5 years of monitoring), metastatic PC (n = 5), and BPH (n = 5) . 22, 19,Claudin 3 was identified as a potential biomarker through proteome analysis of exosomes extracted from conditioned media of PC3  and PNT1A (benign) cell lines . Plasma C.\u2003Biomarkers for prediction of treatment responseThere is an emerging need to identify biomarkers to predict treatment response for patients with advanced PC, especially those with CRPC. To address this need, some studies have been published. However, when comparing with the development of diagnostic or risk stratification biomarkers, the results are rather limited.p = 0.006) and shorter survival after treatment (p = 0.002) [In the study by Zhao et al., proteome analysis was applied to identify biomarkers able to predict response to docetaxel . The ini= 0.002) . FurtherSerum biomarkers predictive of treatment response to everolimus in patients with mCRPC were assessed as part of a phase 2 clinical trial . A totalSeminal plasma is a body fluid that consists of secretions from seminal vesicles (~65% of semen volume), prostate (~25%), testis, and epididymis (~10%) . SeminalA.\u2003Biomarkers for risk stratification to guide therapeutic interventionp = 0.0055) to discriminate between localized (n = 28) and advanced disease (n = 5) [Neuhaus et al., analyzed seminal plasma using CE-MS . A panel (n = 5) . While tp < 0.05) [p = 0.0009), lymph node , and bone  metastatic lesions in comparison to normal prostate samples (n = 8). ROC analysis based on the seminal plasma levels of PROS1 showed an AUC of 0.88 (p < 0.001) when discriminating between benign /low grade PC and intermediate/high grade PC [In a study by Saraon et al., a biomarker discovery study was performed using 2D LC-MS/MS on conditioned media from panel of androgen dependent, androgen independent and normal prostate epithelial cell lines . Differe < 0.05) . Moreovegrade PC .B.\u2003Biomarkers for cancer detectionp = 0.0001) [In parallel, development of diagnostic markers to improve detection of cancer was attempted. For that purpose, as a part of a study by Neuhaus et al., two biomarker panels were established in a training set  . This in 0.0001) .In comparison to body fluids, tissue is the direct site of molecular alterations implicated in cancer onset and progression. Therefore, apart from the identification of proteins indicative of a disease state, tissue proteomics may allow for better understanding of disease biology, thus may guide identification of drug targets. However, high heterogeneity of tissue sample, i.e., by presence of other than cancerous cells, intratumor variability, etc., has to be taken into account when performing such type of analysis, as it may affect the subsequent interpretation of the results. Moreover, collection of tissue samples is invasive and associated with side effects. Several tissue proteomics studies have been performed in the context of PC biomarker development, as presented in the following section, with most of the studies targeting at the identification of biomarkers for risk stratification to guide intervention.A.\u2003Biomarkers for risk stratification to guide therapeutic interventionN-glycoproteins, as being selectively present in plasma [N-glycosylation sites [In two studies, focus was placed on the analysis of n plasma ,86. In ton sites . A totalon sites . NAAA waon sites .p < 0.05) [p < 0.0001, n = 147) [Iglesias-Gato et al. combined Super-Stable Isotope Labeling by/with Amino acids in Cell culture (SILAC) and LC-MS/MS analysis to investigate the PC tissue proteome in 36 tissue samples , aiming at identification of prognostic biomarkers for PC aggressiveness to improve stratification of patients for active surveillance or active treatment . 649 dif < 0.05) . Among t < 0.05) . In bothn = 147) . Moreoven = 147) .p < 0.0001, n = 274) to discriminate between \u201cfavorable pathology\u201d ) vs. \u201dnon-favorable\u201d  and an AUC value of 0.65  for discrimination between \u201cGS6\u201d  vs. \u201cnon-GS6\u201d ) [An eight-biomarker panel based on quantitative multiplex proteomics imaging was established to stratify patients for active surveillance or active treatment . The pan, or M)) . The abop < 0.0001) [p = 0.025). However, based on the follow-up data for 60 out of 62 patients, multivariate analysis did not confirm SND1 as an independent predictor for biochemical failure after RP (p = 0.21) [Kuruma et al. explored the value and biological relevance of Staphylococcal nuclease domain-containing protein 1 (SND1) as biomarker for PC . SND1 wa 0.0001) . The exp = 0.21) .p < 0.0001) [p = 0.008). Importantly, higher nuclear matrix expression was associated with poor prognosis  [Barboro et al. characterized Heterogeneous nuclear ribonucleoprotein K (hnRNP K) expression in the context of PC . IHC ana 0.0001) . Further = 2.95) . hnRNP Kp = 0.0329; lymph node, n = 28, p = 0.0121; bone, n = 74, p = 0.0001) vs. normal tissue (n = 8) was detected [Additional potential biomarkers have been initially identified in cell lines, followed by validation in tissue samples ,92. GlenB.\u2003Biomarkers for detection of cancerPatients\u2019 acceptance of tissue-based diagnostic tests might be problematic, mostly due to its invasive character. Therefore, the investigations are focused towards developing noninvasive diagnostic biomarkers in PC, as supported through numerous studies published in this area (see above); whereas only few and preliminary studies devoted to tissue-based diagnostic markers have been conducted so far, as outlined below.p < 0.05). Differential expression of Prohibitin in PC vs. BPH was confirmed by IHC  [Ummanni et al. analyzed 23 tissue samples from patients with BPH (n = 11) and PC (n = 12) using 2DE in combination with MS for subsequent protein identification . A total= 18 PC) , but itsIn another study, Sun et al. identified Periostin as potential PC biomarker using iTRAQ-based quantification and LC-MS/MS . IHC anam/z 10775 peak for benign tissue [MALDI-MS tissue imaging of cancer, benign epithelium and stromal areas of 13 RP specimens resulted in the identification of discriminatory peptide/ protein masses for cancer, benign and stromal tissue . Analysin tissue . Upreguln tissue . FurtherJiang et al. focused on development of diagnostic biomarkers using proteomics and interactome analysis . Sixty pSimilarly, Davalieva et al. applied 2D-DIGE in combination with MS to investigate differences in proteome from PC (n = 5) and BPH tissue (n = 5) . ComparaC.\u2003Biomarkers for detection of lymph node metastatic PCPang et al. investigated biomarkers associated with lymph node metastatic (LNM) PC. Biomarker discovery was performed in tissue samples  using 2D-DIGE . A totalAdvancements in the management of PC are urgently needed to improve on guiding biopsies and intervention and thus decrease disease burden. As presented above, proteomics has contributed to the identification of potential biomarkers for PC. Urinary and blood-based proteome have been extensively studied to identify noninvasive/minimally invasive biomarkers for cancer detection, while seminal plasma and tissue proteome was rather investigated as a source of biomarkers for risk stratification, in order to better discriminate between aggressive and nonaggressive disease phenotype. In any case, only a small number of investigations have been performed for identification of markers to predict treatment response.As a result, a vast amount of proteomics data has been collected, a long list of molecular determinants of disease has been generated, and some of the shortlisted biomarker candidates could be verified in independent cohorts. In addition, initial assessment of their clinical utility showed rather good performance. This, in principle, confirms the potential value of proteomics findings. It is also becoming evident from multiple studies, that the combination of multiple markers into a panel increases the performance of the tests.Although these results appear promising and the proteomics platforms are sufficiently advanced in analytical and technical terms, the identified biomarkers obviously have not reached the phase of clinical implementation. Based on the presented studies, some main factors can be listed accounting for this: (a) the study design is frequently not adjusted for the specific clinical context, (b) the investigations are not performed in the appropriate population, (c) the studies are underpowered, (d) comparison with the currently applied routine methodologies is missing, and (e) health economics evaluation for cost-effectiveness analysis is not always present.In an effort to support implementation of biomarkers into practice (not only in the context of PC), several guidelines/recommendations have been established covering quality assessment, study design, reporting, and practical aspects ,102,103.Collectively, a solid background has been established in the area of proteomics biomarkers for PC, aiming to address the main clinical needs. This holds a great promise to decrease overdiagnosis and overtreatment, to reduce the number of unnecessary/invasive biopsies, and also in the future to support selection of the best treatment option. Thus, it is now time to organize a way to bring these findings closer to clinical implementation."}
+{"text": "Moreover, semicarbazides 1 and 2 inhibit microvascular sprouting mediated through CD36 in the choroid explant. Seeking a selective CD36 modulator that mediated inflammation without influencing neovascularization, a set of azasulfurylpeptides  were synthesized in which the semicarbazide was replaced by an N-aminosulfamide residue using a novel solid-phase approach. Notably, azasulfurylpeptide 3c diminished selectively CD36-mediated TLR-2-triggered inflammatory response without affecting neovascularization. Subtle chemical modification at the peptide backbone from a carbonyl to a sulfuryl residue has had a selective effect on biological activity providing a valuable probe for studying CD36 chemical biology.Modulation of the cluster of differentiation-36 receptor (CD36) has proven promising for dampening pro-inflammatory macrophage signaling. For example, azapeptides (e.g.,  Inflammation is a defensive biological response to dangerous stimuli such as pathogens and damaged-associated molecular patterns released by apoptotic cells. In response to the tissue insult, innate immunity cells such as macrophages and microglia function to initiate inflammatory responses to remove debris by phagocytosis and to remodel the tissue to a homeostasis state ,2,3. PlaExpressed on macrophage plasma membranes, the cluster of differentiation 36 receptor (CD36) serves key roles in recognition and phagocytosis as a scavenger of multiple-ligands: e.g., oxidized lipoproteins, and cholesterol ,9,10,11.2), such as [azaY4]- and [aza(4-F)F4]-GHRP-6  -GHRP-6 decreased sub-retinal deposits and minimized macrophage infiltration within the subretinal space. In the interest to differentiate the roles of CD36 in inflammatory response and neovascularization, a search for modulators that influence only the former has been pursued.Semicarbazide analogs of growth hormone releasing peptide-6  ,18. In mR-FSL-1) . FurtherR-FSL-1) . Mediation (AMD) , [azaY4]3\u20136, N-aminosulfamide as amino amide surrogate -GHRP-6 (3c). Exhibiting similar binding affinity as its aza-counterpart, [aza(4-F)F4]-GHRP-6 (2), azasulfuryl analog 3c reduced CD36-mediated overproduction of NO, and pro-inflammatory chemokines and cytokines in macrophage cells. Moreover, in a murine model, azasulfurylpeptide 3c behaved like azapeptides 1 and 2 and reduced recruitment of subretinal IBA-1 positive cells induced by blue light exposure. In contrast to the azapeptides 1 and 2, which reduced angiogenic sprouting in mouse choroidal explants, azasulfurylpeptide 3c did not affect choroidal vascular growth. A selective modulator of inflammation without influence on neovascularization, [As(4-F)F4]-GHRP-6 (3c) represents a novel probe for differentiating the pleotropic effects of CD36 towards the development of therapeutic prototypes for countering chronic inflammation without effect on the microvasculature.Through the exploration of the biological activities of azasulfurylpeptides, a novel class of CD36 modulators has been developed and epitomized by azasulfuryl-t-Bu  and benzyl bromide , and stirred for 3h. The volatiles were evaporated to a residue, which was dissolved in dichloromethane , washed with 5% citric acid (1 \u00d7 10 mL), water (1 \u00d7 10 mL) and brine (1 \u00d7 10 mL), dried over MgSO4, filtered and evaporated. The residue was purified by flash chromatography 3, c 0.96); 1H NMR  1.14 , 1.39 , 1.40 , 3.14 , 3.95\u20134.05 , 4.46 , 4.50 , 4.55 , 4.90 , 5.61 , 7.20\u20137.35 , 7.88 ; 13C NMR  18.0, 28.3, 28.6, 39.0, 49.2, 55.2, 57.7, 80.9, 83.2, 127.3, 128.5, 128.6, 128.9, 129.6, 130.3, 134.8, 136.2, 156.0, 170.5, 172.1; IR (neat) vmax/cm\u22121 1155, 1253, 1369, 1460, 1501, 1693, 2989; HRMS (ESI) m/z calculated for C28H40N4NaO7S [M + Na]+ 599.2510; found 599.2526.A solution of Boc-Ala-AsG-D-Phe-Ording to ) in THF tography  eluting 8  in t-BuOAc (1.00 mL) was treated with conc. H2SO4 , stirred at rt for 3 h, quenched with saturated NaHCO3 (10 mL), and extracted with EtOAc (4 \u00d7 15 mL). The organic layers were combined and evaporated to a residue, which was dissolved in water (3.5 mL), cooled in an ice bath, and treated with potassium carbonate  followed drop-wise with a solution of 9-fluorenylmethyl N-succinimidyl carbonate  in 1,4-dioxane (6.5 mL). After stirring at 0 \u00b0C for 1 h and at rt for 4 h, brine was added (25 mL) to the mixture. The layers were separated and the aqueous phase was extracted with EtOAc (3 \u00d7 40 mL). The organic phases were combined, dried over MgSO4, filtered and evaporated. The residue was purified by flash chromatography 3, c 1.00); 1H NMR  \u03b4 1.16 , 1.41 , 3.10\u20133.15 , 3.15\u20133.20 , 4.05\u20134.10 , 4.15 , 4.25\u20134.35 , 4.45\u20134.65 , 5.29 , 5.75 , 7.20\u20137.35 , 7.40 , 7.50\u20137.60 , 7.76 , 8.00 ; 13C NMR  \u03b4 18.3, 28.2, 39.1, 47.3, 49.4, 55.3, 57.6, 67.6, 83.3, 120.3, 125.4, 127.28, 127.38, 127.41, 128.02, 128.05, 128.56, 128.59, 128.8, 129.7, 130.3, 134.7, 136.2, 141.6, 143.9, 144.2, 156.3, 170.5, 171.7; IR (neat) vmax/cm\u22121 1155, 1252, 1369, 1454, 1502, 1703, 3263; HRMS (ESI) m/z calculated for C38H43N4O7S [M + H]+ 699.2847; found 699.2861.A solution of AsF-peptide tography  eluting tert-Butyl ester 9  was treated with TFA:DCM 1:1 (1 mL) for 1.5 h at rt. The volatiles were evaporated to afford acid 10 as a solid : mp 98 \u00b0C; [\u03b1]3, c 1.05); 1H NMR  \u03b4 0.70\u20130.90 , 3.10\u20133.30  3.90\u20134.15 , 4.15\u20134.25 , 4.25\u20134.35 , 4.55\u20134.65 , 4.65\u20134.75 , 5.75\u20135.85 , 5.85\u20136.00 , 6.70\u20137.50 , 7.60\u20137.75 , 8.48 ; 13C NMR  \u03b4 17.2, 39.0, 47.1, 49.4, 55.5, 57.2, 67.8, 120.2, 125.4, 127.32, 127.39, 128.1, 128.6, 128.7, 129.8, 130.3, 134.2, 135.7, 141.5, 143.7, 144.1, 157.0, 172.9, 173.5; IR (neat) vmax/cm\u22121 1165, 1252, 1353, 1454, 1520, 1694, 3299; HRMS (ESI) m/z calculated for C34H35N4O7S [M + H]+ 643.2221; found 643.2231.10  and 2-(1H-benzotriazol-1-yl)-1,1,3,3- tetramethyluronium hexafluorophosphate  in dimethylformamide  was stirred for 1 min, treated with N,N-diisopropylethylamine , stirred for 5 min and added to resin 11  swollen in DMF (2 mL) in a 3-mL plastic filtration tube equipped with polyethylene filter. The resin mixture was shaken for 18 h at rt. The resin was filtered, washed and filtered sequentially using 15 s agitations with DMF (3\u00d7), MeOH (3\u00d7) and DCM (3\u00d7), and dried in vacuo to afford resin 12. A resin aliquot (5 mg) was placed into a 1-mL plastic filtration tube equipped with polyethylene filter, treated with 20% piperidine in DMF and filtered (2 \u00d7 0.5 h), swollen and cleaved with 0.5 mL of a 95:2.5:2.5 cocktail of TFA:H2O:triethylsilane (TES) for 1 h at rt, and filtered. The filtrate was collected in a 1.5 mL Eppendorf\u00ae tube, concentrated with air bubbles, treated with Et2O (1 mL), and centrifuged for 2 min. After decantation, the precipitate was dissolved in H2O (1 mL) and analyzed by LC-MS: Rt 4.97 min on a Sunfire\u2122 column using a gradient of 5\u201380% MeOH (0.1% FA) for 7.5 min + 90% MeOH (0.1% FA) for 2.0 min. The unreacted amine was capped after treatment of the resin with acetic anhydride  and DIEA  in DMF (2 mL), shaking for 0.5 h, washing as above, and drying in vacuo.A solution of acid 12 on treatment (2 \u00d7 0.5 h) with a 20% piperidine in DMF solution followed by filtration, washing and drying as described above. The resin was swollen in DMF and treated with a premixed (1 min) solution of Fmoc-D-Trp(Boc)-OH (3.0 eq.) and HBTU (3.0 eq.) in DMF (2 mL) that was treated (5 min) with DIEA (6.0 eq.), and the mixture was shaken for 18 h at rt. The resin was filtered, washed, and dried as described for 12 above, then treated to remove the Fmoc group and coupled to Boc-His(Trt)-OH as described above. The resin (100 mg) was cleaved using a cocktail of TFA:H2O:TES  for 3 h in a cold room (4 \u00b0C), filtered and washed with TFA (2 \u00d7 2 mL). The filtrate was collected in a 50 mL Eppendorf\u2122 tube, concentrated with air bubbles, treated with Et2O (50 mL) and centrifuged for 5 min. After decantation, the precipitate was dissolved in H2O (5 mL) and freeze-dried to a solid: analysis indicated peptide 3a to be of 73% crude purity (Rt 13.08 min) on a Gemini C18 column with a gradient of 0\u201380% MeOH [0.1% formic acid (FA)] in water (0.1% FA) for 30.0 min, followed by 90% MeOH (0.1% FA) in water (0.1% FA) for 10.0 min. Purification on a Gemini\u00ae 5 micron C18 110A column  with a gradient of 30\u201355% MeOH (0.1% FA) in water (0.1% FA), with a flow rate of 10.0 mL/min, to afford the desired formate salt 3a . The purified product was analyzed by analytical RP-HPLC using a Gemini\u00ae 5 micron C18 110A column  and revealed to be of >99% purity: Rt 18.95 min [5\u201380% MeOH (0.1% FA) in water (0.1% FA) for 30.0 min + 90% MeOH (0.1% FA) in water (0.1% FA) for 10.0 min]; Rt 13.55 min [5\u201380% MeCN (0.1% FA) in water (0.1% FA) for 30.0 min + 90% MeCN (0.1% FA) in water (0.1% FA) for 10.0 min]. HRMS (ESI) m/z calculated for C42H54N12NaO7S [M + Na]+ 893.3851; found 893.3832.The Fmoc group was removed from resin 2CO3  and AsG-peptide 19  in 1:1 water:1,4-dioxane (14 mL) at 0 \u00b0C was treated with a solution of Fmoc-OSu  in dioxane (7 mL), stirred for 1 h, and allowed to warm to rt with stirring for 18 h. Brine (25 mL) was added to the mixture. The aqueous phase was extracted with EtOAc (3 \u00d7 50 mL). The organic phases were combined, dried over MgSO4, filtered and evaporated to a residue, which was purified on two consecutive flash chromatography c 0.98); 1H NMR  showed an 7:50 mixture of carbazate isomers : \u03b4 1.32 , , 1.34 , [1.43 ], 2.90\u20133.10 , 4.20-4.40 , 4.40\u20134.60 , 5.13 , [5.19 ] 5.26 , [5.32 ], 5.80\u20136.00 , 7.15\u20137.35 , 7.40 , 7.60\u20137.70 , 7.81 ; 13C NMR :6 \u03b4 19.1, 28.97 (29.01), 40.6 (40.8), 48.6, 51.2, 60.2 (60.4), 67.5, 71.3 (71.8), 83.9 (84.3), 118.6, 121.8 (121.9), 127.10 (127.17), 127.3 (127.4), 128.7, 129.2, 129.8, 130.2, 131.6 (131.7), 135.04 (135.10), 138.4 (138.5), 143.31 (143.37), 145.5 (145.6), 145.6 (145.7), 154.2, 172.4 (172.7), 175.0; IR (neat) vmax/cm\u22121 1152, 1178, 1226, 1316, 1369, 1384, 1450, 1498, 1695, 2978, 3292; HRMS (ESI) m/z calculated for C35H40N4NaO9S [M + Na]+ 715.2408; found 715.2424.A solution of Natography  columns 21 was synthesized from ester 20  using the protocol described for 10. The volatiles were evaporated to afford 21 as solid : [\u03b1]c 0.98); 1H NMR  showed a 9:20 mixture of carbazate isomers : \u03b4 1.34  [1.42 ], 3.00\u20133.20 , 4.20\u20134.40 , 4.40\u20134.55 , 4.55\u20134.70 , 5.13  [5.18 ], 5.32  [5.37 ], 5.80\u20136.00 , 7.15\u20137.35 , 7.40 , 7.60\u20137.70 , 7.80 ; 13C NMR :6 \u03b4 19.1 (19.2), 40.4, 48.54 (48.63), 51.17 (51.41), 59.9, 67.5, 71.4 (71.8), 118.6, 121.8 (121.9), 127.2 (127.4), 128.7, 129.2, 129.8, 130.2, 131.6, 135.1, 138.4 (138.5), 143.3 (143.4), 145.6 (145.7), 154.1, 158.7, 174.8, 175.0. IR (neat) vmax/cm\u22121 1178, 1220, 1315, 1384, 1449, 1519, 1543, 1643, 1688, 1737, 3071, 3289; HRMS (ESI) m/z calculated for C31H33N4O9S [M + H]+ 637.1963; found 637.1970.Acid 21  and N,N\u2019-diisopropylcarbodiimide  in DMF (2 mL) was stirred for 1 min, treated with hydroxybenzotriazole , stirred for 5 min, and added to resin 11  swollen in DMF (2 mL) in a 3-mL plastic filtration tube equipped with a polyethylene filter. The resin mixture was shaken for 18 h at rt, filtered, washed and dried as described above to afford resin 22, an aliquot of which was analyzed as described above: Rt 5.11 min on a Sunfire\u2122 column using a gradient of 5\u201380% MeOH (0.1% FA) in water (0.1% FA) for 7.5 min followed by 90% MeOH (0.1% FA) in water (0.1% FA) for 2.0 min. The resin was capped with acetic anhydride as described above and dried in vacuo.A solution of AsG(Fmoc)-tripeptide 22 , which was washed and dried as described in the synthesis of 3a above. A solution of 40% tetraethylammonium hydroxide in water  followed by 4-tert-butyldimethylsilyl(TBDMS)oxybenzyl bromide  were added to resin 23 swollen in DMF (2 mL), and the mixture was shaken at rt for 18 h, filtered, washed as described above and dried in vacuo. Analysis of a cleaved resin aliquot of 24b as described above by LC-MS indicated AsY(TBDMS)-peptide to be of 53% purity (Rt 6.09 min) contaminated with bis-alkylation product of 6% purity (Rt 6.09 min) using a Sunfire\u2122 column with a gradient of 5\u201380% MeOH (0.1% FA) in water (0.1% FA) for 7.5 min followed by 90% MeOH (0.1% FA) in water (0.1% FA) for 2.0 min.The Fmoc group was removed from resin 24a) was prepared and analyzed as 24b using benzyl bromide  and indicated to be of 77% purity (Rt 5.89 min) using an initial gradient of 20\u201380% MeOH (0.1% FA) in water (0.1% FA) for 6 min.Alloc-Ala-AsF-D-Phe-Lys(Boc)-NH-Rink resin (24c) was prepared and analyzed as 24b using 4-fluorobenzyl bromide  and indicated to be of 72% purity (Rt 6.86 min) contaminated with bis-alkylation product of 10% purity (Rt 8.33 min) using an initial gradient of 5\u201380% MeOH (0.1% FA) for 7.5 min.Alloc-Ala-(4-F)AsF-D-Phe-Lys(Boc)-NH-Rink resin (24d) was prepared and analyzed as 24b using 4-methoxybenzyl bromide  and indicated to be of 64% purity (Rt 6.71 min) contaminated with bis-alkylation product of 12% purity (Rt 8.07 min) using an initial gradient of 5\u201380% MeOH (0.1% FA) in water (0.1% FA) for 7.5 min.Alloc-Ala-(4-MeO)AsF-D-Phe-Lys(Boc)-NH-Rink resin (24e) was prepared and analyzed as 24b using 2-bromomethylnaphthalene  and indicated to be of 77% purity (Rt 7.71 min) contaminated with bis-alkylation product of 9% purity (Rt 7.71 min) using an initial gradient of 5\u201380% MeOH (0.1% FA) in water (0.1% FA) for 7.5 min.Alloc-Ala-AsNal-D-Phe-Lys(Boc)-NH-Rink resin (24c was swollen in DMF (2 mL) for 30 min, filtered, and treated with a solution of Pd(PPh3)4  and N,N-dimethylbarbituric acid  in 2 mL of 3:2 DCM:DMF. After shaking at rt for 2 h, the resin was filtered and retreated with the same conditions for a second time for 2 h. The resin was filtered, washed as above, treated with 0.5% sodium diethylthiocarbamate (2 mL) for 30 min, filtered and washed two more times with 0.5% sodium diethylthiocarbamate (2 mL) for 15 s. After washing as described above, analysis of a cleaved aliquot of resin showed a Rt 4.28 min: Sunfire\u2122 column; gradient: 5\u201380% MeOH (0.1% FA) for 7.5 min + 90% MeOH (0.1% FA) for 2.0 min. The (4-F)Asf-peptide resin was elongated, cleaved and purified as described above for the synthesis of AsF-peptide 3a: 65% crude purity (Rt 5.96 min) on a Sunfire\u2122 column using a gradient of 5\u201380% MeOH (0.1% FA) in water (0.1% FA) for 7.5 min followed by 90% MeOH (0.1% FA) in water (0.1% FA) for 2.0 min. Purification by preparative RP-HPLC using a Gemini\u00ae 5 micron C18 110A column  with a gradient of 20\u201350% MeOH (0.1% FA) in water (0.1% FA), with a flow rate of 10.0 mL/min afforded (4-F)Asf-peptide 3c  as FA salt: >99% purity (Rt 5.23 min) 5\u201380% MeOH (0.1% FA) in water (0.1% FA) for 7.5 min followed by 90% MeOH (0.1% FA) in water (0.1% FA) for 2.0 min]; (Rt 3.59 min) 5\u201380% MeCN (0.1% FA) in water (0.1% FA) for 7.5 min followed by 90% MeCN (0.1% FA) for 2.0 min. HRMS (ESI) m/z calculated for C42H53FN12NaO7S [M + Na]+ 911.3757; found 911.3769.Resin 2 (3a) was synthesized in 82% crude purity from resin 24a using the same protocols described above for 3c and exhibited identical retention time as material prepared from AsF-peptide 10.H-His-D-Trp-Ala-AsF-D-Phe-Lys-NH2 (3b) was synthesized from resin 24b using the same protocols described above for 3c . HRMS (ESI) m/z calculated for C42H54N12NaO8S [M + Na]+ 909.3801; found 909.3805.H-His-D-Trp-Ala-AsF(4-HO)-D-Phe-Lys-NH2 (3d) was synthesized from resin 24d using the same protocols described above for 3c . HRMS (ESI) m/z calculated for C43H56N12NaO8S [M + Na]+ 923.3957; found 923.3936.H-His-D-Trp-Ala-(4-MeO)AsF-D-Phe-Lys-NH2 (3e) was synthesized from resin 24e using the same protocols described above for 3c . HRMS (ESI) m/z calculated for C46H56N12NaO7S [M + Na]+ 943.4008; found 943.4007.H-His-D-Trp-Ala-AsNal-D-Phe-Lys-NH2 (3f) was synthesized from resin 24c using the same protocols described above for 3c except replacing Fmoc-Ala-OH for Fmoc-His(Tr)-OH . HRMS (ESI) m/z calculated for C39H51FN10O7S [M + Na]+ 845.3647; found 845.3539.H-Ala-D-Trp-Ala-AsF(4-F)-D-Phe-Lys-NHN-methyl morpholine , stirred for 15 min, treated slowly with a solution of tert-butyl N-(4-fluorobenzyl)carbazate  in THF (50 mL), stirred for 3 h, diluted with EtOAc and washed with water and brine. The organic phases were combined, dried over Na2SO4, filtered and evaporated to a residue that was purified by flash chromatography on silica gel eluting with 20\u201340% EtOAc in hexane to afford N-(Fmoc)alanine-N\u2019-4-fluorobenzyl N\u2019-(Boc)hydrazide  as white solid: mp 68\u221269 \u00b0C; Rf 0.25 (EtOAc:hexane 3:2); 1H NMR  \u03b4 7.76 , 7.55 , 7.40 , 7.34\u20137.27 , 7.24\u20137.16 , 6.97\u20136.89 , 5.39\u20135.11 , 4.70\u20134.49 , 4.42\u20134.24 , 4.24\u20134.04 , 1.45 , 1.36 ; 13C NMR  \u03b4 163.5, 161.5, 156.1, 143.8, 141.5, 132.4, 130.5, 127.9, 127.2, 125.1, 120.2, 115.7, 115.5, 67.4, 60.5, 47.2, 28.3, 21.2, 18.1, 14.3; IR (neat) vmax/cm\u22121 1154, 1220, 1248, 1367, 1391, 1450, 1509, 1536, 1678, 2978, 3276; HRMS m/z calculated for C30H32FN3O5 [M + Na]+ 556.2218; found 556.2234. The hydrazide  was dissolved in DCM (35 mL), treated with trifluoroacetic acid (20 mL) and stirred for 3 h. The volatiles were evaporated. The residue was dissolved in DCM and evaporated (3\u00d7), dissolved in EtOAc (150 mL), washed with sat. K2CO3 (150 mL) and H2O (100 mL), dried over MgSO4, filtered and evaporated to afford hydrazide 29  as white powder: mp 176 \u00b0C; 1H NMR  \u03b4 9.32 , 7.89 , 7.78\u20137.55 , 7.55\u20137.40 , 7.40\u20137.20 , 7.20\u20136.96 , 5.23 , 4.36\u20134.11 , 4.11\u20133.92 , 3.82 , 1.14 ; 13C NMR  \u03b4 171.6, 155.6, 1439, 143.8, 140.7, 134.8, 130.53, 130.45, 127.6, 127.1, 125.3, 120.1, 114.8, 114.6, 65.6, 53.6, 48.7, 46.6, 18.3; IR (neat) vmax/cm\u22121 1105, 1266, 1330, 1453, 1509, 1542, 1651, 1696 3275, 3304; HRMS m/z calculated for C25H24FN3O3 [M + Na]+ 456.1694; found 456.1697.A solution of Fmoc-alanine  in THF (50 mL) at \u201315\u00b0C was treated slowly with isobutyl chloroformate  and 29  was added to a microwave vessel containing a solution of 4-nitrophenyl D-phenylalanine tert-butyl ester sulfamidate  in DCE (10 mL), treated with DIEA , at which point the solution turned yellow. The vessel was sealed and heated to 60 \u00b0C using microwave irradiation for 2.5 h. The volatiles were evaporated. The residue was purified by flash chromatography eluting with a solution of 7:3 Et2O:pet. ether. The collected fractions were evaporated to a residue, which was dissolved in DCM (25 mL), washed with sat. NaHCO3, dried over Na2SO4, filtered and evaporated to afford azasulfuryltripeptide 31  as white solid: mp 74\u201376 \u00b0C; Rf 0.35 (7:3 Et2O:petroleum ether); 1H NMR  \u03b4 7.75 , 7.67 , 7.57\u20137.50 , 7.42\u20137.35 , 7.35\u20137.27 , 7.25\u20137.16 , 6.97 , 5.49 , 5.13 , 4.51 , 4.47\u20134.40 , 4.39\u20134.28 , 4.19\u20134.12 , 4.08\u20133.99 , 3.21\u20133.09 , 1.40 , 1.20 ; 13C NMR  \u03b4 171.3, 170.3, 143.7, 141.5, 135.9, 131.3, 131.2, 130.3, 130.1, 128.5, 127.9, 127.3, 127.2, 125.2, 120.1, 115.7, 115.6, 83.3, 67.5, 57.3, 54.5, 49.3, 47.1, 38.8, 28.1, 17.5; IR (neat) vmax/cm\u22121 1151, 1222, 1365, 1450, 1479, 1601, 1695, 2978, 3280; HRMS m/z calculated for C38H41FN4O7S [M + Na]+ 739.2572; found 739.2587. Hydrazide tert-Butyl ester 31  was treated with TFA:DCM 1:1 (9 mL) for 1.5 h at room temperature. The volatiles were then evaporated, residue obtained was dissolved in DCM and evaporated (3\u00d7) to afford acid 32  as white solid: mp 74\u201375 \u00b0C; 1H NMR  \u03b4 8.43 , 7.79 , 7.67\u20137.51 , 7.51\u20137.46 , 7.48\u20137.39 , 7.39\u20137.31 , 7.09\u20136.95 , 6.39 , 6.06\u20135.72 , 4.79\u20134.54 , 4.43\u20134.27 , 4.27\u20134.09 , 4.09\u20133.96 , 3.42\u20133.15 , 1.00 ; 13C NMR  \u03b4 173.4, 164.1, 161.6, 157.0, 141.3, 135.3, 131.5, 131.4, 130.0, 128.5, 128.01, 127.99, 127.3, 125.1, 120.2, 115.6, 115.4, 67.8, 57.0, 54.7, 49.3, 46.9, 38.8, 16.9; IR (neat) vmax/cm\u22121 1103, 1159, 1218, 1347, 1391, 1449, 1477, 1509, 1697, 3276; HRMS m/z calculated for C34H33FN4O7S [M + Na]+ 683.1946; found 683.1956. 32  was coupled to resin 11  according to the protocol described for the synthesis of resin 22. Analysis of a cleaved aliquot showed (Rt 4.97 min) 10\u201390% MeOH (0.1% FA) for 10 min. Following the protocols above for 3a, the resin was capped with acetic anhydride, elongated, cleaved and purified to give (4-F)AsF-peptide 3c having identical chromatographic and spectrometric properties as described above. Acid 5 cells/well in Dulbecco\u2019s modified eagle media (DMEM) containing 100U/mL of penicillin (Pen) and 100 \u03bcg/mL of streptomycin (Strep) on a 48-well plate (Costar\u00ae #3548), and incubated at 37 \u00b0C with 5% CO2. After 2 h, the medium of adhered cells was changed to DMEM-Pen/Strep containing 0.2% of bovine serum albumin (BSA), and supplemented with either azasulfurylpeptide 3a\u2013f or [azaK6]-GHRP-6 as a negative control. After 2 h of pre-incubation, the cells were stimulated overnight with 300 ng/mL of R-FSL-1. Supernatants were collected for fluorescence determination of nitrite using 2,3-diaminonaphtalene (DAN). Briefly, 25 \u03bcL of sample was incubated with 0.5 \u03bcg of DAN in a 100 \u03bcL final volume of phosphate buffer  at rt in the dark. After 15 min, the reaction was stopped with 20 \u00b5L of NaOH (2.8N) and the plate was read using a fluorescence plate reader .The murine J774A.1 macrophage cell lines were obtained from American Type Cell Collection (ATCC #TIB-67), seeded at 1.5 \u00d7 102 atmosphere, and washed twice with PBS to remove non-adherent cells. Macrophages (0.5 \u00d7 106 cells/well) were plated in 48 well-culture plates with DMEM containing 0.2% of bovine serum albumin (BSA), pretreated for 2 h with azasulfurylpeptides 3b\u2013e or [azaK6]-GHRP-6 (1 \u00b5M), before stimulation with a TLR2 ligand: R-FSL-1 (Invivogen\u00ae #L7022) at 300 ng/mL interferon gamma  at 20 ng/mL for 4 or 24 h. The supernatants were recovered, and ELISA  was performed to determine the levels of proinflammatory cytokine and chemokine . The effect on NF-\u03baB activation was documented on cell lysates after 0, 5, 10, 15 and 30 min stimulation with R-FSL1, using NF-\u03baB p65/RelA specific ELISA-based assay (eBioscience\u00ae #85-86083). The results were expressed as mean \u00b1 SEM and analyzed statistically by a one-way analysis of variance (ANOVA) with a Dunnett as a post-test. Level of significance was set at P < 0.05.Peritoneal macrophage cells from C57BL/6 mice were harvested from sterile DMEM cell-culture medium (Wisent # 319-005-CL), allowed to adhere for 1 h at 37 \u00b0C in a 5% CO\u2212/\u2212ApoE) mice were obtained from The Jackson Laboratory . Animals were housed under 12 h light/dark cycles and fed ad libitum with a standard rodent diet. All experimental procedures were done in accordance with the Animal Ethics Committee at Universit\u00e9 de Montreal  and the Canadian Council on Animal Care guidelines for use of experimental animals.Apo E deficient  for 5 d at 1000 lux illumination without previous dark-adaptation. For pupil dilatation, ophthalmic atropine solution 1%  was applied to both eyes daily. Aza- and azasulfurylpeptides 1, 2 and 3c or [azaK6]-GHRP-6 (289 nmol/kg) were administered subcutaneously at 24 h following blue-light exposure for 7 consecutive days. At the end of the blue-light exposure period, the mice were maintained on a 12:12 h light: dark cycle for 3 days, before being sacrificed. Enucleated eyes were fixed in 4% paraformaldehyde (PFA) for 15 min at rt and sectioned at the limbus; the anterior segments were discarded. The posterior eye cups consisting of retinal pigment epithelium (RPE)/choroid/sclera complex were collected and prepared for immunofluorescence analysis. Three to four-month-old ApoERPE/choroid/sclera flat-mounts were treated with PBS solution containing 0.1% Triton 100\u00d7 and 10% fetal bovine serum (FBS) or 5% BSA (saturation buffer) for 45 min. Specimens were incubated overnight at 4 \u00b0C with primary antibodies diluted in saturation buffer. Immunofluorescence was performed using polyclonal rabbit anti-IBA-1 as marker of activated cells. The corresponding secondary antibody, AlexaFluor 488-conjugated antibody was used to reveal the primary antibody. Flatmounts were analyzed using an IX81 Olympus fluorescence microscope . All immunostainings were repeated at least three times and staining that omitted the primary antibody served as negative control. 1, 2 and 3c or [azaK6]-GHRP-6 (289 nmol/kg). Cell numbers were expressed as the mean number of IBA-1\u2013positive cells in subretinal space. Statistical analysis was performed by using a one-way ANOVA with a Dunnett as a post-test. Level of significance was set at P < 0.05.IBA-1\u2013stained cells were counted on flatmounts from control and illuminated mice injected daily with 0.9% NaCl or with aza- and azasulfurylpeptides 1, 2 and 3c or [azaK6]-GHRP-6 were collected and dissected to obtain the complex consisting of the RPE/choroid/sclera, which was cut in 16 explant fragments and cultured in 20 \u00b5L of Matrigel  in 24-wells plates . Explant growth was performed in endothelial cell growth medium (EGM) over 3 days, until the endothelial cells were found to proliferate around the explant. Phototographs of explants were taken under microscopy (T0 and T24 h). The explants were washed with endothelial basal medium (EBM) and incubated in EBM with NaCl or CD36 ligands at 10\u22126 M for 24 h. The sprouting surface was assessed by image analysis using imagen J software. Ratios /sprouting surface at T0 were determined. Numerical results were expressed as mean \u00b1 SEM. Data were compared using one-way ANOVA with Dunnett\u2019s post-test. P < 0.05 was considered statistically significant .Choroidal explants were set as described previously . BrieflyN-Aminosulfamide residues were introduced at the 4-position of GHRP-6 analogs by solid-phase synthesis strategies featuring incorporation of azasulfuryl tripeptide building blocks that were prepared in solution. Initially, azasulfurylphenylalanine (AsF) tripeptide 10 was linked to the solid support and elongated to prepare azasulfurylpeptide 3a  was first synthesized in solution by a route featuring alkylation of Boc-Ala-AsG-D-Phe-Ot-Bu  in 53% yield. Cleavage of the tert-butyl ester with 1:1 TFA/CH2Cl2 gave acid 10, which was coupled to N\u03b5-(Boc)lysinyl Rink amide resin 11 using HBTU and DIEA in DMF. After capping the resin with acetic anhydride, conventional Fmoc-based solid-phase synthesis was used to elongated peptide 12 by amino acid couplings and Fmoc group removals, employing Fmoc-D-Trp(Boc)-OH and Boc-His(Trt)-OH -GHRP-6 (3a) in 12% overall yield from tripeptide 10.To install an AsF residue at the 4-position of GHRP-6, the protected azasulfuryl tripeptide Fmoc-Ala-AsF-D-Phe-OH  wlacetate , and ami(Trt)-OH . Cleavag14 onto Lys(Boc) amide resin 11 and LC-MS analysis of a resin cleaved aliquot indicated little conversion to the desired AsG peptide 15 (19%); instead, the major cleaved product was a deletion sequence, Fmoc-Ala-Lys-NH2 .Alkylation of a resin-bound AsG peptide was pursued to facilitate introduction of side-chain diversity for structure\u2013activity relationship studies . Initial17 with DIC in THF afforded sulfahydantoin 18 in 57% yield -GHRP-6   semicarbate (26)  couplingA in DCM . AzasulfRP-6 3f, . N-aminosulfamide residue on the peptide conformation in solution, a circular dichroism (CD) spectroscopic analysis was made to compare GHRP-6, [azaF4]-GHRP-6 and [AsF4]-GHRP-6 in water  by CD spectroscopy in water gave a curve shape like that of its azapeptide counterpart [azaF4]-GHRP-6 indicative that the turn conformation may be retained in the azasulfurylpeptide. The positive maximum observed at 194 nm in the spectrum of 3a deviates however from the ideal \u03b2-turn CD spectrum, as well as spectra of other secondary structures -GHRP-6 (1), which was shown to inhibit significantly (R)-fibroblast-stimulating lipopeptide (R-FSL) elicited NO overproduction in macrophages (4]-GHRP-6 (3a) reduced significantly NO production compared to its azapeptide analog [azaF4]-GHRP-6 which was shown to display weak inhibitory effect on R-FSL mediated NO release [4]- and [(4-MeO)AsF4]-GHRP-6 (3c and 3d) displayed greater inhibitory effects than their azapeptide counterparts. On the other hand, placement of a bulky naphthylmethyl side chain on the azasulfuryl residue in [2-AsNal]-GHRP-6 (3e), and replacement of His by Ala in -GHRP-6 (3f), both produced analogs with limited inhibitory effect on R FSL-elicited NO production.The six azasulfurylpeptides  and chemokine monocyte chemoattractant protein-1 (MCP-1) downstream from NF-\u03baB activation by R-FSL in peritoneal macrophages AsF4]-GHRP-6 (3c) and [(4-MeO)AsF4]-GHRP-6 (3d) significantly reduced secretion of TNF\u03b1 induced by R-FSL by 1.5-fold. Moreover, 3c significantly reduced the R-FSL-1-induced secretion of MCP-1 by 2.2-fold compared to [azaY4]-GHRP-6 (1) (P < 0.05). Azasulfurylpeptides rophages . Relativ4]-GHRP-6 (3c) to reduce NO overproduction and cytokine/chemokine release in agonist-stimulated macrophage cells, the kinetic profile of modulation of TLR-2-mediated inflammation through the nuclear factor-\u03baB (NF-\u03baB) pathway was measured in peritoneal macrophages from C57BL/6 mice. After treatment with azasulfurylpeptide 3c (1 \u00b5M), the plated macrophages were stimulated with R-FSL-1 (300 ng/mL) and IFN\u03b3 (20 ng/mL) for 0, 5, 10, 15 and 30 min. Notably, azasulfurylpeptide 3c reduced significantly NF-\u03baB activity elicited by the R-FSL by 11% (P < 0.05) at 5 min, by 29% (P < 0.01) at 10 min and by 25% (P < 0.05) at 15 min after exposure to the TLR2-agonist (Considering the significant ability of [(4-F)AsF-agonist .4]-GHRP-6 (3c) to compete with the radiolabeled [125I]-Tyr-Bpa-Ala-hexarelin used as tracer for CD36 binding was tested on purified membranes from rat heart as a source of CD36 [3c (IC50 2.53 \u00b5M) was 1.3-fold lower and 2.4-fold higher than [azaY4]- and [aza(4-F)F4]-GHRP-6 (1 and 2), respectively [The ability of [(4-F)AsFectively .4]-GHRP-6 (3c) with azapeptides [azaY4]- and [aza(4-F)F4]-GHRP-6 (1 and 2), and [azaK6]-GHRP-6 as a negative control, was performed by measuring sub-retinal macrophage and microglia infiltration in a mouse model of retinal inflammation induced by blue-light exposure. Since the apolipoprotein E (ApoE) deficiency was shown to feature a pro-inflammatory phenotype -, and [AsF4]-GHRP-6 AsFhenotype ,38, ApoEhenotype . Macrophhenotype ,40. Uponntensity  A signif\u2212/\u2212 mice b relativ\u2212/\u2212 mice a 41]. C. C4]-GHR]-GHRP-6 d\u2013f all d4]-GHRP-6 (3c) was performed on the RPE/choroid/sclera complex and compared to azapeptides 1 and 2 (4]- and [aza(4-F)F4]-GHRP-6 (1 and 2) to be the most effective inhibitors of choroidal vascular sprouting among a set of 25 azapeptides in an evaluation that illustrated the combination of a small electronegative para-substituent on the azaPhe4 residue and a His1 residue for reducing angiogenic activity [4]-GHRP-6 (3c) did not affect choroidal vascular growth suggesting the requirement of a carbonyl group instead of a sulfuryl moiety for antiangiogenic activity -D-Phe-OH (21) enabled attachment to the solid support. After Fmoc group removal, alkylation of the N-aminosulfamide could be used to introduce a variety of side chains onto the azasulfuryl residue. The power of this novel diversity-oriented solid-phase method for the synthesis of azasulfurylpeptides was demonstrated by the synthesis of five related ligands from a common AsG-peptide.In the context of research on modulators of the CD36 receptor, a solid-phase method was developed to prepare azasulfurylpeptides. Six [azasulfuryl4]-GHRP-6 (3c) exhibited comparable anti-inflammatory effect as related azapeptides 1 and 2 in a CD36 dependent manner. In macrophages, azasulfurylpeptide 3c suppressed TLR-agonist-induced overproduction of NO and pro-inflammatory cytokine- and chemokine- production. Similarly, 3c reduced significantly TLR2-agonist-induced NF-\u03baB in peritoneal macrophages. Moreover, azasulfurylpeptide 3c exhibited comparable CD36 binding affinity as related azapeptides 1 and 2. In a mouse model of retinal inflammation, 3c behaved like 1 and 2 reducing significantly the infiltration of activated/microglia/macrophages into the subretinal space upon photo-oxidative stress. On the other hand, in contrast to azapeptides 1 and 2, which inhibited microvascular sprouting mediated through CD36 in the mouse choroidal explant model, azasulfurylpeptide 3c preserved microvascular survival. Examination of the activity of the six azasulfurylpeptides demonstrated that [(4-F)AsF2) and azasulfurypeptide [As(4-F)F4]-GHRP-6 (3c), the latter did not affect choroidal vascular growth suggesting the requirement for a carbonyl group instead of a sulfuryl moiety for anti-angiogenic activity. Notably, such a structural change influences backbone geometry -GHRP-6  moiety in N-aminosulfamide 3c has obliterated influences on neovascularization without effect on CD36 binding affinity nor CD36-mediated anti-inflammatory activity. As a selective regulator of inflammation, [As(4-F)F4]-GHRP-6 (3c) represents a novel probe for specifically studying CD36-mediated allosteric modulation of TLR-2 heterodimer complex signaling. Moreover, with capacity to dissociate the antiinflammatory activity from the inhibitory activity on microvascular sprouting, azasulfuryl analog 3c is a useful prototype for developing CD36 ligands that are devoid of antiangiogenic profile. The conception of azasulfurylpeptide 3c has thus provided valuable insight into the structural relationships and useful tools for governing CD36 activity that could find their application in the treatment of inflammation underlying ischemic diseases.Highlighting the delicate relationship between the structure of CD36 ligands and their influences on allosteric modulation of the pleotropic effects mediated by the scavenger receptor, the subtle change from a carbonyl (CO) group in semicarbazide"}
+{"text": "A 34-year-old female reported to the emergency department with a chief complaint of epigastric pain. Initial rapid screening was negative for both influenza A and B. The patient eventually developed myocarditis that led to pulseless ventricular tachycardia and death within 24 hours of admission. Viral smear was positive for influenza B postmortem despite the initial negative rapid screen. This case demonstrates the need for a new diagnostic criteria and treatment strategy for viral myocarditis due to influenza while concisely illustrating how the disease can progress in adults despite commonly presenting as a disease in adolescents. Myocarditis can be an exceptionally challenging diagnosis to make due to its multiple etiologies, highly variable nonspecific presentations, and the lack of universal treatment standards.2The classic culprits of viral myocarditis historically include Coxsackie virus, cytomegalovirus, and echovirus. However, there has been increasing evidence of influenza virus causing myocarditis in recent years. Based on the results of Karjalainen et al., the true incidence of myocarditis could be as high as 9%.6A 34-year-old female was brought to the emergency department (ED) by family with a chief complaint of severe epigastric pain. Her symptoms, which had begun five days earlier, consisted of general malaise, self-reported low-grade fevers, and a non-productive cough in addition to her epigastric pain. She had taken off work for the prior three days due to her symptoms. She reported one instance of nausea and vomiting the day prior to her ED admission. She denied any history of dysuria, hematuria, headache, or neck stiffness. Past medical history was significant for polycystic ovarian syndrome and attention deficit hyperactive disorder. Past surgical history was notable for a remote appendectomy and cholecystectomy. Social history revealed that she had quit smoking 10 years prior and drank one alcoholic beverage on average per day. She denied any recreational or intravenous (IV) drug abuse.Triage temperature was 97.5\u00b0F, heart rate was 71 beats per minute (BPM), blood pressure measured at 136/93, respiratory rate was 20, and her oxygen saturation was 98% on room air. Approximately 20 minutes after triage, the patient remained afebrile but her heart rate had increased to 125 and blood pressure decreased to 96/56. She appeared fatigued and slightly diaphoretic. Her oropharynx was clear and moist, neck was supple with full range of motion, cardiac examination revealed no evidence of a murmur, and she displayed normal respiratory effort without any signs of distress or wheezing. Her abdomen was soft and non-tender without rebound or guarding. Urinalysis showed a specific gravity of 1.024, trace ketones, 0\u20132 white blood cell count per high power field (HPF), 0\u20132 red blood cells per HPF, and 16\u201320 hyaline casts. Urine pregnancy test, mycoplasmal immunoglobulin M, and influenza A/influenza B rapid screen were all negative. Chest radiograph was negative for pathology and showed a heart size and vascularity within normal limits, with clear and fully expanded lungs. Blood test results are displayed in the Fluid resuscitation was started upon arrival to the ED. Despite infusing four liters of normal saline over the course of four hours, the patient\u2019s blood pressure never increased above a systolic pressure of 100 and she remained borderline hypotensive. Her admitting diagnosis was systemic inflammatory response syndrome (SIRS) due to a presumed viral but undetermined etiology with hypovolemia. At the time of admittance, her vital signs were a temperature of 97.5\u00b0F, a heart rate of 116 BPM, a respiratory rate of 18 breaths per minute, and a blood pressure of 94/67. She received ondansetron for nausea.Staphylococcus aureus, and rickettsia. Additionally, blood cultures and an electrocardiogram (ECG) were ordered and revealed questionable 0.5mm ST-segment elevation of lateral chest leads . Physical examination was significant for mild epigastric tenderness and acrocyanosis. At this time, she was diagnosed with dehydration secondary to severe sepsis with septic shock. She was given ceftriaxone, vancomycin, and doxycycline to cover meningococcus, methicillin-resistant st leads . TroponiWhat do we already know about this clinical entity?Myocarditis is one of the more rare, but potentially fatal, complications of influenza typically seen in the adolescent population.What makes this presentation of disease reportable?Viral myocarditis typically presents in the adolescent population. However, in this case the patient was an adult with multiple negative diagnostic tests.What is the major learning point?It is essential to keep viral myocarditis on the differential in adults and even when diagnostic tests come back negative.How might this improve emergency medicine practice?This case points out the challenges and inefficiencies of diagnosing viral myocarditis in the emergency setting.The patient was sent for abdominal computed tomography (CT) to look for a cause of sepsis. The imaging showed some atelectasis/bibasilar infiltrates with small bilateral pleural effusions as well as patchy enhancement of the kidneys concerning for pyelonephritis, but no significant pulmonary edema or cause of sepsis. After completing the CT, the patient decompensated into pulseless ventricular tachycardia and eventual death despite attempts at resuscitation. A postmortem influenza smear was negative for influenza A, parainfluenza A1\u2013A4, and positive for influenza B. This finding, coupled with inflammation of the myocardium on the autopsy, led to the diagnosis of fatal myocarditis caused by influenza B.. Most cases of viral infection causing myocarditis are seen in the young adult population, while our patient was 34 years old.A review of literature revealed few confirmed, documented cases of myocarditis secondary to influenza, and even fewer cases of myocarditis specifically caused by influenza B. The case shared some common themes with the other presentations. For example, hypotension refractory to IV fluids was a common finding..11Furthering the difficulty of this diagnosis lies in accuracy of testing. Diagnosis of influenza B via reverse transcriptase polymerase chain reaction relies on a sensitivity of 54% in adults and 62% overall, which is lower than the sensitivity for influenza A .In the treatment of influenza, oseltamivir phospate is thought to be most efficacious within 48 hours from the onset of symptoms. In patients admitted to the ICU with hemagglutinin type 1 and neuraminidase type 1 influenza, there was a reported 75% survival rate in patients given oseltamivir phospate within the time constraint .We present an adult female with myocarditis secondary to influenza B infection. The case was complicated by low sensitivity of rapid influenza screening, inconsistent diagnosing criteria, and questionable treatment strategies. To better serve the population of patients that develop myocarditis from influenza, we need better-defined strategies to approach, diagnose, and treat myocarditis due to influenza B. Additionally, it must be recognized that, although rare, viral myocarditis should be considered in the differential diagnosis of both adults and adolescents.Documented patient informed consent and/or Institutional Review Board approval has been obtained and filed for publication of this case report."}
+{"text": "Aspergillus fumigatus produces a cell wall galactomannan whose biosynthetic pathway and biological functions remain poorly defined. Here, we described two new mannosyltransferases essential to the synthesis of the cell wall galactomannan. Their absence leads to a growth defect with misregulation of polarization and altered conidiation, with conidia which are bigger and more permeable than the conidia of the parental strain. This study showed that in spite of its low concentration in the cell wall, this polysaccharide is absolutely required for cell wall stability, for apical growth, and for the full virulence of A. fumigatus.The fungal cell wall is a complex and dynamic entity essential for the development of fungi. It allows fungal pathogens to survive environmental challenge posed by nutrient stress and host defenses, and it also is central to polarized growth. The cell wall is mainly composed of polysaccharides organized in a three-dimensional network.  Aspergillus fumigatus, the major mannan structure is a galactomannan that is cross-linked to the \u03b2-1,3-glucan-chitin cell wall core. This polymer is composed of a linear mannan with a repeating unit composed of four \u03b11,6-linked and \u03b11,2-linked mannoses with side chains of galactofuran. Despite its use as a biomarker to diagnose invasive aspergillosis, its biosynthesis and biological function were unknown. Here, we have investigated the function of three members of the Ktr  family  in A. fumigatus and show that two of them are required for the biosynthesis of galactomannan. In particular, we describe a newly discovered form of \u03b1-1,2-mannosyltransferase activity encoded by the KTR4 gene. Biochemical analyses showed that deletion of the KTR4 gene or the KTR7 gene leads to the absence of cell wall galactomannan. In comparison to parental strains, the \u0394ktr4 and \u0394ktr7 mutants showed a severe growth phenotype with defects in polarized growth and in conidiation, marked alteration of the conidial viability, and reduced virulence in a mouse model of invasive aspergillosis. In yeast, the KTR proteins are involved in protein 0- and N-glycosylation. This study provided another confirmation that orthologous genes can code for proteins that have very different biological functions in yeasts and filamentous fungi. Moreover, in A. fumigatus, cell wall mannans are as important structurally as \u03b2-glucans and chitin.Fungal cell wall mannans are complex carbohydrate polysaccharides with different structures in yeasts and molds. In contrast to yeasts, their biosynthetic pathway has been poorly investigated in filamentous fungi. In  O- and N-linked mannans decorating glycoproteins and long mannan chains which are a major component of the fungal cell wall. N-linked and O-linked glycans have similar branched structures in yeasts and molds  are integral parts of the cell wall since they are covalently bound to the glucan-chitin core  and Pol II  of the mycelium. That study suggested that at least two sets of mannosyltransferases are responsible for the synthesis of cell wall mannans in the conidium and mycelium of A. fumigatus. Moreover, that study showed that genes with highly conserved sequence can code for proteins which have very different biological functions in yeasts and filamentous fungi. These considerations led us to investigate other orthologs of yeast mannosyltransferases with a function not associated with mannan polymerization in yeast. This is why we investigated the KTR genes, which were excluded from our initial study  th and at the 4th Glycobiology World Congress A. fumigatusKTR genes have very close sequence homologies with the S. cerevisiae KTR genes which belong to the GT15 family (www.Cazy.org). A phylogenetical analysis performed with the MUSCLE software with the 9 KTR members of S. cerevisiae showed that A. fumigatus UB_059750 (AFUA_5G12160) and AFUB_051270 (AFUA_5G02740) genes were closely related to ScKtr7 and ScKtr4, respectively , \u0394ktr4 (B), and \u0394ktr7 (C) mutants and \u0394ktr4::KTR4 and \u0394ktr7::KTR7 revertant strains and targeted replacement strategies used for A. fumigatusKTR genes. Each panel shows the restriction maps of the KTR deletion constructs after the integration of the \u03b2rec/hygromycin resistance marker at the KTR locus and the Southern blot analysis of the parental strain, i.e., the ktr mutant strain. Genomic DNA of each strain was digested with appropriate restriction enzymes and hybridized with a specific probe. Revertant strains \u0394ktr4::KTR4 and \u0394ktr7::KTR7 were obtained after excision of the \u03b2rec/hygromycin marker followed by reintroduction of the respective parental genes using the reusable \u03b2rec/hygromycin cassette. Download FIG\u00a0S1, PDF file, 0.2 MB.Southern blots of Copyright \u00a9 2019 Henry et al.2019Henry et al.Creative Commons Attribution 4.0 International license.This content is distributed under the terms of the \u0394ktr, and complemented strains were grown in liquid and on agar minimum media (MM) and Sabouraud media. After 2\u2009days at 37\u00b0C, the growth of \u0394ktr4 and \u0394ktr7 mutants was severely reduced in MM as well as on Sabouraud agar media . A statistically significant reduction of growth of \u0394ktr4 and \u0394ktr7 mutants was also observed in liquid media , Congo red, and SDS than the parental strain and the \u0394ktr1 mutant and their respective complemented strains  \u00b5m. Conidia produced by the \u0394ktr4 and \u0394ktr7 mutants were heterogeneous in size and larger than those produced by the parental strain, with average diameters of 3.4 \u00b5m (\u00b10.9 \u00b5m) and 4.05 \u00b5m (\u00b11.5 \u00b5m), respectively. In addition, the level of labeling of the \u0394ktr4 and \u0394ktr7 mutant conidia by CFW was much higher than that observed with the parental strain. Moreover, the levels of labeling of the conidia with fluorescein isothiocyanate (FITC) were also different. The conidia from parental and complemented strains were FITC labeled  to only a slight extent, whereas 66% and 31% of \u0394ktr4 and \u0394ktr7 mutant conidia, respectively, were strongly intracellularly labeled .In comparison to the parental strain, the ectively . The sup labeled , suggestiability . For exa10.1128/mBio.02647-18.2FIG\u00a0S2\u0394ku80 strain, the \u0394ktr4 and \u0394ktr7 mutants, and the \u0394ktr4::KTR4 and \u0394ktr7::KTR7 revertant strains. Conidia were collected after three weeks of growth on malt\u20136% KCl solid medium at room temperature. Conidia were stained with either FITC (1 mg/ml) or calcofluor white (0.5 \u00b5g/ml) and observed under a fluorescence microscope. White bars represent 10 \u00b5m. Download FIG\u00a0S2, PDF file, 0.9 MB.Conidial morphology of the parental Copyright \u00a9 2019 Henry et al.2019Henry et al.Creative Commons Attribution 4.0 International license.This content is distributed under the terms of the 10.1128/mBio.02647-18.3FIG\u00a0S3\u0394ku80 strain, the \u0394ktr4 mutant, and the \u0394ktr4::KTR4 revertant strain. Conidial viability was estimated after the storage of 10\u00b3 conidia/ml 0.05% Tween 20 solution at 4\u00b0C for 1 and 2 months. The percentage of survival was estimated by CFU quantification after spreading on 2% malt agar plates. Each value represents the average of data from three independent replicates (error bars represent standard deviations). Download FIG\u00a0S3, PDF file, 0.05 MB.Conidial viability of the parental Copyright \u00a9 2019 Henry et al.2019Henry et al.Creative Commons Attribution 4.0 International license.This content is distributed under the terms of the \u0394ktr4 and \u0394ktr7 mutants germinated faster than their parental strain. On malt agar, conidia from parental, \u0394ktr1 mutant, and \u0394ktr4::KTR4 and \u0394ktr7::KTR7 complemented strains started to germinate after 4\u2009h of incubation in the medium whereas 20% and 32% of \u0394ktr4 and \u0394ktr7 conidia, respectively, had already germinated by the same time  and alkali-soluble (AS) fractions of the A. fumigatus cell wall of parental and mutant strains has been analyzed. No significant difference was observed in the monosaccharide content of the AS fraction of the \u0394ktr4 and \u0394ktr7 mutant strains in comparison to the parental and complemented strains (data not shown). On the other hand, an almost complete loss of the galactomannan content associated with a compensatory doubling of the chitin amount was observed in the AI fraction of the \u0394ktr4 and \u0394ktr7 mutants in comparison to the parental strain  cross-linked to the glucan-chitin core and suggested that Ktr4p and Ktr7p were mannosyltransferases involved in the biosynthesis of the GM.Matrix-assisted laser desorption ionization\u2013time of flight (MALDI-TOF) spectra of protein N-glycans were similar for the parental and t of 162 . These it of 162 . These dl strain . These d10.1128/mBio.02647-18.4FIG\u00a0S4\u0394ku80 strain (A), the \u0394ktr4 mutant (B), and the \u0394ktr7 (C) mutant in liquid Sabouraud medium are shown. Mass spectra were acquired using FlexControl software, and shots were recorded in positive reflectron mode. Ion mass (m/z) data correspond to [M + Na]+ . Download FIG\u00a0S4, PDF file, 0.1 MB.MALDI-TOF mass spectra of N-glycans. MALDI-TOF mass spectra of N-glycans purified from secreted proteins produced by the parental Copyright \u00a9 2019 Henry et al.2019Henry et al.Creative Commons Attribution 4.0 International license.This content is distributed under the terms of the Mr of 43\u2009kDa was produced in Escherichia coli. To test the putative mannosyltransferase activity, the r-Ktr4 protein was incubated with GDP-mannose as the substrate donor and \u03b1-1,2 mannobiose or \u03b1-1,6 mannobiose as the acceptor. Ktr4p was able to use both acceptors to produce a new product (A Ktr4p recombinant (r-Ktr4) protein with a  product . Gel fil product , showing\u0394ktr4 mutant was tested in a mouse model of invasive aspergillosis using cyclophosphamide/cortisone acetate as an immunosuppressive treatment. The parental and complemented strains showed the same survival curves, with no mouse surviving 6\u2009days after infection, whereas 30% of the mice remained alive in the cohort infected by the \u0394ktr4 mutant. Statistical analysis showed that the \u0394ktr4 mutant was significantly less virulent than the parental and complemented strains  Parental strain (\u0394ku80). (D to F) \u0394ktr4 mutant. . (A to C) Lung section with \u0394ku80 strain. A multifocal inflammatory lesion, centered on bronchi/bronchioles (BB), with secondary extension to alveoli (black arrows), containing filamentous fungi (black arrowheads) is shown. (A and B) Fungi were located in the bronchi/bronchioles, with invasion of alveoli (black arrowheads) (B) and large blood vessels (BV). (C) Lung section with \u0394ktr4 mutant. (D to F) Same inflammatory lesion as shown for \u0394ku80 (D and E), with less invasion of alveoli by the fungus (black arrowheads) (E) and no invasion of large blood vessels (F). Download FIG\u00a0S6, PDF file, 0.4 MB.Histopathological sections of mouse lungs infected with Copyright \u00a9 2019 Henry et al.2019Henry et al.Creative Commons Attribution 4.0 International license.This content is distributed under the terms of the A. fumigatus  and Afktr7p share high sequence homologies with the yeast Ktrp orthologs and a mannosyltransferase activity, the deletion of A. fumigatusKTR4 and KTR7 genes did not alter protein mannosylation but led to the loss of the cell wall galactomannan. This report provides another clear example of the finding that orthologous genes code for proteins that may have very different biological functions in yeasts and filamentous fungi even though they have very related enzymatic activities, at least in vitro. It shows that the biosynthesis of the A. fumigatus mannans uses transferases and pathways different from those existing in yeasts. However, even in yeasts, the composition of the cell wall mannans, the number of genes involved in their synthesis, and the phenotype of the respective mutants differ from species to species. The elongation of the poly-\u03b11,6-mannan backbone in S. cerevisiae is carried out by the mannose Pol I (Man Pol I) and Pol II complexes to build up the \u03b1-1,6-mannan backbone , indicating that ktr4p and ktr7p are involved in the cell wall galactomannan biosynthetic pathway. The biosynthesis of galactomannan requires two different and separate pathways responsible for the synthesis of the galactofuran and the mannan elongation. First, the synthesis of the side chains of the GM is under the control of Golgi galactofuranosyltransferases, which use UDP galactofuranose as substrate , 38. Howsferases , 41, thesferases . The Bmtalbicans . These edefective in filamentous growth) orthologs of the yeast DFG5/DCW1 are required for the cross-linking between GM and \u03b2-glucan . Interestingly, deletions of orthologous DFG genes in A. fumigatus led to phenotypes closely related to those seen with the \u0394ktr4 and \u0394ktr7 mutants, showing the importance of the cross-linked GM in the cell wall. The search for new transglycosidases or regulators and protein chaperones involved in the synthesis of the mannan chain is currently under way.A recent study suggested that the DFG  (The 80 pyrG+ . Conidiaium (MM) , Sabourawww.ebi.ac.uk/Tools/msa/muscle/). The software trimAl v3 was used to trim the alignments generated by MUSCLE, with the options \u2013gt 0.9  and \u2013cons 60 . ProTest v2.4 software was used to select the best protein substitution model, namely, LG+I+G+F. Finally, maximum likelihood analyses were conducted with PHYML v3.0.1 to reconstruct phylogenetic trees. Support for the branches was determined from bootstrap analysis of 100 resampled data sets.Sequences of Ktr proteins were downloaded from the PubMed website and used for generating the alignment using MUSCLE v3.8.31 software . For DNA extraction, mycelium was grown for 16\u2009h at 37\u00b0C in Sabouraud liquid medium. For transformation experiments, MM was used. MM was supplemented with 150\u2009\u00b5g/ml hygromycin (Sigma) to isolate transformants. Cells of the E. coli T7 Shuffle strain, used for recombinant protein expression analysis, were grown on Luria-Bertani medium  probe protocol (Roche Diagnostics)  at 37\u00b0C for 24\u2009h, and the mycelial dry weight was estimated after drying at 80\u00b0C until a constant weight was reached.The mycelial growth was assessed in MM and Sabouraud agar media after spotting 10\u00b3 conidia (5\u2009\u00b5l) of each strain. Petri dishes were incubated for 48\u2009h at 37\u00b0C and 50\u00b0C. Growth was also monitored in Sabouraud liquid media as follows: 150-ml flasks with 50\u2009ml of media were inoculated with 107 conidia/ml) with 30\u2009\u00b5l of FITC solution  during 3 h at room temperature in darkness. The conidia were washed three times with 0.05% Tween 20 solution before being subjected to observation under a fluorescence microscope . For calcofluor white (CFW) staining, the conidial suspension was incubated with CFW solution (0.5\u2009\u00b5g/ml) for 30\u2009min at room temperature and observed with fluorescence microscopy .Conidia (3 weeks old) were recovered from malt agar slants by the use of 0.05% Tween 20 aqueous solution. Conidial suspensions were filtered on a 40-\u00b5m-pore-size sterile cell strainer (Fisher Scientific), and conidia were counted using a Luna dual-fluorescence cell counter (Mokascience SARL). Permeability of the conidia with respect to FITC was investigated by incubating 200\u2009\u00b5l of an aqueous suspension of conidia (2.105/ml) in 8-well plates (IBIDI) in liquid MM buffered with 165\u2009mM MOPS  at 37\u00b0C. Films were recorded under a Nikon light microscope  and analyzed by the use of ICY software . The size of conidia was estimated under a microscope using logiciel Image J software .To investigate conidial survival, conidia were kept in a Tween 20 (0.05%) aqueous solution at 4\u00b0C for up to 2\u2009months and survival over time was estimated by CFU quantification on malt agar plates. Conidial germination was followed on Sabouraud agar medium for up to 7\u2009h at 37\u00b0C. To follow the kinetics of germination, conidia were inoculated , and SDS (0.001% to 0.1%). Sensitivity to menadione (0.015 to 160\u2009\u00b5M) was tested in liquid MM with resazurin method as previously described , Congo red (2.5 to 40\u2009\u00b5g/ml), Hescribed . Suscept6 conidia/ml. On day 0, the animals were anaesthetized intramuscularly with 0.1\u2009ml of a mixture of ketamine  (50\u2009mg/ml) and xilacina clorhidrato  (2%) at final concentrations of 12.5 and 2\u2009mg/ml, respectively, and then intranasally inoculated with 30\u2009\u00b5l of saline solution containing a total inoculum of 1.5\u2009\u00d7\u2009105 conidia per mice. The rates of survival of mice were plotted against time, and P values were calculated using the log rank (Mantel-Cox) test and GraphPad Prism 5. A P value of <0.05 was considered signi\ufb01cant. Additionally, lungs removed from mice at 3 days postinfection were \ufb01xed in 10% neutral buffered formalin and embedded in paraffin, and 4-micron-thick serial sections were cut and stained with hematoxylin and eosin (HE)  and Grocott\u2019s methenamine silver (to detect fungi).For virulence assays in the mouse model of invasive aspergillosis, immunosuppression of mice was induced with 150\u2009mg/kg of body weight of cyclophosphamide  administered intraperitoneally (i.p.) and 112\u2009mg/kg of cortisone 21-acetate  administered subcutaneously, on both day \u22123 and day \u22121. Afterward, only cyclophosphamide (150\u2009mg/kg) was used every 3 days until completion of the experiment. The body weight of each mouse was recorded weekly in order to adjust the immunosuppression dosage. Conidial inocula were prepared by growing the strains on malt\u20136% KCl agar slants. Conidia were harvested using saline solution containing 0.01% Tween 20 (Sigma), washed, filtered through a 40-\u03bcm-pore-size nylon sterile filter (to avoid clumping of conidia), and then counted in a hematocytometer chamber, and the concentration was then adjusted to 5\u2009\u00d7\u200910After 24\u2009h of growth of the mycelium in Sabouraud liquid medium at 37\u00b0C with shaking at 150\u2009rpm, mycelia and culture supernatants were separated by filtration. Cell wall fractions  were obtained after mycelium disruption and centrifugation as previously described . Polysac18-SepPak column (Waters) and paper chromatography (Whatmann no. 3) and then analyzed by MALDI-TOF.N-Glycosylation of secreted proteins was investigated according to a previously described protocol . Brieflym/z range of 700 to 3,500\u2009Da with a peptide standard mixture  and with a malto-oligosaccharide mixture. Data were analyzed with Flexanalysis software (Bruker). Samples were prepared by mixing 2\u2009\u00b5l of an oligosaccharide solution\u2013water (0.01 to 2\u2009nmol)\u20132\u2009\u00b5l 2\u2009mg/ml NaCl solution with 4\u2009\u00b5l of 2,5-dihydroxybenzoic acid matrix solution . The samples (1\u2009\u00b5l) were spotted on the target  and dried at room temperature.MALDI-TOF mass spectra were acquired on an UltrafleXtreme mass spectrometer . Mass spectra were acquired in positive reflectron mode using FlexControl software. Mass spectra were externally calibrated in the KTR4 was synthetized by the use of Geneart gene synthesis (Thermo Fisher Scientific) using an E. coli codon table optimized by the manufacturer. Furthermore, the N-terminal sequence (amino acids [aa] 1 to 28), predicted as a signal peptide cleavage site by SignalP software, was removed. The construct was cloned in the pET28a(+) expression vector using N-terminal His tagging, and the E. coli T7 Shuffle strain (New England Biolabs) was used for the protein production. The production of recombinant protein was undertaken after IPTG  induction as follows. A 400-ml volume of LB containing kanamycin (30\u2009\u00b5g/ml) was inoculated at an optimal density of 0.05 and shaken at 20\u00b0C and 150\u2009rpm. When an optical density at 600 nm (OD600) of 0.6 was reached, induction was performed by the addition of 1\u2009mM IPTG for 18\u2009h. After centrifugation , the bacterial pellet was lysed with 8\u2009mg of lysozyme\u201340\u2009ml of 50\u2009mM Tris-HCl buffer (pH 8) for 40\u2009min at room temperature. The supernatant containing the tagged protein was purified using nickel-nitrilotriacetic acid (Ni-NTA) agarose beads (Life Technologies) according the manufacturer\u2019s instructions. The protein was eluted with 250\u2009mM imidazole, concentrated, and desalted using Amicon cells with a 10-kDa molecular weight cutoff (MWCO) (Merck Millipore). Determination of protein concentration was performed by the bicinchoninic acid (BCA) method, and 12% SDS-PAGE was used to verify protein purity. In spite of many attempts, it was impossible to produce a soluble recombinant form of the Ktr7 protein in E. coli, since it was exclusively found in inclusion bodies.The DNA sequence of 2, 5\u2009mM MgCl2 [pH 7.5], 2\u2009mM DTT) containing 6.7\u2009mM GDP-Man (Sigma G5131) and 11\u2009mM 6\u03b1-mannobiose (Dextra M206) or 2\u03b1-mannobiose (Sigma M1050) at 30\u00b0C overnight. To investigate glycoside linkages, reaction products were digested by the use of either jack bean exo-\u03b1-mannosidase (Sigma) (2.5\u2009\u03bcl of an enzymatic reaction mixture with 1.36\u2009U enzyme activity and 10 \u03bcl of 50\u2009mM [pH 6.8] Na acetate buffer) or recombinant \u03b1-1,6-mannosidase (Biolabs)  or \u03b1-1,2-mannosidase (Prozyme) . Mixtures were incubated for 18\u2009h at 30\u00b0C. Digestion products were analyzed by high-pH anion-exchange chromatography (HPAEC) using a CarboPAC PA-1 column  (4.6\u2009by\u2009250\u2009mm) and a pulsed electrochemical detector with the following gradient: an isocratic step of 98% eluent A (50\u2009mM NaOH) and 2% eluent B (500\u2009mM AcONa\u201350\u2009mm NaOH) for 2\u2009min, 2 to 15\u2009min of a linear gradient (98% A/2% B to 65% A/35% B), 15 to 35\u2009min of a linear gradient (65% A/35% B to 30% A/70% B), 35 to 37\u2009min of a linear gradient (30% A/70% B to 0% A/100% B), 37 to 40\u2009min under isocratic conditions with 100% B. The column was stabilized for 20\u2009min under the initial conditions before injection was performed. Enzymatic products were purified by gel filtration chromatography on a TSK-Gel G-oligo-PW column  (7.8\u2009by\u2009300\u2009mm) eluted with water at 0.5\u2009ml/min. The column was calibrated with a mixture of malto-oligosaccharides. The Mw of the products was also analyzed by MALDI-TOF.The mannosyltransferase activity assay was performed as previously described  with modAll animal experiments performed at the Mycology Reference Laboratory were ethically approved by the Animal Welfare Committee of Instituto de Salud Carlos III and performed under the approved project license PROEX 324/16.At least three biological replicates were performed per experiment; the statistical significance of the results was evaluated by a one-way variance analysis using JMP1 software ."}
+{"text": "Platelet \u03b1IIb\u03b23 integrin and its ligands are essential for thrombosis and hemostasis, and play key roles in myocardial infarction and stroke. Here we show that apolipoprotein A-IV (apoA-IV) can be isolated from human blood plasma using platelet \u03b23 integrin-coated beads. Binding of apoA-IV to platelets requires activation of \u03b1IIb\u03b23 integrin, and the direct apoA-IV-\u03b1IIb\u03b23 interaction can be detected using a\u00a0single-molecule Biomembrane Force Probe. We identify that aspartic acids 5 and 13 at the N-terminus of apoA-IV are required for binding to \u03b1IIb\u03b23 integrin, which is additionally modulated by apoA-IV C-terminus via intra-molecular interactions. ApoA-IV inhibits platelet aggregation and postprandial platelet hyperactivity. Human apoA-IV plasma levels show a circadian rhythm that negatively correlates with platelet aggregation and cardiovascular events. Thus, we identify apoA-IV as a novel ligand of \u03b1IIb\u03b23 integrin and an endogenous inhibitor of thrombosis, establishing a link between lipoprotein metabolism and cardiovascular diseases. Activation of integrin \u03b1IIb\u03b23 at the surface of platelets is required for their aggregation and for thrombus formation. Here Xu et al. identify apolipoprotein A-IV as a novel ligand for platelet \u03b1IIb\u03b23 integrin, and find it inhibits platelet aggregation and thrombosis. It is synthesized in the small intestine and can rapidly increase 3\u20135 fold in response to the absorption of dietary or biliary fat, particularly unsaturated fats3. After secretion into the intestinal lymphatics, apoA-IV primarily associates with chylomicrons and enters the blood circulation via the thoracic duct. Unlike other apolipoproteins , apoA-IV binds to lipoprotein particles weakly and can be readily displaced by other apolipoproteins4. As a result, approximately 80% of circulating apoA-IV is lipid-free5. Although abundant in the blood (150\u2013370\u2009\u00b5g/mL)6, the exact function of apoA-IV is still unclear. Roles postulated for apoA-IV to date include regulation of lipoprotein metabolism and reverse cholesterol transport, anti-oxidation, anti-inflammation, and control of food intake7. Several studies in different human populations have consistently demonstrated that the plasma levels of apoA-IV are inversely correlated with cardiovascular diseases (CVDs)10, but its roles in platelet activity and thrombosis, the major cause of heart attack and stroke, and the leading cause of mortality and morbidity worldwide12, are unknown.Apolipoprotein A-IV (apoA-IV) is a 46\u2009kDa exchangeable plasma protein that shares structural features with other apolipoproteins16. They are also actively involved in inflammation18, immune responses21, tumor metastasis23, and contribute to the initiation of atherosclerosis through interaction with other cells including endothelial cells, leukocytes, and endothelial progenitor cells25. Recently, the role of platelets in atherosclerosis has been highlighted since increased platelet production accelerates atherogenesis25. Upon rupture of the atherosclerotic lesion, platelet adhesion, and subsequent aggregation at the site of injury may lead to thrombosis and vessel occlusion, resulting in myocardial and/or cerebral infarction.Platelets are anucleate cells in the blood that play a key role in thrombosis and hemostasis27. Although fibrinogen (Fg), a major ligand of platelet \u03b1IIb\u03b23, was considered to be essential for platelet aggregation (and contributing in part to platelet adhesion), Fg-independent thrombosis occurs31. This suggests that other ligands of \u03b1IIb\u03b23 exist which are involved in platelet aggregation and thrombosis, but little information is available regarding what they are and how they regulate thrombosis and hemostasis; two opposing but critical biological processes.It has been well documented that platelet integrin \u03b1IIb\u03b23 is the dominant integrin expressed on platelets, which plays a key role in platelet adhesion and is required for platelet aggregationHere we show that apoA-IV is a novel ligand of platelet \u03b1IIb\u03b23 integrin. Through competing with Fg and other prothrombotic ligands, it attenuates platelet aggregation, thrombosis, and postprandial platelet hyperactivity, and is an important endogenous protective factor against CVDs.30  peptide-activated human platelet \u03b23 integrins, and incubated them with human blood plasma. Protein(s) associated with \u03b23 integrin-coated beads were electrophoresed and apoA-IV was identified by mass spectrometry. We found that apoA-IV bound to the surface of platelets activated by adenosine diphosphate (ADP) or collagen, but not to quiescent or \u03b23 integrin-deficient platelets in platelet-rich plasma (PRP) Fig.\u00a0. Further30 Fig.\u00a0. Thus, b32. To confirm whether apoA-IV is a ligand of \u03b23 integrin, we generated biotinylated recombinant apoA-IV and detected the binding between apoA-IV and platelet \u03b23 integrins using a Biomembrane Force Probe (BFP)34 34 Fig.\u00a0, Methods)34 Fig.\u00a0, and det)34 Fig.\u00a0, while aets Fig.\u00a0. ApoA-IVets Fig.\u00a0. Furtherins Fig.\u00a0. Importains Fig.\u00a0. Kineticins Fig.\u00a0. Notablyins Fig.\u00a0, enzyme-ins Fig.\u00a0 and a flins Fig.\u00a0. Fg alsoins Fig.\u00a0, indicatins Fig.\u00a0. These f27. Since apoA-IV can inhibit Fg-\u03b1IIb\u03b23 interaction, we first examined the role of apoA-IV in platelet aggregation using apoA-IV-deficient (apoA-IV\u2212/\u2212) mice6 and wild-type (WT) littermate controls (apoA-IV+/+). Platelet aggregation was significantly enhanced in the PRP of apoA-IV\u2212/\u2212 mice following stimulation with various agonists including ADP, collagen, and thrombin receptor activating peptide  , and found the enhancement of platelet aggregation was specific to plasma apoA-IV deficiency  , calcium ionophore (AY23187) and various doses of collagen  Fig.\u00a0. To distncy Fig.\u00a0. This waice Fig.\u00a0. This isice Fig.\u00a0 and thermL) Fig.\u00a0. Recombi35. Consistently, apoA-IV-Tg mice had markedly attenuated platelet aggregation  intact  and C-terminal 41 amino acids (\u0394336\u2013376), leaving the core helical bundle region we had identified previouslyact Fig.\u00a0. This deact Fig.\u00a0. Similaract Fig.\u00a0. Interesact Fig.\u00a0. This su40. We replaced these residues individually with glutamate (E), a conservative mutation that preserves the negative charge, but increases the side-chain volume of the amino acid. As expected, a mutation in D5E or D13E attenuated the inhibitory function of apoA-IV  residues at positions 5 and 13. The D residues in some non-RGD integrin ligands have been reported to be essential for integrin binding-IV Fig.\u00a0. We then-IV Fig.\u00a0. Consist-IV Fig.\u00a0, resulti-IV Fig.\u00a0.Tm) of 54.3\u2009\u00b0C  spectroscopy and thermal denaturation assays. CD wavelength scans revealed excellent superimposition between the WT and DM apoA-IV CD spectra, suggesting no loss of secondary structural elements as a result of the mutation  of recombinant mouse apoA-IV attenuated the thrombus growth in apoA-IV\u2212/\u2212 mice  mice that express approximately 50% \u03b1IIb\u03b23 on platelets without obvious bleeding disorders but do have impaired thrombosis, particularly at high shear in vitro and in vivo  with aspirin (20\u2009\u03bcg/g) and clopidogrel 12\u2009\u03bcg/g) treatments. The inhibitory effect of apoA-IV was similar to aspirin or clopidogrel treatments, although there was a synergistic effect when apoA-IV and aspirin, or apoA-IV and clopidogrel were used in conjunction , we tested platelet function from C57BL/6\u2009J WT, apoA-IV-Tg, apoA-IV+/+, heterozygous (apoA-IV+/\u2212), and apoA-IV\u2212/\u2212 mice under fasting conditions, and after a HFD. We observed that a HFD induced postprandial platelet hyperactivity in WT mice , as well as conducting human studies in healthy subjects, we identified that apoA-IV is a novel ligand of platelet \u03b1IIb\u03b23 integrin and an endogenous inhibitor of platelet aggregation and thrombosis. Through the long-term moderate but significant attenuation of platelet hyperactivity, particularly during the postprandial period, apoA-IV may also slow down the chronic process of atherosclerosis and other inflammatory diseases+/\u2212 mice. However, thrombosis is different from hemostasis and the antithrombotic effect could be achieved before bleeding occurs, as has been well documented in both animal models and antithrombotic drug developments in human clinical trials55. Such is the case in our thrombosis models, in which thrombus growth was markedly decreased in \u03b23+/\u2212 mice in vitro and in vivo. Since there are limited human cases of Glanzmann\u2019s thrombasthenia, it is currently unknown whether the 50% reduction in \u03b1IIb\u03b23 can also reduce their risk for thrombosis. This concept is consistent with the positive correlation between levels of Fg (\u03b1IIb\u03b23 ligand) and platelet aggregation in vitro, and thrombotic events in patients in vivo57.Our results demonstrate that endogenous apoA-IV can block 20\u201340% of interactions between \u03b1IIb\u03b23 and Fg or other prothrombotic ligands under static or low shear rate conditions. Notably, clinical experience has not revealed pronounced bleeding effects of a 50% reduction in \u03b1IIb\u03b23 expression . The same holds true in \u03b2359. These mechanisms may explain its stronger antithrombotic effects in vivo than in vitro. Thus the blockade of \u03b1IIb\u03b23 by apoA-IV is biologically significant in that this level of inhibition does not significantly impair hemostasis, but can predominantly attenuate thrombosis, while a low level of plasma apoA-IV increases the risk for CVDs9. Indeed, our finding that circadian rhythm of apoA-IV in most blood donors had a negative correlation with platelet aggregation throughout a 24\u2009h period, is suggestive and might at least partially explain the high incidence of heart attack and stroke in the morning compared to the evening.Of note, apoA-IV has an enhanced antiplatelet and antithrombotic effect with escalating shear stress at the apical zone of growing thrombi under flow conditions, likely due to high shear stress that may disrupt apoA-IV intra-molecular interactions and increase exposure of the apoA-IV binding site for \u03b1IIb\u03b23. This may be critical for preventing vessel occlusion at the sites of stenosis. In addition, competitive blockade of the Fg-\u03b1IIb\u03b23 interaction and \u03b1IIb\u03b23 outside-in signaling can subsequently reduce platelet granule release and PS exposure, which may decrease amplification of platelet aggregation, and thrombin generation/clot formation in non-anticoagulated blood62. Although a small fraction of apoA-IV in circulation is associated with HDL particles, the inhibitory effects observed in our in vitro study do not likely result from other HDL components, but rather via apoA-IV directly antagonizing prothrombotic ligand-\u03b1IIb\u03b23 binding. Recombinant apoA-IV in buffer  directly bound to \u03b1IIb\u03b23 in single molecule BFP assays and inhibited gel-filtered platelet aggregation. Double mutations of apoA-IV D5E and D13E, which do not affect global structure and likely do not affect affinity of lipid binding39, completely abolished the binding to \u03b1IIb\u03b23 and abrogated the inhibitory effects on platelet function in vitro and in vivo. Furthermore, apoA-IV did not significantly alter platelet cAMP levels. However, the current study could not completely exclude other mechanisms mediated by apoA-IV, such as possible interactions with HDL, LDL or membrane lipid components62, which may synergistically contribute to the inhibitory effect on platelet aggregation and thrombus growth. It is also conceivable that interactions with HDL and other plasma components may increase the sensitivity of apoA-IV to shear stress, which facilitate the accessibility of the N-terminus to \u03b1IIb\u03b23 integrin. These possibilities merit future investigation.Recent studies have shown that the high density lipoprotein (HDL) inhibits platelet function by promoting cholesterol efflux, as well as by attenuating agonist-induced platelet activation signaling pathways upon binding to platelet HDL receptors63. We previously reported that platelet Fg-\u03b1IIb\u03b23 integrin interaction can induce platelets to de novo synthesize P-selectin64, an important mediator of inflammation, leukocyte rolling and the Th1 immune response, which promotes atherogenesis65. In the current study, although we did not observe that recombinant apoA-IV directly altered platelet activation and P-selectin expression, apoA-IV indirectly inhibited the late phase P-selectin expression by interfering with \u03b1IIb\u03b23-Fg/prothrombotic ligand interactions and the subsequent \u03b1IIb\u03b23 outside-in signaling, which is important for platelet granule release and P-selectin expression36. Notably, in the absence of \u03b1IIb\u03b23, apoA-IV did not significantly inhibit the late phase P-selectin expression on thrombin-treated \u03b23\u2212/\u2212 platelets. Consistently, enhanced P-selectin expression was observed on ADP-treated platelets from apoA-IV\u2212/\u2212 PRP, where Fg and other prothrombotic ligands can more easily bind to \u03b1IIb\u03b23 and deliver outside-in signaling, which may increase both platelet P-selectin synthesis and releasing. Our data may explain why transgenic mice overexpressing apoA-IV were protected from atherosclerosis51.The displacement of platelet \u03b23 integrin ligands has broad implications not only in thrombotic disorders, but also in platelet-mediated inflammation. Platelet \u03b23 integrins contribute to platelet\u2013leukocyte and platelet\u2013endothelial cell interactions, and the effect of \u03b23 integrin inhibitors on reduction of intimal hyperplasia has been well demonstrated in animal models66. In our study, we also observed that a HFD induced postprandial platelet hyperactivity. The rapid increase in apoA-IV secretion after lipid intake is therefore important to attenuate postprandial platelet hyperactivity and inflammation, and thus may be physiologically critical to slow the progression of atherosclerosis and thrombogenesis. Furthermore, since platelets have recently been revealed to contribute to tumor metastasis23, in which \u03b1IIb\u03b23-mediated platelet-tumor cell heterotypic aggregation is involved23, whether apoA-IV can thus attenuate this process remains to be investigated.It has also been reported that postprandial spikes in glucose and lipids may generate excess free radicals, induce inflammation and enhance platelet-endothelial cell and platelet-leukocyte interactions, which may play an important role in atherogenesis and thrombogenesis2, which raises apoA-IV synthesis and secretion, may have a significant impact on the prevention of the early developmental stages of atherosclerosis. Infusion of recombinant apoA-IV may be able to directly intervene in thrombosis and control CVDs and stroke.This study provides the first direct link between apoA-IV and platelet activity, and the novel mechanisms as to why apoA-IV is a protective factor for CVDs. We demonstrate that apoA-IV, by antagonizing platelet \u03b1IIb\u03b23 integrin activity, attenuates platelet aggregation and thrombosis, postprandial platelet hyperactivity, and may also slow the progression of atherosclerosis . Furthermore, we identified a circadian rhythm of apoA-IV in humans, which negatively correlates with platelet aggregation and the risk of cardiovascular events. Control of food consumption 2) was purchased from Peptides International . Type I collagen fibrils (equine collagen Horm) were purchased from Nycomed . Alexa Fluor 488 conjugate, DiOC6 dye, and Calcein AM were purchased from Invitrogen . Goat anti-human apoA-IV antibody , mouse anti-human apoA-IV antibody , mouse IgG kappa binding protein conjugated to HRP (sc-516102), fluorescein isothiocyanate (FITC)-conjugated donkey anti-goat IgG, and FITC-conjugated human Fg were purchased from Santa Cruz . Rabbit anti-goat IgG HRP conjugated antibody (HAF017) was purchased from Bio-Techne . Rat anti-mouse CD41 antibody was purchased from EMFRET Analytics . Maleimide-PEG2-Biotin was purchased from Thermo Scientific (Canada). Quick Change Site-Directed Mutagenesis Kit was purchased from Agilent Technologies . Immobilized metal affinity chromatography columns (His GraviTrap) were\u00a0 purchased from GE Healthcare . Purified human platelet \u03b23 integrins were purchased from Molecular Innovations .The high fat food (TD.88137) was purchased from the Harlan Laboratories .Thrombin, ADP, streptavidin and human fibrinogen (Fg) were purchased from Sigma-Aldrich . Thrombin receptor activating peptide . Recombinant \u03b1V\u03b23 ectodomain with a hexa-Histidine tag at the C-terminus was a gift from Dr. Junichi Takagi . K562 cell line expressing \u03b1M\u03b22 was provided by Dr. Tanya Mayadas . CHO cell lines expressing GPIb-IX complex and \u03b1IIb\u03b23 were gifts from Dr. Larry McIntire  and Dr. Xiaoping Du  respectively. Cell lines were tested for mycoplasma contamination before experiments.\u2212/\u2212) mice and C57BL/6J wild-type (WT) mice were purchased from Jackson Laboratory . ApoA-IV\u2212/\u2212 mice have been backcrossed onto a C57BL/6J background to generate apoA-IV+/+ littermates. ApoA-IV transgenic mice overexpressing mouse apoA-IV (apoA-IV-Tg) were kindly provided by Dr. Karen Reue . \u03b23 integrin gene-deficient (\u03b23\u2212/\u2212) mice were kindly provided by Dr. Richard O. Hynes . Both female and male mice were used with a ratio approximately 1:1 unless where indicated for the intravital microscopy thrombosis models that only male mice can be used43. Genotypes of all experimental animals were confirmed by polymerase chain reaction (PCR) analysis of tissue DNA. All mice were housed in the research vivarium of St. Michael\u2019s Hospital in Toronto, or in each participating institution. Mice or platelets from mice were randomly allocated to experimental and control groups. General conditions of mice were monitored, and the blood flow was evaluated before in vivo experiments. Mice with conditions such as dehydration, or reduced activity were excluded from the study. All animal studies were approved by the Animal Care Committees of St. Michael\u2019s Hospital, Toronto, Canada, University of Cincinnati, Cincinnati, USA and The Scripps Research Institute, La Jolla, USA.ApoA-IV deficient . PRP was obtained by centrifugation at 300 \u00d7 g for 7\u2009min. Gel-filtered platelets were then isolated from the PRP using a Sepharose 2B column in PIPES buffer . Platelet-poor plasma (PPP) was prepared by centrifugation at 1500 \u00d7 g for 20\u2009min. The PPP was further centrifuged at 10,000 \u00d7 g for 5\u2009min to remove the remaining cells.Mice (6\u20138 weeks old) were anaesthetized and bled from the retro-orbital plexus using heparin-coated glass capillary tubesg for 7\u2009min. The PRP was transferred to a fresh tube and stored at 37\u2009\u00b0C before experiments. Gel-filtered human platelets were prepared as described above for mouse platelets. Human blood samples with significant hemolysis or visible clot formation were excluded from this study. Human platelets were randomly allocated to recombinant apoA-IV treatment or control groups. All experimental procedures using human blood samples were approved by the Research Ethics Board of St. Michael\u2019s Hospital, Toronto, Canada, the Institutional Review Board of the Georgia Institute of Technology, and Guangdong Provincial Hospital of Chinese Medicine, Guangzhou, China.Human blood samples were drawn from antecubital veins of healthy volunteers after providing informed consent. Blood was obtained by venipuncture into Li-Heparin Vacutainers and was allowed to rest at 37\u2009\u00b0C for 10\u2009min prior to preparation of PRP. Whole anticoagulated blood was spun at 300 \u00d7 Human \u03b23 integrins were coated on the latex beads and the presence of active \u03b23 integrins on the beads was confirmed by flow cytometry with PAC-1 or anti-\u03b23 integrin anti-sera using a FACScan\u2122 flow cytometer . Ligands were precipitated from fractionated, heparin anticoagulated human blood spin filters  according to the manufacturer\u2019s protocol. Beads were then washed, resuspended in protein loading buffer, and subjected to 2D electrophoresis. The protein spots of interest were identified by MALDI Quadrupole time-of-flight mass spectrometry.\u2212/\u2212 mice and were pre-incubated with anti-\u03b23 integrin mAb M1 (where indicated) for flow cytometry. Resting or activated (20\u2009\u00b5M or 50\u2009\u00b5M ADP or 5\u2009\u00b5g/mL collagen) platelets were fixed with 4% paraformaldehyde at 4\u2009\u00b0C. Samples were incubated with goat anti-human apoA-IV antibody , which also detects mouse apoA-IV, and then incubated with fluorescein isothiocyanate (FITC)-conjugated donkey anti-goat IgG (Santa Cruz) at room temperature in the dark. Phosphate-buffered saline  was added to the sample immediately before acquisition. All samples were analyzed by flow cytometry using a calibrated FACScan\u2122 flow cytometer (BD Biosciences). For Western blot analysis, resting or activated (0.5\u2009U/mL thrombin) gel-filtered mouse platelets (4\u2009\u00d7\u2009107 to 1\u2009\u00d7\u2009108) were lysed, separated by SDS-polyacrylamide gel electrophoresis (PAGE), transferred onto polyvinylidene fluoride (PVDF) membrane, and probed with polyclonal goat anti-human apoA-IV antibody and rabbit anti-goat IgG HRP conjugated antibody (Bio-Techne). Following apoA-IV detection, actin was probed as a loading control after stripping the blots and the actin bands were visualized using HRP conjugated goat anti-mouse actin antibody  and purified by immobilized metal affinity chromatography (IMAC) columns 67. Briefly, full-length human and mouse apoA-IV were subcloned into the pET30 E. coli expression plasmid containing 6\u00d7 His tag and tobacco etch virus (TEV) protease cleavage site. The uncut protein was expressed by 1-thio-\u03b2-D-galactopyranoside induction and purified by affinity chromatography utilizing the vector\u2019s His tag and Ni2+ resin columns followed by overnight dialysis in PBS buffer at 4\u2009\u00b0C. The tag was then cleaved using the TEV protease overnight at 4\u2009\u00b0C and the cleaved tag was separated using the Ni2+ columns and collecting the eluent containing pure cut protein.Recombinant human and mouse apoA-IV were expressed in 68. The target gene fragment was first PCR amplified and subcloned into pET 30 E. coli expression vector. Using human apoA-IV as the template, the target gene fragment was amplified by PCR with upstream primers containing TEV protease site (GAGAACCTGTACTTCCAGGGCGAG) with an Nco I site, and a downstream primer including C-terminal linker GlyGlyCys (GGGGGCTGC) with a hind III site. The final construct (TEV-apoAIV-GGC) was then inserted into a pET 30 expression vector using restriction endonucleases Nco I and Hind III. All mutations were verified through sequence analysis. The expression plasmid TEV-apoA-IV-GGC was next transformed into E. coli BL21 cells. Protein expression and purification were performed as described above. For in vitro biotin labeling, the C-terminal biotinylation of apoA-IV-GGC was performed by adding maleimide-PEG2-Biotin (Thermo Scientific) into apoA-IV-GGC in PBS (pH7.4) for 30\u2009min at room temperature to produce a C-terminal biotinylated apoA-IV. SDS-PAGE and Western blot analysis were used to verify apoA-IV biotinylation.Site-specific cysteine incorporation for biotinylation was accomplished by site-directed mutagenesis to introduce a cysteine residue at the C-terminus for plasmid construction33,34. To coat beads with apoA-IV, SA alone pre-coupled beads were prepared as above. Subsaturating biotinylated apoA-IV was coupled to SA beads by 2\u2009h incubation at room temperature. After resuspending in PBS with 1% BSA, beads were ready for immediate use in BFP experiments. Please refer to the published protocols for details33,34.Purified proteins  were covalently pre-coupled with maleimide-PEG3500-NHS  in carbonate/bicarbonate buffer (pH 8.5). To coat proteins onto the glass beads, 2\u2009\u03bcm silanized borosilicate beads (Thermo Scientific) were first covalently coupled with mercapto-propyl-trimethoxysilane (Sigma-Aldrich), then covalently linked to maleimide modified streptavidin  and proteins of interest in PBS (pH 6.8) by overnight incubationtc)  that allowed for bond formation and then retracted for adhesion detection. During retraction, tensile force signified an adhesion event and no tensile force indicated a non-adhesion event. Adhesion and non-adhesion events were enumerated to calculate an adhesion frequency (Pa) in 50 cycles for each probe-target pair. As Pa depends on tc, the 2D effective on-rate (Ackon) and 2D off-rate (koff) can be derived by fitting the Pa vs tc curve with the model 34, where mr and ml are the respective surface densities of receptors and ligands measured by flow cytometry. The 2D effective affinity (AcKa) is calculated as Ackon/koff. Three to five probe-target pairs were measured at each tc. For the competition assay, Pa of Fg-\u03b1IIb\u03b23 interaction was measured with different concentrations of apoA-IV in solution.For the BFP adhesion frequency assay, in each BFP cycle, the target  was driven to approach and contact the probe  with a ~15 pN compressive force for a certain contact time (8) were incubated with increasing doses of human recombinant apoA-IV or BSA control, then incubated with FITC-conjugated human Fg . Platelet activation was induced by TRAP  in the dark. The samples were then fixed using 4% PFA. Fg binding to the platelet surface was analyzed by flow cytometry.Resting human gel-filtered platelets (1\u2009\u00d7\u200910\u2212/\u2212 mouse gel-filtered platelets were incubated with recombinant mouse apoA-IV (160\u2009\u00b5g/mL) or the same molar concentration of albumin for 10\u2009min. To minimize \u03b1IIb\u03b23 integrin outside-in signaling induced by ligand-\u03b1IIb\u03b23 interaction, particularly following platelet granule release  that causes platelet aggregation, low platelet concentrations (4\u2009\u00d7\u2009105/mL) were used. After incubation, the platelets were treated with thrombin (2\u2009U/mL), collagen (2.5\u2009\u00b5g/mL), and ADP (40\u2009\u00b5M) for 2\u2009min. P-selectin expression was then detected with flow cytometry.Resting WT or \u03b23 integrin\u2212/\u2212, apoA-IV+/\u2212, apoA-IV+/+ control, apoA-IV transgenic mice and WT mice) were obtained by centrifugation of sodium citrate anticoagulated whole blood. Platelet concentration in PRP or PIPES buffer was adjusted to 3\u2009\u00d7\u2009108 platelets/mL with the use of autologous PPP or PIPES buffer41. Platelet aggregation was performed at 37\u2009\u00b0C with a sample stir speed of 1000\u2009rpm using a computerized aggregometer . Platelet aggregation in mouse PRP was stimulated by 1\u2009\u03bcM ADP, 1\u2009\u03bcg/mL collagen, and 250\u2009\u03bcM TRAP. Platelet aggregation in human PRP was stimulated by 2.5\u2009\u03bcM ADP and 5\u2009\u03bcg/mL collagen. Platelet aggregation in gel-filtered platelets was stimulated by 10\u2009\u03bcg/mL collagen and 0. 5U thrombin. For platelet aggregation after switching plasma from the opposite genotype40, gel-filtered apoA-IV\u2212/\u2212 and apoA-IV+/+ control platelets were suspended in PPP (3\u2009\u00d7\u2009108 platelets/mL) from either the same or opposite genotype, and aggregation was induced by 250\u2009\u03bcM TRAP. In another set of experiments, gel-filtered platelet aggregation in PIPES buffer was induced by 250\u2009\u03bcM TRAP. Platelet aggregation induced by various agonists was also measured after adding indicated doses of human or mouse recombinant apoA-IV (incubation for 2\u2009min). The change in light transmission was monitored and recorded for at least 10\u2009min.PRP and PPP from human and mice  was used to deplete apoA-IV in human PPP. Antibody was first coated on the protein G Sepharose beads. The same amount of non-specific goat IgG (Santa Cruz) was used as control. Human PPP was prepared as described above, and added to the beads. The eluate was collected and used for western blot , DM . Point mutagenesis was performed in the expression vector using the Quick Change Site-Directed Mutagenesis Kit . All mutations were verified through sequence analysis.Depletion and point mutations of human and mouse apoA-IV were created by site-directed mutagenesis2.dmol\u22121). Thermal denaturation assays were carried out at a single wavelength (209\u2009nm) by monitoring the change in ellipticity as the temperature was raised from 20\u2009\u00b0C to 90\u2009\u00b0C at a rate of 5\u2009\u00b0C/min. All thermal denaturation data were baseline corrected, normalized between 0 (folded) and 1 (unfolded) and were fit to a nonlinear biphasic sigmoidal curve in GraphPad .WT and DM apoA-IV recombinant proteins were purified by size exclusion chromatography on a BioRad SEC650 column equilibrated in PBS. Protein concentration and purity were quantified by A280 and SDS-PAGE analysis, respectively. CD spectral scans and thermal melts of WT and DM apoA-IV (concentrations ranging from 0.4 to 0.5\u2009mg/mL) were acquired on a Jasco J-810 spectropolarimeter using a 1\u2009mm quartz cuvette (Helma). CD wavelength scans were collected between 190 and 250\u2009nm and averaged over five accumulations. Raw data was then converted to molar ellipticity  with heparin (15\u2009U/mL). Blood was then fluorescently labeled with DiOC6 . ApoA-IV\u2212/\u2212 or apoA-IV+/+ control mouse blood was perfused over the collagen-coated surface using a syringe pump . WT control blood (treated with same volume of PBS), recombinant apoA-IV-treated blood (160\u2009\u03bcg/mL), and DM apoA-IV-treated blood (160\u2009\u03bcg/mL) were perfused at shear rates from 300\u2009s\u22121 to 5000\u2009s\u22121. We performed human blood perfusion chamber assays as described above. Platelet aggregation and thrombus formation or platelet adhesion to Fg were recorded in real-time under a Zeiss Axiovert 135-inverted fluorescence microscope (32 X-W objectives). Quantitative dynamics of platelet fluorescence intensity were acquired by SlideBook software .Rectangular microcapillary chambers  were coated with 100\u2009\u03bcg/mL type-I collagen (Nycomed) or 50\u2009\u03bcg/mL human Fg (Sigma-Aldrich) overnight at 4\u2009\u00b0C3)45 or laser43. The person conducting the experiment was unaware as to the genotype or treatments received by the mice.The experiments on intravital microscopy thrombosis models were performed after injuries induced by ferric chloride . Briefly, blood was collected into ACD from the donor-matched mice. Gel-filtered platelets were prepared and labeled with Calcein AM  at room temperature for 20\u2009min. Platelets were then injected into the experimental mice via the tail vein with control saline buffer, mouse recombinant apoA-IV (9\u2009\u03bcg/g) or DM apoA-IV (9\u2009\u03bcg/g). Mice were then anesthetized and the mesentery was externalized. A single mesenteric arteriole of 100\u2013120\u2009\u03bcm diameter was chosen and injury was induced by topical application of 30\u2009\u03bcL of 250\u2009mM ferric chloride. The time required for formation of the first 20\u2009\u03bcm thrombus and the time to complete vessel occlusion was recorded. Images of thrombus formation and dissolution were visualized with a fluorescence microscope.For the mesenteric arterial thrombosis model, thrombus formation in mesenteric arterioles was monitored in 3- to 4-week-old mice43, apoA-IV\u2212/\u2212, apoA-IV+/+ control, and WT control mice  were anesthetized and a tracheal tube was inserted to facilitate breathing. The cremaster muscle was prepared under a dissecting microscope and superfused throughout the experiment with preheated bicarbonate-buffered saline. Antibody, control saline buffer, mouse recombinant apoA-IV (9\u2009\u03bcg/g) or DM apoA-IV (9\u2009\u03bcg/g) were administered where indicated by a jugular vein cannula. Platelets were labeled by the rat anti-mouse CD41 antibody  injection. Multiple independent upstream injuries were induced on a cremaster arteriole using an Olympus BX51WI microscope with a pulsed nitrogen dye laser. The dynamic accumulation of fluorescently labeled platelets within the growing thrombus was captured and analyzed using Slidebook software.For the laser-induced cremaster arterial thrombosis model46. Ten minutes before inducing arterial injury, WT or mutant apoA-IV (9\u2009\u03bcg/g), or an equal volume (100\u2009\u03bcL) of PBS were injected through a catheter into the right jugular vein. After measuring the baseline blood flow rate (volume/time) for 20\u2009s (s), the left common carotid artery was injured by applying fresh FeCl3\u20226H2O solution  onto the exposed adventitia for 180\u2009s. The vessel was then rinsed with warm physiologic saline solution and the flow rate was measured for an additional 1800\u2009s . Three parameters were calculated: (1) time to first occlusion (O-1), until the flow rate was \u22640.1\u2009mL/min (maximum zero flow error of the probe); (2) time to stable occlusion (O-S), until the flow rate was \u22640.1\u2009mL/min lasting at that level for \u226510\u2009min; and (3) flow index (FI), the ratio of the volume of blood flowed through the artery after-injury  to the volume flowed through in an uninjured vessel . For the carotid artery thrombosis model in apoA-IV\u2212/\u2212 and apoA-IV+/+ control mice, the right carotid artery was dissected following anesthetization and held with a miniature Doppler flow probe . Carotid artery injury was induced with a strip of Whatman filter paper saturated with 10% ferric chloride. Blood flow was monitored until complete vessel occlusion was observed.Experiments were performed in >8-week old, 20\u201335\u2009g, isoflurane-anesthetized C57BL/6J mice of both genders\u2212/\u2212, apoA-IV+/+, and WT mice (6\u20138 weeks old) were injected with recombinant apoA-IV where indicated via the tail vein 40\u2009min before injury. Mice were anesthetized and maintained at 37\u2009\u00b0C on a heating pad during the experiment. The tip of the tail (5\u2009mm) was cut off with a sharp scalpel, and the tail was immediately placed into warm saline at 37\u2009\u00b0C. Bleeding time was recorded as the time to cessation of blood flow (bleeding stopped for >10\u2009s). Blood loss was calculated by counting the red blood cells in the PBS fraction.ApoA-IV\u2212/\u2212, apoA-IV heterozygous (apoA-IV+/\u2212), and apoA-IV+/+ mice (6\u20138 weeks old) were fasted for 12\u2009h, followed by a HFD for 3\u2009h. Blood was then collected from these mice following fasting or HFD condition. Gel- filtered platelets (2.5\u2009\u00d7\u2009108/mL) and PPP were prepared respectively. To minimize interference in the light transmission of PRP, which is commonly caused by postprandial chylomicrons and other lipid particles69, 125\u2009\u00b5L gel-filtered platelets were incubated with its PPP (125\u2009\u00b5L) for 20\u2009min under 37\u2009\u00b0C. The same volume of PPP and PIPES buffer were used as blank control. Platelet aggregations were then induced by collagen (10\u2009\u00b5g/mL).C57BL/6\u2009J WT, apoA-IV transgenic (apoA-IV-Tg), apoA-IV\u2212/\u2212 platelet lysate) by incubation of 0.01\u2009\u00b5g/\u00b5L protein in binding buffer  at 4\u2009\u00b0C overnight. Incubation of 3% skim milk (ED Millipore) and 2% TWEEN-20 for 1\u2009h at 37\u2009\u00b0C was used for blocking. For Fg binding experiments, wells were incubated with the appropriate Fg concentration in binding buffer for 1\u2009h at 37\u2009\u00b0C. Wells were then incubated with anti-fibrinogen mouse IgG (Sigma Aldrich) followed by incubation with anti-mouse IgG-HRP (Santa Cruz), both at 37\u2009\u00b0C for 1\u2009h. For apoA-IV binding experiments the desired protein concentration in binding buffer was added to each well and incubated 1\u2009h at 37\u2009\u00b0C followed by the incubation of streptavidin-horseradish peroxidase (HRP) conjugated protein (Abcam), at 37\u2009\u00b0C for 1\u2009h. Peroxidase substrate, o-Phenylenediamine dihydrochloride  was prepared at 0.4\u2009mg/mL in 0.05\u2009M phosphate citrate buffer at pH\u2009=\u20095.0 with 0.4\u2009\u00b5L/mL of 30 % H2O2. The OPD peroxidase reaction was stopped after 1\u2009h with 2\u2009M H2SO4 and the absorbance was read at 492\u2009nm. Between incubation steps the plate was washed with copious amounts of TRIS buffered saline with 0.5% TWEEN-20.A 96-well plate (Nunc MaxiSorp) was coated with purified human \u03b1IIb\u03b23 or control proteins , 25.8 (20\u201331) years; body mass index, 23.6 (19.9\u201329.6) kg/m2; 10 women and 10 men) were recruited in this study. All participants gave written informed consent in accordance with the Declaration of Helsinki.The meals, sleep, physical activity, room temperature, and light the volunteers received were all controlled. Blood samples were collected prior to meals via venipuncture at 12:00, 18:00, 24:00, and 06:00 across a 24-h period. PRP and PPP were prepared as described above. Plasma samples to be assayed for the concentration of apoA-IV were stored at \u221280\u2009\u00b0C until analyzed by ELISA. Platelet aggregation was induced by ADP (6\u2009\u00b5M) and assays were performed immediately using fresh PRP and PPP within 1\u2009h after blood samples were collected.Plasma apoA-IV concentrations were determined using an ELISA that employs affinity purified goat anti-human apoA-IV polyclonal antibody as the capture antibody . ApoA-IV N-20 was raised against a peptide mapping near the N-terminus of apoA-IV of human origin. Recombinant human apoA-IV proteins with known concentrations (determined by Nanodrop) served as a standard. ApoA-IV N-20 (1\u2009\u00b5g/mL) was coated on the surface of ELISA plates (Nunc MaxiSorp) at 4\u2009\u00b0C for overnight. 3% Skim Milk (Millipore) with 2% Tween-20 in PBS buffer were used for blocking the wells at 37\u2009\u00b0C for 1\u2009h. We then incubated recombinant human apoA-IV or human plasma samples (100 times dilution) at 37\u2009\u00b0C for 3\u2009h, followed by incubation with the detection antibody, apoA-IV G-8, a mouse monoclonal antibody raised against a peptide mapping near the C-terminus of apoA-IV of human origin  at 37\u2009\u00b0C for 2\u2009h. The mouse IgG kappa binding protein (m-IgG\u03ba BP) conjugated to HRP  was then incubated in the wells at 37\u2009\u00b0C for 1\u2009h. OPD substrate and the stop solution were used as described above. Three to five times washing were performed between each step. Read absorbance at 492\u2009nm and 650\u2009nm in a plate reader.t-test and non-parametric Kruskal\u2013Wallis one-way analysis of variance followed by Dunn\u2019s test for multiple paired comparisons. The sample size of each experiment was estimated based on our previous experience and the publications from others50.Data are presented as mean\u2009\u00b1\u2009SEM. Statistical significance was assessed by unpaired, two-tailed Student\u2019s Supplementary InformationPeer Review File"}
+{"text": "Apolipoprotein A-IV (apoA-IV) is a lipid-binding protein, which is primarily synthesized in the small intestine, packaged into chylomicrons, and secreted into intestinal lymph during fat absorption. In the circulation, apoA-IV is present on chylomicron remnants, high-density lipoproteins, and also in lipid-free form. ApoA-IV is involved in a myriad of physiological processes such as lipid absorption and metabolism, anti-atherosclerosis, platelet aggregation and thrombosis, glucose homeostasis, and food intake. ApoA-IV deficiency is associated with atherosclerosis and diabetes, which renders it as a potential therapeutic target for treatment of these diseases. While much has been learned about the physiological functions of apoA-IV using rodent models, the action of apoA-IV at the cellular and molecular levels is less understood, let alone apoA-IV-interacting partners. In this review, we will summarize the findings on the molecular function of apoA-IV and apoA-IV-interacting proteins. The information will shed light on the discovery of apoA-IV receptors and the understanding of the molecular mechanism underlying its mode of action. APOA4 gene, apoA-IV protein structure, apoA-IV glycation, and apoA-IV isoforms. Second, we will discuss the cellular processes in which apoA-IV is likely involved and the signaling event it may trigger by focusing on lipoprotein metabolism, reverse cholesterol transport, anti-atherosclerosis, platelet aggregation and thrombosis, glucose homeostasis, and food intake. Finally, we will conclude with a model describing pathways to which apoA-IV may contribute based on our current knowledge and provide some perspectives on future directions.Lipids, such as cholesterol, phospholipids, and triglycerides (TG), are insoluble in water. Therefore, their transport in the blood, lymph, and extracellular fluid requires association with proteins that have the capacity to interact with both lipids and water. Lipoproteins are complex particles comprised of a central core of cholesteryl esters and TG surrounded by an outer layer of free cholesterol, phospholipids, and apolipoproteins . ApolipoAPOA4 gene is located on chromosome 11 in human and chromosome 9 in mouse. In humans, it is part of the gene cluster containing APOA1, APOC3, and APOA5 cholesterol-labeled serum, apoA-IV was shown to increase cholesterol efflux in the presence of phospholipids-containing liposomes [Several lines of evidence have indicated that apoA-IV promotes cholesterol efflux in cultured cells. Using human skin fibroblasts cultured in the medium with [iposomes . The effiposomes . Using ciposomes . ApoA-IViposomes . Analysiiposomes .14C]cholesterol-containing liposome, human apoA-IV was proven to facilitate LCAT activity [3H]cholesterol followed by quantification of radiolabels incorporated into cholesteryl ester, mouse apoA-IV transgenic mice showed higher cholesterol esterification rates than WT mice, indirectly supporting apoA-IV-mediated LCAT activation in vivo [ApoA-IV can activate LCAT and enhance cholesterol esterification rates ,12. LCATactivity . ApoA-I activity . However in vivo . This suApoA-IV increases human plasma CETP activity in vitro . In huma-/-) strain showed significantly reduced atherosclerotic lesion by a mechanism that did not involve increased HDL cholesterol concentration [0 mice) protected the mice from atherosclerosis without an increase in HDL cholesterol [Over-expression of apoA-IV prevents mice from atherosclerosis. Transgenic mice over-expressing human apoA-IV in the liver of C57BL/6 strain and apoE knockout -induced oxidation of lymph lipoproteins or purified LDL was inhibited by rat apoA-IV in a dose-dependent manner [0 mice had decreased LDL aggregation and less oxidized LDL than WT [2+-induced oxidation as well as 2,2\u2019-Azobis(2-amidinopropane) dihydrochloride-induced oxidation of VLDL [ApoA-IV serves as an inhibitor of lipoprotein oxidation ,13,85,86 than WT . Using tApoA-IV regulates intracellular glutathione redox balance and thus mitigates oxidant-induced apoptotic cell death . In mito-/- mice were more susceptible to DSS-induced inflammation, whereas exogenous administration of apoA-IV to apoA-IV-/- in mice reversed the outcome. DSS is thought to trigger mucosal injury and confer toxicity on epithelial cells, leading to the recruitment and activation of inflammatory cells, upregulation of inflammatory mediators, and eventually the development of severe colitis [ApoA-IV acts as an anti-inflammatory agent to alleviate experimental colitis. Dextran sulfate sodium (DSS) treatment induces inflammation and acute colitis in mice. ApoA-IV substantially postponed the onset, and diminished the severity and extent of inflammatory response elicited by DSS . ApoA-IV colitis . ApoA-IV colitis . The inhAs the most abundant integrin in platelet, \u03b1IIb\u03b23 is required for platelet aggregation ,98. Inte-/- mice and apoA-IV transgenic mice, apoA-IV was proven to prevent Fg-dependent and Fg/VWF-independent platelet aggregation in vitro [ApoA-IV negatively regulates \u03b1IIb\u03b23-mediated platelet aggregation and thrombosis . Using rin vitro . This isin vitro . Moreovein vitro . The inhin vitro .-/- mice showed reduced insulin secretion and impaired glucose tolerance. By injecting recombinant apoA-IV into apoA-IV-/- mice, compromised insulin secretion was rescued and glucose tolerance was improved. In addition, injecting apoA-IV into diabetic KKAy mice caused the similar glucose-lowering effect, suggesting apoA-IV had the ability to modulate glucose homeostasis. \u03b2-cells in pancreatic islets are responsible for glucose-stimulated insulin secretion [+ (KATP) channel and depolarizes the plasma membrane, leading to the activation of Ca2+ channels. The influx of ionized Ca2+ into the cytoplasm eventually stimulates the exocytosis of readily releasable insulin-containing granules [2+ [2+-dependent insulin secretion. However, it remains unresolved how apoA-IV enhances cAMP pathway. We speculate the existence of an apoA-IV receptor, to which apoA-IV binds and initiates downstream signaling pathway that results in elevated cAMP levels.ApoA-IV improves glucose homeostasis by promoting insulin secretion at high levels of glucose . Under hecretion . After fgranules . Apart fules [2+ . Recombi-/- mice had lower glucose uptake rates in tibialis anterior, extensor digitorum longus, and soleus muscles, indicating that apoA-IV contributes to efficient glucose uptake in muscles [ApoA-IV promotes glucose uptake in mouse adipocytes via PI3K-Akt signaling pathway . In the  muscles . In 3T3- muscles . ApoA-IV-/- mice, both G6Pase and PEPCK gene expressions were significantly higher than those in WT mice. In primary hepatocytes, recombinant apoA-IV treatment reduced G6Pase and PEPCK mRNA levels. The suppression of gluconeogenic gene expression by apoA-IV was mediated through NR1D1, also known as Rev-erb\u03b1, which is a nuclear receptor and transcription factor that regulates glucose homeostasis by repressing the expression of hepatic gluconeogenic genes including PEPCK and G6Pase [ApoA-IV suppresses hepatic gluconeogenesis through interaction with the nuclear receptors, nuclear receptor subfamily 1 group D member 1 (NR1D1) and nuclear receptor subfamily 4 group A member 1 (NR4A1) ,17. Durid G6Pase ,109. Apod G6Pase . In concInhibition of food intake by apoA-IV is mediated centrally in rats. It was reported that intracerebroventricular (ICV) injection of recombinant apoA-IV significantly and dose-dependently suppressed food intake . By contd value of 0.32 \u00d7 l0\u22126 M [ApoA-IV, together with apo A-I, A-II, C-I, C-II, CIII, and E, are major protein components of HDL . HDL is \u00d7 l0\u22126 M . The max\u00d7 l0\u22126 M . The binRat apoA-IV was identified to interact with NR1D1 in the bacteria two-hybrid library screening using rat liver cDNA library . In HepGHuman apoA-IV has recently been found to be a novel ligand for platelet \u03b1IIb\u03b23 integrin in the search of human plasma protein binding to activated \u03b1IIb\u03b23 . ApoA-IV2+-mediated exocytosis of insulin-containing granules  By granules A. In adigranules B. In thegranules C. Centragranules . Periphegranules .Although platelet apoA-IV receptor has been identified, it is tempting to speculate that apoA-IV has multiple receptors considering its involvement in a variety of biological processes and effect on many different tissues. So far, in vitro studies have implied that apoA-IV directly binds to the cell surface of endothelial cells , adipocy"}
+{"text": "The fungal growth rate was determined to infer fungal tolerance to tobacco extract, and supernatants from cultivated fungi were used to run the toxicity test using Allium cepa assay. The Fusarium sp. strain I.17, isolated from cigarette waste, was the only lineage capable of growing in 20% (v/v) of cigarette tobacco extract, allowed the onions to root, and was selected for optimization. Initially, for the experimental design to selected fungus, a fractional factorial experimental design 25\u22121 was used to examine the effects of yeast extract, cigarette tobacco extract concentration, dextrose, copper sulfate and pH fungal cultivation. The supernatants of these assays were used to run the toxicity test, and yeast extract and copper sulfate were statistically significant in the fungal growth for the decreasing toxicity process and this variable as were select to central composite design. The highest concentration of yeast extract negatively influenced the toxicity decrease, 0.5% of yeast extract in the culture media is the maximum concentration to achieve the best result and to copper sulfate the best result was using 10 \u03bcmol.L\u22121. In conclusion, the experimental design optimized more than seven times the efficiency of tobacco toxicity reducing, resulting in more than 50% of onion root growth, demonstrating the methodology success. And ITS region was used to taxonomy and molecular phylogeny of the isolate Fusarium sp. strain I.17. These results suggest that Fusarium sp. strain I.17 can be used as a potential microorganism to toxicity treatment of cigarette wastes, minimizing the environmental impact of direct burning.Cigarette product waste contains toxic chemicals, including human carcinogens, which leach into and accumulate in the environment and represent a current environmental problem neglected for too long. This study aimed to select filamentous fungi capable of decreasing tobacco extract toxicity as an alternative to a future bioremediation process. The 38 isolates obtained from Culture collection of microorganisms to biotechnological and environmental importance \u2013 CCMIBA (Brazil) were cultivated in yeast extract (10 g.L Cigarette; Toxicity; Bioremediation; Fractional factorial experimental design; Central composite design. Apart from the nicotine, cigarette smoke contains about 5,000 chemical compounds that are considered harmful, such as carbon monoxide, and polycyclic aromatic hydrocarbons\u2014PAH  and incubated at 28 \u00b0C. The isolates were purified and preserved in glycerol 20% at -80 \u00b0C.The 38 fungal strains were obtained from the Culture collection of microorganisms to biotechnological and environmental importance \u2013 CCMIBA - UNILA, Parana state, Brazil , since 19 fungi were previously isolated from Iguassu National Park and 19 isolated from cigarette samples, as described below. . The cigarettes used in this study were provided by Federal Revenue Service from Foz do Igua\u00e7u city. To isolate fungi from cigarettes, about 10 g from massed cigarettes was agitated with 50 mL of saline solution (0.1 % NaCl) for 30 min, then 100 \u03bcl of this solution was inoculated by serial dilution in PDA media . The cultivation was conducted at 28 \u00b0C on a rotary shaker at 150 rpm for seven days. According to The strains were reactivated on PDA media and incubated for seven days at 28 \u00b0C. Afterward, the inoculation process was followed as described by 2.2Fusarium sp. (I.17) was composed of one fractional factorial experiment, one central composite design, and the validation assay.The strategy used in the experimental design for 5\u22121  with four star points \u03b1 = (22) \u00bc and three replicates at the center points leading to a total of 11 experiments were employed to optimize the toxicity treatment of tobacco extract from cigarette wastes by strain I.17. The other three variables  were fixed at the central levels of the fractional factorial experiment .The quality of fit of the model equation was expressed by the coefficient of determination R\u22121 copper sulfate). All the confirmatory experiments were conducted in triplicate, and the values predicted by the optimization model were set as controls.The results were analyzed by the software STATISTICA v.10. A significant level of 10% (p > 0.1) was considered for the variables screened, and it was 5% (p > 0.05) for the central composite design. To confirm the model equation adequacy, confirmatory experiments under the optimized condition were carried out (5% yeast extract and 10 \u03bcmol.L2.3Allium cepa (onion) test, according A.\u00a0cepa were purchased from the local market. Dried bulb onions and/or those with mold attack indication were discarded. The onions were submerged in the fungal culture supernatant (approximately 50 mL) for rooting. The experiment was performed at 24 \u00b1 2 \u00b0C for three days. After 72 h, the root length was measured using a ruler, and the root tips were cut for later mitotic index determination. Filtered water and YDF media  were used as positive and negative control, respectively. All the assays were carried out in triplicates.The toxicity decrease of tobacco extract in the supernatant from cultivated fungi was evaluated using the 2.4To analyze the efficiency of tobacco toxicity treatment, the mitotic index from the onions roots tips was calculated for each treatment according to 2.5\u22121) L\u22121.Laccase activity was determined spectrophotometrically by monitoring the oxidation of 2,2-azino-bis-[3-ethyl benzothiazoline- 6-sulphonic acid] (ABTS), according 2.6The isolate I.17 was cultured onto routine liquid culture media (Potato dextrose) and incubated at 28 \u00b0C until the earliest visible signs of growth were noted. A small amount (approximately 2 mm) of fungal mycelial mass was removed, and DNA was extracted according to The accuracy of the nucleotide sequence was achieved by performing two-directional DNA sequencing. The nucleotide sequences were compared to the National Centre for Biotechnology Information (NCBI) databases using the Blast search algorithm . The seq33.1\u22121 to 5.57 g.L\u22121 . The tobacco extract added in the culture media contains at least three contaminants in high concentrations that are worth mentioning due to their mutagenic capacity and also their potential to cause great environmental impacts . None of the other culture supernatants made the germination of the onions possible. The results suggest that even though the majority of fungal strains tested showed resistance/tolerance to the tobacco toxicity, these fungal strains are not capable of decreasing cigarette toxicity. Even supposing that the fungal strains might have been using nicotine as carbon and nitrogen sources  regarding its capacity for decreasing cigarette toxicity. We evaluated whether the fungus's growth in the culture medium with the different concentrations of the variables resulted in a supernatant with less toxicity. In the first step of these analyses, the influence of five independent factors in decreasing cigarette toxicity was investigated using Fractional Factorial Design 25\u22121. The supernatants from these assays were evaluated in the toxicity assay (A. cepa), and results are shown in \u22121), showing that higher levels could indicate improvements in the studied response.An experimental design was applied to optimize the performance shown by the \u22121). In statistical analyses, both variables tested were considered significant (p < 0.05) and are shown in It was possible to identify the variables that were important for the process, besides being possible to infer their trends, positively or negatively. In this sense, the significant variables were selected for the CCD, according to The statistical significance  was checked by F test (ANOVA). As the F test value (7.31) for the regression was significant [higher than the F tabulated (4.46)], shown in 2 = 64%) and cannot be highly regarded, since only 64% of the mathematical model is explained. The lack of fit value is mainly due to the absence of root growth in some trials, and the variations found in the central points. According to \u22121 of copper sulfate.The percentage of variation was explained by the model 0.64  of the pyridine ring and oxidation (nicotine oxidase) of a carbon-nitrogen bond in the pyrrolidine ring, respectively . HoweverAnother significant variable for the optimization of cigarette toxicity decrease was the presence of yeast extract in the culture media. Yeast extract provided a source of easy nitrogen assimilation for fungal growth. It was cited by To finalize the experimental design an experiment under the optimized conditions was carried out to confirm the model equation . The res3.3Fusarium sp. strain I.17 before  and after  experimental design strategy had been applied shows an improvement to the cigarette toxicity treatment process. In this context, this work had not only identified a potential fungal strain to reduce cigarette waste toxicity but also had presented optimized culture media conditions to reach the best results.In addition to the root size, the mitotic index (MI) from the onions roots tips was calculated in all assay. The lower MI presented by all treatments than the positive control  is stronA.\u00a0cepa MI is an acceptable and a standard measure of cytotoxicity environmental monitoring . ITS sequences of I.17 were aligned with the consensus region and phylogenetic analysis maintained the same profile  that can be applied in the bioremediation process, including in contaminated environments with cigarette waste and/or in the correct ecological destination of seized cigarettes. Further studies are necessary to confirm the toxic cigarette compounds reduced by the Fusarium sp. I.17 in the toxicity treatment, but the achievements of this study open up new avenues for cigarette waste.In the present study, 38 filamentous fungi strains were screened, regarding their capacity for reducing cigarette toxicity. Among them, only one strain had its growth inhibited. In contrast, the other ones showed dry weight ranging from 1.77 g.LWilliam Bartolomeu de Medeiros: Conceived and designed the experiments; Performed the experiments; Analyzed and interpreted the data; Contributed reagents, materials, analysis tools or data; Wrote the paper.Jaqueline Bail: Performed the experiments; Analyzed and interpreted the data.Michel Rodrigo Zambrano Passarini: Conceived and designed the experiments; Contributed reagents, materials, analysis tools or data.Rafaella Costa Bonugli-Santos: Conceived and designed the experiments; Analyzed and interpreted the data; Contributed reagents, materials, analysis tools or data; Wrote the paper.Universidade Federal da Integra\u00e7\u00e3o Latino-Americana (PAIP) (n \u00b0 80/2019 / PRPPG).This work was supported by Data included in article/supp. material/referenced in article.The authors declare no conflict of interest.No additional information is available for this paper."}
+{"text": "Clinical comprehensive decision-making of diabetic ulcers includes curative effect evaluation and curative effect prediction. Nevertheless, there are few studies on the prediction of diabetic ulcers.  Set pair analysis (SPA) was used to assess the curative effect evaluation, and therapeutic effect was evaluated by connection degree (CD). The higher-order Markov chain-SPA curative effect prediction model was established to predict the future curative effect development. The predicted results with higher-order Markov chain-SPA and traditional first-order Markov-SPA model were compared with the actual results of the patients to verify the effectiveness of prediction.  The connection degree of index levels I and II of 15 patients with diabetic ulcers after traditional Chinese medicine (TCM) treatment increased with time, while that of index levels IV and V decreased, indicating that the curative effect tends to improve. The higher-order Markov chain-SPA model was used to predict the curative effect. The results showed that the relative errors were fewer than the traditional first-order Markov-SPA model.  The present study suggests that a method of SPA combined with higher-order Markov-SPA is relatively effective and can be applied to the clinical prediction of diabetic ulcers, which has higher accuracy than traditional first-order curative effect prediction model. Medical decision-making has always been the core and key issue of clinical medicine. The comprehensive decision-making includes not only evaluation of the current symptoms or indicators of patients but also prediction research of future therapeutic effects. At present, there are many methods for medical comprehensive decision-making. Wang et al.  evaluateBy the end of 2017, it was estimated that there are 451 million (age: 18\u201399 years) people with diabetes worldwide. Furthermore, these figures were expected to increase to 693 million by 2045 , and j is the coefficient of opposites, which is generally defined as \u22121. Then connection could be expressed asn\u2009=\u20093, the CD of the five-element connection number is defined as\u2009k. Ex is the expected value of the cloud drop that can represent the qualitative concept. Then, the weight value of symptom index k is defined as \u03c9k.Each symptom index has a different weight in the evaluation of curative effect; the weight of cloud model (CM) was used . The spet, the numbers of symptoms in the five levels are A (t), B (t), C (t), D (t), E (t), and A (t)\u2009+\u2009B (t)\u2009+\u2009C (t)\u2009+\u2009D (t)\u2009+\u2009E (t)\u2009=\u2009N. The original N symptoms are reordered and numbered sequentially in the order of A (t), B (t), C (t), D (t), E (t). The weight corresponding to the serial number of each symptom is \u03c9k(t) at time t.Assume that, at time \u03c9k(t) \u2264 1, \u2009\u2211k=1N\u03c9k(t)=1.According to equation , the CD The five symptom index levels I to V were given the scores 9, 7, 5, 3, and 1 . AfterwaGenerally speaking, when score of curative effect is high, curative effect will be better.n states, it has nothing to do with n previous states, so this characterization is called n-order non-aftereffect. In the following series of papers, Raftery proposed the maximum likelihood method of mixed transfer distribution (MTD) model. The parameter estimation of the higher-order Markov model is studied and the transformation of the higher-order Markov model from theoretical results to practical application tools is realized. Based on the research of Raftery, Ching  denotes the probability distribution vector of each state at time t. For a positive integer n, here we haveThe stochastic process {C(1),\u2026, C(2),\u2026, C(T)} is an n-order Markov chain, where \u03bbr \u2265 0 is a high-order coefficient and \u2211r=1n\u03bbr=1. The M-order square matrix Qr can be considered as r-step state transition probability matrix.Then, {C (t\u2009+\u20091) at time t\u2009+\u20091, which is related to the previous n time states C (t), C (t\u2009\u2212\u20091), and C (t\u2009+\u20091\u2009\u2212\u2009n) and ignores the more previous states. The higher-order Markov chain extends the restriction of only adjacent dependence in the first-order Markov chain that makes the model more realistic.It should be pointed that higher-order Markov chain describes the distribution of state A (t) at time t. At time t\u2009+\u20091, there are A (t1) symptoms, the status of which is still level I, A (t2) symptoms change from level I to level II, A (t3) symptoms change from level I to level III, A (t4) symptoms change from level I to level IV, and A (t5) symptoms change from level I to level V. The state transition probability of the symptom index of level I during time  wasp11=\u2211k=1A(t1)\u03c9k(t)/\u2211k=1A(t)\u03c9k(t); p12=\u2211k=A(t1)+1A(t1)+A(t2)\u03c9k(t)/\u2211k=1A(t)\u03c9k(t); p13=\u2211k=A(t1)+A(t2)+1A(t1)+A(t2)+A(t3)\u03c9k(t)/\u2211k=1A(t)\u03c9k(t); p14=\u2211k=A(t1)+A(t2)+A(t3)+1A(t1)+A(t2)+A(t3)+A(t4)\u03c9k(t)/\u2211k=1A(t)\u03c9k(t); and p15=\u2211k=A(t1)+A(t2)+A(t3)+A(t4)+1A(t1)+A(t2)+A(t3)+A(t4)+A(t5)\u03c9k(t)/\u2211k=1A(t)\u03c9k(t).The number of indexes of curative effect level I is t, t\u2009+\u20091] are QB, QC, QD, and QE, respectively, while the transition probability matrix Q (t\u2009+\u20091) of the system in  isSimilarly, the state transition probabilities of other symptom indicators during time [\u03bb (t\u2009+\u20091\u2009\u2212\u2009r) is equivalent to the weight of the state transition probability matrix Q (t\u2009+\u20091\u2009\u2212\u2009r). If the state transition probability matrix Q (t\u2009+\u20091\u2009\u2212\u2009r) at time t\u2009+\u20091\u2009\u2212\u2009r is more similar to the state transition probability matrix at other times, the contribution of the matrix is smaller and the higher-order coefficient \u03bb (t\u2009+\u20091\u2009\u2212\u2009r) is smaller. Therefore, the higher-order coefficient calculation method can be constructed by using matrix similarity [The higher-order coefficient milarity .t\u2009+\u20091\u2009\u2212\u2009r and t\u2009+\u20091\u2009\u2212\u2009s at any two times are Q (t\u2009+\u20091\u2009\u2212\u2009r) and Q (t\u2009+\u20091\u2009\u2212\u2009s), respectively. The similarity isQ (t\u2009+\u20091\u2009\u2212\u2009r), Q (t\u2009+\u20091\u2009\u2212\u2009s)>\u2009=\u2009tr (Q (t\u2009+\u20091\u2009\u2212\u2009s)TQ (t\u2009+\u20091\u2009\u2212\u2009r)), tr(\u00b7) represents the sum of diagonal elements of a matrix, and \u2016\u00b7\u2016 reflects the norm derived from the inner product of a matrix, which isThe state transition probability matrices of \u03b8 is the angle between the two matrices. When \u03b8\u2009=\u200990\u00b0 and \u0398\u2009=\u20090, it is indicated that the two matrices are not similar; conversely, if \u03b8\u2009=\u20090\u00b0 and \u0398\u2009=\u20091, the similarity of the two matrices is high. The more similar the state transition probability matrix is, the smaller the higher-order coefficient \u03bb is defined. Therefore, the similarity matrix of the pairwise matrix between the matrices Q (t), Q (t\u2009\u2212\u20091), and Q (t\u2009+\u20091\u2009\u2212\u2009n) is shown:Q (t\u2009+\u20091\u2009\u2212\u2009r) and other matrices can be defined asAccording to the similarity matrix \u0398, the similarity between the matrix Furthermore, the high-order coefficient is calculated:n moments before time t is defined as follows:The curative effect CD of t\u2009+\u20091 can be predicted according to equation:t\u2009=\u20091, 2,\u2026, T; Q (t\u2009+\u20091\u2009\u2212\u2009r) is the transition probability matrix at time t\u2009+\u20091\u2009\u2212\u2009r; \u03bb (t\u2009\u2264\u20091\u2009\u2212\u2009r) is the higher-order coefficient, and \u2211r=1n\u03bb(t+1 \u2212 r)=1.CD of curative effect at time According to the previous clinical observation, ten indexes were identified as the main indicators that affect prognosis of diabetic ulcers , 24. Eact-test or the Wilcoxon rank-sum test, as appropriate. Two-tailed p values <\u20090.05 were considered statistically significant. All calculations were carried out by SPSS (version 21.0) software package.Ten experts were invited to assess the importance of symptom indexes of diabetic ulcers ; then, tk was calculated by the cloud model and tested by the confusion degree test, where the confusion value is less than 1. The corresponding image of each symptom was cloud instead of fog ..U (14).The state transfer matrix of a 68-year male patient (patient a) in each treatment course was defined as follows:\u03bbt1\u2009=\u20090.46, \u03bbt2\u2009=\u20090.25, and \u03bbt3\u2009=\u20090.29.His higher-order coefficients of each treatment course were The state transfer matrix of a 66-year female patient (patient b) in each treatment course was shown as follows:\u03bbt1\u2009=\u20090.39, \u03bbt2\u2009=\u20090.24, and \u03bbt3\u2009=\u20090.37.Her higher-order coefficients of each treatment course were The state transfer matrix of a 66-year male patient (patient c) in each treatment course was as follows:\u03bbt1\u2009=\u20090.46, \u03bbt2\u2009=\u20090.25, and \u03bbt3\u2009=\u20090.29.His higher-order coefficients of each treatment course were The state transfer matrix of a 64-year male patient (patient d) in each treatment course was defined as follows:\u03bbt1\u2009=\u20090.44, \u03bbt2\u2009=\u20090.30, and \u03bbt3\u2009=\u20090.26.His higher-order coefficients of each treatment course were The state transfer matrix of a 57-year male patient (patient e) in each treatment course was defined as follows:\u03bbt1\u2009=\u20090.39, \u03bbt2\u2009=\u20090.28, and \u03bbt3\u2009=\u20090.33.His higher-order coefficients of each treatment course were The state transfer matrix of a 58-year female patient (patient f) in each treatment course was defined as follows:\u03bbt1\u2009=\u20090.42, \u03bbt2\u2009=\u20090.28, and \u03bbt3\u2009=\u20090.30.Her higher-order coefficients of each treatment course were The state transfer matrix of a 66-year male patient (patient g) in each treatment course was defined as follows:\u03bbt1\u2009=\u20090.45, \u03bbt2\u2009=\u20090.30, and \u03bbt3\u2009=\u20090.25.His higher-order coefficients of each treatment course were The state transfer matrix of a 50-year male patient (patient h) in each treatment course was defined as follows:\u03bbt1\u2009=\u20090.43, \u03bbt2\u2009=\u20090.34, and \u03bbt3\u2009=\u20090.23.His higher-order coefficients of each treatment course were The state transfer matrix of a 68-year male patient (patient i) in each treatment course was defined as follows:\u03bbt1\u2009=\u20090.36, \u03bbt2\u2009=\u20090.30, and \u03bbt3\u2009=\u20090.34.His higher-order coefficients of each treatment course were The state transfer matrix of a 61-year female patient (patient j) in each treatment course was defined as follows:\u03bbt1\u2009=\u20090.40, \u03bbt2\u2009=\u20090.29, and \u03bbt3\u2009=\u20090.31.Her higher-order coefficients of each treatment course were The state transfer matrix of a 43-year male patient (patient k) in each treatment course was defined as follows:\u03bbt1\u2009=\u20090.40, \u03bbt2\u2009=\u20090.24, and \u03bbt3\u2009=\u20090.36.His higher-order coefficients of each treatment course were The state transfer matrix of a 58-year male patient (patient l) in each treatment course was defined as follows:\u03bbt1\u2009=\u20090.46, \u03bbt2\u2009=\u20090.30, and \u03bbt3\u2009=\u20090.24.His higher-order coefficients of each treatment course were The state transfer matrix of a 47-year male patient (patient m) in each treatment course was defined as follows:\u03bbt1\u2009=\u20090.38, \u03bbt2\u2009=\u20090.31, and \u03bbt3\u2009=\u20090.31.His higher-order coefficients of each treatment course were n) in each treatment course was defined as follows:The state transfer matrix of a 55-year male patient  in each treatment course was defined as follows:\u03bbt1\u2009=\u20090.43, \u03bbt2\u2009=\u20090.32, and \u03bbt3\u2009=\u20090.25.Her higher-order coefficients of each treatment course were t4 \u2009=\u20090.39\u2009+\u20090.61i, \u03bc\u2009(t4)\u2009=\u20090.26\u2009+ 0.74i, \u03bc (t4)\u2009=\u20090.30\u2009+\u20090.62i\u2009+\u20090.08j, \u03bc (t4)\u2009=\u20090.39\u2009+ 0.53i\u2009+ 0.08j, \u03bc\u2009(t4)\u2009=\u20090.26\u2009+\u20090.74i and \u03bc\u2009(t4)\u2009=\u20090.30\u2009+\u20090.47i\u2009+\u20090.23j, \u03bc\u2009(t4)\u2009=\u20090.28\u2009+\u20090.31i\u2009+\u20090.3j\u2009+\u20090.11k, \u03bc\u2009(t4)\u2009=\u20090.62\u2009+\u20090.11i\u2009+\u20090.19j\u2009+\u20090.08k, \u03bc\u2009(t4)\u2009=\u20090.51\u2009+\u20090.30i\u2009+\u20090.08j\u2009+\u20090.11k, \u03bc\u2009(t4)\u2009=\u20090.51\u2009+\u20090.30i\u2009+ 0.19j, \u03bc\u2009(t4)\u2009=\u20090.64\u2009+\u20090.17i\u2009+\u20090.19j, \u03bc\u2009(t4)\u2009=\u20090.39\u2009+\u20090.34i\u2009+\u20090.27j, \u03bc\u2009(t4)\u2009=\u20090.21\u2009+\u20090.68i\u2009+\u20090.11k, \u03bc\u2009(t4)\u2009=\u20090.37\u2009+\u20090.29i\u2009+\u20090.34j, and \u03bc\u2009(t4)\u2009=\u20090.38\u2009+\u20090.39i\u2009+\u20090.23j, respectively. According to the maximum connection degree principle, the levels of curative effect of 15 patients were I and II. In the t3-t4 treatment course, there were no significant changes and even slight reduction of calculation results of effect scores (U), which proposed that the healing of diabetic ulcer has a certain difficulty. However, the overall curative efficacy score of 15 patients tended to increase \u2009=\u20090.44\u2009+\u20090.38i\u2009+\u20090.11j\u2009+\u20090.08k, \u03bc\u2032\u2009(t4)\u2009=\u20090.30\u2009+\u20090.46i\u2009+\u20090.19j\u2009+\u20090.04k, \u03bc\u2032\u2009(t4)\u2009=\u20090.30\u2009+ 0.42i\u2009+\u20090.25j\u2009+ 0.03k, \u03bc\u2032\u2009(t4)\u2009=\u20090.39\u2009+\u20090.39i\u2009+\u20090.15j\u2009+\u20090.07k, \u03bc\u2032\u2009(t4)\u2009=\u20090.36\u2009+ 0.34i\u2009+\u20090.26j\u2009+\u20090.04k and \u03bc\u2032 (t4)\u2009=\u20090.28\u2009+\u20090.40i\u2009+\u20090.25j\u2009+\u20090.07k, \u03bc\u2032\u2009(t4)\u2009=\u20090.24\u2009+\u20090.25i\u2009+\u20090.37j\u2009+\u20090.14k, \u03bc\u2032\u2009(t4)\u2009=\u20090.51\u2009+ 0.16i\u2009+ 0.23j\u2009+ 0.10k, \u03bc\u2032\u2009(t4)\u2009=\u20090.45\u2009+\u20090.22i\u2009+\u20090.24j\u2009+\u20090.10k, \u03bc\u2032\u2009(t4)\u2009=\u20090.42\u2009+\u20090.34i\u2009+\u20090.16j\u2009+\u20090.08k, \u03bc\u2032\u2009(t4)\u2009=\u20090.43\u2009+\u20090.40i\u2009+ 0.15j\u2009+ 0.03k, \u03bc\u2032\u2009(t4)\u2009=\u20090.40\u2009+\u20090.26i\u2009+\u20090.25j\u2009+\u20090.09k, \u03bc\u2032\u2009(t4)\u2009=\u20090.24\u2009+ 0.39i\u2009+ 0.30j\u2009+\u20090.07k, \u03bc\u2032 (t4)\u2009=\u20090.29\u2009+\u20090.35i\u2009+ 0.29j\u2009+ 0.07k, and \u03bc\u2032\u2009(t4)\u2009=\u20090.33\u2009+\u20090.34i\u2009+\u20090.23j\u2009+\u20090.10k. The curative efficacy scores were 7.34, 7.03, 6.96, 7.20, 7.06, 6.78, 6.17, 7.16, 7.03, 7.20, 7.46, 6.91, 6.60, 6.73, and 6.83, respectively, and the actual efficacy scores were 7.78, 7.52, 7.44, 7.62, 7.52, 7.14, 6.52, 7.54, 7.42, 7.64, 7.90, 7.24, 6.98, 7.06, and 7.30. The corresponding relative errors of prediction were 5.99%, 6.97%, 6.90%, 5.83%, 6.52%, 5.15%, 5.33%, 5.03%, 5.27%, 5.72%, 5.61%, 4.53%, 5.44%, 4.71%, and 6.51%, indicating that the higher-order Markov chain-SPA curative effect prediction method is effective and can be applied to clinical practice. The connection degrees of time t4 predicted by the first-order Markov chain-SPA model were \u03bc\u2033\u2009(t4)\u2009=\u20090.38\u2009+ 0.36i\u2009+\u20090.05j\u2009+\u20090.02k\u2009+\u20090.19l, \u03bc\u2033\u2009(t4)\u2009=\u20090.45\u2009+\u20090.33i\u2009+ 0.07j\u2009+ 0.01k\u2009+\u20090.14l, \u03bc\u2033 (t4)\u2009=\u20090.45\u2009+\u20090.33i\u2009+\u20090.07j\u2009+\u20090.01k\u2009+\u20090.14l, \u03bc\u2033 (t4)\u2009=\u20090.38\u2009+\u20090.39i\u2009+\u20090.04j\u2009+\u20090.02k\u2009+\u20090.17l, \u03bc\u2033\u2009(t4)\u2009=\u20090.42\u2009+ 0.34i\u2009+\u20090.09j\u2009+\u20090.01k\u2009+\u20090.14l, \u03bc\u2033 (t4)\u2009=\u20090.32\u2009+\u20090.40i\u2009+ 0.12j\u2009+ 0.02k\u2009+\u20090.19l, \u03bc\u2033 (t4)\u2009=\u20090.29\u2009+\u20090.19i\u2009+ 0.34j\u2009+ 0.08k\u2009+\u20090.11l, \u03bc\u2033 (t4)\u2009=\u20090.44\u2009+\u20090.15i\u2009+\u20090.19j\u2009+\u20090.06k\u2009+\u20090.16l, \u03bc\u2033\u2009(t4)\u2009=\u20090.46\u2009+ 0.19i\u2009+\u20090.14j\u2009+\u20090.05k\u2009+\u20090.15l, \u03bc\u2033 (t4)\u2009=\u20090.37\u2009+\u20090.35i\u2009+ 0.08j\u2009+ 0.02k\u2009+\u20090.18l, \u03bc\u2033 (t4)\u2009=\u20090.44\u2009+\u20090.32i\u2009+\u20090.08j\u2009+\u20090.01k\u2009+\u20090.15l, \u03bc\u2033 (t4)\u2009=\u20090.37\u2009+\u20090.28i\u2009+\u20090.16j\u2009+\u20090.05k\u2009+\u20090.14l, \u03bc\u2033\u2009(t4)\u2009=\u20090.24\u2009+ 0.25i\u2009+\u20090.27j\u2009+\u20090.02k\u2009+\u20090.21l, \u03bc\u2033\u2009(t4)\u2009=\u20090.34\u2009+\u20090.31i\u2009+ 0.23j\u2009+ 0.04k\u2009+\u20090.07l, and \u03bc\u2033 (t4)\u2009=\u20090.34\u2009+\u20090.33i\u2009+\u20090.18j\u2009+\u20090.05k\u2009+\u20090.10l. The curative efficacy scores were 6.44, 6.91, 6.88, 6.58, 6.78, 6.53, 5.97, 6.29, 6.53, 6.39, 6.80, 6.39, 5.60, 6.60, and 6.51, and the corresponding relative errors were 17.22%, 8.11%, 7.53%, 13.65%, 9.84%, 8.54% 8.50%, 16.62%, 12.01%, 16.35%, 13.89%, 11.78%, 19.79%, 6.53%, and 10.80%. The results of the t-test analysis showed that data were normally distributed within the difference between two groups at the significant level of 0.05. The paired t-test resulted in p < 0.05; the difference was statistically significant (p < 0.05), where the high-order Markov chain-SPA curative effect prediction model is more accurate than the first-order Markov chain-SPA model.According to nificant . We coulMedical decision-making composed of curative effect analysis and prediction is of significance for clinical research. It should be noted that studies mainly put emphasis on evaluating the current curative effect that pays less attention to predicting the change and trend of future curative effect. Based on Markov chain and SPA method, this paper applied a higher-order Markov chain-SPA model for the study of curative effect prediction. At present, SPA and the Markov chain were used in many fields of evaluation and prediction research. For instance, study reported that Bao and Zhang  adopted The SPA combined with Markov chain model has also been widely applied to prediction analysis successfully in many fields. For instance, Xie and Guo  used SPAAlthough Markov chain has been successfully used to predict the natural progress of diseases in the field of medicine such as the progress of retinopathy in patients with type 2 diabetes mellitus , currentRefractory wound is the most common skin complication of diabetes and the diabetic ulcers are the main cause of nontraumatic amputation of lower extremities. Epidemiological studies have shown that the amputation rate of diabetic feet in countries with a high incidence of diabetes, such as China, is as high as 19.03% . TCM is U) is the reflection of the therapeutic effect. The level of efficacy of patients can be clearly shown. The Markov chain is a commonly used method to describe dynamic random phenomena that predict the future development of the system according to transition probability.This paper suggested a higher-order Markov chain-SPA curative effect prediction model to evaluate the clinical curative effect and predicted the future curative effect through the curative effect state of previous several times. Clinical efficacy always changes with individual differences, environmental factors, and so on. Through the evaluation of clinical curative effect by establishing the SPA model, the CD is composed of five symptom grades and the proportion of the five grades can be clearly presented. The curative efficacy score (With regard to the weight of symptom indexes of curative effect evaluation, CM was applied . ObviousThis paper introduced a curative effect prediction model, which used the transfer probability and five-element connection degree between each symptom level to construct the higher-order Markov chain-SPA curative effect prediction model. The model was applied to predict the curative effect of diabetic ulcer. The relative error between the predicted results and the actual value is about 5.70%, indicating that the higher-order efficacy prediction model can be used in clinical efficacy prediction of diabetic ulcers.In this paper, CM was used to calculate the weight of curative effect indexes because of the different importance of different symptoms in the evaluation of curative effect. Due to the limitation of the first-order Markov chain only related to the current and the developed curative effect related to many states after treatment, the traditional first-order Markov chain is extended to the higher-order Markov chain. The results show that this method improves the accuracy of the prediction model.In this paper, CM was used to calculate the constant weight, which reflects the relative importance of the index. The relative error between the prediction result and the actual value is approximately 5.70%, which is far lower than traditional first-order Markov chain. In the future, variable weight method will be used to make the index weight change with the state of the curative effect of the index, which reflects the importance of the state order of the symptom index. Moreover, we will evaluate and predict the curative effect for more and longer time in order to reduce the prediction error and make the prediction more accurate.To conclude, the study introduced a curative effect prediction model based on Markov chain and SPA. In this paper, SJHY treatment was applied to treat diabetic ulcer and the curative effect of the first three courses treatment was evaluated to predict the curative effect of the fourth treatment course. The predicted values were compared with the actual values and the predicted values of the traditional first-order model. The following conclusions are obtained:"}
+{"text": "Heme b concentrations typically decline in waters with low iron concentrations but due to lack of field data, the distribution of heme b in particulate material in the ocean is poorly constrained. Here we report particulate heme b distributions across the Atlantic Ocean (59.9\u00b0N to 34.6\u00b0S). Heme b concentrations in surface waters ranged from 0.10 to 33.7 pmol L\u22121  and were highest in regions with a high biomass. The ratio of heme b to particulate organic carbon (POC) exhibited a mean value of 0.44 \u03bcmol heme b mol\u22121 POC. We identified the ratio of 0.10 \u00b5mol heme b mol\u22121 POC as the cut-off between heme b replete and heme b deficient (anemic) phytoplankton. By this definition, we observed anemic phytoplankton populations in the Subtropical South Atlantic and Irminger Basin. Comparison of observed and modelled heme b suggested that heme b could account for between 0.17\u20139.1% of biogenic iron. Our large scale observations of heme b relative to organic matter provide further evidence of the impact of changes in iron supply on phytoplankton iron status across the Atlantic Ocean.Heme  The iron-containing cofactors are grouped based on the coordination and chemical bonds of iron with other elements within the molecule, and one major group of iron cofactors are hemes4.Iron constitutes one of the most important nutrients for phytoplankton5, and are produced via the tetrapyrrole synthesis pathway5. Ambient iron concentrations control heme biosynthesis and thus intracellular heme concentrations4. Heme b (iron protoporphyrin IX) is considered the most common heme structure within an organism6 and is a constituent of the b type cytochromes, catalases, peroxidases, cytochrome P450, globins and nitrate reductase8. Hence, heme b is involved in electron transport and catalysis of hydrogen and other peroxides as well as oxygen control, oxygen-storage and oxygen-transport8. Some marine bacteria are known to use dissolved hemes in seawater as a direct source of iron11. In cyanobacteria, rhodophytes and cryptophytes, hemes are further metabolised to phycobilins via heme oxygenase12. Phycobilins function as chromophores in the light-harvesting phycobiliproteins and the photoreceptor phytochrome13.Hemes are iron-containing porphyrins of different structures that act as cofactors (i.e. prosthetic groups) in hemoproteinsb contributing towards approximately half of this amount14. Honey, et al.15 demonstrated that heme b accounts for between 1 to 40% of the total biogenic iron pool in marine phytoplankton (mean 18\u2009\u00b1\u200914%). At low iron concentrations in culture media (\u22640.50 nmol L\u22121), 6 to 26% of the available iron was utilized for production of heme b cofactors for species from temperate ocean areas15. This percentage ranged from 0.2 to 16% for species from high latitude ocean regions16. These findings suggested that, similarly to iron-use efficiencies14, the heme b quota required for growth is also variable amongst species and growth conditions16.Hemoproteins make up approximately 40% of the intracellular iron pool in phytoplankton, with hemoproteins containing heme \u22121) lead in general to a decrease in growth, photosynthesis and nitrogen fixation rates of phytoplankton22. Although a number of studies have documented the declines in the abundance of several iron proteins in cultured phytoplankton30, only a few studies report the abundances of such proteins in the field35.To date, several studies have documented that low oceanic iron concentrations  conditions36. However, certain eukaryotes  appear able to maintain growth despite the low heme b concentrations36. These species are considered to regulate and reduce intracellular heme b concentrations by allocating the available iron away from the hemoprotein pool in order to maintain other metabolic processes36. Heme b regulation is considered a response of phytoplankton to declining ambient iron concentrations that depends on species- specific requirements in iron and thus may be observed in the field during the iron-induced shifts37 from larger- to smaller-sized phytoplankton populations36.Iron deficiency in higher organisms is expressed by decreases in hemoprotein levels (e.g. hemoglobin). This condition is commonly described as \u201canemia\u201d which literally refers to heme-iron deficiency. In a similar manner, reduced iron supply in the surface waters in the ocean leads to anemic phytoplankton. Hence, in both cultured and field phytoplankton populations, the concentrations of heme b abundance in the Atlantic Ocean. We synthesise previously published36 and new field data covering areas from the subpolar North Atlantic to the subtropical South Atlantic. Since the factors driving the heme b distribution in the natural environment are still uncertain, our aim was to examine physical, chemical and biological processes that potentially influence heme b. The Atlantic Ocean is a good study region for this purpose as it consists of several provinces that exhibit contrasting abundances of iron and macronutrients. In particular, the Atlantic Ocean is an area of scientific interest as it is subject to large spatial variability in iron supply39 with potential impacts on primary productivity, nitrogen and phosphorus cycling45, and carbon export46. Furthermore, low iron supply in the Atlantic Ocean has been connected to reductions in primary productivity48, oceanic CO2 uptake rates by phytoplankton48 and nitrogen fixation rates41 with potential consequences for the global climate49.In this study we present an extensive dataset of heme b makes up a significant portion of the total biogenic iron pool in marine phytoplankton, heme b could potentially provide an assessment of iron utilization in situ. Hence, the second part of our study examines (1) the comparability of field heme b concentrations to predicted heme b from the total biogenic iron pool using a global biogeochemical model, and (2) the potential utility of heme b as an indicator of the magnitude of the biogenic iron pool in the field.Finally, taking into account the laboratory experiments that showed that heme b) from the research cruises M121 (2015) and M124 (2016) in the South Atlantic. We further obtained published data  for the research cruises CD17316, D34615, D36150 and GEOVIDE36. Details on the expeditions are listed in Table\u00a0a (chl a) distribution. Here we list these regions in geographical order (north to south); Labrador Sea, Irminger Basin, Iceland Basin, Celtic Sea, Subtropical North Atlantic Gyre, Tropical North Atlantic, Coastal Tropical North Atlantic, Tropical South Atlantic, Angola Current, Subtropical South Atlantic Gyre and Benguela Current.We compiled newly analysed (unpublished) and previously published data from the Atlantic Ocean collected over a time span from 2005 to 2016. We present here new data  for all oceanographic regions from the surface down to 220\u2009m depth. The highest concentrations of POC were determined in the high latitude North Atlantic Ocean  and the coastal areas . Concentrations of POC were lowest in both subtropical gyres  and open ocean stations of the Tropical North and South Atlantic with a median value of 2.4 \u03bcmol L\u22121 (n\u2009=\u2009752).Particulate Organic Carbon (POC) concentrations ranged from 0.14 to 63.5 \u03bcmol La concentrations ranged from <0.01 to 10.7 nmol L\u22121  overall (0\u2013220\u2009m depth). Similar to POC, chl a was highest in the subpolar North Atlantic  and the coastal areas . Lower concentrations of chl a were determined in tropical areas  and in the subtropical gyres . The lowest chl a values were observed in the Subtropical South Atlantic Gyre, where we determined a median concentration of 0.03 nmol L\u22121. Our results are comparable to those reported during the Atlantic Meridional Transect (AMT) cruises in this region53.Chlorophyll a indicated generally higher concentration within the surface mixed layer (SML) that decreased with depth . However, clear Deep Chlorophyll Maxima (DCM) were also present in most of the oceanographic regions tropical North Atlantic, Angola Current, Benguela Current and (sub-)tropical South Atlantic)  in the SML  for the whole dataset  and the Tropical North Atlantic  whilst chl a:POC was lowest in the subtropical South Atlantic Gyre . Statistically significant differences were determined between the SML and the DCM  and between oceanographic regions  which were mainly attributed to the differences between the North (sub-) tropical Atlantic  and the South Atlantic . Large differences between chl a:POC ratios in the North And South Atlantic have also been observed previously and are thought to be strongly influenced by phytoplankton physiology53.The ratio of chl set Fig.\u00a0. The higb concentrations ranged from 0.10 to 33.7 pmol L\u22121  from the surface layer down to 200\u2009m depth. The depth profiles of heme b  and decreased with depth  except for the cases where a DCM was present .Heme b in the SML is shown in Fig.\u00a0b in the SML for the various oceanographic regions  . These regions include two upwelling areas  and the Congo river plume located in the Angola region; hence, heme b was highest in the Benguela area    which were sampled during the spring bloom in 2014 36. However, the Irminger Basin deviated from this pattern, despite being sampled in the same season, exhibiting the lowest heme b concentrations 36, along with the Subtropical South Atlantic Gyre  and the offshore stations in the tropical Atlantic .The median\u00a0concentration of heme 01) Fig.\u00a0. Signifib correlated with both POC  and chl a  . However, the difference in values between the two layers (above and below the SML) was statistically significant , with heme b: POC significantly higher in the DCM. The depth profiles   and the Subtropical South Atlantic Gyre  suggesting a decoupling of heme b from POC in these regions   and followed a different pattern of spatial distribution in the SML compared to heme b:POC  and highest in the Subtropical South Atlantic Gyre  suggesting community driven differences in photoacclimation and/or hemoprotein regulation patterns.In this study, heme 01) Fig.\u00a0. The lowons Fig.\u00a0. Similar01) Fig.\u00a0. Heme b:POC Fig.\u00a0. Hence, b:POC below 0.10 \u03bcmol mol\u22121 were indicative of iron-limited phytoplankton16, and similar values have been determined for field phytoplankton communities in the iron - limited post-bloom Iceland Basin35 and low-iron Southern Ocean35. In case of Irminger Basin, Louropoulou et al.36 showed heme b depletion  in a large diatom-dominated community in May-June 2014 despite relatively high iron concentrations (\u22650.30 nmol L\u22121), indicating iron limitation resulting from the high iron requirements of the extant phytoplankton population.In laboratory studies, values of heme b concentrations (<1 pmol L\u22121) and low heme b:POC ratios (<0.1 \u03bcmol mol\u22121) in the eastern and in the central Subtropical South Atlantic Gyre, which point to iron-limited phytoplankton communities in these areas. Our observations are confirmed by bioassay experiments that showed the eastern boundary of the Subtropical South Atlantic Gyre was nitrate-iron co-limited during the period of the cruise45. The good agreement between the heme b measurements and the bioassay experiments of Browning, et al.45 reinforces previous comparisons with other approaches for mapping iron-limited phytoplankton communities36 that included the dissolved iron:nitrate ratio56, modified Si* tracer59 and satellite-derived quantum yield of fluorescence \u03a6sat61. Heme b measurements thus appeared to successfully map iron limited phytoplankton by depicting the momentary condition of the phytoplankton cells in situ.In this study, we report a similar pattern of low heme b:POC data in order to investigate overall trends in Atlantic Ocean phytoplankton populations. The distribution of the heme b:POC data  and a mean value of 0.47\u2009\u00b1\u20090.42 \u03bcmol mol\u22121 (n\u2009=\u2009468). Furthermore, both the Irminger Basin and the Subtropical South Atlantic Gyre exhibited an exponential distribution and their medians (0.03 \u03bcmol mol\u22121 and 0.09 \u03bcmol mol\u22121 respectively) deviated from the median of the distribution   and heme b:POC ratios (0.37 \u03bcmol mol\u22121) compared to the eastern and central Subtropical South Atlantic Gyre. These results suggest that this area was not iron limited; indeed Rijkenberg, et al.38 reported iron concentrations up to 6.1\u2009nM\u2009in the upper 800\u2009m off shore of Brazil in the Subtropical Shelf Front (STSF), which is formed by the southward flowing Brazil Current and the norward flowing Malvinas Current62. The iron enrichment was attributed to aeolian deposition and transport by the STSF, and to offshore export of iron from Brazilian shelf waters and the Rio de la Plata river62.In contrast, the western boundaries of the Subtropical South Atlantic Gyre were characterized by slightly higher heme concentrations  do not point towards iron-limited phytoplankton communities, even though heme b concentrations were low ; we attribute this trend to low biomass at the time of sampling. In general, the location of the Intertropical Convergence Zone (ITCZ) defines the dust derived iron supply to surface waters49 and thus influences the biogeochemical status and bloom progression between the northern and the southern oligotrophic waters around the Equator64. In February-March 2011, when sampling was performed, Schlosser, et al.63 reported that the ITCZ was at \u223c1\u00b0N and the Tropical North Atlantic was receiving significant amounts of atmospheric deposition whilst the Tropical South Atlantic had low atmospheric dust concentrations. In addition, Snow, et al.64 reported increased nitrogen fixation rates due to the abundance of Trichodesmium sp. between 15\u00b0N and 7\u00b0S which have high iron requirements relative to non-nitrogen fixing phytoplankton.The heme b:POC ratio, the distribution of the population for the heme b:chl a ratio . However, we observed a contrasting behaviour in the ratios of the two iron limited areas Irminger Basin  and Subtropical South Atlantic Gyre , despite the similar trend in heme b:POC. The medians of heme b:chl a for these two areas deviated from the overall median of the distribution and located either on left (Irminger Basin) or the right  tail. Heme b exhibited the same trend for the two areas which implies that changes in chl a quotas drove the differences in the ratio. Hence, we ascribed this contrast to different extant phytoplankton groups, to different photoacclimation and nutrient status.Similar to the heme b:chl a observed in Irminger Basin implied that the heme b containing proteins of the photosynthetic apparatus decreased whilst chl a was conserved. In culture, several diatoms and prymnesiophytes exhibited decreased heme b:chl a ratio under low iron conditions (<0.50 nmol L\u22121)16 implying allocation of iron away from the hemoprotein pool16. This behaviour was considered an adaptation strategy of phytoplankton that would allow a reduction of the overall iron requirements and a more efficient utilization of the available iron in order to sustain growth16. Here, this pattern was also observed in the field in the Irminger Basin  for diatom populations that likely employed heme b regulation36 in order to adapt to declining iron concentrations during bloom progression. For example, allocating the iron away from the hemoproteins would lead to decline of the heme b-containing cytochromes b6f and b559 of the PSII apparatus28, which in turn would be accompanied by increases in the chl a:PSII ratios. Indeed this was observed by Macey, et al.65 in the post-bloom iron-limited Iceland Basin. Particularly for the eukaryotes, another strategy of reducing iron requirements is switching from nitrate to ammonium utilization68 which induces the reduction of heme b-containing nitrate reductase.The low heme b:chl a in the Subtropical South Atlantic Gyre which was driven by low concentrations of chl a in the area (SML median\u2009=\u20090.03 nmol L\u22121). Furthermore, the ratio chl a:POC was 7.68 \u03bcmol mol\u22121 (n\u2009=\u200932) in that region pointing to lower photoacclimation of the dominant phytoplankton groups. At the time of the study, haptophytes and the picophytoplankton species Synechococcus and Prochlorococcus were most dominant in the eastern parts of the gyre45. Similar community composition characterizes the Subtropical North Atlantic Gyre69. Therefore, we made a comparison of the trends in chl a:POC between these two regions; in the Subtropical North Atlantic Gyre, the chl a:POC was higher compared to the Subtropical South Atlantic Gyre reaching a median value of 65.0 \u03bcmol mol\u22121 (n\u2009=\u2009312). The contrasting behaviour in chl a:POC can be ascribed to differences in light climate, which is known to strongly influence chl a:POC ratios70. Higher light conditions in the Subtropical South Atlantic Gyre in comparison to the Subtropical North Atlantic Gyre, as a result of both higher incident irradiance during winter months71 and shallower mixed layers  pools35. The relationship between biomass and POC is also critical to the interpretation of optical parameters measured from space. Studies of interrelationships between chl a, POC and phytoplankton biomass in the Atlantic Ocean have concluded that chl a:POC ratios vary to a greater extent than C biomass:POC74, with the greater variability in chl a:POC attributed to changes in phytoplankton photophysiology driven by nutrient and light regimes. Thus in analogy, we have assumed throughout our discussion that variability between heme b, chl a and POC reported here will be more strongly influenced by physiological changes than by changes in POC composition. Further support for this assumption, or alternative methods of assessing phytoplankton biomass would be useful in future applications of heme b as an indicator of iron status in the field.Our heme b represents an important amount of the total cellular iron pool in phytoplankton (mean 18\u2009\u00b1\u200914%)75 thus the second part of our study aimed to examine to what extent the heme b field data were comparable to heme b estimated from the biogenic iron pool as predicted from a global biogeochemical model. Here we used the PISCES-v2 (Pelagic Interactions Scheme for Carbon and Ecosystem Studies volume 2) biogeochemical model to estimate the biogenic iron pool which is determined based on Michaelis Menten uptake kinetics, further regulated by a maximum iron-to-carbon (Fe:C) cellular quota and enhanced iron uptake under iron limitation78. Figure\u00a0bio) pool from the model which corresponds to sum of the diatom and nanophytoplankton iron pools extracted at the same geographic position and month as the field data. Values represent the monthly means for the upper most layer of the model (depth 10\u2009m) and ranged from 9.20 to 285 pmol L\u22121 . Although a direct comparison of the absolute values is questionable due to the large uncertainties associated with model predictions of the ocean iron cycle79, there are similar trends between the Febio and heme b abundance in the Atlantic Ocean. In particular, both parameters were highest in the subpolar North Atlantic , along the continental margins  and in the upwelling areas , whilst the lowest values were determined in the oligotrophic Subtropical South Atlantic Gyre.Both theoretical estimates and direct measurements suggest heme b accounts for between 1 and 40% of the particulate Fe (PFe) (averaging 18\u2009\u00b1\u200914%)80. We calculated the predicted heme b concentrations (in pmol L\u22121) from the modelled Febio of each station in the SML using three scenarios  1%, 18% and 40% that represent the range and mean of heme b:PFe observed in laboratory cultures. We used the formula heme b\u2009=\u2009[Febio * [heme b \u2044 PFe] lab]/100, where [heme b / PFe]lab denotes the proportion of heme b relative to PFe determined for cultured phytoplankton under various growing conditions.According to phytoplankton culture experiments with different phytoplankton species, heme b concentrations were lowest for the 1% scenario and highest for the 40% scenario  and the model-based Febio which ranged from 0.17% to 9.1% . Taken together with heme b:POC, these results suggest that, as far as heme b is concerned, field populations were comparable to laboratory observations for species with low heme b content. Furthermore, the ratio of 1% was determined in cultures where iron (0.50 nmol L\u22121) or nitrate supply had been exhausted, thus perhaps better representing the natural environment. Therefore, the model prediction of Febio and the in situ heme b concentrations were consistent with previous laboratory observations16. The differences in the proportion of heme b relative to Febio likely arose because of the microbial community composition of each region and the interspecific differences in hemoprotein processes.Predicted heme rio Fig.\u00a0 with the81. Currently, the biogenic iron pool can be assessed by radioisotope uptake experiments82, single-cell synchrotron x-ray fluorescence84 and determination of particulate iron after careful removal of or correction for lithogenic iron87. Whilst all these techniques provide complimentary and useful information on particulate iron, single cell iron-to-phosphorus ratios or community wide Fe:C uptake rates, none provide a definitive estimate of average in-situ biogenic iron quotas within phytoplankton populations. Furthermore, none of the above methods were applied consistently on larger scale field expeditions. The good agreement of heme b observational and model-based data suggests that heme b could potentially serve as an indicator of the biogenic iron for field studies and provide an assessment of the proportion of iron used in the heme b and the hemoprotein pools in marine phytoplankton, although further comparison of heme b abundance with established methods of assessing biogenic iron are required.Biogenic iron and iron-to-carbon (Fe:C) ratios are critical for linking the iron and carbon cycles in the ocean and constraining phytoplankton iron requirements within biogeochemical modelsb:POC can serve as a reliable indicator of iron limitation since it appeared not to be influenced by species- specific processes which potentially involve modifications in the hemoprotein and/or other protein pools. A comparison of the heme b method with already established protocols, such as bioassay experiments88 and iron-stress biomarkers 90, would validate this simple method for mapping iron limited phytoplankton in small or large scale field expeditions. Although determination of heme b in marine particulate material requires specialist analytical instruments, sample collection is straightforward and utilises the same approaches routinely applied for collection of pigment samples. Importantly, sampling for heme b does not require trace metal clean conditions, significantly widening the potential for assessment of iron limitation in the field. Furthermore, heme b is a ubiquitous biomolecule and is thus not dependent on the presence of particular phytoplankton species.In this study, we suggest that the ratio heme b to biomass ratios suggested that phytoplankton 1) employ diverse mechanisms to utilize the available iron in the hemoprotein pool, and 2) are able to regulate the hemoproteins under iron limiting conditions. Expanding the field and laboratory research in hemoprotein abundance and cycling would contribute to the identification of such iron utilization and regulation strategies. One aspect could be the transcriptomic and proteomic analyses of biomolecules involved in the heme b cycling pathways. These include the proteins associated with the utilization of the heme b cofactor, such as the components of the photosynthetic or nitrate assimilation apparatus, as well as the components of the biosynthesis and breakdown pathways. The information about iron-utilization in hemoproteins and about regulation of the hemoprotein pool would shed light on the molecular response and adaptation of phytoplankton to iron limitation. This information will be particularly useful in the future due to projected alterations in desert dust supply91 and thus, to iron availability in the ocean, with potential impacts on carbon sequestration and climate. Finally, application of the heme b method in oceanic regions other than the Atlantic Ocean would enhance the estimates of the magnitude of the biogenic iron pool and expand our knowledge on phytoplankton physiological status in relation to iron.The variability of the heme b, POC and chl a. We sampled 279 stations and 4 to 6 different depths per station  in order to study heme b abundance in the Atlantic Ocean.During all research cruises sampling of seawater was performed by a stainless steel CTD rosette equipped with Niskin bottles for the determination of heme b. The filters were stored at \u221280\u2009\u00b0C prior to analysis. Heme b was quantified by High Performance Liquid Chromatography (HPLC) \u2013 Diode Array Detection (DAD) \u2013 Electrospray Ionisation (ESI) Mass spectrometry (MS) after extraction by 2.5% w-v Octyl \u03b2-D-glucopyranoside-OGP solution 92. Regarding the analytical procedure and the instruments used, we followed the protocol described by Gledhill (2007) for the samples from the CD173 cruise and Gledhill (2014) for the samples from cruises D346, D361 and M124. Good agreement was obtained between the two analytical methods92. Slight modifications were applied to the analysis of the samples from GEOVIDE and M121 as described in Louropoulou et al.36.Marine particulate material (>0.7 \u03bcm) was collected after filtration of seawater on glass fiber filters  for the determination of heme b for D346, D361, GEOVIDE, M121 and M124 was performed from the MS data on a m/z ratio of 616.122, since the PDA detector is known to have interferences from other pigments co-eluting with heme b and absorbing at a wavelength of 401 nm92. The analytical detection limits were defined as three times the standard deviation of the lowest calibration standard for each of the methods followed and were 1.57\u2009nM (CD173), 190 pmol heme b L\u22121  and 32 pmol heme b L\u22121 (GEOVIDE and M121). Heme b could not be detected in the blank extraction solution in either utilised method.Quantification of heme 2SO3  or with hydrochloric acid - HCl (GEOVIDE) for the removal of inorganic carbon following published protocols94. POC in samples and several blank filters was quantified by elemental NC analyser using acetanilide as the calibration standard93.Seawater was filtered through pre-combusted GF/F for the determination of POC and acidified either with sulphurous acid - Ha was determined for the cruises CD173, D346, D361 and M124 via fluorometry after extraction with 90% (v:v) acetone in the dark95. For the GEOVIDE and M121 cruises, chlorophyll a was determined after extraction with 100% methanol and sonication followed by High Performance Liquid Chromatography quantification96.Chlorophyll 97 . The SML was calculated from the CTD data (obtained by sensors on the rosettes) using the temperature-based criterion (\u0394T\u2009=\u20090.5\u2009\u00b0C)98. We checked the normality of the data distribution by applying the Shapiro-Wilk test which showed a non-normal distribution for all parameters (p\u2009<\u20090.05). Hence, we used the Kruskal\u2013Wallis test for analysis of variance, the Wilcoxon rank sum test to identify differences in the distributions in and below the SML and the Spearman\u2019s rank correlation to check the association between parameters. Surface and section plots were produced using the Ocean Data View99 v.4.7.9 .Data processing, statistical analysis and visualization were carried out using R Statistical SoftwareSupplementary information."}
+{"text": "Amphimerus sp. is a fluke that dwells in the biliary tracts of vertebrate definitive hosts including humans, domestic, and wild mammals in Latin America. Opisthorchiid liver infections are rarely studied in the Americas confirming its status as a neglected tropical disease. In Ecuador, small trematode eggs were reported in human cases from the province of Manab\u00ed in 1949, and recently, Amphimerus sp. adults were recovered from human and reservoir hosts in the province of Esmeraldas. Due to the lack of research on the infectious sources of Amphimerus sp. in the continent, we have developed a series of epidemiological studies with parasitological and molecular techniques to elucidate the endemicity of opisthorchiid fluke infections. We developed a cross-sectional study in three communities at Pedro Pablo G\u00f3mez parish in the province of Manab\u00ed, Ecuador. We examined a total of 176 fecal samples to detect opisthorchiid eggs, and four fish species to find opisthorchiid metacercariae. To study adult worms, we treated and purged seven patients in a family and dissected the livers of a dog and a cat infected. We observed morphological features of adults and metacercariae and used polymerase chain reaction with restricted fragment length polymorphism (PCR-RFLP) and DNA sequencing of a section of the ITS2 gene for identification. Small trematode eggs were detected in 63 (35.8%) out of 176 fecal samples of residents in the three study sites. Adult opisthorchiid flukes were recovered from human patients, a dog and a cat, and they were morphologically and molecularly identified as Amphimerus sp. Opisthorchiid metacercariae were also identified molecularly as Amphimerus sp. in four fish species, i.e., Rhoadsia altipinna, Bryconamericus bucay, Andinoacara rivulatus, and Piabucina aureoguttata. Metacercariae of the heterophyid Haplorchis pumilio were also found in the four fish species examined. This is the first study to confirm the current endemicity of Amphimerus sp. in Pedro Pablo G\u00f3mez, Manab\u00ed, Ecuador. The adult worms isolated here shared morphological characteristics with previous Amphimerus sp. descriptions and were molecularly similar to Amphimerus sp. described in the province of Esmeraldas. Moreover, this study is the first to document four fish species as infection sources of Amphimerus sp. detected via a molecular protocol targeting the metacercariae of the parasite. Fish species identified here should be targeted for public health campaigns to avoid further human liver-fluke infections by Amphimerus sp. or potential intestinal-fluke infections by H. pumilio or others. Amphimerus, family Opisthorchiidae, has been found in the biliary ducts of humans, cats, and dogs, in the northern province of Esmeraldas. Reports as old as 1949 document opisthorchiid infections in the coastal province of Manab\u00ed. Given a lack of studies elucidating the infective larval stage of these flukes in Ecuador, we decided to conduct parasitological and molecular experiments to characterize the presence of these human liver infections in the area. We found adult Amphimerus sp. flukes in humans and other domestic animals, and its metacercariae in four edible freshwater fish species: Rhoadsia altipinna, Bryconamericus bucay, Andinoacara rivulatus, and Piabucina aureoguttata. Moreover, we found a prevalence of 35.8% of small trematode eggs in humans. Finally, we also found the metacercariae of the intestinal fluke Haplorchis pumilio in all fish species examined. Our findings confirm the area of Pedro Pablo G\u00f3mez as an endemic region for opisthorchiid liver infections due to Amphimerus sp., and expand the human differential diagnosis of small trematode eggs to liver and intestinal flukes. Consumption of undercooked freshwater fish of the species identified here could lead to Amphimerus sp. infections. Surveillance in other areas known for raw fish consumption would likely unveil new cases of foodborne trematodiases in Ecuador and other regions.Among neglected tropical diseases, foodborne trematodiases rank among the least studied, especially in the Americas. In Ecuador, a parasite of the genus  Clonorchis sinensis, Opisthorchis viverrini, O. felineus, and Fasciola spp., causing liver fluke infections; Haplorchis spp., Metagonimus spp., Echinostoma spp., and others, causing intestinal infections; and Paragonimus spp., causing lung fluke infections . Th. Th27]. p = 0.05.In each of the three communities, we met with the local people, explained the study goals, and obtained written agreement for participation by the leaders during August 2017. One fecal sample was collected from each local resident above one year old without other restriction criteria. We delivered a plastic flask filled with 70% ethanol labeled with their names, age, gender, and community. We collected samples during the next three days by visiting participants house by house. Flasks were transported to the Centro de Biomedicina at the Universidad Central del Ecuador. For coproparasitological diagnosis, we used the formalin-ether concentration method (Ritchie\u2019s technique), as recently described . In brieEggs from the families Opisthorchiidae and Heterophyidae measuring <30 \u03bcm in length have been labeled as small trematode eggs because their morphological similarities prevent detailed discrimination via light microscopic diagnosis \u201319. HumaOne liver of a cat and one from a dog were examined for liver flukes, both animals coming from the communities studied. According to the owners, the cat had died of an unknown disease, and the dog had drowned; we obtained owners' permission to obtain samples from the deceased animals. Livers were immersed in saline solution, sliced in sections to identify bile ducts, and compressed. One entire family of egg-positive human cases agreed voluntarily to be treated with praziquantel  and purgAstroblepus spp.). Fish were transported to the laboratory facilities in Quito in cooler cages at 4\u00b0C.Freshwater fish were purchased from local residents of each community; they collect fish using casting nets, and eat them as a source of protein. Fishes were divided by morphology, and identified at species level using publicly available taxonomic keys of Ecuadorian freshwater fish ,33 with Fish of the same species were digested artificially to recover live metacercariae ,34,35. BHind III , which targets a specific region of ITS2. The enzyme digestion was performed using 10 \u03bcl of PCR amplicons with 5 U of Hind III for one hour at 37\u00b0C. Digested/undigested PCR products were run in electrophoresis agarose gels (2% w/v) to discriminate fragments; we included DNA from adult Amphimerus sp. from Esmeraldas [Amphimerus sp. sequences (GenBank accession Nos.: AB678442 and AB926430).Given the morphological similarities of metacercariae of the Opisthorchiidae and Heterophyidae ,35 and tmeraldas  as positWe collected and analyzed 176 fecal samples from individuals of the three communities. Small trematode eggs were found in 63/176 (35.8%) samples. Among positives individuals, age ranged from 1 to 83 years  = 22.9), with a female/male ratio of 1:1.04 . No statistical association existed between age or gender and presence of small trematode eggs . No statAmphimerus sp. (see below). Sequences of amplified digested products aligned with those previously identified as Amphimerus sp. in Ecuador (GenBank accession Nos.: LC490158-161). We did not find other trematodes in human stools or the intestines of the dog and cat.We isolated 18 and 45 adult flukes from biliary ducts of the dog and cat livers respectively. In all cases, worms of ~10 mm length had bilateral, ungrouped vitelline glands, divided at the level of the ovaries into anterior and posterior sections. Vitelline glands were distributed beyond the round, partially lobed testes, reaching the posterior end of the adult fluke body . From thRhoadsia altipinna , Bryconamericus bucay , Andinoacara rivulatus , and Piabucina aureoguttata  and 140 bps  following the pattern of adult flukes of Amphimerus sp. isolated in Esmeraldas and those isolated in PPG (Amphimerus sp. by this method (Amphimerus sp. isolated from the dog and the cat in this study (GenBank accession Nos.: LC490160-LC490162) with two nucleotide differences with sequences previously published [Hind III and divided into two fragments with different sizes from those of Amphimerus sp. , trematodes of the Heterophyidae family.In total, we separated 101 individual metacercariae for molecular diagnosis from the fish species examined belonging to each of the three communities . Moleculd in PPG . We founs method . We sequublished ,14, and erus sp. , namely,245710.1 ) and CenAmphimerus sp., we propose the following characteristics as guide for identification: an encysted, oval-shaped metacercaria with a mean size of 179.9 \u03bcm  by 125.4 \u03bcm ; a round, prominent, and easily identifiable ventral sucker ; and an oval to round dark excretory bladder  and Wallace (1939) [H. pumilio metacercariae sequenced, finding a mean size of 181.8 \u03bcm  by 140.3 \u03bcm , without a visible ventral sucker  with an either apparent or unapparent ventral sucker (From examination of the metacercariae identified molecularly as  bladder . These fe (1939) . For coml sucker . Metacerl sucker .O. guayaquilensis, posterior taxonomic classifications agreed that the specimens belonged to the genus Amphimerus [Amphimerus sp. from feces of humans and bile ducts of naturally infected domestic animals, whose DNA sequences match those of Amphimerus sp. from the province of Esmeraldas, ~325 km north of the present study sites , we surlsewhere ,25.P. aureoguttata is a fish that spends its time on river bottoms, and is therefore missed if fish are captured with casting nets  [Amphimerus . We suggest that a two nucleotide difference in the 459 bps sequence section of ITS2 might be a signal of intraspecific variability that should be examined in detail; therefore, we assert that the species status of this parasite is still unresolved and needs further investigation using sensitive molecular and genomic tools [As mentioned earlier, Rodr\u00edguez et al. reported the causative agent of liver-fluke infections in humans and dogs in the area as  in 1949 . Howeverfelineus , and latilensis) . The eviphimerus . Our fine testes , which pic tools ,14,42,48Amphimerus sp. [H. pumilio identified in the four fish species and throughout the studied communities  recently found evidence of ma, Peru . The invte hosts . P. genaate host ; researcAmphimerus sp. life cycle  [The high prevalence of small trematode eggs in the human population of the three communities reported here may still be an underestimate considering the low sensitivity of small trematode egg detection using the formalin-ether concentration technique and one-time fecal sample examination, as we have shown recently . The Kat snails) \u201323,54.Amphimerus sp.) and intestinal flukes  could prompt development of public health education campaigns regarding safe food practices and sanitation, with multisectorial involvement including research groups, community members, and relevant government sectors for effective monitoring, surveillance, and control [O. viverrini infections among the communities of Khon Kaen Province by putting together, among others, human chemotherapy with praziquantel, installation of latrines, and health education targeting behavioral changes on fish intake [Amphimerus sp. in Ecuador. Open research questions regarding this system include (1) determination of whether infections with Amphimerus sp. play a role in development of clinical manifestations in human cases  documentation of the potential geographic ranges of liver fluke infections in Ecuador and other American countries.Understanding the life cycle of zoonotic helminths is paramount to guiding interventions. Recognition of these local fish as a source of metacercariae of liver , (2) idS1 File(PDF)Click here for additional data file."}
+{"text": "Can occult peritoneal metastasis be accurately assessed before surgery and without any invasive intervention?In this cohort study of 1978 patients, a deep neural network, the Peritoneal Metastasis Network, was developed for predicting occult peritoneal metastasis in gastric cancer based on preoperative computed tomography images. The model had excellent discrimination in external validation and substantially outperformed clinical factors.The proposed deep learning model may be useful in preoperative treatment decision-making for avoiding unnecessary surgery and complications in certain patients. Occult peritoneal metastasis frequently occurs in patients with advanced gastric cancer and is poorly diagnosed with currently available tools. Because the presence of peritoneal metastasis precludes the possibility of curative surgery, there is an unmet need for a noninvasive approach to reliably identify patients with occult peritoneal metastasis.To assess the use of a deep learning model for predicting occult peritoneal metastasis based on preoperative computed tomography images.In this multicenter, retrospective cohort study, a deep convolutional neural network, the Peritoneal Metastasis Network (PMetNet), was trained to predict occult peritoneal metastasis based on preoperative computed tomography images. Data from a cohort of 1225 patients with gastric cancer who underwent surgery at Sun Yat-sen University Cancer Center  were used for training purposes. To externally validate the model, data were collected from 2 independent cohorts comprising a total of 753 patients with gastric cancer who underwent surgery at Nanfang Hospital  or the Third Affiliated Hospital of Southern Medical University . The status of peritoneal metastasis for all patients was confirmed by pathological examination of pleural specimens obtained during surgery. Detailed clinicopathological data were collected for each patient. Data analysis was performed between September 1, 2019, and January 31, 2020.The area under the receiver operating characteristic curve (AUC) and decision curve were analyzed to evaluate performance in predicting occult peritoneal metastasis.A total of 1978 patients  were included in the study. The PMetNet model achieved an AUC of 0.946 , with a sensitivity of 75.4% and a specificity of 92.9% in external validation cohort 1. In external validation cohort 2, the AUC was 0.920 , with a sensitivity of 87.5% and a specificity of 98.2%. The discrimination performance of PMetNet was substantially higher than conventional clinicopathological factors . In multivariable logistic regression analysis, PMetNet was an independent predictor of occult peritoneal metastasis.The findings of this cohort study suggest that the PMetNet model can serve as a reliable noninvasive tool for early identification of patients with clinically occult peritoneal metastasis, which will inform individualized preoperative treatment decision-making and may avoid unnecessary surgery and complications. These results warrant further validation in prospective studies. This cohort study assesses the use of a deep learning model for predicting occult peritoneal metastasis based on preoperative computed tomographic images in patients with gastric cancer. However, because of cost-effectiveness concerns, routine staging laparoscopy is not being universally used, especially in East Asia.8 Therefore, an unmet need remains for accurate and sensitive prediction of occult peritoneal metastasis using a noninvasive means.Computed tomography (CT) is the most widely used imaging modality for diagnosis of peritoneal metastasis. Certain CT features, such as omental cake, large ascites, and peritoneal thickening, may be used to diagnose the presence of peritoneal metastasis. However, these classic signs typically appear at a late stage, and tumor implants less than 1 cm are often missed, resulting in a low sensitivity of 28.3% to 50.9%.11 These techniques have demonstrated excellent diagnostic performance in a variety of clinical applications.14 Recently, deep learning has been used to predict response and survival outcomes after adjuvant chemotherapy in GC.11 We developed a deep learning model, the Peritoneal Metastasis Network (PMetNet), to predict clinically occult peritoneal metastasis using preoperative CT in patients with GC.Deep learning, in particular, convolutional neural networks, has emerged as a powerful technique for extracting subtle information from medical images.TRIPOD) reporting guideline. The institutional review board at each participating center  approved this study. Patient informed consent was waived given the retrospective design, and all data were deidentified.In this multicenter, retrospective cohort study, we collected clinicopathological and image data from 1978 patients with AGC who were consecutively treated at 3 hospitals . The traAll patients received open (1048 [53%]) or laparoscopic (930 [47%]) surgery. The inclusion criteria were histologically confirmed GC, standard unenhanced and contrast-enhanced abdominal CT performed less than 30 days before operation, complete clinicopathological data, no combined malignant neoplasm, and CT images obtained before operation. We excluded 273 patients who had stage T1 tumors given a low risk of peritoneal metastasis in early-stage disease or whose primary tumor could not be identified at CT as well as patients who had received previous anticancer therapy before surgery (such as neoadjuvant chemotherapy).Preoperative staging for most patients enrolled in this study was based on CT images, and only a small proportion of patients (<10%) underwent endoscopic ultrasonography, positron emission tomography, or staging laparoscopy before surgery. All patients\u2019 peritoneal metastasis statuses were initially diagnosed as negative by a radiologist\u2019s interpretation of the CT images. During surgery, the patient\u2019s peritoneum was carefully evaluated by the surgeons. For patients who had peritoneal metastasis suggestive of cancer, samples of their peritoneal implants or ascites were sent for pathological or cytological examination. The presence of peritoneal metastasis was identified according to the American Joint Committee on Cancer guidelines by consensus between the pathologists and surgeons.Baseline clinicopathological data, including age, sex, preoperative differentiation status, Lauren type, carcinoembryonic antigen, and cancer antigen 19-9, were collected from medical records. The clinical characteristics of the 1978 patients are listed in 15 Both radiologists (C.C. and Q.Y.) were blinded to the clinical and histopathological data but were aware that the patients had GC. Any discrepancy was resolved by a third radiologist . The reason for including tumor delineation was to ensure that the deep learning network\u2019s attention was focused on the most relevant part of the image for prediction purposes. This network has been shown to outperform networks that are trained without the tumor mask.11All patients underwent contrast-enhanced abdominal CT before surgery. Portal venous-phase CT images were retrieved from the Picture Archiving and Communication System (Carestream). Details regarding the CT acquisition parameters and image retrieval procedure are presented in the eMethods in the 2 in the CT slice that contains the largest area of the primary tumor along with its segmentation mask. The network output is the probability of occult peritoneal metastasis.We proposed a densely connected convolutional network combined with long-short connections (DCCN-LSC) to predict peritoneal metastasis based on CT image  . The codP\u2009<\u2009.05 were selected as independent predictors in the multivariable model. We then built a nomogram with the combined PMetNet signature and clinical features based on the multivariable logistic regression. The prediction model was validated by measuring the discrimination and calibration using bootstrapping with 1000 times of resampling. Calibration plots were used to graphically represent the agreement between the predicted and actual probability of occult peritoneal metastasis. A decision curve analysis was performed to evaluate the model\u2019s clinical usefulness by quantifying the net benefit at various threshold probabilities.17We assessed the associations between clinical characteristics and peritoneal metastasis using univariate analysis. Multivariable logistic regression was applied to select independent predictors of peritoneal metastasis. Variables that achieved a predefined statistical significance at 2 test or the Fisher exact test, as appropriate. The area under the receiver operating characteristic curve (AUC) was also used to measure discriminative ability of the prediction models. Nomograms and calibration plots were generated using the rms package of R software, version 3.5.1 . Statistical analyses were performed with R software, version 3.5.1 and SPSS, version 21.0 (IBM Corp). All statistical tests were 2 sided with a significance level of P\u2009<\u2009.05.Differences in distributions between the variables examined were assessed with the unpaired, 2-tailed \u03c7A total of 1978 patients  were included in the study. The clinicopathological characteristics for the training cohort (n\u2009=\u20091225), external validation cohort 1 (n\u2009=\u2009504), and external validation cohort 2 (n\u2009=\u2009249) are listed in We proposed a novel end-to-end deep neural network, PMetNet, to predict occult peritoneal metastasis of a patient based on CT image. The deep learning model, PMetNet, accurately predicted occult peritoneal metastasis in the training cohort. Receiver operating characteristic curve analysis showed that the AUC was 0.955 . The model achieved a sensitivity of 83.7% at a high specificity of 92.8% for predicting the presence of peritoneal metastasis .For validation, the PMetNet model had a similar prediction performance in the 2 external validation cohorts, with AUCs of 0.946  in external validation cohort 1 and 0.920  in external validation cohort 2. With the same cutoff, the model showed sensitivities of 75.4% and 87.5% and specificities of 92.9% and 98.2% in the 2 external validation cohorts, respectively. Of note, the model had high negative predictive values of 97.9% in the training cohort, 90.9% in external validation cohort 1, and 98.2% in external validation cohort 2 .The discrimination performance of PMetNet was substantially higher than conventional clinicopathological variables in all 3 cohorts  . On multThe decision curve analysis showed that, for a wide range of threshold probabilities from 5% to 75%, using the PMetNet to predict occult peritoneal metastasis provides additional clinical benefit compared with the intervention-for-all and intervention-for-none strategy as well as common clinicopathological variables , such a model could be used to identify more patients with clinically occult peritoneal metastasis, which might otherwise be missed by the radiologist.To our knowledge, this cohort study is the first and largest (nearly 2000 patients) study to use deep learning for the prediction of occult peritoneal metastasis in patients with GC. Peritoneal metastasis is a major pattern of metastatic spread in GC and represents an incurable disease with a poor prognosis.22 have developed radiomics-based signatures to predict peritoneal metastasis. However, this approach relies on handcrafted definition of specific features, which is biased by developer experience and may miss important information contained in the image. Compared with a recent radiomics study,20 the model in this study achieved consistently better diagnostic performance with higher AUCs, sensitivity, and specificity, confirming the power of the deep learning approach. Importantly, this study included only patients with clinically occult peritoneal metastasis. The sensitivity of PMetNet may be higher when considering all patients with peritoneal metastasis.6Several recent studies24 Taken together, these results demonstrate that deep learning based on CT images can be used to uncover subtle relations between tumor characteristics and metastatic potential.To gain insight into how the deep learning network produced an output, the study used Grad-CAM to provide visualization of what regions were highlighted on the original CT images. By examining the network visualization for thousands of patients, the class activation map was found not to be uniform and only certain intratumoral regions were activated . This fiThis study found that among traditional clinical risk factors, the only consistent predictor of peritoneal metastasis across 3 cohorts was Lauren type. However, combining clinical variables with the imaging model did not significantly improve the results over imaging alone. This finding suggests that the risk of occult peritoneal metastasis is mainly contained in the primary tumor. This suggestion reaffirms the approach of incorporating the tumor mask into the deep learning network, which allows its attention to focus on the most relevant region for prediction.The current study is focused on patients who underwent resection but did not receive any systemic therapies before surgery. In future work, it will be interesting to test whether the proposed deep learning model will identify peritoneal disease in patients who have been treated with neoadjuvant chemotherapy, which is the standard treatment for local AGC in the US. In addition, imaging may be combined with other complementary data, such as blood and serum biomarkers, to further enhance the prediction accuracy.This study has limitations, the main one being its retrospective nature, although the study included patients from 3 different institutions to assess its reproducibility. The study was focused on patients with GC in Asian populations, and differences exist in the prevalence and presentation of disease for patients in Western countries, whose cancers tend to be diagnosed at more advanced disease stages. Therefore, the model\u2019s performance in different ethnic groups should be further evaluated. In addition, CT images were collected from several scanners, and acquisition parameters varied. The model\u2019s generalizability across diverse populations and scanners should be rigorously tested. Because the network requires tumor contour with manual delineation, robust automated segmentation tools should be developed to reduce interobserver variation. Given the low image contrast and extensive anatomical variations in GC, fully automated tumor segmentation with high accuracy and consistency remains a challenging task, even with state-of-the-art deep learning approaches. Further investigation and development of more robust segmentation methods are needed. The current model is based on 2-dimensional imaging as an input. Future models incorporating 3-dimensional imaging might further improve performance.Finally, the deep learning model\u2019s specificity is not perfect, with a false-positive rate of 2% to 7%. Currently, this model cannot be used alone to exclude patients who might be eligible for curative surgery. For clinical applications, it will be crucial to integrate information from investigations of other modalities, such as endoscopic ultrasonography and/or laparoscopy, to improve the specificity and sensitivity for the diagnosis of occult peritoneal metastasis.These findings represent an important step forward in the accurate prediction of occult peritoneal metastasis by applying advanced deep learning techniques. If validated in prospective studies, the PMetNet model could serve as a useful approach for the noninvasive prediction of occult peritoneal metastasis and may inform individualized surgical management of GC."}
+{"text": "Streptococcus (S.) suis is a major porcine pathogen causing high morbidity worldwide. This includes well-managed herds with high hygiene standards. In Europe, no licensed vaccine is available. As practitioners are obliged to reduce the use of antibiotics, autogenous S. suis vaccines have become very popular in Europe.S. suis publications are reviewed that include important data on epidemiology, pathologies and bacterin vaccination relevant for the use of AV in the field. Differences between herds such as the porcine reproductive and respiratory syndrome virus infection status and the impact of specific S. suis pathotypes are probably highly relevant for the outcome of immunoprophylaxis using autogenous S. suis bacterins. Thus, a profound diagnosis of the herd status is crucial for management of expectations and successful implementation of AV as a tool to control S. suis disease. Induction of opsonizing antibodies is an in vitro correlate of protective immunity elicited by S. suis bacterins. However, opsonophagocytosis assays are difficult to include in the portfolio of diagnostic services.Autogenous vaccines (AV) are generally neither tested for safety, immunogenicity nor protective efficacy, which leads to substantial uncertainties regarding control of disease and return on investment. Here, S. suis bacterins are associated with limitations and risks of failure, which can partly be managed through improvement of diagnostics.Autogenous  Streptococcus (S.) suis. Different proteins of S. suis have been expressed as recombinant antigens in Escherichia coli and used after purification as vaccination antigens in challenge trials with mice or pigs . As the pressure for reduction of the use of antibiotics in veterinary medicine increases in Europe, autogenous S. suis vaccines have become a main tool in porcine practice. However, it is hoped that licensed vaccines will become available to combat S. suis disease burden. This review is based on the current scientific S. suis literature and the authors\u2019 experience with diagnostic services, experimental S. suis infections and many years of consultation of practitioners with the objective to improve the use of autogenous S. suis vaccines.Worldwide, numerous research groups work on the identification of protective antigens of view see ). HopefuS. suis is a very diverse pathogen. Currently 29 confirmed serotypes are described for this species [S. suis serotype 2 is most frequently isolated from clinical cases of S. suis disease [S. suis strains from 7 European countries isolated from diseased pigs between 1991 and 1997. Thirty-two percent (n\u00a0=\u2009132) and 20% (n\u00a0=\u200984) of the strains belonged to serotypes 2 and 9, respectively. However, serotype 9 has become the most prevalent serotype among invasive isolates in some European countries with a large pig industry such as the Netherlands and Spain [S. suis strains isolated between 1996 and 2004 and 2015\u20132016 in Germany and recorded a reduction of cps2 strains  among invasive isolates from 44.3 to 23.5%, respectively. The authors speculate that the increased use of autogenous vaccines (AV) in recent years led to this reduction. Furthermore, reduction of serotype 2 cases through AV may have paved the way for serotype 9 emergence as discussed by B\u00fcttner et al. [ disease . Wisseli disease  serotypeent n\u00a0=\u200912 and 20%20% n\u00a0=\u20098 of the snd Spain  comparedent n\u00a0=\u200912 and 20%S. suis isolates [epf, mrp and sly encoding the extracellular factor, the muramidase-released protein and the hemolysin suilysin, respectively [Very different strains may belong to the same serotype. This is well known for serotype 2 harboring highly virulent, moderately virulent and strains considered avirulent based on the results of epidemiological studies and experimental infections \u201310. Receisolates . Furtherisolates . Virulenectively , 9, 13.S. suis strains and a large online database is available which allows to determine the sequence type (ST) of a S. suis isolate after sequencing 7 housekeeping genes (https://pubmlst.org/ssuis) [S. suis diseases in Europe [Various laboratories have used multilocus sequence typing (MLST) to compare g/ssuis) . Closelyn Europe . Whereasn Europe , 14. Basn Europe . HoweverS. suis genotypes among geographical regions. Important examples are the high prevalence of virulent mrp+\u00a0epf+ sly+\u00a0cps2 strains of CC1 and of mrp* cps9 of CC16/CC87 in Europe in contrast to the situation in North America, where S. suis cps2 strains of CC25 and CC28 are dominating among invasive isolates [cps7) strains of ST29 in Germany [S. suis serotypes and sequence types suggest that there are also important differences between European countries, though piglets are frequently transported from one country to another. Regarding the complex epidemiology of S. suis diseases, the number of sequence-typed strains in Europe is still rather low. A systematic unbiased typing of invasive isolates from various European countries has not been conducted to date. For a more comprehensive review of the prevalence and geographical distribution of S. suis sequence types/CCs we refer the reader to Goyette-Dejardins et al. [There are very important differences regarding the prevalence of isolates , 10. Howisolates . Furtherisolates , which iisolates . We rece Germany . Thus, ts et al. .cps2 strains of CC28 [cps typing and MLST might not be sufficient to estimate the virulence potential of a strain which adds to the complexity of profiling biologically relevant S. suis genotypes. However, in many cases, determination of the serotype and the ST is sufficient to identify a virulent S. suis pathotype [Interestingly, it was recently shown that there are differences in virulence among  of CC28 . This imathotype .S. suis isolates are genotyped by diagnostic services for practitioners on a large scale in various European countries such as Germany and Austria, investigations on putative differences in the prevalence of S. suis genotypes between herds and different pig lineages within a country, have not been published to the best of our knowledge. This is however highly relevant for herd management and the use of AV.Although S. suis herd problem, thorough clinical examinations of different affected animals and proper sampling of sites of infection during necropsies of sacrificed animals is highly recommended. In most piglets with central nervous system disorders due to S. suis meningitis bacteriological investigations of brain swabs and/or cerebrospinal fluid will generate unambiguous results as long as the piglet was not treated with antibiotics prior to sampling. Appropriate samples in case of a septicemic animal are internal organs such as spleen and liver. Legislature restricts necropsies on farms in some European countries. In Germany for example, the animal by-products disposal law (\u00a710) generally prohibits the skinning, opening and cutting of animal carcasses on farms. Thus, if necropsies are not an option, cerebrospinal fluid (CSF) and heparinized blood are in our experience excellent samples for bacteriological investigations of animals with a suspected diagnosis of S. suis meningitis and septicemia, respectively. Sufficient anesthesia is the least requirement for a CSF aspirate. However, for animal welfare reasons we recommend sacrificing piglets with central nervous system disorders for sampling of CSF. To avoid transporting the carcasses long distances to the nearest pathological examination facility, these samples may be obtained from animals at the respective farm. For detection of S. suis bacteremia heparinized blood might be directly streaked on Columbia blood agar plates. This is a convenient approach to screen numerous piglets without clinical signs of disease but elevated body temperature for S. suis bacteremia. Although it is not in accordance with the classical microbiological blood culture, we have successfully used this method over many years to obtain invasive S. suis isolates from live animals.In case of clinical signs that raise the suspicion of a S. suis are very often among the contaminating bacteria. Contaminations might also easily occur in the case of swabs taken from the bicuspid and tricuspid valves. The heart should be opened with a new sterile pair of scissors to prevent these contaminations. In case of arthritis, removal of hair and subsequent thorough sterilization of the skin or even removal of the skin should be conducted prior to sampling of the joints. Isolates of such samples can generally be regarded as invasive as these sites are sterile in healthy animals. However, this is not the case for isolates obtained from samples of the respiratory tract as S. suis colonizes the upper respiratory tract of piglets physiologically in high numbers. S. suis isolates from lung samples collected in necropsies conducted hours after an animal\u2019s death are not necessarily related to the disease of the animal. Including these isolates in an AV should be carefully evaluated.Piglets that have been found dead might also be investigated but care should be taken with regard to post-mortem contamination, especially of the liver and peritoneal swabs. Alpha hemolytic streptococci including S. suis genotypes and of S. suis infections of herds occurring intermingled with Glaesserella (G.) parasuis (Haemophilus parasuis) infections. In our opinion the number of investigated animals should not be less than 4 (better 6) and investigations should be repeated at an additional time point if feasible  to give a justified claim on the role of predisposing factors in this herd as isolation of multiple different genotypes indicates strong predisposition (see below), (ii) to manage expectations as protective efficacies of cps9 bacterins are generally lower than of cps2 bacterins (see below), (iii) to detect new infections in the herd related to S. suis patho\u2212/genotypes not included in an AV generated in the past and (iv) to relate one\u2019s own experience with specific compositions of autogenous bacterins.One could argue that an AV should include all invasive S. suis isolates via multiplex (MP) PCRs has become a very important diagnostic service in Europe and is offered by numerous laboratories using different protocols [cps1, cps2, cps7 and cps9 as well as the virulence markers mrp, epf and sly [gdh and arcA were included to confirm the putative diagnosis of S. suis [. MP-PCRs used for profiling of S. suis isolates do not allow reliable detection of large variants of epf [epf monoplex PCR should be conducted to identify strains with variants of the epf genes (designated epf*) encoding extracellular factors (EF*) larger than the 110\u2009kDa EF [mrp and epf through additional PCRs might also be used for fine typing of S. suis strains belonging to cps1, cps2, cps7 and cps9 [mrp+\u00a0epf* sly+\u00a0cps2+ is biologically relevant as this pathotype is considered to be moderately virulent in comparison to highly virulent mrp+\u00a0epf+\u00a0sly+\u00a0cps2 and experimentally avirulent mrp- epf- sly- cps2 strains in Europe [S. suis studies have been published since this original work by Vecht et al. [For the reasons mentioned above, typing of virulence-associated genes of rotocols , 7, 23.  S. suis , 25. MP-0\u2009kDa EF . Differeand cps9 , 27, 28.n Europe . Althougmrp, epf and sly have been used for numerous years by diagnostic services in Central Europe as virulence markers. However, there are other virulence markers that might be used as well. Differentiation of putative pilus gene clusters as described by Takamatsu et al. [srtBCD plus srtF and srtF plus srtG genotypes are associated with virulent strains of CC1 and CC27, respectively. Furthermore, other genes such as the gene encoding surface antigen one (SAO) harbor repetitive sequences and show size variations in S. suis which might be used for PCR-based typing of S. suis isolates similar to mrp and epf typing [The genes u et al.  is a furf typing , 31 .cps operons via PCR is generally in accordance with serotyping, but important deviations are known. As pointed out in various previous publications [cps2) using diagnostic services based on virulence-associated gene profiling. As a consequence, only one serotype might be included in the AV. To overcome this restriction, differentiation of serotype 2 and 1/2 via serotyping or cpsK sequencing is recommended [S. suis research has focused very much on serotype 2 and has to some extent covered also serotypes 9, 7 and 1. Information on other serotypes except for data on their prevalence is not available.Differentiation of ications , 7, 23 sommended . Whethercps1, cps2, cps7 and cps9 as well as the virulence-associated factors mrp, epf and sly allow identification of important pathotypes such as mrp+\u00a0epf+\u00a0sly+\u00a0cps2 and mrp+\u00a0sly+\u2009cps9 strains. However, the informative value for strains not belonging to any of the four cps types is rather low, even more as mrp and epf are only confirmed virulence markers within cps2 [mrp, epf and sly for all S. suis strains of an out-of-sample collection [S. suis strains through detection of three genes  which have so far to the best of our knowledge not been used for profiling of S. suis isolates within diagnostic services. The gene SSUST30534 encoding a putative ATP sugar transporter is associated with asymptomatic carriage. So far, this tool developed by Wileman et al. [S. suis strains isolated in Great Britain. We imagine that this novel MP-PCR approach could also become a valuable tool for diagnostic services, especially for the screening of sows during quarantine. However, as it does not differentiate important pathotypes such as mrp* cps9 strains of CC16 and mrp+\u00a0epf+\u00a0cps2 strains of CC1, the application of this new method for the characterization of invasive isolates used for composition of an AV is less convincing.Any of the described MP-PCRs detecting hin cps2 . Accordillection . Recentlllection  conducten et al.  has beenS. suis diseases. This has been shown experimentally for porcine reproductive and respiratory syndrome virus type 2 (PRRSV) by different groups [S. suis serotype 2 infection in contrast to piglets from non-infected gilts (only 5 of 23 with severe disease) [S. suis diseases [S. suis serotype 7. The devastating outcome of this coinfection was reproduced experimentally [S. suis serotype 7 is generally considered less virulent than serotype 2. Accordingly, intranasal infections with serotype 7 alone did either result in mild [Virus infections predispose piglets for invasive t groups \u201336. As adisease) . In addidiseases , 37, 38.mentally . S. suis in mild  or no cl in mild .S. suis genotypes causing disease at a time (unpublished results). As there are substantial differences in virulence among S. suis strains, we claim that these differences between herds are related to predisposing factors such as PRRSV infection. If PRRSV is circulating in a herd, S. suis strains being only weakly virulent by themselves will get the chance to cause disease in contrast to herds which are not subject to strong predisposition. Therefore, the heterogeneity of S. suis strains isolated from internal organs of diseased pigs in a herd seems to be related to the impact of main predisposing factors such as PRRSV infection.We have recorded great differences among herds in the number of S. suis pathotype from diseased pigs in both herds, namely a mrp+\u00a0epf* cps2 strain of CC 1 and a ST94 mrp+\u00a0sly+\u00a0cps9 strain though other genotypes are frequently detected on the mucosal surfaces and the tonsils. In herds that experience S. suis diseases only in association with a single highly virulent S. suis pathotype, although numerous other S. suis serotypes and STs are present on the mucosal surfaces, predisposing virus infections may be less important for this herd problem. The clinical outcome is very much determined by the virulence of the S. suis strain. This has been shown in comparative experimental infections [We have been investigating numerous diseased pigs over many years from two PRRSV free herds and have with one exception detected only a single fections , 21. In S. suis infections secondary to infection with the highly virulent VR-2385 PRRSV strain. Vaccination of PRRSV infected piglets with a S. suis serotype 2 bacterin failed to elicit significant protection against a homologous challenge. Ceftiofur treatment was the only regime leading to significantly reduced mortality. The study by Halbur et al. [S. suis is needed, it seems overall very likely that PRRS caused by an immune modulating virus infection has negative effects on the protective efficacies of S. suis bacterins.For veterinary practice, it is important to ask if the protective efficacy of bacterins is also influenced by predisposing virus infections. However, very few researchers have addressed this question. Halbur et al.  comparedr et al.  lacks a r et al. . AlthougS. suis have also been investigated by different groups [S. suis serotype 2 leads to increased mortality compared to single influenza H1N1 virus and S. suis serotype 2 infection [S. suis have also been reported in the field in England [S. suis serotype 2 to adhere to and invade respiratory epithelial cells [S. suis bacterin is influenced by influenza virus infections occurring either during vaccination or concomitantly with S. suis infection has to the best of our knowledge not been addressed in any study. However, we speculate that this might be the case e. g. through the exacerbated expression of cytokines such as CCL2, CCL4, IL-6, IL-8, and TNF\u03b1 [Coinfections of swine influenza virus and t groups \u201345. Expenfection . Coinfec England . Accordial cells , 43, 45.and TNF\u03b1 .S. suis infection and vaccination, but their role in the epidemiology of S. suis diseases remains to be determined.There are certainly more virus infections such as Porcine Circovirus type-2 (PCV2) with a putative influential effect on S. suis pathotypes [No commercial vaccine is available for protection against disease caused by various thotypes . Until tS. suis serotype 2 bacterins have been shown to elicit protection against homologous challenge by different groups [S. suis serotype 2 bacterins with a water-in-oil and aluminium hydroxide adjuvant. The authors observed protection against mortality only with the water-in-oil adjuvant and not with aluminium hydroxide. Furthermore, the vaccination protocol is also very important. Prime-boost vaccination in the 2nd and 4th week of life with an autogenous S. suis serotype 2 bacterin failed to induce seroconversion. Accordingly, significant protection was not observed in these early vaccinated piglets [S. suis bacterin vaccination of suckling piglets (at least not priming prior 3\u2009weeks of age). This is in agreement with the advice by Haesebrouck et al. [S. suis serotype 2 bacterin is generally not sufficient to elicit protection as was shown in a challenge experiment conducted 2\u2009weeks after bacterin priming in the 6th week of life [S. suis, in contrast to other bacterial pathogens, expresses an IgM-specific protease [cps7) strains of CC29 that IgM plays an important role in restricting survival of this pathotype in porcine blood. As IgM levels increased after weaning in the course of the early natural adaptive immune response, this pathotype was efficiently killed in porcine blood by IgM [S. suis strains express numerous virulence factors contributing to survival in porcine blood as reviewed in depth by Fittipaldi et al. [S. suis population as there are great differences among strains.t groups , 47, 48. piglets . In cont piglets . Based ok et al.  not to i of life . A putatprotease . Thus, pd by IgM . Viruleni et al. . In our S. suis strains, e. g. S. suis serotypes 2 and 9, or even as combinations with other pathogens such as G. parasuis. We are not aware of any publication describing the immunogenicity and protective efficacy of a multivalent S. suis bacterin. Therefore, any combination goes along with the risk of interfering with the protective efficacy of the serotype 2 bacterin. If the vast majority of diseases in growing piglets are caused by serotype 2, we recommend application of a monovalent S. suis bacterin with an appropriate adjuvant in the 4th and 6th week, as this has been demonstrated to lead to protection. However, there are cases which call for variations, e.g. if two serotypes are of comparable importance for disease in a herd. Furthermore, S. suis diseases between the 6th and 8th week of life make it difficult to give a justified recommendation: Preparturient vaccination of sows with a serotype 2 bacterin covers the 6th but not the 8th week of life [S. suis diseases is important to manage expectations prior to introduction of an AV . Regulation 2019/6 defines AV as \u201cinactivated immunological veterinary medicinal products which are manufactured from pathogens and antigens obtained from an animal or animals in an epidemiological unit and used for the treatment of that animal or those animals in the same epidemiological unit or for the treatment of an animal or animals in a unit having a confirmed epidemiological link\u201d (Article 2(3)). Articles 94 , 105 (Veterinary prescriptions), 108 , 117 , 120 (Advertising prohibition for AV), 123 (Controls by competent authorities) and 134  of the new regulation shall apply to AV. The regulation 2019/6 will lead to the harmonization of standards for production and quality control within Europe. Therefore, it will be necessary to set up detailed GMP guidelines to ensure the quality of AV in the future. Meanwhile the European Manufacturers of Autogenous Vaccines and Sera (EMAV) was set up as an association of AV producers to \u201eensure high level product quality standards based on requirements determined by laws, regulations and technical standards and standards set out by the association \u201c(https://www.emav.be). However, as the regulation 2019/6 will enter into force on 28th January 2022 the existing requirements for production and use of AV still differ between EU Member States [The European Union Directive 2001/82/EC defines AV (autogenous products) as \u201eInactivated or non-inactivated immunological veterinary medicinal products which are manufactured from pathogens and antigens obtained from an animal or animals from a holding and used for the treatment of that animal or the animals of that holding in the same locality\u201d(Article 3).The use and production of AV is regulated at the national level in the European Member States as the Directive 2001/82/EC excludes them from legal standards and does not define criteria for their quality, safety, efficacy and potency . Therefor States \u201363.S. suis diseases is crucial for using bacterins successfully. Furthermore, a comprehensive herd screening covering main porcine viruses as well as differentiation of S. suis pathotypes is important for managing expectations on autogenous bacterins. Although different groups have demonstrated protection of S. suis serotype 2 bacterins against experimental homologous challenge, the protective effectiveness of AV used in the field is to the best of our knowledge not documented. The authors propose that a database including diagnostic data collected prior and post introduction of autogenous bacterins as well as protocols used for generation of bacterins and vaccination strategies would increase the scientific foundation substantially.Understanding the epidemiology of"}
+{"text": "Cytopathogenic (cp) pestiviruses frequently emerge in cattle that are persistently infected with the bovine viral diarrhea virus (BVDV) as a consequence of RNA recombination and mutation. They induce apoptosis in infected tissue cultures, are highly attenuated in the immunocompetent host, and unable to establish persistent infections after diaplacental infections. Cp strains of BVDV have been used as naturally attenuated live vaccines and for species-specific plaque reduction tests for the indirect serological detection of BVDV. Here, we present a genetically engineered cp strain of the classical swine fever virus (CSFV). Cytopathogenicity of the strain was induced by the insertion of ubiquitin embedded in a large NS3 to NS4B duplication. The CSFV RNA genome was stabilized by the inactivation of the NS2 autoprotease, hindering the deletion of the insertion and the reversion to a wild-type genome. Additional insertion of a mCherry gene at the 5\u2032-end of the E2 gene allowed fluorescence-verified plaque reduction assays for CSFV, thus providing a novel, cost-efficient diagnostic tool. This genetically stabilized cp CSFV strain could be further used as a basis for potential new modified live vaccines. Taken together, we applied reverse genetics to rationally fixate a typical cp NS3 duplication in a CSFV genome. The classical swine fever virus (CSFV) is the causative agent of classical swine fever (CSF), formerly termed hog cholera. CSFV has been eradicated in most developed countries, but despite longstanding eradication efforts by the OIE , CSF is still an economically important disease. Recent outbreaks of CSFV in the domestic pig population and/or endemic situations in known wild boar reservoirs are reported from Africa, Asia, the Caribbean, Central and South America and Europe ,2,3. ThePestivirus within the Flaviviridae family [rns, E1 and E2) are located in the N-terminal third of the polyprotein downstream of an autoprotease (Npro). The structural proteins are processed by host cell proteases  and are not involved in genome replication [The CSFV is a member of the genus e family . The smae family . This gee family . The IRElication . The nonlication , while mlication ,10,11. Tlication . NS3 matpro (BVDV strain cpPE515), or by the insertion of other cellular processing signals, such as ubiquitin (BVDV strain CP1) [The regulation of NS2-3 cleavage hallmarks the non-cytopathogenic (ncp) biotype of pestiviruses, which is able to establish persistent infections after diaplacental infections and does not cause cytopathic effects in cultured cells. In contrast, efficient maturation of NS3 and high-level replication are observed in the cytopathogenic (cp) biotype of pestiviruses that cannot establish persistent infections in the natural host, is highly attenuated, and induces apoptosis in cell cultures ,14. The ain CP1) . Cp BVDVain CP1) ,30. In contrast to BVDV, helpervirus-independent cp genomes of CSFV have not been found in the field ,32. Thuspro gene. Since the Npro is an intrinsic unstable protein [Reporter CSFVs were used decades ago for the direct detection of viral replication without the use of immunolabeling (reviewed in ). Studyi protein , even sh protein ,47. E2 f protein . Conside2 concentration of 5%. Mutagenesis of CSFV was performed modifying an established reverse genetics system for the CSFV strain Alfort/Tuebingen [SK-6 cells  kindly puebingen . The nuc\u00ae D-BVD, CP 4350; Pfizer Animal Health, New York, NY, USA). The cellular insertion was amplified using the oligonucleotides Ubi*_forw (5\u2032-GAGAATGGCAAAATCAGTCGCCTTC-3\u2032) and Ubi*_rev (5\u2032-CCCACCACGAAGTCTCAACACTAG-3\u2032) and the One-Step OneTaq RT-PCR Kit . After sub-cloning in a T-vector , the gene was amplified by extension PCR with suitable nucleotide overhangs for an assembly reaction with oligonucleotides CSFV-353-Ubi*-GA_forw (5\u2032-ATCTCTGCTGTACATGGCACATGGAGGTACATGGCACATGGGAGAATG-3\u2032 and CSFV-5163-Ubi*-GA_rev (5\u2032-CTTGCAAACAGCTGGCCCCCCACCACGAAGTCTCAAC-3\u2032). The CSFV cDNA clone was used for the generation of a replication-competent DI9-like subgenome. Therefore, the pBR322 plasmid backbone with the 5\u2032-UTR and the non-structural protein region of CSFV was amplified using a Phusion reaction together with the oligonucleotides CSFV-378_rev (5\u2032-CTCCATGTGCCATGTACAGCAGAGAT-3\u2032) and CSFV-5140_forw (5\u2032-GGGCCAGCTGTTTGCAAGAAGG-3\u2032). This in vitro plasmid assembly reaction  generated the plasmid pR4 (cp CSFV-DI-Ubi*).A cellular ubiquitin insertion cassette was amplified from the cp BVDV strain CP Rit encoding an N-terminally truncated (3 aa) ubiquitin moiety together with parts of the ribosomal protein S27a . CP Rit E. coli, strain ER2420 (NEB), which has an EcoK r m, McrBC, Mrr Dam and Dcm background. The plasmid pBeloBAC11 carries a gene encoding resistance to chloramphenicol (Cam). After transformation and to retain the plasmid, cells were grown with 17 \u00b5g/mL Cam. The cp CSFV strain containing a duplication of the non-structural proteins NS3 to NS4B downstream of the cellular insertion cassette was constructed in a bacterial artificial chromosome (BAC) backbone using a three-piece assembly approach. Therefore, a BAC-backbone  with a SP6 promoter was amplified by a Phusion polymerase reaction using the oligonucleotides BAC-SP6_rev (5\u2032-GTATAGTGTCACCTAAATCGTTACAATTCACTGGCCGTCG-3\u2032) and CSFV-12271-BAC-GA_forw (5\u2032-GACTAAGGTAATTTCCTAACGGCCCTAAATAGCTTGGCGTAATCATGGTC-3\u2032). Then, the CSFV cDNA was amplified with an SP6 promoter from the 5\u2032-end to the desired insertion locus within the N-terminal part of the NS4B gene using the plasmid p447 as a template with the oligonucleotides SP6_forw (5\u2032-ACGATTTAGGTGACACTATAG-3\u2032) and Ubi*-CSFV-7776-GA_rev (5\u2032-GAAGGCGACTGATTTTGCCATTCTCTTGTTGTGTTTCTGTGTCTCCTG-3\u2032). The plasmid pR4 (cp CSFV-DI-Ubi*) was used as a template to amplify the ubiquitin insertion and the upstream non-structural proteins NS3 to NS5b together with the 3\u2032-UTR with the help of the oligonucleotides Ubi*_forw and CSFV-12295_rev (5\u2032-GGGCCGTTAGGAAATTACCTTAGTC-3\u2032). The DNA fragments were assembled, producing the cDNA plasmid pR6 (cp CSFV-Ubi*). The pBeloBAC11 derived plasmid pR6 was transformed in 1512A in the NS2 protein that prevents NS2-3 cleavage by the inactivation of the NS2 autoprotease. Mutagenesis was performed using PCR and DNA assembly. The oligonucleotides CSFV-4891-A1512_forw (5\u2032-GGACCACCAGTGGTCGCCGGTATGACCCTAGCCGATTTC-3\u2032) and CSFV_12295_rev were used for the amplification of one fragment, while CSFV-4932-A1512_rev and CSFV-12271-BAC-GA_forw were used for the other. The resulting plasmid was named pR14 (cp CSFV-Ubi*-C1512A). The cp CSFV-Ubi* was stabilized by mutagenesis, causing the amino acid exchange Cpro, Erns and E1 were amplified from pR14 using the oligonucleotides CSFV-12271-BAC-GA_forw and CSFV-2442_rev (5\u2032-CCGCCCTTGTGCCCCGGTCACCAGCAGCAGCC-3\u2032). The E2 gene and downstream CSFV sequences, including the cellular insertion cassette and duplicated non-structural proteins, were amplified using the oligonucleotides CSFV-2443_forw (5\u2032-CTAGCCTGTAAGGAAGACTACAGGTATGCGATC-3\u2032) and CSFV-12295_rev. A mCherry coding DNA fragment was amplified using extension PCR to provide complementary sequences using the oligonucleotides CSFV-2424-mCherry-GA_forw (5\u2032-GACCGGGGCACAAGGGCGGGTGAGCAAGGGCGAGGAGGATAAC-3\u2032) and CSFV-2465-mCherry-GA_rev (5\u2032-CTGTAGTCTTCCTTACAGGCTAGCTTGTACAGCTCGTCCATGCCG-3\u2032). The PCR products were purified and assembled using a NEBuilder reaction. The resulting plasmid was termed pR31 (cp CSFV-Ubi*-C1512A-mCherryE2). Mutagenesis of the constructs was validated using a commercial Sanger sequencing service . A scheme of the respective constructs is shown in For the insertion of the mCherry gene at the 5\u2032-end of the E2 gene of CSFV, a three-piece assembly reaction was designed. The complete BAC-backbone, the 5\u00b4-UTR and the coding region of N7 to 9.5 \u00d7 107, according to the manufacturer\u2019s product information. This error rate comes close to the range of the DNA plasmid replication in E. coli, which has an error rate between 1 \u00d7 109 and 1 \u00d7 1011, depending on genotype and growth conditions [4 [1512A and cp CSFV-Ubi*-C1512A-mCherryE2 to analyze the occurrence of mutations during passaging.PCR products were used as the template for SP6-dependent in vitro RNA synthesis. The DNA templates were amplified from the respective plasmids using Phusion polymerase (NEB) together with the oligonucleotides SP6_forw and CSFV-12295_rev. A total of 250 ng of phenol-chloroform purified PCR products were used as the template for in vitro transcription reactions as previously described [nditions . Howevertions [4 . Therefov/v) Triton-X 100  in PBS, and stained with the monoclonal antibody (Mabs) 8.12.7 anti NS3 [wt/vol) polyacrylamide tricine gels and transferred onto nitrocellulose membranes . The membranes were blocked with 5% (wt/vol) skim milk  in phosphate-buffered saline (PBS) with 0.05% (v/v) Tween-20 . The murine Mabs A18 anti-CSFV E2, 8.12.7 anti NS3, GL5A1 anti NS5A [Indirect immunofluorescence assays were performed as previously described . Brieflyanti NS3  or A18, nti NS5A  and E5D8nti NS5A  , serum toxicity controls (serum dilution 1/5), cell controls and virus back titration controls were included in each assay. Cells were fixed with 4% paraformaldehyde in PBS for 20 min at 4 \u00b0C after 48 h, when strong fluorescence signals and cytopathogenic effects were visible in the control wells with the cp CSFV-Ubi*-C1512A-mCherryE2 back titrations. All CSFV infected cells were stained with the E2-specific Mab A18, and a FITC labeled goat anti-mouse IgG for comparison. The SVNA reactions were analyzed using a fluorescence microscope . The 50% neutralization dose (ND50/mL) was calculated for each virus-serum combination using the Spearman\u2013Kaerber method.SVNAs were performed as described previously . Serum dRNA extractions were performed using a volume of 140 \u00b5L (cell-free culture supernatant or cell lysates). Total RNA was extracted using the QIAamp Viral RNA Mini Kit  or the RNeasy Mini Kit (QIAGEN) according to the manufacturer\u2019s instructions on a QIAcube Connect device (QIAGEN). RT-qPCRs were performed on a StepOne real-time PCR system  using the Luna Universal Probe One-Step RT-qPCR Kit (NEB). CSFV specific primers and probes were used as previously described  togetherpro that autoproteolytically processed NS3 very efficiently [pro transfected cells. An indirect immunofluorescence test using Mab 8.12.7 anti NS3 showed a strong cytoplasmic fluorescence signal in the dead cells 48 h post-transfection. The bright NS3 dependent staining within the cytoplasm together with the death of the transfected cells is shown in The cp BVDV strain CP Rit has incorporated a cellular mRNA sequence coding parts of the ribosomal protein S27a fused with an N-terminally truncated ubiquitin moiety . This fuiciently . We obse2468 (aa 132 of NS4B) of CSFV. In analogy to the organization of the BVDV CP Rit, the genes from NS3 to NS4B were duplicated and embedded in the complete non-structural protein module (NS3-NS5B) downstream of the Ubi*. The cDNA clone of cp CSFV-Ubi* with a total genome length of 15.2 kb was constructed in a BAC backbone to ensure genetic stability considering the homologous duplication of more than 2.5 kb. Template cDNA was produced by long-range PCR, and synthetic RNA was transcribed via SP6-polymerase. Already 24 h after transfection of the synthetic RNA of cp CSFV-Ubi* into SK-6 cells, the first cytopathic effects were observed, and the cellular monolayer was largely destroyed within 48 h. The high replication and protein expression levels of the cp CSFV-Ubi* were demonstrated by strong fluorescence signals in immunofluorescence staining of the NS3 antigen . Furthermore, RT-PCR analyses with CSFV-RT-qPCR-99_forw and CSFV-5694_rev revealed no evidence for co-passage of subgenomic DIs, as no 5\u2019-end truncated fragment can be observed in Recognizing this apparent instability of our construct, we searched for a way to hinder homologous recombination or the emergence of wild-type-like CSFV phenotypes following deletions of the insertion. Because even complete codon exchange in the duplicated region does not necessarily stabilize such a virus, we decided to exchange the active cysteine residue (aa 1512) within the NS2 protease domain against an alanine. This mutation inactivates the NS2 autoprotease and thus prevents NS2-3 cleavage so that Ceplicate . Accordi1512A strain was genetically labeled using the insertion of a mCherry gene at the 5\u2032-end of the E2 gene as presented earlier [1512A-mCherryE2 was rescued from synthetic RNA by electroporation and analyzed in virus passages. The mCherry-E2 fusion protein in cp CSFV-Ubi*-C1512A-mCherryE2 is fully capable of virion morphogenesis, receptor binding, and host cell infection as demonstrated by its intact infection cycle. As in the cp CSFV-Ubi*, the first cytopathic effects were observed 24 h post-transfection, but viral spread in the infected culture was notably slower in direct comparison. A strong fluorescence of mCherry was observed 24 to 48 h after transfection, and the cellular monolayer was largely destroyed within 48 h post-transfection, as shown in To generate a new and cost-efficient diagnostic tool for indirect CSFV detection, we constructed a dual reporter virus suitable for fluorescence-verified plaque reduction assays. Therefore, the helpervirus-independent stable cp CSFV-Ubi*-C earlier . The vir1512A-mCherryE2, which show no or only very weak mCherry fluorescence signals, can be stained with CSFV specific antibodies. To verify that the observed fluorescence signals arise due to the mCherry-E2 expression, indirect immunofluorescence using Mab 8.12.7 anti-CSFV NS3 and FITC conjugated goat anti-mouse IgG was applied. By overlaying the signals, a close correlation between red and green fluorescence was documented. However, it must be mentioned that signal amplification in immunohistochemical staining results in a very high sensitivity. Therefore, some cells at the margin of the plaques of cp CSFV-Ubi*-C1512A, the cp CSFV-Ubi*-C1512A-mCherryE2 was stable on SK-6 cells for 11 passages. The RT-PCR analyses of cp CSFV-Ubi*-C1512A-mCherryE2 presented in As the parental cp, CSFV-Ubi*-C1512A, and cp CSFV-Ubi*-C1512A-mCherryE2 showed reduced progeny virus titers in direct comparison to the wild-type ncp CSFV Alfort/Tuebingen. In the experiment, ncp CSFV produced a peak titer of 1 \u00d7 106 TCID50/mL 48 h post infection, while cp CSFV-Ubi*, cp CSFV-Ubi*-C1512A and cp CSFV-Ubi*-C1512A-mCherryE2 released about 2 log10 lower titers of progeny virus in the cell culture supernatant. No effect of the C1512A mutation on the progeny virus production was observed comparing cp CSFV-Ubi* and cp CSFV-Ubi*-C1512A. The insertion of the mCherry gene additionally reduced infectious virus production by a factor of two in comparison to cp CSFV-Ubi*. We also measured intra- and extracellular viral RNA levels in ncp CSFV Alfort/Tuebingen and cp CSFV-Ubi*-C1512A 12, 24, 48 and 72 h post infection  of 0.01 to study the viral spread and to generate viral growth curves. Progeny virus titers were measured 24, 48 and 72 h after inoculation, as presented in nfection B,C. Vira1512A, cp CSFV-Ubi*-C1512A-mCherryE2 and ncp CSFV Alfort/Tuebingen was compared to investigate their cell culture spread. SK-6 cells were infected with 10 PFU/FFU of the respective virus. After 2 h of infection, the infection medium was removed and replaced with 1% carboxymethyl cellulose medium to prevent the long-distance spread of viral particles. Focus and plaque size was determined by counting the infected cells within single foci or plaques using immunofluorescence 48 h after infection. In 1512A consisted of 55 cells (95% CI +/\u2212 2.4) and the plaques of cp CSFV-Ubi*-C1512A-mCherryE2 contained only 46 cells (95% CI +/\u2212 2.6).The plaque or focus size of cp CSFV-Ubi*-C1512A-mCherryE2 strain, which has not been characterized so far. The elevated NS protein expression levels and the efficient NS protein processing became apparent by the immunodetection of NS5A in 1512A-mCherryE2 strain with a strong band at 110 kDa (E1-mCherryE2 heterodimer) and weaker bands at 80 kDa (unglycosylated mCherryE2) and 160 kDa (mCherryE2-mCherryE2 homodimer). The unglycosylated mCherryE2 with 80 kDa, a strong band at 110 kDa (E1-mCherryE2 heterodimer) and a weak band with 160 kDa (mCherryE2-mCherryE2 homodimer), were also seen in the immunoblot in We also analyzed the protein expression of the different CSFV strains at 24 h post-transfection. The immunoblot against the helicase domain of NS3 in 1512A-mCherryE2 strain was designed as a novel tool for the indirect detection of CSFV infections using a fluorescence-verified plaque reduction assay. For the validation of this potential application, SVNAs with cp CSFV-Ubi*-C1512A-mCherryE2 and ncp CSFV Alfort/Tuebingen were performed in parallel following the standard procedure. Defined positive and negative reference antisera were tested  were transfected in cells pre-infected with an ncp CSVF. The emerging helpervirus-independent cp CSFVs were isolated by subsequent plaque purification. This approach yielded an 18.1 kb long cp CSFV strain (CP G1), in which a complete DI sequence was integrated at the 3\u2032-end of the ORF. However, CP G1 was genetically unstable and reverted completely during passaging into the parental replicative subgenomic DIs .The first genetically stable cp CSFV was presented in 2008 using genomic integration of a complex Jiv insertion of 1539 nucleotides derived from the cp BVDV strain CP8. The resulting cp CSFV-Jiv was tested in an animal experiment. It showed no reversion to wild-type-like genomes, was completely avirulent and induced a strong protective immune response. The cp CSFV-Jiv was proposed as a suitable vaccine candidate . Howeverpro to NS2 protein genes against Ubi*, a ubiquitin fusion protein gene derived from the cp BVDV strain CP Rit. The Ubi* gene has previously been characterized in this well-known temperature-sensitive vaccine strain [1512A, which leads to NS2 autoprotease deficiency, prevented the replication of ncp recombination products and stabilized the cp CSFV. It can be hypothesized that genetically stable cp BVDV strains with duplicated viral sequences known from the field were evolutionarily stabilized in a similar manner. In the selection of the fittest viruses, adaptation processes probably took place compensating the imbalance between mature NS3 and uncleaved NS2-3 by inhibition of the NS2-autoprotease [1512A could potentially be further stabilized and optimized by the introduction of additional mutations within NS2 and/or NS3. Since we did not detect reversion in cp CSFV-Ubi*-C1512A within 11 passages, we assume that the C1512A mutation alone is sufficient to stabilize the cp CSFV-Ubi*. The emergence of mutants carrying larger genomic deletions, which inhibit the growth of helper-independent cp CSFV as DIs, was not observed, probably because the cp CSFV-Ubi*-C1512A already replicated its genome with a very high efficacy. The emergence of such DIs was also never observed in cell culture propagation of cp BVDV field strains containing duplicated viral sequences together with insertions of cellular mRNA sequences.First, we generated a cp CSFV-DI-Ubi* by exchanging the cassette encoding Ne strain . The ence strain ,61. As eprotease . Cp CSFV1512A strain to generate a new valuable tool for veterinary CSFV diagnostics. We inserted an additional red fluorescent protein gene (mCherry) at the 5\u2032-end of the E2 ectodomain to produce a dual reporter virus that destroys the cellular monolayer with clearly visible plaques and allows the verification of the virus-related causation of the cell damage by fluorescence microscopy. The application of the cp CSFV-Ubi*-C1512A-mCherryE2 in fluorescence verified virus neutralization assays was successfully tested in this study.Our new reverse genetics system for a cp CSFV with functionally uncoupled NS2-3 and NS3 proteins allows, for the first time, the study of the independent functions of NS3 and NS2-3 within a single cistron. Future studies will use mutational analyses of separated protease, NTPase and helicase domains as well as of the packaging module to investigate their importance for the different steps in the pestiviral lifecycle. Furthermore, the stabilized cp CSFV showed an enormous antigen expression, which might be beneficial in live attenuated CSFV vaccines. Since this concept can be applied to any CSFV strain, known safe vaccine strains already in use could be modified by inserting stabilized duplications. In this study, we applied the stable cp CSFV-Ubi*-C1512A-mCherryE2, which causes a strong fluorescence signal only in cells killed by the cp CSFV infection, immunofluorescence staining is often inconclusive in such cases because the dead cells are washed away during the staining steps, and a nonspecific background staining occurs in the remnant cells. LED technology has greatly reduced the purchase price and maintenance costs of fluorescence microscopes [1512A-mCherryE2 could reduce costs and improve the speed and reliability of SVNA against CSFV. The stabilized cp CSFV-Ubi*-C1512A still has to be tested in animal experiments to confirm and document its avirulence and immunogenicity, which could be inferred from analogies with cp CSFV-Jiv and various known cp BVDV strains. Given the high cost of such animal studies, the authors of this article cannot perform these tests without industrial collaborators or external funding. Due to the strong antigen expression, the virus may also be suitable as a live vector for the expression of foreign genes in wild boar. In summary, we generated a cytopathogenic CSFV strain rationally stabilized by a point mutation, which has many different potential applications in basic research, prophylaxis, and diagnostics.Currently, various measures are used to control or eradicate CSFV in different regions of the world. The most important measures in countries with successful CSFV eradication programs are molecular biological diagnostics, which are mainly accomplished by RT(q)-PCRs. Unfortunately, there are still many countries where CSFV is endemic and domestic pig herds must be protected from disease by vaccination. In this regard, SVNA is still a common laboratory system for identifying CSFV affected herds in less developed and economically weak countries. It is also still the \u201cgold-standard\u201d test to confirm questionable reactions in antibody ELISA since a definitive diagnosis can be obtained with the high specificity of the SVNA reaction. It is also possible to distinguish the humoral immune response of pigs against CSFV from reactions against other related viruses, such as BVD or BVDV. The SVNA itself is simple to perform, involves comparatively low equipment and consumable costs, and can be performed even in rural areas in any cell culture laboratory with the necessary safety equipment. In addition, the SVNA can be used to check the protection status of pigs after vaccination, which may be relevant in vaccine development and testing as well as during vaccination campaigns. However, SVNAs cause a very high labor burden when they are performed with ncp viruses, as the cell cultures have to be fixed, permeabilized and immune-assayed before evaluation. The dual reporter CSFV presented in this study can significantly reduce the effort and assay cost. It can also improve the assay performance because the cp CSFV causes a clearly visible cytopathogenic effect, which allows a faster and easier evaluation of SVNA after approximately 48 h as a plaque reduction assay under the light microscope. In case of questionable results, the reactions can be validated by the fluorescence of the infected cells under a fluorescence microscope. Such doubtful reactions occur, for example, when the sera to be tested are toxic to the cell culture system at lower dilution levels, which is frequently observed in sera from diseased animals. In contrast to cp CSFV-Ubi*-Croscopes . Due to The author B.L. is the inventor of a patent on pestiviral marker vaccines ."}
+{"text": "Each of them enabled cellulose palmitate foam formation. Isobutane foams exhibited the lowest density with the largest average cell size and nitrogen foams indicated most uniform cell morphology. The effect of die temperature on foamability was further studied with isobutane (3 wt%) as a blowing agent. Die temperature had a relatively low impact on foam density and the differences were mainly encountered with regard to surface quality and cell size distribution. This study demonstrates that cellulose palmitate can be foamed but to produce foams with greater quality, the material homogeneity needs to be improved and researched further.Polymer foams are widely used in several fields such as thermal insulation, acoustics, automotive, and packaging. The most widely used polymer foams are made of polyurethane, polystyrene, and polyethylene but environmental awareness is boosting interest towards alternative bio-based materials. In this study, the suitability of bio-based thermoplastic cellulose palmitate for extrusion foaming was studied. Isobutane, carbon dioxide (CO Polymer foams, also known as cellular plastics, are an important polymeric material. Cellular structure is formed from a combination of gaseous and solid phases. Foams can be closed-cell or open-cell in structure. In general, closed-cell foams are more rigid, whereas open-cell foams are usually flexible. Depending on the structure and material, polymer foams can have a low density, good thermal and sound insulation properties, and high specific strength. Therefore, these foam materials have been widely used in the fields of thermal insulation, acoustics, automotive, packaging, sports equipment, and construction ,2,3,4. AExtrusion foaming is one of the primary foaming processes due to its continuous nature especially for polyolefins, polystyrene, and vinyl plastics . In extrThe most widely used polymer foams are made of polyurethane (PU), polystyrene (PS), polyethylene (PE), or poly(vinyl chloride) (PVC). These conventional polymers are petrochemical derivatives and are not bio-based. However, environmental awareness, new legislative initiatives, and depletion of non-renewable resources have been boosting interest towards more sustainable bio-based materials. Considerable efforts are therefore being made to replace petrochemical-based polymeric foams with foams based on renewable resources such as starch ,21,22,23Cellulose-based thermoplastics are also a promising biopolymer group for replacing synthetic foams in certain foam applications. However, only some results of cellulose-based extrusion foams have been reported ,32,33,34In this study, the suitability of cellulose palmitate ester for extrusion foaming was examined. The cellulose palmitate was prepared according to our earlier study. It has also been reported that the cellulose palmitate can be used to compensate for the use of fossil-based injection molding plastics and melt-spun fibers; thus, it was assumed that cellulose palmitate would also work well in the extrusion foaming process ,40. FoamCommercial softwood dissolving-grade pulp purchased from Domsj\u00f6 Fabriker AB  was used as a starting material and the pulp was pre-treated with ozone according to the method described by Willberg-Keyril\u00e4inen et al. . LithiumThree different physical blowing agents were used to prepare the cellulose palmitate foams. Carbon dioxide, nitrogen, and isobutane R600a (IB) were purchased from Linde Group . The blowing agent content was varied during foaming to find the optimal dosing. Finntalc M05SL  was used as a nucleating agent.The cellulose palmitate was prepared using the homogeneous method presented by Willberg-Keyril\u00e4inen et al. ,37. In t3/rev melt pump and static mixer-type melt cooler with oil tempering. The extruder screw geometry appropriate for foaming was used that has a three-phase compression process and an increase in inner diameter at the blowing agent injection point. The extruder barrel was heated with 3 heating bands (zones) and the blowing agent was injected between zones 2 and 3. The extruder was also equipped with a round capillary die. The die geometry was 2/20 (diameter/length in mm).Foams were prepared with the Brabender Plastograph EC plus 19 mm singe screw extruder . The extruder was also equipped with a 0.66 cmBlowing agents were injected and pressurized with the Teledyne ISCO dual-syringe pump system . As carbon dioxide and isobutane can be liquefied, they were also dosed with the Teledyne pump. The injection pressure for carbon dioxide and isobutane was 120 bar and 85 bar, respectively. In order to aid liquefaction, the pump was cooled to 2 \u00b0C. As nitrogen cannot be liquefied easily, it was injected as gas. Nitrogen dosing was conducted using the Bronkhorst EL-FLOW mass flow controller . Still, the Teledyne pump was used to pressurize the nitrogen gas to 200 bar. The blowing agent dosage was calculated as a mass percentage based on the material throughput determined by measuring a 1 min sample by hand. During the foam processing, the extruder barrel temperatures and melt pump temperatures were kept constant. The temperature profile was 130 \u00b0C, 135 \u00b0C, 135 \u00b0C, 135 \u00b0C. Therefore, to prepare the sample, only the melt cooler and die temperatures were changed. Other processing-related variables included the blowing agent concentration, melt pump RPM , and die geometry. When a foam sample was taken, the die pressure was recorded with Brabender WinEXT software . The extrusion foaming setup is presented in Cellulose palmitate material was dried under vacuum at 30 \u00b0C overnight. Additionally, the extruder hopper was shielded with nitrogen gas flow (~5 L/min) to prevent the material from absorbing moisture. The nucleating agent was dry-blended by hand in a bag with the cellulose palmitate before processing. The amount of nucleating agent was kept constant at 1.2 wt%.Due to the irregular shapes of the prepared foams, the densities were determined with a liquid submersion technique. Water purified with reverse osmosis was used as the liquid media. Surfactant was used to reduce the surface tension of the water to prevent microbubbles from forming on the foam surfaces during submersion. Additionally, as the sample foams are closed cell and the material is impermeable to water, ingress of water into the foam cells is not expected. Four parallel measurements were made from each foam sample. The foams were weighed with the Mettler Toledo XS205 DualRange scale .Scanning electron microscope (SEM) images were taken in order to determine the cell size, wall thickness, and general cell structure. Images were captured with JEOL JSM-6360LV . A small section of the foam extrudate was frozen in liquid nitrogen and fractured. The fractured surfaces were then gold-coated with the Bal-Tec SCD050  sputter coater. An acceleration voltage of 7 kV was used and the images were constructed from secondary electrons.Cell size distribution was analyzed using X-ray micro-computed tomography (X\u00b5CT). Samples were imaged using the Rx Solutions desktom 130 scanner . An acceleration voltage of 40 kV and a voxel size of 3.7 \u00b5m were used. Scanning time was around 60 min per sample. To measure pore sizes, local thickness transform was used . The loc2-0.5 was produced at a higher die temperature (120 \u00b0C) than the other CO2 samples (115 \u00b0C) as temperatures below 120 \u00b0C caused the material to freeze at the die. Carbon dioxide at 0.5% did not provide enough plasticization to the material in order to reach the lower processing temperature. Maximum blowing agent concentrations for isobutane, carbon dioxide, and nitrogen were 5%, 3%, and 1%, respectively. The maximum blowing agent amount was determined in-situ by evaluating the foaming behavior of the extruded material. With an excessively high amount of blowing agent, the foam would rupture prematurely, producing a slight popping sound, and collapse. The amount of maximum blowing agent is related to the blowing agent solubility to the cellulose palmitate as well as to the relationship between the material melt strength and specific volume of the blowing agent [The foaming parameters used in the preparation of cellulose palmitate foam samples with isobutane, carbon dioxide, and nitrogen are presented in ng agent .2-3 that were made with the same amount of blowing agent, they both produced a die pressure of 101 bar. However, CO2-3 did so with 10 \u00b0C lower melt cooler and die temperatures, indicating that the plasticization effect of carbon dioxide is higher than that of isobutane. The effect of nitrogen is more difficult to evaluate and compare due to the increased throughput. Nitrogen was used at a higher material throughput in order to increase nitrogen feeding accuracy with the utilized mass flow controller. However, generally nitrogen is far less soluble and therefore has less plasticization capability than carbon dioxide [A blowing agent is known to reduce the polymer material viscosity. During the foaming process, blowing agents act as a plasticizer and increase the free volume ,44. To c dioxide ,46.All three physical blowing agents were able to foam the cellulose palmitate material successfully. The visual appearance of the produced foam strands is presented in 2-0.5 also have very similar densities of 0.47 g cm\u22123 and 0.45 g cm\u22123, respectively.Foam morphologies determined with SEM imaging are presented in \u22123 and CO2-1 had a density of 0.24 g cm\u22123. Samples with 3% isobutane B and 1% 2-3. In particular, the sample foamed with 5% isobutane  permeates into the cells, replacing the blowing agent until equilibrium is reached. Isobutane and carbon dioxide are eventually replaced by air. If the blowing agent diffusion rate is faster than that of air, the cells have a small vacuum that can cause the cells to shrink or collapse due to poor cell wall stiffness ; this is2-0.5 and N2-1 show no signs of shrinking or collapse as the cell walls are not creased. Furthermore, compared to isobutane and carbon dioxide, the material is fully foamed even at a low nitrogen dosage of 0.5%. Despite the comparatively low dosage of nitrogen, samples N2-0.5 and N2-1 have a similarly low density of around 0.19 g cm\u22123 as IB-5 and CO2-3. Nitrogen has the highest specific volume followed by carbon dioxide and isobutane [When nitrogen is used as a blowing agent, the diffusion of nitrogen out of the cells can be considered to be in equilibrium with air diffusing into the cells. Therefore, shrinkage with nitrogen is negligible. sobutane . TherefoThe average cell size and cell density are a combination of several foaming parameters such as pressure drop rate, level of supersaturation, use of nucleating agents, temperature, and blowing agent ,51. The The density results in Based on the results of the blowing agent survey, one blowing agent was selected for further foaming temperature studies with cellulose palmitate. Based on cell morphology and density measurements, nitrogen would seem like the logical choice considering it produced foams with the most uniform cell structure and low density. However, while proper mechanical tests were not conducted, the strength of each foam was estimated by hand. The foams prepared with nitrogen had virtually no strength and were quite brittle in nature. Therefore, the selection of the blowing agent was narrowed down to carbon dioxide and isobutane. From these two very similarly behaving blowing agents, better surface quality and visual uniformity was achieved with isobutane. Isobutane foams exhibited significant cell collapse but based on the blowing agent diffusion rates, isobutane could benefit more from temperature adjustment or at least the effect of foaming temperature may be clearer. Therefore, isobutane was selected.Foaming parameters used in the isobutane temperature survey are presented in Foam side profiles presented in The cause for the shrunken surface of samples foamed at 130 \u00b0C and 125 \u00b0C is visible on the SEM images presented in Cell size distribution of samples IB-3_130\u00b0C, IB-3_120\u00b0C, and IB-3_110\u00b0C were analysed using tomography. The results are presented in Foam appearance, SEM images, and tomography data all show differences between the foaming temperatures. However, densities of the foams are surprisingly similar as evident in \u22123. However, major differences in foam morphology were noticed between the blowing agents. Nitrogen produced foams with the most uniform cell structure and the smallest average cell size without visible shrinking. Nitrogen was also able to foam the material with a very low dosage of 0.5 wt%. Isobutane produced foams with the largest average cell size and with visible shrinking. Carbon dioxide produced foam with an average cell size between that of nitrogen and isobutane but also with significant shrinking and poor surface quality. A higher amount of isobutane and carbon dioxide than nitrogen was required to foam the material fully.The foamability of cellulose palmitate was tested with three physical blowing agents: isobutane, nitrogen, and carbon dioxide. All three blowing agents were able to foam the material successfully and achieve densities below 0.20 g cm\u22123 density was achieved.While the average cell size with isobutane was the largest of the three blowing agents, it was still deemed to be the most suitable blowing agent to conduct foaming temperature optimization studies. Foaming temperatures in the range of 105\u2013130 \u00b0C with 3 wt% isobutane were tested. While higher radial foam expansions were encountered more often at high temperatures (130 \u00b0C) than low temperatures (110\u2013105 \u00b0C), foaming temperature had very little effect on foam density. Additionally, cell size distribution developed at high and low temperatures was relatively similar but for different reasons. At high temperatures, foam shrank due to poor cell wall stiffness and rapid gas loss, resulting in a higher number of small cells. At low temperatures, a higher number of small cells were developed due to the high material viscosity and increased die pressure that promotes nucleation. The optimal foaming temperature for cellulose palmitate material with 3 wt% isobutane was around 120 \u00b0C because at that temperature, the most uniform cell size distribution with low 0.19 g cmUsed cellulose palmitate material was rather non-uniform which had an influence on the overall foam quality. The material uniformity has also undoubtedly masked some of the foaming characteristics caused by different blowing agents and foaming temperatures. Nevertheless, clear conclusions were able to be established. Further studies should focus on improving material uniformity for foaming purposes and greater foaming characteristics."}
+{"text": "To create a larger pool of candidate substrates, adaptors, or regulators, we carried out a far more sensitive and comprehensive in\u00a0vivo protein trapping analysis. We identified 59 highly enriched CLPC1 protein interactors, in particular proteins belonging to families of unknown functions , as well as the UVR domain proteins EXE1 and EXE2 implicated in singlet oxygen damage and signaling. Phylogenetic and functional domain analyses identified other members of these families that appear to localize (nearly) exclusively to plastids. In addition, several of these DUF proteins are of very low abundance as determined through the Arabidopsis PeptideAtlas http://www.peptideatlas.org/builds/arabidopsis/ showing that enrichment in the CLPC1-TRAP was extremely selective. Evolutionary rate covariation indicated that the HugZ/DUF2470 family coevolved with the plastid CLP machinery suggesting functional and/or physical interactions. Finally, mRNA-based coexpression networks showed that all 12 CLP protease subunits tightly coexpressed as a single cluster with deep connections to DUF760-3. Coexpression modules for other trapped proteins suggested specific functions in biological processes, e.g., UVR2 and UVR3 were associated with extraplastidic degradation, whereas DUF760-6 is likely involved in senescence. This study provides a strong foundation for discovery of substrate selection by the chloroplast CLP protease system.The chloroplast chaperone CLPC1 unfolds and delivers substrates to the stromal CLPPRT protease complex for degradation. We previously used an  Arabidopsis, maize, rice, and tobacco demonstrated the essential nature of the plastid CLP system. Complete loss of the CLPC chaperone or CLPPR protease capacity results in embryo lethality, whereas partial loss results in delayed growth and development and virescent leaves biotic conditions . Each plt leaves , 6, 7.Arabidopsis consists of a hetero-oligomeric protease core comprising one or more copies of five proteolytically active subunits (CLPP1 and CLPP3-6), four proteolytically inactive proteins (CLPR1-4), as well as two plant-specific accessory proteins , three AAA+ chaperones , and two adaptors CLPS1 and CLPF. Plastids do not contain any CLPX homologs, which instead are present in mitochondria along with CLPP2  but were extremely enriched through the trapping approach. These proteins of unknown function could simply be substrates but should also be considered candidates for a regulatory role in CLP proteolysis, e.g., as a modulator of CLPC chaperone or CLPPR protease activity, as an adaptor, coadaptor, or antiadaptor in substrate selection or perhaps supporting the priming and oligomerization of the CLPC chaperones. In such cases, these proteins could have evolved with the CLP system, and we therefore set out to search for signals of coevolution between these interactors and the different components of the CLP system at the amino acid level. This study will provide a comprehensive analysis for these DUF, UVR, HugZ proteins and their homologs based on (i) phylogenetic and Evolutionary Rate Covariation (ERC) analyses, (ii) an analysis of protein sequence coverage by experimental peptides, possible posttranslational modifications, and protein abundance in different parts of the plant based on our recently launched Arabidopsis PeptideAtlas build#1 (http://www.peptideatlas.org/builds/arabidopsis/), and (iii) mRNA-based coexpression networks using information from ATTEDII (https://atted.jp/). The coexpression and ERC analyses will be used to infer possible functional and/or physical relationships between the CLP machinery and these enriched proteins and their homologs.To obtain a more in-depth analysis of CLPC1 trapped proteins, we used the same genetic material as in  but carrin\u00a0vivo protein interaction screen with chloroplast CLPC1-WT and CLPC1-TRAP proteins expressed in wildtype Arabidopsis. Both transgenes are driven by a constitutive promotor, and each has a C-terminal STREPII tag that allows for efficient affinity enrichment (clpc1-1 line with the CLPC1-STREP transgene showed full complementation of the virescent phenotype and reduced biomass phenotype of clpc1-1 (clpc1-1 null mutant (A). The scatter plot in Figure\u00a01A shows the number of spectral counts in CLPC1-WT and CLPC1-TRAP for all 1643 proteins; the 575 proteins that we have annotated as plastid proteins are marked up in blue. Figure\u00a02A summarizes the proteomics workflow. These plastid proteins represented \u223c72% of the protein biomass based on both adjusted Spectral Counts (adjSPC) and normalized adjSPC (NadjSPC). Previously, we also carried out a similar in\u00a0vivo protein interaction analysis for transgenic plants expressing two different STREPII-tagged versions of the unrelated chloroplast glutamyl peptidase CGEP . CLPC1 was observed in equal amounts in the CLPC1-WT and CLPC1-TRAP samples, with an average ratio of 0.98. This demonstrates that CLPC1 affinity enrichment was consistent and successful. The CLPC1 interactome included all known proteins of the chloroplast CLP system, including the adaptor CLPF, but excluding the adaptor CLPS1 (A). This lack of identification of CLPS1 by MS/MS is because it is a small protein (12\u00a0kDa) with relatively few suitable tryptic peptides ; immunoblotting with CLPS1 specific serum previously showed that CLPS1 was enriched to the same extent as CLPF (B). Together, this showed that the interaction between the CLP protease core and CLPC1 was stabilized by blocking ATP hydrolysis in CLPC1 through the Walker B mutations, supporting our previous findings . Seventy-seven proteins were significantly (p\u00a0< 0.01) different between CLPC1-TRAP and CLPC1-WT . Most of these (67) were enriched in the CLPC1-TRAP samples , and only 10 proteins were enriched in CLPC1-WT as compared with CLPC1-TRAP . Thirteen proteins were also observed in the CGEP affinity eluates; the negative control, however, only two of these, stromal CPN21 and HDS, were at least 3-fold enriched in the CLPC1-TRAP , indicating that a 3-fold enrichment was a strong criterium for specific trapping in the CLPC1-TRAP.We first used statistics to evaluate plastid proteins for potential enrichment in the CLPC1-TRAP or CLPC1-WT samples. We limited the plastid proteins to those with at least a total of 18 adjSPC across all experiments, resulting in 339 proteins. A volcano plot displays the log2 of CLPC1-TRAP/CLPC1-WT ratio and -log10 ing data C. SeventA-inset). These 10 proteins not assigned to the plastid nearly all have a low number of SPC , with the exception of Hsc70-4 with 117 SPC. Five are observed only in two of the three bioreplicates. One of them (AT2G13440) is likely plastid localized, and the others have diverse functions and are unlikely to be located in plastids. This showed that our experiments and bioinformatics workflow (including selection criteria for enrichment) indeed mostly find plastid proteins, and the ones not in the plastid have low number of matched spectra. Most of these plastid proteins (52/59) were observed in all three biological CLPC1-TRAP replicates. Important, these 59 proteins were identified with at least three independent nonredundant peptides  , were also observed in the CGEP-STREP experiments, and they could be nonspecific interactors with CLPC1 or perhaps also functionally interact with both CLPC1 and CGEP (see further below).To obtain a stringent (conservative) set of proteins enriched in the CLPC1-TRAP eluates for further evaluation, we required at least 3-fold enrichment in CLPC1-TRAP compared with CLPC1-WT. We also required either two or three observations across the three biological CLPC1-TRAP replicates and a minimal threshold of 18 matched MS/MS for proteins identified in the CLPC1-TRAP samples . This resulted in a set of 69 proteins  of whichFig.\u00a01ication) . Of thes p\u00a0< 0.1 . Of the  p\u00a0< 0.1 . Just 2 D. This illustrates, e.g., that DUF760-2 has a high relative abundance in the CLPC1-TRAP sample and is 32-fold enriched as compared with CLPC1-WT, whereas EXE1, EXE2, and DUF760-5 are >200-fold enriched and identified with \u223c200 matched MS/MS spectra.The relation between relative abundance in the CLPC1-WT and CLPC1-TRAP eluates and the relative enrichment in the CLPC1-TRAP for the 59 plastid proteins is shown in Figure\u00a01B.The functions of the enriched proteins in Figure\u00a02Arabidopsis chloroplast nucleoids ucleoids , 23, RH3ucleoids ), as welucleoids , 26, a Ducleoids , 28 and ucleoids  and pTACucleoids . None ofucleoids . Their ee.g., Calvin\u2013Benson cycle or starch metabolism), but instead they are involved in six other metabolic pathways, namely, fatty acid metabolism (ACC2 and pyruvate kinase), phenylalanine synthesis , 5\u2032-adenylylsulfate reductases-1,2,3  involved in sulfur metabolism, the methylerythritol phosphate pathway (DXS1 and HDS), the thiamin pathway  primary carbon metabolism , an, ane.g.,ay  and have an N-terminal LON domain, an AAA+ domain, and the catalytic LON domain (p\u00a0= 0.09). Finally, both the chaperone CPN20 and its cochaperonin CPN10-1 .The enrichment analysis also identified 12 proteins with unknown function . These aFig.\u00a02Arabidopsis genome identified one additional member of this family (AT1G48450\u2013DUF179-2) , assigned DUF179-3 . HoweverUF179-2) .Table\u00a02SArabidopsis genome revealed one additional member of this family (DUF760-8)  , which wi.e., EXE1, EXE2, UVR2, UVR3, and UVR4   .The enrichment analysis identified one protein with a HugZ domain (IPR037119), assigned HugZ-1. Analysis of the original proteome dataset  found twArabidopsis homologs to ARM. It is interesting to note that ARM domains are frequently found in combination with U-box or F-box domains involved in proteasomal degradation. Examples are AT5G67340, AT2G44900 (ARMADILLO-1), AT3G60350 (ARABIDILLO-2)  with four armadillo repeat (ARM) domains; we named it ARM . The ArmDILLO-2) , 54, 55,DILLO-2) .Arabidopsis homologs of DUF3143.In our previous trapping study , we founArabidopsis genome identified additional proteins with DUF179, DUF760, HugZ, and UVR domains resulting in a total set of 22 Arabidopsis proteins  AT4G23960 and AT4G10925 (neither have been studied) likely involved in substrate recognition for degradation by the proteosome. This pattern suggests neofunctionalization within proteostasis.BLAST and functional domain searches against the proteins . We searanalyses . With thanalyses , all famVR3/UVR4 , EXE1/EXVR3/UVR4 , CLPF (FVR3/UVR4 ). The UVVR3/UVR4 . DuplicaERC is a method to reveal genes with a history of coevolution and/or shared evolutionary pressures, based on the concept that functionally related genes will experience correlated changes in rates of sequence evolution across a phylogeny , 60, 61.B and Figure\u00a06A shows the full matrix with p-values, and Figure\u00a06B displays the significant relationships as a network. This analysis showed strong coevolution between all subunit pairs within the CLPPR core and between CLPT1/T2 and the CLPPR core subunits, with the exception of CLPP5. This lack of coevolution for CLPP5 is surprising given that CLPP5 is essential for both structure and proteolytic function  and the candidate interactors listed in Figs.\u00a02function . There ifunction . The excsubunits ). For CLArabidopsis glutamyl-tRNA reductase (GluTR) binding protein (GBP) localized in chloroplasts. GluTR is important for the synthesis of 5-aminolevulinate, a precursor in heme and chlorophyll biosynthesis. Of importance, GBP plays a regulatory role in the stability of GluTR and protects the N terminus from being recruited by CLPS1 for degradation by the CLP system , whereas DUF179-1 showed a weaker coevolution signature with DUF760-1 and UVR2/3. These coevolutionary links provide a further incentive to study these interactors in more detail.We also found signs of ERC between CLP subunits and some of the CLP interactors . In partP system . This isArabidopsis (B). To better understand the functional relationship of the trapped proteins and their homologs (Arabidopsis data from ATTED-II based on both microarray and RNA-Seq experiments (A). This resulted in a set of 2157 nonredundant genes  to CLPF (LS\u00a0= 6.2/6.3). Interesting, DUF760-2, DUF760-3, and DUF3143 showed many connections to the tight CLPPRT cluster even at LS \u2265 7, suggesting that these three DUF proteins likely have a function closely associated with the plastid CLP system. At the highest stringency level (LS \u22657) , only DUTo more easily visualize the connectivity between CLP and trapped proteins, we generated a network of the combined top 20 and LS \u2265 6 coexpressors but including only those coexpressors with at least two edges . This rewww.peptideatlas.org/builds/arabidopsis/)  and reanalyzed through a uniform processing and metadata annotation pipeline. In the first release, \u223c40 million of \u223c143 million MS/MS spectra acquired from a wide range of highly diverse samples from Arabidopsis  were matched to the reference genome Araport11, identifying 17,858 uniquely identified proteins at the highest confidence level  and 3543 lower confidence proteins. The raw MS datasets of the CLPC1 trapping experiment, as described above, as well as our previous CLPC1 trapping study  . Arabidoe.g. tissue types, subcellular fractions) , indicative of their low abundance and specific CLPC1 trapping (A). DUF760-3 was by far the most abundant in this first PeptideAtlas release, whereas DUF760-5, DUF760-7, and HUGZ-3 were the least abundant and DUF760-8 was never observed  across these very diverse datasets, overall protein sequence coverage by matched peptides, and the most N-terminal residue observed and evaluated in what datasets in PeptideAtlas these proteins were observed , e.g., DUF760-6 is highly enriched in the CLPC1-TRAP but generally not that frequently observed in PeptideAtlas. Similarly, EXE1, EXE2, DUF179-1, and others are observed many times in the PeptideAtlas but only EXE1 and EXE2 are extremely enriched in the CLPC1-TRAP.Figure\u00a09B). However, for both proteins many more peptides were detected in the CLPC1-TRAP experiments showing that these proteins were truly highly enriched. All 21 observed proteins (bona fide N terminus of the mature protein was detected because it was identified by a semi-tryptic peptide immediately downstream of a residue that was not K or R (hence not cleaved by trypsin) and with C-terminal K or R residues. Indeed, in most of these cases, the detected N terminus did fit the pattern of a cleaved cTP   than the heterozygous CLPC1-TRAP line used for the current affinity enrichment. It is likely that proteins enriched in the CLPC1-TRAP line might also overaccumulate in the clpc1-1 null line, and indeed, that was the case for several proteins, in particular EXE2 and DUF179.3.The CLPC1-TRAP plants do have pale green (virescent) young leaves, but these leaves green as they further develop and mature. The virescent phenotype must be accompanied with changes in the (chloroplast) proteome, and indeed, comparative proteomics of the homozygous henotype . This clThis study identified 15 trapped proteins involved in DNA and RNA metabolism and 22 proteins involved in different chloroplast metabolic pathways; most of these are likely to be CLP protease substrates but protein half-life experiments in CLP-deficient backgrounds will be needed to investigate this further. Furthermore, another 10 proteins involved in chloroplast proteostasis were highly enriched in the CLPC1-TRAP; these include the CLPF adaptor, the CLPD chaperone, CLPT1 and CLPT2, as well as the CPN10/CPN20 cochaperone pair. Several of these proteins are direct components of the CLP chaperone-protease system . The >10-fold enrichment of cochaperone pair CPN10 and CPN20 is highly intriguing given the recent identification in the Chlamydomonas CLP core structure through cryo-EM ; perhapsi.e., DUF179, DUF760, DUF151/UVR, DUF3143, HugZ, ARM, as well as EXE1 and EXE2. We identified 12 proteins in these families as being highly enriched in the CLPC1-TRAP, and analysis with BLAST and phylogeny identified another 10 members in these families, several of which were also enriched in the CLPC1 samples. Most  of these 22 proteins localize to the chloroplast, suggesting that they specifically evolved to play a role in chloroplast metabolism or proteostasis. These proteins can perhaps serve as adaptors or in other regulatory functions in the Clp system and can also be substrates. Studies to determine possible regulatory functions such as CLP adaptor are difficult and often highly multiyear projects, as evidenced by the few examples published so far, in all cases for various types of bacteria. Just a few examples are (i) HSPQ in Escherichia coli which is now shown to be a regulator of Clp by inhibiting CLPS substrate selection but only if HSPQ is acetylated, thus HSPQ serves as an antiadaptor of CLPS  Me hexamer , and .All together this comprehensive study provides a broad foundation to study the physiological role of the chloroplast CLP chaperone-protease system and discover molecular players and details of substrate delivery and regulation of CLP activity.wt/CLPC1-WT-STREPII and heterozygous wt/CLPC1-TRAP-STREPII transgenic lines used in this study are described in  were transferred to soil and grown under the same light/dark regime. Rosettes were harvested after 38\u00a0days just before bolting, divided in three separate batches per genotype, weighed, immediately frozen in liquid nitrogen, and stored at\u00a0\u221280 \u00b0C. The different batches serve as biological replicates.Homozygous ribed in . Seeds w2, 75\u00a0mM NaCl, 0.32\u00a0mg avidin/ml EM, and 250\u00a0\u03bcg/ml pefablok serine protease inhibitor). The suspension was filtered through four layers of Miracloth , and larger particles were removed by centrifugation for 1.5\u00a0h at 28,000\u00a0rpm in a SW28 rotor at 4 \u00b0C. The supernatants were collected and aliquoted and either directly used for affinity purification on StrepTactinXT high-capacity affinity beads (# 2-4030-010 from IBA Life Sciences) or stored at\u00a0\u221280 \u00b0C for later analysis. StrepTactin columns (0.5\u20131\u00a0ml) were prepared as in (Batches of rosettes (10\u201314\u00a0g) were ground by pestle and mortar in liquid nitrogen to a fine powder and vortexed in 10 to 12\u00a0ml extraction medium  using 100-min gradients with 95% water, 5% ACN, 0.1% FA (solvent A) and 95% ACN, 5% water, 0.1% FA (solvent B) at a flow rate of 300\u00a0nl/min. Two blank samples were run after the six samples from each lane. The acquisition cycle consisted of a survey MS scan with a set mass range from 400 to 2000 m/z at the 70,000 resolving power followed by 10 data-dependent MS/MS scans with 2.0\u00a0m/z isolation window. Dynamic exclusion was used for 15\u00a0s. AGC target values were set at 1\u00a0\u00d7 106 for the MS survey scans and maximum scan time 30\u00a0ms, and either 5.105 or 5.104 for MS/MS scans and maximum scan time 50\u00a0ms. Each sample was analyzed three times using different acquisition conditions  as follows: (i) 5.105 MS/MS AGC and two internal washes with 95% B, (ii) 5.105 MS/MS AGC and one internal wash with 95% B, and (iii) 5.104 MS/MS AGC and one internal wash with 95% B.Affinity eluates of the transgenic lines expressing CLPC1-WT-STREP and CLPC1-TRAP-STREP were separated by SDS-PAGE on Biorad Criterion Tris-HCl precast gels (10.5%\u201314% acrylamide gradient) with three biological replicates. We refer to these eluates further as CLPC1-WT and CLPC1-TRAP. Each of the SDS-PAGE gel lanes were completely cut into consecutive gel slices (six per lane), followed by reduction, alkylation, and in-gel digestion with trypsin . The pepp-value <0.01 for individual ion scores; precursor ion window 700\u20133500\u00a0Da) were carried out: (i) full tryptic (error tolerance 6\u00a0ppm for MS and 0.5\u00a0Da for MS/MS) with variable M-oxidation, Gln to pyro-Glu (N-termQ), N-term protein acetylation, W mono-, di-, or tri-oxidation and Fixed Cys-carbamido-methylation, two missed cleavages (in Mascot PR or PK does not count as missed cleavage), (ii) semi-tryptic (error tolerance 3\u00a0ppm and 0.5\u00a0Da for MS/MS) with variable M-oxidation, N-term acetylation, Gln to pyro-Glu (N-termQ), W-mono-, di-, or tri-oxidation, and fixed Cys-carbamido-methylation, two missed cleavages. W-oxidation was included based on the recent observations showing that a specific tryptophan residue in EXECUTER1 was oxidized  . GLEE was run in a Windows platform with a cubic polynomial equation fitting, adaptive binning, and 20,000 iterations for the estimation of variation. No normalization by protein length or peptide length was included. Volcano plots were generated in Excel.Peak lists in MGF format were generated from RAW files using Distiller software (version 2.7.1.0) in default mode (Matrix Science). MGF files were searched with MASCOT v2.4.0 against TAIR10 including a small set of typical contaminants and the decoy . Two parallel searches  (http://ppdb.tc.cornell.edu/), and protein experimental or predicted subcellular location was obtained from PPDB. Proteins were assigned to plastid, mitochondria, peroxisome, or \u201cother.\u201dCoexpressed genes for the CLP and protein interactors families were downloaded (July 2020) from the plant coexpression database ATTED-II (ted.jp/)  using daComplete sets of annotated protein-coding sequences for 18 species across Archaeplastida were obtained from published sources  and procraxmlHPC-PTHREADS-AVX -s <input file name> -n <output file name> -m PROTGAMMALG -p 12345 -x 12345 -# 100 -f a. The -m argument indicated the model used . The -p and -x arguments provided a seed for parsimony search and bootstrapping, respectively. The -# argument indicates the number of bootstrap replicates. The -f a argument implements rapid bootstrap analyses and best scoring tree search. Gene-tree/species-tree reconciliation analyses were carried out using Notung (version 2.9) (ion 2.9) , 79. Theion 2.9) , 81 in oion 2.9)  was usedion 2.9) .p-Values were corrected for multiple tests using false discovery rate  via the PRIDE partner repository and are available with the dataset identifier PXD017400. Matched posttranslational modifications as included in the Mascot searches, and limited information about MS-based identification results , as well as annotation of protein name, location, and function for the identified proteins can be found in the PPDB (http://ppdb.tc.cornell.edu/). The RAW files from PXD017400 were also\u00a0processed as part of the Arabidopsis PeptideAtlas project\u00a0and are available at http://www.peptideatlas.org/builds/arabidopsis/ (Arabidopsis proteome datasets from other processed PXDs from ProteomeXchange.The MS data have been deposited to the PRIDE Archive (idopsis/ . These PThis article contains The authors declare that they have no conflicts of interest with the contents of this article."}
+{"text": "Acinetobacter species have been a leading cause of nosocomial infections, causing significant morbidity and mortality over the entire world including Ethiopia. The most important features of A. baumannii are its ability to persist in the hospital environment and rapidly develop resistance to a wide variety of antibiotics. This study aimed to determine trend of antimicrobial resistance in Acinetobacter species over a five years period.Acinetobacter species recovered from clinical specimens referred to the national reference laboratory was extracted from microbiology laboratory data source covering a time range from 2014 to 2018. Socio-demographic characteristics and laboratory record data was analyzed using SPSS 20.A retrospective data regarding occurrence and antimicrobial resistance of Acinetobacter species were analyzed from various clinical specimens. Majority of them were from pus (33.3%) followed by blood (23.5%), urine (15.6%) and body fluid (11.7%). Significant ascending trends of antimicrobial resistance was shown for meropenem (12.5% to 60.7%), ceftazidime (82.1% to 100%), ciprofloxacin (59.4% to 74.4%), ceftriaxone (87.1% to 98.6%), cefepime (80.0% to 93.3%) and pipracillin- tazobactam (67.8% to 96.3%). However, there was descending trend of antimicrobial resistance for tobramycin (56.5% to 42.8%), amikacin (42.1% to 31.4%) and trimethoprim-sulfamethoxazole (79.0 to 68.2%). The overall rate of carbapenem non-susceptible and multidrug resistance rates in Acinetobacter species were 56.7% and 71.6%.respectively.A total of 102 strains of Acinetobacter species showed increasing MDR and resistance to high potent antimicrobial agents posing therapeutic challenge in our Hospitals and health care settings. Continuous surveillance and appropriate infection prevention and control strategies need to be strengthened to circumvent the spread of multidrug resistant pathogens in health care facilities.A five year antimicrobial resistance trend analysis of  Acinetobacter species are aerobic gram-negative bacilli that can cause healthcare-associated infections and can survive for prolonged periods in the environment and on the hands of healthcare workers .At this time, please address the following queries:Please clarify the sources of funding  for your study. List the grants or organizations that supported your study, including funding received from your institution.State what role the funders took in the study. If the funders had no role in your study, please state: \u201cThe funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript.\u201dIf any authors received a salary from any of your funders, please state which authors and which funders.If you did not receive any funding for this study, please state: \u201cThe authors received no specific funding for this work.\u201dPlease include your amended statements within your cover letter; we will change the online submission form on your behalf.3. Your ethics statement should only appear in the Methods section of your manuscript. If your ethics statement is written in any section besides the Methods, please move it to the Methods section and delete it from any other section. Please ensure that your ethics statement is included in your manuscript, as the ethics statement entered into the online submission form will not be published alongside your manuscript.4. Please ensure that you refer to Figure 4 in your text as, if accepted, production will need this reference to link the reader to the figure.[Note: HTML markup is below. Please do not edit.]Reviewers' comments:Reviewer's Responses to QuestionsComments to the Author1. Is the manuscript technically sound, and do the data support the conclusions?The manuscript must describe a technically sound piece of scientific research with data that supports the conclusions. Experiments must have been conducted rigorously, with appropriate controls, replication, and sample sizes. The conclusions must be drawn appropriately based on the data presented. Reviewer #1:\u00a0YesReviewer #2:\u00a0Partly**********2. Has the statistical analysis been performed appropriately and rigorously? Reviewer #1:\u00a0N/AReviewer #2:\u00a0Yes**********3. Have the authors made all data underlying the findings in their manuscript fully available?PLOS Data policy requires authors to make all data underlying the findings described in their manuscript fully available without restriction, with rare exception (please refer to the Data Availability Statement in the manuscript PDF file). The data should be provided as part of the manuscript or its supporting information, or deposited to a public repository. For example, in addition to summary statistics, the data points behind means, medians and variance measures should be available. If there are restrictions on publicly sharing data\u2014e.g. participant privacy or use of data from a third party\u2014those must be specified.The Reviewer #1:\u00a0YesReviewer #2:\u00a0Yes**********4. Is the manuscript presented in an intelligible fashion and written in standard English?PLOS ONE does not copyedit accepted manuscripts, so the language in submitted articles must be clear, correct, and unambiguous. Any typographical or grammatical errors should be corrected at revision, so please note any specific errors here.Reviewer #1:\u00a0NoReviewer #2:\u00a0Yes**********5. Review Comments to the AuthorPlease use the space provided to explain your answers to the questions above. You may also include additional comments for the author, including concerns about dual publication, research ethics, or publication ethics. Reviewer #1:\u00a0The manuscript describes the increase of resistance rates in Acinetobacter spp. strains, isolated from different types of samples, in Ethiopia. Although the authors presented interesting results, it is difficult for me to recommend this paper for publication in PLOS ONE in its present form.1- The authors must include line numbers, as well as page numbers to help with the correction.2- The authors should revise the English and the style of the text. There are two types of fonts along the text.3- The authors should correct the nomenclature, in many cases, they have written Acinitobacter instead of Acinetobacter, and on several occasions, the word appears without italics.4- The authors should homogenize the names of the antibiotics, whether with or without a capital letter, but all the same. The same applies for the percentages, between or not a parenthesis, but all the same in the same paragraph.5- The acronym HAI has two different explanations, one in the introduction and another one in the results.Introduction:6- Line 7: The authors should explain the meaning of TU.7- The first time the name of a bacteria is mentioned should be written with its complete name. The subsequent times should be written in the reducing form of its name.8- Line 30: b-lactamase should be changed to \u03b2-lactamase.Material and Methods9- The section \u201cStudy period and area\u201d is partially missing.10- It is not clear if \u201cSampling technique\u201d is a section that includes the next ones, or if the content of this section is missing.11- The authors should explain which antimicrobial susceptibility test and how they performed it.12- Line 12: The authors may scape the r from strains.13- The authors should explain what statistical test they have used.Results14- It would be interesting if the authors could provide data relating the resistance rates of the strains with the empirical treatment received by the patients.15- Figure 1: The authors should include the complete name of the labels.16- Line 9: The authors should explain the meaning of CSF.17- Line 11: Why the authors tested carbapenem susceptibility only in 37 strains, instead of in all the 102 samples?18- Line 11: The reference to Figure 2 should be in the previous sentence.19- The percentage of ceftriaxone for 2018 in the text does not correspond with the 2018 percentage in the table.20- Figure 2: The authors should explain the meaning of EPHI.21- Figures 3 and 4: The authors should include the label of the Y-axis.22- Figures 3 and 4: I recommend the elimination of the grey background from both figures to facilitate the differentiation between the different line colours.23- Figures 3 and 4: the meaning of the antibiotic acronyms should be explained.Discussion24- Line 10: What is the meaning of x^2?25- The authors should revise the style and the content of the discussion, especially the last three paragraphs.Reviewer #2:\u00a0English needs improvement.Absolute numbers may not be mentioned when percentage is given.Introduction: at risk people may be described in a single sentence.Study period: the sentence seems incomplete.More than half of the samples were collected from two hospitals. How was the hospitals selected for this study?Figures should be in percentage.The references are not uniformly written.**********what does this mean?). If published, this will include your full peer review and any attached files.6. PLOS authors have the option to publish the peer review history of their article  digital diagnostic tool,\u00a0 11 Nov 2020Response to reviewers Journal Requirements:When submitting your revision, we need you to address these additional requirements.1. Please ensure that your manuscript meets PLOS ONE's style requirements, including those for file naming. The PLOS ONE style templates can be found athttps://journals.plos.org/plosone/s/file?id=wjVg/PLOSOne_formatting_sample_main_body.pdf andhttps://journals.plos.org/plosone/s/file?id=ba62/PLOSOne_formatting_sample_title_authors_affiliations.pdfResponse \u2013Thank you editor, we have edited our manuscript based on the PLOS ONE's style requirements.2. Thank you for stating the following financial disclosure: .At this time, please address the following queries:a. Please clarify the sources of funding  for your study. List the grants or organizations that supported your study, including funding received from your institution.b. State what role the funders took in the study. If the funders had no role in your study, please state: \u201cThe funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript.\u201dc. If any authors received a salary from any of your funders, please state which authors and which funders.d. If you did not receive any funding for this study, please state: \u201cThe authors received no specific funding for this work.\u201dResponse \u2013 thank you editor! The authors received no specific funding for this work.\u201d We have included this in updated cover letter. Please include your amended statements within your cover letter; we will change the online submission form on your behalf.3. Your ethics statement should only appear in the Methods section of your manuscript. If your ethics statement is written in any section besides the Methods, please move it to the Methods section and delete it from any other section. Please ensure that your ethics statement is included in your manuscript, as the ethics statement entered into the online submission form will not be published alongside your manuscript.Response \u2013thank you we included in the method section.4. Please ensure that you refer to Figure 4 in your text as, if accepted, production will need this reference to link the reader to the figure.Response \u2013thank you we referred Figure 4 in the text with some modification. Reviewer #1: The manuscript describes the increase of resistance rates in Acinetobacter spp. strains, isolated from different types of samples, in Ethiopia. Although the authors presented interesting results, it is difficult for me to recommend this paper for publication in PLOS ONE in its present form.1- The authors must include line numbers, as well as page numbers to help with the correction.Response \u2013 thank you reviewer for the suggestion to follow submission guidelines we included the line numbers and page number. 2- The authors should revise the English and the style of the text. There are two types of fonts along the text.Response \u2013 thank you we revised the English and make the fonts uniform \u2018Arial\u2019.3- The authors should correct the nomenclature, in many cases, they have written Acinitobacter instead of Acinetobacter, and on several occasions, the word appears without italics.Response \u2013yes we admitted this and we use \u2018find and replace\u2019 Acinitobacter with Acinetobacter throughout the text. Thank you for this important comment.4- The authors should homogenize the names of the antibiotics, whether with or without a capital letter, but all the same. The same applies for the percentages, between or not a parenthesis, but all the same in the same paragraph.Response \u2013 thank you, we make it small letter for and antibiotics and make it uniform for percentages, between or not a parenthesis, throughout the texts as highlighted yellow. 5- The acronym HAI has two different explanations, one in the introduction and another one in the results.Response \u2013thank you reviewer we make it uniform as the acronym HAI means to show hospital acquired infection. Introduction:6- Line 7: The authors should explain the meaning of TU.Response \u2013thank you -this is a genomic species of Acinetobacter which is given by taxonomy classification in addition to species level. 7- The first time the name of a bacteria is mentioned should be written with its complete name. The subsequent times should be written in the reducing form of its name.Response \u2013 thank you for your comment also with exception at the beginning of a sentence, we wrote it in reduced form.8- Line 30: b-lactamase should be changed to \u03b2-lactamase.Material and MethodsResponse \u2013we thank you. Change has been made as \u03b2-lactamase as highlighted yellow 9- The section \u201cStudy period and area\u201d is partially missing.Response \u2013 yes, it was missing. We filed it appropriately here after. Thank you! 10- It is not clear if \u201cSampling technique\u201d is a section that includes the next ones, or if the content of this section is missing.Response \u2013 thank you again! we mean data extraction method from archived records of the laboratory.11- The authors should explain which antimicrobial susceptibility test and how they performed it. Response \u2013 thank you for the comment. The test protocol for the antimicrobial susceptibility test was Kirby-Bauer disc diffusion method.12- Line 12: The authors may scape the r from strains. Response- thanks you! Corrected as highlighted in the text as \u2018strains\u2019 13- The authors should explain what statistical test they have used.Descriptive ,crosstab, chi-square ,ratio, proportion, Results14- It would be interesting if the authors could provide data relating the resistance rates of the strains with the empirical treatment received by the patients.Response \u2013 thank you! , we have included that in figure 2.15- Figure 1: The authors should include the complete name of the labels.Response- thank you we wrote the complete name16- Line 9: The authors should explain the meaning of CSF.Response \u2013 thank you! we mean cerebrospinal fluid as highlighted in the text yellow.17- Line 11: Why the authors tested carbapenem susceptibility only in 37 strains, instead of in all the 102 samples?Response \u2013thank you! There was a shortage of the carbapenem drug during testing. 18- Line 11: The reference to Figure 2 should be in the previous sentence.Response \u2013 thank you! We have moved fig 2 to previous 19- The percentage of ceftriaxone for 2018 in the text does not correspond with the 2018 percentage in the table.Response \u2013thank you! We mean 98.6% and that has been corrected 20- Figure 2: The authors should explain the meaning of EPHI.Response \u2013thank you we mean Ethiopian public health Institute. 21- Figures 3 and 4: The authors should include the label of the Y-axis.Response \u2013thank you we included the label of Y-axis.22- Figures 3 and 4: I recommend the elimination of the grey background from both figures to facilitate the differentiation between the different line colours.Response \u2013thank you we eliminated the background color.23- Figures 3 and 4: the meaning of the antibiotic acronyms should be explained.Response \u2013thank you, we wrote in long form.Discussion24- Line 10: What is the meaning of x^2?Response \u2013thank you x2 we mean a symbol of chi-square 25- The authors should revise the style and the content of the discussion, especially the last three paragraphs.Response \u2013thank you so much we have corrected the last three paragraphs Reviewer #2: English needs improvement.Response \u2013thank you we have attempted to revise the English grammar and spelling errors.Absolute numbers may not be mentioned when percentage is given.Response \u2013thank you we opted to use percentage and edit again in the abstract and result section Introduction: at risk people may be described in a single sentence.Response:Thank you for the comments. Correction has been made per the comment given. Study period: the sentence seems incomplete.Response .thank you, it was missed we incorporated and fill the incomplete as highlighted yellowMore than half of the samples were collected from two hospitals. How was the hospitals selected for this study?Response \u2013thank you, the study included all health facilities referring specimens however specimens were no growth for Acinetobacter species during culturing in some facilities. They are high load government hospitals refer sample for microbiology culture and antimicrobial susceptibility testing. This study analyzed the isolates only i.e. we excluded the no growth specimens Figures should be in percentage.Response .Thank you we have made change to percentage The references are not uniformly written.Response \u2013thank you we revised and have written it in Vancouver style.AttachmentResponse to Reviwers.docxSubmitted filename: Click here for additional data file. 13 Jan 2021PONE-D-20-27426R1Multidrug resistance pattern of Acinetobacter species isolated from clinical specimens referred to Ethiopian Public Health Institute: a retrospective study.PLOS ONEDear Dr. Ayenew,Thank you for submitting your manuscript to PLOS ONE. After careful consideration, we feel that it has merit but does not fully meet PLOS ONE\u2019s publication criteria as it currently stands. Therefore, we invite you to submit a revised version of the manuscript that addresses the points raised during the review process.==============================Please pay special attention to the comments suggested by the reviewers are they still highlight major concenrs that will improve the quality and clarity of the manuscrtpt.==============================plosone@plos.org. When you're ready to submit your revision, log on to https://www.editorialmanager.com/pone/ and select the 'Submissions Needing Revision' folder to locate your manuscript file.Please submit your revised manuscript by Feb 27 2021 11:59PM. If you will need more time than this to complete your revisions, please reply to this message or contact the journal office at Please include the following items when submitting your revised manuscript:A rebuttal letter that responds to each point raised by the academic editor and reviewer(s). You should upload this letter as a separate file labeled 'Response to Reviewers'.A marked-up copy of your manuscript that highlights changes made to the original version. You should upload this as a separate file labeled 'Revised Manuscript with Track Changes'.An unmarked version of your revised paper without tracked changes. You should upload this as a separate file labeled 'Manuscript'.If you would like to make changes to your financial disclosure, please include your updated statement in your cover letter. Guidelines for resubmitting your figure files are available below the reviewer comments at the end of this letter.http://journals.plos.org/plosone/s/submission-guidelines#loc-laboratory-protocolsIf applicable, we recommend that you deposit your laboratory protocols in protocols.io to enhance the reproducibility of your results. Protocols.io assigns your protocol its own identifier (DOI) so that it can be cited independently in the future. For instructions see:\u00a0We look forward to receiving your revised manuscript.Kind regards,Monica Cartelle Gestal, PhDAcademic EditorPLOS ONE[Note: HTML markup is below. Please do not edit.]Reviewers' comments:Reviewer's Responses to QuestionsComments to the Author1. If the authors have adequately addressed your comments raised in a previous round of review and you feel that this manuscript is now acceptable for publication, you may indicate that here to bypass the \u201cComments to the Author\u201d section, enter your conflict of interest statement in the \u201cConfidential to Editor\u201d section, and submit your \"Accept\" recommendation.Reviewer #1:\u00a0All comments have been addressedReviewer #3:\u00a0All comments have been addressed**********2. Is the manuscript technically sound, and do the data support the conclusions?The manuscript must describe a technically sound piece of scientific research with data that supports the conclusions. Experiments must have been conducted rigorously, with appropriate controls, replication, and sample sizes. The conclusions must be drawn appropriately based on the data presented. Reviewer #1:\u00a0(No Response)Reviewer #3:\u00a0Partly**********3. Has the statistical analysis been performed appropriately and rigorously? Reviewer #1:\u00a0(No Response)Reviewer #3:\u00a0Yes**********4. Have the authors made all data underlying the findings in their manuscript fully available?PLOS Data policy requires authors to make all data underlying the findings described in their manuscript fully available without restriction, with rare exception (please refer to the Data Availability Statement in the manuscript PDF file). The data should be provided as part of the manuscript or its supporting information, or deposited to a public repository. For example, in addition to summary statistics, the data points behind means, medians and variance measures should be available. If there are restrictions on publicly sharing data\u2014e.g. participant privacy or use of data from a third party\u2014those must be specified.The Reviewer #1:\u00a0(No Response)Reviewer #3:\u00a0Yes**********5. Is the manuscript presented in an intelligible fashion and written in standard English?PLOS ONE does not copyedit accepted manuscripts, so the language in submitted articles must be clear, correct, and unambiguous. Any typographical or grammatical errors should be corrected at revision, so please note any specific errors here.Reviewer #1:\u00a0(No Response)Reviewer #3:\u00a0Yes**********6. Review Comments to the AuthorPlease use the space provided to explain your answers to the questions above. You may also include additional comments for the author, including concerns about dual publication, research ethics, or publication ethics. Reviewer #1:\u00a0The paper has been clearly improve, but I would recommend the authors to revise again due to some italics, antibiotic names as well as some spaces that are missing.Reviewer #3:\u00a0the manuscript needs some attention on the following -1. Introduction- please clearly define the multi-drug resistance of Acinetobacter species.globally and regional data supporting the severity of multi-drug resistance of the organism  would make the context stronger.2. Methods- Inclusion criteria are not mentioned clearly.3. Discussion- The result of empirical therapy is not discussed. please discuss with significance.4. Conclusion- Please rephrase the 1st line of conclusion.**********what does this mean?). If published, this will include your full peer review and any attached files.7. PLOS authors have the option to publish the peer review history of their article  digital diagnostic tool,\u00a0 29 Jan 2021Review Comments to the AuthorReviewer #1: The paper has been clearly improved, but I would recommend the authors to revise again due to some italics, antibiotic names as well as some spaces that are missing.Response \u2013 thank you! We have made changes in our revision some italics, antibiotic names as well as some spaces missed.Reviewer #3: the manuscript needs some attention on the following -1. Introduction- please clearly define the multi-drug resistance of Acinetobacter species.globally and regional data supporting the severity of multi-drug resistance of the organism  would make the context stronger.Response \u2013 thank you for the comments to be added and we incorporate definition of MDR \u2013Acinetobacter species, global and regional data supporting the severity of the disease in the introduction part.2. Methods- Inclusion criteria are not mentioned clearly.Response \u2013 thank you we have added the inclusion criteria of the study in method part 3. Discussion- The result of empirical therapy is not discussed. please discuss with significance.Response \u2013 thank you for the comment regarding missed discussion of empirical therapy. We have added with significance in line number 205 on page 11 4. Conclusion- Please rephrase the 1st line of conclusion.Response \u2013 we rephrase the 1st line of conclusion in line 243 on page 13 of the manuscript.AttachmentResponse to Reviewers.docxSubmitted filename: Click here for additional data file. 16 Apr 2021Multidrug resistance pattern of Acinetobacter species isolated from clinical specimens referred to the Ethiopian Public Health Institute: 2014 to 2018 trend anaylsisPONE-D-20-27426R2Dear Dr. Ayenew,We\u2019re pleased to inform you that your manuscript has been judged scientifically suitable for publication and will be formally accepted for publication once it meets all outstanding technical requirements.Within one week, you\u2019ll receive an e-mail detailing the required amendments. When these have been addressed, you\u2019ll receive a formal acceptance letter and your manuscript will be scheduled for publication.http://www.editorialmanager.com/pone/, click the 'Update My Information' link at the top of the page, and double check that your user information is up-to-date. If you have any billing related questions, please contact our Author Billing department directly at authorbilling@plos.org.An invoice for payment will follow shortly after the formal acceptance. To ensure an efficient process, please log into Editorial Manager at onepress@plos.org.If your institution or institutions have a press office, please notify them about your upcoming paper to help maximize its impact. If they\u2019ll be preparing press materials, please inform our press team as soon as possible -- no later than 48 hours after receiving the formal acceptance. Your manuscript will remain under strict press embargo until 2 pm Eastern Time on the date of publication. For more information, please contact Kind regards,Monica Cartelle Gestal, PhDAcademic EditorPLOS ONEAdditional Editor Comments :Reviewers' comments:Reviewer's Responses to QuestionsComments to the Author1. If the authors have adequately addressed your comments raised in a previous round of review and you feel that this manuscript is now acceptable for publication, you may indicate that here to bypass the \u201cComments to the Author\u201d section, enter your conflict of interest statement in the \u201cConfidential to Editor\u201d section, and submit your \"Accept\" recommendation.Reviewer #1:\u00a0All comments have been addressedReviewer #3:\u00a0All comments have been addressed**********2. Is the manuscript technically sound, and do the data support the conclusions?The manuscript must describe a technically sound piece of scientific research with data that supports the conclusions. Experiments must have been conducted rigorously, with appropriate controls, replication, and sample sizes. The conclusions must be drawn appropriately based on the data presented. Reviewer #1:\u00a0(No Response)Reviewer #3:\u00a0Yes**********3. Has the statistical analysis been performed appropriately and rigorously? Reviewer #1:\u00a0(No Response)Reviewer #3:\u00a0Yes**********4. Have the authors made all data underlying the findings in their manuscript fully available?PLOS Data policy requires authors to make all data underlying the findings described in their manuscript fully available without restriction, with rare exception (please refer to the Data Availability Statement in the manuscript PDF file). The data should be provided as part of the manuscript or its supporting information, or deposited to a public repository. For example, in addition to summary statistics, the data points behind means, medians and variance measures should be available. If there are restrictions on publicly sharing data\u2014e.g. participant privacy or use of data from a third party\u2014those must be specified.The Reviewer #1:\u00a0(No Response)Reviewer #3:\u00a0Yes**********5. Is the manuscript presented in an intelligible fashion and written in standard English?PLOS ONE does not copyedit accepted manuscripts, so the language in submitted articles must be clear, correct, and unambiguous. Any typographical or grammatical errors should be corrected at revision, so please note any specific errors here.Reviewer #1:\u00a0(No Response)Reviewer #3:\u00a0Yes**********6. Review Comments to the AuthorPlease use the space provided to explain your answers to the questions above. You may also include additional comments for the author, including concerns about dual publication, research ethics, or publication ethics. Reviewer #1:\u00a0(No Response)Reviewer #3:\u00a0Thanks to the author for the corrections properly.I have no other issues regarding this article. If there is any minor issue please correct it.**********what does this mean?). If published, this will include your full peer review and any attached files.7. PLOS authors have the option to publish the peer review history of their article (If you choose \u201cno\u201d, your identity will remain anonymous but your review may still be made public.Do you want your identity to be public for this peer review? For information about this choice, including consent withdrawal, please see our Privacy Policy.Reviewer #1:\u00a0NoYes:\u00a0Iffat Ara IfaReviewer #3:\u00a0 21 Apr 2021PONE-D-20-27426R2 Acinetobacter species isolated from clinical specimens referred to the Ethiopian Public Health Institute: 2014 to 2018 trend anaylsis\u00a0\u00a0\u00a0\u00a0 Multidrug resistance pattern of Dear Dr. Ayenew:I'm pleased to inform you that your manuscript has been deemed suitable for publication in PLOS ONE. Congratulations! Your manuscript is now with our production department. onepress@plos.org.If your institution or institutions have a press office, please let them know about your upcoming paper now to help maximize its impact. If they'll be preparing press materials, please inform our press team within the next 48 hours. Your manuscript will remain under strict press embargo until 2 pm Eastern Time on the date of publication. For more information please contact plosone@plos.org. If we can help with anything else, please email us at Thank you for submitting your work to PLOS ONE and supporting open access. Kind regards, PLOS ONE Editorial Office Staffon behalf ofDr. Monica Cartelle Gestal Academic EditorPLOS ONE"}
+{"text": "Scientific Reportshttps://doi.org/10.1038/s41598-021-03016-1, published online 28 January 2022Correction to: The original version of this Article contained errors.In the Results section, under the subheading \u2018Assay specificity for HIV\u20111\u2019,\u201cThey comprised of 27 male and 47 female participants.\u201dnow reads:\u201cThey comprised of 26 male and 46 female participants and 2 donors with unknown gender.\u201dIn the Methods section, under the subheading \u2018Assay specificity for HIV\u20111\u2019,\u201cAs previously mentioned, the specificity of the assay on crude cellular lysates was determined using 74 HIV-1 negative IAVI protocol L donors , 12 chronically infected protocol L donors  and 32 treatment-suppressed male HIV-1 positive donors from the London St. Stephens Trust.\u201dnow reads:\u201cAs previously mentioned, the specificity of the assay on crude cellular lysates was determined using 74 HIV-1 negative IAVI protocol L donors , 12 chronically infected protocol L donors  and 32 treatment-suppressed male HIV-1 positive donors from the London St. Stephens Trust.\u201dThe original Article has been corrected."}
+{"text": "Gata1low mutation that decreases expression of Gata1 in erythroid cells and megakaryocytes, includes anemia, thrombocytopenia, hematopoietic failure in bone marrow and development of extramedullary hematopoiesis in spleen. With age, these mice develop myelofibrosis, a disease sustained by alterations in stem/progenitor cells and megakaryocytes. This study analyzed the capacity of hGATA1 driven by a \u03bcLCR/\u03b2-globin promoter to rescue the phenotype induced by the Gata1low mutation in mice. Double hGATA1/Gata1low/0 mice were viable at birth with hematocrits greater than those of their Gata1low/0 littermates but platelet counts remained lower than normal. hGATA1 mRNA was expressed by progenitor and erythroid cells from double mutant mice but not by megakaryocytes analyzed in parallel. The erythroid cells from hGATA1/Gata1low/0 mice expressed greater levels of GATA1 protein and of \u03b1- and \u03b2-globin mRNA than cells from Gata1low/0 littermates and a reduced number of them was in apoptosis. By contrast, hGATA1/Gata1low/0 megakaryocytes expressed barely detectable levels of GATA1 and their expression of acetylcholinesterase, Von Willebrand factor and platelet factor 4 as well as their morphology remained altered. In comparison with Gata1+/0 littermates, Gata1low/0 mice contained significantly lower total and progenitor cell numbers in bone marrow while the number of these cells in spleen was greater than normal. The presence of hGATA1 greatly increased the total cell number in the bone marrow of Gata1low/0 mice and, although did not affect the total cell number of the spleen which remained greater than normal, it reduced the frequency of progenitor cells in this organ. The ability of hGATA1 to rescue the hematopoietic functions of the bone marrow of the double mutants was confirmed by the observation that these mice survive well splenectomy and did not develop myelofibrosis with age. These results indicate that hGATA1 under the control of \u00b5LCR/\u03b2-globin promoter is expressed in adult progenitors and erythroid cells but not in megakaryocytes rescuing the erythroid but not the megakaryocyte defect induced by the Gata1low/0 mutation.The phenotype of mice carrying the  Gata1 blocks the maturation of erythroid cells at the pro-erythroblast stage inducing the cells into apoptosis (Gata1 expression in megakaryocytes (MK) arrests their terminal maturation and retains the cells in proliferation , two transgenic mice lines have been created carrying either the entire hGATA1 gene or its cDNA under the control of a \u03bcLCR coupled with the promoter of the \u03b2-globin gene  is viable at birth  males generated as previously described (Gata1 locus) or Gata1low/low females and their progeny genotyped by polymerase chain reaction (PCR) at birth, as previously described  when males. All the experiments were conducted on Gata1low/0 and Gata1+/0 males containing or not the hGATA1 transgene at 3\u20134\u00a0months of age, unless otherwise indicated. Mice were housed under good animal care practice conditions in the animal facilities of Istituto Superiore Sanit\u00e0 and the experiments were performed according to the protocol n. 419/2015-PR approved by the Italian Ministery of Health and according to the directive 2010/63/EU of the European Parliament and of the Council of September 22, 2010 on the protection of animals used for scientific purposes.Transgenic escribed  were croescribed   and ketamine  by double ligation of the splenic artery and vein, as described in the animal protocol n. 419/2015-PR. See reference  for furtMice were topically anesthetized with lidocaine (one drop/eye) and then blood was collected from the retro-orbital plexus into ethylen-diamino-tetracetic acid-coated microcapillary tubes (20\u201340\u00a0\u00b5L/sampling). Hematocrit (Hct) and platelet counts (Ptl) were determined manually.In Situ Cell Death Detection Kit\u201d , as described by the manufacturer. At the end, slides were counter-stained with propidium iodide (Sigma-Aldrich). Samples were analyzed with a light microscope (Leica) equipped with a Coolsnap video camera for computerized images .Histological  and Transmission Electron Microscopy (TEM) observations were performed as previously described . For imm\u03c1< 1.080) spleen cells separated over standard Ficoll gradient (Sigma-Aldrich) were suspended in Ca++ Mg++-free phosphate buffered saline supplemented with 1% (v/v) bovine serum albumin, 2\u00a0mM EDTA, 0.1% NaN3 and incubated for 30\u00a0min on ice with 1\u00a0\u00b5g/106 cells of phycoerythrin (PE)-conjugated CD117 (anti-cKit), CD71 and CD61, and fluorescein isothiocyanate (FITC)-conjugated anti-CD34, TER119 and CD41 . Apoptotic cells were detected by double staining with FITC-Annexin V (PharMingen) and propidium iodide (5\u00a0\u03bcg/ml). In selected experiments, erythroid cells (TER119pos/CD71pos), megakaryocytes (CD41pos/CD61pos), hematopoietic stem cell  and erythroid-megakaryocyte  and myeloid  restricted progenitor cells were enumerated and eventually prospectively isolated as previously described (Mononuclear cells obtained from liver and marrow and light density (escribed . The sor\u22125\u00a0M \u03b2-mercaptoethanol (Sigma-Aldrich), penicillin, and streptomycin sulfate , and glutamine . Cultures were stimulated with a cocktail of growth factors contained rat SCF , murine IL-3  and GM-CSF , human FLT3-ligand , IL-11  in combination with either thrombopoietin  (megakaryocyte-permissive conditions) or erythropoietin  (erythroid-permissive conditions), as previously described  were analyzed 7\u00a0days after the beginning of the culture, as described (MEP cells were cultured under conditions of limiting dilution (3 cells/mL) in 96-well plates containing Iscove modified Dulbecco medium  supplemented with fetal calf serum , 7.5 \u00d7 10escribed . The culescribed .Gata1 gene, or additional erythroid (Hba-a1 and Hbb-b1) or megakaryocytic  specific genes , with the ABI PRISM 7700 Sequence Detection System (Applied Biosystems). For each gene (X) quantitative values were obtained from the threshold cycle number (Ctx), and expressed as 2Ctx\u2212\u0394, were \u0394Ctx is the difference between the average Ct of the target X gene from that of the housekeeping gene (Gapdh).Total RNA was prepared using a commercial guanidine thiocyanate/phenol method  as described by the manufacturer. Glycogen  was added to each sample as a carrier. cDNA was synthesized from 1\u00a0\u03bcg of total RNA using random primers and SuperScript III . Quantitative PCR was carried out as recommended by the manufacture with TaqMan PCR kits specific for the human or the murine Statistical analysis was performed by one-way analysis of variance Dunnett\u2019s Multiple Comparison and one-way analysis of variance Tukey Multiple Comparison Test, as indicated. The analyses were performed with GraphPad Prism 5 software for Windows .Gata1 locus (Gata1+/0) carrying the hGATA1 transgene (hGATA1/Gata1+/0) were crossed with either CD1 (wild-type at the Gata1 locus) or Gata1low/low females. For each crossing, 10 and 20 separate matings, respectively, were performed. These crossing generated a total of 66 and 99 pups with an average number of pups per mating of 6.6 and 4.9 for CD1 and Gata1low/low mating, respectively  in blood smears not only as expected in Gata1low/0 mice (hGATA/Gata1low/0 littermates (The hematocrit (Hct) and platelet counts of the /0 mice  but alsotermates .hGATA1 rescues the anemia but not the thrombocytopenia induced by the Gata1low mutation.These results indicate that the presence of hGATA1 and of the endogenous murine Gata1 (mGata1) gene expressed by adult hematopoietic progenitor and precursors cells prospectively isolated from the bone marrow of adult Gata1+/0, Gata1low/0 and hGATA1/Gata1low/0 mice (pos/CD36pos cells), expanded in vitro as previously described  prospectively isolated from hGATA1/Gata1low/0 mice. In these mice, expression of hGATA1 persisted at the level of the erythroid precursors while it was barely detectable in megakaryocytes  in Gata1low/0 mice vs. 4.17 \u00b1 5.22 in hGATA1Gata1low/0 mice (n = 6) (p = 0.0078 by ANOVA) while the frequency of Annexinpos Ter119pos cells in the bone marrow from two Gata1+/0 mice analysed in parallel was 0.5 and 0.7.By contrast, the presence of the ant mice . These rhGATA1 mRNA was similarly undetectable in megakaryocytes from Gata1low/0 and hGATA1/Gata1low/0 littermates  and divided by CD34 staining into bipotent erythro-megakaryocytic  and common myeloid/bipotent granulo-monocytic  progenitor cells  and had no effect on the frequency of progenitor cells and megakaryocytes that remained, respectively, lower and higher than normal . In agreement with these observations, the liver from mice containing the human transgene, hGATA1/Gata1+/0 and hGATA1/Gata1low/0 alike, contained detectable numbers of LSK and hematopoietic progenitors, and significantly higher numbers of erythroid and megakaryocyte precursors compared to wild type mice   .hGATA1 induces hematopoiesis in the bone marrow and reduces that in the spleen in mice carrying the Gata1low mutation.These results indicate that the presence of Gata1low mutation increases the proliferation potential of MEP which acquire at the single cell level the ability to generate in vitro, in addition to erythroid cells and megakaryocytes, also mast cells with the phenotype CD117pos/Fc\u03b5RIpos  and megakaryocytes (CD41pos/CD61pos), respectively (hGATA1/Gata1+/0 mice generated a lower number of cells (fold increase \u223c50), the great majority of their progeny was erythroid, with low numbers of megakaryocytes even when the cells were cultured under megakaryocyte-specific conditions, and very few mast cells (CD117pos/Fc\u03b5RIpos) . By contrast with the progeny of Gata1low MEP, that of double mutant MEP contained mostly erythroid cells, with very few mast cells, in cultures stimulated with erythroid specific conditions while the frequency of megakaryocytes in cultures stimulated with megakaryocyte-specific growth factors remained high  . As experyocytes , confirmryocytes . The facned high .mGata1 and hGATA1 mRNA in erythroid precursors and megakaryocytes generated in vitro from MEP cells prospectively isolated from Gata1+/0, Gata1low/0 and hGATA1/Gata1low/0 mice  is expression of hGATA1 erythroid restricted? 2) Since hGATA1 is not expected to be expressed by megakaryocytes, do the double mutants develop myelofibrosis, a disease driven by abnormalities sustained by reduced Gata1 expression in these cells?In this manuscript, we used a standard hGATA1 gene under the control of a \u03bcLCR coupled with the promoter of the \u03b2-globin gene is expressed in hematopoietic cells from adult mice carrying the Gata1low mutation, identified the cells in which the transgene is expressed and analyzed whether the levels of expression sustained by these regulatory sequences are sufficient to rescue the phenotypic abnormalities induced by the mutation. Our results confirmed that embryos carrying the Gata1low/0 mutation are anemic and thrombocytopenic while adult mutants express significantly lower levels of Hct and platelet counts compared to the wild type littermates. We confirmed that in Gata1low/0 mice, the levels of Gata1 transcripts are reduced already in progenitor cells (CMP/GMP and MEP) and not only in erythroid and megakaryocyte precursors. We also confirmed that reduced levels of Gata1 mRNA resulted in lower GATA1 protein content in erythroid cells, which displayed greater apoptotic levels, and in megakaryocytes, that remained morphologically immature. The hGATA1 under the control of \u03bcLCR/\u03b2-globin regulatory sequences was already expressed at the level of progenitor cells (both CMP/GMP and MEP) and of erythroid cells prospectively isolated from hGATA1/Gata1low/0 littermates. These data are consistent with the observation that the \u03bcLCR/\u03b2-globin regulatory sequences are already active at the levels of the stem/progenitor cells, which express low but clearly detectable levels of \u03b2-globin mRNA, and in erythroid cells but not in cells of other hematopoietic lineages such as megakaryocytes , two of which (HSI and HSII) lay within 8\u00a0Kb upstream of the coding sequences and the third one (HSIII) within the first intron  and although expression of hGATA1 is below detection in megakaryocytes prospectively isolated from the bone marrow, it is expressed by megakaryocytes differentiated in culture from the double mutants, the large majority of which has been suggested to represent either niche- or immune-poised MKs (hGATA1 at the level of the multi-potent megakaryocyte precursors prevented their switch to niche-poised cells, thereby rescuing the myelofibrosis trait. Unfortunately, different populations of megakaryocyte precursors poised to generate megakaryocytes and immune-poised or niche-poised megakaryocytes have all the same morphology (To address the second question, we investigated whether ryocytes . In addiryocytes . This apryocytes . In factryocytes  or nicheryocytes . This siof GATA1 . Data frof GATA1 , suggestised MKs . It is trphology , thus thLast but not least, our data have implications to design strategies for the cure of primary myelofibrosis, the most severe of the Philadelphia-negative myeloproliferative neoplasms which has presently no cure . In fact"}
+{"text": "In this paper we analyze the effect of shocks in production networks. Our work is based on a rich dataset that contains information about companies from Slovenia right after the financial crisis of 2008. The processed data spans for 8 years and covers the transaction history as well as performance indicators and various metadata of the companies. We define sales shocks at different levels, and identify companies impacted by them. Next we investigate stress, the potential immediate upstream and downstream impact of a shock within the production network. We base our main findings on a matched pairs analysis of stressed companies. We find that both shock and stress are associated with reporting bankruptcy in the future and that stress foremost impacts the future sales of customers. Furthermore, we find evidence that stress not only results in performance losses but the reconfiguration of the production network as well. We show that stressed companies actively seek for new trading partners, and that these new links often share the industry of the shocked company. These results suggest that both stressed customers and suppliers react quickly to stress and adjust their trading relationships. The network consists of nodes (companies) with directed edges that define supplier and customer relations. This network is characterized by temporal dynamics since companies may change their suppliers and customers especially during turbulent times like the period after the 2008 global crisis.shocks, and may be unable to fulfill their liabilities to others, and therefore impose stress on their upstream supplier and downstream customer partners. The effect of these individual company-level shocks [Multimodal temporal links between companies result in the complex structure of today\u2019s economy. Companies rely on the input and output of their trading partners. These linkages between suppliers and customers form the l shocks , 2 in thPrevious works cover results on economic networks of financial entities \u201314 and rAs reviewed by , only a The dataset is not limited to a single bank since all the information is available from the central bank of the country.The data contains all transactions within the country that have been sent through the Trans-European Automated Real-time Gross settlement Express Transfer systemThe yearly balance sheet data indicates the performance of each company.The data is longitudinal and completely covers the 8 years between 2008 and 2015.Our work contributes to this stream of literature in several ways. We take advantage of a longitudinal dataset that makes it possible to analyzing the dynamics of the production network, especially during the times of the financial crises. In contrast to the earlier literature , we shifstressed and analyze their behavior in the upcoming years.Relying on this information we aim to understand how shocked companies affect the behavior of their partners within the production network. We define shocks based on yearly sales changes available from the balance sheets and consider a company shocked if it experiences a sudden drop in its sales. We define the adjacent, immediate upstream, downstream and bi-directional partners of shocked companies More specifically, as illustrated in Fig.\u00a0In order to address these questions, we employ a matched pairs quasi-experimental design and match each stressed company to a company that does not experience shock or stress and has similar industrial, sales performance and network characteristics as the stressed one. We compare the future aspects of the stressed and control groups, and seek to answer if stress influences future economical performance or induces any changes within the production network.Our results suggest that both shock and stress is associated with a higher chance of bankruptcy, and stress results in future decrease of sales performance. Furthermore, we find that stressed companies quickly adjust their relationships and seek for new trading connections suggesting that this behavior is key for resiliency against idiosyncratic shock propagation. The fact that new links often appear from the same industry as the shocked node indicate that these replace the previously shocked partner.The rest of the paper is organized as follows. We provide a detailed description of the dataset in Sect.\u00a0sales growth, i.e., the yearly relative sales changes of companies. Note that we exclude from our analysis changes larger than 100%, which cover 6% of all the available records , it can connect a newly observed company to an already seen one (Q), and it can connect two companies that we never observed before (R). While several new edges appear each year, the fraction of R edges is low, i.e., most of the new edges connect to an already existing part of the network. In Fig.\u00a0Throughout our analyses we consider the period between 2008 and 2015 where all the listed information is available. Table\u00a0We follow previous related studies that use sales growth as a primary outcome variable , 23, 24.c in year\u00a0y. Since company sales are non-negative, and we restrict our analysis for changes less than 100%, c in year yshocked if \u03bd is a predefined parameter. In other words, we define a company shocked in a year if it suffers a great sales loss but operated without any decrease in sales in the previous year and hence showed no sign of suffering a shock. Note that once a company is shocked in year s, we exclude it from the analysis of the following years First, we define yearly sales growth of a company as stressed companies  from years earlier than y, initially does not indicate decreasing performance in year  Since transactions reflect customer-supplier relations, we distinguish between stressed nodes depending on their relation to the shocked node. The successors of the shocked node are defined as suppliers, and the predecessors of the node are customers. We also distinguish bidirectional relations where cash flow was observed in both ways between the shocked and stressed companies. This categorization results in stressed suppliers, stressed customers and stressed bidirectional partners.We analyze the potential effect of these shocked companies on their network neighborhoods and define see Fig.\u00a0. We const we randomly select a matched control c company that has the same industry classification as the stressed one,has sales y, does not indicate decreasing performance in year y,has never been shocked until year y to\u00a0t.has similar in- and out-degree in year  For degree matching we match nodes with in/out-degrees that are at the same magnitude. This is particularly important since we have shown in Fig.\u00a0For each of the identified stressed company First we investigate if shock events are related to bankruptcies and calculate the fraction of companies that eventually become bankrupt amongst all shocked and non-shocked companies. We repeat the analysis at shock levels between 20% and 80% and report the results of chi-square statistics. Next we compare stressed nodes to their matched control group. We calculate the fraction of bankrupt companies within the two groups at shock levels between 20% and 80% and report the results of chi-square statistics.In order to put the bankruptcy related results into a wider context and estimate the effect sizes of the proposed shocked and stressed statuses, as a secondary analysis, we perform a logistic regression based classification on bankruptcy. We include all companies and aim to predict future bankruptcy based on company performance , the industry classification, the number of immediate relationships (suppliers and customers) and the status of the company . We are following a stepwise approach and in total, we run three models. The baseline model (STEP1) includes the industry classification, the mean total sales, the relative sales growth, the mean number of yearly customers (log transformed) and the mean number of yearly supplies (log transformed). In STEP2 we added the shock status  into the model in addition to the baseline predictors. Finally, (STEP3) the model includes stress  along with all the previous predictors. The continuous predictors are centered around the mean. We provide the statistical significance and parameter estimates of the individual predictors for the best model.In order to assess how stress affects future sales performance, we compare the sales performance of the stressed companies to their control groups in the two years following the original shock event We investigate network dynamics around the stressed and control nodes. We compare the number of new customers, suppliers and bidirectional relations that the stressed and control groups establish in one and two years following the original shock event. As presented in Sect.\u00a0Finally, we ask if stressed companies potentially \u201creplace\u201d their shocked partners and find new connections within the industry sector of the shocked node. We investigate at 50% shock level the new suppliers of shocked customers and the new customers of shocked suppliers. We calculate the ratio of stressed nodes where the shocked neighbor(s) industry categories can be found within the new links initiated in followup years . AltogeWe compare the future sales performance of stressed companies to their matched controls\u2019 performance. Our results are summarized in Fig.\u00a0see Fig.\u00a0b. In consee Fig.\u00a0c\u2013d. Finasee Fig.\u00a0e\u2013f at thNext we investigated whether stress results in future shocks and whether shocks show any cascading behavior see Fig.\u00a0. We calcmentclasspt{minimaFinally, we analyze the number of new links stressed companies initiate (see Figs.\u00a0see Fig.\u00a0c, especiNext we present results in a similar way for new customer links of stressed and control groups in Fig.\u00a0Finally, our results indicate that 14.8% of the new supplier links initiated in year The current study explores the impact of shocks in the production network. We examined a unique dataset containing temporal information on companies for an 8 year period from Slovenia. We found that economic partners of shocked companies have a higher chance of going bankrupt, even if they do not show signs of performance loss at the time of the shocking event. These results suggest that not only sales shocks, but the shock induced stress is related to bankruptcy. It is important to highlight that besides these, other factors including the sales performance, the number of customers, and the industry sector significantly impact the likelihood of future bankruptcy as seen in our logistic regression based results. These findings are in line with previous reports , 22.We hypothesized that stressed companies experience loss in performance in the follow-up years. Our results support this hypothesis. Specifically, we found that stressed customers show a significant drop in sales compared to control companies. However, compared to the stressed customers, suppliers appear to be more resilient to the shock induced stress in terms of sales performance. Bidirectional relationships are more stable in the first year follow-up, while their performance seems to be heavily impacted in the second year. This might reflect a temporal shift in the impact of shock on mutually dependent partnerships. We note that bidirectional partnerships represent a complex form of economical interactions and give place to the interplay of multiple network effects. Detailed analysis of the bidirectional partnerships is out of the scope of the current study, however the increased likelihood of being shocked in this category with the above mentioned performance stability raises important questions for future experiments.The result that stress frequently leads to shock, makes it likely that there is a shock spill over to other neighbors in the network. These results are in line with , where tRegarding the stress induced reconfiguration of the network we hypothesized that the tense urges the stressed party to replace the problematic partner. More specifically, we expected that companies\u2019 new partnership seeking would vary according to their relationship with the shocked neighbor. In line with our expectations customers of the shocked node initiated more new partnerships with suppliers, and suppliers improved the numbers of their customers consistently for at least two years. Furthermore, we found that these new links often share the industry sector of the initially shocked node and hence may be potential replacements. Surprisingly, in case of the suppliers we have observed an emphasised seek for new suppliers at lower stress levels. This might be associated with their above presented stress resilience.While the data and our analyses presents various aspects of the production network, we must note their limitations. Foremost, since no performance indicators were available for foreign companies, we investigated the customer-supplier relations within a single country, which decreases the generalizability of the presented results. Furthermore, since companies are required to send all funds over 50k EUR via the TARGET2 system, the data covers all of the large transactions, but not necessarily all of the smaller transactions that are less than 50k EUR. Some part of the customer-supplier relations may remain uncovered which can lead to an overall underestimation of the effects of stress. Throughout the paper we consider all industry sectors other than governmental and financial services to be part of the production network. Some of the companies within our analyses may not strictly belong to the production network. More information on the companies activities could provide a more precise view of the network itself. Surprisingly, a few of the reported results potentially show trends with the shock threshold, e.g., there is an increasing trend in Fig.\u00a0The data studied is right after the 2008 global financial crisis and therefore we consider this the broad, implicit cause of the disruptions within the nation\u2019s economy. Throughout the analyses we study sales drops that are strong indicators of \u201cshocks\u201d. However, we do not have explicit information on the specific root cause of shocks.In this paper we employ a time sensitive, matched pairs quasi-experimental design and the presented analyses correct for confounders such as the company\u2019s industry sector, current sales, number of customer and supplier links. There can be additional factors to consider and follow-up analyses with different matching criteria can lead to new discoveries. For example, one could restrict the control group to have at least one connection to the industry category of the shocked company. Although we control for several potential confounders, richer datasets may allow to correct for additional variables other than the ones considered in this study.Although our results show that sudden sales losses, shocks, heavily impact their immediate environment, some companies seem to be resilient against stress. Future investigation would be needed to identify potential protective factors that contribute to stress resilience."}
+{"text": "We employ meteorological, hydrological and socio-economic data to build a comprehensive picture of the drought severity, its multiple effects and cross-sectoral consequences in the basin. Time series of different drought indices illustrate the severity of the 2018\u20132019 drought and how it progressed from meteorological water deficits via soil water depletion towards low groundwater levels and river runoff, and losses in vegetation productivity. The event resulted in severe production losses in agriculture (minus 20\u201340% for staple crops) and forestry , while other economic sectors remained largely unaffected. However, there is no guarantee that this socio-economic stability will be sustained in future drought events; this is discussed in the light of 2022, another dry year holding the potential for a compound crisis. Given the increased probability for more intense and long-lasting droughts in most parts of Europe, this example of actual cross-sectoral drought impacts will be relevant for drought awareness and preparation planning in other regions.The 2018\u20132019 Central European drought was probably the most extreme in Germany since the early sixteenth century. We assess the multiple consequences of the drought for natural systems, the economy and human health in the German part of the Elbe River basin, an area of 97,175 kmThe online version contains supplementary material available at 10.1007/s10113-023-02032-3. The Central European drought of 2018\u20132019 was a compound event with two consecutive years of exceptionally low precipitation. Through depleted soil water storage the event also extended into 2020. This drought was probably the most severe in Central Europe for centuries, perhaps even for more than two millennia  and the fact that drought factors (lower precipitation and average soil water capacity) concentrated here.The area of interest is the German part of the Elbe River basin (GEB) covering an area of 97,175 kmAs many data are not available for hydrological basins but administrative units, we often combined federal state data from Berlin, Brandenburg, Saxony-Anhalt, Saxony and Thuringia  regularly publishes monthly 1-km gridded meteorological variables over Germany DWD-CDC ,b,c. TheThe agrometeorological model of the DWD, AMBAV L\u00f6pmeier , n.d. caDaily river discharge data of the Elbe gauges Dresden and Neu Darchau and the Havel gauge Rathenow UP for the years 1961\u20132019 had been obtained from the Global Runoff Data Centre GRDC , KoblenzVegetation status monitoring by the Plant Phenology Index (PPI) was calculated from the Moderate Resolution Imaging Spectroradiometer (MODIS) nadir bi-directional reflectance distribution function (BRDF) adjusted reflectance (NBAR) product (Version 6.0) at a daily time step and 500-m spatial resolution  of the UFZ drought monitor UFZ  is a resing (Eq.\u00a0). As theing (Eq.\u00a0). This dA GRACE-based groundwater index (GGI) was obtained in the same manner from weekly grids of NASA\u2019s GRACE-based shallow groundwater drought indicator  which includes the Havel catchment. The average time lag of a flood wave from Dresden to Neu Darchau is 6.5\u00a0days, and the distance between the gauges along the river course is 480.84\u00a0km which indicates a wave celerity of about 0.9\u00a0m/s. Hence, the streamflow contribution of the intermediate area was estimated by subtracting the respectively time-lagged runoff at Dresden from the runoff at Neu Darchau. Negative contribution values around flood peaks were avoided by considering the flood wave dispersion through gamma kernel smoothing of the Dresden time series. The error of this procedure should be less than that of the original gauge measurements. A map with the three gauges and their (difference) catchments is shown in Fig. To assess drought severity from the streamflow perspective we calculated the Standardized Streamflow Index (SSI) following the Best Monthly Fit (BMF) approach by Vicente-Serrano et al.   was utilized. While primarily based on daily NBAR reflectance in red and NIR bands using MODIS data similar to other vegetation indices, the PPI calculation  were observed in 2019 as well as the record minimum of 35.9% in the Havel area in September of the same year.The UFZ Drought Monitor SMI maps showing the end-of-summer situations in 2018 and 2019 are reproduced in Fig. The drought propagation into the natural systems is shown in Fig.\u00a0Dry conditions in spring during the onset of the vegetation period are a major threat for plants. In 2003, this was the case in many parts of the Elbe River basin in March and April, whereas in 2018 these months were still humid enough, favouring spring vegetation growth that contributed to soil moisture depletion and consequently exacerbated summer drought , see Wellbrock et al. (Based on a former European Council regulation (EEC 3528/86) , the fedk et al. ). Time sRegarding drought effects on biodiversity there are only a few sources specifically focusing on the 2018\u20132019 drought in Eastern Germany. In December 2018 and January 2019, vast amounts of fish died in canal systems near the Elbe estuary. The fishes were dying from aluminium (Al) contamination which damages the gills and inhibits oxygen uptake. Low groundwater levels initiated oxidation processes which led to acidification causing Al dissolution from the clay minerals in the soil. Precipitation events in December 2018 finally transported the contaminated water into the canal system M\u00f6llers ..Ciconia ciconia) which feed on amphibians, especially frogs. In Eastern Germany, the stork population stagnated in recent years while other parts of the country saw certain increases  is closely monitored since their return to Germany in the year 2000. Their main distribution is inside the GEB, and their numbers increased almost linearly from 77 packs in the observation year 2017/2018 to 157 packs in 2020/2021  Rev. 2 Eurostat , indicatIn 2018, GEB crop yield averages dropped by 20\u201340% compared to their pre-drought levels cf. Figs  and S11.Although many meat and dairy farmers had to buy expensive extra fodder from abroad, the drought is not visible in livestock numbers or slaughtering rates. To quantify the economic impact on the agricultural sector as a whole, we inspected the developments of gross value added (GVA) and workforce in the agricultural sector Fig. . Over thAccording to CLC 2018  dates back to 2004. Based on figures collected by Br\u00e4mick  and 697.9 (2019) billion ton-kilometres. Road and rail had quite stable transport shares of about 71% and 18.5%, respectively DESTATIS .Marginally affected was the hauling capacity on German waterways, dropping from 55.5 billion ton-kilometres in 2017 to 46.9 billion ton-kilometres in the first drought year DESTATIS . ConsideThis section refers mainly to office work or indoor activities: (J) information and communication; (K) financial and insurance activities; (L) real estate activities; (M) professional, scientific and technical activities; (N) administrative and support service activities; (O) public administration and defence, compulsory social security; (P) education and (Q) human health and social work activities.No outages in electricity and tap water supply are a good precondition for indoor work, only air conditioning is still more of an exception than the rule in the GEB, and many indoor work places became uncomfortably hot in the summers of 2003, 2018 and 2019. This problem is reflected in recent demand peaks for air conditioning sets as seen in the imports and exports visualized in Fig. Econometric time series on the service sector\u2019s productivity in the five-state aggregate are shown in Fig.\u00a0The region-specific drought-related health risks were heat, ultra-violet (UV) radiation and air pollution. The German Weather Service (DWD) issues daily heat alerts based on the concept of perceived temperature , another European drought year has materialized, and stability boundaries are tested anew, probably with increased vulnerabilities , caused significant economic damages in agriculture and forestry but only modestly affected the secondary and tertiary economic sectors. Tap water supply was generally continuously maintained; however, the associated summer heat caused health issues and excess mortality.This cross-sectoral analysis demonstrates drought-related interdependencies between the natural and socio-economic systems which are understudied but will become more significant with increased frequency and duration of droughts. Emerging evidence on the link between anthropogenic climate forcing and drought  multifaceted challenges in Central Europe, such as price inflation in the Eurozone or insecure food and energy supplies, any socio-economic crisis cannot not easily be attributed to drought alone, save socio-economic disruptions are likely to become more frequent and more damaging under future droughts. To avoid worst-case scenarios like a blackout Below is the link to the electronic supplementary material."}
+{"text": "Inbred mice (C57Bl/6) display wide variability in performance on hippocampal-dependent cognitive tasks. Examination of microdissected dentate gyrus (DG) after cognitive testing showed a highly significant negative correlation between levels of bone morphogenetic protein (BMP) signaling and recognition memory. Cognitive performance decline during the aging process, and the degree of cognitive decline is strongly correlated with aging-related increases in BMP signaling. Further, cognitive performance was impaired when the BMP inhibitor, noggin, was knocked down in the DG. Infusion of noggin into the lateral ventricles enhanced DG-dependent cognition while BMP4 infusion led to significant impairments. Embryonic overexpression of noggin resulted in lifelong enhancement of recognition and spatial memory while overexpression of BMP4 resulted in lifelong impairment, substantiating the importance of differences in BMP signaling in wild-type mice. These findings indicate that performance in DG-dependent cognitive tasks is largely determined by differences in levels BMP signaling in the dentate gyrus. Throughout life, the generation of new neurons in the brain, or neurogenesis, are known to be important for helping to maintain cognitive abilities. The current study describes a significant mechanism contributing to the changes in neurogenesis in aging and provides a specific molecular target for intervention for aging-related changes in cognitive function.The precise cellular and molecular basis for variations in cognitive abilities are largely unknown. Cognitive ability has been associated with numerous genetic loci as well as with environmental experiences, and the interplay of biology and experience helps to shape brain function . VariabiA unique feature of the hippocampal DG is the presence of neural stem cells (NSCs) that give rise to new neurons throughout an individual\u2019s lifetime. Numerous studies have documented significant age-related declines in hippocampal neurogenesis, as well as declines in hippocampus-dependent cognition, particularly in recognition and spatial memory functions, in rodents . The parA strong candidate signaling pathway was the bone morphogenetic protein (BMP) pathway because of the substantial amount of data supporting its role as a critical regulator of hippocampal neurogenesis and spatial memory function . IncreasThus, the aim of the current study was to investigate whether differences in BMP signaling in the DG of inbred mice are correlated with the observed natural variations in cognitive behavior in adult and in aged mice. Examination of microdissected DG after cognitive testing showed a highly significant negative correlation between levels of BMP signaling and cognitive performance. Further, both cognitive performance and hippocampal neurogenesis declined during the aging process, and the degree of cognitive decline was highly correlated with aging-related increases in BMP signaling. Interventions that decreased or increased BMP signaling in both adult and aging mice led to lifelong changes in cognitive performance that correlated with the level of BMP signaling. Thus, performance in these hippocampus-dependent cognitive tasks is largely determined by the level of BMP signaling in the DG.All animal procedures were approved by the Institutional Animal Care and Use Committee (IACUC). All experiments were performed in accordance with the Public Health Service Policy on Humane Care and Use of Laboratory Animals. Behavioral analysis was performed during the light cycle. Wild-type (C57Bl/6) male mice of various ages were purchased from The Jackson Laboratory. The creation of the NSE-noggin and NSE-BMP4 transgenic mice was described previously .2) for 10\u2009min of habituation. On day 3, mice were placed in the arena with two identical objects (familiarization) that were placed 25\u2009cm apart  and were allowed to explore the objects for 20\u2009min. On day 4, mice were placed in the arena with a familiar object and a novel object and were allowed to explore the objects for 20\u2009min. The novel object was placed on the nonpreferred side of the arena, as determined in the familiarization phase, to avoid side preference. Identical and novel objects were similar in size but differed in color and shape. Object exploration was measured using LimeLight3 Software by designating two zones (with one object in each) which tracked each animal. Percent exploration was calculated by measuring time spent exploring each object over 20\u2009min on both familiarization and novel testing days. Animals that did not explore for at least 20 s were excluded from analysis. The discrimination index was calculated by subtracting the time spent with the familiar object from the time spent with the novel object and divided it by the sum of the time spent with both objects [(Tnovel \u2013 Tfamiliar)/(Tnovel + Tfamiliar)].Novel object recognition (NOR) was performed over 4\u2009d. On days 1 and 2, mice were placed in the empty arena , preloaded with the noggin or BMP4 solutions and attached to the cannula with a 1\u2009cm plastic catheter, was implanted into the subcutaneous pocket before insertion of the cannula into the ventricle. Each pump delivered noggin (R&D) at 50\u2009ng/\u03bcl or BMP4 (R&D) at 30\u2009ng/\u03bcl for 15\u2009d at a rate of 0.25\u2009\u03bcl/h. The concentrations and the rate of delivery were decided according to preliminary testing. Behavioral testing was performed on day 14 (NOR) and 15 (Y-maze) followed by killing.BrdU  was administered via four intraperitoneal injections at 50\u2009mg/kg over the course of 8 h. Animals were killed 24 h after the last BrdU injection via transcardiac perfusion with cold PBS.Following transcardiac perfusion, the DG from one hemisphere was microdissected on ice and mechanically homogenized in T-Per extraction reagent  containing Halt protease and phosphatase inhibitors . Lysates were centrifuged at 10,000 rpm for 15\u2009min at 4\u00b0C and supernatant collected for Western blot analysis. Primary antibodies used were: mouse anti-BMP4 , rabbit anti-noggin , rabbit anti-phospho-Smad1/5/8 , rabbit anti-Smad1/5/8 , and mouse anti-GAPDH . Blots were imaged using Azure Biosystems C600 imaging system and densitometry analysis performed using ImageJ. When appropriate, blots were stripped using stripping buffer  following manufacturer\u2019s protocol.m glycine in PBS for 1 h at room temperature (RT). Primary antibody was diluted in blocking buffer and incubated overnight at 4\u00b0C. Sections were washed three times in PBS and incubated for 1 h at RT with a fluorophore-conjugated secondary antibody and DAPI for nuclear staining. Following three final washes in PBS, cover glass was applied with ProLong Gold Antifade Reagent.Following transcardiac perfusion with cold PBS, one hemisphere was removed to be postfixed in 4% PFA for 2 h. Brains were transferred to 30% sucrose for 24 h before being embedded in OCT and stored at \u22128\u00b0C; 25-\u03bcm-thick sections were serially mounted onto Superfrost slides using a cryostat (Leica). Tissue sections were washed three times in PBS, blocked in 5% normal goat serum (Jackson ImmunoResearch) with 0.25% Triton X-100 and 0.3 m sodium tetraborate, pH 8.5 twice for 10\u2009min and washed in PBS three times for 5\u2009min. Blocking and antibody incubation were then performed as described above.For BrdU detection, slides were incubated in 2N HCl for 20\u2009min at RT before initial blocking step. Slides were quenched with 0.1 Images were acquired using a Leica TCS SP5 Confocal Microscope. Z-stacks of five images at 40\u00d7 magnification of areas of interest in the dentate gyrus (DG) were obtained with the step size set at 2\u2009\u03bcl. Z-stacks  of equal thickness and equivalent rostro-caudal position were quantified for each sample. Stereological cell counting was performed using ImageJ software. For per volume quantification, cell counts were normalized to the volume of the DG cell layer imaged.To investigate the connections between natural variations in cognitive performance and BMP signaling in inbred mice, we first examined variations in recognition memory using the novel object recognition (NOR) test. NOR takes advantage of the natural bias of mice to explore novel stimuli and can be modified to probe each phase of memory formation from acquisition to consolidation to recall. This measure of cognition is largely dependent on the DG although it also involves perirhinal cortex . During r = \u22120.6337, p\u2009=\u20090.0027) with the level of BMP signaling, measured as the ratio of pSMAD1/5/8 to total SMAD1/5/8  cells; r = \u22120.6286, p\u2009=\u20090.003) between the level of BMP signaling and performance on the NOR test  promoter . As expe10.1523/ENEURO.0213-22.2022.f5-1Extended Data Figure 5-1A) Y-maze performance to above young WT (2-month-old) levels. B, Preference for novel object is comparable between young WT and noggin-infused aged WT. Unpaired t test, *p\u2009<\u20090.05. Download Figure 5-1, TIF file.Noggin infusion improves cognitive performance in aged animals to similar levels as young animals. Infusion of noggin into the lateral ventricles of 22-month-old WT mice improves (Cognitive ability has been associated with numerous genetic loci as well as with environmental experiences, and the interplay of biology and experience helps to shape brain function . To idenThe NOR test evaluates recognition memory and nonspatial learning, which involves detection of novelty that primarily, although not exclusively, involves the hippocampus . There wTo further investigate this, we directly increased levels of BMP signaling by infusing a lentiviral vector to silence noggin expression. This resulted in a decrease in levels of neurogenesis and impaired cognitive performance. Conversely, infusion of noggin into the ventricles improved cognitive function in both adult and aged mice, while BMP4 infusion achieved the opposite. These observations further confirmed the causal relationship between levels of BMP signaling and cognitive performance. While the present study does not establish a causal relationship between the changes in behavior and neurogenesis, our group recently showed a direct causal relationship between activity of newly generated granule neurons resulted from adult neurogenesis with depression-like behavior . Future Cognitive functions decline with age in concert with many cellular and molecular changes in the brain including an increase in BMP signaling in the DG of both mice and humans . We founIn summary, these findings indicate that recognition and spatial memory performance are strongly correlate with the level of BMP signaling in the DG, and that aging-related increases in BMP signaling in the DG play a role in the age-related declines in these cognitive functions. These data thus identify this molecular pathway as a target for the treatment of age-related cognitive decline."}
+{"text": "For years, cancer has remained the second leading cause of death in U.S. and Europe even though cancer mortality has decreased, as new advances in medical treatment have made this decrease possible. Chemotherapy has remained the gold standard and \u201cone-size-fits-all\u201d treatment for cancer, yet this approach has lacked precision and, at times, failed. Recent studies attempt to mimic the spatial microenvironment of cancer tissue to better study chemotherapy agents by combining patient-derived cells and three-dimensional (3D) scaffold, bioprinting, spheroid, and hydrogel culturing. This commentary aims to collect and discuss recent findings concerning the combined application of biomaterials with patient-derived cancer cells to better study and test therapies in vitro, that will further personalize and facilitate the treatment of various cancers, and also address the limitation and challenges in developing these 3D models.Although advances have been made in cancer therapy, cancer remains the second leading cause of death in the U.S. and Europe, and thus efforts to continue to study and discover better treatment methods are ongoing. Three-dimensional (3D) tumor models have shown advantages over bi-dimensional (2D) cultures in evaluating the efficacy of chemotherapy. This commentary aims to highlight the potential of combined application of biomaterials with patient-derived cancer cells as a 3D in vitro model for the study and treatment of cancer patients. Five studies were discussed which demonstrate and provided early evidence to create 3D models with accurate microenvironments that are comparable to in vivo tumors. To date, the use of patient-derived cells for a more personalized approach to healthcare in combination with biomaterials to create a 3D tumor is still relatively new and uncommon for application in clinics. Although highly promising, it is important to acknowledge the current limitations and challenges of developing these innovative in vitro models, including the need for biologists and laboratory technicians to become familiar with biomaterial scaffolds, and the effort for bioengineers to create easy-to-handle scaffolds for routine assessment. Although current trends show that overall cancer death rates have decreased for men, women and children, cancer remains the second leading cause of mortality in the U.S. behind cardiovascular disease and is responsible for millions of deaths worldwide ,2. In 20While considerable progress has been made in 3D bioprinting, many obstacles remain in creating tumor models that provide physiological relevance and reliable data for the development of personalized treatment. The ability to replicate tumor microenvironments and establish vasculature for appropriate oxygen and nutrient distribution to specific areas within the 3D culture are challenges that need to be addressed ,6,7. DesConventional preclinical cancer models have generally used tumor cell lines as their source of cell derivation. Immortalized cell lines have been a preference for in vitro and in vivo preclinical models because of their ease of acquisition, production, reproducibility, and proliferation rates compared to primary cells ,9. Cell Despite their upsides, immortalized cell lines have a handful of drawbacks that significantly affect their overall effectiveness as tumor modeling agents. Their biggest drawback occurs in their production; because cells derived from immortalized cell lines must have uncontrolled tumor-like growth in ex vivo conditions, they may suffer from altered genetic material, differing biological or tumorigenic properties compared to primary cells. Pan et al. discovered proteomic differences of the hepatoma cell line Hepa1-6 compared to primary hepatocytes . Other tPatient-derived cells for use in 3D models offer a unique and relatively new approach to tumors. Unlike tumor cell lines that have garnered phenotypic and functional changes throughout their use, patient-derived cell models allow for the retention of most biochemical and physiological features from the in vivo tissue ,18,19. FAdvancements in tissue engineering have slowly allowed biomaterials to play a bigger role in creating these 3D cancer models than using only cells . Not only do biomaterials allow for a more realistic 3D structure, but they offer more realistic cell-to-cell interactions and microenvironments as opposed to 2D models ,24,25. AAmong synthetic polymers, aliphatic polyesters are another class of biomaterials that is usually biodegraded through hydrolysis and their characteristics can be controlled easily . One of Natural polymers, due to their water solubility, usually result in hydrogels, which are common types of biomaterials for 3D cancer models due to their ease of encapsulating the cells of interest. Synthetic polymers, which are usually more hydrophobic in nature are thermoplastic and soluble in non-water solvents. Therefore, they often result in scaffolds fabricated either a sponge or fiber form, obtained via emulsion, compression molding, 3D printing or electrospinning, among other methods. Such prefabricated structures can offer microenvironments for 3D cancer models, in which geometrical features, porosity, mechanical properties and roughness can be all tuned. Just like hydrogels, they provide the vital cell\u2013cell and cell-ECM interactions that would mimic real tumors. Additionally, these scaffolds account for controlled mechanical properties, thus can be stiffer and more stable and can better withstand shear stress, as opposed to hydrogels .Personalized healthcare is a much more effective form of treatment for very complex diseases that have been, for the longest time, receiving broad and comparatively generic treatments. Tumors and their complete environment in a body are incredibly complex and individualized and the utilization of patient-derived cells with the combination of biomaterials to create a 3D model may be a promising method to address this challenge. Cell lines are most often used to create a 3D in vitro model, while patient derived cells are most often used as patient derived xenographs (PDX) models in vivo models. Comparatively, very few studies use both patient derived cells in tandem with biomaterials to create an in vitro 3D models of tumors. The flow chart explaining the process to build those models for personalized therapy is shown in There are many applications of biomaterials as 3D in vitro tumor models; however, they are usually coupled with cell lines instead of patient-derived cells. For example, Sun et al. utilized bioprinted scaffolds seeded with hepatocellular carcinoma HepG2 cell line  and AbboTo the best of our knowledge, there are only a few studies reporting the combination of both patient-derived cells and biomaterials as 3D in vitro models, which are summarized in w/w)% and a poly/poly (PEOT/PBT) copolymer as their structure materials [In their study, Ricci et al. isolated a pancreatic ductal adenocarcinoma (PDAC) cells from an explant of a patient, created different scaffold architectures, and used the scaffold as well as the PDAC cells in conjunction to explore biomaterial-based 3D tumor models . Three daterials . PDAC ceaterials . Matrix aterials . MMP-2 aaterials ,50, are aterials . Resultsaterials .In conclusion, this study showed the possibility of using various biomaterial scaffolds with patient-derived cells to find a compatible pair that could work to model real pancreatic tumors. Among them, spongy scaffolds, like those obtained via PVA/G emulsion and freeze-drying, were the most suitable. They showed volume swelling ratio higher than 200% and were mechanically soft, with material stiffness increasing with G content \u226520%, due to enhanced sites of G crosslinked by glutaraldehyde .w/w)% were similar in terms of morphology, swelling behavior, water stability, physico-chemical and viscoelastic mechanical properties, with an apparent compressive modulus of about 7 kPa at strain rates of 0.005 s\u22121 [w/w)% sponges showed high volume porosity  and pore interconnectivity (97.44%), the latter under pore-pore openings \u226551.2 \u00b5m [The comparative analyses demonstrated that PVA/G 70/30 and PVA/G 80/20  with custom ECM components (PA-ECM) for ex vivo tissue modeling with increased adaptability . This mo+ cells from acute myeloid leukemia (AML) and myeloproliferative neoplasm (MPN) patients for up to 3 weeks.Andr\u00e9s Garc\u00eda-Garc\u00eda et al. demonstrated how cellular niches may be built in a 3D hydroxyapatite scaffold and perfusion flow-based bioreactor system and used to maintain, expand, and regulate the phenotypic and functional properties of patient-derived human malignant hematopoietic stem and progenitor cells (HSPCs) ex vivo . The fulThe use of patient-derived cells for a more personalized approach to healthcare and biomaterials to create 3D tumor are relatively new and uncommon. Although highly promising due to their more accurate cellular environments that mimics that of the patient, it is important to acknowledge the current limitations of these innovative in vitro models. From having to mimic the molecular biology, physiology and genetic makeup of these cancer cells and ultimately reproduce the heterogenous nature of cancer cells, these models face multiple obstacles. A key challenge is developing a way to create a network of vasculatures in tumors. Without these capillary networks, the 3D tumor growth would be difficult and possibly impossible to occur. Nonetheless, studies have shown that if these bioprinted models are able to account for cellular and molecular factors, it is possible to transform stem cells into endothelial cells, thus promoting angiogenesis ,56. MoreAs technology and knowledge about how these cancers rapidly progresses, current conventional cancer models still carry several limitations. In future studies, it will be vital to minimize the cost and focus on the development and fabrication of less time-consuming models, while accounting the importance of every cellular and molecular factors when using patient-derived cells and designing these 3D tumor constructs. Furthermore, keeping cell viability and replicating the complex environment of tumors, such as vascular network and surrounding stromal cell to cell interactions, are areas of research that ongoing and future studies are and should focus on. A recent study by Contessi Negrini et al. has suggested the use of human mesenchymal stromal cells to pregenerate bone ECM on a 3D printed polyurethane scaffold, to be used, after cell lysis, as a bioactive and biomimetic environment for osteosarcoma cell growth , which d"}
+{"text": "N =\u2009377) in which participants were randomly assigned to provide their impression of either (1) poor people or (2) rich people, suggest that the two types of power produce different effects on perceptions of warmth and competence. Personal power increased stereotype consistent perceptions of warmth whereas social power increased stereotype consistent perceptions of competence as well as agency, which was identified as a separate dimension. The pattern of results is discussed in view of previous work on power effects and stereotyping, and potential explanations and suggestions for future research are outlined.The present study expands previous research on the effects of power on stereotyping by investigating the impact of two types of power  on two universal dimensions of social perception; warmth and competence. Results from an experiment ( Stereotyping has been a central domain of inquiry in social psychology for decades, and a number of studies suggest that social power can affect the tendency to stereotype others. However, independence from others, personal power should lead to increased stereotyping compared to social power, which is associated with interdependence and hence the need for interaction and responsibility, which should lead to reduced stereotyping. A similar line of reasoning was presented by However, So far, few if any studies have investigated the effects of social vs. personal power on stereotyping that involves warmth and competence. Accordingly, the main purpose of the present study is to contribute to filling this gap in the literature by investigating whether social power and personal power produce different effects on perceptions of warmth and competence.For the purpose of the present research, two social groups that tend to be viewed as outgroups and ambivalently stereotyped, yet in the opposite direction, were chosen for inquiry: rich people and poor people, respectively. Poor people tend to be perceived as higher in warmth than competence, whereas rich people tend to be perceived as higher in competence than warmth e.g., .other-profitable, i.e., affects other people, competence represents a self-profitable trait, i.e., affects the possessor and his/her odds of goal-achievement.Based on the line of reasoning by Based on the line of reasoning above, the following exploratory hypothesis was formulated for empirical inquiry in the present study:Hypothesis: Social and personal power will have different effects on stereotyping of warmth and competence.An online experiment was conducted to test the hypotheses. Participants who provided their informed consent took part online on a voluntary basis and rated their own social and personal power before being randomly assigned to rate either poor people or rich people.In the vignette, participants were instructed to \u201cthink about people that you have either read about, heard about, or know yourself that you have reason to believe  and that are likely to be viewed as (poor/rich),\u201d and to provide their personal impression of the given group.p \u2264\u20090.05) based on the current sample size. 74.3% of participants were female. Age was measured in 10-year intervals, with a median of approximately 50\u2009years old. 34% held a bachelor\u2019s degree, while 52% held a master\u2019s degree or PhD.Participants were recruited on Facebook and LinkedIn. A sample of no less than 300  was aimed for in order to reach satisfactory statistical power (>0.80) to detect small effect sizes in multiple regression analyses with up to five predictors cf. . 377 parSocial power was measured with eight items drawn from the Sense of Power scale , of which four  were drawn from Competence was initially measured with four items  drawn from agency attributed to the target social group. These results correspond to previous research that indicates that competence and agency represent distinct dimensions in social perceptions  to 7 (strongly agree).Demographic control-variables included gender, age , education level, income level, and self-estimated financial status (from poor to very good).Warmth =\u20094.813, SD\u2009=\u20090.882, t(201)\u2009=\u200912.753, p <\u20090.001, d =\u20090.987] and agency .Poor people were rated close to scale midpoint on competence  and agency . The scores on warmth were significantly higher than the scores on competence  and agency  compared to warmth. The scores on competence and agency were also significantly different .Rich people, in contrast, were rated close to scale midpoint on warmth  and significantly higher on competence  than rich people, yet significantly lower on competence  and agency . Hence, the results reveal that the rich as well as the poor were ambivalently stereotyped, yet in a reversed pattern, as expected.When comparing rich people and poor people, ratings were significantly different across all dependent variables. Poor people were rated as significantly warmer Yet, it may be argued that as part of the research design, powerful participants were asked to rate powerful (rich people) and powerless participants were asked to rate powerless (poor people). However, perceptions of competence (and agency) were affected by social power only, whereas personal power had no effect, and the differences in effects between personal and social power are of primary interest here. Future studies may, nevertheless, benefit from using other social groups, i.e., ingroups as well as outgroups, in which the power dimension is less salient.It should also be noted that the sample was skewed in terms of gender distribution, with women comprising the majority (74.3%) of the sample. Previous research has shown that women are more likely to participate in voluntary, non-compensated online surveys than men . The genFuture studies are needed to test the generalizability of the pattern of findings presented here across settings, samples, and social groups or individuals. Future studies on the effects of social and personal power on stereotyping may also benefit from investigating the role of perceived status and competition and the distinct emotions associated with different patterns of stereotyping, e.g., pity, envy, admiration, and contempt, in order to shed light on potential moderators and other explanatory mechanisms cf. .The present study contributes to existing research on the effects of power on stereotyping. The findings suggest that two types of power, i.e., social power and personal power, produce different effects on perceptions of warmth and competence, as well as of agency, within and across two groups: rich people and poor people. These findings highlight the need for more research exploring the malleability of power effects in general and the effects of social vs. personal power on social perception and stereotyping in particular.The raw data supporting the conclusions of this article will be made available by the authors, without undue reservation.The present study was designed in accordance with the European Data Protection Regulation (GDPR) and no sensitive personal data were collected. Data collection was performed using the digital survey tool Nettskjema, which is offered by the University of Oslo (Norway) and specifically designed to meet Norwegian privacy requirements. All potential participants were informed that (1) participation was voluntary and could be terminated at any time without providing any reason, and (2) the study was strictly anonymous and designed in accordance with privacy regulations, i.e., that no information that could identify individual participants directly or indirectly was collected. All participants were required to provide their informed consent.The author confirms being the sole contributor of this work and has approved it for publication.The author declares that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest.All claims expressed in this article are solely those of the authors and do not necessarily represent those of their affiliated organizations, or those of the publisher, the editors and the reviewers. Any product that may be evaluated in this article, or claim that may be made by its manufacturer, is not guaranteed or endorsed by the publisher."}
+{"text": "In the published article, there was an error in affiliation(s) 29. Instead of \u201cDepartement of Pediatrics, Diabetes Research Institute, IRCCS San Raffaele, Milano, Italy\u201d, it should be \u201cDiabetes Research Institute, IRCCS San Raffaele Hospital, Milan, Italy\u201d.The authors apologize for this error and state that this does not change the scientific conclusions of the article in any way. The original article has been updated.All claims expressed in this article are solely those of the authors and do not necessarily represent those of their affiliated organizations, or those of the publisher, the editors and the reviewers. Any product that may be evaluated in this article, or claim that may be made by its manufacturer, is not guaranteed or endorsed by the publisher."}
+{"text": "There was a significant reduction in time above range (TAR) (p = 0.001) and increase in time below range (TBR) (p < 0.001), Children using isCGM showed a more pronounced improvement in TIR during camp compared to rtCGM-users (p = 0.025). The increase in TIR strongly correlated with numbers of scans per day in isCGM-users . Compared to isCGM-users, rtCGM-users showed significantly less TBR. The TIR target was met by 30.8% of participants during camp. Conclusion: Glycemic control improved significantly during the camp. However, on average, the therapy goal (TIR > 70%) could not be achieved despite great professional effort.Background: The aim of this study was to assess and compare the time in range (TIR) of children with type 1 diabetes (T1D) before and during a diabetes summer camp using different therapy modalities. Methods: A retrospective analysis of continuous glucose monitoring (CGM) data collected from 26 children with T1D  before and during a 14-day summer camp. CGM methods: 50% intermittently scanned CGM (isCGM) and 50% real-time CGM (rtCGM). No child was using a hybrid closed loop system. Results: Mean TIR during camp was significantly higher than before camp ((67.0 \u00b1 10.7%) vs. 58.2% \u00b1 17.4%,  Continuous subcutaneous glucose monitoring (CGM) facilitates diabetes management and helps improve glycemic control ,2,3 in pThe ALERTT1 study showed that a switch from isCGM to rtCGM improved TIR in adults significantly after 6 months , while uDirect comparisons between the effect of rtCGM vs. isCGM use on glycemic control are scarce ,11,12,13The application of therapy modalities can be examined much better at the controlled, but real-life environment of a diabetes camp. To date, there is no pediatric study directly comparing CGM therapy modalities in a diabetes camp setting. Nor is there a study that dealt more closely with the achievement of glycemic targets (time in range (TIR), time above range (TAR) and time below range (TBR)), during a diabetes camp, paying particular attention to the type of sensor used. This seemed particularly interesting to us, because there are clear differences when using isCGM and rtCGM, such as: self-determined or caregiver-determined checking of sensor values (scanning) for isCGM systems and predefined target range-triggered alarms of values outside the target range for rtCGM systems. In addition, we were interested in whether the scanning behavior of isCGM users changed at the camp compared to the period before camp and whether this change was associated with glycemic control. This is particularly interesting as there are currently no concrete recommendations for the daily number of scans per day in children using an isCGM.Therefore, we retrospectively compared glycemic control  in childAs described in our previous publication , data weThe main study \u201cDiabetes Knowledge and Skills in Children with Type 1 Diabetes before and after participation in a diabetes camp\u201d was registered and approved by the ethics board of the Medical University of Vienna . Only data from children using CGM systems before and during camp was analyzed in this sub-study. All children continued to use the insulin regimen and CGM system they had already been using at home. CGM systems used by the participants were: Medtronic Enlite (ENL), Dexcom G6 (DEX), both rtCGM-systems and Abbott Freestyle Libre (FSL), an isCGM-system. Inclusion criteria were documented sensor use for at least 70% of the time over at least 14 consecutive days during a period of 30 days prior to the camp and documented sensor use for more than 70% of the time during camp. This resulted in 26 participants. See Details on the procedures during the camp were already published . At campInsulin dose adjustments  were performed by diabetologists. The insulin dosage was continuously adapted as required with consideration of current glucose trends, previous values and planned activities and meals.CGM was routinely performed throughout the camp. During the day sensor readings were checked by children together with medical staff several times a day with additional fingerprick measurements before every meal, exercise activity, before bedtime, in case of signs of hypo- or hyperglycemia and signal loss . During During the last two camp days, all data (two camp weeks and 30 days prior camp) were downloaded from all devices (CGM-systems and pumps) for later analysis.Data analysis was performed retrospectively using downloaded data (as described above) and evaluation of paper charts. Time in range (TIR) (70\u2013180 mg/dl (3.9\u201310 mmol/L)) (6), time below range (TBR) (<70 mg/dL (3.9 mmol/L)), time above range (TAR) (>180 mg/dL (10 mmol/L)) and time using CGM (%) were calculated for each individual separately and are given as percentages. Additionally, TIR, TBR, TAR and time using CGM were calculated separately for the pre-camp and camp timespan. Time before camp was defined as the time from 13 June 2019 0:00 am to 13 July 2019 4:00 pm. Time during camp was defined as the time from 13 July 4:00 pm to 27 July 12:00 pm. Additionally, for TIR, TBR and TAR daytime as well as nighttime was analyzed separately. Nighttime was defined as the period when children were supposed to be in bed (10.00 pm until 7.00 am). Glycemic targets were defined according to the international consensus on TIR : TIR > 7Individual total daily doses (TDD) of insulin (IU/kg/d) and amount of carbohydrate consumption were extracted from pump data and paper charts and further analyzed regarding percentage of basal insulin. Pre-camp information on insulin dose prescription of pen-users were collected by questionnaires directly prior camp. Body mass index (BMI) was calculated as weight in kilograms divided by squared height in meters. In order to adjust for age and sex, BMI standard deviation score (BMI-SDS) values were derived applying the least mean square method   using agt-tests were used for comparisons between groups. Pre-camp and Camp TIR, TAR, TBR and sensor usage were compared using paired t-tests, in case of normal distribution. For quantitative data without normal distribution Mann\u2013Whitney U-Test and Wilcoxon Rank Test were used for comparison, and data are given as median . Pearson\u2019s correlation coefficients (two-tailed) were used to describe the strength of relationships between the dependent variables  and potential covariates . An alpha-level of p < 0.05 (two-tailed) was considered statistically significant. Baseline characteristics are given as mean \u00b1 standard deviation, median  or percentages, as appropriate. All statistical analyses were performed using Microsoft Office Excel 2019 or SPSS 26.0. Differences between pen vs. pump users and rtCGM vs. isCGM users were analyzed using chi-square tests for qualitative data. For quantitative data with normal distribution, Baseline characteristics of patients are displayed in p = 0.093. A median number of 28.5  days during one month before camp, and 12.5  days during camp were analyzed, with a median sensor usage of 95 % before camp and 96 % during camp, p = 0.004 , while TBR significantly increased from 3.2 \u00b1 2.3 to 5.5 \u00b1 3.0% (p < 0.001) (TAR was significantly lower during camp (27.5 \u00b1 10.2%) than before camp  . p < 0.001). While before camp, the target for TAR (<25%) was not met\u2014neither during the day nor during the night, during camp, the TAR target was met during night. Significant pre-camp to camp differences for TIR, TAR, TBR were also seen, when daytime and nighttime were analyzed separately . During At camp, the target for TBR (<4%), was only achieved during the day, but not during night, where TBR even increased to 7.6 \u00b1 5.0% .In comparison to pre-camp, total daily insulin (TDD) dosage was reduced by 18.3 \u00b1 11.0% during camp. There was no difference in the extent of reduction between the pen and the pump group, or between isCGM and rtCGM users. Percentage of basal insulin was slightly increased during camp . Comparing changes in TIR, TAR and TBR pre-camp to camp between pen and pump users resulted in no statistical differences \u00a0Table S2p = 0.025) and decrease in TAR , , . TBR andOverall, TBR increased both in isCGM and rtCGM users compared to pre-camp. However, TBR was significantly pronounced in the isCGM group, both during the camp and the pre-camp period. Daytime TBR did not differ between isCGM and rtCGM users, neither pre-camp nor during camp. During daytime, absolute differences in TBR between the two groups were small. While there was no significant change in daytime TBR in the isCGM group, the rtCGM group showed a small but statistically significant increase in daytime TBR at camp  compared to the period before the camp , which was nonetheless still within the target range of TBR < 4%. Nighttime TBR between the two groups showed a distinct difference. In both groups, there was a clear increase in nocturnal hypoglycemia (nighttime TBR), which was particularly pronounced in the isCGM group. On average, isCGM users spent 11.3 \u00b1 3.9% of the night below the target range, whereas in rtCGM users the TBR-target (<4%) was still met.p = 0.004). During camp, there was no significant difference in TAR between the two groups. Before camp, daytime TAR differed significantly between isCGM and rtCGM users, . The number of daily isCGM-scans increased significantly pre-camp to camp . The increase in TIR was particularly more pronounced when pre-camp TIR was low . In isCGM users the increase in daily scans showed a strong, positive association with TIR-increase  targets during the camp, while 11 participants achieved none. During the camp no severe hypoglycemia, no ketoacidosis or any other relevant intercurrent illness requiring medication or treatment at a hospital occurred.Overall, TIR improved significantly compared to the reference period before camp. Nonetheless, the consensus targets were achieved only in a third of our patients, despite great commitment and 24/7 effort by an interdisciplinary team. Only three children achieved all three TIR/TAR/TBR targets. Two out of these three participants were still in remission phase, with a diabetes duration of 3 months, and used DEX and insulin pens. However, compared to the ALERTT1 trial, where only 28% of rtCGM and 15% of isCGM users reached the TIR target , the resWith a mean HbA1c of 7.3 \u00b1 0.8% the diabetes control of camp participants within the three months before camp had already been good and is comparable to the glycemic control in this age group as evident in the Prospective Diabetes Follow-up registry (DPV) , which iThe improvement in glycemic control amounted to a significant increase in TIR and a significant decrease in TAR. Despite a significant reduction in TDD and continual adjustments of the insulin dose, there also was a significant increase in TBR, which was presumably a consequence of an increase in exercise at camp. Overall, nighttime was better than daytime glycemic control. Particularly, there was a clear decrease in TAR, comparable to the results of the ALERTT1 trial . While tIn general, more time was spent in hypoglycemia during the night than during the day, which is comparable to the results of the CORRIDA trial that investigated the effects of 4 days of physical activity on glycemic control in adults . This suA major difference in glycemic control was evident between isCGM and rtCGM groups, despite having the same level of professional, multidisciplinary care. Most children with isCGM were able to significantly improve their pre-camp glycemic control during camp. They almost achieved the same high level of TIR observed in children using an rtCGM system. Specifically, this improvement was mostly a result of a reduction in TAR. With an average of 18 scans per day at camp, scans were performed almost hourly in the isCGM group. As the increase in daily scans pre-camp to camp was strongly associated with the improvement in TIR, the number of scans seem to have been a key to success in the isCGM group. This is an interesting finding, as the number scans in our study, are much higher than in other studies ,25,26,27However, an essential difference between isCGM and rtCGM systems was found in nighttime TBR with 11.3% compared to 3.9%. This result was in line with results from the CORRIDA study, which also reported how differences in rtCGM and isCGM concerning hypoglycemia were most notable during night . Although both rtCGM and isCGM systems are covered by the Austrian health insurance, most children participating at the summer camp used the FSL (isCGM) system . A possiHowever, it may be that precisely these alarms, which are often perceived as annoying , made thRemarkably, there was no difference in the glycemic control between pen or pump users with both groups having a similarly good glycemic control. This finding supports the hypothesis that CGM system use is probably more essential for achieving good glycemic control than the way in which insulin is administered . The overall improvement in glycemic control may also be based on a certain peer effect. Together as a group the participating children were possibly more motivated to carry out the diabetes therapy with more effort and care . Moreover, the major difference to the situation at home is that at the camp, the children were looked after 24/7. Even during the night, glucose controls were carried out regularly and it was possible to react immediately and appropriately to alarms and glucose values outside the target range. The structured daily routine with regular rounds of measurements before meals and during the night had a positive effect, especially in the group of isCGM users, by increasing their scanning frequency. With almost 18 scans per day, the frequency of scans at the camp was very high. It is possible that a certain peer effect caused the children to additionally perform scans when their peers were scanning for symptoms such as hypoglycemia, even when they themselves were not presenting with such symptoms.However, of note is that this high level of effort provided by a multidisciplinary diabetes summer camp cannot be carried out by all families at home, especially not during the night.Although this study provides valuable insights into the use of various CGM systems and improvement of glycemic control in children participating in a diabetes camp, there are several limitations. First, the cohort was small due to the inherently limited number of camp participants. In addition, the retrospective design of the study represents a important limitation and that the selection of the camp participants and the choice for the individually applied CGM systems were not the responsibility of the study team. Furthermore, although we did have access to the pump and sensor data for one month before the summer camp, we had limited information about parental support, meals, exercise, etc. at home. As the group of children using their insulin pump with a PLGS mode was small, comparing children using PLGS with other groups would not have yielded meaningful statistical results. It can therefore not be ruled out that a part of the better performance in terms of hypoglycemia prevention in the rtCGM group was attributable to the use of PLGS. However, even in the group of children who used the combination of a Medtronic 640G pump and Enlite sensors, more than half did not reach the glycemic targets during camp.Beyond that, we do not have data on glycemic control after camp participation, nor age- and gender matched control groups, who did not participate in a diabetes camp at all.In contrast to rtCGM users, isCGM users showed a significant improvement in glycemic control under camp conditions. However, this was probably mainly due to the structured monitoring not only during the night, which partially replaced the missing alarm function, and to suboptimal at-home use of isCGM systems. In isCGM users, there was a clear correlation between the improvement in glycemic control and the increase in scan frequency. The strong increase in TBR among isCGM users shows once again that the management of nocturnal hypoglycemia is a challenge, even or especially in a camp setting and that spot measurements are not sufficient.On average, during and before camp, TIR was higher in rtCGM than in isCGM users. As glycemic control in the rtCGM group had already been good before camp, it was not further improved, or rather differences did not reach statistical significance. However, even in the rtCGM group, more than half of the patients did not achieve a TIR > 70% during the camp.Without the use of artificial pancreas or hybrid-closed loop systems, there seems to be a certain ceiling effect under real-life conditions regarding improving glycemic control in children as the glucose targets\u2014on average\u2014were not achieved despite great and proactive effort and 24/7 medical care. The fact that even in this well-controlled camp setting among children with T1D with already good diabetes management, glycemic targets could only be reached by a minority, underlines the burden for families with children with T1D and raises questions whether these glycemic targets are achievable, at least during a diabetes camp loaded with varied activities. Several studies have so far shown that artificial pancreas systems represent a benefit for families and children with T1D . These s"}
+{"text": "In these times of pandemic, the acceptance or rejection of vaccines has become increasingly clear, with a considerable rise in the anti-vaccine movement in Spain. It is important to understand the attitudes that lead a person to refuse vaccination in order to develop more effective public health campaigns. The objective of this study has been to study the psychometric properties and measurement invariance of the Vaccination Attitudes Examination (VAX) scale in a Spanish sample. Confirmatory factor analysis and structural equation modelling have been used to study the psychometric properties of the VAX. Likewise, the measurement invariance by gender and educational level has been studied. The structure of four related factors for VAX is confirmed, as well as its predictive value, since the factor \u201ctrust in the benefit of the vaccine\u201d clearly predicts the choice to be vaccinated. The strong measurement invariance by gender and educational level is also confirmed. The comparison of latent means between groups indicates that there are no differences by gender in any factor. However, people with a high educational level present higher scores in factors \u201cconcern about unforeseen future effects\u201d, \u201cconcern about commercial effects and speculation\u201d and \u201cpreference for natural immunity\u201d. The VAX is presented as a reliable and valid tool to assess four different factors related to attitudes towards vaccines in Spain. Future studies of its cross-cultural invariance may help to determine the main factors that lead people not to be vaccinated in order to develop more effective public health campaigns.The online version contains supplementary material available at 10.1186/s40359-022-00929-y. Despite the proven efficacy of vaccines in reducing mortality and morbidity from vaccine-preventable diseases, vaccination rates have been declining for years in many areas of the world even before the coronavirus pandemic . This haAlthough the decision to be vaccinated or not is individual, it is influenced by the historical, political and sociocultural context of the reference country where the vaccination is carried out . The medAttitudes and Behaviours Regarding Vaccination Decisions , and SRMR\u2009=\u20090.103. The four-related factor model showed very good fit regardless of the value of \u03c72 (\u03c72 (48)\u2009=\u2009156.87, p\u2009<\u20090.001), with CFI\u2009=\u20090.957, RMSEA\u2009=\u20090.062, RMSEA 90% CI\u2009=\u2009, and SRMR\u2009=\u20090.043. All factor loadings were statistically significant (p\u2009<\u20090.001) and above 0.580. Likewise, all the correlations among the factors were statistically significant (p\u2009<\u20090.001) and in the expected sense  was good for all the factors: F1 (CR\u2009=\u20090.818), F2 (CR\u2009=\u20090.717), F3 (CR\u2009=\u20090.790) and F4 (CR\u2009=\u20090.802). The Average Variance Extracted (AVE) was good for F1 (AVE\u2009=\u20090.697), F3 (AVE\u2009=\u20090.564) and F4 (AVE\u2009=\u20090.607), but slightly low for F2 (AVE\u2009=\u20090.467).In Table p\u2009=\u20090.970; F2) b\u2009=\u20090.020, z\u2009=\u20090.387, p\u2009=\u20090.699; F3) b\u2009=\u2009\u2212\u00a00.053, z\u2009=\u2009\u2212\u00a00.659, p\u2009=\u20090.510; F4) b\u2009=\u2009\u2212\u00a00.041, z\u2009=\u2009\u2212\u00a00.575, p\u2009=\u20090.565).Regarding the measurement invariance models, the scalar invariance model for gender presents a change in CFI of the scaled metric model above the established limit. However, following Cheung and Rensvold (2002), a change of 0.010 or greater in CFI must appear together with a change of 0.015 or greater in RMSEA, in order to consider that there is no invariance, or there must be a change of 0.030 or greater in SRMR, which is not the case here either. Therefore, since the excessive change only occurred in CFI, it can be considered that the results showed scalar invariance, and the estimated latent means by gender and by educational level could be compared. After fixing latent mean values to zero for men, no differences for gender were observed in any of the factors: F1) b\u2009=\u20090.003, z\u2009=\u20090.037, p\u2009<\u20090.001) and F4 \u201cpreference for natural immunity\u201d .The results of the invariance model by educational level showed strong invariance. After fixing latent mean values to zero for the \u201cup to higher education\u201d group, it was found that only the first factor (trust of vaccine benefit) showed non-significant differences . However, people with university studies showed significantly higher means in F2 \u201cconcern about unforeseen future effects\u201d , F3 \u201cconcern about commercial effects and speculation\u201d . As the sign of the coefficient is positive (\u03bb\u2009=\u20090.602), and the reference group is 1 (being vaccinated), this result indicates that the higher the score in this factor, the greater the probability of being vaccinated against Covid. The coefficients of the other two factors were not statistically significant. The odds ratio for the four factors are 6.777 (SE\u2009=\u20092.511), 0.669 (SE\u2009=\u20090.812), 1.185 (SE\u2009=\u20090.665), and 0.535 (SE\u2009=\u20090.344), respectively. On the other hand, the estimated value of b for the Vaccine variable is \u2212\u00a01.858 (p\u2009<\u20090.001). This means that, from a low level on the trait, people are more likely to be vaccinated than not to do so.In Fig.\u00a0The objective of this study has been to adapt the Vaccination Attitudes Examination (VAX) scale in a Spanish sample, and to study its psychometric properties as well as the measurement invariance by gender and educational level. The results obtained in the CFAs report a very good fit of the model of four related factors in the present sample, as in the previous studies carried out with the VAX. Likewise, the corrected homogeneity indices and the Composite Reliability index report good reliability indicators for both the items and the subscales.It should be noted that the value of the Average Variance Extracted is slightly lower than the cut-off point established in the second factor (worries over unforeseen future effects of the vaccine). This result could indicate that this factor may have less weight when explaining or predicting whether a person could be vaccinated or not, depending on the score obtained on it. Likewise, the existence of measurement invariance by gender and educational level has been verified, which indicates that it is possible to make comparisons between the latent scores in the factors for these groups.The results indicate that, in this sample, there are no statistically significant differences in any of the VAX factors between men and women. However, there are differences depending on the level of studies in three factors: F2 \u201cconcern about unforeseen future effects\u201d, F3 \u201cconcern about commercial effects and speculation\u201d and F4 \u201cpreference for natural immunity\u201d. Specifically, people with completed university studies present higher estimated latent scores in the three factors. However, there are no differences between both groups in Factor 1 (trust of vaccine benefit). These results may be in line with those found in some studies. A review of the literature found studies in China, Lebanon, Israel, Bangladesh, and the United States in which higher educational level had been identified as associated with vaccine hesitancy . HoweverOn the other hand, the results of the validity model clearly indicate that the first factor of the VAX (trust of vaccine benefit) is the only significant predictor of whether a person decides to get vaccinated or not, while the other three factors are not relevant for predicting vaccination in this sample. Furthermore, only people with fairly low levels of being vaccinated or not (b\u2009=\u2009\u2212\u00a01.858), decide not to be vaccinated. In other words, only people who show high levels of mistrust in vaccines will decide not to get vaccinated. These results make sense if we take into account that more than 95% of the sample report having received the coronavirus vaccine. Perhaps for this reason, only the first factor predicts vaccination. In other words, despite showing a certain mistrust of the vaccine itself, of governments and pharmaceutical companies, and a certain preference for natural immunity, the vast majority of people in this sample have decided to get vaccinated. This is probably because, despite possible doubts or distrust of the vaccines developed against the coronavirus, the confidence in the vaccines is much higher.Among the limitations of this study is the sample, since it is a non-probabilistic sample, and therefore, not representative of the population. Even so, the percentage of people in this sample who have been vaccinated is practically the same as that of Spain on the dates on which the sample was collected . LikewisIt would be very interesting to carry out cross-cultural studies with the VAX to check which factors predict whether or not to be vaccinated depending on the country, since in the European Union report  it has bThe Vaccine Examination Attitudes (VAX) scale has shown adequate psychometric properties in Spain. Its structure of four related factors and its concurrent validity to predict whether people have been vaccinated or not are confirmed. Likewise, this scale presents measurement invariance by gender and educational level. It is confirmed that it is a very useful instrument to evaluate attitudes towards vaccines in Spain, which would allow obtaining more information about attitudes towards specific vaccines in the event of possible new pandemics, as well as to alleviate the slight rise in the anti-vaccine movement in Spain.Additional file 1. Items of the Vaccine Attitudes Examination (VAX) scale in Spanish."}
+{"text": "S-adenosylhomocysteine hydrolase (AHCY) deficiency results mainly in hypermethioninemia, developmental delay, and is potentially fatal. In order to shed new light on molecular aspects of AHCY deficiency, in particular any changes at transcriptome level, we enabled knockdown of AHCY expression in the colon cancer cell line SW480 to simulate the environment occurring in AHCY deficient individuals. The SW480 cell line is well known for elevated AHCY expression, and thereby represents a suitable model system, in particular as AHCY expression is regulated by MYC, which, on the other hand, is involved in Wnt signaling and the regulation of Wnt-related genes, such as the \u03b2-catenin co-transcription factor LEF1 (lymphoid enhancer-binding factor 1). We selected LEF1 as a potential target to investigate its association with S-adenosylhomocysteine hydrolase deficiency. This decision was prompted by our analysis of RNA-Seq data, which revealed significant changes in the expression of genes related to the Wnt signaling pathway and genes involved in processes responsible for epithelial-mesenchymal transition (EMT) and cell proliferation. Notably, LEF1 emerged as a common factor in these processes, showing increased expression both on mRNA and protein levels. Additionally, we show alterations in interconnected signaling pathways linked to LEF1, causing gene expression changes with broad effects on cell cycle regulation, tumor microenvironment, and implications to cell invasion and metastasis. In summary, we provide a new link between AHCY deficiency and LEF1 serving as a mediator of changes to the Wnt signaling pathway, thereby indicating potential connections of AHCY expression and cancer cell phenotype, as Wnt signaling is frequently associated with cancer development, including colorectal cancer (CRC). S-adenosylhomocysteine hydrolase (AHCY) is an enzyme that catalyzes the hydrolysis of S-adenosylhomocysteine (SAH) to produce adenosine (Ado) and homocysteine (Hyc) ,2,3. SAHSo far, AHCY deficiency has been linked to a range of metabolic disorders, including liver disease . Also, AHowever, the pathogenic effects of AHCY deficiency at molecular level still appear elusive. Understanding the mechanisms that lead to aversive conditions and diseases as a result of AHCY deficiency is important for developing effective strategies for the prevention and treatment of these conditions. Thus, in this study we investigated the effects of AHCY downregulation on the colon cancer derived model cell line SW480.To do so, we enabled short hairpin RNA (shRNA)-mediated gene silencing in SW480 cells in order to resemble AHCY deficiency at cellular level. The efficiency of generating AHCY-deficient environments was evaluated by determining the concentrations of crucial metabolites SAM and SAH in the AHCY-deficient SW480 cells. Subsequently, after establishing effective AHCY silencing, we performed RNA sequencing to analyze changes in gene expression levels in response to AHCY down-regulation. To contextualize the RNA-seq data, we deployed ingenuity pathway analysis (IPA) for predicting changes to signaling networks and related downstream effects, and to identify new targets or candidate biomarkers in the context of various biological systems. We also performed Western blotting to confirm data obtained from RNA sequencing, by assessing the protein levels of key components of signaling pathways of interest.Besides the major role of AHCY in the regulation of the cellular methylation potential, we show that AHCY downregulation can impact a wide range of cellular functions. Our findings provide new insights into the molecular mechanisms underlying the effects of AHCY downregulation, in particular on lymphoid enhancer-binding factor 1 (LEF1), a member of the T-cell Factor (TCF)/LEF1 family of high-mobility group transcription factors, and a downstream mediator of the Wnt/\u03b2-catenin signaling pathway. The Wnt pathway is highly conserved and involved in various cellular processes, including embryonic development, tissue homeostasis, stem cell maintenance, and cell differentiation. This result bodes well with previous findings that implicate disorder of Wnt signaling in various diseases, including cancer and neurodegenerative diseases . On the The levels of S-adenosylmethionine (SAM) and S-adenosylhomocysteine (SAH) were measured in AHCY-deficient cells to investigate the impact of AHCY deficiency on the metabolism of these compounds. Compared to the control cells, the AHCY-deficient cells exhibited a significant increase in the amount of SAH, with levels approximately two-fold higher . In the mRNA sequencing of SW480 cells yielded an average of 65 million paired-end reads per sample, with a read length of 151 nucleotides. The reads were aligned to the reference genome  using DRAGEN RNA Pipeline (Version 3.9.5) available on BaseSpace Sequence Hub , with an average mapping rate of 98.1% of total reads. RNA quantification was performed using the aforementioned BaseSpace tool, and differential expression analysis was performed using the DRAGEN Differential Expression tool  that utilizes DeSeq2 algorithm to identify differential expresses genes between two conditions.p-value < 0.05 and fold change > 0.5). Of these differentially expressed genes, 1350 were upregulated and 2277 were downregulated in the treated group compared to the control group.Overall, we identified approx. 15,000 expressed genes in SW480 cells, with 3627 genes showing significantly different expression levels between treated and control groups  was used to analyze the data generated by mRNA sequencing, indicating significant differences in gene expression in several biological processes and pathways. We found 523 genes related to cellular movement, 605 related to cellular development, and 600 genes related to cellular growth and proliferation to be differentially expressed, respectively . We observed changes in the lymphoid enhancer-binding factor 1 (LEF1) gene expression levels. Accordingly, we have observed changes in Wnt signaling , Table 3Other changes within the Wnt pathway include WNT6 (Wnt family member 6) with a highly increased expression. Wnt6 is highly conserved in various species, mainly considered to be a member of the \u03b2-catenin-dependent Wnt signaling pathway.Besides the upregulation of LEF1 and its possible regulatory role in Wnt signaling, we have observed the reduced expression of cadherin 12 (CDH12) .Also, we show increased ALCAM expression (activated leukocyte cell adhesion molecule). The expression of ALCAM correlates with the expression of Snail proteins, showing Snail 1 and Snail 2 to be more active . Snail pAlso, significant alterations in genes associated with tumor cell invasion were detected, such as significant upregulation of TGF\u03b21, ROAR, DAB2, BMP6, NOS2, PLXN2, and CADPS exhibited, and significant downregulation of TCF4 .The transcript levels of Cyclin A, Cyclin B, and CDK1 were found to be significantly increased . Cyclin There is an established connection between c-MYC and AHCY. Namely, c-MYC regulates expression of AHCY in human breast cancer cells. Thus, we have identified several proteins that are potentially regulated by MYC . Among tAdditionally, upregulation and activation of STAT3, MYC, CDC25A, and BCL2 is shown , suggestAHCY-deficient SW480 cells exhibit significant upregulation of genes important for the tumor microenvironment pathway, such as MMP19, MMP24, and CSF2, as well as upregulated activation of PLAU and BCL2 .We have observed higher expression of TIAM1 and activation of Rac1 . TIAM1 aRNA-seq data revealed an interesting observation regarding the expression of G protein-coupled receptor (GPCR) signaling. We found a downregulation of Adora receptors (GPCR) signaling in the AHCY-deficient cells , suggestWe observed activation of ROCK kinase, which further contributes to cytoskeletal remodeling and cell contractility . Namely,Western blotting results confirmed efficient lentiviral mediated knockdown of AHCY gene expression in SW480 cells, with significantly decreased AHCY protein levels a.Also, Western blotting revealed a significant increase in the protein levels of LEF1 in AHCY-deficient SW480 cells when compared to the control cells b. QuantiIn order to imbalance the cellular SAM-to-SAH ratio and inflict changes to the cellular methylation potential, we knocked-out endogenous AHCY in the model cell line SW480, which leads to an accumulation of SAH. The elevated levels of SAH in the AHCY deficient cells may have implications for cellular processes that rely on proper methylation, such as gene expression regulation and epigenetic modifications.Indeed, we have established a new link between S-adenosylhomocysteine hydrolase and cancer cell signaling by analyzing differentially expressed pathways in AHCY deficient SW480 cells. Namely, after AHCY knockdown, these cells exhibit significantly increased LEF1 protein levels, placing LEF1 into a complex interplay of various signaling pathways and molecular players involved in tumor cell migration and invasion, in particular the Wnt signaling pathway, where the upregulation of LEF1 possibly is disrupting the TCF/LEF transcription factors ratio.Namely, LEF1 is part of the Wnt/\u03b2-catenin signaling pathway, which includes for example genes such as c-Myc, LBH, Oct4, NANOG that have been associated with the upregulation of proteins typically involved in human breast cancer, gastrointestinal tumors, prostate cancer, leukemia, and others ,33,34,35Cyclin D1 is involved in cell cycle progression, especially in the G1 phase, and is necessary for growth and proliferation. They also serve as downstream effectors of Wnt signaling and are activated by the recruitment of LEF1 to their respective promoter sites. Namely, the promoters for c-myc and cyclin D1 contain LEF1 consensus sequences that allow \u03b2-catenin-LEF1 to bind and modulate c-myc and cyclin D1 expression. Other downstream target genes involved in proliferation could be affected as well, such as survin, and VEGF ,37,38,392+\u2014dependent proteolytic enzyme) [Point mutations of LEF1 located in exons 2 (K86E) and 3 (P106L) of LEF1 result in increased promoter activity and expression for c-myc and cyclin D1, causing increased leukemia cell proliferation . Altered enzyme) . These s enzyme) . Namely, enzyme) ,46,47,48 enzyme)  but is f enzyme) , a shiftTo conclude: LEF1 is a crucial component of the Wnt signaling pathway. It is a transcription factor that interacts with \u03b2-catenin to regulate the expression of Wnt target genes. In the absence of Wnt signaling, \u03b2-catenin is typically targeted for degradation. However, when the Wnt pathway is activated, \u03b2-catenin accumulates in the nucleus and forms a complex with LEF1. This complex activates the transcription of Wnt target genes, which are involved in various cellular processes, including cell proliferation and differentiation.The precise mechanisms and consequences of these interactions may vary depending on the cellular context, specific target genes, and extracellular signals present. Further investigations are necessary to fully elucidate the intricate interplay between LEF1 and these canonical and non-canonical pathways in the context of our study, considering their potential impact on gene expression and cellular processes.So far, the hallmark of EMT is the loss of epithelial marker expression, typically indicated by the presence of E-cadherin, with a gain in mesenchymal marker expression such as of N-cadherin and vimentin accompanied by invasive phenotype . TherefoE-cadherin together with \u03b2-catenin as an adaptor protein establishes links to the actin cytoskeleton. Under physiological conditions, cytoplasmic \u03b2-catenin remains in an inactive state by being bound to the APC/GSK3\u03b2/Axin/CK1 degradation complex and undergoes phosphorylation for ubiquitination. Wnt signaling inhibits this degradative process by phosphorylating and inhibiting the GSK3\u03b2 complex. Under conditions that amplify aberrant Wnt signaling, \u03b2-catenin translocates into the nucleus and binds to TCF-4/LEF-1 proteins to induce Wnt target genes such as c-Myc, cyclins, MMP, etc., leading to uncontrolled cell proliferation and growth . In the Besides the upregulation of LEF1 and being part of the Wnt/\u03b2-catenin signaling pathway with possible regulatory roles in aforementioned processes, we have observed the reduced expression of cadherin 12 (CDH12) that has been implicated in promoting increased metastatic potential and cell migration . The losContributing to potential migratory capacity might be enhanced expression of ALCAM, which is involved in cancer cell migration, in conjunction with the activation of the EMT pathway. ALCAM facilitates interactions between cells and their surrounding environment, and influences cytoskeletal rearrangements, promoting cellular protrusions that expedite directed cell migration. The expression of ALCAM correlates with the expression of SNA1, which is evident in our data .Snail family members  TGF\u03b21\u2019s elevated activity aligns with invasion promotion, (b) ROAR\u2019s surge suggests heightened invasiveness, (c) DAB2\u2019s rise echoes invasion dynamics, (d) BMP6\u2019s elevation points to tumor progression, (e) NOS2\u2019s increase connects to invasiveness, (f) PLXN2\u2019s upregulation implies migration involvement and, (g) CADPS\u2019s rise aligns with invasiveness ,67,68,69Interestingly, in the context of cell migration and invasion, we found downregulation of Adora receptors (GPCR), suggesting a potential alteration in cellular responses to external stimuli. This downregulation may place the tumor cells under increased stress, making them more competitive for limited resources and driving the activation of mechanisms responsible for cell migration and invasion.Additional cytoskeletal dynamics are possibly mediated through signaling by Rho Family GTPases, fostered by the observed activation of ROCK kinase, which contributes to cytoskeletal remodeling and cell contractility. Namely, Rho GTPases, including Rho, PIP5K, and ROCK, are key regulators of cytoskeletal dynamics, including downstream effectors, such as FAK , which exhibits increased activation suggesting an enhanced focal adhesion turnover and cell-substrate adhesion, including cytoskeleton reorganization ,71. ThusIncreased transcript levels of Cyclin A, Cyclin B, and CDK1 indicate a potential modulation of cell cycle dynamics in response to AHCY deficiency. Cyclin B, in collaboration with CDK1, orchestrates the transition from the G2 phase to the mitotic phase, enabling successful cell division . The incRB1, when inactive or phosphorylated, releases its inhibitory effect on E2F transcription factors. The active E2F factors, in turn, promote the transcription of genes involved in DNA replication and cell division. TFDP1 interacts with E2F, forming the E2F/TFDP1 complex, which enhances the transcriptional activity of E2F. This complex further promotes the expression of genes required for cell cycle progression .The activation of the E2F/TFDP1 complex leads to the transcription of genes involved in various phases of the cell cycle, such as G1/S transition, S phase, G2 phase, and M phase. However, it is unclear whether the dysregulated cyclin signaling observed in AHCY deficient SW480 cells may be influenced by aberrant LEF1 activity and its interplay with the Wnt pathway.Significant perturbations in expression levels have been observed for several proteins that are potentially regulated by MYC, but also MYC itself. Namely, MYC exerts its regulatory role by directly binding to the regulatory regions of distinct genes such as SOX5, SON, OLR1, LRG1, and COL4A1, which have been found to be significantly associated with MYC activity, specifically in terms of their potential downregulation. Proteins SOX5, SON, and OLR1 have been implicated in various aspects of cancer progression and metastasis . SOX5, aSignificant changes have been detected in the tumor microenvironment pathway including genes MMP19, MMP24, and CSF2, as well as PLAU, BCL2, TIAM1 and Rac1. These changes might be attributed to the increased LEF1 protein levels, suggesting potential implications for the modulation of the tumor microenvironment in response to AHCY deficiency.In addition, CSF2, also known as GM-CSF (Granulocyte-Macrophage Colony-Stimulating Factor), is a cytokine that plays a crucial role in the regulation of immune cell development, function, and inflammation. In addition to its immunomodulatory functions, emerging evidence suggests that CSF2 also contributes to cancer cell migration and invasion in the context of cancer metastasis, and indeed we detected highly increased expression of CSF2. In epithelial ovarian cancer cells, the activation of the CSF2/p-STAT3 pathway leads to the enhancement of stem cell-like properties in cancer cells .TIAM1 acts as a GEF, a protein that facilitates the exchange of GDP (guanosine diphosphate) for GTP (guanosine triphosphate) on Rac1. This exchange shifts Rac1 into its active, GTP-bound form, triggering downstream signaling pathways that promote cell migration. Within the existing scientific literature, there is a firmly established comprehension of TIAM1\u2019s integral role in cell proliferation and tumorigenic potential ,82.Loss of TIAM1 or RAC1 inhibition induces cell death via BAX/BAK-mediated apoptosis. TIAM1-Nur77 interaction is required for small cell lung cancer (SCLC) cell survival ,83.In addition, TIAM1 was elevated in thyroid cancer, and TIAM1 knockdown repressed thyroid cancer cell proliferation and promoted ferroptosis through regulating Nrf2/HO-1 axis. Taken together, these findings may suggest that TIAM1 plays a significant role in the tumor microenvironment signaling pathway by activating cell proliferation and tumorigenic potential .The activation of the Wnt signaling pathway in the context of increased LEF1 protein expression and reduced AHCY expression may occur through the following potential mechanism: epigenetic regulation of Wnt pathway genes. Reduced DNA and RNA methylation due to AHCY deficiency can disrupt the epigenetic regulation of genes within the Wnt signaling pathway. Hypomethylation-induced upregulation of Wnt ligands and receptors can result in an increased availability of Wnt ligands, facilitating enhanced binding to cell surface receptors. This series of events initiates intracellular signaling, ultimately culminating in the activation of the Wnt pathway . In summTaken together, our findings provide valuable insights into the complex interplay of various signaling pathways and molecular players involved in tumor cell migration and invasion. Understanding these mechanisms at a molecular level may pave the way for the development of targeted therapeutic interventions aimed at disrupting these pathways and inhibiting tumor metastasis. Further investigations into the precise molecular mechanisms underlying the observed alterations and their implications for tumor progression will be crucial for a comprehensive understanding of tumor biology.2.SW480 cells were obtained from the American Type Culture Collection (ATCC) and cultured in DMEM  supplemented with 10% fetal bovine serum  and 1% penicillin-streptomycin  at 37 \u00b0C in a humidified atmosphere with 5% COHEK293T cells were obtained from the American Type Culture Collection (ATCC) and cultured according to SW480 cells. Cells were sub-cultured every 2\u20133 days and passages 5\u201310 were used for all experiments.6 cells/dish and incubated overnight. The cells were transfected with 5 \u03bcg of the short hairpin RNA (shRNA) lentiviral vector plasmids shRNA2 and shRNA4  and pMD2.G (1.25 \u03bcg) using Lipofectamine 3000 , according to the manufacturer\u2019s instructions. For the production of control cells, we used SHC016 non-target shRNA plasmid , in combination with psPAX2 and pMD2.G plasmids. After 24 h, the transfection medium was replaced with fresh medium. The supernatant containing functional lentiviral particles was collected 48 h and 72 h post-transfection, pooled, and filtered through a 0.45 \u03bcm syringe filter .HEK293T cells were seeded in a 10-cm dish at a density of 5 \u00d7 102. Prior to lentiviral transduction, cells were tested for antibiotic resistance to puromycin using the MTT assay.SW480 cells were cultured in DMEM media supplemented with 10% fetal bovine serum (FBS) and 1% penicillin-streptomycin in a humidified incubator at 37 \u00b0C and 5% CO50) was determined using Excel.Cells were seeded at a density of 2000 cells per well in a 96-well plate and incubated for 24 h to allow for cell attachment. Puromycin was added at various concentrations  and incubated for 48 h. Following incubation, the media was removed, and the cells were washed with phosphate-buffered saline (PBS). MTT solution (5 mg/mL) was added to each well and incubated for 4 h at 37 \u00b0C. The MTT solution was removed, and the formazan crystals were dissolved in dimethyl sulfoxide (DMSO). Absorbance was measured at 570 nm using a microplate reader . The concentration of puromycin that resulted in 50% inhibition of cell growth  at a final concentration of 8 \u03bcg/mL. After 24 h, the transduction medium was replaced with a fresh medium containing the appropriate antibiotic  at a concentration of 1 \u03bcg/mL. The cells were then cultured for 3 days to allow for the selection of transduced cells.SW480 cells were seeded in a 6-well plate at a density of 2 \u00d7 106 cells using TRIzol\u00ae Reagent  following the manufacturer\u2019s instructions. Two different cell passages were used to extract RNA both for shAHCY and shCTRL cells and treated as a biological replicate. RNA quantity was determined using a Qubit 3.0 Fluorometer and Qubit\u00ae RNA BR Assay Kit . Agilent 2100 Bioanalyzer and Agilent RNA 6000 Nano Kits  were used to assess the sample quality. TruSeq Stranded mRNA Library Prep Kit , NP-202\u20131001) was used to prepare libraries from 90 ng of total RNA. The collected libraries were analyzed on a Bioanalyzer 2100, diluted to 1.4 p.m., and sequenced on an Illumina NextSeq500 System using NextSeq500/550 High-Output v2 Kit, with 75 cycles . Run setup, direct data streaming, demultiplexing, and analysis were performed at the BaseSpace Sequence Hub  using the RNA Express BaseSpace App with default analysis parameters. Signaling pathway analysis was done by Ingenuity Pathway Analysis software . The IPA Core Analysis was run with the Causal Network analysis option on the uploaded datasets for transcriptome data. Additional relevant parameters include the measurement value type for transcriptome log2 (fold change), a cut-of range: \u22120.5\u20130.5; focus on: both up/down-regulated, and species: human. The p-value was calculated using the right-tailed Fisher\u2019s exact test.Total cell RNA was extracted from 1 \u00d7 103VO4  at a final concentration of 1 mM. Following sonication on ice . After centrifugation at 14,000 rpm at +4 \u00b0C. The protein concentration in the supernatant was determined using a Pierce BCA Protein Assay Kit . Proteins were separated by SDS-PAGE electrophoresis and transferred onto nitrocellulose membranes using the Trans-Blot\u00ae TurboTM Transfer System  and Mini Nitrocellulose Transfer Packs , according to the manufacturer\u2019s recommendations with turbo settings for transferring proteins of a wide range of molecular weights. To verify the successful transfer and quantify total proteins on the membrane, the proteins were briefly stained with a Ponceau S solution  and then rinsed with TBS-T buffer , 150 mM NaCl, 0.1% Tween-20). The membrane was then blocked with blocking buffer  for 1 h at room temperature (RT) and washed 3 times for 15 min with TBS-T buffer . The appropriate primary antibodies, e.g., anti-AHCY , anti-LEF1 , anti-STAT3 , and anti-GAPDH , were diluted in blocking buffer according to the manufacturer\u2019s recommendation, and the membranes were incubated with it for 2 h at RT or overnight at +4 \u00b0C, respectively. The membranes were washed 3 times for 15 min with wash buffer, and the mouse IgG Fc binding protein Horseradish Peroxidase (HRP) conjugated secondary antibody , diluted in blocking buffer according to the manufacturer\u2019s recommendation, was added for incubation at RT for 1 h for STAT3 and LEF1 membranes. Accordingly, the HRP conjugated secondary Goat Anti-Rabbit IgG H&L antibody  was used for AHCY and GAPDH detection, respectively. Afterwards, the membranes were washed 3 times for 15 min with wash buffer.Whole-cell proteins were obtained by cell scraping in cold lysis buffer. The pellet is resuspended in 300 \u00b5L of a previously prepared cell lysis buffer RIPA , 1% NP-40) supplemented with protease inhibitors cOmplete\u2122 Mini Protease Inhibitor Cocktail  and phosphatase inhibitor sodium orthovanadate Nahttps://imagej.net/ij/).The chemiluminescent signal was developed using the ClarityTM Western ECL Blotting Substrate  kit according to the manufacturer\u2019s recommendation and detected using Alliance Q9 Mini . Densitometry analysis of the signal on the membrane images was performed using the ImageJ software (Liquid chromatography linked to tandem mass spectrometry (LC-MS/MS) was deployed for the determination of S-adenosylmethionine (SAM) and S-adenosylhomocysteine (SAH) in human cells as a modification of a previously published method by the Kozich laboratory . Namely,The preprocessed gene expression data were uploaded into IPA for pathway analysis using the Core Analysis module. Core Analysis integrates known biological pathways, molecular networks, and functional annotations to analyze the input data.The Core analysis was run with the Causal Network analysis option on the uploaded datasets for transcriptome data, providing single datasets. Molecule identification: IPA mapped the gene symbols from the uploaded data onto its knowledge base to identify the corresponding molecules. This step aimed to ensure that the input genes were correctly annotated and matched with the existing biological information.p-value threshold of  was used to identify significantly enriched pathways. Functional analysis: IPA conducted functional analysis to identify the biological functions, diseases, and upstream regulators associated with the input dataset. This analysis involved the prediction of activation or inhibition of regulatory molecules based on the input data and known downstream effects.Pathway Analysis: IPA performed pathway enrichment analysis using Fisher\u2019s exact test to determine the statistical significance of pathway enrichment based on the input gene expression patterns. A Interpretation and Visualization: IPA\u2019s visualization tools, including pathway maps, network diagrams, and functional analysis results, were used to interpret and visualize the results of the pathway analysis. These visualizations aided in understanding the underlying biology and generating hypotheses.Statistical Analysis in IPA: Statistical significance in pathway enrichment and functional analysis results was determined using appropriate statistical tests: Fisher\u2019s exact test and z-score calculation. Multiple testing corrections Bonferroni were applied to control for false discovery rate where applicable.p-value of less than 0.05 was considered statistically significant.All data are presented as mean \u00b1 standard deviation (SD) of at least three independent experiments. Statistical analysis was performed using GraphPad Prism software (version 9.0.1) and differences between groups were analyzed using one-way ANOVA followed by Tukey\u2019s multiple comparison test. A Our study investigated the impact of the knockdown of S-adenosyl homocysteine hydrolase (AHCY) on gene expression and subsequent changes on signaling pathways in the model cell line SW480.Methylation potential: Significant alteration in the SAM/SAH ratio is observed between shAHCY (AHCY-deficient) and shCTRL (control) cells, favoring SAH. Since SAH acts as an inhibitor of methylation enzymes, alterations in the SAM/SAH ratio can disrupt the normal methylation regulation within cells. This, in turn, can affect the regulation of gene expression, as methylation plays a crucial role in epigenetic gene control. AHCY deficiency\u2019s impact on methylation capacity may have downstream effects on gene expression, possibly influencing the Wnt signaling pathway and the role of LEF1 and the formation of the \u03b2-catenin/LEF1 complex, which is crucial for Wnt target gene regulation in SW480 tumor cells. Further research is needed to explore the intricate interplay between AHCY deficiency, Wnt signaling, and LEF1 in the context of CRC.2+ pathway is associated with muscle contraction, gene transcription, and enzyme activation and activates both \u03b2-catenin-dependent and \u03b2-catenin-independent pathways.Calcium Signaling: Calcium signaling can intersect with the non-canonical Wnt pathway through various mechanisms. Calcium ions can modulate the activity of Wnt signaling components, including LEF1, by affecting \u03b2-catenin stability, the interaction between \u03b2-catenin and LEF1, or downstream signaling events. The PCP pathway after Wnt activation is also responsible for gene expression regulation but also for cell cytoskeleton remodeling, together with ROCK and JNK kinases. The WNT/CaEpithelial-Mesenchymal Transition (EMT): LEF1, as a downstream effector of the canonical Wnt pathway, can participate in the regulation of EMT. EMT is a dynamic process involved in tissue remodeling and cancer progression. Activation of the canonical Wnt pathway, including the involvement of LEF1, has been linked to the induction or maintenance of EMT programs.G Protein-Coupled Receptor (GPCR) Signaling: GPCR signaling can intersect with the canonical Wnt pathway through various mechanisms. Wnt ligands can be activated by GPCRs kinases, leading to the activation of downstream signaling cascades, which can modulate the canonical Wnt pathway and potentially influence the activity of LEF1, and we see in our RNAseq data lower differential expression of GPCRs.Thus, we show that AHCY deficiency affects the levels of LEF1 protein in SW480 cells, leading to metabolic and signaling shifts causing gene expression changes with broad effects on Wnt signaling, EMT, cell cycle regulation signaling, and the tumor microenvironment pathway with potential implications for enhanced proliferation, cell invasion and metastasis:In summary, the canonical Wnt pathway and LEF1 indicate interplay on several signaling levels and demonstrate that LEF1 plays a crucial role in cancer survival and activity. Further investigation of LEF1 in the context of cancer progression may contribute to the identification of new therapeutic targets for smart medicine development for CRC patients."}
+{"text": "Oryza sativa L.) is one of the most economically and socially important cereals in the world. Several strategies such as biofortification have been developed in a way eco-friendly and sustainable to enhance crop productivity. This study implemented an agronomic itinerary in Ariete and Ceres rice varieties in experimental fields using the foliar application of selenium (Se) to increase rice nutritional value. At strategic phases of the plant\u2019s development , they were sprayed with sodium selenate (Na2SeO4) and sodium selenite (Na2SeO3). In the first foliar application plants were sprayed with 500 g Se\u00b7ha\u22121 and in the remaining two foliar applications were sprayed with 300 g Se\u00b7ha\u22121. The effects of Se in the level of micro and macronutrients in brown grains, the localization of Se in these grains, and the subsequent quality parameters such as colorimetric characteristics and total protein were considered. After grain harvesting, the application of selenite showed the highest enrichment in all grain with levels reaching 17.06 \u00b5g g\u22121 Se and 14.28 \u00b5g g\u22121 Se in Ariete and Ceres varieties, respectively. In the Ceres and Ariete varieties, biofortification significantly affected the K and P contents. Regarding Ca, a clear trend prevailed suggesting that Se antagonizes the uptake of it, while for the remaining elements in general (except Mn) no significant differences were noted. Protein content increased with selenite treatment in the Ariete variety but not in Ceres. Therefore, it was possible to conclude, without compromising quality, that there was an increase in the nutritional content of Se in brown rice grain.Rice ( The agricultural food systems are essential in providing most of the nutrients and compounds for human welfare and health although it is well known that micronutrient deficiency affects orldwide .Biofortification is linked with the biological enhancement of food cultures using for example macro and micronutrients through a conventional plant breeding approach, genetic engineering, or agronomic methodologies . Thus, tOryza sativa L.) is one of the most economically and socially important cereals in the world [indica and tropical japonica), frictional polishing (8\u201310% loss of grain weight) decreased the concentration of Manganese (Mn), Iron (Fe), Potassium (K), and Phosphorus (P) by 60\u201380% [Rice  reported insufficient concentration of Se in 75% of the white grains [Rhizobium, Azotobacter, and Azospirillum [Selenium (Se) deficiency affects approximately 0.5\u20131 billion population in the world . Additioe grains . Thus, se grains ,15. Amone grains ,17, as wpirillum .Several ways of applying Se have been developed such as soil application, soaking or seed coating, and foliar fertilization . Studies\u22121) it was possible to obtain 9.44 mg\u00b7kg\u22121 and 17.7 mg\u00b7kg\u22121 of Se increment, respectively [\u22121) were always higher than grains exposed to Se. Moreover, the natural interaction between macro and micronutrients is well documented in the literature [Previous Se biofortification studies in non-polished rice grains of Ceres variety have shown that with the application of selenate and selenite  located in Salvaterra de Magos, Portugal, to grow two rice varieties, Ariete and Ceres, which were tested. 2SeO4) and sodium selenite (Na2SeO3) at the same concentration. Since in the 1st pulverization with 500 g Se\u00b7ha\u22121 on the end of booting visual toxicity symptoms were observed, this concentration was reduced to 300 g Se\u00b7ha\u22121 during anthesis and milky grain stage. Control plants were not sprayed at any time with Na2SeO4 or Na2SeO3. The randomized blocks and a factorial arrangement (3 concentrations \u00d7 2 forms of Se \u00d7 2 varieties \u00d7 4 replicates = 48 plots) with the plot size for each replication was 8 m length \u00d7 1.2 m width = 9.6 m2. The cultural techniques adopted in soil preparation and sowing were those traditionally used in rice cultivation in the region. The agronomic management of trials, namely the control of weeds, diseases, and insect pests, the application of nitrogen fertilizers, and the irrigation water were the typically used for rice crops. The trial duration occurred from 22 August to 23 October 2019. The analysis was performed in dehusked grains (brown rice) of both varieties.Biofortification was carried out by three foliar pulverization with solutions of sodium selenate . During the agricultural period, air temperatures reached a daily average of 17\u201326 \u00b0C. Additionally, the minimum and maximum recorded temperatures are 12 \u00b0C and 35 \u00b0C, respectively . During \u22121, using a \u00b5-EDXRF system  according to Cardoso et al. and Reboredo et al. [\u22121; Fe = 6 mg kg\u22121; K = 60 mg kg\u22121; Mn = 9 mg kg\u22121; P = 2100 mg kg\u22121; Se = 3 mg kg\u22121; and Zn = 3 mg kg\u22121. Plant reference materials were used for data validation: orchard leaves (NBS 1571) and poplar leaves (GBW 07604); the recovery values ranged between 91 and 98%.Quantification of Se, Zn, Mn, Fe, Ca, K, and P, and the localization of Se in brown grains, were determined in harvested grains from control and sprayed plots, with selenate and selenite, at 0 and 300 g Se\u00b7hao et al. ,36. To eThe colorimetric parameters of grain and flour samples were measured using a fixed wavelength according to the methods described elsewhere . The sysCrude protein in the whole flour was determined by the Kjeldahl method through quantification of total nitrogen considering that all nitrogen integrates the amino acid structure of proteins, according to Lidon et al. .Statistical analysis of the data was performed with the IBM SPSS Statistics 20 program, through a one-way analysis of variance and Tukey\u2019s test for mean comparison considering a 95% confidence level. 2SeO4) treatment were 5749 and 6319 kg ha\u22121, respectively. However, in the selenite (Na2SeO3) application the yield of Ariete was 5400 kg ha\u22121 while in Ceres was 5903 kg ha\u22121. In the Ariete and Ceres variety controls, yields of 6024 and 6241 kg ha\u22121 were obtained, respectively.The yields of Ariete and Ceres varieties, in the selenate  the decrease of P content of plants treated with Se was more pronounced after selenate application in both varieties (\u22121) and Ceres (21.36 \u00b5g g\u22121), both of them after selenite treatment, while the levels of Fe were very close (p \u2264 0.05) regardless the varieties and treatments. In general, the content of both macro- and micronutrients was always higher when selenite was applied compared to selenate.Compared with control plants (6459 \u00b5g garieties  occurrin\u22121) after application with selenite.The location of Se was performed in brown rice grains after they were dehusked since the longitudinal cut removes the outer layer. This analysis showed that Se is evenly distributed throughout the grain, for both varieties . As stat\u22121) in Ariete and Ceres, respectively. Although without significant differences, the a* (red\u2013green transitions) values were positive and low varying between 1.921\u20135.353 and 1.306\u20134.517 in the Ariete and Ceres varieties, respectively. This result revealed a tendency towards red color with less tendency in the whole flours. The positive values of b* (yellow\u2014blue transitions) revealed a tendency towards yellow color, with the maximum value (25.55) registered in the grain of the Ariete variety. Although small oscillations were observed, there were no significant differences in the application of Se compared to the control.The colorimetric analysis performed on the grain and whole flour of the varieties under study revealed values higher than 50 for the brightness (L) parameter in both samples, although the L values were not significantly different. The highest values were observed in the flours compared to the grain . In the \u22121 of selenite\u2014the content increased from 6.323% to 6.902%. A significant decrease in total protein content of Ceres variety was observed when selenate was applied.Total protein content was analyzed in whole flour of both varieties, with significant differences regarding the control . There wThe challenge of increasing the nutritional content of rice grains while respecting legislation and considering consumer requirements has disrupted the search for efficient solutions. The low content of Se in rice grains does not allow the requirements of the dietary intake of human populations to be met . Rice biRice plants show the greatest sensitivity to high temperatures nine days before the panicle emerges (heading) and during this phase . In our \u22121, showed a Se content of 13.17 mg kg\u22121 and 28.63 mg kg\u22121, respectively [\u22121. Although the grain is effectively biofortified, this discrepancy can be due to the interaction between the plant and environment in the paddy field, which is never uniform [In our case, both varieties showed a significant increase in Se , particuectively . However uniform . \u22121 which shows similar assimilation capacity. In rice, probably because selenate is taken up via the sulphate transport system [The results of selenate application in both varieties revealed Se contents ranging between 9.45 and 6.95 \u00b5g gt system . Howevert system ,48,49. \u22121) revealed the effectiveness of the biofortification process. Selenate treatment showed 4.9\u20137.1-fold increases in Se concentration in the grain while 5.9\u20138.4-fold increases were obtained with selenite treatments [Additionally, regarding genotypic variability, under flooded conditions rice plants mainly take up selenite form  which iseatments . Independently of the foliar fertilization, the results of the localization analyses showed that the Se is evenly distributed throughout the grain in both varieties . This as\u22121) the concentration of Fe in rice grains did not show significant differences, however, with foliar spraying (50 \u00b5m L\u22121) the highest levels were observed in selenate treatment [\u22121 in both varieties [2SeO4) in rice increases the Zn content in both plant parts [Regarding the effects of Se application on the micro and macronutrient, studies have reported that after applying selenate and selenite to soil  treated with both the selenium forms (selenocysteine and sodium selenate) than in the control plants [\u22123) on selected macronutrients of maize seedlings (Zea mays L. var. saccharata Kcke. cv. Zlota Karlowa) revealed that Ca and P content increased, while K content decreased with increasing Se treatments [A clear trend for a decrease in the Ca content in both selenite and selenate treatments, compared with control grains was noted, while in the case of K and P it seems that the treatment with selenate decreases the content of the grain, but not the selenite treatment . Calciuml plants , althougeatments , thus shThere is a positive impact regarding color on consumer perception. Based on this, the quality parameters were considered. The parameter brightness (L) always revealed values >50 while a* and b* positive values . Our datw/w, 2\u20133% w/w, and ca. 90% w/w, respectively [Compared to the white rice grain, the brown grain has a higher nutritional value because is constituted of bran layer, embryo, and endosperm, in the proportions of 6\u20137% ectively . Howeverectively ; howeverectively , becauseectively .Although Fe content was not influenced by biofortification, it is known that most of the Fe is associated with the aleurone layer and embryo , both of\u22121) in Ariete and Ceres varieties, without reaching the toxicity threshold. Although both treatments had significant differences, it was in the selenite treatment that the brown grains showed the highest Se content. Although without significant differences in mineral content , the data seem to suggest that selenite treatment can contribute to the increase of both macro and micronutrients. Since biofortification promoted the uniform distribution of Se in all grain tissues, it is possible to obtain brown and white grains of both varieties with high content of this micronutrient. The colorimetric parameters of the brown grain and whole flour were not affected by the applied biofortification, with the brightness remaining high. Although brown grain consumption is encouraged as it is a great nutritional source, after selenite application, the total protein content was also increased in the Ariete variety, thus highlighting its nutritional importance.This study addressed an agronomic biofortification with selenate and selenite (300 g Se\u00b7ha"}
+{"text": "Many attempts have been made to induce limb salvage as an alternative to amputation for primary bone cancer in the extremities, but efforts to establish its benefits over amputation yielded inconsistent results with regard to outcomes and functional recovery. This study aimed to investigate the prevalence and therapeutic efficiency of limb-salvage tumor resection in patients with primary bone cancer in the extremities, and to compare it with extremity amputation.Patients diagnosed with T1-T2/N0/M0 primary bone cancer in the extremities between 2004 and 2019 were retrospectively identified from the Surveillance, Epidemiology, and End Results program database. Cox regression models were used to test for statistical differences between overall survival (OS) and disease-specific survival (DSS). The cumulative mortality rates (CMRs) for non-cancer comorbidities were also estimated. The evidence level in this study was Level IV.p\u2009<\u20090.001; DSS: adjusted HR, 0.70; 95% CI, 0.58\u20130.84; p\u2009<\u20090.001). Limb-salvage resection was associated with significantly better OS and DSS than extremity amputation for patients with limb osteosarcoma . Mortality from cardiovascular diseases and external injuries was remarkably declined in primary bone cancer in the extremities patients who underwent limb-salvage resection .A total of 2,852 patients with primary bone cancer in the extremities were included in this study, among which 707 died during the study period. Of the patients, 72.6% and 20.4% underwent limb-salvage resection and extremity amputation, respectively. In patients with T1/T2-stage bone tumors in the extremities, limb-salvage resection was associated with significantly better OS and DSS than extremity amputation (OS: adjusted HR, 0.63; 95% confidence interval [CI], 0.55\u20130.77; Limb-salvage resection exhibited excellent oncological superiority for T1/2-stage primary bone tumors in the extremities. We recommend that patients with resectable primary bone tumors in the extremities undergo limb-salvage surgery as the first choice of treatment. In thThe rarity of primary bone tumors has contributed to the scarcity of data on bone cancer management . PrimaryDespite the widespread belief that radical surgery lowers the risk of recurrence and complications , 18, limThis study aimed to investigate the prevalence and outcomes of limb-salvage surgery in patients with primary bone cancer in the extremities and compare the resultant data with those of extremity amputation. In this study, we tended to depict the oncological superiority of limb-salvage resection for early-stage bone tumors in the extremities, and to demonstrate limb-salvage resection as a valuable therapeutic option for T1/2-stage bone tumors in the extremities. These results provide guidance for the management of primary bone cancer in the extremities.2.2.1.http://www.seer.cancer.gov)  program. The SEER program is a population-based framework of geographically distinct tumor registries from the US, covering approximately 30% of the US population . The supcer.gov) . This stcer.gov) .Data on patients with first primary bone cancer in the extremities were obtained from the National Cancer Institute's SEER program. We included first primary diagnosis of primary bone cancer in the extremities (site codes: C40.0-C40.3) during 2004\u20132019. We excluded patients who only had information from the death certificate. We include only early-stage bone cancer in the extremities with a stage of T1/2-N0-M0. The cases with lymph node invasion and distant metastasis were excluded. In addition, we excluded the cases with unclear surgical information or those treated by local tumor destruction . The dat2.2.During follow-up until December 31, 2019, relevant demographic data, tumor-specific information, type of treatment, and survival status were collected. The available patient information in the SEER database included age at diagnosis, sex, race, year of diagnosis, residential area , household income, and vital status at the last follow-up. Clinicopathological information for primary bone cancer in the extremities, including the AJCC TNM stage and type of surgery, was also extracted. The histology of bone cancer was defined by International Classification of Diseases for Oncology, 3rd Edition: osteosarcoma (histology codes: 9180/3\u20139200/3), chondrosarcoma (histology codes: 9220/3\u20139243/3), Ewing sarcoma (histology codes: 9260/3), and other less frequent tumors . Data onFor primary bone cancer in the extremities, the T, N, and M values of the stage were based on AJCC 6th stage codes for patients diagnosed during 2004\u20132009, AJCC 7th stage codes for patients diagnosed during 2010\u20132015, and SEER combined stage for patients diagnosed during 2016\u20132019 . In the The causes of death in patients with primary bone cancer in the extremities were classified into two major groups: cancer- and non-cancer-related deaths . The SEER cause-specific death classification variable from death certificates was used to define the causes of death . Non-can2.3.P\u2009<\u20090.05 was considered statistically significant. Analyses were performed using the SEER*Stat software version 8.3.8 and R 3.6.3  and disease-specific survival (DSS) using the Kaplan\u2013Meier method. The log-rank test was used to assess the statistical significance of survival discrepancies between the different interventions. Multivariate Cox proportional hazards models were then created to evaluate factors associated with OS and DSS. Independent variables included in the univariate model were age, race, sex, year of diagnosis, residential area, household income, AJCC T stage, and surgery type. Cumulative mortality rates (CMRs) for non-cancer comorbidities were estimated using the Kaplan\u2013Meier method . For var R 3.6.3 , 33.3.3.1.N\u2009=\u20092,653) underwent surgical operations, among which 72.6% and 20.4% underwent limb-salvage resection and extremity amputation, respectively (p\u2009<\u20090.001). Most patients who underwent limb-salvage resection (67.9%) were <40 years of age. Of the patients aged 0\u201339 years, 74.2% underwent limb-salvage resection, and only 19.1% underwent extremity amputation (p\u2009=\u20090.009)  deaths were recorded, with a median follow-up time of 5.2 years (range: 0\u201315.9 years) . Most ofectively . Patientputation . Additioputation . The bla=\u20090.009) .3.2.p\u2009<\u20090.001)  . The 5-y<\u20090.001) . This pr<\u20090.001) .p\u2009<\u20090.001) with a 5-year DSS rate of 82.2% for limb-salvage resection and 71.6% for extremity amputation (p\u2009<\u20090.001)  .p\u2009<\u20090.001), with a 5-year DSS rate of 88.0% and 83.7% for limb-salvage resection and extremity amputation, respectively (p\u2009<\u20090.001), with a 5-year DSS rate of 76.6% for limb-salvage resection and 63.6% for extremity amputation . In multivariable Cox analyses, American Indian/Alaska Native race category , T2-stage disease , and older age  were predictors of grave prognosis , chondrosarcoma , and other bone cancer . Limb-salvage resection was associated with similar OS as extremity amputation for patients with Ewing sarcoma in the extremities  (p\u2009=\u20090.01), chondrosarcoma , and other bone cancer . Limb-salvage resection was associated with similar OS as extremity amputation for patients with Ewing sarcoma in the extremities   . Limb-sap\u2009=\u20090.7) .3.3.p\u2009<\u20090.001) (p\u2009=\u20090.005) (p\u2009=\u20090.009)  (p\u2009=\u20090.003) (p\u2009=\u20090.5) (p\u2009=\u20090.02) and external injuries (p\u2009=\u20090.03)  . Cardiov=\u20090.005) . Mortali=\u20090.009) . Cardiov\u2009=\u20090.03) . Mortali=\u20090.003) , whereasp\u2009=\u20090.5) . When re\u2009=\u20090.03) .4.In this study involving more than 2,800 patients with early-stage bone cancer in the extremities, we compared the prevalence and therapeutic efficiency of limb-salvage resection with that of extremity amputation. The primary purpose of this study was to compare the overall survival and disease-specific survival rates of patients with a diagnosis of primary bone cancer in the extremities undergoing limb salvage and extremity amputation surgeries for treatment. Previous studies aimed at this question have not included or evaluated primary bone cancer as one entity when evaluating outcomes in limb salvage and amputation surgery, but focus on patients with limb trauma \u201337 or alOur results showed that limb-salvage resection was associated with a significantly better prognosis than that with extremity amputation in patients with T1- and T2-stage bone tumors in the extremities. In addition, limb-salvage resection might have the advantage of preserving the motor function and completeness of the extremities, which are completely destroyed after extremity amputation. The previous gold-standard treatment for primary bone cancer in the extremities was extremity amputation. In recent decades, great advances have been made in surgical procedures, including precise tumor location, better preoperative preparation, mastered operative skill, advanced surgical techniques, and optimal control of postoperative infections. With these advances, limb salvage tended to take the place of amputation as the dominant treatment paradigm , 12. In Interestingly, we observed an elevated mortality risk for cardiovascular disease after extremity amputation in patients with early-stage bone cancer in the extremities. Previous studies have indicated that traumatic amputees may have high mortality due to CVDs . Post-trIt should be carefully evaluated before limb-salvage surgery is applied to patients with bone tumor in the extremities, particularly when the tumor is difficult to resect or when it metastasizes to distant sites. The major oncological limitations of this procedure are the underlying risks of complications from reconstructive procedures, reconstruction failure, fracture, revision surgeries, conversion to amputation after failed revision surgery, and prosthetic joint infection. Besides, there might be other oncological limitations, such as the underlying risks of residual tumor and tumor recurrence. To address these concerns, postoperative chemotherapy, radiotherapy, or molecular targeted therapy should be employed for the high-risk population. To avoid future tumor recurrence or newly developed tumors, routine screening and active follow-up should be performed after this procedure. This procedure does have its disadvantages, and amputation should be adopted when it's impossible to achieve limb salvage.This study had several limitations. First, given its descriptive and retrospective study design, we could not prospectively assess the effects of surgical interventions in patients with primary bone cancer in the extremities and thus could not draw causal inferences . Second,Notwithstanding these limitations, this study may make an important contribution to the surgical intervention and cancer surveillance literature for cancers in the extremities. The strength of this study is that the data were derived from a high-quality population-based real-world cancer registry. The implications of this study might provide new evidence for the treatment of primary bone cancer in the extremities. Given to the limitations of this study, further prospective studies are needed to support our findings.5.In conclusion, this study revealed that limb-salvage resection exhibited excellent oncological superiority for T1/2-stage bone tumors in the extremities. Moreover, limb-salvage resection might be associated with a reduced mortality risk from non-cancer comorbidities, including cardiovascular diseases and external injuries. Limb salvage could be a new option in recommendations of the management of physical and psychological well-being. Guidance on selecting appropriate candidates should be developed."}
+{"text": "Nature published the paper titled \u201cDecade-long leukemia remissions with the persistence of CD4+ CAR T-cells\u201d . According to the results presented, it could be argued that \u201cchimeric antigen receptor (CAR) T-cells can actually cure patients with chronic lymphocytic leukemia (CLL)\u201d. CAR T-cells remained detectable more than ten years after infusion, and immunoglobulin heavy chain (IGH) rearrangement deep sequencing showed persistent deep molecular remission for both patients (no CLL clonotypes were detectable six months after CAR T-cell infusion and onwards). However, the existing actual disease status of both patients remained unclear, as it was unknown: (1) if CAR T-cells killed all leukemia cells during the initial anti-leukemic response phase, that is, soon after CAR T-cell infusion into both patients; (2) if few CLL cells survived, but persistent CAR T-cells had been able to destroy any leukemia cells before they reach detectable levels. In the first case, both patients could be considered definitely cured; in the second not and their decade-prolonged deep remission could be a consequence of the cytotoxic activity of the functionally active CD4+ CAR T-cells. The first version appears to be stronger and the supporting arguments have been included in a comprehensive commentary article. A new therapeutic intervention may emerge with the potential to fully improve the quality of life of both patients and in addition, ongoing research into CAR T-cells may turn in a new, more effective direction.On Feb 2, 2022,  Immunotherapy has become a standard treatment for many cancers, with chimeric antigen receptor (CAR) T-cell therapy representing one of the most promising options. Since 2017, six CAR T-cell commercial products have been approved by the Food and Drug Administration (FDA) to treat highly refractory hematological malignancies. This therapy has been extraordinarily successful putting hematologic patients who had months to live, into remission . CAR T-cChronic lymphocytic leukemia (CLL) is the most common adult leukemia, largely incurable. Durable CAR T-cell activity in CLL is limited and identifying ways to achieve long-term remissions is critical to CAR T-cell utility . The firMelenhorst et al.  presenteThe mapped clonal CAR T-cell evolution over 10 years revealed two distinct response phases , 7, 10: During this phase, CAR T-cell population shifted gradually over time from CD8+ to CD4+ T-cells. Based on Figure 1b, c  and Figuin vitro conditions. IGH deep sequences supported the concept that B-cells continued to be produced by the bone marrow and were exported to the peripheral blood. CD19 expression, notably absent on the stem cells and B-cell precursors, emerges around the late pre-pro-B to pro-B cell stage to mature B-cells; therefore, it seems unlikely the ongoing B-cell suppression was due to eradication of an early progenitor population  . Anti-idGiven there are very few immunotherapies in which the therapy itself is still active and can be readily identified many years later, these patients presented a remarkable opportunity. This raises the prospect of assessing CAR T-cell profiles in larger future clinical cohorts to determine if similar phenotypes and long-term responses hold across other CLL patients, as well as other malignancies. In addition, future development of more advanced ultrasensitive techniques can contribute to better defining the disease status and further determining whether a given patient is actually cured at a given point in time after infusion of CAR T-cells."}
+{"text": "In the last two decades, many detailed full transcriptomic studies on complex biological samples have been published and included in large gene expression repositories. These studies primarily provide a bulk expression signal for each sample, including multiple cell-types mixed within the global signal. The cellular heterogeneity in these mixtures does not allow the activity of specific genes in specific cell types to be identified. Therefore, inferring relative cellular composition is a very powerful tool to achieve a more accurate molecular profiling of complex biological samples. In recent decades, computational techniques have been developed to solve this problem by applying deconvolution methods, designed to decompose cell mixtures into their cellular components and calculate the relative proportions of these elements. Some of them only calculate the cell proportions (supervised methods), while other deconvolution algorithms can also identify the gene signatures specific for each cell type (unsupervised methods). In these work, five deconvolution methods  were implemented and used to analyze blood and immune cells, and also cancer cells, in complex mixture samples (using three bulk expression datasets). Our study provides three analytical tools  that allow a thorough comparative analysis of the cell mixture data. The work indicates that CIBERSORT is a robust method optimized for the identification of immune cell-types, but not as efficient in the identification of cancer cells. We also found that LINSEED is a very powerful unsupervised method that provides precise and specific gene signatures for each of the main immune cell types tested: neutrophils and monocytes (of the myeloid lineage), B-cells, NK cells and T-cells (of the lymphoid lineage), and also for cancer cells. The transcriptome analysis, as a global profile of gene expression, is a key factor for the study of complex biological samples composed of multiple cell populations in heterogeneous mixtures. Specifically, transcriptomics allows us to identify how genes change according to the biological processes happening in the human organism, or under specific pathological alterations that modify cellular function, such as tumorigenesis and cancer development. For example, increased infiltration of pro-inflammatory immune cells (primarily CD8+ cytotoxic T cells) in the tumor microenvironment (TME) is associated with a good prognosis in cancer patients ,2,3,4, wUsing these global gene expression technologies, massive RNA data has been produced for millions of samples in thousands of transcriptomic studies over the past few decades, including highly relevant and accurate information on gene activity. The identification of the role of specific cells in bulk RNA data generally requires the application of specific experimental techniques, such as flow cytometry or immuno-histochemistry, which have major limitations since they are expensive, time consuming and usually restricted to known available markers, and to the possibility of separating and isolating the cells . In contGlobal signals or numerical values are generally used to measure all elements present as a mixture in a complex sample . These mixture samples are decomposed using a mathematical method to identify their elements and calculate the number of components and their relative composition or percentage. Deconvolution is the mathematical term for this type of analytical approach. Usually, to explain this mathematical procedure, the phenomenon called the \u2018cocktail party problem\u2019 is used . The expPeng Lu, Aleksey Nakorchevskiy and Adward M. Macotte were the first to use such methodologies, estimating the quantity of distinct yeast cell types at various stages of the cell cycle . Since tij is a linear combination of the expression level sik of gene i (i = 1\u2026n) in cell type k (k = 1\u2026c), weighted by the proportion pkj of cell type k in sample j [This global data B can also be explained as a set of equations, one per gene for each of the samples , where the value bsample j . TherefoThere are two types of deconvolution methods depending on the elements to be estimated. When the aim is only estimating one of the two matrices (S or P), the method is known as partial deconvolution (supervised methods) and requires, in addition to a mixture matrix B, another remaining matrix (S or P) that provides the gene signatures or cell proportions. However, if the method can infer both matrices, so it only needs the B matrix, then it is a complete deconvolution, and the algorithm is defined as an unsupervised method . In our First, we analyzed the results obtained after the implementation of CIBERSORT, FARDEEP, DECONICA and LINSEED, using a dataset (GSE64385) that includes purified cell populations, mixed in known proportions. To evaluate the different algorithms, a correlation plot (corrplot) has been made for each method. In the first case, shown in Therefore, other plots (cell-signature plots and bar-mixture plots) were created. The cell-signature plots for CIBERSORT and LINSEED are presented in On the other hand, This comparative analysis shows that LINSEED was able to recognize the presence of cancer cells in all samples, even when the proportion of these cells was lower . Meanwhile, CIBERSORT found cancer cells in the samples S01 and S02  but could not find any cancer cells in the rest of the samples . These results demonstrated the great capacity of LINSEED to calculate the proportions of cancer cells and the fact that CIBERSORT is a method focused mainly on immune cells . In thisIn this section, three supervised deconvolution methods  were applied to calculate a large collection of cell types and subtypes identified in PBMCs.The analyses were performed using 13 PBMC samples, obtained from dataset GSE107011. For these samples, we had global gene expression data , plus the proportions of each cell type in each sample determined experimentally. Finally, an analysis of cell signatures was performed to identify five immune cells , provided by LM22 matrix (used in CIBERSORT and FARDEEP) and by those estimated by the unsupervised methods LINSEED, considering the matching genes between LM22 signature matrix and these ones present in the GSE64385 expression data (512 genes). For this purpose, we chose to apply a clustering analysis, whose results are shown in https://cibersortx.stanford.edu/, accessed 10 June 2022), decreasing the number of genes contained in the signature matrix while maintaining the most important genes, which are well reported in the literature. All the data corresponding to these two heatmaps are included in the The analysis in search for gene signatures for the cells carried out with LINSEED was quite specific, since by using the LM22 cell data matrix provided by CIBERSORT, we were able to select with this unsupervised method 117 genes as cell markers for the 5 cells studied. The precise analysis of the cellular composition and heterogeneity of complex biological samples opens the way to identify cellular marker genes, to determine changes in specific biological processes due to different cells, as well as to analyze the initiation and development of pathological states or diseases, driven by certain cells in a given organism. Previous studies in human tumors have demonstrated the clinical impact of the infiltration of certain immune cells, especially T lymphocytes ,24, and In our work, we implemented five deconvolution methods: three supervised  and two unsupervised (DECONICA and LINSEED) using global expression signal (bulk) data . In general, the most accurate methods were CIBERSORT and LINSEED, with high correlations, low RMSE values and cell distributions as the real known data. Both methods performed best using the LM22 matrix as the signature matrix . Given that the calculation of cell proportions is directly related to the signatures considered and that most of the methods use mathematical regression models, they are expected to have similar results. However, for the supervised methods to be accurate in their computations, the signature matrix and the bulk data must be collected by the same expression platform, as Chen et al. mention in their article . In addiRegarding DECONICA, the frequencies calculated may create confusion about its accuracy. The general correlation coefficients were high, and furthermore, the RMSE values did not differ much from the errors calculated for CIBERSORT. However, DECONICA cell proportions were distributed around a mean value, so there is no variability between the calculated proportions for the samples. Based on this fact, it is recommended to use LINSEED, instead of DECONICA, when the signature array is not available . In addition, when the bulk expression signal had a large number of genes, the computation of gene pairwise correlations was very time consuming, further reducing the accuracy of DECONICA. With respect to the use of ABIS, it was necessary to know the real proportions, which were used to calculate the scale factor, before running the algorithm. Therefore, if the objective is only to use the method to estimate cell abundance, it is not recommended to use it, because an experimental determination of the cell proportions would have to be applied previously. Regarding cell signatures, LINSEED was a powerful tool to optimize the sets of cell marker genes provided by CIBERSORT, selecting a much reduced number of marker genes contained in the LM22 reference matrix (designed to identify 22 immune cell types).The RMSE values obtained for the deconvoluted expression data used in In general, from our study, we can state that none of the studied methods for cell mixture deconvolution is adaptable to address all possible circumstances in the analysis of expression profiles obtained from complex biological samples, and a robust comparative analysis of the results is essential to assess the value and capacity of each method. In this context, it is important to note that the aim of this paper was not to present a \u201cbenchmarking\u201d of deconvolution methods, but rather a study in which we compare the results of several well-known first-generation deconvolution approaches to obtain gene signatures and to facilitate the identification of major immune cells and cancer cells. In recent years, a large number of publications have addressed the benchmarking of deconvolution methods. From 2019 to 2022, several relevant benchmark and comparative studies of deconvolution methods were reported: in 2019, Sturm et al. published a comprehensive evaluation of transcriptome-based cell-type quantification methods applied to estimate nine different immune and stromal cells in bulk RNA-seq samples ; then, iConsidering these recent comparative studies, we are well aware of the existence of novel second-generation deconvolution methods, such as: CIBERSORTx , MuSiC  and DWLSDespite this great development in deconvolution procedures, there are still important problems for the accuracy of these methods that are mainly associated with the quality of the reference data used. The analysis of cell mixtures in real biological samples faces serious difficulties associated with: sample heterogeneity and variability, sample purity and cross-contamination, overlapping of cell signatures, technical noise from cell determination methods, batch effects, etc. These problems need to be addressed both by improving cell-specific determination technologies ; and by the improvement of computational developments  algorithms such as Deep Neural Networks (DNNs)).A major biological problem in cellular deconvolution is the lack of specific gene signatures for all the different cell types, which causes the \u201cspillover effect\u201d: an overlap of gene signatures between different cell populations ,39,46. IWe used for the analyses three cell mixture datasets, two of them including genome-wide expression data obtained using high-density microarrays technology: GSE64385  and GSE1(i)LM22: Signature matrix composed of 22 immune cell types and 547 genes, designed by CIBERSORT authors . We used(ii)\u2018sigmatrixMicro.txt\u2019: Matrix consisting of 819 genes characterizing 11 immune cell types in complex cell mixtures. Signal expression was obtained with Illumina microarrays . We appl(iii)\u2018sigmatrixRNAseq.txt\u2019: Signature matrix composed of 1296 gene biomarkers to identify 17 immune cell populations. Signal expression was obtained with Illumina RNA-seq . We applSupervised methods require a gene signature matrix, which must contain the expression profiles of the gene markers used to identify the different cell types . These gene signature matrices are usually generated using the same platform as the analyzed samples. In our analysis, we used three gene signatures matrices :A (representing absolute frequencies of the cell types in the samples) whose numbers maximize the skewness and kurtosis statistics of the distribution. Therefore, with n being the number of observable variables (genes), m the number of samples, and c the components into which to decompose the data, the mixture expression matrix (B) can be formulated as the product of matrix A and the signature matrix S, as shown by Equation (3).This is an unsupervised deconvolution method and therefore only requires the mixture expression matrix or bulk . For theT and XT have the same dimensionality and can be mapped as points within the common m-dimensional space. These mapping and transformation steps are performed using the algorithm Simplex [This method, like the previous one, solves a complete deconvolution since it is also an unsupervised method. In this case, cell type-specific genes are defined by their exclusive expression in only one component within a mixture. In an ideal scenario, the gene markers expression behaves exactly linearly with the proportions of the corresponding mixture component. Therefore, expression levels of the biomarkers to the same mixture component are also mutually linear with each other. Subsequently, to deconvolute a mixture of signals, LINSEED identifies the marker genes (the specific genes) for each cell type, by calculating the mutual linearity between pairs of genes . Mutual  Simplex , which fIt is a supervised method that can be applied to decompose the whole gene expression data . Before Subsequently, the expression of the signature matrix (per cell type) is multiplied by this coefficient, and the deconvolution is performed. For deconvolution, ABIS is based on a robust linear model (RLM), which for each gene and sample is described by Equation (6).Considering n the total gene number and c the cell types to be estimated. For any gene i  and any cell type k ,\u00a0\u03c4 = (\u03c41 + \u03c42 + \u22ef + \u03c4n)T indicates that the i-th gene  is an outlier. For more information regarding the outliers estimation, see the original article [This is a supervised method designed to solve partial deconvolution problems, previously eliminating outliers that may disrupt the results. For this purpose, FARDEEP is based on the aLTS (Adaptive Least Trimmed Squares) algorithm , which i article .\u03b5) that the model can tolerate [\u03b5 will also increase. Finally,\u00a0Supervised method that solves a partial deconvolution, so mixture and signature matrices are needed as parameters. To perform deconvolution, it is based on the machine learning algorithm known as Support Vector Regression (SVR) , which itolerate . The hypIn summary, one of the main conclusions of this work is that we need multiple analytical tools to perform a fair evaluation of different cell mixture deconvolution methods, and our plots  facilitate such comparative analysis. In addition, the study shows that CIBERSORT provides robust and consistent results in the deconvolution analyses of mixtures of immune cells; with high correlations in cell proportions, low RMSE values, as well as high similarity between the estimated and known cell type distributions. CIBERSORT is supervised, always using a predefined signature matrix (LM22), which includes genes that characterize the main immune cell types (as can be seen in"
\ No newline at end of file