diff --git "a/deduped/dedup_0233.jsonl" "b/deduped/dedup_0233.jsonl"
new file mode 100644--- /dev/null
+++ "b/deduped/dedup_0233.jsonl"
@@ -0,0 +1,53 @@
+{"text": "Environmental Science & Technology now shows that rice grown in this area contains, on average, 1.76 times more arsenic than rice grown in California. With rice consumption increasing steadily in the United States, high-rice diets may be of concern, says principal investigator Andrew Meharg, chair of biogeochemistry at the University of Aberdeen, United Kingdom.At one point during the reign of King Cotton, farmers in the south central United States controlled boll weevils with arsenic-based pesticides, and residual arsenic still contaminates the soil. Today, rice paddies cover fields where cotton once grew, and a large market basket survey published in the 1 April 2007 issue of Arkansas produces about half and California about 20% of the total rice grown in the United States. The rest comes from Louisiana, Mississippi, Texas, Missouri, and Florida. The total U.S. rice crop for 2004 was 6.4 million metric tons, or 1.6% of total world production, according to the USDA.USDA data further show that U.S. rice tends to be milled and packaged close to where it is grown. About 60% of the rice grown in the United States is eaten here, and this figure has been increasing by about 2\u20133% a year. Rice is eaten directly or processed into breakfast cereal, rice cakes, package mixes, pet food, and beer. U.S. rice also is exported to South America, Asia, and Europe. Meharg\u2019s team purchased 134 varieties of rice, including brown, white, organic, polished, unpolished, and instant, at grocery stores across Arkansas and California.Meharg traced where the rice varieties originated from information on the packages and by performing a principal component analysis of selenium, cobalt, copper, and other minerals in the grain. \u201cThis elemental profile directly relates rice to soil on which it is grown,\u201d says Meharg.Total arsenic levels in the 107 south central rice samples averaged 0.30 \u03bcg/g, compared to an average of 0.17 \u03bcg/g in the 27 California samples. A white rice sample from Louisiana ranked highest in total arsenic (0.66 \u03bcg/g), and an organic brown rice from California ranked lowest (0.10 \u03bcg/g). Organic growing conditions, however, do not guarantee low arsenic levels, since any rice growing in arsenic-laden soil soaks up arsenic, says Meharg.U.S. rice consumption averages about 12 grams daily, but Asian Americans average more than 115 grams daily; Hispanic and black consumers also have higher-than-average rice intakes. The U.S. EPA, which classifies inorganic arsenic as a group A human carcinogen, sets a daily limit at 10 \u03bcg/L from drinking water (the most frequent route of exposure). There is no U.S. standard for arsenic in food. However, Meharg calculated that people who eat more than 115 grams of high-arsenic rice could reach or surpass the drinking water standard.Environmental Science & Technology. Rice grown in Bangladesh, the world\u2019s hot spot for arsenic poisoning, contains about 80% inorganic arsenic, and people there eat 450 grams daily.\u201cHigh-arsenic\u201d in this instance is based on the Louisiana sample that scored highest in arsenic content, assuming that the arsenic content was 42% inorganic, as measured by Meharg in a study published in the 1 August 2005 issue of Pediatrics put the prevalence of autistic spectrum disorders at 6.7 children per 1,000, with 15% of these children on gluten-free diets.Rice is recommended as a substitute for wheat for people with celiac disease, a condition in which the wheat protein gluten damages the intestinal lining and impairs absorption. Celiac disease afflicts 1 in 133 Americans. Gluten-free diets also are promoted for children with autistic spectrum disorders, although no clear scientific evidence supports the use of such a diet. Estimates published in the November 2001 issue of The arsenic levels in U.S. rice \u201care possibly cause for concern,\u201d says John Duxbury, a soil chemist at Cornell University. He completed a market basket analysis of rice purchased in upstate New York that, like Meharg\u2019s, found high levels of arsenic in rice grown in the south central United States. But Duxbury points out that the findings are perhaps less straightforward than they may seem. In contrast to Meharg\u2019s calculations, the U.S. rice sample with the highest arsenic in Duxbury\u2019s unpublished analysis contained only 22% inorganic arsenic. Moreover, Duxbury\u2019s greenhouse experiments show that farmers could significantly reduce rice arsenic levels by applying less water to the plants. Other researchers are designing rice plants that absorb less arsenic.\u201cUntil this all gets sorted out, consumers shouldn\u2019t be overly concerned,\u201d Duxbury says. Nevertheless, rice fanciers might note that both Duxbury and Meharg found basmati rice imported from India and Pakistan and jasmine rice from Thailand to contain the least arsenic."}
+{"text": "Aplysia, the rhinophore, is a chemosensory organ and several behavioural studies showed that the rhinophores can detect pheromones, initiate orientation and locomotion toward food. However the functional neuroanatomy of the rhinophore is not yet clear. Here we apply serotonin-immunohistochemistry and fluorescent markers in combination with confocal microscopy as well as optical recording techniques to elucidate the structure and function of the rhinophore of the sea slug Aplysia punctata.For marine snails, olfaction represents a crucial sensory modality for long-distance reception, as auditory and visual information is limited. The posterior tentacle of N-methylpyridinium iodide (DiA) demonstrated the connection of glomeruli with the ganglion. Around 36 glomeruli (mean diameter 49 \u03bcm) were counted in a single rhinophore. Fluorimetric measurements of intracellular Ca2+ levels using Fura-2 AM loading revealed Ca2+-responses within the rhinophore ganglion to stimulation with amino acids. Bath application of different amino acids revealed differential responses at different positions within the rhinophore ganglion.With anatomical techniques an overview of the neuroanatomical organization of the rhinophore is presented. Labelling with propidium iodide revealed one layer of cell nuclei in the sensory epithelium and densely packed cell nuclei beneath the groove of the rhinophore, which extends to about two third of the total length of the rhinophore. Serotonin immunoreactivity was found within the olfactory glomeruli underneath the epithelium as well as in the rhinophore ganglion. Retrograde tracing from the rhinophore ganglion with 4-(4-(dihexadecylamino)styryl)-2+-levels indicates, that processing of odour information takes place within the rhinophore ganglion. Our neuroanatomical and functional studies of the rhinophore open up a new avenue to analyze the olfactory system in Aplysia.Our neuroanatomical study revealed the number and position of glomeruli in the rhinophore and the rhinophore ganglion as processing stage of sensory information. Serotonin-immunoreactive processes were found extensively within the rhinophore, but was not detected within any peripheral cell body. Amino acids were used as olfactory stimuli in optical recordings and induced sensory responses in the rhinophore ganglion. The complexity of changes in intracellular Ca Aplysia have been investigated intensively with respect to behavioural and neurobiological studies, and the gill withdrawal reflex has become a well known neuronal model circuit for studies of the cellular basis of learning and memory )n e.g.: ,53). As . As Aplyetection , it woul2+-levels led us suggest, that processing of odour information takes place within the rhinophore ganglion. Our neuroanatomical and functional studies of the rhinophore open up a new avenue to analyze the olfactory system in Aplysia, leading towards understanding neuronal processing of chemical cues in the marine environment.The glomeruli and the rhinophore ganglion represent different processing stages for sensory information. We found 36 glomeruli in the rhinophore and retrograde labelling with DiA revealed the connection between glomeruli and rhinophore ganglion. The glomeruli are situated close to the epithelials layers towards the lumen of the groove and appear to be surrounded by a thin glia-like sheath. Serotonin-immunoreactivity was found extensively within the rhinophore, but was not detected in any peripheral cell body. Therefore these serotonergic fibres appear to be efferent projections from central ganglia. Amino acids were used as potentially important olfactory stimuli for aquatic animals, and optical recordings show that amino acids induce sensory responses in the rhinophore. The complexity of changes in intracellular CaAplysia punctata were collected from shallow waters around Helgoland. Animals were cooled in ice, fixed in 4% formaldehyde in Artificial Sea Water  piperazine-N-2-ethansulfonic acid Na-salt). Before further treatments rhinophores were washed three times in 0.1 M phosphate buffered saline . For labelling with fluophore-conjugated phalloidin, immunocytochemistry, tracing with lipophilic markers and nuclear staining, the rhinophores were embedded in 5% low-melting point agarose  and sectioned in a frontal or sagittal plane at 150 \u03bcm thickness with a vibrating microtome . Free-floating agarose sections were preincubated in PBS with 0.2% Triton X-100 and 2% normal goat serum  for one hour at room temperature. Different combinations of double stainings were performed. To label serotonergic neurons, sections were incubated with a primary antibody against 5-HT, raised in rabbit  in PBS with 0.2% Triton X-100 and 2% NGS overnight at room temperature. This antibody was used in previous studies in gastropod molluscs [Specimens of molluscs ,27. AfteN-methylpyridinium iodide  was used as retrograde tracer. Crystals of DiA were transferred into the rhinophore ganglion with a fine minuten pin. Following dye application the rhinophores were fixed in 4% formaldehyde in PBS and incubated for 7 days at 4\u00b0C. Embedding, sectioning and double labelling with propidium iodide were performed as described above. Finally, sections were rinsed in PBS and mounted in PBS on microscopic slides.The fluorescent lipophilic dye 4-(4-(dihexadecylamino)styryl)-Rhinophores were fixed in Bouin's fixative solution for 2 days, washed with ethanol, embedded in Spurr's resin and sectioned in a frontal plane (6 \u03bcm). After normal histological procedures, the plastic sections were stained after the method from Mallory (for details ) on a hoFluorescent tracers and antibodies were visualized using a laser-scanning confocal microscope (Leica TCS SP). Glomeruli counts per slice were corrected for double-counting in adjacent slices using the method after Weibel . Image p2+-levels. Fluorescence images were acquired with an interval of 5 s and an exposure time of 50 ms per image.All physiological experiments were performed at the marine station Helgoland. The rhinophores were dissected as described above and cut longitudinally using a razor blaze. The half containing the ganglion was incubated for 60 min at 4\u00b0C with ASW containing 5 \u03bcM Fura II acetoxymethylester (AM). After removal of the incubation buffer the rhinophores were washed for 10 min. Changes in fluorescence were monitored with an imaging system  and a CCD camera mounted on an inverted microscope (Zeiss Axiovert 100) equipped with a UV objective (Zeiss NeoFluar 20X). Different regions within the rhinophore ganglion were measured using the \"region\" function of the software . Changes in fluorescence were obtained by ratiometric measurements with excitation at 340 nm and 380 nm excitation. Values were presented as relative changes in ratios representing alterations in intracellular CaPleurobranchea californica [+ buffer stimulation (400 mM NaCl was replaced by 400 mM KCl), which always elicited a strong response. Calcium-imaging experiments were performed with 25 (K+)-responsive rhinophores.For odour stimulation the recording chamber (volume 3 ml) was mounted on the microscope stage, and the bath flow was adjusted to 4 ml/min with a peristaltic pump. The chamber volume was exchanged in less than one minute. Amino acids, which induced the highest response in ifornica  were choUB and WR had the general idea for this project and designed the neuroanatomical and neurophysiological experiments. AW performed the labelling with the fluorescent dyes and the fluorimetric measurements. MO did the histology. AW, WR and UB wrote the manuscript."}
+{"text": "The structure relates to interactions between and within the DNA strands, and the array of other macromolecules that constitutes functional chromatin. It is only through its changing conformations that DNA can organize and structure a large number of cellular functions. In particular, DNA must locally uncoil, or melt, and become single-stranded for DNA replication, repair, recombination, and transcription to occur. It has previously been shown that this melting occurs cooperatively, whereby several base pairs act in concert to generate melting bubbles, and in this way constitute a domain that behaves as a unit with respect to local DNA single-strandedness. We have applied a melting map calculation to the complete human genome, which provides information about the propensities of forming local bubbles determined from the whole sequence, and present a first report on its basic features, the extent of cooperativity, and correlations to various physical and biological features of the human genome. Globally, the melting map covaries very strongly with GC content. Most importantly, however, cooperativity of DNA denaturation causes this correlation to be weaker at resolutions fewer than 500 bps. This is also the resolution level at which most structural and biological processes occur, signifying the importance of the informational content inherent in the genomic melting map. The human DNA melting map may be further explored at  In a living cell, DNA both is an information carrier and carries out important structural tasks, such as organizing its replication and distributing the chromosomes to the daughter cells. DNA is frequently depicted as an antiparallel double-stranded helix, but DNA may rather be viewed as having a dynamically changing structure. This is because in performing most of these tasks, it is necessary for the DNA helix to become single-stranded locally, or unwound, thereby creating \u201cbubbles\u201d in the double strand, much as what happens when a twisted rope with two strands is untwisted. In the cell, this happens by the aid of the enzymatic machinery, but it may also be observed in experiments when a gradual increase in temperature produces bubbles. Our calculations in producing a melting map are based on temperature changes, but may be viewed as a map of bubble formation tendencies along the genome. In DNA, an opening bubble does not open one base at a time, but rather as a cooperative event, in that several base pairs act in concert to form a bubble, and we use an algorithm that takes this aspect into consideration. We then explore the correlations between the melting map and many known features of the human genome. We also demonstrate the extent of cooperativity, and find that the melting map carries information otherwise not available. Once the melting map is calculated, a number of more detailed studies of relationships to DNA structure and function are made possible, as well as improvements of algorithms for modelling DNA with associated proteins as they occur in the natural cellular environment. Currently, a community-wide effort is being pursued to understand how the genome itself, in concert with its epigenetic modifications and its organization in the cell nucleus, functions to provide each cell with the functionality and gene regulation that it requires at various levels of organization, such as cell state and tissue specificity. Two important and distinct approaches towards this goal may be found: (1) data-driven statistical learning methods that can provide results in a relatively short time, with little knowledge of the biological mechanisms involved; (2) knowledge-driven physical modeling that can provide a mechanistic understanding of the system in terms of its molecular constituents. However, by nature the latter is a relatively slow and difficult process.In most of the fifty years following the discovery of DNA structure , the basStudies of chromatin DNA in its nuclear environment have found that chromosomal compartmentalization occurs in the nucleus, and that apparently most of the genes locate in the inner part of the nucleus ,9. The iThe interest in the physical organization of DNA may be considered as a reflection of the fact that many complex biological processes require an integrative approach, given the relative shortage of laboratory-based observations. Sequence-oriented annotations of diverse types, physical modeling, and experimental observation of chromatin organization are now providing rich, yet disparate, sources of information on scales ranging from a few base pairs to the whole genome. A systematic integration and statistical exploration of the combined data is believed to provide a more complete picture of the functionality of DNA in its natural context.In parallel with the determination of the DNA sequence, efforts have been made to model the molecular behavior of DNA. A central issue has been prediction of how the DNA denatures, or melts, to dynamically create local single-stranded regions, to which a number of single-strand binding elements can attach, and thus influence such functions as gene transcription and a number of other DNA-dependent functions.Algorithms for this aspect of DNA behavior have been built on the foundations of polymer theory and statistical mechanics, in which the pioneering work of Poland and Scheraga  establisDNA melting algorithms aim at quantitative predictions of in vitro experiments in dilute DNA solutions at specific temperatures, ionic strengths, and denaturing solutes . Few attAn important requirement for any melting algorithm to be useful on long genomic sequences is that its computation time grows linearly with sequence length. For decades, the only available linear algorithm was the Poland\u2013Fixman\u2013Freire (PFF) algorithm ,19. It cEarlier studies similar to the present one have investigated genomic profiles of the local GC contents , partly Combining a knowledge-driven modeling approach and data-driven statistical explorations, we now report the complete calculation of the human genomic melting map, and we report a first explorative examination of the potential information content of the melting map. We discuss the large-scale computational challenges, such as the algorithmic complexity, the high-precision floating point formats, a Fixman\u2013Freire approximation for very large sequence lengths, and the hardware requirements. We find that the cooperativity of DNA dominates at sequence resolution below 500 base pairs, and most importantly, that neighboring melting domains influence each other such that GC content is no longer a sufficient predictor of single-strandedness. This has important implications for understanding the interactions in chromatin.x) = \u03c3(2x + d)\u03b1\u2212  is approximated by \u03a9\u2032(x) = const \u00d7 \u03c3 \u00b7 f(2x + d), where the power function has been replaced by some multi-exponential functionI, n,A and nB  can be determined by fitting f(x) to x\u03b1\u2212. The MELT87 code contained a hard-coded set of I = 10 exponentials. Although it is known that with a fixed number I, the Fixman\u2013Freire approximation breaks down for long enough sequences, the consequences for the melting calculations have been largely ignored in the literature. I = 10 and an I = 21 approximation. The I = 10 approximation is only accurate for loop sizes up to the order of 104, whereafter it decreases exponentially. The I = 21 approximation is accurate for loop sizes up to the order of 108, whereafter it also decreases exponentially. When we first applied an I = 10 approximation in the calculation for human chromosomes, we observed \u201cceiling\u201d artefacts imposing upper limits on the melting temperatures. An interpretation of this observation is that very large loops should be included in the partition function at high temperatures, despite their low statistical weights. To take large loops properly into account, we derived a Fixman\u2013Freire approximation for arbitrary sequence length. Here, the parameters I, n,A and nB are given algebraically by the following expressions: I \u2265 1 + ln(2N) where N is the sequence length, nB = n\u2212Ie, andhttp://meltmap.uio.no/tools/loopentropy.html).The melting profiles were calculated using the Poland algorithm  with theI = 21 exponentials. The extra computation time spent (about twice that for an I = 10 set) removes the artefacts that would otherwise have required extra validation efforts.For all the human chromosomes, we used the set of \u03c3 = 3.5 \u00b7 10\u22125, \u03b1 = 1.75, and d = 0. We do not distinguish methylated cytosine from unmethylated cytosine, and we use the parameters for unmethylated cytosine in both cases. Unknown bases in the sequence (denoted by N) are assigned their own parameters obtained by averaging over the four bases A, C, G, and T.The Poland algorithm also uses parameters that determine the free energy contributions of the helical segments. Several sets of experimentally determined parameters are available, but a comparative study by SantaLucia  has showx) at which the probability at position x equals 50%. The resulting Tm-profiles or melting maps summarize the main features of melting along the sequences. The melting maps are stored in a format rounded to two digits after the decimal point. The complete calculation of probability profiles for all human chromosomes takes approximately 22 CPU days on an HP Superdome . The calculation requires at least 13 GB RAM to process the longest chromosome (~240 Mbps) with seven arrays extended precision.The output of the Poland algorithm is a probability profile showing the probability of each position to be in the helical state calculated for a given temperature. For each chromosome, we calculate all probability profiles in the range 45\u00b0 C to 110 \u00b0C at every 0.1 \u00b0C temperature increment. From this set of probability profiles, we derive the melting temperatures Tm. As the melting maps represent cooperative melting events of many base pairs, many features are still present at a lower resolution.hg17 (May 2004) , the length L = xend \u2212 xstart + 1, the average melting temperature, and the end-to-end step height (Tm(xend) \u2212 Tm(xstart)), were determined. Segments of L < 9 were discarded for downstream analyses.Second, we also defined three types of segments, called The Pearson correlation coefficient was used to quantify the direction and magnitude of coordinated relations between various pairs of continuous variables, for example, the melting temperature versus the GC contents, and the recombination rates, respectively.The local GC content was calculated for every nonoverlapping window of different lengths (varied from 10 bps to 1 Mbps) as the ratio of G + C over the total number of A + T + G + C within each window. Note that the Ns do not contribute in the above definition, i.e., we made no assumptions of the base pair composition with respect to unknown bases.When investigating the correlation between melting profiles and the recombination rates, we used the DeCODE data source, as publicly available ,39. ThisFor exploratory analysis of annotation correlations, the EpiGRAPH analysis service ,41 was uhttp://www.mathworks.com). Although the wavelet decomposition algorithm has been under continuous improvement since its inception, wavelet analysis is still computationally demanding.The enormous size of the human genome, with the shortest chromosome being more than 45 Mbps, requires an approach that can, beyond local details, reveal possible global patterns in an analysis of the melting map. Wavelet analysis, having evolved from Fourier transformations, has become an increasingly popular and useful tool for analyzing signals that contain nonstationary power at many different frequencies. It has been found in previous studies ,43 usingWe performed continuous wavelet transformation, using a 1-Kbp window-averaged melting profile over a wide range of scales from 20 Kbps to 5 Mbps, at steps of 20 Kbps. Subsequently, the scale-averaged wavelet power spectra were computed for examining the underlying rhythm of fluctuations in power over various scales.We also randomly chose some melting map stretches of 2~3 Mbp in length from various chromosomes, and performed the wavelet analysis within each nonoverlapping 10-Kbp or 20-Kbp segments. This analysis was done at base-pair level, that is, using scales from 2 bp to 1,024 bp at steps of 2 bp to capture oscillations at a high resolution.n. The lowest melting temperature per chromosome varied from 48.85 \u00b0C to 51.82 \u00b0C, where Chromosome 16 displayed the low 48.85 \u00b0C at the 10,501th 1-Kbp segment, which fully overlapped with a repeat of (TA)n type. The 100-bp segments displayed similar statistics . The broad ranges of melting temperatures in the human melting map were in contrast with those of the randomized chromosomes, which had melting temperatures in a narrow range of 70 \u00b1 6 \u00b0C. A similar picture arose for the GC contents of 1-Kbp windows. In the human genome, the bulk of GC contents (in 1-Kbp nonoverlapping window) ranges roughly from 20% to 80%, while in the randomized chromosomes, the ranges are about six times as narrow.The fundamental feature of a melting map is the occurrence of thermodynamically stable and unstable regions, having relatively high and low melting temperatures, respectively. For the human chromosomes, we obtained statistics of melting map features using nonoverlapping averaging window sizes from 10 bp to 1 Mbp. We compared the correlations between GC content and the melting temperature using different window sizes, ranging from 10 bps to 1 Mbps. The human genomic melting map showed a very strong correlation with the local GC content within windows of 1 Kbp and larger; above 0.99 for all chromosomes see . As alsop-value of below 4.16E-4 (using Bonferroni correction), as shown in Correlating a genome-wide recombination rate  with theflat segments on Chromosome 21 were investigated but did not reveal strong correlation with melting temperature (unpublished data).Similarly, the Pearson correlations of the SNP frequency distribution  with thehttp://meltmap.uio.no/results/extreme_tms.html). We defined stable  and unstable  regions as consecutive stretches of extreme high/low temperatures. Twenty high-Tm regions  and 20 low-Tm regions  were randomly chosen from various chromosomes. EpiGRAPH analysis (see http://meltmap.uio.no/results/EpiGraph/061011_125400_423443447_Attributes.html) indicated that unstable regions were associated with AT richness, low levels of evolutionary conservation, and high SNP frequency, and also exhibited frequent overlap with tandem repeats. The stable regions correlated with not only physical parameters of DNA, such as high solvent accessibility (as illustrated in http://meltmap.uio.no/results/exon_vs_nonexon.html).For a more detailed analysis of the stable and unstable regions, we defined the melting temperatures above 90 \u00b0C and below 50 \u00b0C as extreme temperatures . A statistically significant association between Alu-type SINE repeat structures and the up/down class was found, compared with the flat class . When comparing segments with increasing melting temperatures (up segments) with decreasing temperatures (down segments) (in a 5\u2032-3\u2032 orientation), no significant differences were found.The perhaps most interesting aspect of a melting map may in fact lie within the melting domain segmentation. In a macroscopic view, the human genomic melting map broadly follows the local GC content. However, with increased resolution, the cooperative melting characteristics appear as expected. Relatively flat plateaus of nearly equal melting temperatures are widespread, interspersed with step-like areas of both minor and large changes. We applied our segmentation definitions to examine the details of the melting map and its cooperativity. We thus performed an EpiGRAPH comparison of the annotation differences between two classes of randomly selected cases among the lass see B. There flat segments of different sizes (below 100 bps), we performed EpiGRAPH analyses using 25 cases from each of two classes, which contained flat segments at ~68 \u00b0C in the length of ~60 bps and ~20 bps, respectively, from Chromosome 21. Both options of choosing data with and without repeat masking were examined. It was found that the correlation of the two classes with the kurtosis and SD of the physical parameters , as well as those for C and G frequency, had Bonferroni-adjusted p-values being equal or smaller than 10\u22126, but no significant correlation to functional annotations were found (unpublished data).In an attempt to capture possible functional differences between flat segments of Chromosome 21. Intriguingly, we observed not one, but three, distinct bands in a scatter plot  based on the difference between the average melting temperatures of the segments and their neighbor regions  at both sides. The segments in category I had higher melting temperatures on both sides than on themselves, and those in category III had lower melting temperatures on both sides than on themselves. The other segments were clustered into category II. When To further investigate the relationship between sequence statistics and melting features, we examined the GC contents of all 50 bp plot see , indicathttp://meltmap.uio.no/results/wavelet_global.html).Wavelet analysis on the low resolution melting map  was performed in order to uncover possible oscillating patterns of melting temperatures along the whole sequence. Although different chromosomes did not reveal an identical pattern of periodicities, ~200 Kbp, ~400 Kbp, and ~1 Mbp were the common wavelengths observed in multiple chromosomes. This was also conducted for the GC content (using 1-Kbp nonoverlapping windows), and it tended to fall into the same general picture as that of the melting map. In contrast, no visible peaks could be found in the spectral analysis of the randomized chromosomes . In these analyses, a frequency of approximately 150 bps, roughly corresponding to the nucleosome length, was frequently seen. We also observed a general oscillation pattern in the range of 500~600 bps in most of the regions examined. A sample plot of local wavelet analysis is shown in As it was possible that some periodic patterns with scales fewer than 1,000 bps also exist locally, we performed high-resolution  spectral analysis on several randomly chosen ENCODE regions (see We here present the complete melting map of the human genome. While we find a high correlation (0.99) between the local GC content and the melting map averaged in 1-Kbp windows for all human chromosomes, The randomized chromosomes derived from the selected randomization procedure were intended to serve as a baseline for comparison and for verification of our analyses. As these were required only to have the same overall frequencies of As, Cs, Gs, and Ts as the corresponding human chromosomes, the di-nucleotide composition was not preserved in the randomization procedure. Other randomization procedures would be worthwhile exploring for biological questions. The randomized chromosomes displayed a much more uniform GC content than the human chromosomes. As a consequence, the mosaic structure of the human chromosomes, presumably reflecting biological function, was not preserved. The correlations for the human chromosomes between DNA annotations and melting map features were not found for the randomized ones, well in line with our expectations.We correlated the melting map with various physical and functional features of the genome at several levels of resolution in a first exploration of the information contained. The recombination rate ,39 and tflat window as having minimal SD of melting temperature, as opposed to nonflat windows that have high SD. To identify melting segments of various lengths, we chose an approach based on incremental step of consecutive melting temperatures. Both approaches were shown to be useful for this first exploratory effort.In a zoomed-in view, the domain structure of the melting map is distinct from the GC content. To explore possible correlations between these domains and the plethora of other existing annotations for the human genome, it was necessary to extract the corresponding segments from the melting map in an automated way. No clear and rigorous definition of a melting domain exists, and it is not known how accurately domains can be determined from a melting map. Thus, we tried several approaches to locate segments at various resolution levels. Given a constant size of a window, we defined a Future studies, however, should address the segmentation aspect more elaborately. Better segmentation algorithms can be applied, for example, by modifying existing algorithms used for analyzing the GC contents ,34. A be. for promoter locations in prokaryotes [However, using the simple segmentation algorithm described, we were able to identify, and to some extent quantify, the effect of cooperativity between neighboring regions. We clearly demonstrated that the influence of neighbor regions is visible for the segments at lengths fewer than 150 base pairs, and increases in importance down to 20-bp segments. Also, it is observed that the cooperative effect depends on the length of the central segment, melting temperature differences between neighbor regions, and the lengths of neighboring regions. Cooperativity is generally not considered for most computer prediction algorithms of biological functions. As has been shown by Benham et alkaryotes , it seemThe extreme instances of high and low melting temperatures were statistically compared with existing annotations. The low-Tm regions naturally coincided with AT-rich regions, but were also found to coincide with regions of poorer conservation and relatively frequent SNP and repeat occurrence. The high-Tm regions correspondingly were found to be associated with GC-rich sequences, but more interestingly also to various physical parameters of DNA, such as high solvent accessibility and rise, and a higher association to genes. These findings are generally expected from the underlying sequence composition. It is for instance well-known that the gene frequency is higher in GC-rich regions, as are the bendability and B to Z conformation transitions. It is thought that these parameters relate to a propensity for gene transcription .flat and nonflat segments significantly identified Alu type repeats as a major contributor of nonflat segments. The general structure for these retrotransposed sequences of a few hundred base pairs consists of a GC-rich transcription start site, a variable middle part, and an AT-rich tail part [As the cooperative effect was found to be more pronounced for shorter melting segments, we focused on those of length fewer than 100 bps. Among these, a selection of ail part . In factAn overrepresentation of transcription start sites and increased gene frequency was also found in nonflat segments, as compared with flat segments. Recently, it has been observed that Alu-type sequence may have significant effects on gene expression, either through their influence on alternative splicing, through adenosine-inosine editing, or through protein translation influences . Alu seqWe found that exonic sequences had a shift toward higher melting temperature, compared with non-exons across the whole spectrum of melting temperatures, as well as a larger tail at the high melting temperature side. Others have previously found correlations between the occurrence of exons and relatively stable, high-Tm regions ,59. HowePreviously, others have performed spectral analysis of selected regions of the human genome GC content and intra-strand asymmetry ,62, in oThis paper is primarily concerned with establishing basic relationships between the human genomic melting map and available biological annotations. We are aware that the melting model employed in this work was developed for in vitro predictions. DNA in vivo, being much more densely packed together with histones and other macromolecules, seems too encumbered to form melting bubbles freely. Nevertheless, single-stranded regions are widespread in vivo, driven by molecular motors, rather than by temperature. Both replication and transcription rely on local opening of the DNA to take place, and also these processes should be scrutinized for possible dependencies on the melting map. For instance, DNA mutation rates may be related to the probabilities and lifetimes of bubbles exposing the bases. In a study using the Dauxois\u2013Peyrard-Bishop model on selected transcriptional promoters, it was indicated that the algorithm could identify the transcription start site , althougThe central hypothesis for this melting map exploration is that the predictions of in vitro melting may reflect also the in vivo behavior. It is reasonable to believe that the sequence-dependent bubble openings are functionally important in vivo. However, the correlations with biological annotations do not necessarily indicate causalities, and their possible physical or biological origins cannot be deduced from this preliminary work alone. Some correlations may stem from sequence composition due to evolutionary changes, reflected in the melting map, but with no relation to bubble openings and functional role. Further studies of the melting map and its association to annotations and DNA structures are clearly warranted and at present made possible on a genomic scale. One such interesting topic would be the evolutionary aspects of the melting curve across related species with available sequence information. It is our opinion that the development of further refined melting models, that include more aspects of the in vivo physical constraints and flexibility of chromatin DNA as actually experienced in the different settings in the nucleus, could benefit from the knowledge gained in studies like the present one. This would significantly influence the understanding of the mechanisms behind a number of central structural and functional aspects of cells.http://meltmap.uio.no/: 1) brief introduction of the project (http://meltmap.uio.no/intro.html), 2) source code of the melting map calculation (http://meltmap.uio.no/code.html), 3) online tool for calculating parameters of loop entropy factor approximation (http://meltmap.uio.no/tools/loopentropy.html), 4) human genomic melting map data files (based on UCSC release hg17) (http://meltmap.uio.no/rawdata.html), 5) browser of human genomic melting map (http://meltmap.uio.no/browser), 6) human genomic melting map being included in the Ensembl genome browser as a DAS source (http://meltmap.uio.no/tools/ensembl.html), and supplementary analytical results .The following materials  can be accessed via the Web page"}
+{"text": "Naegleria and Cryptosporidium amplicons generated in vitro with in silico DNA melting simulations using the programs POLAND and MELTSIM., then test the utility of these programs for assay design using a genetic marker for toxin production in cyanobacteria.DNA melting curve analysis using double-stranded DNA-specific dyes such as SYTO9 produce complex and reproducible melting profiles, resulting in the detection of multiple melting peaks from a single amplicon and allowing the discrimination of different species. We compare the melting curves of several Naegleria and two species of Cryptosporidium were similar to POLAND and MELTSIM melting simulations, excepting some differences in the relative peak heights and the absolute melting temperatures of these peaks. MELTSIM and POLAND were used to screen sequences from a putative toxin gene in two different species of cyanobacteria and identify regions exhibiting diagnostic melting profiles. For one of these diagnostic regions the POLAND and MELTSIM melting simulations were observed to be different, with POLAND more accurately predicting the melting curve generated in vitro. Upon further investigation of this region with MELTSIM, inconsistencies between the melting simulation for forward and reverse complement sequences were observed. The assay was used to accurately type twenty seven cyanobacterial DNA extracts in vitro.The SYTO9 melting curve profiles of three species of Naegleria and Cryptosporidium and the complex melting profiles generated in vitro using SYTO9 verified that the complex melting profile of PCR amplicons was solely the result of DNA dissociation. Other data outputs from these simulations were also used to identify the melting domains that contributed to the observed melting peaks for each of the different PCR amplicons.Whilst neither POLAND nor MELTSIM simulation programs were capable of exactly predicting DNA dissociation in the presence of an intercalating dye, the programs were successfully used as tools to identify regions where melting curve differences could be exploited for diagnostic melting curve assay design. Refinements in the simulation parameters would be required to account for the effect of the intercalating dye and salt concentrations used in real-time PCR. The agreement between the melting curve simulations for different species of  Meltinget al . Typing rescence .Tm. Wittwer et al [Giardia (660 bp amplicon from the gdh gene) [Naegleria (350 \u2013 400 bp amplicons from the intergenic spacer region) [Relatively few melting curve assays are based on the melting profile of the entire PCR product, with many measuring the melting of specific probes from the region of interest, typically targeting single nucleotide polymorphisms (eg. fluorescent resonance energy transfer (FRET) probes ). Whole er et al  identifidh gene)  and Naeg region) .The idea that large double-stranded DNA fragments of several kilobases may contain several melting domains is not new , and wasNaegleria and a segment of 18S rDNA from two species of Cryptosporidium. We also describe the use of these resources to design an informative melting curve assay for two different species of toxic cyanobacteria in silico and then physically test the assay in the laboratory to confirm assay performance with real samples.Two publicly available bioinformatic resources have been developed to model DNA melting: POLAND  and MELTN. australiensis, N. fowleri and N. lovaniensis were very distinct as previously reported [N. australiensis amplicon melted with a single sharp peak  versus base position) were similar for the POLAND first order reaction  was less than 0.3\u00b0C (data not shown). In the case of the C. parvum sequence there was a subtle difference between the POLAND  to a solution containing PCR buffer, MgCl2 and one of four different double-strand DNA-specific binding dyes: SYTO9 [unpublished). Whilst each of the dyes was used at an optimum concentration, analysing the melting curves under otherwise standard conditions limited any variability that may be contributed by differing reaction conditions or PCR amplification. The comparison of melting curves for each of the Naegleria test amplicons using the four dyes  and in each case the number of peaks and the separation of the peaks were predicted by the POLAND [Naegleria amplicons. Similarly, melting curves of a segment of 18S rDNA from C. parvum and C. muris resulted in distinct profiles that were predicted by the simulation programs, with MELTSIM providing a better prediction of the C. parvum melting curve. In both cases the actual Tms determined using SYTO9 melting curve analysis were generally 3 \u2013 5\u00b0C higher than the predicted Tms.Complex melting profiles resulting in multiple melting peaks provide a superior tool for identification of species or characterization of amplicons compared with simple profiles that result in only a single peak. In addition to e POLAND  and MELTe POLAND  programsTms is expected considering that the thermodynamic values used in the simulations for base pair stabilities or base stacking are based on empirical data determined for specific salt concentrations in the absence of any intercalating dyes , in practice this will be difficult considering that different dyes might interact with DNA differently and that the interaction might be affected by the ratio of dye:DNA molecules.The difference observed between the experimental and predicted Delcourt ). ConsidDelcourt  it wouldNaegleria SYTO9 melting curve profiles and melting simulations generated using POLAND or MELTSIM was not limited to the use of SYTO9. Three other double-stranded DNA-specific dyes were combined with purified Naegleria test amplicons, in addition to SYTO9; and resulted in melting curves with the same number of peaks and similar peak separation to simulations generated by POLAND and MELTSIM. Between-dye comparisons demonstrated that relative peak height varied slightly between dyes, most obviously for the N. fowleri melting curve, whilst the shape of the peaks was most obviously different when SYBR Green I was used. The melt map of the N. fowleri sequence suggests that the first 75 base-pairs of the sequence represent the melt domain contributing to the first peak. This region is AT-rich (73% A+T) which, considering the GC-preference of SYBR Green I [The close agreement in the  Green I ,28, may in silico melt curve assay design we chose a target gene of more than 6 Kb, cynD/AoaB, implicated in the biosynthesis of the cyanotoxin cylindrospermopsin [cynD/AoaB gene homologues, then manually submitting individual polymorphic regions to melt simulation. Screening sequences firstly with POLAND, we identified a 267 bp sequence segment that generated distinctly different melt profiles depending on the origin of the sequence: two melt peaks for cynD from C. raciborskii and one peak for AoaB from A. ovalisporum. When these two sequences were submitted to MELTSIM the simulation likewise predicted one melt peak for AoaB sequence; however, only one melt peak was predicted for cynD sequence, although the Tm was different to the AoaB sequence and there was a sub-peak/shoulder that was not present in the AoaB profile. The substantial differences in the simulated melting curves for the cynD sequence were surprising when compared to the melting simulations for the Naegleria and Cryptosporidium amplicons, where POLAND and MELTSIM predictions were similar except for fine scale changes. Comparison between these simulations and actual SYTO9 melting curve analysis of the cynD amplicon leaves no doubt that the POLAND program is clearly better enabled to model the melting in this case.To test the utility of the POLAND and MELTSIM programs for ermopsin ,29. The cynD and AoaB sequences, with the same major peak identified and only minor differences in other regions of the profile (data not shown).The underlying basis for the differences observed between MELTSIM and POLAND are likely embedded in the way the two programs implement the Poland algorithm and incorporate the thermodynamic parameters used for base stacking, loop opening and closing and so on. A difference between MELTSIM and POLAND is the base pair stability parameters that they use, with POLAND using the values determined by Blake and Delcourt in 1998 , whereasTm, resulting in a peak with a height proportional to the relative size of the domain. In contrast, the POLAND melt peaks appear to correspond with domains identified from the melt map generated using second order reaction probabilities. This causes POLAND to overestimate peak heights in some instances  yielded a different melt profile to the original with a much more obvious second peak half the height of the first peak (data not shown), more similar to the observed profile. This finding is surprising, especially considering that the melt map of the reverse complement appeared to be similar to the original except for the orientation and for the fact that the entire reverse complemented 3' end was included in the melt map . This raises the possibility that some data might be missing from the MELTSIM simulation, resulting in the loss of part of the domain and the subsequent failure to detect the second peak. Analysis of the reverse complementary sequences of C. parvum and N. fowleri resulted in no change to the profiles, although the Tm of the main C. parvum peak shifted slightly to the right by approximately 1\u00b0C (data not shown).Interestingly, the melt profile of cynB, suggesting that MELTSIM does not use the melt map output directly in the prediction of the melting curve.The truncation of the MELTSIM melt map appears to be caused by rounding during the calculation of domain sizes. The maximum number of domains per block (sequence) is 60, and it appears that MELTSIM calculates block size by dividing the sequence length by the number of domains per block and rounding the resulting number down to the nearest whole number. The melt map only allows plotting of 60 domains, which in the case of the sequences used in this study meant that sequences were truncated at approximately 240, 300 or 360 bp. Preliminary experiments conducted using a Linux compilation of MELTSIM [cynD/AoaB amplicons, initially identified by melting curve simulation, were exploited in a diagnostic assay to type known strains of cyanobacteria that produce the cyanotoxin cylindrospermopsin. Actual amplification of the expected 267 bp amplicon indicated that the strain was potentially toxic and the melting curve analysis confirmed that the correct product had been amplified and also typed the strain according to its genus. The Tm for each of the melt peaks observed was very uniform and divided the strains into two distinct groups. The melting curve analyses for C. raciborskii and A. ovalisporum were completely concordant with taxonomic classification. Notably, two Anabaena bergii strains were observed to bear sequences similar to the AoaB gene on the basis of the SYTO9 melting curve analysis. Later phylogenetic investigation of these strains using several highly conserved sequences confirmed that these were initially misidentified and were actually A. ovalisporum (data not shown). Whilst the assay proved to be highly informative for isolated cyanobacterial strains, it may also be used for routine testing of environmental samples, since cases of algal blooms that contain more than one species of cylindrospermopsin-producing cyanobacteria are rare (Dr. Peter Baker pers. comm.). The possibility also remains open that single filaments of cyanobacteria may be taken from a live environmental sample, extracted and the DNA amplified by real-time PCR.The differences in the melting curves for the Sampling extant sequence polymorphism by melting curve analysis of whole products and using the melting curve \"signatures\" for biotyping may be less discrete than melting curve analysis of single nucleotide polymorphisms (SNP) (e.g. using oligonucleotides for FRET). However, for some applications, such as species identification, the use of whole product melting curve analysis may be preferred because it is more tolerant to any small sequence differences that might result due to intraspecific variation. In addition, identification using whole product melting curve profiles is likely to be more robust than a SNP because by its nature a SNP is relying on only a single character difference for identification, whereas multiple character differences are usually required to change the melting curve profile of a larger fragment. The POLAND or MELTSIM programs will in their present form be useful as a guide to melt curve assay design but with some further refinement might be adapted into dedicated melting curve assay design software that provides access to the full richness of informative sequence polymorphism already present in sequence databases.in silico may stimulate more widespread use of whole product melting curve analysis and ultimately lead to dedicated melting curve assay design software.Multiple melting domains in a melting curve provide a rich source of information for typing samples. Computer-aided melting simulation provides a gateway to the exploitation of this information. The demonstration that melting curve assays can be designed reliably C. raciborskii and A. ovalisporum were cultured as described by Wilson et al [N. australiensis, N. fowleri and N. lovaniensis were prepared by aseptic transfer of a single plaque to a 1.5% non-nutrient agar plate  supplemented with 300 \u03bcL E. coli (3 \u00d7 1010 cells/ml) in sterile saline. All subcultures were derived from the Australian Water Quality Centre Culture collection. C. parvum oocysts (Swiss cattle C26) were purchased from the Department of Veterinary and Biomedical Sciences, Murdoch University, Perth, Australia. C. muris oocysts were kindly provided by Dr Una Ryan.The cyanobacteria on et al  and the Naegleria cultures, a loopful of cells was aseptically transferred from the edge of a plaque into 20 \u03bcL of Instagene (Bio-Rad USA) and DNA extracted from the cells according to the protocol supplied by the manufacturer. Oocyst DNA was extracted by 5 cycles of freeze thawing in liquid nitrogen followed by Instagene extraction following the manufacturer's instructions.For cyanobacterial cultures, sub-samples of 1 ml were taken from densely grown cultures and pelleted by centrifugation at 14000 RPM for 10 min in a Sigma 1\u201315 Microfuge . The supernatant was removed by sterile pipetting and DNA extracted from the remaining pellet using the QIAamp DNA Minikit  according to the Tissue Extraction protocol supplied by the manufacturer. For Cryptosporidium 18S rDNA was amplified as described by Keegan et al [Naegleria PCR was performed as described by Robinson et al [Taq PCR buffer , 1 U of Platinum Taq , 2.5 \u03bcM SYTO9 and 4 mM MgCl2 . For cyanobacterial templates, the thermal cycling conditions included an initial denaturation at 94\u00b0C for 2 min, followed by 50 cycles at 94\u00b0C for 5 s and 60\u00b0C for 25 s, with data acquisition on the FAM channel following the 60\u00b0C anneal/extension step. The amplified PCR products were visualised on 1.5% agarose gels stained with Gelstar  to check product formation and sizes of the products were estimated from a DNA molecular weight marker: pUC19/HpaII digest .PCRs were performed using a Rotor-Gene 3000 . an et al , except on et al . CyanobaMelting curve conditions included an initial hold step of 70\u00b0C for 1 min, followed by temperature ramping of 0.5\u00b0C/30 s to 99\u00b0C. SYTO9 was detected in the FAM channel  using a gain setting of 2. Melting curves were initially visualised using the Rotor Gene Analysis software (version 6) with the digital filter set to none. For preparation of graphs data were exported from Rotor Gene experiment files into Origin 7 (OriginLab Corporation) and lines were drawn through points using a b-spline.Naegleria DNA was amplified as described above except that SYTO9 was omitted from the reaction mixture. Amplicons were purified using Montage PCR purification columns  according to the protocol supplied by the manufacturer. Purified amplicons amplified from the same template were pooled and the mass of DNA in each of the pools calculated by UV spectrophotometric analysis using a GeneQuant Pro . The mass of DNA in each of the pools was adjusted to 30 ng/\u03bcL. For the melting analysis, all reactions were melted with 25 \u03bcL total reaction volumes containing 120 ng of test amplicon DNA, 2.5 mM MgCl2 , 1 \u00d7 PCR buffer II  and either 0.25 \u00d7 SYBR Green I , 1 \u00d7 LC Green , 2 \u03bcM SYTO 9  or 2 \u03bcM SYTO 59 . Melting curve conditions included three repetitions of the following cycle: two initial hold steps for 1 min each, 95\u00b0C then 60\u00b0C, followed by temperature ramping of 0.5\u00b0C/30 s from 70 to 99\u00b0C. SYTO9 and LC Green were detected in the FAM channel  at a gain of 6 and 10 respectively, SYBR Green I was detected in the SYBR channel  at a gain of 7.33 and SYTO59 was detected in the Cy5 channel  using a gain setting of 8.67. Melting curves were visualised by the analysis software  with the digital filter set to none. The purified amplicons used in the melting analyses were visualised on 1.5% agarose gels as described above to confirm that the amplicons were single products of the correct sizes.AJ132027 (Naegleria fowleri NG166), AJ132034 , X96569 , AF093496 (Cryptosporidium muris), AF040725 (Cryptosporidium parvum), AF395828  and DQ531847 (Cylindrospermopsis raciborskii). Where required, sequences were truncated to remove sequences outside of the region bounded by the primers. Melting simulations were performed using the POLAND program [vs. temperature\" plot and the first and second order reaction stack indices for temperature pf 50% probability for POLAND and the \"theta  vs. temperature\" plot and melt map plot for MELTSIM.GenBank accession numbers for DNA sequences used in the computer simulations are:  program . Poland JPR participated in experimental design, developed the cyanobacterial PCR assay, conducted the melting curve analyses and drafted the manuscript. CPS contributed to the cyanobacterial component of the work. PTM participated in experimental design, conducted the melting simulations and data analysis, prepared the figures and drafted the manuscript. All authors have read and approved the final manuscript."}
+{"text": "Millions of people worldwide consume arsenic-contaminated rice; however, little is known about the uptake and bioavailability of arsenic species after arsenic-contaminated rice ingestion.in vivo swine model.In this study, we assessed arsenic speciation in greenhouse-grown and supermarket-bought rice, and determined arsenic bioavailability in cooked rice using an In supermarket-bought rice, arsenic was present entirely in the inorganic form compared to greenhouse-grown rice (using irrigation water contaminated with sodium arsenate), where most (~ 86%) arsenic was present as dimethylarsinic acid (organic arsenic). Because of the low absolute bioavailability of dimethylarsinic acid and the high proportion of dimethylarsinic acid in greenhouse-grown rice, only 33 \u00b1 3% (mean \u00b1 SD) of the total rice-bound arsenic was bioavailable. Conversely, in supermarket-bought rice cooked in water contaminated with sodium arsenate, arsenic was present entirely in the inorganic form, and bioavailability was high (89 \u00b1 9%).These results indicate that arsenic bioavailability in rice is highly dependent on arsenic speciation, which in turn can vary depending on rice cultivar, arsenic in irrigation water, and the presence and nature of arsenic speciation in cooking water. Arsenic speciation and bioavailability are therefore critical parameters for reducing uncertainties when estimating exposure from the consumption of rice grown and cooked using arsenic-contaminated water. Arsenic contamination of groundwater has been reported in many countries throughout the world, most notably in Southeast Asia. In recent years, much attention has focused on the As calamity in Bangladesh and West Bengal, India, following the highly publicized reports of vast populations being exposed to As-contaminated groundwater. Recently, Oryza sativa L.), which represents approximately 83% of the total irrigated area in Bangladesh  influenced As uptake in the swine model.In this study, we investigated the concentration and speciation of As in supermarket-bought rice, in rice grown under greenhouse conditions using As-contaminated irrigation water, and in rice cooked in As-contaminated water. In addition, we assessed the bioavailability of As in rice using an Oryza sativa Quest) was grown under greenhouse conditions.We used three rice varieties in this study. Supermarket-bought rice, including Basmati White (India) and Long White  rice, were purchased from a local supermarket , whereas Paddy rice . This As concentration was selected because it represented the highest concentration of As reported in contaminated groundwater in Bangladesh (V.Quest was cultivated under paddy conditions in pools containing washed sand (pH 7.5) mixed with a slow-release fertilizer low in phosphate. The slow-release fertilizer was applied at a rate consistent with nitrogen and potassium rates applied in field conditions (70 kg/ha). Rice seeds were germinated in moist compost and planted into pools 3 weeks after germination. After transplantation, each pool contained 75 seedlings which were exposed to a 16-hr light period with the temperature maintained at 28 \u00b1 5\u00b0C. Plants were grown to maturity (30 weeks) under paddy field conditions  with irrigation water containing 1,500 \u00b1 300 \u03bcg As/L supplied as Nangladesh . No addi3 (10 mL). Digestion tubes were allowed to stand overnight at room temperature; the following day, the tubes were placed on a heating block and the temperature increased in steps from 75 to 140\u00b0C for up to 10 hr. Digested samples were removed from the heating block when nitric acid volumes were reduced to 1 mL. Once the digests had cooled, samples were diluted to 20 mL with deionized water and filtered (0.45-\u03bcm filters) before analysis by inductively coupled plasma\u2013mass spectrophotometry . For quality assurance and quality control, the appropriate number of blank and standard reference material samples  were included in the digestion procedure and sample analysis.We analyzed Basmati White, Long White, and Quest for total As concentration by digesting approximately 0.5 g rice with concentrated HNOThe nature of As speciation in rice grains was determined using the trifluoroacetic acid (TFA) extraction technique of 4H2PO4 adjusted to pH 5.6 with aqueous NH3) flow rate was 1.5 mL/min. We quantified As compounds by external calibration with standard solutions of arsenite (AsIII), AsV, dimethylarsinic acid (DMA), and monomethylarsonic acid (MMA) (The nature and concentration of As species in extract solutions was determined by HPLC-ICP-MS (Agilent Technologies). Samples were injected onto a PRP-X100 anion-exchange column  using a fixed 50-\u03bcL sample loop. The column temperature was maintained at 40\u00b0C and the mobile phase (20 mM NHid (MMA) .In vivo assays were approved and conducted according to application 1702 of the Institute for Medical and Veterinary Science Animal Ethics Committee. Animals used in the study were treated humanely and with regard for the alleviation of suffering. Female Large White swine, weighing 20\u201325 kg, were used for in vivo bioavailability assays. After acclimation for 12 days to animal house conditions, swine were fasted for 24 hr before surgery for the insertion of jugular catheters. We used medical-grade vinyl tubing  for all catheterizations, according to the method of in situ. A 15-gauge blunt luer needle fitting  was fitted to catheter ends. Interlink injection site bungs  were attached when catheters were not in use. Extension tubing  connected to a three-way tap  was fitted to catheter ends when sampling blood during experiments.ad libitum. Before As dosage, blood samples were taken to determine baseline blood As concentrations. Catheters were then flushed with 20 mL heparinized saline (50 IU Heparin/mL). For oral As dosage, solutions of MMA, DMA, AsIII, or AsV (80\u2013100 \u03bcg As/kg) were supplied in 150 mL deionized water after intravenous administration of diazepam  and ketamine  to induce short-term anesthesia to facilitate the passing of a gastric tube. Intravenous As dosages  were administered using a catheter separate from the blood sampling catheter. Arsenic-contaminated rice (170\u2013270 g) was fed to animals with 20 g pelletized food to increase palatability. Blood samples were routinely taken over 26 hr after dosage and collected in 7.5-mL heparinized collection tubes . After each blood sample, catheters were flushed with saline. Catheters were flushed with 20 mL heparinized saline after 6-, 10-, 24-, and 26-hr samples. Plasma was separated from red blood cells by centrifugation  and then stored at \u221220\u00b0C before As analysis. For each in vivo treatment , three separate animals were used. The concentration of As in blood plasma was determined by ICP-MS (Agilent Technologies) and As bioavailability calculated using pharmacokinetic analysis encompassing areas under the plasma-concentration [area under the curve (AUC)] time curves after zero correction and dose normalization. When calculating the absolute bioavailability of As species, the AUC for the respective As intravenous treatment was used and compared to oral doses (Equation 1).During bioavailability assays, animals were housed in metabolic cages. Swine were fed twice daily [500 g low-As swine pellets (10 \u00b1 5 \u03bcg As/kg)], 2 and 10 hr after As dosage while water was supplied Oral-As is area under the As blood plasma concentration versus time curve for an oral arsenic dose; AUCIV-As is area under the As blood plasma concentration versus time curve for an intravenous arsenic dose; DRIV-As is dose of intravenously administered arsenic (milligrams per kilogram); and DROral-As is dose of orally administered arsenic (milligrams per kilogram).where AUCWhen calculating the absolute bioavail-ability of As in rice, we compared As speciation data and AUC values for rice doses to intravenous As treatment:Oral-rice is area under the As blood plasma concentration versus time curve for an oral rice dose; AUCIV is area under the As blood plasma concentration versus time curve for an intravenous arsenic dose ; R is ratio (fraction of 1) of either As species  in the rice; DRIV is dose of intravenously administered arsenic  (milligrams per kilogram); and DROral-rice is dose of orally administered As in rice (milligrams per kilogram)where AUC2O2  using U.S. Environmental Protection Agency method 3015A (We used two methods to determine As in blood plasma. Samples (3 mL) were digested with nitric acid  and Hod 3015A . After dod 3015A  before a3 digestion method was confirmed by a quantitative average As recovery of 30.05 \u00b1 0.87 mg/kg (n = 4) from CRM DC73349 samples (26.18 \u00b1 3.14 mg As/kg). During the determination of total As concentration in rice and plasma samples, duplicate analysis, spiked sample recoveries, and check values were included. The average deviation between duplicate samples (n = 16) was 3.8% (0.2\u20138.5%), the average recovery from spiked samples (n = 8) was 103% (101\u2013109%), whereas check value recoveries (n = 32) ranged from 94.2 to 106.7% (101.5% average recovery). In addition, we assessed the accuracy of the As speciation method by analyzing As standard solutions  during the speciation procedure. Recoveries for MMA, DMA, AsIII, and AsV were 92 \u00b1 3% (n = 6).During the analysis of total As concentration in rice samples, a standard reference material (CRM DC73349) was included in the digest and analytical procedures for quality assurance and quality control. The accuracy of the HNOSeveral studies  have detV/L, the As concentration increased from 32 to 1,000 \u03bcg/kg  produced a final As concentration of 480 \u03bcg/kg (wet weight) as a result of absorption of water during the cooking process. However, when Basmati White rice was cooked in water containing 1,000 \u03bcg As00 \u03bcg/kg . In a pr/kg  , the daiIII. Previous studies have demonstrated the variability in As speciation in rice varieties from around the world . The paucity of absorption data and the expense and difficulty in performing relevant bioavailability studies have led to a conservative approach regarding As absorption from food in human health risk assessment. In fact, reducing the uncertainties in estimating exposure of As in food through bioavailability studies was a key recommendation for future research from Environmental Health Criteria 224, ompounds . To addrtabolism .III, and AsV to determine the absolute bioavailability of these As species  to increase its As content  and then fed to the swine. This treatment was performed to determine the bioavailability of As absorbed during the cooking process. Absolute As bioavailability in these rice treatments was determined according to Equation 2. Data from speciation studies was included in bioavailability calculations because of the observed variability in gastrointestinal absorption of different As species.We determined the absolute bioavailability of As in rice after pharmacokinetic studies using two different rice treatments. Quest  was cooked in \u201cuncontaminated water\u201d and then fed to the swine to determine the absolute bioavailability of As in rice after cultivation using As-contaminated irrigation water. In addition, Basmati White was cooked in \u201cAs-contaminated water\u201d , only 33.1 \u00b1 3.2% of As was absorbed into systemic circulation (Results from culation . The lowculation . DMA wasculation .V supplied to the cooking water (in vitro gastrointestinal digestion and Caco-2 cells found that As bioaccessibility ranged from 63 to 99% (in vitro gastrointestinal digestion methods used, which may not reflect digestion processes occurring in vivo.In contrast, Basmati White cooked in As-contaminated water contained entirely inorganic As as a result of Asng water . After cng water . A previ3 to 99% . HoweverWhen calculating the contribution of rice consumption to MTDI values, the inclusion of As speciation and bioavailability data produces significantly different values compared with calculations using total rice-bound As concentrations . In TablThe most striking difference in MTDI calculations occurred for rice varieties containing high proportions of organic As (e.g., Long White, Instant White, and Quest; in vivo after oral administration, resulting in low bioavailability values for rice containing high proportions of this As species. Conversely, As bioavailability was high in rice containing high proportions of inorganic As as a result of cooking the rice in AsV-contaminated water. To the best of our knowledge, this is the first study that has assessed the bioavailability of As in rice using a suitable animal model for human health risk assessment. Studies of this nature, incorporating As speciation and bioavailability, are critical to reduce uncertainties in estimating exposure and to provide a more accurate estimate of risk.The results from this study demonstrate that As speciation plays a major role in determining the amount of As absorbed after consumption of As-contaminated rice. DMA was poorly absorbed"}
+{"text": "Oryza sativa L.), is a significant problem throughout the world and an emerging threat in regions where it was previously absent. Despite belonging to the same species complex as domesticated rice and its wild relatives, the evolutionary origins of weedy rice remain unclear. We use genome-wide patterns of single nucleotide polymorphism (SNP) variation in a broad geographic sample of weedy, domesticated, and wild Oryza samples to infer the origin and demographic processes influencing U.S. weedy rice evolution.Weedy rice (red rice), a conspecific weed of cultivated rice (O. sativa varietal groups not grown commercially in the U.S., suggesting weed origins from domesticated ancestors. Hybridization between weedy groups and between weedy rice and local crops has also led to the evolution of distinct U.S. weedy rice populations. Demographic simulations indicate differences among the main weedy groups in the impact of bottlenecks on their establishment in the U.S., and in the timing of divergence from their cultivated relatives.We find greater population structure than has been previously reported for U.S. weedy rice, and that the multiple, genetically divergent populations have separate origins. The two main U.S. weedy rice populations share genetic backgrounds with cultivated Oryza species. Our results demonstrate the potential for weedy life-histories to evolve directly from within domesticated lineages. The diverse origins of U.S. weedy rice populations demonstrate the multiplicity of evolutionary forces that can influence the emergence of weeds from a single species complex.Unlike prior research, we did not find unambiguous evidence for U.S. weedy rice originating via hybridization between cultivated and wild  Among the most widespread and costly agricultural pests are the numerous weeds that have evolved from within the same complex of interfertile species as domesticated plants -3. The rThe larger complex of interfertile species within which conspecific weeds evolve includes the crop, wild relatives, and other feral weeds . StudiesOryza sativa L., weedy rice has morphological characteristics typical of wild species  and of cultivated rice . The long term persistence of weedy rice throughout the range of cultivated rice, suggests that it can adapt to local changes in agronomic practices as well as different biotic and abiotic conditions . Currenian rice -15,27. Aarieties , a groupufipogon . To dateOryza crop-wild complex, to infer the origin and demographic history of U.S. weedy rice. Specifically we attempt to address remaining uncertainties regarding 1) the ancestral Oryza group(s), including other wild species, that gave rise to U.S. weedy rice, 2) the timing of divergence between U.S. weedy rice and its progenitor(s), and, 3) the role of hybridization in the establishment of U.S. weedy rice populations. We find considerable population structure in U.S. weedy rice, with genetically divergent populations having separate origins. Exotic cultivated O. sativa varieties are the main contributors to weedy rice genomes, and there is little evidence of contribution from wild Oryza. Hybridization among weedy groups has also influenced the emergence of novel weed phenotypes. Assessments of demographic parameters suggest differences among divergent weedy groups in the effect of population bottlenecks upon U.S. colonization, and in the timing of their origins. Our results demonstrate how similar weedy life histories can evolve from divergent genetic backgrounds.Taking advantage of the existing genomic resources for domesticated rice ,29, we uWeedy rice seed was obtained from collections made over a period of 30 years in the Southern rice belt  and maintained by the United States Department of Agriculture (USDA) at the Dale Bumpers Rice Research Institute, Stuttgart Arkansas , 22 temperate japonica , and 6 aromatic (fragrant rice varieties). A plurality of evidence supports the independent domestication of the indica and aus groups from the japonica and aromatic groups beginning ~ 10,000 ybp from divergent populations of O. rufipogon  . An ue Rose; ) or haveufipogon ) accessiufipogon . Four acs slaves . Similarme Oryza .DNA was extracted from approximately 1 g of fresh leaf material from one plant per accession using a modified CTAB protocol ,40. DNA GQ999668-GQ999777.DNA sequencing was carried out in Cogenics sequencing facilities  as described in ,42. BaseO. sativa cultivars from independent domestication events have been used to distinguish cultivar groups  markersose from  for whicose from . We assuOryza tend to self-fertilize, while wild Oryza outcross more frequently (10 to 60%) . We chose summary statistics shown to be sensitive (correlated) to changes in population growth and timing of divergence . These sy in Zea .We employed a similar rejection approach as in ,65 and uO. barthii or O. meridionalis). These SNPs were excluded from analyses when occurring in targeted groups. Insertions and deletions (indels) were not used in haplotype determination or calculation of summary statistics . Heterozygotes were observed almost exclusively in O. rufipogon, and only two weedy rice and four cultivated O. sativa accessions had heterozygous sites.The 48 sequenced STS ranged in aligned length from 400 to 921 base pairs (bp) over all accessions, for a total of ~24,145 bp aligned sequence per accession. We observed 827 SNPs in our entire dataset. Thirty-three SNPs had more than two alleles, primarily (73%) due to alternative states present in the outgroup species . We observed the same sized length variants (i.e. the size of deletion in base pairs) for each marker that were found in ,48   are differentiated from other hull phenotypes. With increasing K, SH individuals remained in a single cluster, while the non-SH group was further subdivided into five subpopulations  Figure . Individs Figure . Based os Figure . For exaOryza, we used InStruct and a dataset that included all accessions in our panel (n = 209). The best fitting model contained nine populations (K = 9)  for U.S. weedy rice within anel n = 09. The b) Figure . ClusterO. rufipogon although most individuals appeared to be admixtures  and O. rufipogon (53%)  Table , and wasaus and are not differentiated in the InStruct analysis that included all individuals , and rare in indica (20%) and O. rufipogon (7%) . We did not observe high frequency or specific haplotypes that would suggest weedy rice is a product of recent hybridization with O. rufipogon.In general, U.S. weedy rice groups contain a subset of diversity observed in their most closely related cultivated Oryza groups using mean and median values of STS Fst  were consistent with expectations that U.S. weedy rice populations have experienced population bottlenecks  and SH  are an order of magnitude smaller than for their ancestral populations . ML estimates of current weedy rice Ne were also smaller than estimates of current Ne for their relatives. Ne estimates for aus and indica across simulations were similar, with HPD intervals covering similar ranges in population size  per individual, and, therefore, depending on the actual degree of selfing , population size estimates may be, at most, twice as large [We used IMa and ABC to infer time of divergence and population sizes for the two main weedy rice groups (SH and BHA1) and their closest ks Table . ML estias large .aus and indica was ~6,047 ybp,  and BHA1 from aus  predate the introduction of cultivated rice to the U.S. (~1690's), and its establishment in the southern rice belt (>150 years). However, confidence HPD intervals for all estimates are very large and overlap  differ between the BHA and SH groups.Although clustering of weedy rice groups with cultivated relatives could also be due to common descent from a shared ancestral founding gene pool, the pattern of shared polymorphisms among weedy and cultivated groups is more consistent with direct descent from domesticated ancestors. Most of the SNPs found in the SH and BHA groups are a subset of those found in tropical japonica [Oryza germplasm have occurred. During the establishment of rice industry in the southern rice belt (~1860-1900), rice germplasm collected by the USDA was given to farmers directly for testing [O. sativa varieties.The close relationship of weedy rice with cultivated groups not grown in the U.S. suggests that both major weed groups were introduced either as stock seed contaminants or escaped breeding material. Although the majority of rice grown commercially in the U.S is japonica ,39, exte testing , potentiaus and indica cultivar groups, which likely stem from the same domestication event. The ML estimate of ~6,000 years , or within 1000 ybp  and were also relatively frequent in other groups such as O. rufipogon, O. nivara, and tropical japonica, supporting the possibility of introgression. However, our Instruct analysis did not detect contribution of other Oryza groups to BHA weedy rice, and we have no a priori reason to believe our aus sampling did not capture the genetic diversity present in this geographically limited group. Given the shared ancestry of all cultivars, weeds, and O. rufipogon, BHA1 private alleles shared with other groups could be a result of lineage sorting since divergence from aus. Interestingly, the single fixed SNP differentiating BHA groups from aus was not observed in any other Oryza group, supporting longer divergence between BHA weedy rice and its putative progenitor. Our estimates suggest that the founders of the BHA1 weedy rice group split from their cultivated relatives several thousand years ago and therefore may have existed as weeds prior to their introduction to the U.S. The ABC analysis marginally supported the introduction of BHA weeds before SH, which is contrary to expected based on historical records; black hull awned plants were not recorded until the 1920's, and anecdotal evidence attributes their origin to a cultivar introduced to Louisiana and abandoned due to excessive shattering [Both demographic analyses suggested an older divergence of BHA1 from its putative n Tables  and 5. Ile Table . These pattering .indica or aus are grown in the U.S., and therefore, an additional introduction of a weedy or cultivated group to the country would be required if BRH were the result of hybridization between indica-aus, indica-BHA, or SH-aus. The high estimates of Fst between SH and BHA1 (~0.32) indicates that gene flow is relatively infrequent between weedy groups. Prior research has suggested non-overlapping flowering time, high selfing rates, and height differences as possible mechanisms restricting gene flow between straw-hull and black-hull awned weedy types [In addition to multiple introductions, our results suggest that hybridization and introgression occurring post-founding have contributed to the development of morphological diversity in weedy rice populations. The BRH population is most probably a product of hybridization occurring in the U.S. between SH and BHA weedy rice Figure . No indidy types .tropical japonica cultivars grown in the U.S. have contributed to genomic backgrounds of weeds in our sample set is limited to a few individuals in the MX populations  may have evolved in U.S. weedy rice populations. It will be interesting to determine whether trait evolution supports pre-existence of the groups as weeds in Asia, or evolution of weediness upon introduction to the U.S. agroecosystem.The absence of any ALC, KMO, and YJ conceived the experiments. MR, and CST collected the data. BLG contributed materials. MR analyzed the data. MR and ALC wrote the paper. All authors read, provided editorial assistance, and approved the final manuscript.Supplementary Table 1. U.S. weedy rice accessions used in study.Click here for fileSupplementary Table 2. Oryza accession information and coefficients of ancestry inferred by InStruct.Click here for fileSupplementary Table 3. Information on STS fragments, primers, and diversity data.Click here for fileSupplementary text 1. MS command line and description of parameter values.Click here for fileSupplementary Table 4. Mean DIC (5 simulations) for InStruct analysis of A) only U.S. weedy rice (n = 58), B) all Oryza accessions (n = 209).Click here for fileSupplementary Table 5. Number of segregating sites, fixed and shared polymorphisms and private sites between various Oryza groups.Click here for fileSupplementary Table 6. ML estimates and 90% posterior density intervals (HPD) of demographic parameters for three population pairs.Click here for fileSupplementary Figure 1. Marginal posterior probability curves for demographic parameters for each population pair comparison as estimated by IMa. All estimates have not been converted to individuals or years A) ancestral population size for aus - indica, B) time of divergence aus - indica, C) migration from aus to indica in red, migration from indica to aus in black, D) population size of aus in red and indica in black, E) ancestral population size for aus - BHA1, F) time of divergence aus - BHA1, G) migration from aus to BHA1 in red, migration from BHA1 to aus in black, H) population size of aus in red and BHA1 in black, I) ancestral population size for indica - SH, J) time of divergence indica - SH, K) migration from indica to SH in red, migration from SH to indica in black, L) population size of indica in red and SH in black.Click here for file"}
+{"text": "Various methods have been developed to explore inter-genomic relationships among plant species. Here, we present a sequence similarity analysis based upon comparison of transcript-assembly and methylation-filtered databases from five plant species and physically anchored rice coding sequences.Lolium perenne (ryegrass), Zea mays (maize), Hordeum vulgare (barley), Glycine max (soybean) and Arabidopsis thaliana  was undertaken. Each rice pseudomolecule was divided into 10 segments, each containing 10% of the functionally annotated, expressed genes. This indicated a correlation between relative segment position in the rice genome and numbers of alignments with all the queried monocot and dicot plant databases. Colour-coded moving windows of 100 functionally annotated, expressed genes along each pseudomolecule were used to generate 'heat-maps'. These revealed consistent intra- and inter-pseudomolecule variation in the relative concentrations of significant alignments with the tested plant databases. Analysis of the annotations and derived putative expression patterns of rice genes from 'hot-spots' and 'cold-spots' within the heat maps indicated possible functional differences. A similar comparison relating to ancestral duplications of the rice genome indicated that duplications were often associated with 'hot-spots'.A comparison of the frequency of sequence alignments, determined by MegaBLAST, between rice coding sequences in TIGR pseudomolecules and annotations vs 4.0 and comprehensive transcript-assembly and methylation-filtered databases from Physical positions of expressed genes in the rice genome are correlated with the degree of conservation of similar sequences in the transcriptomes of other plant species. This relative conservation is associated with the distribution of different sized gene families and segmentally duplicated loci and may have functional and evolutionary implications. Oryza sativa) and Arabidopsis thaliana, both of which have relatively small genomes. Rapid progress is being made for some other species, particularly maize (Zea mays [Sorghum bicolor [Brachypodium distachyon [Brassica spp. [Triticum aestivum) and barley (Hordeum vulgare) and the forage and amenity ryegrasses (Lolium perenne and L. multiflorum) and fescues (Festuca pratensis and F. arundinacea), are still in the process of development [de novo markers which target particular areas of a genome . Howeveelopment -23. Untiap views ). In theap views  obtained-10 identified significant alignments with between 7% (At_TA) and 45% (Zm_TA) of the all TIGR rice loci (TRL) . Subdividing the TRL database on the basis of annotation and pseudomolecule origin identified marked differences in the percentage of alignments within the different subdivisions [see Additional file Using MegaBLAST with parameters of wordsize (W) = 16 and expectation (E) = 1 \u00d7 10i.e. 10/pseudomolecule) and moving windows of 100 consecutive FAexpTRL (MWs) for each pseudomolecule  with expressed functional annotations (FAexp) consistently generated the highest number of MegaBLAST alignments [see Additional file i.e., the number of significant alignments identified for one test database for one pseudomolecule linear 10% segment is a positive indicator of the number of alignments one will expect to find in the other test databases. This is also true for comparisons between scores generated for the different test databases and for comparisons between numbers of alignments and scores (except for comparisons involving scores from the Gm_TA and At_TA databases)  Table  which shs) Table  [see AddFigure Significant correlations between the number of segmentally duplicated FAexpTRL and % alignments/linear10% of each pseudomolecule Table  indicateArabidopsis gene models in the At_CD database . By searching the Genevestigator\u00ae Meta-Analyzer database with these gene models, the expression profiles of 435 FAexp Arabidopsis gene models were obtained for both growth stage and plant organs, and the stage and organ of maximal expression were identified. The maximal expression profiles for these Arabidopsis gene models are compared with a random sample of 1599 FAexp Arabidopsis gene models in Tables MegaBLAST searches of the 3057 FAexpTRL present in the highest 10% MWs (red colour code) [see Additional file i.e. as available through the TIGR and Gramene genome browsers) are informative in terms of establishing sequence similarities on a gene by gene basis. In contrast to these two approaches, this present study does not seek to comment directly on syntenic relationships between different plant species or to describe precise homologues or orthologues of individual genes. Additionally, it differs from other analyses in that the basic unit used is not a gene or a measure of physical, cytogenetic or genetic distance, but a unit of linearly ordered 'reliable' gene models for each pseudomolecule ('reliable' being defined as FAexpTRL for the purposes of this paper).It is well established that the physical and genetic order of markers and genes from one species can be reflected by similar orders or partial orders in a different species (synteny); a major goal of comparative plant genomics is to enable detailed analyses of these kinds to take place. It is also well established that detailed individual sequence alignments (-10 in the present study). MegaBLAST wordsizes of 16, 20, 24, 28 (the MegaBLAST default) and 40 were tested with the Lp_MF database and these identified 63, 58, 48, 39 and 16% of the functionally annotated TRL, respectively. However, while the relative numbers of significant alignments identified was affected by altering the wordsize, the relative proportions of alignments between the different pseudomolecules stayed, more or less, the same [data not shown, but as illustrated for FAexpTRL in Additional file Six different databases, derived from 3 monocot species and 2 dicot species and generated either from expressed sequences or through methylation-filtered genomic DNA isolation, were tested against the Os_CD database. In the absence of the complete sequence of any genome there will always be limitations and unknowns in the degree of representation present in a given database. Additionally, the stringency of the cut-off threshold for reporting a significant alignment will, obviously, affect the outcome  chromosome 3 [There are few obvious differences between the 3 monocot test species in terms of the heat map patterns, though ryegrass is probably the most distinct. Bearing in mind the lower apparent coverage of the rice genome present in the Lp_MF database relative to the Zm_MF/TA and HV_TA databases, the hot-spots on Pm3 and Pm5 are less intense for ryegrass than they are for maize and barley . In comparison, there were 508 different FAexpTRL from Pm1, 2, 4, 6, 7, 8, 9 10, 11 and 12 which were in the bottom 10% (dark blue zone) for the average monocot % alignment category and which also had no significant alignments with any of the 4 monocot test databases. While it is not possible to draw any conclusions about the presence or absence of specific genes from either grouping, it is possible to look at the representation of large gene families  within these top and bottom 10% groupings. Table In this analysis, there were 3057 FAexpTRL from Pm1, 2, 3, 4, 5, 7, 8, 9 and 10 which were in the top 10% (red zone) for the average monocot % alignment category and which also had significant alignments with all 4 monocot test databases  in the At_CD database with significant similarities to FAexpTRL and present in the top 10% (red zone) average monocot % alignment category. Considering just the plant organs  in the top 10% group, as opposed to the control group, could all be associated directly or indirectly with meristematic cell division. Lateral root cap and callus tissue were particularly striking in this respect. For growth stage, those associated with germination and the initiation of floral development were represented more strongly in the top 10% group than in the control. No comparison could be made with FAexpTRL present in the bottom 10% as, by definition of the MegaBLAST discrimination used in this study, these were not represented within the At_CD database. There is an indication, from both the annotation comparisons and the maximal expression profile comparisons, that some genes within hot- and cold-spots may have a degree of diverged functionality. In support of this principle, growth stage differences in the overall transcription patterns between euchromatin and heterochromatin in rice have been noted previously for chromosome 4 [MegaBLAST identified 435 FAexp i.e. not originating from effective polyploidisation) the situation may not be fully analogous [There has been a considerable amount of genome duplication in the development of the modern-day rice genome, principally through ancestral polyploidisation, but also involving more recent duplications ,36,37  mechanisms that have led to the modern day plant genome. The present study has developed an approach to identifying and illustrating similarities and differences between coding sequences related to the physical position rice of putative orthologous gene models. It has thus contributed to the developing understanding of the internal structure of plant genomes and their interrelationships.The complete sequence of the rice genome and the rapid development in the complete sequencing of the maize and Arabidopsis 'orthologues' of FAexpTRL present in hot-spots showed a slight enrichment for tissues directly associated with meristematic cell division , Lolium perenne , Zea mays (maize), Hordeum vulgare (barley), Glycine max (soybean) and Arabidopsis thaliana  and their abbreviations used in this study are described in Table Details and sources of the databases developed for For different parts of the analysis, the rice CDS database (Os_CD) was subdivided into groups based upon the annotation assigned to the individual TIGR rice loci (TRL). Annotations [originally obtained from the file 'all.TU_model.brief_info.4', detailed in Additional file Additional subdivisions of the FAexpTRL Os_CD sequences were made based on their relative physical order in the individual rice pseudomolecules; each division consisted of a 'linear' 10% of the FAexpTRL assigned to each pseudomolecule  [see Additional file The relative positions of FAexpTRL identified as being segmentally duplicated within the rice genome were obtained from TIGR, rice genome annotation, 500 kb rice genome semental duplication database .-10 (-e 1e-010) and alignment output (-D 3). Six different searches were performed, each one consisting of one of the 6 transcript assembly (TA) or methylation-filtered (MF) databases described in Table Sequence alignments were performed using standalone MegaBLAST  obtainedFrom each MegaBLAST search the number of TRL aligned to sequences from each of the other databases above the cut-off thresholds was recorded along with the associated scores. Where multiple significant alignments/TRL were identified within one of the test databases, the alignment with the highest score was used.\u00ae (8.1) [For each linear 10% pseudomolecule division, the number of significant alignments from each test database was calculated as a percentage of the total number of FAexpTRL in the Os_CD database. Additionally, the proportion of segmentally duplicated FAexpTRL in relation to the total number of FAexpTRL per 10% pseudomolecule division was calculated. Spearman rank correlation coefficients and associated probabilities were generated using GenStat for Windows\u00ae (8.1) .MWs for the individual test databases were calculated on the basis of: 1) the % of FAexpTRL aligned with the test database above the cut-off thresholds per 100 consecutive FAexpTRL on each rice pseudomolecule, 2) the average score of the alignments with the test database above the cut-off thresholds in each group of 100 consecutive FAexp TRL on each rice pseudomolecule. Additionally MWs were calculated for 1) average alignment data from the 4 monocot databases; each FAexpTRL was assigned a value of 0, 0.25, 0.5, 0.75 or 1 based on the proportion of the monocot databases with which it was aligned. MWs were then calculated for the average alignment score/100 consecutive FAexpTRL; 2) the relative proportion of segmentally duplicated FAexpTRL thresholds in each group of 100 consecutive FAexpTRL on each rice pseudomolecule and 3) average gene family size in each group of 100 consecutive FAexpTRL on each rice pseudomolecule [see Additional files For Figure Arabidopsis gene model alignments from the At_CD database [see Additional file \u00ae Meta-Analyzer database [Arabidopsis gene models were constructed. The profiles developed from the FAexpTRL identified in the highest 10% MWs were compared with profiles developed from a random sample of 1599 FAexp Arabidopsis gene models.FAexpTRL present in the highest 10% average MWs (red colour code) [see Additional file database ,57 for bTRL = TIGR rice locusFA = Functionally annotatedFAexp = Functionally annotated, expressedMW = moving windowPm1, 2 etc. = TIGR rice pseudomolecule 1, 2, etc.IA designed and executed the analysis, all authors contributed to data interpretation, manuscript preparation and read and approved the final version.Contains supplementary tables: Additional file Click here for fileIllustrates the %MegaBLAST alignments/rice pseudomolecule between FAexpTRL and the plant databases.Click here for fileLists moving window (MW) scores used to produce Figures Click here for fileSupplementary methods describing the derivation of FAexp gene family sizes based upon identical annotations.Click here for fileIllustrates colour coded MWs comparing %alignments between the Os_CD database and the test databases in relation to average gene family size.Click here for fileArabidopsis gene models used in MegaBLAST analyses; 3) TIGR rice loci gene families and sizes based upon identical annotations.Lists 1)TIGR rice loci model identifiers and annotation categories; 2) Click here for fileContains MegaBLAST scores for the test databases against Os_CD.Click here for file"}
+{"text": "Recent studies have suggested that the presence of iron overload prior to stem cell transplantation is associated with decreased survival. Within these studies, the criteria used to define iron overload have varied considerably. Given the lack of consensus regarding the definition of iron overload in the transplant setting, we sought to methodically examine iron status among transplant patients. We studied 78 consecutive patients at risk for transfusion-related iron overload  who received either autologous or allogeneic stem cell transplant. Multiple measures of iron status were collected prior to transplantation and examined for their association with survival. Using this data, three potentially prognostic iron measures were identified and incorporated into a rational and unified scoring system. The resulting Transplant Iron Score assigns a point for each of the following variables: (1) greater than 25 red cell units transfused prior to transplantation; (2) serum ferritin > 1000 ng/ml; and (3) a semi-quantitative bone marrow iron stain of 6+. In our cohort, the score (range 0 to 3) was more closely associated with survival than any available single iron parameter. In multivariate analysis, we observed an independent effect of iron overload on transplant survival (p = 0.01) primarily attributable to an increase in early treatment-related deaths (p = 0.02) and lethal infections. In subgroup analysis, the predictive power of the iron score was most pronounced among allogeneic transplant patients, where a high score (\u2265 2) was associated with a 50% absolute decrease in survival at one year. In summary, our results lend further credence to the notion that iron overload prior to transplant is detrimental and suggest iron overload may predispose to a higher rate of lethal infections. However, recent evidence suggests that the determination of iron status before transplant has important prognostic implications [Long-standing iron overload can lead to heart and liver failure, resulting in premature death . As our ications -6.Iron overload prior to transplantation was initially identified as a marker of poor prognosis in pediatric \u03b2-thalassemia patients . Among tWhile each of these retrospective studies suggests that iron overload adversely affects transplant outcome, the clinical definition of iron overload varied considerably between studies. We set out to examine multiple measures of pre-transplant iron status with the goal of determining which marker(s) were most closely associated with clinical outcome following transplant. We chose to study patients at risk for transfusion related iron overload  undergoing either autologous or allogeneic transplant. Three measures related to transfusional iron overload were closely associated with transplant survival: (1) number of blood unit transfusions, (2) serum ferritin, and (3) bone marrow iron stores. These readily available measures were combined into a clinical scoring system termed the Transplant Iron Score.The Transplant Iron Score showed a strong independent association with overall survival. Our findings further validate the detrimental impact of iron overload in the setting of stem cell transplantation and identify a potential mechanism of action.We evaluated 78 consecutive adult patients admitted to the Wake Forest transplant unit with a diagnosis of AML, MDS, acute lymphoblastic leukemia (ALL), or aplastic anemia. The included patients were all undergoing their first hematopoietic stem cell transplant between September 9, 1999 and March 19, 2004. The patient demographics and characteristics are summarized in Table \u00ae Ferritin assay, Bayer Diagnostics, Tarrytown, NY). Transferrin saturation was calculated using the method by Huebers and Finch [All serum samples were obtained upon admission to our bone marrow transplant unit, prior to the initiation of the preparative chemotherapy. Samples were continuously stored at -20\u00b0C, until measurements of iron parameters were performed. Serum ferritin levels were measured using a two-site chemiluminometric sandwich immunoassay (ADVIA Centaurnd Finch . Serum lBone marrow samples obtained within two months of transplantation were reviewed by two of the authors for specimen adequacy (I.M. and Z.L.), and representative sections of the patient's samples were stained with the Gomori's iron stain method . Iron coBased on univariate quartile analysis, the three iron parameters with the strongest survival association were identified. Cutoff values for each parameter were determined independently using comparative statistics. Using this method, multiple pre-defined cutoffs were examined and compared for their association with survival. In order to maintain an adequate sample size on both sides of the cutoff, only values within the second and third quartile were considered. The selected cutoff values demonstrated the highest ability to discriminate survival based on a comparative analysis of hazard ratios.Ultimately, these three iron parameters were incorporated into a unified scoring system. For each patient, a score was calculated by assigning a single point for each of the following: (1) serum ferritin \u2265 1,000 ng/mL, (2) greater than 25 transfused units of red cells, and (3) marrow iron stain of 6+. The sum of points, ranging between 0 and 3, was defined as the Transplant Iron Score. For missing data, no points were assigned. In the single patient where less than two parameters were available for scoring, the iron score was deemed indeterminate and was excluded from additional statistical analysis. The remaining 77 patients (99 percent) were included for analysis in our study. To allow further analysis within our study, a score of two or greater was deemed \"high\" and those patients were considered to have transfusion related iron overload. Meanwhile, a score of zero or one was classified as a \"low\" score. For purposes of comparing the Transplant Iron Score to other individual or combinations of iron parameters, each iron parameter was scaled be scored on a 0 to 3 scale. Using this approach, the individual iron parameters were divided into one of four quartile groups, similar to the four possible score groups defined by the Transplant Iron Score. Based on these groupings, a univariate relative risk of death was calculated for each iron parameter using hazard regression analysis.st 2007. The following clinical and demographic parameters were collected for statistical analysis: age at the time of transplant, gender, diagnosis, disease status , transplant type , and cytogenetic data for acute myeloid leukemia patients at the time of diagnosis. Cytogenetic information was grouped into poor, average and favorable categories based on the study by Byrd et al [Survival time was measured from the date of transplant to the date of death or last known follow-up. All data was censored as of July 1rd et al . The sperd et al . Kaplan-th to 75th quartile) of transfused blood, the risk of death following transplant increased by a factor of 1.4. Serum ferritin was also significantly associated with transplant survival (p = 0.02), while the marrow iron stain showed a strong trend towards statistical significance (p = 0.08). Though not significant by quartile analysis, a bone marrow iron stain score of +6 was significantly associated with increased mortality (p = 0.04). The number of patients above the cutoff for transfusion number, ferritin, and iron stain were 30, 41, and 7, respectively. The Transplant Iron Score, when compared with individual and a combination of iron parameters, was most closely associated with survival (p = 0.0006). The risk of death nearly doubled with each point increase of the Transplant Iron Score.Multiple measures related to iron homeostasis were collected prior to stem cell transplant and are listed in Table Trend analysis further supported that higher Transplant Iron Scores were associated with decreased overall survival Figure . The unaThe increase in mortality associated with iron overload resulted primarily from early deaths. In the first six months following transplant, 56% of those with a high iron score had died as compared to 22% among those with a low score Figure . This eqWe further examined the cause of death among the 20 patients that died as a result of treatment related complications. The majority of these patients (55%) had either documented (5 patients) or suspected (6 patients) lethal infection. Furthermore, the rate of infection related mortality was disproportionately high among those with a high iron score (26%) as compared to those with a low score (8%) (p = 0.04 by Fisher's exact test). Clinical information regarding the 7 patients with a high iron score with infection-related mortality is detailed in Table Multivariate analysis was used to establish whether the Transplant Iron Score was independently associated with transplant survival. Covariables included established predictors of transplant outcome, such as age, gender, donor-type, and remission status. In addition to standard transplant risk factors, an inflammatory marker (C-reactive protein) was included along with measures of end-organ damage . Because frank organ failure is not likely to be present in eligible transplant patients, quartiles were used in the evaluation of end-organ damage in an attempt to identify early organ damage . The Transplant Iron Score had a significant independent effect on overall survival (p = 0.01) Table . Among tEstimating systemic iron stores in stem cell transplant patients is challenging. Serum ferritin has frequently been used as an estimate of systemic iron stores, but is prone to false elevation in the setting of inflammation and malignancy . Other bWe identified three clinical markers of iron overload that were associated with decreased survival: (1) transfusion burden, (2) serum ferritin, and (3) bone marrow iron stores. Intuitively, each of these is a marker of transfusion related iron overload, and all have been used separately to estimate iron overload in transplant and non-transplant studies ,6,19. EaIn comparison to individual iron parameters, the Transplant Iron Score was more closely associated with transplant outcomes. Specifically, the iron score was more closely associated with survival than ferritin quartiles, which have previously been used to estimate pre-transplant iron overload . AdditioUsing the Transplant Iron Score, we investigated the mechanism by which iron overload influences transplant survival. Classically, excess iron accumulates over decades resulting in progressive heart and liver dysfunction and eventually leading to premature death . In contTo further explore the mechanism by which iron overload influences survival, we closely examined the cause of death for each of the transplant recipients. We observed that treatment related mortality occurred more frequently in those patients with a high iron score. The majority of these deaths resulted from infection, thereby suggesting that lethal infection is the dominant mechanism by which iron overload influences transplant survival. While it has been suggested that iron overload predisposes to infection ,5,22, toIn addition to adding insight into the mechanism of action of transplant iron overload, our study also helps to define its clinical applicability. Specifically, our study simultaneously compares the impact of iron overload in both the autologous and allogeneic transplant setting. Using the Transplant Iron Score to define iron overload in both groups, we found allogeneic transplant patients to be at a disproportionately high risk of death associated with iron overload. Our data suggests that iron overload as a prognostic marker may be limited to, or at least more pronounced in, patients undergoing allogeneic stem cell transplant.We acknowledge the limitations inherent in our small single-institution study and believe that validation of the Transplant Iron Score is necessary prior to its incorporation into clinical practice. Nevertheless, our results strongly support the notion that iron overload prior to transplant is detrimental and provide rationale to study chelation therapy within the transplant setting. Typically, there is only a small window of opportunity between when a patient is identified as needing transplantation and when the transplant is undertaken. If patients with iron overload are detected early in this process, it is conceivable that iron chelation could minimize the negative impact of iron overload on transplant survival. This exciting possibility merits study in a prospective randomized fashion.The authors declare that they have no competing interests.JAS co-authored the manuscript, participated in the study design, collected clinical data, and performed the statistical analysis. RFC co-authored the manuscript, collected clinical data, and performed the laboratory testing. ZL performed the iron stain grading and provided pathology expertise. DH provided the blood samples and participated in the design of the study. GP provided data and expertise from our blood bank. YKK participated in the design of the study. MG assisted with data collection. JL participated in the statistical design. SVT participated in design of the study and assisted with proofreading. FMT participated in the design and coordination of the study. IM conceived of the study, and participated in its design and coordination."}
+{"text": "Well preserved genomic colinearity among agronomically important grass species such as rice, maize, Sorghum, wheat and barley provides access to whole-genome structure information even in species lacking a reference genome sequence. We investigated footprints of whole-genome duplication (WGD) in barley that shaped the cereal ancestor genome by analyzing shared synteny with rice using a ~2000 gene-based barley genetic map and the rice genome reference sequence.Based on a recent annotation of the rice genome, we reviewed the WGD in rice and identified 24 pairs of duplicated genomic segments involving 70% of the rice genome. Using 968 putative orthologous gene pairs, synteny covered 89% of the barley genetic map and 63% of the rice genome. We found strong evidence for seven shared segmental genome duplications, corresponding to more than 50% of the segmental genome duplications previously determined in rice. Analysis of synonymous substitution rates (Ks) suggested that shared duplications originated before the divergence of these two species. While major genome rearrangements affected the ancestral genome of both species, small paracentric inversions were found to be species specific.We provide a thorough analysis of comparative genome evolution between barley and rice. A barley genetic map of approximately 2000 non-redundant EST sequences provided sufficient density to allow a detailed view of shared synteny with the rice genome. Using an indirect approach that included the localization of WGD-derived duplicated genome segments in the rice genome, we determined the current extent of shared WGD-derived genome duplications that occurred prior to species divergence. Arabidopsis thaliana [Whole-genome duplications provide the genetic material for evolutionary innovation. Thinking about the evolutionary force behind the emergence of gene duplications goes back to Ohno , who stathaliana , poplar thaliana , grape [thaliana  and ricethaliana . While pthaliana , the evothaliana  leading thaliana  and chanthaliana .Oryza sativa ssp. indica whole genome shotgun sequence information. This dataset, however, showed considerable differences in the position of corresponding genes when compared to the Oryza sativa ssp. japonica assembly, mainly because of differences in the intergenic regions contributing to 28% misalignment rate between both genomes [Today, it is commonly accepted that segmental gene duplications present within the rice genome originated from a single whole-genome duplication event (WGD) in a common ancestor at around 20 million years before the divergence of many cereal crops, including rice, Sorghum, the Triticeae and maize . While t genomes .japonica rice genome and the increased availability of genomic resources for other grass species now enables a more detailed understanding of the evolution of grass genomes. While initial studies based on the comparison of RFLP maps uncovered colinear relationship of genes between rice and other grass species [Apart from these ambiguities, the nearly complete genomic sequence for the  species ,14, deta species ,16. Give species .Oryza sativa ssp. japonica rice, the objectives of this study were (i) to revise and refine the rice WGD event, which is shared by all members of the grass family, (ii) to review barley-rice colinearity using an expanded set of mapped barley genes, and (iii) to detect, locate and analyze genome-wide remnants of the WGD in the barley genome.Taking advantage of a comprehensive genetic map of barley comprising 1930 EST-derived markers and the availability of a well annotated and curated sequence of the genome of Oryza sativa ssp. japonica) provides a reference dataset to study the WGD event shared by all cereals [The availability of the complete genomic sequence of rice . Bearing in mind that ongoing local gene duplications in rice are common [a priori excluded genes and their homologs from the analysis whenever they occurred at more than 5 distinct places (> 1 Mb) in the rice genome sequence and (ii) determined whether duplicated genes were arranged colinearly within any corresponding sister segments by applying three quality parameters: gene pair density weight > 2, maximum distance between two neighboring gene pairs = 500 kb, minimum number of gene pairs = 5 (see Methods for details). Statistical significance of observed segmental duplications was tested subsequently by the one-sided Fisher's exact test  of the 07 of thee common . We obseAfter applying the above filtering steps, 4492 (8.0%) genes were determined as being segmentally duplicated genes and were organized in almost perfect colinearity between their respective rice chromosomes. They could be assigned to 24 pairs of genomic segments covering 261 Mb (70%) of the rice genome  and Os12 (0.0 \u2013 7.5 Mb) differed from all other duplicated segments by having higher ratios of 19% and 30% duplicated genes, respectively. A significantly lower mean Ks of 0.35 was characteristic of this segment pair compared to all other nine duplicated blocks that exceeded a size of 10 Mb and suggested a more recent origin . More specifically, 60% (147/244) of all gene pairs in this region had Ks ratios smaller than 0.2 resulting in a right-skewed Ks distribution (median of 0.13). The 2 Mb-bin analysis showed that the first 2 Mb-bin of chromosomes 11 and 12 contributed significantly to the Ks ratio difference observed for the other WGD derived chromosomal segment pairs. Here, the ratio of duplicated genes was as high as 65% and 70%, respectively  of the mapped barley EST sequences against all the rice CDS. In total, 1756 (91%) of the barley ESTs showed sequence homology with at least one rice CDS. EST sequences with homology to more than 5 non-locally duplicated rice genes were excluded from the analysis, leaving 1506  ESTs for further analysis. This step substantially reduced the 'background' that was not related to barley-rice synteny and was similar to the approach taken to filter background duplications within the rice genome. The genetic map position of each barley EST was plotted against the physical location of the highest BlastN-scoring rice homolog, which was considered the corresponding rice ortholog. Segments of the barley and rice genomes exhibiting conserved synteny were defined after visual inspection of the corresponding x-y plots allowing for small discrepancies of 5 cM from the colinear ordering of putative orthologs  barley ESTs followed a colinear distribution with their corresponding rice homologs (putative orthologs). These were organized into 21 segments  as observed in this study were restricted to the boundaries of duplicated segments in rice.Seven out of the 10 largest duplicated segments in rice shared synteny with barley and thus seven AD's could be identified  could be identified in addition to 'best' rice homologs (putative orthologs) Figure . Here, fTwo hypothetical additional AD's were found for which less than 8 barley ESTs were syntenic to one of the duplicated segments in rice. In the first, shared synteny between Hv5H and Os03 was supported by 65 barley ESTs  for which sufficient data was available to analyze the distribution of pairwise synonymous substitution rates (Ks) among corresponding duplicated genes. Duplicated genes of nine out of these ten segments had equivalent Ks distributions with similar median values ranging from 0.91 to 1.07 . A peak of the Ks distribution between 0.4 and 0.6  indicated that barley-rice orthologs were evolutionary younger than all segmental duplications in rice originating from WGD. However, they were older than the paralogs of the segmental duplication between chromosomes Os11 and Os12 (os11_12_1). The Ks distribution of putative paralogs between barley and rice with respect to ancestral duplications, was congruent  with the distribution of synonymous substitution rates of the segmentally duplicated gene pairs  of the rice genome. The 1544 previously reported duplicated genes in ten duplicated blocks involving 45% of the rice genome [indica versus japonica) that resulted in shifts of the coordinates of corresponding regions  . Ks analIn contrast, Salse and co-workers  identifiIn summary, by analyzing the rice genome structure on an updated genome annotation, we found strong support for the commonly accepted single WGD hypothesis for the rice genome: (i) Segmental duplications involved more than 70% of the rice genome as described previously. (ii) No overlap among pairwise duplicated segments could be observed. (iii) Gene pairs located within corresponding sister segments were arranged in almost perfect colinear order. (iv) The duplicated genes of nine out of the ten largest duplicated segments comprised equivalent Ks distributions and gene retention rates suggesting a common origin.The existence of shared patterns of a common WGD predating the divergence of barley and rice was supported by three observations in our data: (i) The pattern of macro-synteny between barley and rice was highly conserved. This implied that genome reorganization after WGD occurred in the common ancestor of both barley and rice before species divergence. (ii) Synteny between barley and rice involved the largest duplicated rice regions and for at least seven of these paralogous relationship in barley could be resolved to segments that were orthologous to duplicated regions in the ancestral grass genome progenitor. (iii) Smaller Ks of barley-rice orthologs compared to paralogs located in WGD-derived segments in rice confirmed a WGD before species divergence.The roughly 2000 gene-based genetic map of barley provided sufficient coverage to explain genome wide shared synteny between barley and rice. The use of classical genetic maps in the presented study was however limited in the regions that correspond to central/centromeric parts of barley chromosomes. These regions are characterized by low recombination rates over large physical distances. Resolution in these regions is poor and while the corresponding syntenic regions could be identified to the rice genome (e.g. for Os11/Os12), inversions or even the orientation of whole syntenic rice chromosomes could not be fully resolved.We found excellent correspondence to the grass genome colinearity model proposed by Devos . Using cThe mosaic of syntenic segments between barley and rice in the present study resulted in a karyotype evolution model for the structurally similar Triticeae genomes Figure  in whichA barley genetic map consisting of approximately 2000 non-redundant EST sequences allowed us a detailed analysis of shared synteny with the rice genome. Based on shared synteny between both species, the locations of at least seven corresponding duplicated segments were identified that originated from an ancestral WGD event. While small paracentric inversions and reduction of chromosome numbers were species specific, genome reorganization after WGD preceded taxon divergence as shared synteny extended the boundaries of rice duplicated genomic segments originating from WGD and only low levels of differential gene loss were found. Our results indicate positions of WGD segments within the barley genome that are shared with rice and hence the potential location of putative barley paralogs. Comparative analysis with the rice genome further showed that low-recombining central parts of barley chromosomes, although not represented by many genetic markers, can correspond to large physical regions of the rice genome consisting of many genes.Release 5 of the Rice Pseudomolecules and Genome Annotation  was usedTwo sources of barley genetic markers were utilized and integrated. The first set, subsequently referred to as 'map1', originated from a previously published barley consensus transcript map, which combined genetic positions of cDNAs from three individual mapping populations using RFLP, SNP, and SSR marker technologies . RedundaA second unpublished set, subsequently referred to as 'map2', comprised 1025 EST-based SNP loci derived from a doubled haploid (DH) 'Morex' \u00d7 'Barke' population  mapped by the Illumina Golden Gate assay  as described previously  (data caIn order to integrate both marker datasets ('map1' and 'map2') into a more comprehensive consensus map, gene sequence information underlying all markers was referenced against a single tentative barley unigene set based on assembly #32 of the HarvEST database . As a reThree regression methods implemented in the R statistical language  were teslm(i) Linear least squares regression implemented in the R function loess with the degree = 1  and span = 0.7 (the smoothing parameter) after inspection of the resulting plots with respect to the accurate placing of telomeric and pericentromeric markers(ii) Local polynomial regression fitting using e is the residual and k the tuning constant, which is computed with k = 1.345 MAR/0.6745 and MAR is the median absolute residual [(iii) Local polynomial regression fitting with the same set of parameters as (ii), but as an robust implementation using the Huber weight function, which depends on the residuals of the anchor points and therefore is less sensitive to outliers. In the initial state, for each anchor marker a weight of 1 was taken. In an iterative approach weights were recalculated depending on the coefficients of the regression and the resulting residuals according to the Huber weight function residual . Ten iteloess) using the Huber weight function outperformed the non-robust implementation of loess as well as the linear regression fitting in terms of robustness against outliers and mean prediction error  as well as among barley cDNA sequences and rice CDS (barley-rice), a BlastN analysis  was perfTo reduce the background noise that we observed for homolog pairs in the rice genome, a density based approach was chosen to compute scores for each homologous pair that could be placed according to their coordinates in a 2D-matrix in the following way:x, identify all additional homolog pairs N in the neighborhood that are located within a Euclidian distance d of k = 0.05 of the respective chromosome sizes(1) For each given homolog pair x using the location of all neighbors as: (2) Compute a distance-dependent score for x with W < 2 as background noise(3) Discard all Subsequently, the remaining rice gene pairs were grouped into segments fulfilling the following requirements: The distance between direct neighbors of homologous pairs is \u2264 500 kb, the minimum number of homologous pairs per segment is 5, and the minimum size of the segment is at least 500 kb on both chromosomes.All circular figures were generated with the help of the software Circos v 0.22 .fisher.test of the R statistical package was applied to test (i) the distribution of homologs located in duplicated segments in the rice genome under the null hypothesis H0 that there is no overrepresentation of homologs within both rice intervals, (ii) the distribution of orthologs between barley and rice under H0 that there is no overrepresentation of 'best' homologs within both barley and rice intervals and (iii) the distribution of 'best' and 'second-best' rice homologs of given barley ESTs across ancestral duplicated blocks under H0 that there is no overrepresentation of 'best' homologs in the putative orthologous and no overrepresentation of 'second-best' homologs in the putative paralogous regions. In all cases H0 was rejected for p \u2264 0.05.The one-sided Fisher's exact test implemented in the function TukeyHSD of the R statistical package was used to compute confidence intervals of pairwise means among the different data sets to test which means of the Ks distributions differ significantly.The Tukey Honest Significant Difference method implemented in the function bl2seq, which allows Blast on 2 sequences  of a TBlastX analysis. However, TBlastX is unable to perform gapped alignments and thus frameshifts caused by sequencing errors of 1 or 2 bases within the EST sequence could lead to a suboptimal or shortened alignment. For this reason, a subsequent gapped BlastN analysis of the same sequences was performed and the resulting alignment was scanned for gaps. If gaps were found, the original sequences were modified depending on which sequence strand such gap characters could be found within the alignment: On the one hand, all nucleotides of the EST sequence located opposite to connected gaps in the CDS are either frameshifts (if the number is not a multiple of 3) or inserted codons  and hence were cut out. On the other hand, gaps within the EST alignment string were correlated to the respective codon in the CDS  and all such codons in the CDS as well as all corresponding nucleotides of the EST were cut out and thus no frameshift was introduced into the CDS.yn00 for obtaining the Ks substitution ratio utilizing BioPerl objects and modules.A second TBlastX alignment was performed to test whether these modifications lead to a better codon alignment in terms of E-value and Bitscore. Then, the codon alignment was checked for two essential quality criteria, for the absence of internal STOP codons within the EST sequence and for the +1 frame of the CDS sequence. The last codon pair of the alignment was chopped in case of a terminal STOP codon within the CDS sequence. After all quality checks were fulfilled, the resulting codon alignment was handed to the software Computation of Ks substitution rates of the 'map1' marker data set were based on respective HarvEST consensus sequences extracted according to EST cluster membership. Ks values were computed for all different data sets and Ks values > 2 were not retained. Density plots of Ks distributions were plotted by applying a smoothing bandwidth of 0.05.Hordeum vulgare; Ks: synonymous substitution rates; Os: Oryza sativa; RFLP: restriction fragment length polymorphism; SNP: single nucleotide polymorphism; TE-related genes: transposable element-related genes; Tukey HSD: Tukey's Honest Significant Differences test; WGD: whole-genome duplication.AD: ancestral duplicated block; CDS: coding sequence; EST: expressed sequence tags; Hv: TT, AG, IG and NS conceived the study. TT designed the study, analyzed the data and wrote the manuscript. NS computed the genetic map on unpublished barley genotyping data provided in collaboration with RW and TJC. AG, RW and NS contributed to the writing of the manuscript. All authors read and approved the final paper.Supplementary Figures and Tables. This file is a collection of supplementary Figures and Tables.Click here for file"}
+{"text": "Polished rice is a staple food for over 50% of the world's population, but contains little bioavailable iron (Fe) to meet human needs. Thus, biofortifying the rice grain with novel promoters or enhancers of Fe utilization would be one of the most effective strategies to prevent the high prevalence of Fe deficiency and iron deficiency anemia in the developing world.OsNAS1) fused to a rice glutelin promoter. Endosperm overexpression of OsNAS1 resulted in a significant increase in nicotianamine (NA) concentrations in both unpolished and polished grain. Bioavailability of Fe from the high NA grain, as measured by ferritin synthesis in an in vitro Caco-2 cell model that simulates the human digestive system, was twice as much as that of the control line. When added at 1\u22361 molar ratio to ferrous Fe in the cell system, NA was twice as effective when compared to ascorbic acid (one of the most potent known enhancers of Fe bioavailability) in promoting more ferritin synthesis.We transformed an elite rice line cultivated in Southern China with the rice nicotianamine synthase gene (Our data demonstrated that NA is a novel and effective promoter of iron utilization. Biofortifying polished rice with this compound has great potential in combating global human iron deficiency in people dependent on rice for their sustenance. Iron (Fe) deficiency is the most prevalent nutrient deficiency in the world afflicting over 50% of the world populationS-adenosylmethionine (SAM) by NA synthase (NAS)2+, Fe3+ and Zn2+, in plantsArabidopsis NAS gene in tobacco resulted in a six-fold increase in NA level and a significant increase of Fe, Zn and manganese concentrations in leaves of adult plantsOsNAS3 led to increase of Fe, Zn in both green tissue and mature seed. Anemic mice fed with the OsNAS3 activated transgenic rice seeds recovered to normal levels of hemoglobin and hematocrit within 2 weeksOsNAS1 gene in rice-grain endosperm, and obtained a significant increase of NA concentrations in the polished rice. Using a well-characterized in vitro Caco-2 cell  model for predicting bioavailability of iron in foodOsNAS1 transgenic lines displayed twice as much bioavailable iron as that of the non-transgenic control line. Responses of ferritin synthesis in the Caco-2 cells to the addition of NA in rice digests or ferrous sulfate solutions revealed that NA is a more potent promoter than AA, the strongest promoter of iron utilization currently identified. Overall, our findings indicate a great potential for biofortifying rice with NA to help eradicate iron deficiency in populations consuming rice as their staple food.Nicotianamine (NA) is biosynthesized from three molecules of OsNAS1, accession number AB021746) expression in rice endosperm. In addition, the T-DNA region of the binary vector (used for rice transformation) contained a selectable marker gene bar for the herbicide bialaphos resistance . Reverse transcriptase PCR (RT-PCR) analysis was performed using RNA samples extracted from T2 immature seeds of four independent transgenic lines EN1 to EN4 to verify the expression of OsNAS1 in the endosperms of transgenic seeds. The endosperm expression of OsNAS1 resulted in a substantial increase of the NAS1 transcript in EN1 to EN4 seeds over control seeds sistance . The eliol seeds . The oveth field  and hydrth field .2 rice polished and unpolished grain were determined by high-performance liquid chromatography (HPLC). Compared with the WT grain, the grains from four transgenic lines, EN1-EN4, accumulated substantial amounts of NA (\u22121 of dry weight (DW), which were 3.3 to 5.2 times greater than that in the WT grain. A similar increase of NA was also observed in the polished grain. The NA concentrations in the transgenic polished grain were 23.5\u201347.0 \u00b5g g\u22121 DW, which were 4.1 to 8.2 times greater when compared with the WT counterparts , and a commonly-used standard rice variety Nishiki, ferritin concentrations in Caco-2 cells were used as a proxy for Fe bioavailability in the digests. Compared with Nishiki, Xiushi 110 WT rice grains produced greater levels (P<0.001) of ferritin  Fe bioavailability  and ferric chloride (FeCl3) bioavailability were compared with those of AA additions. At a molar ratio of 1\u22361 (Fe:enhancer), AA increased the ferrous and ferric Fe bioavailability by approximately 2 fold whereas NA enhanced ferrous and ferric Fe bioavailability by 4.7- and 2.3-fold, respectively  resulted in NA accumulation in grains but not in shoots  increased both Fe and Zn concentration in shoots, roots and seeds, including in polished rice NAS between our data and the NAS3-D study NAS gene achieved by using different strategies of the activation of NAS genes. It was proposed that the increase of iron concentration in the OsNAS3 activation-tagged mutant lines resulted in the recovery of anemia in mice when the grains were used for mice feeding experiment OsNAS3-activation rice grain on the improvement of mice anemia should be the result of both increased Fe content as shown Overexpression of d grains . HoweverAscorbic acid (AA) is a well known promoter of non-heme Fe absorption from plant food-based diets because of its ferric reducing and ferrous complexing propertiesNAS1 gene in rice endosperm for the purpose of production of an antihypertensive staple food NAS1 gene, our transgenic rice accumulated similar amount of NA in the grain. Our data showed that besides preventing hypertension, the NA over-accumulated transgenic rice has great potential in combating global human Fe deficiency in people dependent on rice for their sustenance.NA was previously shown to be a strong inhibitor to angiotensin I-converting enzyme (ACE)The japonica variety Xiushui 110 was used for the rice transformations. Seeds were germinated in tap water for 2 days and transferred into a Yoshida nutrient solution\u22121 total Fe and 87.8 mg kg\u22121 total Zn as determined by inductively coupled argon-plasma mass spectrometry .Seeds used for elemental analyses, NA determinations and Caco-2 assays were harvested from a paddy field on the farm of the Huajia campus, Zhejiang University, with a planting distance of 18\u00d718 cm. The soil contained 10.92 g kgOsNAS1 ORF was amplified by RT-PCR and inserted into the binary vector pTF101.1 Agrobacterium-mediated rice transformation as described previously Full length OsNAS1 and housekeeping gene OsACTIN . The gene expression levels were determined by comparing densities of bands after agarose gel electrophoresis of the PCR products.Total RNAs were extracted from immature seeds 18 days after pollination using the TRIzol Reagent  according to manufacturer's recommendations. The first-strand cDNA was synthesized using SuperScript II reverse transcriptase . Semi-quantitative RT-PCR was performed using the primer pairs for 3 and H2O2 in Teflon-coated microwave vessels. Metal concentrations were determined via ICP-MS. Each measurement was repeated three times.Grain harvested from the field experiment was husked to obtain the unpolished grain. Portions of the unpolished grain samples were processed with a rice milling machine JNMJ3  for 1 min, 3 times, to obtain polished grain. Grain samples were then ground to fine powder and digested with ultra-pure HNO\u22121) and Dionex RS 2000 fluorescence detector . Elution was performed using a linear gradient of AccQ*Tag  reagent elution solution  and acetonitrile . The linear gradient was: 0\u20132 min, 80% A and 20% B; 2\u201320 min, 60% A and 40% B; 20\u201325 min, 5% A and 95% B; 25\u201335 min, 0% A and 100%B. Authentic nicotianamine  was used to construct standard curves to determine nicotianamine concentrations in the samples. Each measurement was repeated three times.Nicotianamine assays were carried out as described below using, with minor modifications, the HPLC method reported by Wada et alin vitro digestion, polished rice grains were processed as follows: no treatment, cooking, washing, or washing plus cooking. For the cooking treatments, rice grains were cooked at 121\u00b0C for 15 min. For the washing treatment, 1 gram of rice grains was washed with 2 ml sterile Milli-Q water . The samples were frozen, and then lyophilized to dryness, ground, and stored in an airtight plastic container at room temperature. One gram of freeze-dried samples was used for Fe bioavailability measurements.Prior to in vitro digestion/Caco-2 cell culture model assay was carried out to assess the Fe bioavailability in rice as described\u22121 protein, was used as an index of Fe bioavailability. Experiments were conducted using six-well plates with a control sample. Polished grain from rice variety of Nishiki was used as the control sample. Fe bioavailability of each rice sample was assessed with and without NA as described. NA was added at the start of the in vitro digestion process. The Caco-2 experiments were replicated six times.The Statistical significances were analyzed using SAS program ."}
+{"text": "CYP81A6 and thus renders transgenic rice to be sensitive to bentazon, a herbicide used for rice weed control. We generated transgenic rice plants by this method using a new glyphosate resistant 5-enolpyruvylshikimate-3-phosphate synthase (EPSPS) gene from Pesudomonas putida as the gene of interest, and demonstrated that these transgenic rice plants were highly sensitive to bentazon but tolerant to glyphosate, which is exactly the opposite of conventional rice. Field trial of these transgenic rice plants further confirmed that they can be selectively killed at 100% by one spray of bentazon at a regular dose used for conventional rice weed control. Furthermore, we found that the terminable transgenic rice created in this study shows no difference in growth, development and yield compared to its non-transgenic control. Therefore, this method of creating transgenic rice constitutes a novel strategy of transgene containment, which appears simple, reliable and inexpensive for implementation.Plant transgenic technology has been widely utilized for engineering crops for trait improvements and for production of high value proteins such as pharmaceuticals. However, the unintended spreading of commercial transgenic crops by pollination and seed dispersal is a major concern for environmental and food safety. Simple and reliable containment strategies for transgenes are highly desirable. Here we report a novel method for creating selectively terminable transgenic rice. In this method, the gene(s) of interest is tagged with a RNA interference cassette, which specifically suppresses the expression of the bentazon detoxification enzyme  Transgenic crop improvement and modification is one of the core biotechnologies of modern agriculture In addition to physical containment measures, several genetic strategies, including maternal inheritance, male sterility and seed sterility , have been proposed for containing transgenes Oryza species, which co-occur with cultivated rice in field, through pollen-mediated gene flow. Although rice is primarily self-pollinating, the outcross between cultivated rice plants or between weedy rice and cultivated rice happens commonly Oryza species to make them super weeds.Containment of transgenic rice is an urgent issue. Transgenic rice not only could contaminate non-transgenic conventional rice, but also disperse to nearby weedy rice and other sexually compatible CYP81A6Bentazon is a benzothiadiazole herbicide which has been used for weed control of several major crops, such as rice, corn, wheat and soybean for over a decade. These crops are naturally resistant to the herbicide most likely because they express cytochrome P450 enzymes capable of detoxifying it G6 (gb: EU169459), which is a synthetic 5-enolpyruvylshikimate-3-phosphate synthase (EPSPS) gene from Pseudomonas putida fused with a chloroplast transit peptide at its N-terminus. The polyubiqitin-1 promoter of Zea maysG6 serves as the transformation selection marker as well as the gene of interest for conferring glyphosate tolerance to facilitate weed control of the transgenic rice. The RNA interference cassette consists of the cauliflower mosaic virus 35S promoter (CaMV35S) and an inverted repeat sequence of 207bp of the rice cytochrome P450 gene CYP81A6. This RNA interference cassette was constructed in tandem to the G6 gene inside the T-DNA  by Agobacterium-mediated transformation method G6 gene as the selection maker but without the RNA interference cassette, suggesting that this RNA interference cassette likely does not affect the transformation.The T-DNA plasmid pG6-450i was used to transform a local rice cultivar \u201cXiushui 110\u201d , and 450R . This fragment represents the very 5\u2032 end of the CYP81A6 cDNA from 1 to 207bp. Another 327bp fragment of CYP81A6 cDNA was obtained by PCR from the same rice genomic DNA using the primer 450F, and the primer 450R2 . This fragment represents the very 5\u2032 end of the cDNA from 1 to 327bp. Both PCR products were cloned into the pMD-T vector , confirmed by sequencing and then released from the T-vectors by digestion with XhoI and BglII. These two fragments and the T-DNA plasmid pCAMBIA1300 predigested with XhoI and dephosphorated, were ligated. The resulted plasmid construct, which contains a 207bp inverted repeat sequence of CYP86A6 for RNA interference, was named as p1300-450i.The 207bp fragment of G6, including its 5\u2032 end DNA fragment encoding the chloroplast transit peptide from the acetohydroxyacid synthase of Zea mays and its 3\u2032 end terminator fragment from the maize phosphoenolpyruvate carboxylase, was synthesized by Shanghai Sangon Limited, China (gb: EU169459). G6 was isolated from Pesudomonas putid in our laboratory recently. The restriction sites of BamHI and EcoRI were added to its 5\u2032 and 3\u2032 end of the gene, respectively, to facilitate the cloning. The Z. mays polyubiquitin-1 promoter AAGCTTGCATGCCTACAGTGC AGCGTGACCCGGTCGTGCGCG, a HindIII site was attached and underlined) and ZmUbiR . Advantage GC cDNA PCR kit (TaKaRa) was used to obtain this promoter by PCR from maize genomic DNA. This PCR amplified ZmUbi-1 promoter was digested with BamHI and HindIII, and then ligated in a 3-way to the synthetic G6 gene predigested with EcoRI and BamHI, and the plasmid p1300-450i predigested with HindIII and EcoRI. The resulted T-DNA construct was named as pG6-450i and was used for Agribacterium mediated rice transformation.The full length of maize optimized synthetic glyphosate resistant EPSPS gene Agrobacterium tumefaciens (LAB4404) by electroporation. A local rice cultivar \u201cXiushui-110\u201d (Oryza sativa L. ssp. japonica) was transformed using an Agrobacterium-mediated transformation procedure described previously T-DNA plasmid transformation vector pG6-450i was transformed into 0 transgenic rice plants of independently transformed events were cultured in a greenhouse in solution prepared according to Yoshida et al. (1976) at about 18\u201325C\u00b0 with 12\u201314 h light 0 plant seeds, the transgenic rice plants from the solution culture were replanted to soil containers in greenhouse. For field trials of T1 plants, the T0 seeds were first geminated and grew on soil seedbed for 3 weeks, and then the seedlings were replanted into the test field.T2. Bentazon (48% solution) was obtained from Jiangsu Luli Limited . In primary screening, bentazon of 4000 mg/L was used for spraying. In sensitivity assay, bentazon with final concentrations of 500, 1000 and 2000 mg/L were sprayed evenly. Glyphosate was obtained from Albaugh Inc. . It was diluted to 20 mM and then added with Tween-20 to the final concentration of 0.01% for spray. For field trials, bentazon of 1500 mg/L were sprayed at the rate of 100 mL/m2 also, and the growth of the plants was monitored daily.The rice plants were all sprayed with handhold sprayer at the rate of 100 mL/m5\u2032 CTCGAAGCTTACGTTTTTAATGTAC TGAAT) and 450R (5\u2032AGATCTGCTTCTTGACGAGGTGGAGGTGT), which could amplify a DNA fragment of 440bp, consisting of the CaMV35S terminator and the 207bp of the sequence of CYP81A6. The PCR products were analyzed by agarose gel electrophoresis.CTAB method Standard western analysis method was carried out to detect the expression of G6 in transgenic rice plants. Leaf samples collected from transgenic plants as well as non-transgenic control plants were ground in liquid nitrogen and then suspended in SDS sample buffer. After boiled for 10 min, the soluble fractions of these samples were separated by SDS-PAGE and then blotted onto nitrocellulose membrane. The rabbit antiserum against G6 was used as the first antibody and the alkaline phosphatase-conjugated goat anti-rabbit IgG as the second antibody (Sigma).CYP81A6 was amplified by the primer R450A1 (5\u2032 TCGCCGCCTGATCGACGCGGAGCGGC) and R450A2 (5\u2032 TGCACTGGAGGTAGCCGAGGCGAGT). The corresponding genomic fragment of this cDNA contains an intron, thus we can rule out the possible contamination of genomic DNA in the PCR reaction. Meanwhile, the Actin cDNA fragment was amplified, as a control, in a separate reaction with the same RNA as template using primer Act1 (5\u2032AGGGCTGTTTTCCCTAGTATCGTGG) and Act2 (5\u2032GATGGCATGAGGAGGGGCAT). The PCR products of CYP81A6 and Actin from the same event or control plants were then combined and analyzed by argrose gel electrophoresis.Five rice plants from each transgenic event and non-transgenic control plants of the same cultivar were sampled at 20 days after germination. The leaves collected from the 5 plants of the same event or the non-transgenic control were combined and its total RNA was extracted with the TRIzol reagent (Invitrogen). RT-PCR was performed using one-step RT-PCR kit (Fermentas). A cDNA fragment of Transgenic rice plants as well as the non-transgenic control plants were planted and tested in field from May 2006 to Oct. 2007 at the University farmer of Zhejiang University at Hangzhou, China. The biometrical data on plant height, number of panicles per plant, panicles length, number of grains per panicles and weight per 1000 grains were measured, recorded and the mean values were analyzed by Duncan's multiple\u2013range test using the DPS statistical software ."}
+{"text": "Oryza sativa) productivity is adversely impacted by numerous biotic and abiotic factors. An approximate 52% of the global production of rice is lost annually owing to the damage caused by biotic factors, of which ~21% is attributed to the attack of insect pests. In this paper we report the isolation, cloning and characterization of Allium sativum leaf agglutinin  gene, and its expression in elite indica rice cultivars using Agrobacterium-mediated genetic transformation method. The stable transgenic lines, expressing ASAL, showed explicit resistance against major sap-sucking pests.Rice , coding for mannose binding homodimeric protein (ASAL) from garlic plants, has been isolated and introduced into elite indica rice cultivars susceptible to sap-sucking insects, viz., brown planthopper (BPH), green leafhopper (GLH) and whitebacked planthopper (WBPH). Embryogenic calli of rice were co-cultivated with Agrobacterium harbouring pSB111 super-binary vector comprising garlic lectin gene asal along with the herbicide resistance gene bar, both under the control of CaMV35S promoter. PCR and Southern blot analyses confirmed stable integration of transgenes into the genomes of rice plants. Northern and western blot analyses revealed expression of ASAL in different transgenic rice lines. In primary transformants, the level of ASAL protein, as estimated by enzyme-linked immunosorbent assay, varied between 0.74% and 1.45% of the total soluble proteins. In planta insect bioassays on transgenic rice lines revealed potent entomotoxic effects of ASAL on BPH, GLH and WBPH insects, as evidenced by significant decreases in the survival, development and fecundity of the insects.In planta insect bioassays were carried out on asal transgenic rice lines employing standard screening techniques followed in conventional breeding for selection of insect resistant plants. The ASAL expressing rice plants, bestowed with high entomotoxic effects, imparted appreciable resistance against three major sap-sucking insects. Our results amply demonstrate that transgenic indica rice harbouring asal exhibit surpassing resistance against BPH, GLH and WBPH insects. The prototypic asal transgenic rice lines appear promising for direct commercial cultivation besides serving as a potential genetic resource in recombination breeding. Oryza sativa, L.) as their staple food, and by 2025 about 60% more rice must be produced to meet the needs of the growing population [Nilaparvata lugens, BPH), green leafhopper  and whitebacked planthopper  are known to cause severe damage to the rice plant besides acting as vectors for major viral diseases.Globally, more than 3 billion people from Asia and other countries depend on rice  have been introduced into diverse crop plants to protect against the damages caused by lepidopteran and coleopteran insects which feed by chewing [Bt insecticidal proteins such as lectins, protease inhibitors as well as ribosome-inactivating proteins [In recent times, successful attempts have been made to prospect for novel candidate genes that convey tangible resistance against major insect pests from various sources such as microbes, plants and animals. Different versions of  chewing -12. Furtproteins . Howeverproteins . Recent proteins ,16.Lectins are carbohydrate-binding proteins that specifically recognize diverse sugar structures and thus mediate various biological processes, viz., cell-cell and host-pathogen interactions, and serum glycoprotein turnover besides innate immune responses . LectinsGalanthus nivalis agglutinin (GNA), Concanavalin A (Con A) and Pisum sativum agglutinin (PSA), revealed palpable antimetabolic effects towards members of the homopteran insects both under in vitro [in planta conditions [G. nivalis agglutinin (GNA) has been widely studied and introduced into different plants, viz., rice, wheat and tuber crops [Allium sativum agglutinin (ASA), showed antimetabolic effects towards BPH and GLH insects [asal) exhibit increased resistance against GLH and BPH pests. In three subspecies of rice, significant advances made in the regeneration protocols and gene delivery methods have facilitated introduction of beneficial genes for various agronomic traits. In the recent past, it has been established that Agrobacterium-mediated transformation is an efficacious method for transferring novel candidate genes into elite indica rice varieties [A wide range of lectins exhibiting either mannose or mannose/glucose sugar binding affinity, including in vitro -28 as wenditions ,29,30. Aer crops ,32,23,24er crops ,35,23,24 insects . Express insects ,37. Saha insects  reportedarieties -41,23,12asal) gene from A. sativum, and its expression in elite indica rice cultivars using Agrobacterium-mediated genetic transformation method. Molecular evidences suggest stable integration of asal and bar genes into the genomes of rice plants, and their variable expression at RNA and protein levels. The stable transgenic lines, expressing ASAL, showed explicit resistance against major sap-sucking insects, viz., BPH, GLH and WBPH.The present investigation deals with the isolation, cloning and characterization of lectin  in rice plants has been demonstrated through Southern, northern and western analyses. The various ASAL-expressing rice lines furnished marked resistance against three major sap-sucking pests, viz., BPH, GLH and WBPH.The observations described herein pertain to the isolation of asal was isolated from garlic plants through the synthesis of cDNA followed by PCR using gene specific primers. The PCR product contained 546 bp coding sequence (Genbank accession no: DQ525625) that codes for a polypeptide of 181 amino acids (ABF70332), containing a signal peptide of 30 a.a. The ASAL protein showed maximum identity of 98% with the mannose specific lectins isolated from the leaf (AAW48531) and bulbs (AAB64238) of garlic plants. The plant expression cassette, comprising CaMV35S promoter, asal and nos terminator, was cloned at HindIII site of pSB11 bar intermediate vector of the Agrobacterium containing bar gene expression cassette  was co-cultivated with the Agrobacterium strain LBA4404 harbouring Ti-plasmid pSB111-bar-asal. A total number of 47 and 29 putative transformants were obtained from 2116 calli of Chaitanya and 4381 calli of BPT5204, respectively. From these, 14 transformants of Chaitanya and 3 of BPT5204 were selected for further analyses based on their high tolerance to herbicide (0.25%) BASTA . Southern blot analysis was carried out using BASTA and PCR positive plants. When genomic DNA of transgenic plants was digested with HindIII and probed with asal coding sequence, it showed hybridizable band of ~1.6 kb . Whereas, no such protein was observed in the untransformed control plants. The level of ASAL expression in transgenic plants was determined by the enzyme-linked immunosorbent assay (ELISA), and the amount of ASAL among transformants ranged between 0.74% and 1.45% of the total soluble proteins.Genomic DNA was isolated from the BASTA tolerant transgenic rice plants as well as from the untransformed control plants. PCR analysis of transgenic rice plants showed amplification of 560 bp and 546 bp products, representing  kb Fig. . Similarand Fig. . Genomic kb Fig. . These b0) transformants were germinated and T1 progenies were grown to maturity in the glass house. Eight T1lines of Chaitanya, viz., T32, T47, T49, T51, T56, T59, T63 and T68, and three T1 lines of BPT5204, viz., T43, T54 and T63, were tested with the herbicide BASTA and were also subjected to insect bioassays. In T1 progenies, both the transgenes bar and asal showed a monogenic segregation of 3 resistant: 1 susceptible plant(s) besides co-segregation in a normal Mendelian fashion for BASTA tolerance as well as for insect resistance  transgenic lines, for three major sap-sucking pests of rice. Transgenic rice lines (30-day-old) expressing ASAL showed significant resistance towards BPH, GLH and WBPH insects with minimal plant damage  developed on the bromocresol green paper was counted to estimate the feeding capacity of the insects. A mean number of ~8 \u00b1 1.36, ~21 \u00b1 2.12 and ~25 \u00b1 4.06 honeydew units/plant were excreted by BPH, GLH and WBPH, respectively, when fed on different transgenic rice plants compared to ~162 \u00b1 6.7, ~173 \u00b1 6.32 and ~189 \u00b1 7.3 honeydew units/plant observed on control plants Fig.  and 10C.A. sativum agglutinin  gene to provide resistance against major sap-sucking insects of rice, viz., BPH, GLH and WBPH which cause severe damage to rice plant affecting crop productivity. Earlier, we reported that transgenic rice engineered with the gna gene from G. nivalis could confer substantial resistance against major sap sucking pests [Bt genes into various crops, the damages caused by sucking pests steadily increased as they failed to convey resistance against these pests. Several plant lectins have proved insecticidal against a wide array of pests belonging to lepidoptera, coleoptera, diptera and homoptera [A. sativum lectin gene  and its constitutive expression in two high-yielding indica rice cultivars. Further, strong entomotoxic effects of ASAL transgenics against major sap-sucking pests has been demonstrated employing standard screening techniques that reflect situations prevailing in the field.In our ongoing efforts to clone and introduce different plant lectin genes into rice genome against homopteran pests, we have been evaluating the potential usefulness of ng pests ,24. An ang pests . It has ng pests . Damagesomoptera ,23-25,37bar-asal has been used to transform the elite indica rice cultivars. PCR and Southern analyses of BASTA tolerant plants confirmed the stable integration of bar and asal genes into the indica rice genome. Presence of ~1.6 kb hybridizable band with the asal probe in HindIII digested DNA, and ~1.9 kb hybridizable band with the bar probe in EcoRI digested DNA of transformants indicate the existence of two intact expression units of bar and asal in the rice genome  with that of previously reported garlic lectin protein ,44. Emplome Fig.  and 3B. nts Fig. , therebyvel Fig. . Marked 1 generation. BASTA test and Southern analysis indicated that bar and asal are transmitted in a Mendelian fashion. Segregation analyses of transgenes in T1 progenies revealed a monogenic ratio of 3 resistant: 1 susceptible plant(s) for both herbicide tolerance and insect resistance, affirming that these genes are stably integrated into the rice genome  used in artificial diet bioassays against sucking insects [nes Fig. , subjection Fig.  and 7C. ion Fig. . Similarion Fig. . Howeverion Fig.  and 9C, ion Fig.  and 10C, insects ,25.Although the precise mechanism of lectin toxicity to insects is unclear, yet it probably involves binding of lectins to the receptors present on the gut epithelial cells of various insects . ImmunohIn planta insect bioassays, reported herein, were carried out on asal transgenic rice lines adopting standard screening techniques followed in the conventional rice breeding for selection of insect resistant plants. The ASAL expressing plants, bestowed with high antifeedant and antimetabolic effects, afforded high-level resistance against three major sap-sucking insects. T4 transgenic lines of Chaitanya and BPT5204 varieties are being evaluated in limited open-field trials in the hopper-prone areas. To our knowledge, none of the rice cultivars thus far developed by conventional methods could show worthwhile resistance against three major sap-sucking pests. The overall results amply indicate that asal transgenic rice lines exhibit surpassing resistance against BPH, GLH and WBPH insects. The prototypic transgenic rice harbouring exotic asal appear promising for direct commercial cultivation besides serving as a novel genetic resource in recombination breeding.Four-week-old garlic plants (var. Godavari) grown in the net house, at CPMB, O.U., were used for total RNA isolation. Plant material was ground in the liquid nitrogen and homogenized in an equivalent volume (w/v) of denaturing buffer , 0.5% SDS, 0.1 M \u03b2-mercaptoethanol, 2 M sodium citrate pH 4.0, water saturated phenol and chloroform) . The RNA- reverse transcriptase  according to the manufacturer's protocol. The coding sequence of asal was obtained by PCR using primers 5'-GGA TTC ATG GGT CCT ACT ACT TCA TCT CCT-3', and 5'-GAA TTC TCA AGC AGC ACC GGT GCC AAC CTT-3', employing first strand cDNA as the template. The 25 \u03bcl PCR reaction mixture containing template DNA (100 ng), primers (10 \u03bcM), buffers, dNTPS (0.5 mM) and pfu DNA polymerase, was subjected to initial denaturation (94\u00b0C) for 5 min; followed by repeated denaturation (94\u00b0C) for 45 s, annealing (63\u00b0C) for 45 s, and elongation (72\u00b0C) for 1 min for a total of 35 cycles on PTC-200 Peltier Thermal Cycler. Final elongation was carried out at 72\u00b0C for 10 min. Amplified products were analyzed by gel electrophoresis on 1.0% agarose gel. PCR product was digested with BamHI and EcoRI then ligated into pGEM-4Z [BamHI and EcoRI sites using the rapid ligation kit [E. coli (Top10) cells. The recombinant clones were subjected to DNA sequencing using automated DNA sequencer.First strand cDNA was synthesized with Super Script II RNase H pGEM-4Z  at BamHItion kit  and tranasal gene was excised with BamHI and EcoRI enzymes from pZEM4Z vector, and cloned between CaMV35S promoter and nos terminator of intermediate vector pSB11 bar constructed earlier in our laboratory. The binary vector contains bar (CaMV35S-bar-nos) gene as a plant selection marker [bar-CaMV35S-asal-nos, was maintained in HB101 cells and mobilized into A. tumefaciens strain LBA4404 by triparental mating [bar-asal.The n marker . The recl mating  using thAgrobacterium-mediated genetic transformation experiments were carried out using LBA4404 strain harbouring pSB111-bar-asal super-binary vector. Two leading indica rice cultivars, Chaitanya and BPT5204, obtained from the Directorate of Rice Research (DRR), Hyderabad, were employed for genetic transformation. Mature seeds were manually dehusked and surface-sterilized with 0.1% (w/v) HgCl2 for 7 min followed by three washings with autoclaved distilled water, and kept at 29\u00b0C for germination. After 24 h of incubation, sprouted embryos were cut aseptically and placed on MS [Agrobacterium cultures were initiated by inoculating a single colony of the bacterium into 6 ml YEP medium containing 50 mg/l spectinomycin and 10 mg/l tetracycline at 225 rpm and 29\u00b0C for 24 h. The bacterial culture was pelleted at 3500 rpm and resuspended in 10 ml of PIMII medium [Agrobacterium culture and left on the shaker at 225 rpm for 30 min. These calli were placed on the co-cultivation medium and 20 \u03bcl of Agrobacterium culture was added on each callus for infection [ed on MS  medium  and bar . The DNA from the untransformed control plants was used as negative control and the intermediate vector was used as positive control. For Southern blot analysis [EcoRI and HindIII separately, electrophoresed on a 0.8% agarose gel and subsequently transferred to an N+ Nylon membrane [asal and 560 bp bar coding regions were used as probes after labelling with \u03b1-32P dCTP employing ready to go random primer DNA labelling kit [Genomic DNA was isolated from the BASTA tolerant and untransformed control plants using the method of . PCR anaanalysis , approximembrane  and fixeling kit . The memNorthern blot analysis was carried out according to . About 2- membrane [asal serum (1:10000 dilution) and goat anti-rabbit IgG horse-radish peroxidase conjugate [2O2.Samples of transgenic and untransformed control leaf tissue were homogenized in 50 mM Tris-HCl buffer pH 9.0. The extract was centrifuged at 5000 g for 20 min at 4\u00b0C, and the supernatant was collected. Protein samples (5 \u03bcg) were subjected to 15% SDS-PAGE according to . Followimembrane  by electmembrane . After ponjugate  as secon2O2 and kept in dark for 10 min. The reaction was stopped by 1 N H2SO4 and the absorbance was recorded on ELISA reader at 450 nm.Wells of the microtitre plate were coated with 1 \u03bcg of crude protein extract of transgenic plants and kept for overnight at 37\u00b0C and at 4\u00b0C for 1 h. The wells were washed thrice with 20 mM PBS containing 0.05% Tween 20 and were blocked with 10% non-fat dried milk for 2 h at 37\u00b0C, subsequently washed six times with PBS-T. The primary antibody (1:10000) was added to the wells and incubated for 2 h at 4\u00b0C. After incubation, the wells were washed thrice with PBS and incubated with secondary antibody (1:10000) for 1 h at room temperature. The plates were washed thrice with PBS and 0.001% TMB substrate in 0.05 M phosphate citrate buffer was added along with 0.1% H1 and T2 asal transgenic plants along with their respective controls as well as susceptible control Taichung Native 1 (TN-1) and resistant checks PTB33, Vikramarya and MO-1 at the Directorate of Rice Research, (DRR), Rajendranagar, Hyderabad. All bioassays were carried out at 25\u00b0C under an approximate 16 h/8 h light/dark photoperiod regime. The BPH, GLH and WBPH insects were maintained on 25\u201330 day old TN-1 plants under controlled conditions in the glass house. Premated gravid females of BPH, GLH and WBPH were allowed to ovi-posit separately on TN-1 plants for two days and the freshly hatched nymphs or the nymphs after attaining the desired age were utilized for various experiments. The degree/level of resistance exhibited by transgenic rice plants was scored based on a scale of 0\u20139, as used in the International rice testing programme [49, T51 of Chaitanya, and T63 of BPT5204, expressing high levels of ASAL were employed for developmental and fecundity assays of BPH, GLH and WBPH insects. In these experiments each plant was confined in an insect proof clean plastic cylinder (50 cm in length and 15 cm in diameter) around the stem of the plant and top of the plastic cylinder was sealed with fine nylon mesh. For developmental assay each of the 20 BPH, GLH and WBPH first instar nymphs were introduced separately on each plant confined in an insect proof cage and mortality of insects was monitored at 3 day intervals for 24 days [t-test or ANOVA.Insect bioassays of brown planthopper (BPH), green leafhopper (GLH) and white backed planthopper (WBPH) were carried out on both Trogramme . Homozyg 24 days . Twenty 2) as per [The extent of insect feeding was also estimated by semi-quantitative assay of the honeydew produced . Whatman) as per .YB and SVK carried out the isolation, cloning of the gene, genetic transformation, molecular characterization of transgenics and insect bioassays on transgenic plants; ICP designed and assisted in carrying out insect bioassays; VDR and KVR designed the strategy, data analysis and interpretation, and drafted the manuscript."}
+{"text": "Rice is one of the most important crops in the world. Although genetic improvement is a key technology for the acceleration of rice breeding, a lack of genome information had restricted efforts in molecular-based breeding until the completion of the high-quality rice genome sequence, which opened new opportunities for research in various areas of genomics. The syntenic relationship of the rice genome to other cereal genomes makes the rice genome invaluable for understanding how cereal genomes function. Producing an accurate genome sequence is not an easy task, and it is becoming more important as sequence deviations among, and even within, species highlight functional or evolutionary implications for comparative genomics. Food security is a major issue as we aspire toward sustainable development. In spiteof continuous increases in agricultural production due to the introduction ofimproved crop cultivars and the wide use of affordable technologies, more than800 million people still do not have access to sufficient food to meet theirdietary needs . CerealWorldwide transformation of agriculturewas first achieved with the Green Revolution, which led to significantincreases in agricultural production. It began in the 1940s with thecultivation of a high-yielding dwarf wheat cultivar with resistance to pestsand diseases. The Green Revolution for rice in the 1960s, based on the cultivarIR8, also dramatically increased rice production and helped food production tokeep pace with population growth.Now, the second GreenRevolution, which will be based on genomics, is expected to pave the way forthe leap in crop production. The availability of the rice genome sequenceallowed the development of innovative approaches to increasing production. In the last 10 years, the basic syntenic relationships ingene content and gene order within the grass family have been established \u20136. ThereOryzasativa ssp. japonica cv. Nipponbare has been recognized as a goldstandard for understanding the genetics and biology of rice at the molecularlevel and in the breeding and genetic manipulation of cereal crops.Among plants, only the Arabidopsis  and riceOryza is also described in thecontext of the rice genome as a reference.Thischapter presents a past history of the rice genome sequencing efforts and apresent endeavor for analysis of the genome sequence to clarify its structureand function. Approach to the \u201cdifficult\u201d regions whose functions are themaintenance and regulation of chromosomes\u2014notably thecentromeres and telomeres\u2014is described.Application of the new sequencing technology toward comparative studies amonggenus http://rgp.dna.affrc.go.jp/E/IRGSP/index.html). For construction ofsequence-ready physical maps, two complementary approaches were used. The RiceGenome Research Program (RGP) in Japan anchored the genomic clonesusing expressed sequence tags/sequence-tagged sites (EST/STS) and geneticmarkers from the genetic and transcript maps of rice [TheInternational Rice Genome Sequencing Project (IRGSP) was established in 1997.The 10 member countries agreed to sequence a standard rice cultivar(Nipponbare), to use common resources, and to share sequencing of the 12 ricechromosomes by using a map-based clone-by-clone strategy sequences, resulting in 433 Mb of sequence composed of 50 233contigs of Nipponbare [japonica and indica genome.Incontrast to the hierarchical clone-by-clone strategy used by the IRGSP, awhole-genome shotgun (WGS) sequencing strategy is widely used in manysequencing projects . In this with 4\u00d7  and late with 4\u00d7  genome c with 4\u00d7 . This WGpponbare . Nearly pponbare  havebeepponbare  of the jTheeffectiveness of the WGS sequencing strategy was compared with that of thehierarchal clone-by-clone sequencing approach , 24. Althttp://ricegaas.dna.affrc.go.jp [http://www.softberry.com/berry.phtml) and with BLAST [http://rice.tigr.org/tdb/e2k1/osa1/data_download.shtml),and gene models are improved with rice ESTs and transcripts [Detectingthe gene-coding regions within the genome sequence is one of the most efficientways to characterize the structure and function of the genome.RGP constructed an annotation system that facilitates gene detection of thegenome sequence in a timely manner. The Rice Genome Automated Annotation System, or RiceGAAS(rc.go.jp ), was derc.go.jp and Fgenth BLAST  forsiminscripts . Both sehttp://rgp.dna.affrc.go.jp/genomicdata/AnnSystem.html). This pipeline directlytakes the output generated from RiceGAAS for in-depth analysis with in-house editing tools. Eachgene model is manually edited to improve the prediction accuracy. The genemodels for each BAC or PAC clone are released to the public domain through theDDBJ/EMBL/GenBank database. All data can be accessed through the centraldatabase whole genome annotation (WhoGA) on our website athttp://rgp.dna.affrc.go.jp. Initially, only the six chromosomes  assigned to RGP were manually curated. Recently, curation ofthe rest was completed, so the manual annotation of the entire genome is nowavailable. After removal of clone overlaps, a total of 57 724 genes werepredicted, including many hypothetical genes predicted by a single predictionprogram. Among them, 24056 gene models are supported by full-length cDNAs. Allthe gene models are ordered and organized in a genome browser.RGPhas also developed a manual annotation system to facilitate curation of thegene models by human annotators(http://rapdb.lab.nig.ac.jp) will befurther improved with the integration of other annotation and functionalgenomics data.Apartfrom these individual activities, the IRGSP conceived the establishment of theRice Annotation Project (RAP), a community standard annotation project, in2004. Genes were annotated at regular jamboree-style annotation meetings to facilitate the manualcuration of all gene models in rice. The National Institute of AgrobiologicalSciences has been leading this project, collaborating with IRGSP members andmany international and Japanese laboratories. So far, three RAP meetings havebeen held, at which gene models, chiefly constructed by mapping full-lengthcDNAs on the latest rice genome assemblies, have been manually curated. Thiscollaboration confirmed 32000 curated genes, most of which have some degree ofevidence . The RAPhttp://rgp.dna.affrc.go.jp/E/IRGSP/index.html). Here, we focus on both regionsbecause they play essential roles in chromosome maintenance or segregation.Atthe time of completion of the genome in 2004, IRGSP published nearly 371 Mb ofhigh-quality DNA sequences, leaving about 5% of its estimated 389 Mb to besequenced . These uCen8). The majority ofcopies of the 155-bp centromeric satellite repeat CentO, totaling 68.5-kb, occur in three large clusters in thecenter, separated by centromere-specific retrotransposon of rice (CRR) sequences. Numerous sequences ofother transposable elements were also found in its surrounding region. Cen8 contains an ~750-kb core domainthat binds rice CENH3, the centromere-specific H3 histone [Cen8. A similar result was foundin Cen3, where a much bigger region(~1881 kb) has been found to have associations with CENH3 [CentO satellite DNA in the centromere of individual chromosomesvaries from 60 kb to 1.9 Mb in O. sativa [CentO clusters within the core region differ markedly between Cen4 and Cen8 in theNipponbare genome. Cen8 has onlythree CentO tracts (clusters) with442 copies of the 155-bp tandem repeat distributed within a 75-kb region,whereas Cen4 has up to 18 tracts butonly 379 copies of the repeat within a 124-kb region [CentO repeats, on the other hand, areabsent from several wild rice species, such as Oryza brachyantha [Oryza species in thefuture, since in-depth analysis of the Cen8 and Cen4 sequences has demonstratedsegmental duplication and inversion of centromeric DNA [O. brachyantha, revealing positionalshift of centromere [Becauseof the relatively small amount of centromeric satellite DNA in rice,significant progress has been made in genomic and molecular studies of thestructures, functions, and evolution of rice centromeres. Two centromeres,derived from chromosomes 4 and 8, have been completely sequenced, revealing thecomplicated composition and structure of the first centromeres to have beensequenced among eukaryotes \u201339. Repe histone . It issth CENH3 . As ach. sativa . The numb region , 39  [Arabidopsisthaliana and shows tandemly repeated arrays of 5\u2032-TTTAGGG-3\u2032 [Arabidopsis but much shorter than those of Nicotianatabacum, ranging in a length from 5 to 20 kb, thus hinting at the geneticcontrol of telomere length in plants [Oryza;this variation should provide useful information for future studies of telomereevolution. Gene annotation in the 7 rice subtelomere regions (each within 500 kb) demonstrated that the genomic region adjacent to the chromosome terminus isgene-rich (1 gene per 5.9 kb on average). Since nearly half of these annotatedgenes match rice full-length cDNAs, these rice subtelomeres could be consideredto have high transcriptional activity. Recently, sevennew rice telomeres were partly sequenced, and their sequences have beensubmitted to DDBJ (http://rgp.dna.affrc.go.jp/E/publicdata/telomere2007/index.html). Among theabove 14 chromosomal ends, the telomere and subtelomere regions on the shortarm of chromosome 9 show some specific compositional and structural features.Sequencing and analysis of the fosmid clone OSJNOa063K24 revealed that thetelomere repeats are colocalized with the ribosomal RNA gene (rDNA) cluster[Likethose of centromeres, the composition and structure of telomere regions in ricehave also been analyzed. Telomeres form the ends of linear eukaryoticchromosomes, serving as protective caps that prevent end-to-end fusion,recombination, and degradation of chromosomal ends . The telprotozo) , 49. TheTAGGG-3\u2032 . Rice teTAGGG-3\u2032 . Sequencn plants , 53. Int cluster. Besides cluster. It willO.sativa L.) has two subspecies, indica and japonica. Both are important asmodern crops, and there are many phenotypic variations among them, conferringadaptation to many different environmental and cultural conditions. Crossing ofthese subspecies has produced new cultivars of agricultural importance. Knowingthe differences at the molecular level would widen the capacity for ricebreeding. RGP constructed a BAC library of Kasalath, an indica cultivar, generating 78427 high-quality BAC end sequencesfrom 47194 BAC clones, and mapped these end sequences on Nipponbare chromosomesequences [http://rgp.dna.affrc.go.jp/E/publicdata/kasalathendmap/index.html).http://rgp.dna.affrc.go.jp/blast/runblast.html). Other approaches [Riceis believed to have been domesticated from a wild relative 0.2 Mya  or 0.44 equences . Mappingproaches , 60 coulOryza rufipogon. Recently, the origin has been clarified by comparison ofretrotransposon [Ithad long been a mystery how Asian rice originated from its wild progenitor, ansposon , retropoansposon , chloropansposon , and genansposon  sequenceOryza has 23 species [O. sativa in Asiaand O. glaberrima in Africa) are domesticated and cultivated. This fact isremarkable given that rice grows under a wide variety of natural conditions.Consequently, many genetic resources might be waiting to be developed. Study ofthe wild relatives mightreveal new genes for hybridization, improved yield, and sustainable production.The Oryza Map Alignment Project of the USA and Chinaaims at the establishment of an experimental platform to unravel and understandthe evolution, physiology, and biochemistry of the genus. The Arizona GenomicsInstitute has constructed 12 BAC libraries from the AA (the same as sativaspecies) to HHKK (remote species from sativa) species genomes.Computer-based mapping and filter hybridization screening provided high-densitycross-species physical maps [Thegenus  species , butonlcal maps , 66.O. sativa and itsprogenitors are expected to show extensive base substitutions andrearrangements. Therefore, it would be difficult to reconstruct the genomesequences of wild rice relatives from cultivars. As resequencing with theconventional Sanger methodology can take much time and effort, a newpyrosequencing technology was developed. Massively parallel short reads frompyrosequencing analysis [O. rufipogon IRGC105491 (AA species) werechosen from a fingerprint contig of the OMAP BAClibrary (OR_CBa-FPC contig 51). This contig corresponds to an 800-kb region ofthe short arm of Nipponbare chromosome 6 and is expected to contain two genesfor rice flowering(Hd3a and RFT1). DNA of each BAC clone was purified individually and thenmixed for pyrosequencing on a GS20 genome analyzer (Roche). The output fromthis analysis (ca. 20\u00d7 coverage) contained 286639 reads. Of these,169130 reads were mapped and 16123462 bases were aligned to the correspondingNipponbare sequences, forming 1422 mapped contigs that cover 57.5% of theentire genomic region. The average depth was 23.39 showing deep coverage.Thegenome sequences of analysis  could seTocompare these sequences with those from Sanger sequencing, we shotgun sequenceda BAC clone OR_CBa0004O24 and assembled it with phred/phrap software to formcontigs. Each contig sequence from pyrosequencing was aligned to itscorresponding Sanger sequence by BLAST alignment. Statistical results from thiscomparison are shown in Hd3a  between O. sativa cv.Nipponbare (by Sanger method) and O. rufipogon (by pyrosequencing). Only3 SNPs and no in/delwere found in exons (540 coding nt), whereas many deviations  were found in introns; this was evolutionally reasonable. This sequenceconservation might indicate that Hd3a is functionally important and under purifying selection.Comparing only high quality  nucleotides gave an overall error rate of 0.0409% or 0.0359%.This means that the high-coverage reads from pyrosequencing show more than99.95% accuracy. Researchers have pointed out that pyrosequencing is moreproblematic in repeats and homopolymers than Sanger technology , 69, butOryza genomes.Theseresults show that emerging new resequencing technologies , when pOryza has alsobecome a feasible strategy for understanding the evolutionary events that ledto the development of cultivated rice. The syntenic relationships among cerealcrops must be thoroughly exploited from now on. The rice genome sequence willbe the most important tool in explaining the structure and function of othercereal genomes, and its use may open new opportunities for researchers to lookdeeper into the synteny between rice and other cereal crops, which has beenmaintained for some 60 million years of evolution [Therice genome sequence has become available as a reference genome, providing abasis for understanding the wide range of diversity among cultivated and wildrelatives of rice. The continuous efforts in generating a high-quality sequencehave paved the way for clarifying the structures of genomic regions that aredifficult to analyze, including centromeres and telomeres. Comparative genomicswithin the genus"}
+{"text": "African Rice (Oryza glaberrimaSteud.): Lost Crop of the Enslaved Africans Discovered in Suriname. African rice (Oryza glaberrima Steud.) was introduced to the Americas during the slave trade years and grown by enslaved Africans for decades before mechanical milling devices facilitated the shift towards Asian rice (O. sativa L.). Literature suggests that African rice is still grown in Guyana and French Guiana, but the most recent herbarium voucher dates from 1938. In this paper, evidence is presented that O. glaberrima is still grown by Saramaccan Maroons both for food and ritual uses. Saramaccan informants claim their forefathers collected their first \u201cblack rice\u201d from a mysterious wild rice swamp and cultivated these seeds afterwards. Unmilled spikelets (grains with their husk still attached) are sold in small quantities for ancestor offerings, and even exported to the Netherlands to be used by Maroon immigrants. Little is known of the evolution of O. glaberrima, before and after domestication. Therefore, more research is needed on the different varieties of rice and other \u201clost crops\u201d grown by these descendants of enslaved Africans who escaped from plantations in the 17th and 18th centuries and maintained much of their African cultural heritage in the deep rainforest. Oryza glaberrima Steud.) was introduced to the New World in the 17th century by means of the slave trade. Unprocessed rice was purchased by slave traders in West Africa to serve as ship provision, and later grown by the enslaved in their home gardens (Carney O. sativa L.) was introduced in the 1690s, the entire rice cultivation in South Carolina must have been based on O. glaberrima , each with a different language and culture. Due to the scarce influence of Christianity, Maroon culture and religion are often considered the most \u201cAfrican\u201d of the Americas , the National Herbarium of the Netherlands (NHN\u2013L), and the New York Botanical Garden (NYBG). Three samples of loose Oryza spikelets were deposited at the Economic Botany collection of the NHN\u2013L. Fresh samples, purchased at the Paramaribo market in December 2009, were handed over to the Amsterdam Botanic Garden for planting trails and sent to Susan McCouch, Cornell University, for molecular analysis.Data on the cultivation and use of African rice were collected in the framework of the research project \u201cMedicinal Plants of Suriname: Changes in Plant Use after Migration to the Netherlands.\u201d Fieldwork took place from January to July 2006 and consisted of general ethnobotanical inventories, market surveys, and interviews around Paramaribo and along the lower Marowijne River (among the Aucan Maroons) and lower Suriname River (among Saramaccan Maroons) Fig.\u00a0. AdditioOryza worldwide, of which only O. sativa and O. glaberrima are cultivated. Three wild species are listed for the Guianas: O. grandiglumis (D\u00f6ll) Prodoehl, O. latifolia Desv., and O. rufipogon Griff , Suriname (BBS), or French Guiana (CAY), nor in the large Neotropical collections of the National Herbarium of the Netherlands (L), the New York Botanical Garden (NYBG), the Smithsonian Institution (US), and the Missouri Botanical Garden Herbarium (MBG). The specimen of O. glaberrima collected in 1938 by A. Vaillant (No. 24) is located in the in the Mus\u00e9um National d\u2019Histoire Naturelle (P) in Paris. Based on the observations of Port\u00e8res  of unmilled O. sativa spikelets were being sold by Maroon women for USD 1.30 each in the medicinal plant market in Paramaribo , a piece of sugarcane, and a few green bananas to the Earth Mother. This offering, known among Creoles as \u201cala mofo nyan\u201d , consists of a plate with boiled eggs, banana pudding, molasses, melegueta pepper (Aframomum melegueta [Roscoe] K. Schum.), maize, bananas, plantains, taro, and rice. Apparently, both African and Asian rice species figure in these ancestor offerings. The Boni Maroons serve dozens of different rice dishes during the ceremonies that mark the end of a mourning period  of unmilled d Fleury .O. sativa) was sold in both Maroon and East Indian shops in the Netherlands as it is offered during Maroon and Hindu ceremonies. In January 2010, a bag of loose, unmilled O. glaberrima spikelets was purchased in a Saramaccan \u201cculture shop\u201d in the East of Amsterdam. According to the shopkeeper, black rice was much tastier than normal rice, but it was rather rare and he had to order it all the way from his relatives in Klaaskreek. He sold bags of 50 gr for USD 6.00.The vendors of a Saramaccan herb shop and an Aucan market stall in Amsterdam said they occasionally sold \u201cbusi aleisi\u201d or \u201cblaka aleisi.\u201d Unfortunately, the African rice was not in stock when we conducted our market surveys in 2000 (van Andel and van\u2019t Klooster Olyra latifolia L.) that grows abundantly at forest clearings in Suriname.When I asked renowned Saramaccan tree spotter Frits van Troon about the origin of African rice, he said it was a wild plant that his ancestors had found growing on the edge of a swamp in the middle of the forest. They collected the panicles from this \u201cnatural rice field\u201d and took them to their own gardens to plant the seeds. It was a rice species that matured in three months which, according to van Troon, \u201cwas handy for the Bush Negroes because they needed food quickly. They had little time to wait, since they had to escape further in the forest.\u201d Van Troon remembered that his now\u2013deceased mother still planted this fast\u2013maturing variety of African cereal. Although he maintained the wild origin of the crop, reflected in its name \u201cm\u00e1tu al\u00edsi\u201d (forest rice), he denied that it had anything to do with the wild grass known as \u201cdagu aleisi\u201d , where I had been doing fieldwork in 2006 (but never saw any field of African rice). Soon after I asked some villagers about the crop, they located a bag of uncleaned grains stored as sowing material, which consisted of an infrutescence with many loose seeds . According to Poeketie, people found it too tiresome to pound off the rice husks by hand, even though many households in the village still owned wooden mortars.My field assistant, Saramaccan farmer Albie Poeketie, was not aware that his neighbor cultivated African rice and asked for some seeds to sow in his own garden. He told me that the species was more frequently cultivated in the past, but after a mechanical rice mill became operational in the neighboring village of Klaaskreek, farmers had shifted to \u201ckuli al\u00edsi\u201d , the commercial Asian varieties grown by East Indians along the coast. He explained how African rice could only be milled by \u201cm\u00e1ta ku tat\u00ed\u201d (mortar and pestle), and afterwards needs to be winnowed by hand  in the large, richly decorated trays made from the buttresses of When asked about the origin of African rice, Poeketie said he had never heard of the story of the Saramaccan woman who hid seeds in her hair. He remembered being told that his forefathers once found a large swamp in a forest where this type of rice was growing abundantly. All present\u2013day African rice originated from the seeds his ancestors had collected from that field. He was sure that the mysterious rice swamp was not made by Maroons (or other human beings), since it was found it in an uninhabited stretch of forest.Oryza glaberrima. The fact that the rice field was made by a spirit of the deep woods may have led to the name \u201cm\u00e1tu al\u00edsi\u201d (forest rice) and the strong claim that the plant was growing wild before Saramaccans started to cultivate it. How this mysterious rice swamp ever came to be, which rice species  was growing there, and whether it was related to the legend of the woman who hid the rice in her hair, we will probably never know. The importance, however, of Maroon oral history and ritual practices in the conservation of the different rice cultivars is evident.\u201cAround 1800, one day when hunting on the Upper Pikil\u00edo, near Kwaminangoto, Gbagidi discovered a mysterious swamp surrounded by tempting bananas, wild rice, and various other crops. After cutting samples and setting out for home, he was horrified to see his favorite hunting dog being swallowed up by the swamp\u2019s quicksand\u201d Price : 250. ThO. glaberrima in Eastern Ghana  that combine the hardiness of the African species with the productivity of the Asian species . A missed opportunity, since there are indications that additional \u201clost African crops\u201d are still grown by Maroons or survive as relicts around former settlements, like the Bambara groundnut, Vigna subterranea (L.) Verdc. and the Senegal date palm, Phoenix reclinata Jacq. (van Andel et al. \u201cLittle research has focused on the role of provision gardens as the botanical gardens of the dispossessed, the marginal, those who struggled to hold on to their cultural identity under dehumanized conditions\u201d Carney : 156. CaOryza glaberrima is still grown, milled by hand, eaten, offered to the ancestors, sold on the market, and even exported to the Netherlands by Maroons. Traditional religion plays an important role in the survival of this ancient rice species, and Maroon women earn additional income by selling African rice seeds still in the husk for religious purposes. Previous research suggests that various cultivars of the cereal are grown, which may shed new light on the domestication process of African rice outside its center of origin. Much of the historical rice diversity has likely been lost before scientists were able make collections and store germplasm in gene banks. Therefore, it is imperative to collect and describe the existing rice cultivars grown by the different Maroon tribes in Suriname before they disappear through the introduction of improved varieties, shortage of labor due to migration, or loss of traditional religion. Further research on Maroon agriculture may also reveal more \u201clost crops\u201d that have disappeared from the former plantations, but are still cherished by the descendants of those who fled them.We can conclude that in the discussion of the survival of African cultural traditions among Afro\u2013Americans (Mintz and Price"}
+{"text": "The model presented here attempts to quantify the energetic components stabilizing the structure of DNA such as base pairing, stacking, and ionic environment which are partially disrupted during the process of thermal denaturation. The model gives a Pearson product-moment correlation coefficient (r) of \u223c0.98 between experimental and predicted melting temperatures for over 300 sequences of varying lengths ranging from 15-mers to genomic level and at different salt concentrations. The approach is implemented as a web tool ( Several physico-chemical factors such as base stacking, hydrogen bonding, hydrophobic, electrostatic and van der Waals interactions etc. stabilize the DNA molecule DNA denaturation (melting) is the process of separation of ds-DNA into two single strands. This cooperative unwinding is also known as helix-coil or melting transition DNA \u2018breathes\u2019 even at normal cell temperatures DNA melting is measured by the absorbance of UV light (260 nm) by the DNA solution, where the amount of UV light absorbed is proportional to the fraction of non-bonded base pairs. This UV absorbance is due to the \u03c0-\u03c0* electronic transition in both purine and pyrimidine bases, which reflects a change in the electronic configuration of the bases due to the decrease in double helical stacking and base paring upon melting. As the temperature increases, melting of the double-stranded DNA is initiated and the absorbance of UV-light increases through a series of sharp jumps. The absorbance increases by 30\u201340% depending on the DNA sample. Earlier theories on DNA melting have incorporated stacking and hydrogen bonding within the framework of models for transitions in polypeptides: (i) Zimm-Bragg theory; where stacking is modeled as a nearest-neighbor interaction; Many attempts have been made to predict the melting temperatures of short nucleotide sequences, which is of particular interest in primer design. The earliest of these methods used a simple formula to calculate Tm based on the GC content of the sequence The accuracy benchmark dataset compiled by Panjkovich & Melo Melting of DNA necessitates the disruption of stacking interactions between the two base pairs within each dinucleotide step. During the process, cross strand stacking interactions are completely lost while intra-strand stacking interactions are disrupted partially. The dinucleotide steps are assembled into four groups on the basis of their possible interactions as RR, RY, YR and YY, where R and Y denote a purine and a pyrimidine respectively. RY has the highest stacking as known from experiments The melting of DNA also requires the breakage of Watson-Crick hydrogen bonds (H-bonds) and it is well known that GC pairs (3 H-bonds) are stronger than AT pairs (2 H-bonds). Based on this, and the knowledge of interaction energies of H-bonded pairs The contribution of H-bond energy and stacking energy is almost equivalent in the stabilization of duplex DNA, as discerned from various studies on modified bases A total of 16 dinucleotide combinations are possible of which only 10 are unique when read in the 5\u2032 \u2192 3\u2032 direction. These are arranged here in the decreasing order of DNA strength parameter value (Table1): (i) GC, (ii) CC\u200a=\u200aGG, (iii) CG, (iv) AC\u200a=\u200aGT, (v) TC\u200a=\u200aGA, (vi) CT\u200a=\u200aAG, (vii) TG\u200a=\u200aCA, (viii) AT, (ix) TT\u200a=\u200aAA, (x) TA. The above assignment of DNA strength parameter values is also found to be consistent with the observations on relative stabilities of dinucleotides The value of DNA strength parameter for the whole sequence is accumulated by adding the values  for each+] concentration in the solution, implemented as a natural logarithmic variable, which is in accordance with previous work The salt effects are taken into account on the basis of [NaAll the above contributors are pooled into a simple equation and processed through the multiple regression analysis method of Analyse-It software package Tm \u200a=\u200a Predicted melting temperatureE \u200a=\u200a DNA strength parameter per baseLen \u200a=\u200a Length of nucleotide sequence (number of base pairs)+] concentration of the solution (Molar)Conc \u200a=\u200a For genomic sequences, the Tm is first calculated by computing the cumulative strength parameter of a melting unit of 70 bp from the start which is then derived per base and employed in eq. (1). This window is translated by one base pair and a new Tm is calculated and the procedure is repeated till the end of the sequence. The Tm for the whole genomic sequence is then developed as the average of overlapping melting units of length 70 bp, a number arrived at empirically which appears to have biological significance as discussed below.In this study, a phenomenological model is developed on the basis of a theoretical appraisal of the events occurring during the process of DNA thermal denaturation. The model was trained on a dataset of 123 oligomers to achieve a best fit equation (1); , which gThe correlation coefficients with experimental melting temperatures for the four parameters used in the model, as a single entity and in all possible combinations are shown in The following methods were reported earlier in the literature for melting temperature predictions: (i) Basic method The melting temperatures of 20 genomes were also calculated using eq. (1) as described in the The melting of large and genomic level sequences can be modeled as a cooperative phenomenon, occurring simultaneously at various places along the DNA sequence, where each melting region can be described as a \u201cmelting unit\u201d Escherichia coli at various salt concentrations are calculated and reported in st entry  and the 2nd entry  of the table that there are discrepancies in the experimental melting temperature values derived by various methods at nearly the same salt and nucleotide concentrations. Allowing for this difference, it may be noted that the calculations are in general accord with experiment.The melting temperatures of In a nutshell, the phenomenological model presented here for melting temperature prediction covers a large range of salt concentration, GC content and length of DNA sequence and could pave the way for a deeper molecular-level understanding of DNA melting.Escherichia coli genome (NC_000913) is depicted in Oryza sativa is shown in Previous work has shown that there appears to be an underlying energy basis for the discrimination of genic and non-genic regions in prokaryotic genomes www.scfbio-iitd.res.in/chemgenome/Tm_predictor.jsp. The utility has an input box wherein the user can paste the sequence. Alternatively, the user can input the sequence with the help of buttons provided in the utility. In case of large DNA sequences, the user can also upload the sequence file through the browse option provided. The calculated Tm is reported either on the web page  or on the email-id provided by the user (for large sequences). The utility also provides the option of calculating melting temperatures at various salt and DNA concentrations. The training and test datasets and a tutorial to calculate Tm for a small sequence manually are also provided.The melting temperature prediction method presented here is also presented by means of a web utility: A simple phenomenological model is developed for predicting the melting temperatures of DNA sequences based on stacking and hydrogen bonding interactions, length of the sequence, salt and nucleotide strand concentration. The model is applicable to a wide range of sequence lengths including genomic sequences, base composition and salt concentrations. This method thus overcomes the limitations noted earlier of predictive models giving good results in a limited sequence and length data space and smaller range of salt concentration. Work is in progress to develop melting profiles of complete genomes in pursuit of genome annotation to eventually facilitate a molecular level understanding of genome organization.Figure S1Data space representation for the length parameter.(0.25 MB TIF)Click here for additional data file.Figure S2Data space representation for the salt concentration parameter.(0.23 MB TIF)Click here for additional data file.Figure S3Data space representation for the %GC content of the sequence.(0.48 MB TIF)Click here for additional data file.Figure S4Normal probability plot of residuals for the training dataset.(0.22 MB TIF)Click here for additional data file.Figure S5Distribution of residuals with the predicted melting temperatures.(0.37 MB TIF)Click here for additional data file.Text S1The equation to predict the melting temperature of DNA without the use of the nucleotide strand concentration.(0.02 MB DOC)Click here for additional data file.Table S1Experimental and predicted melting temperatures for the training dataset of 123 oligomers.(0.22 MB DOC)Click here for additional data file.Table S2Experimental and predicted melting temperatures for the test dataset of 225 oligomers.(0.38 MB DOC)Click here for additional data file.Table S3Experimental and predicted melting temperatures for a dataset of 15-mers.(0.16 MB DOC)Click here for additional data file.Table S4Experimental and predicted melting temperatures for 40 base pair long oligonucleotide sequences.(0.03 MB DOC)Click here for additional data file.Table S5Analysis of variance for the regression equation (1) derived from the training dataset.(0.03 MB DOC)Click here for additional data file."}
+{"text": "Dictyostelium purpureum). To further characterize the interplay among genetic variation, species boundaries, social behaviour, and reproductive isolation in the Dictyostelia, we conducted phylogenetic analyses and mating experiments with the geographically widespread social amoeba Dictyostelium giganteum.Microorganisms are ubiquitous, yet we are only beginning to understand their diversity and population structure. Social amoebae (Dictyostelia) are a diverse group of unicellular eukaryotic microbes that display a unique social behaviour upon starvation in which cells congregate and then some die to help others survive and disperse. The genetic relationships among co-occurring cells have a major influence on the evolution of social traits and recent population genetic analysis found extensive genetic variation and possible cryptic speciation in one dictyostelid species  is not likely to correlate with either genetic or geographical distance. To test this prediction, we performed 108 mating experiments and found no association between mating probability and genetic or geographical distance.D. giganteum isolates from across North America display little genetic variation, phylogeographic structure, and genetic differentiation among populations relative to the cryptic species observed within D. purpureum. Furthermore, variation that does exist does not predict the probability of mating among clones. These results have important implications for our understanding of speciation and social evolution in microbes. Studies of microbial biogeography and diversity provide a better understanding of the population structure, intraspecific genetic differentiation, and genetic diversity of these ubiquitous organisms ,2. UnlikSocial amoebae live in decaying vegetative matter that forms the top layers of soil worldwide . These sD. discoideum. One to six mating types have been reported in different species .,27.D. diDictyostelium purpureum and showed strong intraspecific genetic differentiation - some haplotypes found within D. purpureum were more divergent than a number of pairs of closely related but distinct species, suggesting the possibility of cryptic species. The objectives of the current study are (1) to examine the evolutionary history of Dictyostelium giganteum by sequencing the same regions of the nuclear ribosomal DNA, and using this phylogeny (2) to compare the level of intraspecific genetic variation between D. giganteum and D. purpureum and (3) to test predictions on the potential for sexual mating (macrocyst formation) between clones of D. giganteum with varying genetic and/or geographical distances. This work is fundamental to understanding social behavior among clones of D. giganteum , a dict.g., see , becauseD. giganteum species , of which 16 were parsimony informative.We sequenced, on average, 4,060-bp of the rDNA in all 24 samples and identified 16 unique haplotypes. With the two published  AM168042) this ma AM168042; AdditioD. giganteum were not well resolved in any of the trees.Neighbor-joining, maximum parsimony (MP), maximum likelihood (ML), and Bayesian analyses of the unique haplotypes produced similar topologies. Figure D. giganteum and outgroup taxa was 0.110 (range 0.103 - 0.111), and 0.037 between outgroups D. discoideum and D. citrinum. Within D. giganteum, genetic distances ranged from 0 - 0.022 (including the two published D. giganteum sequences) and 0 - 0.007 (excluding the two published D. giganteum sequences). The average pairwise sequence divergence between the basal lineages  and the rest of the D. giganteum clones was 0.004.We found small genetic distances between groups of lineages, substantially smaller than differences between closely related but distinct species. The average genetic distance between D. giganteum . Pairwise population comparisons indicated that this was largely driven by the Massachusetts group being different from both Texas populations  given that no other pairwise population comparisons were significant (data not shown). Nevertheless, the sample sizes are very small, so power to test further structure is lacking.Overall, we found pronounced population differentiation for D. giganteum, compared to the divergence between species, suggests that D. giganteum is a single species and sexual mating  in D. giganteum is just as likely to occur between pairs of isolates from throughout the tree and/or different geographic locations, assuming isolates are of different mating types. The two groups we focused on were the group consisting of the basal lineages  and the group containing the rest of the D. giganteum isolates given that Fst estimates showed significant differentiation between the Massachusetts and Texas populations.The findings of low genetic divergence within To test the above hypothesis, we performed three sets of 8-clone pairwise mating experiments with isolates that varied in both geographical and genetic distances. After replicating all of Experiment #3 and two other pairwise matings from Experiment #1 , which confirmed previously published results for this species . Ten of For example, in Experiment #1, QSgi12, QSgi17, and QSgi22 were all considered the same mating type because all mated with QSgi6 but no other isolates did Figure . OverallWe also investigated whether the time to macrocyst formation for these pairs correlated with genetic distance between a pair of clones but found no significant relationship . The same was true for geographical distance .D. giganteum from the phylogenetic analyses of the rDNA sequence data. First, and most importantly, there appears to be very little genetic differentiation among isolates of D. giganteum and no clear evidence of phylogenetic structure. Isolates from a given geographical location do not cluster together  regardless of geographical location or genetic distance. This is in contrast to D. purpureum - a species with extensive genetic variation and phylogenetic structure. Mehdiabadi et al. [D. purpureum isolates from different phylogenetic groups. However for D. giganteum, we found that sexual mating (macrocyst formation) did not correlate with either genetic or geographical distance  9 clones from Pasadena, Texas , (ii) 5 clones from Houston, Texas , (iii) 3 clones from the University of Michigan Biological Station near Pellston, Michigan , (iv) 3 clones from Wellesley, Massachusetts , (v) 3 clones from Mountain Lake, Virginia , and (vi) 1 clone generously provided by Jim Cavender from Whitewater, Wisconsin  and another from an unknown location  and Dictyostelium citrinum (GenBank accession number DQ340385) served as outgroups.We used 24 2, 0.2 \u03bcL DNTPs, 1 \u03bcL forward primer, 1 \u03bcL reverse primer, 1 \u03bcL 10\u00d7 Buffer, 0.1 \u03bcL Platinum Taq DNA Polymerase (Invitrogen), 4.575 \u03bcL water, and 1 \u03bcL DNA) using the following protocol , sequenced PCR products in both directions, and performed phylogenetic analyses. We selected the nuclear ribosomal DNA as the marker of choice because Schaap et al. [GU386290-GU386313.DNA extraction, amplification, and sequencing were carried out as described in Mehdiabadi et al. . We extrp et al.  showed tp et al. . We assep et al.  in BioEdp et al. . SequencWe used four different methods to reconstruct the rDNA gene tree: Bayesian, ML, MP, and neighbor-joining approaches. For the Bayesian tree, we used MrBayes v3.1  to estimWe estimated genetic distances between haplotypes in MEGA4  using thST with the rDNA sequence data using the analysis of molecular variance approach [To test for population differentiation, we calculated Fapproach  implemenapproach . Our anaTo test whether mating correlated with genetic distance, we performed three round robin 8-clone macrocyst experiments, where each clone was paired with seven other clones as well as itself , we considered that pair as capable of forming macrocysts. Also, if replicate experiments for a given pair of clones had macrocysts form at different times (1/38), we used the earliest time in our Fisher's exact test analysis and the averaged time in our correlation analysis.NJM, MRK, DCQ, and JES designed research, NJM performed research, NJM and MRK analyzed the data, NJM, MRK, DCQ, and JES wrote the manuscript, and all authors read and approved the final manuscript.Table S1. D. giganteum unique haplotypes. Symbols refer to geographical locations of isolates as shown in Figure Click here for file"}
+{"text": "Many patients with advanced chronic kidney disease are referred late to renal units. This is associated with negative aspects. The purpose of the present study was to characterize late versus early referrals for renal replacement therapy including their renal disease, health care contacts and medical treatment before renal replacement therapy (RRT) and the consequences for RRT modality and mortality.Nationwide cohort study including 4495 RRT patients identified in the Danish Nephrology Registry 1999\u20132006. The cohort was followed to end 2007 by linkage to other national registries. Late referral: follow-up \u226416\u2009weeks in renal unit before RRT start. Cox proportional hazards models were used to estimate the relative risk of mortality or waiting list status within 365\u2009days in late referrals versus early referrals.A total of 1727 (38%) incident RRT patients were referred late. Among these, 72% were treated in non-nephrology hospital departments and 91% in general practice 2\u2009years to 16\u2009weeks before RRT start. Fewer late referrals received recommended pre-RRT treatment as judged by renin-angiotensin-system blockade: 32% versus 57% or the D-vitamin analogue alfacalcidol: 5% versus 30% (P\u2009<\u2009.001). Primary RRT modality was peritoneal dialysis: 18% in late versus 32% in early referrals (P\u2009<\u2009.001), 7% versus 30%, respectively, had an arteriovenous dialysis-fistula (P\u2009<\u2009.001) and 0.2% versus 6% were on the waiting-list for renal transplantation (P\u2009<\u2009.001) before RRT start. One-year-mortality was higher in late referrals: hazard ratio 1.55 (CI 95% 1.35\u20131.78). In a subgroup, 30% (CI 95% 25\u201335%) late and 9% (CI 95% 6\u201312%) early referrals had plasma creatinine \u2264150% of upper reference limit within 1 to 2\u2009years before RRT start (P\u2009<\u2009.001).Late nephrology referrals were well-known to the healthcare system before referral for RRT start and more often had near normal plasma creatinine levels within 2\u2009years before RRT start. They infrequently received available treatment or optimal first RRT modality. An increased effort to identify these patients in the healthcare system in time for proper pre-dialysis care including preparation for RRT is needed. Treatment of advanced chronic kidney disease (CKD) includes renoprotective therapy, prevention of CKD-related complications and preparing for chronic renal replacement therapy (RRT). It is well-known that late referral of CKD patients to renal units is associated with several negative aspects such as increased mortality; although many studies are limited by a lack of data on the history of CKD progression in individuals before RRT start -12. HoweTo establish a strategy on earlier referral it is important to get information on patients referred late, including their renal disease progression and previous contacts to the health care system. The aim of the present study was to characterize late versus early CKD referrals, their contacts to the health care system before RRT start and consequences for the treatment. It was a nationwide study offering complete follow-up.The Danish population consisted of 5.3 million persons in 1999 increasing to 5.4 in 2006 . DenmarkThe study population consisted of all 5513 incident chronic RRT patients in 1999\u20132006 in Denmark, except patients from Greenland and the Faroe Islands or patients without residence permit. Cross-linkage between registries was made with the unique personal identification number assigned to all Danish citizens from birth or immigration.Information on date of chronic RRT start, modality, renal diagnosis and date of death were obtained from the Danish Nephrology Registry , where aInformation on courses in hospital was obtained from the National Patient Registry . This adInformation on contacts to general practice was obtained from the Danish National Health Service Registry. This administrative registry contains information on all contacts to and services given by general practitioners since 1990 .Information on medical treatment was obtained from the Register of Medicinal Product Statistics of the Danish Medicines Agency. The registry contains information on prescribed and sold drugs since 1994 excluding in-hospital drug use [Information on all patients listed for renal transplantation since 1995 was obtained from the Scandia transplant database .Individual level information on income, highest level of completed education, immigration and ethnic origin was obtained from Statistics Denmark .Level of renal function before RRT start was evaluated in the subgroup of patients with residence in Copenhagen Municipality 2001\u20136. Information on plasma creatinine was obtained from databases of the departments of clinical biochemistry in three of four hospitals in Copenhagen and the Laboratory of the General Practitioners in Copenhagen. Data from one hospital was lost with a local change of software. Not all laboratories used plasma creatinine measurement methods standardized or traceable to isotope dilution mass spectrometry (IDMS). Therefore we could not calculate valid estimated glomerular filtration rates with the MDRD  study foearly referral accordingly as courses starting more than 16\u2009weeks before. Patients who had had a previous course in a renal unit ending more than 2\u2009years before RRT start were classified as late referrals.Late referral of patients with CKD was defined as a course in a renal unit starting within 16\u2009weeks or less before RRT start and In and outpatient courses in any non-nephrology department were studied two years to 16\u2009weeks before RRT start. Some patients had contact to more than one specialty. Courses in cardiology and endocrinology were contained within contacts to departments of internal medicine and equally contacts to urology departments within contacts to any surgical department.Contacts to general practice were studied two years to 16\u2009weeks before RRT start and patients were classified as: i) patients seen in the clinic, ii) contacts to general practitioner by e-mail or telephone only or iii) no contact to general practitioner.Pre-RRT renal care was evaluated by medical treatment with renin-angiotensin system (RAS) blocking agents, the vitamin-D analogue alfacalcidol and NSAID judged by prescriptions filled within the period two years to 16\u2009weeks before RRT start. Values of defined daily dose (DDD) were made by the WHO based on an average dose per day for an adult using the drug for the main indication . A minimComorbidity was evaluated within 2 years before RRT start by ICD-10 diagnose of in and for cancer also outpatient hospital course: i) acute myocardial infarction; I22-22, ii) cerebrovascular disease: I60-I64, iii) cancer (excluding non-melanoma skin cancers): C00-43 and C45-C99 and iiii) bacteraemia: A41-42. Furthermore mean number of inpatient hospital-days and number of visits in general practice within 2 years before RRT start was used as a measure of comobidity.Income was defined retrospectively as total income in the year 5\u2009years before start of RRT, corrected for inflation according to the price index in Statistics Denmark and grouped into low -, medium- and high corresponding to the level of approximate tertiles in the Danish 2006 population aged 30 to 69\u2009years.Patients were divided into 3 groups according to the highest level of completed education: i) primary school, ii) high school and skilled craftsmen and iii) persons with university degrees, nurses, librarians, school teachers etc.Ethnic origin was defined according to the patients\u2019 and their parents\u2019 country of birth and citizenship . Origin Details on definitions of education, income and ethnic origin are described elsewhere .Chi-squared, Fisher\u2019s exact and Wilcoxon signed rank sum test were used where appropriate. Logistic regression was used to compare age, sex, income, education and renal diagnosis in late referrals versus early referrals. Likelihood ratio test for interaction was made for confounder and exposure variables: age, sex, income, education, renal diagnosis and referral. Type 3 test was used to test the effect of income and education. Cox proportional hazards models, with time to death or renal transplantation waiting list status as outcome variables, were used to estimate the relative risk of mortality or waiting list status within 365\u2009days in late referrals versus early referrals. Adjustment was made for differences in age, sex, renal diagnoses, comorbidity and emigration. The proportional hazards assumption was met. All variables were kept in the models regardless of significance level. Analyses were performed using SAS version 9.2, SAS Institute Inc.The study was approved by the Danish Data Protection Agency. Data was anonymised to ensure privacy of the involved patients.Patients from 5 of 15 renal units were excluded because of non-specific classification of hospital departments to the NPR. These included 886 patients (16%) of the total 5513 incident RRT patients. A total of 86 patients (2%) were excluded because of renal diagnoses indicating irreversible acute renal failure: haemolytic uremic syndrome and acute tubular necrosis or age less than one year. Also, 46 patients (1%) who immigrated within the 2\u2009years before RRT start were excluded. Basic characteristics of the patients included and excluded regarding sex, age and renal diagnoses were similar. The remaining cohort was 4495 patients.In a total of 4495 patients, 1727 (38%) were referred late to a renal unit before RRT start and 806 patients (18%) very late, within 1\u2009week  for late referral was 1.29 in patients aged \u226570\u2009years compared to <70\u2009years (P\u2009<\u2009.001)  had had a course in a non-nephrology department within 2\u2009years to 16\u2009weeks before RRT start Table\u2009. These iPrescriptions of alfacalcidol or RAS blocking agents were filled by fewer late compared to early referrals Table\u2009. While tIn total, 314 (18%) late compared to 897 (32%) early referrals started RRT with peritoneal dialysis Table\u2009. A lowerA total of 435 (25%) in late referrals died within one year after RRT start compared to 412 (15%) in early referrals (P\u2009<\u2009.001). Mortality within 1\u2009year also differed with a hazard ratio of 1.55 (95% CI 1.35\u20131.78) in late compared to early referrals when adjusted for differences of age, sex, emigration, comorbidity and renal diagnoses.In a total of 370 patients, 114 (31% CI 95% 26\u201336%) late referrals, with residence in Copenhagen Municipality commenced RRT in 2001\u20136. In 33 (29% CI 95% 24\u201334%) of late and 206 (80% CI 95% 76\u201384%) of early referrals plasma creatinine was >150% of upper reference limit 1\u20132\u2009years before RRT start (P\u2009<\u2009.001). In 34 (30% CI 95% 25\u201335%) of late and 22 (9% CI 95% 6\u201312%) of early referrals plasma creatinine was \u2264150% of upper reference limit (P\u2009<\u2009.001). While, in 47 (41% CI 95% 36\u201346%) of late and 28 (11% CI 95% 25\u201331) of early referrals we have no information on plasma creatinine 1\u20132\u2009years before RRT start (P\u2009<\u2009.001).The present Danish nationwide study, including 4495 incident RRT patients in the period 1999\u20132006 shows that 38% of the patients had been referred to a renal unit within 16\u2009weeks before RRT start. This is in accordance with previous reports in smaller studies reporting late referral in 22\u201340% of incident RRT patients when defined as a nephrology course starting\u2009\u2264\u20094\u2009months before RRT start ,9,10,12.The reasons for late referral of well-known patients are not clarified. One explanation might be fast progression of renal disease. Most studies on late referral are limited by lack of data on the history of CKD in individuals before RRT start. In the present study, a subgroup analysis in 370 patients showed that 30% of late referrals had plasma creatinine \u2264150% of upper reference limit within 1\u20132\u2009years before RRT start. A European and an American study have found that general practitioners were less responsible for late referral than non-nephrology medical specialists ,26.The quality of pre-RRT care was evaluated by the use of specific drugs to prevent CKD progression and modify complications as well as the use of a common nephrotoxic agent. The frequency of peritoneal dialysis as primary RRT modality, arteriovenous vascular access in haemodialysis patients and renal transplantation waiting-list status also reflect pre-RRT care. It was found that fewer late referrals received RAS blocking agents or the D-vitamin analogue alfacalcidol. The use of short-term NSAID was the same in both referral groups but long-term use was a little higher in late referrals probably reflecting that both groups had significant proportions of patients with chronic pain conditions. Furthermore, late referrals less often commenced RRT with peritoneal dialysis, had an arteriovenous fistula or were on the renal transplantation waiting-list. Previous studies have shown similar results -5,7,9,12The late referred patients were characterized by older age and more comorbidity. This has also been reported in previous studies ,7,9. AcuIn accordance with our findings, previous studies have observed more cancer and cardiovascular disease in late compared to early referrals ,10,25,26As reported in other studies ,12,25, wIncome and education was similar in early and late referrals in our study like in a French study . GeneralIn accordance with our findings, one-year mortality adjusted for comorbidity was higher in late compared to early referrals ,12. ThisThe nationwide administrative and clinical registries used in this study offer complete sources of data as all citizens have free access to the tax-financed health care system. The validity of data including the date of RRT start in and completeness of the Danish Nephrology Registry is good . Also, iDifferent definitions of late referral have been used in the literature: 1, 3, 4 or 6\u2009month or level of serum creatinine ,10,12,25We only had information on plasma creatinine before RRT start in a subgroup of patients. Thus, the generalisability of the results depends on similarities of CKD progression in these patients compared to other patients. Late nephrology referral is of course unavoidable for patients with irreversible acute renal failure or rapidly progressive renal failure. Irreversible acute renal failure has been reported to constitute 11\u201338% of late referrals .The retrospective design of this study only sheds light on the courses of patients starting active treatment of renal failure and not the ones receiving conservative treatment as we have no information on non-referrals. A prospective study, identifying persons with CKD by plasma creatinine, would provide additional information.Late nephrology referrals were well-known to the healthcare system before referral to renal units and more often had near normal levels of plasma creatinine within two years before RRT start. They infrequently received available treatment or optimal first RRT modality. More attention on referral of CKD patients from general practice and non-nephrology hospital departments to renal units is recommended.No competing interests to declare.AK, MM and KH contributed to conception, design and acquisition of data as well as analysis and interpretation of data. KH drafted the manuscript. AK, MM and KH were all involved in revising the manuscript critically for important intellectual content and have given final approval of the version to be published.The pre-publication history for this paper can be accessed here:http://www.biomedcentral.com/1471-2369/13/108/prepub"}
+{"text": "Gentamicin nephrotoxicity is one of the most common causes of acute kidney injury (AKI). Hypoxia-inducible factor (HIF) is effective in protecting the kidney from ischemic and toxic injury. Increased expression of HIF-1\u03b1 mRNA has been reported in rats with gentamicin-induced renal injury. We hypothesizd that we could study the role of HIF in gentamicin-induced AKI by modulating HIF activity. In this study, we investigated whether HIF activation had protective effects on gentamicin-induced renal tubule cell injury. Gentamicin-induced AKI was established in male Sprague-Dawley rats. Cobalt was continuously infused into the rats to activate HIF. HK-2 cells were pre-treated with cobalt or dimethyloxalylglycine (DMOG) to activate HIF and were then exposed to gentamicin. Cobalt or DMOG significantly increased HIF-1\u03b1 expression in rat kidneys and HK-2 cells. In HK-2 cells, HIF inhibited gentamicin-induced reactive oxygen species (ROS) formation. HIF also protected these cells from apoptosis by reducing caspase-3 activity and the amount of cleaved caspase-3, and -9 proteins. Increased expression of HIF-1\u03b1 reduced the number of gentamicin-induced apoptotic cells in rat kidneys and HK-2 cells. HIF activation improved the creatinine clearance and proteinuria in gentamicin-induced AKI. HIF activation also ameliorated the extent of histologic injury and reduced macrophage infiltration into the tubulointerstitium. In gentamicin-induced AKI, the activation of HIF by cobalt or DMOG attenuated renal dysfunction, proteinuria, and structural damage through a reduction of oxidative stress, inflammation, and apoptosis in renal tubular epithelial cells. Gentamicin is an aminoglycoside antibiotic that is widely used in the treatment of gram-negative bacterial infections. However, its clinical use has been limited because gentamicin-induced acute kidney injury (AKI) occurs in approximately 20% of patients Hypoxia-inducible factor (HIF), a heterodimeric transcription factor composed of an oxygen-sensitive \u03b1 subunit and a constitutively expressed \u03b2 subunit, is an important regulatory factor in the defense mechanisms against hypoxia in vitro and in vivo, whether HIF has protective effects on renal tubule cell injuries induced by gentamicin, and we investigated the mechanism of such an effect.The up-regulation of HIF in various kidney disease models, including ischemic or nephrotoxic acute kidney injury and chronic kidney disease All animal procedures were approved by Institutional Animal Care and Use Committee of Medical Science Research Institute, Seoul National University Bundang Hospital (BA 0810-033/037-01).We cultured HK-2 cells (ATCC CRL-2190), which are proximal tubular epithelial cells derived from normal human kidney tissue, using Renal Epithelial Basal Medium  with the recommended supplements included in the REGM Singlequot Bulletkit. The cells were fed two to three times weekly and subcultivated via trypsinization when near confluence. HK-2 cells between passages 10 and 25 were used for these experiments.The cells were divided into four groups; 1) control cells, 2) gentamicin-treated cells, 3) gentamicin-treated cells with cobalt pre-treatment, and 4) gentamicin-treated cells with DMOG pre-treatment. Before the experiments, the cells were incubated in basal medium in the absence of supplements for 24 h. Gentamicin  and cobalt  were dissolved in 0.9% saline solution. DMOG  was dissolved in dimethyl sulfoxide  solution. On the day of the experiment, the cells were pre-treated with 150 \u00b5M of cobalt or 1 mM of DMOG for 24 h to activate HIF-1\u03b1. Previous studies demonstrated that no adverse effects were observed at these doses of cobalt or DMOG in the cells Gentamicin-mediated apoptosis in HK-2 cells was detected by enzymatically labeling DNA strand breaks using TUNEL staining. TUNEL staining was performed with a Cell Death Detection kit . To reveal the total nuclei, the same slides were stained with 4\u2032,6\u2032-diamidino-2-phenyindole (DAPI) in phosphate-buffered saline. Cells with apoptotic nuclei were counted in at least 10 different fields and were expressed as the percentage of the total cells counted. Additionally, TUNEL staining was performed on the kidney tissue of experimental animals using the same kit. Cells with apoptotic nuclei were counted in more than 20 consecutive fields under\u00d7200 magnification.A caspase-3 activity assay was performed using of the Caspase-3/CPP32 Fluorometric Assay Kit . The cells were incubated in cell lysis buffer and centrifuged at 14,000 rpm, and the supernatants were incubated with DEVD-AFC (specific substrate for caspase-3) at 37\u00b0C for 1 h. The activity was assayed using a fluorometer.Oxidation-sensitive DCFH-DA dye  was used to determine intracellular production of ROS. The cells were loaded with DCFH-DA at a final concentration of 10 \u00b5M and were incubated at 37\u00b0C for 30 min. Next, the cells were washed with phosphate-buffered saline, removed from the dishes by scraping, and measured for fluorescence intensity. Fluorescence was measured with a fluorescence spectrophotometer at 490 nm of excitation and 526 nm of emission.HK-2 cell lysate proteins were applied to each lane and analyzed by Western blot. Antibodies to HIF-1\u03b1 , \u03b2-actin , caspase-3 , and caspase-9  were used for assay. Incubation with peroxidase-conjugated anti-rabbit or anti-goat IgG secondary antibodies  was followed by band visualization using enhanced chemiluminescence . The band densities were quantified by densitometry .n\u200a=\u200a17) were randomly assigned to three groups: the control, gentamicin + vehicle (GM + VEH), and gentamicin + cobalt (GM + Co) groups. All of the rats were anesthetized with enflurane , and osmotic minipumps  were subcutaneously implanted to deliver 10 mg/kg/day of cobalt (GM + Co group) or vehicle (control and GM + VEH group) for 7 days. This dose of cobalt was confirmed not to be shown any adverse effects on the rats Male Sprague-Dawley rats , weighing approximately 220 g, were used. The rats . The BUN and creatinine levels in the serum and urine were measured using an automatic analyzer . The creatinine clearance was calculated using a standard formula and was adjusted for body weight.Tissue for light microscopy and immunoperoxidase staining was fixed in formalin and embedded in paraffin. Three-micrometer sections were stained with hematoxylin and eosin (H&E). Indirect immunoperoxidase staining with anti-ED-1 antibody  was performed, as described previously et al. All analyses were performed in a blind manner. The sections were examined and assigned morphological injury scores, as reported by Houghton Tissue preparation and semiquantitative immunoblotting were performed as described previously Real-time PCR was performed to evaluate the mRNA expression of vascular endothelial growth factor (VEGF) in the kidneys. Real-time PCR was performed using the Applied Biosystems 7500 Fast Real-Time PCR System , as described previously P<0.05.All of the data are presented as means\u00b1s.d. The statistical analysis was performed using the Mann-Whitney U-test and the Kruskal-Wallis test with SPSS software . Statistical significance was indicated by Cobalt and DMOG are PHD inhibitors and can therefore activate HIF. To activate HIF-1\u03b1 in the human renal proximal tubule cell HK-2, we treated HK-2 cells with cobalt or DMOG. There were no changes in the amount of HIF-1\u03b1 protein between the control and gentamicin-treated cells . HoweverTo determine whether gentamicin-induced apoptosis occurred in HK-2 cells, we treated the cells with gentamicin and analyzed them with enzymatic labeling of DNA strand breaks using terminal deoxynucleotidyl transferase-mediated deoxyuridine triphosphate nick end-labeling (TUNEL). The number of apoptotic cells was markedly increased by treatment with gentamicin . We examNext, we investigated whether HIF activation prevented gentamicin-induced ROS formation because ROS are important mediators of gentamicin-induced apoptosis. The increases in intracellular ROS formation by gentamicin were revealed by fluorescence using 2\u2032,7\u2032-dichlorofluorescein (DCF). As shown in in vivo. The up-regulation of HIF-1\u03b1 proteins by cobalt infusion was demonstrated by western blotting of kidney nuclear homogenates. The band density corresponding to HIF-1\u03b1 was not affected by gentamicin treatment (0.91\u00b10.07-fold vs. the control), but it was significantly increased in the rats treated with cobalt (1.5\u00b10.06-fold vs. the control)  . Next, wcontrol) .P<0.05).in situ TUNEL assay. The scattered and bright nuclei stained by the TUNEL assay were easily detected in the kidneys of gentamicin-treated rats, yet the number of nuclei was significantly decreased in the kidneys of the gentamicin-cobalt-treated rats  et al. showed the elevation of HIF mRNA levels in the rats treated with 3 different doses of gentamicin Xu in vivo and in vitroOxidative stress plays an important role in the nephrotoxicity of gentamicin Treatment with gentamicin has been shown to involve renal inflammatory responses in experimental animals in vitro and in vivo. However, HIF activation using PHD inhibitors protected against this apoptosis. The connection among HIF, inflammation, and apoptosis needs to be elucidated. Cummins et al. reported that HIF activation by DMOG reduced the inflammation in a murine model of colitis due to the development of an anti-apoptotic phenotype Gentamicin treatment results in the apoptosis of tubular epithelial cells, both in experimental animals and in cultured cells in vivo experimental data using specific PHD inhibitors instead of cobalt. Second, we did not evaluate the effect of direct hypoxic preconditioning on the protection of renal tubule cells against gentamicin. However, carbon monoxide preconditioning and a PHD inhibitor showed comparable levels of HIF activation in an ischemia-reperfusion experiment Our study has some limitations. First, we did not provide additional In summary, the activation of HIF using PHD inhibitors attenuated renal dysfunction, proteinuria, and structural damage in an animal model of gentamicin-induced AKI. This beneficial effect of HIF activation occurred through a reduction of oxidative stress, inflammation, and apoptosis in renal tubular epithelial cells. Currently, HIF PHD inhibitors are in clinical trials for the treatment of anemia"}
+{"text": "Here we employed single isomorphous replacement with anomalous scattering (SIRAS) for phasing and demonstrate successful application to SFX de novo phasing. Only about 20,000 patterns in total were needed for SIRAS phasing while single wavelength anomalous dispersion (SAD) phasing was unsuccessful with more than 80,000 patterns of derivative crystals. We employed high energy X-rays from SACLA (12.6\u2009keV) to take advantage of the large anomalous enhancement near the LIII absorption edge of Hg, which is one of the most widely used heavy atoms for phasing in conventional protein crystallography. Hard XFEL is of benefit for de novo phasing in the use of routinely used heavy atoms and high resolution data collection.Serial femtosecond crystallography (SFX) with X-ray free electron lasers (XFELs) holds great potential for structure determination of challenging proteins that are not amenable to producing large well diffracting crystals. Efficient  Serial femtosecond crystallography (SFX) has provided molecular structures from micron-sized protein crystals at ambient temperature123et al. recently reported de novo phasing by the SAD method using SFX data of the tetragonal lysozyme crystals, collected at LCLS Phase determination is the central problem in protein crystallography. Single wavelength anomalous dispersion (SAD) is now the most commonly used experimental phasing methodde novo method for phasing.For SAD phasing, highly accurate intensity measurements are essential as this method utilizes weak anomalous differences . The SPring-8 Angstrom Compact free-electron Laser (SACLA) provides femtosecond X-ray pulses at such high photon energy to allow high resolution P212121 and show one Hg site per asymmetric unit, composed of 308 amino acid residues (de novo phasing method for SFX studies.We applied the SIRAS phasing method to obtain the structure of luciferin-regenerating enzyme (LRE)SFX experiments on the LRE crystals were performed at BL3 of SACLA. For the native crystals, 133,958 images were collected. Of these, 26,238 images (20%) were preselected based on diffraction intensity and 10,792 patterns (41%) were indexed (see Methods). The Hg-derivative crystals were prepared by soaking and diffraction data were collected at a wavelength of 0.984\u2009\u00c5 (12.6\u2009keV). Out of 583,291 collected images, we selected 298,061 (51%), from which 85,747 patterns (29%) were indexed.Diffraction patterns were processed using the CrystFEL software suiteWe have tested various combinations of numbers of native and derivative patterns for SIRAS phasing . Using 1all of 11.89% and CCweak of 9.42%. An isomorphous difference Patterson map also showed a significant peak corresponding to the position of the Hg atom at 8.1\u03c3 (Rwork\u2009=\u200922.3% and Rfree\u2009=\u200927.6%). After a few cycles of manual model rebuilding using CootRwork\u2009=\u200918.5%% and Rfree\u2009=\u200923.2% (Rwork of 20.2% and Rfree of 23.5%). In the anomalous difference Fourier map, two Hg sites with peak heights of 19.3\u03c3 and 3.52\u03c3 were identified near the Cys residue with occupancies of 0.66 and 0.16, respectively. The stereochemical qualities of the final refined model were analyzed using MolProbity in PHENIXSearches for the heavy atom substructure, phasing calculations and phase improvement were performed with the SHELX C, D, and E programs at 8.1\u03c3 . Using t at 8.1\u03c3 . Automat\u2009=\u200923.2% . The modde novo phasing, we repeated the SIRAS phasing protocol using different numbers of native and derivative patterns  between I and ano, of two randomly divided data sets by changing the number of diffraction patterns. This provides a measure for the quality of the anomalous signal with respect to the number of diffraction patterns. The analysis showed that the anomalous signals were very weak; CCano was \u22120.066 using 10,000 patterns and remained relatively low, at 0.038 even with ~85,000 patterns. This explains why SAD phasing was unsuccessful. For more accurate analysis of anomalous signals, we introduced a new correlation coefficient termed CCanoref, which measures the consistency between I(+)\u2009\u2212\u2009I(\u2212) and anoref values for the increased number of diffraction patterns confirms the presence and enhancement of the anomalous signals  at BL26B2 of SPring-8. Diffraction patterns were collected up to 1.7\u2009\u00c5 resolution by the oscillation method at room temperature. The SR data show a good agreement with the SFX data; the correlation coefficients for the majority of resolution shells to 2.0\u2009\u00c5 are around 0.95, supporting the good quality of the SFX data collected at SACLA  is beneficial because it enables high resolution data collection with the fixed detector dimensions.For the application of the SIRAS method it is necessary to prepare both native and isomorphous derivative crystals. SIRAS phasing employed here benefited from both good isomorphism between crystals and the availability of high resolution data. Although non-isomorphism could be an issue, there is a reasonable chance of successful phasing by collecting data from both native and derivative crystals. We believe that SIRAS is a practical alternative for A clear peak for a single Hg atom per asymmetric unit was observed in the anomalous difference Patterson map with 20,000 or more patterns  and SHELde novo phasing by SFX including SIRAS and SAD.We expect a better data processing algorithm than the Monte-Carlo integration to facilitate efficient structure determination. Recently new developments that employ the partiality correction and the post-refinement techniques are reported2223Photinus pyralis was cloned into pET15b (Novagen) expression vector between NdeI and BamHI sites to obtain pLRE-pET15, which enabled expression of LRE with a N-terminal cleavable 6His-tag.The open reading frame of LRE from Escherichia coli BL21(DE3) cells transformed with pLRE-pET15 plasmid were grown to an OD600 of 0.6 in 2 L TB medium  at 37\u2009\u00b0C with shaking at 180\u2009rpm. The protein expression of 6His-LRE was induced by adding IPTG to the culture to a final concentration of 0.2\u2009mM and the incubation were continued at 18\u2009\u00b0C for 16\u2009hours with shaking at 160\u2009rpm. A cell pellet of 25\u2009g (wet weight) was obtained from 1\u2009L TB medium at the end of the culture.g for 20\u2009min was incubated with 20\u2009mL cOmplete His-Tag Purification Resin (Roche) for 2\u2009hours with shaking. The resin bound with 6His-LRE was washed on an open column with 300\u2009mL buffer A and 6His-LRE was eluted with buffer A containing 300\u2009mM imidazole. The fractions containing 6His-LRE were pooled and the 6His-tag was cleaved by incubation with Thrombin (20U for 1\u2009mg of 6His-LRE) at 4\u2009\u00b0C overnight. Tag-cleaved LRE was dialyzed against buffer B  and concentrated to 27\u2009mg/mL. The yield of LRE was 100\u2009mg per 1\u2009L TB medium.Purification of LRE was performed either on ice or at 4\u2009\u00b0C. The cell pellet (50\u2009g) was suspended in 150\u2009mL buffer A  containing 1\u2009mM PMSF and the cOmplete Protease Inhibitor Cocktail (Roche) and lysed with an Emulsiflex-C3 high-pressure homogenizer (Avestin) and a Branson 250 sonicator. The clear lysate obtained from centrifugation at 25,000\u2009\u00d7\u20092) at ratios between 1:2 and 1:1.6 followed by incubation at 4\u2009\u00b0C overnight. Micro crystals were collected by centrifugation at 1,000\u2009\u00d7\u2009g for 5\u2009min and stored in the stock solution . The microseeding technique was carried out for the Hg-derivative crystals. Micro crystals containing Hg-derivative LRE were obtained by soaking native micro crystals in the stock solution containing 1\u2009mM HgO for 6 days and then back-soaked in the stock solution for 1\u2009hour. The micro crystals were mixed with a grease matrixMicro crystals for XFEL data collection were generated by mixing purified LRE solution  and precipitant solution  to form a sitting drop. The drop was then equilibrated over 600\u2009\u03bcL of the reservoir solution at 20\u2009\u00b0C. Hg-derivative crystals were obtained by soaking the native crystals in the stock solution containing 1\u2009mM HgO for 6 days and then back-soaked in the stock solution for 5 days. A single crystal in the stock solution was mixed with the greaseCrystals for the SR data collection were obtained by the sitting drop vapor diffusion method. 1\u2009e. The pulse duration was <10\u2009fs, and the repetition rate was 30\u2009Hz. The rod-shaped micro crystals with a width of 2\u20135\u2009\u03bcm and a length of 10\u201330\u2009\u03bcm were filtered using a mesh with pore size of 30\u2009\u03bcm then mixed with the grease\u03bcL/min and the inner diameter of the needle was 110\u2009\u03bcm. The diffraction patterns were collected using the multi-port CCD (MPCCD) detector with the short working distance (SWD) octal sensor arrangementThe SFX experiment was performed at BL3 of SACLA. Photon energy was tuned to 12.6\u2009keV (0.984\u2009\u00c5), at which energy Hg shows an anomalous scattering contribution \u03bcm Aluminum (36.36% transmittance at 12.6\u2009keV) and designed to cover reflections with lower resolution than 3.8\u2009\u00c5. Both absorber radius and center position were determined by inspecting diffraction images on the detector. Before Monte-Carlo integration, the integrated intensities and measurement errors of the spots in the absorber region were corrected by the theoretical transmission factor. The angular dependence was not taken into account.Prior to data processing by CrystFEL, images were discarded if the maximum value of low resolution area (~3.8\u2009\u00c5) did not exceed 5,000 ADU. Diffraction images were indexed and integrated by CrystFEL version 0.5.3a. Indexing was performed using DirAx version 1.16The initial phases were determined and improved by SHELXC, D, E  using the auto-tracing featureThe CC between the electron density map given by SHELXE and the map derived from the refined structure was calculated using phenix.get_cc_mtz_pdb\u03bcm3 and the dataset was collected using five irradiation points with step size of 35.7\u2009\u03bcm and beam size of 80\u2009\u00d7\u200990\u2009\u03bcm (FWHM). The total absorbed dose for each point (36 images) was 58.7\u2009kGy  on BL26B2, SPring-8  at room temperature. The crystal size was 200\u2009\u00d7\u2009400\u2009\u00d7\u200950\u2009Accession codes: The coordinates and experimental data have been deposited at the Protein Data Bank (PDB) with codes 5D9B (SFX native), 5D9C (SFX Hg derivative), 5D9D (SPring-8 Hg derivative). The raw diffraction images will be available at CXIDB (http://cxidb.org) with CXIDB ID 31.How to cite this article: Yamashita, K. et al. An isomorphous replacement method for efficient de novo phasing for serial femtosecond crystallography. Sci. Rep. 5, 14017; doi: 10.1038/srep14017 (2015)."}
+{"text": "Single-wavelength anomalous diffraction phasing using selenomethionine-derivatization and mercury-soaking techniques has been successfully applied to serial femtosecond crystallography with 13.0\u2005keV or 12.6\u2005keV X-rays produced at SACLA.High-energy X-rays are essential for  de novo structural determination of biomacromolecules.Serial femtosecond crystallography (SFX) using X-ray free-electron lasers (XFELs) holds enormous potential for the structure determination of proteins for which it is difficult to produce large and high-quality crystals. SFX has been applied to various systems, but rarely to proteins that have previously unknown structures. Consequently, the majority of previously obtained SFX structures have been solved by the molecular replacement method. To facilitate protein structure determination by SFX, it is essential to establish phasing methods that work efficiently for SFX. Here, selenomethionine derivatization and mercury soaking have been investigated for SFX experiments using the high-energy XFEL at the SPring-8 Angstrom Compact Free-Electron Laser (SACLA), Hyogo, Japan. Three successful cases are reported of single-wavelength anomalous diffraction (SAD) phasing using X-rays of less than 1\u2005\u00c5 wavelength with reasonable numbers of diffraction patterns . It is demonstrated that the combination of high-energy X-rays from an XFEL and commonly used heavy-atom incorporation techniques will enable routine  Construction of ACG  fused with a FLAG tag at its N-terminus was performed as described previously  in the presence of 0.05\u2005mg\u2005l\u22121 kanamycin (Wako). The transformed cells were cultured in LeMaster medium  supplemented with 5\u2005mg\u2005ml\u22121l-Se-methionine, 1% glucose, and KAO and MICHAYLUK vitamin solutions (Sigma\u2013Aldrich). Protein expression was induced by the addition of 0.5\u2005mM isopropyl \u03b2-d-1-thio\u00adgalacto\u00adpyranoside (IPTG) (Wako) at OD600 = 0.5\u20130.7, and the cells were further incubated overnight at 16\u00b0C. The harvested cells were disrupted by sonication (Tomy Seiko) and the insoluble fraction was removed by centrifugation. The recombinant stem domain was purified by glutathione-Sepharose 4B affinity chromatography  and the GST tag was removed with PreScission protease  on the column. The sample was passed through Q Sepharose  and loaded onto a Superdex75 10/300GL  column equilibrated with 10\u2005mM HEPES\u2013NaOH (pH 7.0), 100\u2005mM NaCl and 1\u2005mM DTT. The recombinant ACG was purified by \u03b1-lactose-agarose affinity chromatography (Sigma\u2013Aldrich). ACG protein was eluted by 0.2\u2005M lactose from the column. The eluent was diluted by 0.1\u2005M HEPES\u2013NaOH (pH 7.5) and passed through Q Sepharose, then loaded onto a Superdex200 10/300GL  column equilibrated with 10\u2005mM HEPES\u2013NaOH (pH 7.0), 100\u2005mM NaCl and 1\u2005mM DTT. The purified samples were concentrated to 15\u201330\u2005mg\u2005ml\u22121, frozen in liquid nitrogen and stored at \u221280\u00b0C.The stem domain of human POMGnT1 (92\u2013250) (UniProt ID Q8WZA1) was subcloned into pGEX-6P-1  and expressed in 2.2.d-manno\u00adpyranoside and ACG with blood type A tetraose type 2 (ELICITYL) were obtained by the hanging-drop vapor diffusion method at 20\u00b0C. The reservoir solution conditions and the crystal structures have been described previously  and 16\u201318% PEG 4000. The conditions for ACG were 26\u201332% PEG 1500.Large crystals of Stem with 4-nitrophenyl \u03b2-et\u00a0al., 2016g, and the supernatant was recovered as a seed solution. Before crystallization, 5\u2005mM 4-nitrophenyl \u03b2-d-manno\u00adpyranoside and 2.5\u2005mM blood type A tetraose type 2 were mixed with Stem and ACG, respectively. In a 0.7\u2005ml tube, 100\u2005\u00b5l of 10\u201315\u2005mg\u2005ml\u22121 protein solution was mixed with 100\u2005\u00b5l of 16\u201318% PEG 4000 (for Stem) or 32% PEG 1500 (for ACG), and then 2\u2005\u00b5l of the seed solution was added. The tube was rotated on an RT-50 rotator at 50\u2005rpm for 1\u20132\u2005d at 20\u00b0C. The microcrystal solution was filtered through a 30\u2005\u00b5m CellTrics filter (Chiyoda Science) and adjusted to a number density of approximately 2\u20136 \u00d7 106\u2005crystals\u2005ml\u22121.Crystals with a diameter of 200\u2013300\u2005\u00b5m appeared within one week. Microcrystals for SFX were prepared by the rotational seeding crystallization technique , 10% MPD, 0.2\u2005M MgCl2, 0.1\u2005M NaCl and 5% glycerol.Preparation of LRE-Hg crystals was performed as described previously  before data collection , respectively. The total data collection times were approximately 1, 5.5 and 2.5+17\u2005h, respectively. The anomalous scattering contributions The microcrystal suspension was concentrated by centrifugation for 5\u201310\u2005s at 20002.5.CrystFEL, images were filtered through Cheetah  in each pattern was extended by 1.8\u2005nm\u22121 (Stem-Se), 1.5\u2005nm\u22121 (ACG-Se) or 1.2\u2005nm\u22121 (LRE-Hg) using the --push-res option. In the test of the number of patterns required for SAD phasing, the first patterns in the list were successively merged without any reordering or selection of patterns.Integrated intensities on each pattern were merged using The SACLA High-Performance Computing (HPC) system was used for computation. Up to 16\u2005nodes were used simultaneously, each of which consisted of two Intel Xeon X5690 processors operating at 3.47\u2005GHz (12\u2005threads) and 24\u2005GB memory, and it took 1\u20136\u2005h to process the data for each case.2.6.SHELXC (Version 2013/2), SHELXD (Version 2013/1) and SHELXE (Version 2016/1) with the auto-tracing feature , 2.0 (ACG-Se) and 2.1\u2005\u00c5 (LRE-Hg), which were decided by SHELXC. Substructure optimization was not performed in SHELXE. Initial model building with iterative refinement by REFMAC .The initial phases were determined and improved using 3.3.1.et\u00a0al., 2016P21212. Diffraction data from SeMet-Stem were collected at a wavelength of 0.954\u2005\u00c5 (13.0\u2005keV). There are two monomers in the asymmetric unit and each polypeptide consists of 164 amino acid residues, of which three methionine residues were replaced with SeMet (Bijvoet ratio \u2243 3.7%). Out of 91\u2005437 collected images, 35\u2005295 (38.6%) were selected using the Cheetah pipeline adapted for SACLA   when the correct solution was attained . Data collection, phasing and refinement statistics for the minimum set of patterns and for all patterns are summarized in Table S2 in the supporting information.We tested various numbers of patterns in SAD phasing using a custom-made script. The script first ran ed Fig. 1. At leasSHELXD as CCall of 9.21% and CCweak of 5.42%. The CC values were weighted by the estimated standard deviation of observations, which probably contributed to their small values . When the correct hand was used in SHELXE, a mean FOM of 0.649 was obtained, and 285 residues were modeled with CC = 42.5%. The electron-density map for the correct hand was readily interpretable . After a few cycles of manual model rebuilding using Coot and automated refinement using phenix.refine, the refinement converged with residuals Rwork = 17.04% and Rfree = 20.67%. In the anomalous difference Fourier map, six Se sites with peak heights of 20.6\u03c3, 19.4\u03c3, 18.0\u03c3, 18.0\u03c3, 11.2\u03c3 and 6.1\u03c3 were identified . Anomalous difference Patterson maps of 13\u2005000 and 26\u2005583 patterns are shown in Fig. S7 in the supporting information.From 13\u2005000 patterns, we identified the positions of three Se atoms in the asymmetric unit using le Fig. 2. Automat3.2.Agrocybe cylindracea galectin)  is higher than the Laue symmetry (6/m), there was a need to resolve the indexing ambiguity. The lower Bijvoet ratio and indexing ambiguity complicate the structure determination.SeMet-labeled ACG . The electron-density map from 60\u2005000 patterns was readily interpretable . The correctness of the indexing ambiguity resolution was confirmed by comparison with the refined model . Data collection, phasing and refinement statistics for the minimum set of patterns and for all patterns are summarized in Table S3 in the supporting information.We tested various numbers of patterns in the SAD phasing in the same way. At least 60\u2005000 patterns (a mean multiplicity of 443.4 at 1.5\u2005\u00c5 resolution) were required for SAD phase determination Fig. 1. The locle Fig. 3. In the Fmodel of the refined structure (1.4%) was three times lower than that of Stem-Se  were discarded. Prediction refinement and the use of partialator in CrystFEL Version 0.6.1, which were not available in the previously used CrystFEL (Version 0.5.3a), considerably improved the data quality over the entire resolution range .The intensities were merged in the same way using supporting information). The electron-density map from 11\u2005000 patterns was readily interpretable . The refined structure was consistent with the structure solved by SIRAS phasing  were required for SAD phase determination Fig. 1. The locle Fig. 4. In the 3.4.Cheetah pipeline adapted for SACLA .In SAD phasing, the phase improvement technique is essential, where high-resolution reflections play an important role, while low-resolution reflections contain a larger anomalous signal that enables substructure determination. To investigate how the high-resolution cutoff affected the phasing, we collected an additional data set for LRE-Hg. Out of 1\u2005268\u2005105 collected images, 542\u2005592 (42.8%) were selected using the 3.5.et\u00a0al., 2010supporting information).In the Monte Carlo integration method, larger numbers of observations yield higher accuracy   compared with the values in our cases (2.2\u20134.2%). Thus, CCano may not be a good quality indicator for SAD phasing with SFX data, which has large fluctuations.CCsupporting information), unlike conventional crystallography where, generally, reflections at lower resolution have higher data quality. This could be a reason why enormous numbers of patterns were required for SAD phasing of low-resolution data. Further investigation including other SFX cases would be required.In all cases of this study, the anomalous data quality of the low-resolution reflections was limited and hit a peak at \u223c2.5\u2005\u00c5 for each case  and perform SAD phasing with 11\u2005000\u201360\u2005000 indexed patterns.et\u00a0al., 2014et\u00a0al., 2015et\u00a0al., 2015et\u00a0al., 2015cppxfel , 5xfd (ACG-Se 60\u2005000 patterns) and 5xfe (LRE-Hg 11\u2005000 patterns). The raw diffraction images for LRE-Hg are available at CXIDB (http://cxidb.org) with CXIDB ID 31. Those of Stem-Se and ACG-Se have been deposited with CXIDB ID 61 and ID 62, respectively.The coordinates and experimental data have been deposited in the Protein Data Bank (PDB) with codes 6.et al. (2002et al. (2002The following references are cited in the Supporting Information for this article: Adams  al. 2002; Grosse- al. 2002; Karplus al. 2002.10.1107/S2052252517008557/lz5015sup1.pdfAdditional figures and tables. DOI: Stem-Se, 5xfcPDB reference: ACG-Se, 5xfdPDB reference: LRE-Hg, 5xfePDB reference: https://doi.org/10.11577/1236753Raw diffraction images for LRE-Hg. URL: https://doi.org/10.11577/1365655Raw diffraction images for Stem-Se. URL: https://doi.org/10.11577/1365656Raw diffraction images for ACG-Se. URL:"}
+{"text": "Extracellular vesicles (EVs) are important in the intercellular communication of the central nervous system, and their release is increased during neuroinflammation. Our previous data demonstrated an increased release of EVs during HIV-1 infection and immune activation in glial cells. However, the molecular mechanism by which infection and inflammation increase EV release remains unknown. In the current study, we investigated the role of glutaminase 1 (GLS1)-mediated glutaminolysis and the production of a key metabolic intermediate \u03b1-ketoglutarate on EV release.Human monocyte-derived macrophage primary cultures and a BV2 microglia cell line were used to represent the innate immune cells in the CNS. Transmission electron microscopy, nanoparticle tracking analysis, and Western blots were used to determine the EV regulation. GLS1 overexpression was performed using an adenovirus vector in vitro and transgenic mouse models in vivo. Data were evaluated statistically by ANOVA, followed by the Bonferroni post-test for paired observations.Our data revealed an increased release of EVs in GLS1-overexpressing HeLa cells. In HIV-1-infected macrophages and immune-activated microglia BV2 cells, treatment with bis-2-ethyl sulfide (BPTES) or CB839, two specific GLS inhibitors, significantly decreased EV release, suggesting a critical role of GLS1 in EV release. Furthermore, addition of \u03b1-ketoglutarate or ceramide rescued EV release during BPTES treatment, implicating \u03b1-ketoglutarate and ceramide as critical downstream effectors for GLS inhibitors. These findings were further corroborated with the investigation of brain tissues in GLS1-transgenic mice. The EV levels were significantly higher in GLS1 transgenic mice than those in control mice, suggesting that GLS1 increases EV release in vivo.These findings suggest that GLS1-mediated glutaminolysis and its downstream production of \u03b1-ketoglutarate are essential in regulating EV release during HIV-1 infection and immune activation. These new mechanistic regulations may help understand how glutamine metabolism shapes EV biogenesis and release during neuroinflammation.The online version of this article (10.1186/s12974-018-1120-x) contains supplementary material, which is available to authorized users. Extracellular vesicles (EVs) are secretory vesicles budded from the plasma membrane of a variety of cells. EVs range from 50\u00a0nm to 1\u00a0mm and differ in their\u00a0origins, either from direct fusion with plasma membrane or intracellular multivesicular bodies. EVs have been detected at an elevated level in the cerebral spinal fluid in patients with mild to severe Alzheimer\u2019s disease, Parkinson\u2019s disease, prion disease, and amyotrophic lateral sclerosis . ProteinGlutamine is the most abundant amino acid in the plasma, and the metabolism of glutamine involves hydrolysis to glutamate by mitochondrial enzyme glutaminase 1 (GLS1). Subsequently, glutamate can be excreted or can be further metabolized to \u03b1-ketoglutarate. Our previous studies uncovered a pathogenic role of glutaminase (GLS) in neuroinflammation and neuronal injury. There are two major types of GLS identified in mammals, the \u201ckidney-type\u201d glutaminase (GLS1) and \u201cliver-type\u201d glutaminase. GLS1 is the predominant glutamine-utilizing enzyme in the central nervous system (CNS), where \u201cliver-type\u201d glutaminase is expressed at a lower level . GLS1 isGLS1 has been identified as an important metabolic factor controlling EV release from astrocytes during neuroinflammation . HoweverTo further study the functional impacts of GLS1 on EV release, we constructed adenovirus vectors that overexpressed KGA or GAC to mimic the upregulation of these isoforms during HIV-1 infection. The extracellular levels of glutamate increased significantly in both KGA- and GAC-overexpressing HeLa cells at the multiplicities of infection (MOI) of 200 compared with those in uninfected or vector-treated cells  treatment. After overnight treatment, the levels of extracellular glutamate were increased with the addition of glutamine in a dose-dependent manner Fig.\u00a0, b. To dTo further investigate whether GLS1-mediated glutamine metabolism is crucial for EV release in HIV-1-infected macrophages and immune-activated microglia, we used BPTES, a potent GLS1 inhibitor . Human mTo investigate GLS1-mediated glutamine metabolism in immune-activated microglia, we used BPTES and CB839, both of which are potent GLS1 inhibitors . BPTES oGLS1-mediated glutamine metabolism produces glutamate and subsequently \u03b1-ketoglutarate (\u03b1-KG). To determine whether \u03b1-KG is required for EV biogenesis and release, 1\u00a0mM of \u03b1-KG was added to LPS-stimulated BV2 cells with GLS1 inhibitors. Treatment with BPTES and CB839 significantly reduced GLS1 activity in the presence of 1\u00a0mM \u03b1-KG Fig.\u00a0, confirm6 ceramide  greatly exceed the quantity of viral particles (~\u2009106/ml) in the supernatant. Therefore, we conclude that the particles detected by the NanoSight are predominantly EVs, including exosomes and microvesicles.Our characterizations of EVs involve the determination of EV markers in Western blots, EV size/concentrations in well-established NanoSight, and the morphological examination through negative staining TEM. Notably, the size of EVs remains the same throughout all the studies as determined by NanoSight analysis, indicating that the regulation of the EVs during HIV-1 infection and immune activation of macrophages/microglia are more specifically on the number and contents. EVs are known to include exosomes, microvesicles, and apoptotic bodies according to their cellular origin. In our studies, there is little evidence of apoptotic bodies in the EVs since the size of EVs was overwhelmingly smaller than 300\u00a0nm, whereas typical apoptotic bodies are more than 500\u00a0nm. Furthermore, it is known that EV isolation contains virions, and HIV-1 virions are around 145\u00a0nm , which mPreviously, we reported that using GW4869 could effectively inhibit the release of EVs in HIV-1-infected macrophages and LPS-treated microglia , 38\u201342. In summary, our studies suggest that GLS1-mediated glutamine metabolism is essential in regulating EV release during HIV-1 infection and immune activation. GLS1 regulates EV release through its key downstream products \u03b1-ketoglutarate and ceramide. GLS1 overexpression in the brain leads to increased levels of EVs in vivo. These new mechanistic regulations may help understand how glutamine metabolism shapes EV release during infection and inflammation. Targeting glutamine/a-KG pathway would be an attractive strategy to regulate EV release.MDM were used in full compliance with the University of Nebraska Medical Center and National Institutes of Health ethical guidelines, with the Institutional Review Board (IRB) #: 162-93-FB. We have the informed written consent from all participants involved in this study. All mice were housed and bred in the Comparative Medicine Animal Facilities at the University of Nebraska Medical Center. All procedures were conducted in accordance with the protocol (11-018-04) approved by the Institutional Animal Care and Use Committee at the University of Nebraska Medical Center.ADA strain was used to infect the macrophages and microglia at a multiplicity of infection (MOI) of 0.1 and 0.5, respectively. After 24\u00a0h, the culture medium was changed to remove any remnant virus. Seven days after HIV-1-infection, the culture medium was changed to glutamine-free neurobasal medium for 24\u00a0h, and supernatants were collected for subsequent HPLC or Western blot analysis. HeLa and BV2 cell lines were obtained from ATCC, and both cell lines were grown in DMEM with 10% fetal bovine serum and antibiotics. LPS was used to immune activate BV2 cells for 24\u00a0h, and supernatants were collected for HPLC and Western blot analysis. Bis-2-ethyl sulfide (BPTES) and CB839  were used in HIV-1-infected macrophages or LPS-treated microglia prior to EV isolation. \u03b1-Ketoglutarate  and C6 ceramide  were also used to manipulate the metabolic intermediates in HIV-1-infected macrophages or LPS-treated microglia. All experiments involving human cell samples are approved by the\u00a0Institutional Review Board at the University of Nebraska Medical Center.Human peripheral blood-derived mononuclear cells were isolated through leukopheresis from healthy donors. Human macrophages were differentiated in Dulbecco\u2019s modified Eagle\u2019s media (DMEM)  with 10% human serum, 50\u00a0\u03bcg/ml gentamycin, 10\u00a0\u03bcg/ml ciprofloxacin (Sigma), and 1000\u00a0U/ml recombinant human macrophage colony-stimulating factor (MCSF) for 7\u00a0days. Human fetal microglial cells were obtained from fetal brain tissue-derived microglia-astrocytes mixed cultures as previously described . The HIVReplication-defective adenovirus vectors expressing human KGA and GAC were generated using RAPAd\u00ae CMV Adenoviral Expression System . Generation of the full-length human KGA and GAC constructs was described in our prior publication . Adenovig for 10\u00a0min to remove free cells, at 3000\u00d7g for 20\u00a0min to remove cellular debris, and then 10,000\u00d7g for 30\u00a0min to remove free organelles. Lastly, EVs were collected by ultracentrifugation at 100,000\u00d7g for 2\u00a0h at 4\u00a0\u00b0C. To prepare EVs for Western blotting, the EV pellets were lysed in M-PER mammalian protein extraction reagent . For negative staining, EVs were fixed in 2% glutaraldehyde and 2% paraformaldehyde. For glutaminase activity assay and neurotoxicity, the EVs were resuspended in 1\u00a0ml of glutamine-free neurobasal medium.EVs were isolated from the supernatants of GLS1-overexpressing cells, HIV-1-infected macrophages, and LPS-activated microglia through differential centrifugations. Briefly, the supernatants were first centrifuged at 300\u00d7g for 10\u00a0min and 3000\u00d7g for 20\u00a0min at 4\u00a0\u00b0C to get rid of cells, membranes, and debris. After the supernatants were filtered through 0.45-\u03bcm filter (Thermo Scientific), they were subjected to 10, 000\u00d7g for 30\u00a0min at 4\u00a0\u00b0C to eliminate organelle contaminations. The supernatants were further centrifuged at 100,000\u00d7g for 70\u00a0min at 4\u00a0\u00b0C to pellet EVs. The pellets were then resuspended in filtered PBS, or MPER lysate solution for NanoSight or Western blot. All the samples were ultracentrifuged in ultraclear polycarbonate tubes (Beckman Coulter) that have a volume of 13.2\u00a0ml. A Beckman Coulter ultracentrifuge  was used with a rotor type SW 41 Ti.EV isolations from the brains were carried out as described previously with modifications according to the protocol . The freEVs were fixed and then spread on the silicon monoxide and nitro-cellular film-coated copper grid. The droplets were removed with filter paper, air-dried at room temperature, and then subjected to transmission electron microscopy (TEM).A NanoSight NS 300  equipped with an sCMOS camera was utilized to analyze the size distribution and concentration of EVs. NanoSight utilizes NTA, which is a combination of light scattering and Brownian motion technology to measure the concentration and size and distribution of particles in the EV supernatants. After the whole process of EV isolation, the pellets were first resuspended in 100\u00a0\u03bcl of filtered PBS and then diluted 100 times. The conditions of the measurements include temperature of 25\u00a0\u00b0C; viscosity of 1\u00a0cP, 25\u00a0s per capture frame; and a measurement time of 60\u00a0s. All the conditions were kept the same among all the samples. The results indicate the mean sizes and concentration of at least three individual measurements.Protein concentrations were determined by Bradford protein assay. SDS PAGE separated proteins from the whole cell and EV lysates. Afterward, they were electrophoretically transferred to polyvinyldifluoridene membranes . The membranes were incubated overnight at 4\u00a0\u00b0C with polyclonal antibodies for KGA and GAC , tissue transglutaminase (tTG) , flotillin-2 , and \u03b2-actin (Sigma), followed by horseradish peroxidase-linked secondary anti-rabbit or anti-mouse secondary antibodies . Antigen-antibody complexes were visualized by Pierce ECL Western Blotting Substrate. For quantification of the data, films were scanned with a CanonScan 9950F scanner, and images were analyzed using the public domain NIH Image program .Highly concentrated whole cell lysates were collected from flasks and subjected to GLS activity assay using a two-step assay , 47. BriGlutamate levels were analyzed by RP-HPLC using an Agilent 1200 liquid chromatograph and fluorescence detector as previously described  with a fp value <\u20090.05. All experiments were performed with cells from at least three donors to account for any donor-specific differences. Assays were performed at least three times in triplicate or quadruplicate within each assay.Data are expressed as means\u2009\u00b1\u2009SD unless otherwise specified. Statistical analysis was performed using one-way analysis of variance (ANOVA), followed by the Bonferroni post-test for all paired observations unless otherwise specified. Significance was determined by a Additional file 1:Figures S1. Both KGA and GAC are successfully overexpressed by adenovirus in vitro. S2: EV release in HIV-1-infected macrophages is dependent on glutamine. S3: LPS, BPTES, and CB839 do not affect BV2 cell viability. (DOCX 6796\u00a0kb)"}
+{"text": "A prospective Drug Utilization Review (DUR) program has been implemented in Korea to improve the quality and safety of medication use.To evaluate the influence of the DUR program in reducing incidence of preventable adverse drug reactions (pADRs).This study was performed using administrative data from the Health Insurance Review and Assessment Service (HIRA). The claims data for all adult patients with adverse drug events (ADE)-related diagnoses from 2009 to 2014 were obtained. Incidence rates of first-time and repeat pADRs prior to and after DUR program implementation were evaluated. Quarterly trends in incidence rates of overall ADE, allergic reactions, and ADRs were analyzed.Data extraction covering the period from 2009 to 2014 led to the identification of 3,927,662 records. First-time pADR rates decreased gradually after implementation of the DUR program . The program had a similar influence on repeat pADR rates . The program did not decrease rates of first-time or repeat allergic reactions . In the cohort aged \u226465 years, first-time pADR rate reduction was significant . In contrast, first-time pADR rate was increased by 0.6% [-0.7\u20131.9] in patients \u226565 years.Implementation of the prospective DUR program effectively reduced the number of pADRs. In the future, to reduce non-preventable ADRs such as allergic reactions, provision of clinical information including allergy history should be added to the DUR program. An adverse drug event (ADE) is defined as \u201can injury resulting from medical intervention related to a drug\u201d . The terThe clinical and economic burdens of ADEs are significant. Thus, it is critical to minimize the potential consequences of ADEs. Although a large majority of medical errors and ADRs are preventable, numerous studies have reported that ADRs are associated with clinically significant morbidity and mortality, and are a serious threat to public health \u20135. A revTo reduce potential ADEs and their consequences, many types of quality assurance programs have been developed and introduced \u20138. In SoWe utilized the national health insurance claims database to evaluate the influence of the DUR program in reducing pADR incidence by quantitatively studying trends in ADE episodes leading people to seek medical care.The DUR program in Korea uses a concurrent process to improve the quality of medication use and health outcomes with information technology that creates a shared network between the healthcare providers and the computer server of the Health Insurance Review and Assessment Service (HIRA) since December 2010. It involves monitoring and reviewing drug use to evaluate appropriateness based on best medication use criteria. The program implemented interventions to improve medication use and overall patient care. It monitors 33,550 drug products and 2,070 ingredients for duplicate prescription, drug-drug interaction, contraindication due to pregnancy and/or age, potential inappropriate medication for the elderly, and dose and duration of drug regimen [ADE-related diagnosis codes were adapted from a study conducted by Stausberg and colleagues . In thisThis was a population-based retrospective cohort study using administrative data from the HIRA claims database. The database consists of information on the entire health care system used by approximately 50 million Koreans, and covered by National Health Insurance (NHI). The NHI program is a universal health care system that allows beneficiaries to access any medical facilities in Korea with low or no co-payment. Those who are unable to afford co-payments are covered by the national insurance and exempted from co-payment. Therefore, the HIRA database contains records of all Koreans regardless of socioeconomic status.The database contains clinic and hospital visit records that record patient information including age, sex, diagnosis, medical procedure and services, type of health care institution, date of visit, admission and discharge, length of hospitalization, and medical specialty. The database also contains pharmacy records regarding prescribed medications, such as brand and generic names, strength, quantity, route of administration, single administration doses, total daily doses, and prescription dates. The diagnoses are coded using the sixth revision of the Korean Standard Classification of Diseases, which reflects the ICD-10 codes. Prior to providing the data, HIRA encrypted the original identification of each patient to protect privacy. The study was evaluated and approved by the institutional review board of Ajou University (IRB No. 201507-HR-BM-001-01). Patient informed consent was exempted since all patient information was fully encrypted.Claims data for all adult patients (\u226518 years of age) with ICD-10 codes in categories A1, A2, B1, B2 and C from January 1, 2009 to December 31, 2014 were obtained. A first-time event was defined as an event occurring for the first time during the study period with no prior events for a minimum of one year. We excluded events occurring in 2009 to identify the first one that occurred in 2010. If the same type of event recurred within 30 days, the events were considered as a single event. On the other hand, if an ADE or an ADR occurred at least 30 days after the first event, it was considered as a repeat event. For overall trends in incidence rates, all events from 2010 to 2014 were included . For anaPatient characteristics before and after DUR program implementation are compared using descriptive statistics. Events related to allergic reactions and pADRs collectively comprise the ADE dataset. Quarterly trends in incidence rates of first-time and repeat ADEs, allergic reactions, and ADRs are analyzed. A two-phase interrupted time series design with segmented linear regression analysis is used to evaluate the longitudinal effects of system implementation: pre-DUR program implementation , post-DUR program implementation . Seasonal variations are statistically normalized and autocorrelation is corrected to avoid underestimated standard errors and overestimated significance of the effects of an intervention . FrequenData extraction from the HIRA database covering the years 2009 through 2014 identified 3,927,662 records with a primary diagnosis of an ADE. The incidence rates of first-time ADEs were 58.9, 58.8, 58.5, 59.1 and 59.8 per 10,000 population in 2010, 2011, 2012, 2013, and 2014, respectively. On the other hand, 5.4, 5.6, 5.1, 5.2 and 5.1 repeat ADEs occurred in every 10,000 population.Demographic data and clinical characteristics are presented in The repeat/first-time pADR event ratio was 9.8. Among the people who experienced first-time pADRs, the same types of ADR occurred in 64,816 cases . Among these people, 27,900 (43.0%) sought medical care from primary care physicians while 15,958 (24.6%) were treated at tertiary hospitals.The present study provides a comprehensive, population-based evaluation of the influence of DUR program implementation on the incidence of first-time and repeat pADRs. Our data demonstrate that 59 out of every 10,000 individuals experience adverse events due to medications at least once each year, and of those, 26 individuals experience preventable ones. The DUR program had a significant impact on healthcare as demonstrated by decreased rates of pADRs while rates of allergic reactions unchanged or trended up. Since the DUR program does not include a module that alerts drug allergy history, this was as expected. The HIRA agency is currently making an effort to establish a module related to allergy alerts which requires a complex algorithm. Instead, hospitals with a pharmacovigilance center currently have an institution-level DUR program to alert the ADR risk for patients with allergy history using an ADR database.A few studies have evaluated the impact of the DUR program on clinical outcomes, although results have been heterogeneous , 13. HenA case-controlled retrospective study evaluating the impact of DUR implementation on physician spillover effect on future prescription following pharmacist\u2019s intervention reported that a physician in a case group was eight times less likely to receive repeated interventions than a physician in a control group  . The shoThere are also a few studies evaluating effects of the DUR program in Korea since implementation. However, previous studies have focused on its effectiveness in cost-saving or in reducing the number of inappropriately prescribed medications , 14\u201316 rIn contrast, we evaluated the DUR program\u2019s direct effects on reducing specific negative clinical outcomes; the incidence of preventable adverse events due to medications. Since the program is not designed to capture non-preventable ADEs such as allergic reactions, we used rates of total ADEs and of allergic reactions as controls. As shown in Conversely, both first-time and repeat pADR rates were significantly decreased  upon DUR program implementation. In addition, when comparing incidence rates during pre- and post-DUR periods Tables , post-DUADRs are recognized as a major cause of morbidity, especially in the elderly. It has been reported that 36.7% of total prescriptions to elderly patients visiting ambulatory care were inappropriately prescribed . This waLiver damage was one of the disease manifestations most frequently identified as medication-induced in many studies , 22. In To our knowledge, this is the first study to evaluate the effectiveness of implementation of the nationwide, prospective DUR program in reducing first-time and repeat pADRs. While recognizing its financial benefits by reducing total health care system and medication usage is important, our analyses demonstrated that the DUR program is able to detect pADRs before medication is dispensed and prevent potentially fatal medical consequences.However, our study had several limitations. First, although pharmacists are encouraged to enter the over-the-counter medications into the DUR program for comprehensive medication review, it is not mandatory. Thus, it is possible that the DUR is limited to prescription medications. Second, when pharmacists\u2019 are dispensing medications, they are unable to review the appropriateness of prescribed medications since the program does not provide clinical information. Therefore, the effect of the DUR program may have been underestimated in preventing adverse medical results.In conclusion, implementation of the prospective DUR program was effective in reducing the incidence of pADRs. Continuous updates of criteria in the DUR program is encouraged to minimize pADRs. In addition, in order to reduce non-preventable adverse drug reactions, such as allergic reactions, providing clinical information including allergy history should be established in the DUR program.S1 Table(DOCX)Click here for additional data file."}
+{"text": "Adherence to antiplatelet medications is critical to prevent life threatening complications  after percutaneous coronary interventions (PCIs), yet rates of nonadherence range from 21-57% by 12 months. Mobile interventions delivered via text messaging or mobile apps represent a practical and inexpensive strategy to promote behavior change and enhance medication adherence.The Mobile4Meds study seeks to determine whether text messaging or a mobile app, compared with an educational website control provided to all Veterans, can improve adherence to antiplatelet therapy among patients following acute coronary syndrome (ACS) or PCI. The three aims of the study are to: (1) determine preferences for content and frequency of text messaging to promote medication adherence through focus groups; (2) identify the most patient-centered app that promotes adherence, through a content analysis of all commercially available apps for medication adherence and focus groups centered on usability; and (3) compare adherence to antiplatelet medications in Veterans after ACS/PCI via a randomized clinical trial (RCT).We will utilize a mixed-methods design that uses focus groups to achieve the first and second aims (N=32). Patients will be followed for 12 months after being randomly assigned to one of three arms: (1) customized text messaging, (2) mobile app, or (3) website-control groups (N=225). Medication adherence will be measured with electronic monitoring devices, pharmacy records, and self-reports.Enrollment for the focus groups is currently in progress. We expect to enroll patients for the RCT in the beginning of 2018.Determining the efficacy of mobile technology using a Veteran-designed protocol to promote medication adherence will have a significant impact on Veteran health and public health, particularly for individuals with chronic diseases that require strict medication adherence.ClinicalTrials.gov NCT03022669 Coronary heart disease is the leading cause of death in Veterans and affects 15.5 million people in the United States . AlthougMedication nonadherence is a pervasive public health problem among Veterans and non-Veterans -12; howeIn the past decade, mobile health  has been introduced as a mechanism to enhance medication adherence and demonstrates strong potential to promote behavior change. The use of technology can facilitate adoption and integration of medication adherence by promoting behavioral strategies via health messaging, emphasizing healthy habits, tracking goals, and giving incentives for behavior change . While oBoth text messaging and mobile apps are two popular forms of mHealth that provide convenient, inexpensive, and nonintrusive engagement with individuals. The use of mobile technology can particularly benefit those who have significant barriers to taking medications, such as confusion about which medications to take, forgetfulness, and lack of social support. Text messaging is more widely used by all age groups; however, mobile apps offer many more features than text messaging, and can harness the full sensing and computational capacity of mobile devices to collect and analyze health-related data in real time to deliver health and behavioral interventions ,26.Text messaging is popular, fast, direct, efficient, user-friendly, traceable, and provides easy data transfer . Text meP=0.02), percentage number of doses taken (P=0.01), and percentage of prescribed doses taken on schedule (P=0.01) [P=0.005), and self-reported adherence revealed no significant differences among groups [In a pilot randomized controlled trial (RCT) from 2012-2013, we compared antiplatelet and statin adherence among patients with coronary heart disease in a 30-day study who received: (1) text messaging for medication reminders and education, (2) educational text messaging only, or (3) no text messaging . Among 9(P=0.01) . Text meg groups . We concText Messaging we aim to determine preferences for content and frequency of text messaging to promote medication adherence. Second, using Mobile Apps we aim to identify the most patient-centered  mobile app that promotes medication adherence with stratification by low/high mobile phone use and sex. Finally, we aim to examine Medication Adherence by comparing adherence to antiplatelet medications upon hospital discharge from ACS/PCI via: (1) text messaging, (2) mobile app, or (3) website-control. The proposed research study, Mobile4Meds, seeks to determine whether text messaging or a mobile app  can improve adherence to antiplatelet therapy among patients post-ACS/PCI. There are three topics and aims of this proposed study. First, using To date, most mHealth studies have not been based on behavioral health theories ,31. In aMobile4Meds is a mixed-methods study using both qualitative and quantitative research methods. Engaging patients initially through qualitative methods will provide opportunities for: (1) better translation, dissemination, and use of research results; (2) better evidence to inform guidelines; (3) targeted quality improvement; and (4) using research to address concerns of diverse patients . Figure We will use focus groups to fulfill the objectives of Aim 1. Each focus group will have 6-8 participants, which is a size that allows for easy exchanges of ideas and a diversity of perspectives to be represented. We will recruit a convenience sample of 24-32 participants for four focus groups. Aims 1 and 2 will include the same participants who will attend a total of four focus group sessions .The participants from San Francisco Veterans Affairs Medical Center (SFVAMC) are likely to be predominantly male; therefore, we will likely recruit one group of female Veterans from SFVAMC and one focus group of female non-Veterans from John Muir Medical Center (JMMC) in the East Bay. The four groups will account for variability in mobile phone use (low/high) and sex. Inclusion criteria for Aims 1 and 2 include: (1) >21 years of age, (2) history of ACS or PCI within one year, and (3) current/former antiplatelet (thienopyridine) prescription. Exclusion criteria are: (1) cognitive impairment, and (2) lack of English proficiency/literacy.We will explore different content for the development of a text messaging intervention to determine the ideal tailored messages for delivery in the RCT (Aim 3). After studying various behavioral change theories and frameworks, we will create a text messaging intervention with the underpinnings of common behavioral change theories. A library of 80-100 sample text messages that apply personalized content will be created to enhance medication adherence. We found that education alone increased medication adherence in prior studies, so we will deliver cardiovascular risk reduction messages along with messages regarding medications. Topics will include medications, diet, exercise, risk factors for coronary heart disease , depression, stress management, and preventive care. Participants will choose the frequency and timing of text messaging. An example of an automated medication text messaging may be, \u201cJohn, take your Plavix 75mg at 9am. Confirm with 1.\u201dWe will distribute written materials such as flyers and brochures to advertise voluntary participation in the research study. The research team  will consult with the cardiac rehabilitation staff at SFVAMC and JMMC to identify individuals who are willing to participate in a research study. The research team will meet with interested individuals and provide verbal and written explanation of the study. Participants will sign a written informed consent document.low or high mobile phone user. Separating participants into groups will help facilitate identification of common ideas and goals that low/high mobile phone users and men/women may address during the focus groups. We will use maximum variation sampling to ensure variability in age, gender, ethnicity, and low/high mobile phone use.Upon recruitment into the study, participants will complete a sociodemographic questionnaire and a brief survey that will determine if he/she is a In Aim 1, the focus group sessions will address ideal content and frequency of text messaging. First, we will give an introduction of the study aims and purpose of the focus group. Second, we will discuss the needs, preferences, perceived facilitators, and perceived barriers of using text messaging for medication adherence. Third, we will review sample text messaging, and we will ask participants which content and frequency of text messaging are the most effective and least intrusive. Finally, all participants will be able to suggest text messaging to create the most personalized messages.All focus groups will be audiotaped, and the RA will take field notes on individual and group reactions that are not captured by the recording. We will complete field notes at the conclusion of each session, and all sessions will be transcribed verbatim.Thematic analysis will include reading and coding the completed field notes and interview transcripts. We will create an initial set of codes that account for the study aims and other topics that emerge from the data. Some codes will be generated deductively, while others will be generated inductively based on themes and issues that emerge from ongoing coding. We will compare coding, resolve differences, and revise the coding scheme. We will assess intercoder reliability by having 10% of the data cross-coded. The key outcomes will be content and frequency of text messaging, particularly focusing on how preferences vary across groups. We will use ATLAS.ti  for all qualitative analyses to determine the preferred app for Aim 3.content analysis) and Aim 2b (usability testing). The usability study will include the same individuals from the focus groups in Aim 1 who are stratified by low/high mobile phone use and sex, to accommodate easy exchanges of ideas and a diversity of perspectives. In contrast to Aim 1, there will be three focus group sessions to fulfill Aim 2. Recruitment, group assignment, and data collection will be the same for Aim 2a and Aim 2b.Aim 2 consists of Aim 2a  in subsequent weeks. Participants will record impressions in a diary while using the apps. We will contact the participants by text/email/ phone-call/visit within two days after using each mobile app to troubleshoot any difficulties. At the start of each week, we will contact participants to remind them to switch over to the next mobile app.After the trial period with mobile apps, the focus group for Session 3 (which assesses usability) will include: (1) follow-up on patients\u2019 experience and preferences with using the selected mobile apps, and (2) completion of a 10-item System Usability Scale to provide a quantitative evaluation of the mobile apps to supplement the focus groups and interviews . A winniThe three focus group sessions for Aim 2 will be transcribed, coded, and analyzed in the same manner as in Aim 1. The System Usability Scale used in the Mobile App Session 3 focus group will yield a single number from 0 to 100 representing a composite measure of the overall usability of mobile apps being tested . The scaThe research design for Aim 3 is an RCT that lasts 12 months. In contrast to Aims 1 and 2 that included participants who were post-ACS/PCI within one year and recruited from a cardiac rehabilitation program, participants for Aim 3 will be recruited from the hospital after ACS/PCI.We plan to enroll 225 total participants (75 participants per group). Allowing for a 15% attrition rate over the 12-month study, we conservatively estimate that this recruitment target will result in a total sample size of n=192, which will give 86% power to detect a medium effect size  between at least one treatment group and the control group using Dunnett\u2019s method to adjust for multiple comparisons. This sample size would give more than 95% power to detect an effect size of d=0.69, as found in our previous clinical trial . AnalysiThe convenience sample will consist of 159 male and female Veterans from SFVAMC and 66 female participants (29% of sample) from JMMC. A sample size of 225 is considered to be feasible considering the number of post-ACS/PCI patients who are treated at both institutions. We have incorporated a 29% oversample of women to ensure a sufficient sample size to examine subgroup differences in intervention effects, given the low enrollment of female Veterans in Veterans Health Administration (6%) . InclusiWe will recruit from SFVAMC and JMMC inpatient units using two recruitment strategies. First, we will inform the cardiologists and nurses in the cardiac units at the hospital sites about the study so they can identify patients who meet eligibility criteria. A patient-friendly handout will be made available for the health care team to give to interested participants. Second, we will obtain a daily list of patients who had PCI and their electronic medical records will be screened for eligibility in the study using a checklist to examine the inclusion and exclusion criteria. Participants who agree to participate will provide written informed consent.Group assignment will be generated by random allocation sequence using random blocks stratified within recruitment site (SFVAMC or JMMC) of either three or six, which will be prepared by the study biostatistician. The research team will assign patients to their groups by distributing presealed envelopes in consecutive, numbered order. Due to the nature of the study design, the research team and participants cannot be blinded to the intervention once group assignment is determined.After written consent is obtained, we will collect clinical data by reviewing electronic medical records. Participants will complete the following baseline questionnaires: (1) sociodemographic information and medical history, (2) mobile phone use, and (3) Mini-Cog Test . All instext messaging group will receive text messages with content and frequency informed by Aim 1. We will use the Veterans Affairs (VA) Annie text messaging program. For non-Veteran females, we will use a text messaging program from CareSpeak Communications. The app group will use the preferred app that is selected in Aim 2. The major purpose of the app is to remind participants to take medications; however, the app will likely include other features such as providing educational messages. The website group will be offered the American Heart Association patient education website  and will serve as an active control group [7 small steps to big changes are to manage blood pressure, control cholesterol, reduce blood sugar, get active, eat better, lose weight, and stop smoking.We will conduct an RCT with random assignment to one of three groups: (1) text messaging, (2) mobile app, or (3) website-control, for a total of 12 months. Both intervention groups will also be offered the patient education website that the control group will be given. The ol group . The webSubsequent in-person follow-up visits at 1, 6, and 12 months will take place in participants\u2019 homes or other mutual meeting places as requested. Follow-up visits will be scheduled at times that are convenient for participants to meet.Medication adherence will be assessed with five different measures at various intervals to validate patterns of adherence, including: Medication Event Monitoring System , Morisky Medication Adherence Scale (MMAS-8), 7-day recall, VA Corporate Data Warehouse (Veterans), and Peoplechart Meds Incontext  to provide adherence to antiplatelet medication for Veterans. For non-Veteran females from JMMC, we will use an equivalent data source through Peoplechart Meds Incontext, which is a software program that tracks adherence through sanctioned prescription data sourced directly from retail pharmacies and Prescription Benefits Managers .We will examine other variables  and their relationship to medication adherence. Patients will complete the instruments at baseline, 1, 6, and 12 months .Upon completion of the intervention study, we will conduct a process evaluation so that improvements can be made for a multi-site full scale study. The objectives of the process evaluation are to assess participants\u2019 perspectives on feasibility, acceptability, usability, challenges, strengths, and weaknesses of the intervention. In addition, we will ascertain reasons for nonadherence to antiplatelet medications since understanding the reasons for nonadherence is crucial to avoid negative patient outcomes. We will adopt a qualitative research approach using in-depth individual interviews from a diverse sample of participants .Descriptive statistics, means, and SDs for quantitative variables, and frequencies and percentages for categorical variables, will be provided for all demographic and study variables. Random assignment of the patients to the text messaging, mobile app, and website groups should ensure that there are no preexisting differences between the three groups in personal factors .The primary outcome will be the percentage of prescribed doses taken based on MEMS data (aggregated over 12 months). Secondary outcomes will include: (1) percentages of days correct number of doses were taken, (2) doses taken on schedule, (3) MMAS-8, (4) 7-day recall, (5) VA Corporate Data Warehouse (Veterans), and (6) Peoplechart Meds Incontext (non-Veterans). The MMAS-8 will be analyzed as a range of 0-8. We will synthesize adherence measures with the key primary endpoint of MEMS data compared with secondary measures of adherence to assess for concurrent and predictive validity. We will also calculate associations between all of the adherence measures but expect that they will track well together. Prior to fitting the mixed-effects linear model, we will examine univariate and bivariate relationships between the outcomes and both demographic and coded qualitative responses.Our primary analysis will use a mixed-effects linear model. The predictors will be a categorical predictor of group (with control as reference), time, and the group-by-time interactions, as well as the recruitment site (SFVAMC vs JMMC), as randomization is stratified by site. The parameters in the group-by-time interaction are the primary parameters of interest, describing whether adherence changes differentially over baseline in each of the treatment groups compared to the control group. We will also investigate whether other models for change over time are more appropriate, including arbitrary means or nonlinear time functions through comparison of Akaike information criterion/Bayesian information criterion. Secondary analyses will adjust for select covariates that are strongly associated with adherence.P<0.10) will be included in a multiple regression analysis in which medication adherence is the dependent variable. The multiple regression analysis will provide the optimum combination of these variables to explain the total percent of variance in medication adherence, and indicate the unique contribution of each variable to the regression model.To determine the factors related to medication adherence, we will examine sociodemographic, clinical, and psychosocial variables. The variables that show at least a moderate correlation and have a significant relationship to medication adherence  among Veterans using multiple methods to assess adherence. We will also examine the relationship between medication adherence and important variables . The study duration of 12 months, which is the recommended duration of antiplatelet use for most MI/PCI patients, will provide valuable information about patterns of medication adherence.Evaluating the clinical application of mHealth strategies through rigorous scientific design and methodology is an important step in establishing whether there is potential for long-term benefit among Veterans who live with chronic disease . The besResearchers suggest that patient knowledge, self-monitoring, counseling, accountability, and a personalized program can contribute to improvement in medication adherence . ExpertsThere are potential limitations associated with this study. In Aims 1 and 2, if we do not reach saturation of ideas or if we find distinct differences between groups, we may add a mixed-group to tease out differences. We may also add an additional focus group of mixed and unstratified participants to identify differences. Alternatively, we will conduct structured one-on-one interviews to acquire richer information as a supplement to the focus groups.In Aim 3, a limitation may be attrition due to Veteran disinterest in receiving text messages or using a mobile app for 12 months. We will address the potential barrier of disinterest during the two focus groups, as planned in Aims 1 and 2, and ask Veterans how to best engage with them after ACS/PCI over 12 months. Multiple strategies will be used to maximize participant retention and decrease missing data, since the intervention is intended to last 12 months. The dropout or missing data rates for the three groups will be examined to see that they are significantly different. Sensitivity analyses will include a complete-case analysis.Another potential limitation may be cross-over effects for the text messaging and website (control) groups if they use a mobile app concurrently during the RCT. We will request that patients not use any other electronic medication reminders, including on their mobile phones . At the conclusion of the study, we will ask participants in the text messaging and control groups if they used any other electronic reminders. If they have, we will conduct sensitivity analyses as described.As the aims of Mobile4Meds are achieved, scientific knowledge and clinical implementation of behavioral change interventions related to mobile technology and medication adherence will be advanced. Improving medication adherence through mHealth technology may have significant effects on lowering morbidity and mortality among Veterans with coronary heart disease. Since poor adherence to long-term therapies severely compromises the effectiveness of treatment, providing innovative solutions through mHealth may provide relief for this critical issue in population health from the perspective of clinical outcomes and quality of life . Moreove"}
+{"text": "Bombyx mori silk fibroin (SF) protein and renewably sourced low molecular weight nylon 610 and high molecular weight nylon 1010. Films were characterized using scanning electron microscopy (SEM), Fourier-transform infrared (FTIR) spectroscopy, differential scanning calorimetry (DSC) and thermogravimetric analysis (TGA). Results of this study demonstrated that enhanced structural and thermal properties were achievable in composite films SF-N610/N1010 due to their chemical similarity and the possible formation of hydrogen bonds between nylon and silk molecular chains. This study provides useful insight into the sustainable design of functional composite materials for biomedical and green technologies.As the average life expectancy continues to increase, so does the need for resorbable materials designed to treat, augment, or replace components and functions of the body. Naturally occurring biopolymers such as silks are already attractive candidates due to natural abundance and high biocompatibility accompanied by physical properties which are easily modulated through blending with another polymer. In this paper, the authors report on the fabrication of biocomposite materials made from binary blends of  Highly renowned for its impressive strength and luster, silk has served as an important and versatile commodity material for centuries. Beyond its traditional and widespread use in textiles, silk's abundance of desirable properties offers great potential for use in a range of advanced materials applications. In particular, silk\u2019s remarkable mechanical strength, flexibility, low immunogenicity, high oxygen permeability, and overall good biocompatibility ,2,3,4 maBombyx mori cocoons, silk fibroin (SF) is a fibrous biopolymer consisting of repeating glycine-alanine/serine dipeptides responsible for beta-sheet crystal structures mixed with amorphous regions rich in large amino acids [Derived from no acids ,15. Thesno acids ,13. An uno acids . Neverthno acids ,16,17,18no acids ,20 and ono acids , gelatinno acids , polyvinno acids , and othno acids . When deno acids .Nylon is a family of semi-crystalline synthetic polymers made up of polyethylene segments separated by peptide units which can be arranged in either a parallel or antiparallel structure. Similar to silk, the conformation of nylon\u2019s peptides results in the unique hydrogen bonding responsible for many of its attractive properties . OriginaNylon and silk have great potential as candidates to modify each other. Chemical similarity between the polymers suggests possible miscibility. However, further motivation stems from the possibility that some interaction between molecular chains of silk and nylon will promote an altered structural conformation, leading to a difference in crystallization behavior and properties. Several types of nylons exist and are classified by their structural geometries. Of particular interest for this study, though, are nylons of the even-even type. Even-even nylons are distinguished by centers of symmetry along the molecule and have no sense of direction . For thiSF has already been blended with different nylons to create a variety of materials with enhanced properties, supporting the conclusion that this combination is both functional and versatile. Cebe and colleagues  reportedBombyx mori silk at various composition ratios by solution cast method. Film synthesis utilized a CaCl2\u2013formic acid solvent to cast films followed by the removal of Ca+ ions to allow for increased beta-sheet crystallinity. Films were characterized through morphological, structural, and thermal analysis. FTIR results confirmed that post-cast removal of Ca+ ions induced beta-sheet confirmation in SF. Further investigation using thermal analysis revealed that an increase in silk concentration led to a decrease in metastable gamma-phase nylon crystals and an increase of stable alpha-phase crystals for nylon 610 and nylon 1010. Improved thermal stability of silk was also observed when blended with nylon. While several researchers have investigated the modified properties of some silk-nylon composite materials, there has been a lack of attention paid to the effects of different amide densities in nylon on the overall composite properties. In this paper, the authors report on the fabrication and comparative investigation of the structural and thermal behavior in binary composite films fabricated from one of two forms of even-even nylons differing in molecular weight (N610 and N1010) with \u00ae Renewably Sourced Polyamide nylons PA610 and PA1010 were received in pellets from DupontTM  as a gift (Dr. Bryan Sauer) and were not further purified. Cocoons of Bombyx mori silk were obtained from Treenway Silks . The cocoons were degummed to remove the sericin coating and extract the fibers by boiling in a 0.02 M NaHCO3  solution for 15 min followed by thorough rinsing with deionized water. The degummed silk fibers were air dried overnight, and put into a vacuum oven at room temperature for one day to remove surface moisture [Zytelmoisture . ACS GraBombyx mori silk at various composition ratios by solution cast method. Solutions of formic acid and CaCl2 (30 mg/mL) dissolved SF and nylon 610 separately at 15% w/v as well as SF and nylon 1010 separately at 10% w/v. Weight compositions of nylon solutions were determined by their respective solubility in formic acid and conditions for successful formation of casted films which are dependent on their molecular weights.Separate lines of polyamide composite films were created using nylon 610 and nylon 1010 blended with 2 and then thoroughly dried via vacuum. For the remainder of the study, the samples are referred to in the following format: LN for Nylon 610 (low molecular weight nylon) and HN for Nylon 1010 (high molecular weight nylon). The number which follows (S%) is the percentage of silk in the film and is specified in each figure. For example, LNS30% is a composite film with 30 wt % silk and 70 wt % nylon 610.Bulk solutions of the nylons in formic acid were dissolved at approximately 55 \u00b0C and stirred at 1000 rpm for 2 h. To avoid degradation from extended exposure to formic acid, the rapid dissolution of silk at room temperature began only when the nylons were almost entirely dissolved. Silk was dissolved in increments to prevent the fibers from aggregating and forming a gel. Silk and nylon solutions were centrifuged to remove impurities and then combined at room temperature at the corresponding volumetric ratios to make seven different 5 mL samples for each type of nylon. Once combined, the samples were vortexed for 5 min and immediately cast on polydimethylsiloxane (PDMS) substrates. Films were left to dry overnight in the fume hood. The following day, films were soaked in water for 30 min to remove CaClScanning electron microscopy (SEM) was used to assess the morphological characterization of the films. The experiments were performed using a Leo 1530 VP SEM . All samples were sputter-coated with gold for SEM imaging. All figures were obtained with an electron high tension (EHT) at 3.00 kV.\u22121 with 64 background scans and 64 sample scans at a resolution of 4 cm\u22121. For each film sample, four total measurements were taken to ensure homogeneity. However, only one spectrum is shown in this report to demonstrate the overall trend. Between samples, the ATR crystal was cleaned with methanol. A Bruker Tensor 27 Fourier-Transform Infrared (FTIR) Spectrometer  was used, equipped with a deuterated triglycine sulfate detector and a multiple reflection, horizontal MIRacle ATR attachment ) that was continuously purged with nitrogen gas. Readings were taken at a range of 4000 to 400 cmData were collected using a TA Instruments  Q100 DSC, with purged dry nitrogen gas flow (50 mL/min), equipped with a refrigerated cooling system. The instrument had been previously calibrated with indium for heat flow and temperature, and aluminum and sapphire reference standards were used to calibrate heat capacity. After washing, film samples were cut and encapsulated in aluminum pans and heated in the DSC. Temperature-modulated differential scanning calorimetry (TMDSC) measurements were taken at a heating rate of 2 \u00b0C/min with a modulation period of 60 s and temperature amplitude of 0.318 \u00b0C, from \u221240 to 400 \u00b0C. Test specimens of 5\u20136 mg were cut into several pieces with diameters ~1 mm and sampled to include a mixture illustrative of the bulk film composition to mitigate potential divergent data.The degradation of films was monitored using a Pyris 1 Thermogravimetric Analyzer  with a nitrogen gas flow rate of 50 mL/min. Changes in mass were recorded over a temperature range of 25 to 500 \u00b0C at a rate of 5 \u00b0C/min. Test specimens of 8\u201310 mg were cut into several pieces with diameters ~1 mm and sampled to include a mixture illustrative of the bulk film composition to mitigate divergent data.The composite silk films produced by nylon 610 (LNS) greatly resembled those of nylon 1010 (HNS) blends at every composition ratio. Both types of nylon homopolymer produced chalk white film, whereas the silk homopolymer produced translucent tan film. Blended films adopted an appearance believed to be the average result of its constituents. Miscibility plays an important role in the overall structure and properties of polymer blends for designed application purposes . Visual SEM was performed to analyze the microstructure of the film surfaces. As seen in w/v as opposed to 10% w/v in HNS100. LNS100 shows a very smooth surface, whereas HNS100 is more wrinkled. The increased wrinkling can be explained by a greater mass loss due to evaporation of more solvent.Generally, LNS blends produced more homogeneous films compared to HNS. This is likely due to differences in molecular chain length. It is possible that the lower molar mass of nylon 610 resulted in higher hydrogen bonding per unit mass. LNS100 and HNS100 were both made of silk homopolymer, however LNS100 was fabricated at 15% 2 using a 30 min water bath treatment.To gain a better understanding of the interactions between the silk and nylon molecular chains as well as the effects of fabrication processing on structural confirmation, FTIR was used to examine the amide groups of silk fibroin and both nylon 610 and 1010 blends. \u22121, which is attributed to the characteristic alpha-crystalline conformation of nylons [\u22121) upon removal of CaCl2 in the water bath. SF showed an absorption band at 1639 cm\u22121 (amide I) prior to water wash, indicative of dominated random coils and extended chains in the protein structure [2 removal, however, the amide I peak shifted to 1622 cm\u22121 indicating that an intermolecular beta-sheet conformation was formed [\u22121 was attributed to C=O stretching in the SF. For unwashed SF and Nylon/SF blends, no significant peak could be observed at 1622 cm\u22121, suggesting that beta-sheet secondary structures were formed by removing CaCl2 in the water bath.Both nylon 610 (LNS0) and nylon 1010 (HNS0) showed an absorption band at 1631 cmf nylons ,33. The tructure . Upon Cas formed . The sho2 is once again negligible . On the other hand, in samples containing a greater silk composition, a band observed at 1535 cm\u22121 representing the amorphous phase was shifted to 1514 cm\u22121, which has been reported to represent water inaccessible beta-sheets and tyrosine side chain groups [2 molecules. For nylon-dominated samples in the amide II region, the effect of removing CaClStrong interactions between polymers of composite blends can result in enhanced properties of the blends . ThermogIn both types of composite films, a multi-step mass loss mechanism is observed. The degradation behaviors of both blend types appear to follow a trend intuitive of their composition. In the silk fibroin homopolymer, there is an experienced mass loss beginning at approximately 265 \u00b0C, whereas LNS0 and HNS0 remain thermally stable until approximately 400 \u00b0C. Although silk begins to degrade at a lower temperature than the nylons, A visual interpretation of the 500 \u00b0C region in E(T)M is determined from Equation (1):S(T)M and N(T)M are the percent mass remaining at temperature T, for silk protein and nylon respectively, and Expected values were determined under the assumption that no interactions were present. Therefore, any measured value that is not within reasonable deviation of the expected value should be considered as having synergism . The expFurther analysis was performed using a temperature modulated DSC to investigate phase behavior in the films. Normalized heat flow vs. temperature results for the different films are shown in Tm1 peak) occurs at 213 \u00b0C, followed by a second melting of stable Tm2 peak) at 223 \u00b0C. No shift in the melting temperatures was observed at different composition ratios; however, with increasing concentrations of silk, there appeared to be a decrease in Relative peak intensities suggest that the nylon 610 homopolymer (LNS0) is alpha-phase dominated. In all films containing nylon 610, an initial melting of metastable Tm1 and Tm2 of 189.0 and 197.5 \u00b0C, respectively, compared to Tm1 and Tm2 of 189.1 and 200.1 \u00b0C, respectively, in the HNS90 sample. HNS50 displayed the highest melting temperatures out of the nylon 1010-silk films at Tm1 = 193.5 and Tm2 = 201.5 \u00b0C.In contrast to nylon 610, nylon 1010 (HNS0) was dominated by gamma-phase crystals. Similar to LNS films, HNS films experienced a decrease in gamma crystals and an increase in alpha-phase crystals, although the effects appeared more pronounced. Unlike LNS samples, HNS samples also exhibited variable melting temperatures when blended with different ratios of silk. 2\u2013formic acid solvent has been used to produce regenerated SF materials with improved mechanical strength [2 has also been reported to decrease beta-sheet crystallinity in silk fibroin films and cause more random coils. Murase [+ ions infiltrating the silk structure, thereby preventing hydrogen bonding. CaClstrength  and therstrength . However. Murase  explaine2\u2013formic acid solution cast followed by water treatment. FTIR analysis showed that the removal of Ca+ ions induced beta-sheet formation in samples with significant silk composition. On the basis of experimental results and insight from previous investigations [For this study, the authors prepared blend films of silk with nylons using a CaCligations ,36, the 2\u2013formic acid. The removal of CaCl2 was observed to induce beta-sheet formation in the silk as indicated by the 1622 cm\u22121 peak in FTIR. Strong interactions between silk and nylon led to a tunable thermal stability in composites as shown by the TGA and DSC. Increasing the concentration of silk also led to a decrease in metastable gamma nylon crystals and an increase in stable alpha nylon crystals. This effect was especially pronounced in HNS films where heightened melting temperatures were also observed approaching 50/50 composition. It is possible that the addition of silk causes changes in the nylon side chains, further leading to the appearance of alpha crystals rather than gamma crystals. More studies will be conducted in the future to further understand this mechanism.In this study, the authors showed that nylon610-silk and nylon1010-silk blend films could be prepared by solution casting from CaCl"}
+{"text": "The enteric species F human adenovirus types 40 and 41 (HAdV-40 and -41) are the third most common cause of infantile gastroenteritis in the world. Knowledge about HAdV-40 and -41 cellular infection is assumed to be fundamentally different from that of other HAdVs since HAdV-40 and -41 penton bases lack the \u03b1V-integrin-interacting RGD motif. This motif is used by other HAdVs mainly for internalization and endosomal escape. We hypothesised that the penton bases of HAdV-40 and -41 interact with integrins independently of the RGD motif. HAdV-41 transduction of a library of rodent cells expressing specific human integrin subunits pointed to the use of laminin-binding \u03b12-, \u03b13- and \u03b16-containing integrins as well as other integrins as candidate co-receptors. Specific laminins prevented internalisation and infection, and recombinant, soluble HAdV-41 penton base proteins prevented infection of human intestinal HT-29 cells. Surface plasmon resonance analysis demonstrated that HAdV-40 and -41 penton base proteins bind to \u03b16-containing integrins with an affinity similar to that of previously characterised penton base:integrin interactions. With these results, we propose that laminin-binding integrins are co-receptors for HAdV-40 and -41. Whereas most other HAdVs exhibit a broad tropism, enteric species F HAdV-40 and -41 exclusively cause gastroenteritis and are a major cause of infantile gastroenteritis worldwide after rotavirus and norovirus4, with a seroprevalence greater than 40%4.HAdVs are classified into species A to G and the yet increasing number of HAdV types5, sialic acid-containing glycans6, CD469, and desmoglein 2 (DSG-2)10. All HAdVs are equipped with one single fibre protein except for species F HAdV-40 and -41 and species G HAdV-52, which are equipped with one long, CAR-binding fibre and one short fibre13. The second step involves the interaction of the penton base (PB) capsid protein to secondary or co-receptors on the cell, which leads to internalisation and endosomal escape14. Species A to E HAdVs use the RGD-binding group of integrins as co-receptors19. Integrins are transmembrane, heterodimeric glycoproteins involved in signalling, cell adhesion and cell migration20. The dimers are built by the non-covalent association of one \u03b1 and one \u03b2 polypeptide, and are classified into four groups based on their ligand interactions21. LDV -binding integrins  interact with ligands on epithelial cells or on leukocytes, such as VCAM-1 (vascular cell adhesion molecule 1) and MAdCAM-1  and are involved in cell-cell interactions and migration (leukocyte homing). The \u03b1V integrins , \u03b15\u03b21, \u03b18\u03b21 and \u03b1IIb\u03b23 are known as RGD (asparagine-glycine-aspartate)-binding integrins. These integrins are involved in cell-matrix adhesion and interact with extracellular matrix (ECM)-containing proteins such as vitronectin and fibronectin. The two remaining groups, which partly overlap, include collagen-binding integrins  and laminin-binding integrins . These groups are also involved in cell matrix adhesion.Most HAdVs infect host cells through a two-step process. First, the knob domain of the trimeric fibre capsid protein interacts with primary cellular receptors, such as the coxsackie and adenovirus receptor (CAR)22. The PBs of species F HAdVs are unique in that they lack the otherwise conserved RGD motif , which mediates the interaction with integrins, and are instead replaced with a RGAD motif in HAdV-40 and an IGDD motif in HAdV-4123. Combined with the exclusive gastrointestinal tropism and the nearly unique presence of two fibres in these HAdVs, it has been suggested that the short fibres have replaced the entry function of the PBs24. In this study, we challenged this suggestion and hypothesised that the PB proteins of these HAdVs contribute to cellular entry through interactions with laminin-binding integrins.Interactions of HAdV species A to E with integrins are mediated by the exposed RGD-containing loops found in each monomer of the pentameric PB. Carrying the fibres, the PBs are located at each of the 12 vertices of an icosahedral HAdV particle25 that overexpress human integrin alpha subunits. Flow cytometry . To examine which integrins HAdV-41 uses to enter these cells, we used a GFP-encoding HAdV-41 vector (HAdV-41GFP). The vector transduced CHO cells that expressed the laminin- and/or collagen-binding \u03b12, \u03b13, and \u03b16 subunits, the RGD-binding \u03b15 and \u03b18 subunits or the LDV-binding \u03b19 subunit more efficiently than the respective control CHO cells , which was used here as a reference vector, transduced CHO-\u03b1V cells more efficiently than control cells. The increased transduction of CHO cells expressing human laminin-, collagen-, RGD-, and LDV-binding integrins by HAdV-41GFP indicated that these integrins could potentially play a role in the early steps of HAdV-41 infection. Since the enteric HAdV PB do not contain RGD motifs, but instead contain potential laminin-binding integrin motifs, also in the otherwise RGD-containing loops, we focused on investigating the role of laminin-binding integrins.To study the relevance of non-RGD binding integrins during entry and infection by enteric HAdVs, we used a library of CHO\u00a0(Chinese hamster ovary) cell linestry Fig.\u00a0 and westtry Fig.\u00a0 analysesig.\u00a0Fig.\u00a0. To examlls Fig.\u00a0. There w26. HT-29 cells express the laminin-binding integrin subunits \u03b12, \u03b13 and \u03b16 subunit, which can associate with \u03b21  or \u03b24 subunits (\u03b16) and the RGD-binding integrin \u03b1V, which associates with \u03b21, 3, 5, 6, and 8. HT-29 cells express no, or very low amounts of \u03b14, \u03b15, \u03b17 and \u03b19 integrin subunits  of laminin 332 reduced HAdV-41 infection efficiently . However, laminin 332 surprisingly increased HAdV-5 infection by around 60%. Also, pre-incubation of HT-29 cells with vitronectin or fibronectin (RGD-containing integrin ligands) did not affect HAdV-41 infection , the latter to determine molecular weight and multimeric nature of a protein by measuring its diameter in the gas phase30. These analyses confirmed that the recombinant proteins were predominantly pentameric with the correct structure and molecular weight of ~250\u2009kDa. When CHO-K1, CHO- \u03b12, CHO- \u03b13 and CHO- \u03b16 cells were pre-incubated with soluble 41PB, a reduced transduction of CHO-\u03b13 and CHO-\u03b16 cells was observed  in a baculovirus system and purified them using liquid chromatography. 5PB was used as a control. The proteins were ~90% pure as determined by SDS-PAGE and by MALDI-TOF MS. We also investigated pentamerisation by electron microscopy (EM) and gas-phase electrophoretic mobility macromolecular analysis (GEMMA) Fig.\u00a0, the latved Fig.\u00a0, but notved Fig.\u00a0, as comp. The same was observed for the short fibre knob (41SFK). Whole virus only bound to CHO-CAR cells but did not bind to any of the CHO-integrin cells in this experiment , since HT-29 cells express CAR, which is the known attachment receptor.To determine if the fibre proteins affect transduction of CHO-cells, we performed fibre knob and whole virus binding of HAdV-41 to CHO-K1, CHO-\u03b12, CHO-\u03b13 and CHO-\u03b16 cells. We detected binding of the FKs by flow cytometry using an antibody against the tagged FKs while radiolabelled virus binding was assessed by counts on a microbeta counter. The results show that the binding of the long fibre knob (41LFK) to the control CHO-K1 and to the integrin expressing cells was similar Fig.\u00a0. The sament Fig.\u00a0. Thus, t5\u2009M\u22121 s\u22121 range and most dissociation rates in the 10\u22122\u2009s\u22121 (or close to) range. However, the lower affinities for \u03b16\u03b21 resulted from either a markedly slower association of 41PB (low 104 M\u22121 s\u22121 range) or from a markedly faster dissociation of 40PB (low 10\u22121\u2009s\u22121 range). The affinity of these interactions is in the range determined by previous studies for 2PB:integrin interactions31. 5PB affinity to \u03b16\u03b24 and \u03b16\u03b21 was approximately three times lower. This provided further evidence that there is a direct interaction between the enteric HAdV PB proteins and \u03b16- containing integrins.Finally, surface plasmon resonance analysis was performed to confirm direct interaction between immobilised \u03b16-containing integrins (>90% pure as checked by SDS-PAGE) and the recombinant PB proteins (added in solution) and to determine affinity and kinetics of these interactions. Both 40PB and 41PB bound with high affinity (30\u201340\u2009nM range) to \u03b16\u03b24 and with approximately ten-fold lower affinity to \u03b16\u03b21 Fig.\u00a0. With a 33 are engaged in entry and/or endosomal release of other HAdVs. Our data suggest that the enteric species F HAdVs are more promiscuous and use a fundamentally different repertoire of integrins than other HAdVs, which appears surprising, since the tropism of this virus is strictly limited to the intestinal tract. As per our knowledge, there have been no studies to date explaining the function of the PB of the enteric species F HAdVs, which lack the otherwise conserved RGD motif. We hypothesised that these viruses interact with integrins other than the RGD-binding integrins and through RGD-independent mechanisms. Whereas the RGD motif is the most well documented integrin-binding motif, there are many other motifs known to interact with other integrins. For example, it has also been shown that SIKVAV34 and a glutamic acid residue in the third position from the C-terminus of laminin \u03b3 chains (IEK and LEQ) are involved in integrin binding35. 40PB and 41PB (but not the PBs of other HAdVs) contain amino acid motifs resembling those of integrin-binding laminins: ASIK/IEQ (HAdV-40) and ASIQK/IEK (HAdV-41)37, both motifs being positioned in the loop corresponding to the RGD loop. To identify whether enteric HAdVs employ specific integrins as co-receptors, we used a library of CHO cells that overexpress various human integrins. CHO cells that express human integrin alpha have been used in many studies39 which defined the binding specificity of integrins to many new ligands including several viruses. To date, human alpha/hamster beta integrin dimers have been shown to be identical to their human counterpart in ligand specificity. Since these cells are refractory to wild type HAdV infection, we used a HAdV-41GFP vector and quantified transduction. Cells expressing human \u03b12, \u03b13, \u03b15, \u03b16, \u03b18 and \u03b19 subunits were transduced to a higher degree than their corresponding control CHO cells. The use of multitude of integrins revealed in this experiment suggested a more promiscuous usage of integrins by HAdV-41  as compared by other HAdVs. The identity of the target cells where enteric HAdVs replicate has not yet been established, but non-human enteric AdVs such as avian, murine and porcine AdVs replicate in the small intestinal epithelial cells of their hosts42. In humans, these cells express various integrins, which have different distributions throughout the intestine (Table\u00a01). RGD-binding integrins such as \u03b1V have not been detected in the intestinal epithelium of the small intestine43. The presence and distribution of laminin-binding integrins in the human intestine and the presence of motifs in the PB of enteric HAdVs that potentially interact with laminin-binding integrins lead us to investigate the impact of these integrins in further detail. When HT-29 cells were pre-incubated with soluble laminin-332 and -511, a dose-dependent decrease in infection of WT HAdV-41 was observed. The effect was less pronounced and dosage independent for HAdV-5, which was used as a reference. The increased infection of HAdV-5 with the highest concentration of laminin 332 is an interesting observation, which we cannot fully explain. We hypothesise that under certain conditions, laminins can function as a bridge and generate indirect binding of virions to cells, as has been suggested in the case of fibronectin and HAdV-3733. Laminins also bind to cellular molecules other than integrins, such as \u03b1-dystroglycan, 67\u2009kDa laminin-binding protein, galactosyltransferase, and syndecan-128, which we did not evaluate further. We cannot exclude that the effect of laminins that we observed is due to interactions with these molecules, but taken together with the other data presented here, these results support that HAdV-41 makes use of one or more of the laminin-binding integrins for infection, rather than any of these non-integrins. We also identified the participation of laminin-binding integrins in the entry of HT-29 cells by HAdV-41, where HT-29 cells treated with soluble laminin clearly had fewer internalised viral particles as compared to untreated cells. These date indicate that the laminin-binding integrins play a role in virus entry or internalisation. Next, soluble recombinant 40PB and 41PB were produced in the baculovirus system in which PBs of other types of HAdVs44 have been purified previously for structural and functional studies. 41PB reduced HAdV-41 transduction of CHO-\u03b13 and CHO-\u03b16 cells, but not the transduction of CHO control cells or CHO-\u03b12 cells. Since \u03b13 and \u03b16 are expressed on the villus and \u03b12 is mainly expressed in crypts these results suggest that HAdV-41 may have a preference to infect cells on the villus rather than the crypt. Upon co-incubation with 52SFK we observed a small but statistically significant  decreased transduction of the control cells (CHO-K1). However, the control protein did not affect the transduction of the integrin-expressing cells. A significant  reduction in infection was seen for both viruses when HT-29 cells were pre-treated with soluble PB and then infected with wild type HAdV-41 or HAdV-5. We speculate that the reduced infection of HAdV-5 in the presence of 41PB and vice-versa is because integrins used by\u00a0HAdV-5 overlaps with some of those used by HAdV-41, such as \u03b13\u03b2132. We also observed that HAdV-41GFP transduced CHO cells that overexpress RGD binding integrins such as \u03b15- and \u03b18-containing integrins, and hence it could be that 41PB reduced infection of HAdV-5 through interactions with these integrins. Since HT-29 cells express all the candidate laminin-binding integrins such as \u03b12, \u03b13 and \u03b16, it is difficult to conclude from these experiments if one or some of these integrins is more essential than others. To further investigate the importance of individual integrins we infected \u03b16 integrin knockout HAP1 cells. We did not observe a reduction in infection by HAdV-41 as compared to the control cells. HAP1 and HT-29 cells express many different integrin types including \u03b12, \u03b13 and \u03b24. This feature together with the fact that integrin usage by HAdVs is redundant, it would be an impractical task to interfere with multiple integrins by knockouts, soluble integrins or anti-integrin antibodies. We performed HAdV-41 infection of HT-29 cells and CHO-integrin cells in the presence of soluble integrins and anti-integrin antibodies but only observed minor effects (data not shown).Here we found that enteric species F HAdVs may use the laminin-binding \u03b12-, \u03b13-, and \u03b16-containing integrins. Studies from other groups have shown that several, RGD-binding integrins such as \u03b1V\u03b21, \u03b1V\u03b23, \u03b1V\u03b25, and \u03b15\u03b21, as well as the laminin-binding integrin \u03b13\u03b2131.41LFK bound equally to each of the CHO cells . We observed the same with the 41SFK. Whole virus only bound to CHO cells expressing human CAR and not to integrin expressing CHO cells, which shows that integrins are not required for binding. On HT-29 cells, only the 41LFK blocked attachment of HAdV-41 and not the 41SFK, which confirms CAR, and not integrins, as the attachment molecule. These data, taken together with the results from CHO cell transduction experiments, suggest that the PB protein (and not the fibre proteins) is responsible for increased transduction of the CHO-integrin cells. This signifies that laminin-binding integrins function as secondary or accessory receptor and not as primary attachment receptors for HAdV-41. Furthermore, SPR studies with \u03b16\u03b21 or \u03b16\u03b24 and 5PB or 41PB showed that the affinity of 41PB was three times higher than that of 5PB and that the affinity of this interaction is similar to the affinities of RGD-equipped penton base:integrin interactions seen in previous studies27, it is likely that the enteric species F HAdVs have adapted to use other integrins that are present on intestinal epithelial cells. Laminin-binding integrins, especially \u03b16\u03b24, are predominantly expressed on the basal surface of intestinal epithelial enterocytes45. When these cells migrate from the crypt and are shed from the villus, gaps are created between the enterocytes46, which might expose integrins as well as lateral and basal CAR, the attachment molecule for the LFs of species F HAdVs. Analogous to the infection route of other HAdVs, we envision that the LF binds CAR, tethering the virion to the cell and allowing subsequent interactions between PB and integrins to occur, which results in entry and infection. The function of the RGD-lacking PB proteins of enteric species F HAdVs has been an enigma. It has been suggested that the entry mechanism for enteric species F HAdVs is different from that of other HAdVs i.e., the SF replaces the PB as mediators of cellular entry or entry is integrin-independent24. Based on the results presented here we propose that 41PB are used during virus entry. However, we cannot exclude the possibility that the SF also contributes to entry. Specifically, we propose that HAdV-41 and probably also HAdV-40 use laminin-binding integrins as well as other integrins as co-receptors, but do not use the \u03b1V-containing integrins that are used by multiple other HAdVs.In conclusion, since the small intestinal epithelium does not express, to the best of our knowledge, RGD-recognising \u03b1V integrinsCells: Chinese Hamster Ovary (CHO)-K1 cells were grown in Ham\u2019s F12 Nutrient mix (Gibco); CHO-B2 cells were grown in Dulbecco\u2019s modified Eagle\u2019s medium (Sigma-Aldrich); and CHO-\u03b17 cells (from GenScript) were grown in Ham\u2019s F12K nutrient mix  with 4\u2009\u00b5g/ml of puromycin (Gibco). The above cell media were supplemented with 10% fetal bovine serum , 20\u2009mM HEPES buffer (Sigma-Aldrich) and 20 U/ml penicillin\u2009+\u200920\u2009\u00b5g/ml streptomycin . CHO-K1 was used for generation of CHO-\u03b1247, CHO-\u03b1339, CHO-\u03b1648, CHO-\u03b17, CHO-\u03b1849 and CHO-\u03b1950 whereas CHO-B2 was used for generation of CHO-\u03b1V51, CHO-\u03b14\u03b2152, CHO-\u03b14\u03b2753 and CHO-\u03b1551. The different CHO cells were grown as described53. HT-29 cells  (gift from Dr. Marie-Louise Hammarstr\u00f6m) were grown in McCoy\u2019s 5\u2009A medium (Gibco) with PEST and 10% FBS. All the above cells were cultured at 37\u2009\u00b0C in the corresponding media. Spodoptera frugiperda Sf9 insect cells (Gibco) were grown and maintained at 28\u2009\u00b0C either as adherent or suspension cultures in Sf900 II SFM serum-free media (Gibco) supplemented with PEST. Virus: Species F HAdV-41 (strain Tak) (kindly provided by Dr. Alistair H. Kidd) and species C HAdV-5  were produced in A549 cells with or without 35S-labeling as described54 but the virions were eluted in sterile phosphate buffered saline (PBS) instead of sterile DMEM, after desalting CsCl, using NAP columns . The virions were stored at \u221280\u2009\u00b0C in PBS with 10% glycerol. HAdV-41 was labelled using the Alexa Fluor 488 Microscale Protein Labeling Kit (Thermo Fischer Scientific) according to the manufacturer\u2019s protocol. After the labelling reaction, the conjugate was purified by dialysis  against one litre of PBS overnight followed by 2\u20133\u2009hours of dialysis in one litre PBS with 10% glycerol the next day. Vectors: HAdV-41 GFP vector was produced as described55 and HAdV-5 GFP vector was purchased from Vector Development Lab. Antibodies used in flow cytometry and western blot were P2W7 , P1E6 , ASC-1 , 44H6 , P1D6 , GoH3 , 3C12 , clone # 481709 , Y9A2 , 422325 , P5D2 , anti-actin antibody (Sigma-Aldrich), RmcB , anti-RGS His , anti-mouse IgG Alexa Fluor 488 (Life technologies) and anti-rat IgG FITC antibody (Dako Cytomation). Serotype-specific rabbit polyclonal antisera against HAdV-41 and HAdV-5 used in infection experiments were a kind gift from Dr. G\u00f6ran Wadell56.Integrin ligands used in infection experiments were laminin 332 and laminin 511 (Biolamina), vitronectin (R&D) and fibronectin (Roche). Recombinant human integrins used for surface plasmon resonance (SPR) experiments (\u03b16\u03b24 and \u03b16\u03b21) were purchased from R&D Systems. 40PB, 41PB and 5PB: Full length 40PB, 41PB or 5PB DNA was cloned in pFastBac HT A vector (providing hexa-histidine tag to N-terminus of expressed protein) and transformed into E.coli DH10Bac. The recombinant bacmids were further analysed by PCR according to the Bac-to-Bac Baculovirus Expression System kit from Invitrogen. Sf9 (Spodoptera frugiperda) cells were transfected with the bacmid DNA and incubated at 28\u2009\u00b0C for 96\u2009hours, generating a passage 1 (P1) baculovirus stock that was then used to generate high-titre P2 stock. 4.3\u2009\u00d7\u2009105 cells/ml of Sf9 cells were infected at a MOI of 5 with the P2 viral stock and the cells were incubated at 28\u2009\u00b0C for four days under shaking conditions. After incubation, the cells were lysed and purified first with Ni-NTA agarose column (Qiagen) and then with a HiTrap Q-sepharose column  using an \u00c4KTA liquid chromatography system . The soluble recombinant proteins were then stored in PBS with 10% glycerol in \u221220\u2009\u00b0C. 41SFK and 41LFK: Cloning and purification of 41SFK (amino acids 215 to 387) and 41LFK (amino acids 363 to 562) was done as described in13.5 cells/well) and washed once with FACS buffer (PBS with 2% FBS). Integrin-recognising or anti-CAR monoclonal antibodies were diluted 1:500 or 1:40 respectively in FACS buffer and incubated with the cells for 30\u2009minutes at 4\u2009\u00b0C. Unbound antibodies were washed away with FACS buffer and the cells were then incubated with Alexa Fluor 488 donkey anti-mouse IgG (diluted 1:1000 in FACS buffer) or rabbit anti-rat IgG FITC antibody (diluted 1:40 in FACS buffer) for 30\u2009minutes at 4\u2009\u00b0C. After incubation with the secondary antibody, the cells were washed with FACS buffer and analysed on the FACSLSRII cytometer (Becton Dickinson). The results were analysed with FACSDiva software (Becton Dickinson). To determine FK binding on the CHO-integrin cells , 10\u2009\u03bcg/ml of 41LFK and 41SFK diluted in 100\u2009\u03bcl serum-free media were added to the cells for one hour on ice, washed and then stained with an anti- RGS His mouse monoclonal antibody (diluted 1:200 in FACS buffer) for 30\u2009minutes. After washing unbound primary antibody, the same method was followed as with the integrin/CAR expression samples.Flow cytometry analysis was performed to check integrin expression on CHO-integrin cells and HT-29 cells and to check expression of human CAR on CHO-integrin cells. CHO-B2 and -K1 control cells, corresponding integrin-expressing cells (except CHO-\u03b18), CHO-CAR and HT-29 cells were detached with PBS-EDTA, counted and then allowed to recover in growth media at 37\u2009\u00b0C. After one hour, the cells were added to a V-bottom 96-well plate . Cell debris were pelleted by centrifugation at 12000 RPM for 10\u2009minutes at 4\u2009\u00b0C. Equal amounts  of each cell supernatant was resolved on a 12% Bis-Tris denaturing gel  and transferred to a nitrocellulose membrane (Bio-Rad Laboratories). The membrane was blocked with 5% non-fat dry milk in PBS-T (PBS supplemented with 0.05% Tween 20) and incubated with an anti-human \u03b18 integrin monoclonal antibody (diluted 1:1500) or with anti-actin antibody (diluted 1:3000). The antibodies were diluted in 5% non-fat dry milk in PBS-T. After three ten-minute washes with PBS-T, the membrane was incubated with a 1:1000 diluted HRP conjugated secondary antibody (Dako Cytomation) in PBS-T with 2.5% non-fat dry milk. Expression of human \u03b18-integrin was detected by chemiluminescence using SuperSignal West Femto (Thermo Fisher Scientific) and visualised using the multipurpose CCD camera system FujiFilm LAS-4000.CHO cells were grown as monolayers in 96-well clear bottom plates (Greiner bio-one). The cells were washed three times with serum-free medium before pre-incubation with/without recombinant, 41PB, or with recombinant, soluble 52SFK at 4\u2009\u00b0C for one hour. HAdV-5GFP vector (11250 vp/cell) or HAdV-41GFP vector (100000 vp/cell) was then incubated with the cells for two hours on ice. After incubation, the cells were washed three times with serum-free medium and then incubated at 37\u2009\u00b0C for 72\u2009hours in maintenance medium (growth medium with 1% FBS). Subsequently, the cells were washed once with PBS and then examined in a fluorescence plate reader  in PBS. Numbers of infected cells were calculated using the Tina program of the TROPHOS. The results are expressed as % transduction of control cells (either CHO-K1 or CHO-B2), where GFP signal per well is counted.Negative staining EM: Samples were applied to carbon-coated copper-grids and stained with 1.5% Uranyl Acetate (UA). The 41PB sample was analysed with a JEOL-1230 TEM-Microscope  at 80\u2009kV and micrographs were acquired with a Orius 830 2k \u00d7 2k CCD camera using the digital micrograph software  and a pixel size of 2.69\u2009\u00c5 on the objective scale. The 5PB sample was analysed with a Talos 120\u2009C TEM-Microscope  operating at 120\u2009kV and micrographs were acquired with a Ceta 16\u2009M CCD camera (FEI) using the TEM Image & Analysis software ver. 4.15 (FEI) and a pixel size of 1.56\u2009\u00c5 on the objective scale.57. Datasets with more than 1600 extracted particle images (p.i.) of PBs (41PB: 1637 p.i and 5PB: 2419 p.i.) were processed and 2D classified into 2D classes using the Relion (2D classification) algorithm60. 41PB p.i. were classified into 6 classes, a good symmetrical class of a top view and a side view were selected . 5PB p.i. were classified into 70 classes, after exclusion of p.i. in non-representative classes, further 2D classification into 10 classes (1836 p.i.) was performed. Additional exclusion of p.i. in non-representative classes generated 2 good symmetrical 2D classes of a top view and a side view of 5PB .Particle picking and data processing were performed with the Scipion software package3 was used61.Buffer was changed from PBS (41PB was stored in PBS) to 20\u2009mM ammonium acetate buffer, pH 7.8 containing 0.005% (v/v) Tween 20 using G-25 columns  since the sample should not contain non-volatile salts. The PB protein in 20\u2009mM ammonium acetate was scanned five times (120\u2009seconds per scan) with a capillary pressure of 3.7\u2009bar and a diameter range of 2.55\u2013255\u2009nm. For molecular mass calculations, a particle density of 0.58\u2009g/cmHT-29 cells were grown as monolayers in 96-well clear bottom plates. The cells were washed three times with serum-free medium and treated with or without different concentrations of (a) recombinant laminin 332 or laminin 511 or (b) recombinant 41PB or 5PB (negative control) for one hour on ice. HAdV-5 and HAdV-41 were incubated with the cells for one hour on ice after a wash. Following incubation, the cells were washed three times with serum-free medium and then incubated at 37\u2009\u00b0C for 44\u2009hours in maintenance medium (growth medium with 1% FBS). Next, the cells were washed once with PBS and then fixed with ice-cold methanol at \u221220\u2009\u00b0C for 10\u2009minutes. The cells were then stained with polyclonal rabbit anti-HAdV-5 (1:10 000) or anti-HAdV-41 (1:300) diluted in PBS for 30\u2009minutes at room temperature. After two 15-minute washes with PBS, the cells were incubated with goat anti-rabbit IgG (H\u2009+\u2009L) secondary antibody with an Alexa Fluor 647 conjugate (1:250) diluted in PBS for 30\u2009minutes at room temperature. Pictures were taken and numbers of infected cells were calculated using the Tina program of the TROPHOS after two 15-minute washes with PBS.62. The images were used to calculate a ratio between the total number of viral particles (green/Alexa Fluor 488) and uninternalised particles (red/Alexa Fluor 568 and green/Alexa Fluor 488).HT-29 cells were grown as monolayers in each well of an 8-well tissue culture chamber on a slide. The cells were washed with PBS and treated with or without 0.1\u2009\u00b5M laminin 332 or laminin 511 for one hour on ice. Alexa Flour 488 labelled HAdV-41 was diluted 1:100 in McCoy\u2019s 5A media with 3% FBS and added to the cells without washing away the laminins. The cells were incubated with the virus for five hours at 37\u2009\u00b0C to facilitate entry. After incubation, the cells were rinsed once with ice cold PBS +10% FBS and kept on ice for 15\u2009minutes prior to staining. All subsequent steps where performed on ice, unless otherwise stated. First, un-internalised virus particles were stained using a rabbit polyclonal antibody raised against the Alexa Fluor 488 dye (Thermo Fisher Scientific), diluted 1:250 in PBS +10% FBS. After one hour of slow rocking, the cells were washed three times with cold PBS +10% FBS and a goat anti rabbit secondary Alexa Fluor 568 conjugated antibody (Thermo Fisher Scientific) was added diluted 1:1000 in PBS +10% FBS and allowed to bind for one hour. Finally, the cells were washed three times with PBS +10% FBS and fixed with 4% PFA at room temperature for 20\u2009minutes, rinsed twice with PBS, and the nucleus stained by Hoescht 33342. The slides were mounted with ProLong Gold Antifade and imaged using a Nikon confocal microscope. A total of 30 images were taken using a 100x lens and quantification was performed using the analyse particle routine in ImageJ5 cells/well) and washed with binding buffer (BB: Dulbecco\u2019s modified Eagle medium supplemented with HEPES and PEST). 35S-labelled virions  were added to the cells and incubated for one hour on ice. Unbound virions were washed away with BB and the cell-associated radioactivity was measured in a Wallac 1450 Microbeta liquid scintillation counter (Perkin-Elmer). To study effect of soluble FKs on binding of 35S-labelled HAdV-41, cells were incubated with different concentrations of 41SFK and 2\u2009\u00b5g/ml of 41LFK after reactivating cells. The unbound fibre knobs were washed away with BB before addition of virions.CHO-K1, CHO-\u03b12, CHO-\u03b13, CHO-\u03b16 and CHO-CAR cells were detached with PBS-EDTA, reactivated in growth media for one hour at 37\u2009\u00b0C (in solution), pelleted in 96 well plates  surfactant P20, pH 7.4) and injected for 120\u2009seconds at 30\u2009\u00b5l/minute followed by 120\u2009seconds of dissociation. All covalent surfaces were regenerated with one 30\u2009second pulse of 10\u2009mM glycine\u2013HCl . All Biacore kinetic experiments were conducted at 25\u2009\u00b0C. Biacore sensorgrams and binding affinities were calculated and processed using Biacore T200 evaluation software .SPR experiments were performed using Biacore T200 optical biosensors . Standard EDC/NHS coupling was used to covalently immobilise the integrin \u03b16\u03b24 and \u03b16\u03b21 to CM5 sensor chips for 420\u2009seconds at a flow rate of 10\u2009\u00b5l/minute using a 40\u2009\u00b5g/ml integrin concentration in 10\u2009mM sodium acetate, pH 4.0. Immobilisation density was approximately 16000 response units (RU). For each Biacore kinetic experiment, a series of seven PB concentrations serially diluted 2-fold was prepared in the running buffer  and t-test was performed using GraphPad Prism 7 for Mac OS X. P-values < 0.05 were considered statistically significant. For SPR experiments, variance is denoted as\u2009\u00b1\u2009standard deviation (SD).Dataset 1"}
+{"text": "Proof for the involvement of brain Na+, K+-ATPase and ECS in behavior is summarized and it is hypothesized that ECS-Na+, K+-ATPase-induced activation of intracellular signaling participates in the mechanisms underlying BD. We propose that the activation of ERK, AKT, and NF\u03baB, resulting from ECS-Na+, K+-ATPase interaction, modifies neuronal activity and neurotransmission which, in turn, participate in the regulation of behavior and BD. These observations suggest Na+, K+-ATPase-mediated signaling is a potential target for drug development for the treatment of BD.Bipolar disorder (BD) is a severe and common chronic mental illness characterized by recurrent mood swings between depression and mania. The biological basis of the disease is poorly understood and its treatment is unsatisfactory. Although in past decades the \u201cmonoamine hypothesis\u201d has dominated our understanding of both the pathophysiology of depressive disorders and the action of pharmacological treatments, recent studies focus on the involvement of additional neurotransmitters/neuromodulators systems and cellular processes in BD. Here, evidence for the participation of Na Major depressive disorder, dysthymia, and bipolar disorder (BD), commonly referred to as depressive disorders, are a serious and devastating group of diseases. Affecting some 10% of the population, they pose a significant public health issue. These disorders are manifested by a combination of symptoms that interfere with the ability to work, study, sleep, eat, and enjoy once pleasurable activities. BD is one of the most distinct syndromes in psychiatry and has been described in numerous cultures over the course of history, in a manner suggesting considerable similarity of the syndrome in time and place ,3. BD is+, K+-ATPase and endogenous cardiac steroids (ECS) are involved in the etiology of BD. Although a complete description of Na+, K+-ATPase and ECS is beyond the scope of this article, a cursory review of these entities will be presented before focusing on their possible involvement in BD. The reader is referred to the excellent reviews on a more comprehensive presentation on Na+, K+-ATPase and CS-induced signaling included in this special issue of IJMS.Despite the devastating impact of BD on millions worldwide, the underlying mechanisms of the etiology and neurobiology of the disease is poorly understood. Historically, the brain systems that receive the greatest attention in neurobiological studies of mood disorders are the monoaminergic neurotransmission, which are distributed extensively throughout the network of limbic, striatal, and prefrontal cortical neuronal circuits that are thought to support the behavioral manifestations of mood disorders . This no+, K+-ATPase), an enzyme present in the plasma membrane of most eukaryotic cells, hydrolyzes ATP and uses the free energy to drive the transport of potassium into the cell and sodium out of the cell, against their electrochemical gradients. This pump is the major determinant of the Na+ and K+ electrochemical gradient. As such, it has an important role in regulating cell volume, plasma membrane electrical potential, as well as cytoplasmic pH and Ca2+ levels through the Na+/H+ and Na+/Ca2+ exchangers, respectively and in driving a variety of secondary transport processes [+, K+-ATPase is a hetero-oligomer composed of stoichiometric quantities of two major polypeptides: its \u03b1 and \u03b2-subunits. The 100\u2013112 kDa \u03b1-subunit is a multi-spanning membrane protein that is responsible for the catalytic and transport properties of the enzyme and contains the binding sites for the cations, ATP, cardiotonic steroids (CS) and a group of regulatory proteins [+, K+-ATPase and modulates ion transport [Sodium, potassium-activated adenosine triphosphatase , FXYD3 (Mat-8), FXYD4 (CHIF), and FXYD7), are auxiliary subunits of Na+, K+-ATPase and regulate pump activity in a tissue- and isoform-specific way [The \u03b11 subunit is essentially omnipresent at the tissue and cellular levels. The \u03b12 isoform is predominantly expressed in muscle  and brain (in astrocytes and glia cells) . The \u03b13 ific way ,33,38.+, K+-ATPase \u03b1 isoform elicit behavioral changes. Moseley and colleagues showed that \u03b11 heterozygous mice exhibit an increased locomotor response to AMPH, whereas \u03b12 heterozygous mice show reduced locomotor activity and increased anxiety-related behavior [2+/G301R) shows hypo-locomotion in female mice and a stronger response to aversive acoustic stimuli of both males and females, compared with WT mice [+/D801Y) in the \u03b13 isoform exhibited hyper-locomotion relative to WT mice and increased sensitivity to chemically-induced epileptic seizures [+, K+-ATPase activity is involved in determining behavior.Numerous studies have shown that mutations in the Nabehavior ,40. The behavior . The het WT mice . Mice haseizures . And finseizures , circadiseizures  as well seizures . CumulatCardiac steroids, which include cardenolides (such as ouabain and digoxin), and bufadienolides , have been used for centuries, and are used today to treat cardiac failure, arrhythmias, and other maladies in Western and Eastern medicine ,48,49,50+, K+-ATPase also acts as a signal transducer. The pioneering observation that the addition of low concentrations of ouabain to cultured neonatal cardiac myocytes or A7r5 smooth muscle cells rapidly activates Src [+, K+-ATPase interactions. For almost 20 years, research on the molecular basis of the CS-induced signaling, unequivocally led by Dr. Zijian Xie and his colleagues, has been conducted in many laboratories. These hundreds of studies have established that the interaction of CS with Na+, K+-ATPase is directly responsible for the activation of signal transduction cascades in cardiac myocytes, renal epithelial cells, neuronal, and several other cell types. The signaling activates Src, phopholipase C, MAPK, Akt, and reactive oxygen species, slows Ca2+ oscillation, and consequent NF\u03baB activation [+, K+-ATPase-mediated signaling is involved in many physiological processes, including cell growth, differentiation, inflammation, muscle contractility, kidney function, and behavior . In most, if not all, studies Na+, K+-ATPase-mediated signaling is manifested following the addition of CS. Hence, the so-called Na+, K+-ATPase-mediated signaling is actually CS-Na+, K+-ATPase-mediated signaling and strengthens the versatile roles of the ECS. Importantly, the activation of the intracellular signaling reactions by CS-Na+, K+-ATPase interactions occurs at cardenolide and bufadienolide concentrations (nM and sub-nM) similar to those found in the human circulation [It is now accepted that in addition to its main transport function, Naates Src  set the tivation ,75. It iculation ,69,71,76+, K+-ATPase/ECS system in BD:+, K+-ATPase \u03b1 subunit gene (ATP1A3) has been reported [+, K+-ATPase \u03b1 isoforms, suggests that this enzyme plays a role in the etiology of the disease [+, K+-ATPase \u03b13 isoform (Myshkin mice) induces manic-like behavior [An allelic association between BD and a Nareported . The sig disease . It was behavior .+, K+-ATPase activity in erythrocytes [+, K+-ATPase activity in bipolar illness showed a significant mood-state-related decrease in the enzyme\u2019s activity in both manic and BD patients [+, K+-ATPase density was significantly lower in BD patients than in major depressed and schizophrenic patients [+, K+-ATPase \u03b11 isoform expression was found in mice treated with the mood stabilizer lithium [BD has been consistently associated with abnormalities in Nahrocytes ,81. Metapatients . Furtherpatients . In addi lithium .The plasma levels of endogenous CS were significantly reduced in manic individuals, compared with those in normal controls ,85. The Numerous studies have demonstrated that intracerebroventricular (i.c.v.) injection of ouabain induces hyperactive behavior in rats ,88,89. AThe i.c.v. administration of highly specific and sensitive anti-ouabain antibodies, which lower brain ECS, resulted in anti-depressive effects, as measured in the forced swimming test in normal rats  as well Administration of amphetamine (AMPH), a potent central nervous system stimulant, to BALB/c and black Swiss mice, resulted in a marked increase in locomotor activity, accompanied by a threefold increase in brain ECS . The redAMPH caused oxidative stress in the hippocampus and frontal cortex, manifested by an increase in SOD and a decrease in CAT and GPx activity, and a reduction in NPSH and an increase in TBARS levels. The reduced brain ECS activity following i.c.v. administration of anti-ouabain antibodies protected against these AMPH-induced effects .Genetic, molecular, behavioral, and pharmacological studies in the past decade provided strong evidence for the involvement of the Na+, K+-ATPase, CS activate several intracellular signaling pathways, including ERK and Akt phosphorylation. Administration of ouabain in the lateral brain ventricle in rats resulted in mania-like hyperactivity, affording this experimental perturbation an animal model for mania [+, K+-ATPase. Such a sequence of events was proposed for the CS-induced effects on stimulation of cell viability [As described above and in detail in this issue, by interacting with Naor mania ,92,96. Ior mania . Phosphoor mania . It was or mania . These for mania . The resor mania , implicaor mania ,101, AMPiability , increasiability ,104, andiability .+, K+-ATPase activity and signaling and BD is depicted in + and K+ gradients across the plasma membrane, established by the ion transporting activity of Na+, K+-ATPase, are the main determinants of the resting membrane potential, directly influencing neuronal activity [+, K+-ATPase activity by CS [+, K+-ATPase induces the activation of intracellular signaling cascades, including Ca2+ oscillation and ERK, AKT, and NF\u03baB activation. It is well established that alterations in these intracellular signaling have profound effects on synaptic transmission and plasticity. This was documented repeatedly for ERK [The possible link between Naactivity . Synaptity by CS ,108,109. for ERK ,111,112, for ERK ,114,115, for ERK ,117,118 +, K+-ATPase-induced signaling is evolving. The goal of this overview was not to draw definitive conclusions about Na+, K+-ATPase signaling in BD but to summarize the current knowledge, and to discuss limitations and shortcomings in the existing research. The emerging literature provides exciting initial evidence suggesting that alterations in Na+, K+-ATPase signaling is involved in BD. However, additional work is necessary in order to establish a causal relationship between the two. The uncovering of the metabolism and physiological role of ECS in the brain is the fundamental need. Furthermore, pharmacological experiments evaluating the effects of ERK, AKT, and NF\u03baB inhibitors on behavior and examination of the consequence of alterations in ECS metabolism on Na+, K+-ATPase signaling may provide important information on the issue. A deeper and clearer understanding of the Na+, K+-ATPase-induced signaling cascades will establish a better understanding of the complex mechanisms underlying the pathophysiology of BD and may lead to new venues for the development of novel targets for the treatment of this disease.BD is a heterogeneous condition with a myriad symptoms varying in manifestation; dysregulation of numerous biochemical pathways has been suggested to be involved in its pathogenesis. Research in Na+, K+-ATPase\u201d, \u201couabain\u201d, \u201ccardiac steroids\u201d, \u201cintracellular signaling\u201d, \u201cERK\u201d, \u201cAKT\u201d, and \u201cNF\u03baB\u201d. No language or time constraints were applied. The lists of references were searched manually to find additional articlesThis review was based on search in the PUBMED data base for the key words \u201cbipolar disorder\u201d or \u201cdepression\u201d or \u201cmania\u201d with \u201cNa"}
+{"text": "Caenorhabditis elegans embryonic divisions and found several parameters that are altered at different stages in a reproducible manner. During early divisions, furrow ingression asymmetry and midbody inheritance is consistent, suggesting specific regulation of these events. During morphogenesis, we found several unexpected alterations to cytokinesis, including apical midbody migration in polarizing epithelial cells of the gut, pharynx and sensory neurons. Aurora B kinase, which is essential for several aspects of cytokinesis, remains apically localized in each of these tissues after internalization of midbody ring components. Aurora B inactivation disrupts cytokinesis and causes defects in apical structures, even if inactivated post-mitotically. Therefore, we demonstrate that cytokinesis is implemented in a specialized way during epithelial polarization and that Aurora B has a role in the formation of the apical surface.Although cytokinesis has been intensely studied, the way it is executed during development is not well understood, despite a long-standing appreciation that various aspects of cytokinesis vary across cell and tissue types. To address this, we investigated cytokinesis during the invariant  Highlighted Article: Investigations of cytokinesis reveal reproducible patterns during early embryonic development and specialized cytokinesis during epithelial polarization at morphogenesis in Caenorhabditis elegans. Caenorhabditis elegans embryonic divisions  cells can form a lumen, which begins with delivery of apical membrane proteins to the midbody . Absciss neurons  and reguroblasts . Epithelroblasts . The MBRs embryo . The MBRs embryo . FurtherC. elegans, cells complete the embryonic divisions and organize into tissues . We imaged NMY-2 (Movie\u00a01). The first furrow is slightly asymmetric . The MBR from the first mitotic division was always inherited by the P1 daughter cell  (Movie\u00a01). Therefore, multiple proteins remain on the MBR after internalization, which may affect its function in P1.The first mitotic division of P0 generates AB and P1 daughter cells A. We exaed NMY-2 , which led NMY-2 , which lymmetric  and the ter cell A,D,I,N,Sig.\u00a0S1H) . AIR-2 wFig.\u00a0S1I,J, Movie\u00a01), and remained associated with the MBR after it was engulfed (Movie\u00a01). NMY-2 and ZEN-4 also remained on the MBR (Movie\u00a01). RAB-11 briefly accumulated at the midbody in the first two mitotic divisions and was not observed on the MBR . Further, the P0 midbody was always inherited by EMS. Abscission timing was relatively fast in both AB and P1 cell divisions as indicated by microtubule disassembly . Disruption of polarity by par-3(RNAi) caused random midbody inheritance as previously observed . Therefore, both midbody inheritance and furrow symmetry depend on polarity in the early embryo.The MBR is reproducibly inherited in the early divisions. The AB MBR was invariably engulfed by EMS instead of either of the AB daughter cells . Using lattice light-sheet imaging, we observed E8 midbodies migrating to the nascent apical midline over 30\u2005min (Movie\u00a02). AIR-2::GFP localized on elongated spindle midzone microtubules during movement . The length of the spindle midzone microtubules relative to the cell was 0.47 (average 4.6\u2005\u03bcm/9.8\u2005\u03bcm) in the intestinal cell division, which is more than twice that of the early two cell divisions 0.17 (average 9.3\u2005\u03bcm/53.4\u2005\u03bcm) in P0 and 0.17 (average 7.7\u2005\u03bcm/44.3\u2005\u03bcm) in AB . Therefore, abscission occurs after the midbody migrates to the apical midline. To our knowledge, this is the first observation of apical migration of the midbody in C. elegans.We next analyzed cytokinesis during morphogenesis, which revealed several novel patterns. The intestine is derived from the E blastomere, which undergoes five embryonic divisions . The E8 m) in AB W. The mim) in AB X and 2I.Fig.\u00a0S2C,O, Movies\u00a02-4) after ZEN-4 and NMY-2 were internalized  colocalizing with the apical polarity marker PAR-6 . Endogenously tagged AIR-2::GFP and immunostained endogenous AIR-2 could also be observed at the apical midline . The centrosome also migrates to the midline during E16 polarization . In contrast, the first three E cell divisions exhibited symmetric furrowing . Therefore, after cytokinesis in the E8-E16 divisions, the MBR is internalized but Aurora B remains at the apical surface.We observed another novel behavior of Aurora B after the E8-E16 division. AIR-2::GFP remained localized at the apical midline . Therefore, apical RAB-11 localization is established during E8-E16 cytokinesis and intestinal epithelial polarization.RAB-11 vesicle trafficking of apical proteins to the midbody establishes the apical membrane in other systems . In C. edulthood . We imagFig.\u00a0S2M). The midbodies of the E16-E20 divisions also underwent apical migration after symmetrical furrowing (Movie\u00a05). Therefore, apical midbody migration occurs both during and after epithelial polarization in the intestine.The anterior and posterior pairs of E16 cells  undergo one last embryonic division to achieve the E20 intestine stage. In the four central E8 cells, which do not divide again , the midbody migrated to the midline at E8-E16 as described above. However, the midbodies from Eala, Eara, Eplp and Eprp migrated toward the midline at E8-E16, but the AIR-2 signal diminished (air-2(or207) (zen-4(or153) (spd-1(oj5) (Table\u00a0S1). Embryos shifted from 15\u00b0C to 26\u00b0C after 4.5\u2005h (corresponding to late E4 to early E8 stages) or 6.5\u2005h (corresponding to E8-E16 stage or early bean stage) showed significant lethality in both air-2(or207) and zen-4(or153), but not spd-1(oj5) (Table\u00a0S1). Mutant embryos shifted after most divisions had finished at the comma to 1.5-fold stage hatched at a rate similar to those at permissive temperature (Table\u00a0S1). The air-2(or207) mutant has penetrant cytokinesis failure immediately after inactivation in early embryos . Consistent with this, only mild lagging chromosome segregation defects were observed in older air-2(or207) mutants . A temperature-sensitive mutant of the INCENP homolog icp-1(or663ts) (n=22 divisions). Therefore, these mutants allow us to bypass early divisions but do not yield rapid-onset, highly penetrant cell division phenotypes later in development.We next investigated the function of Aurora B and other cytokinetic regulators during the E8-E16 division. To bypass the essential function of cytokinetic regulators during the early divisions, we inactivated temperature-sensitive (ts) mutants after isolating two-cell embryos and incubating them at the permissive temperature (15\u00b0C) until different stages before shifting them to the non-permissive temperature (26\u00b0C) until they hatched A. After 2(or207)  embryos 4(or153)  and spd-d-1(oj5)  embryos  embryos  but thisor663ts)  also didair-2(or207) mutant embryos shifted at the E4-E8 stage had reduced spindle midzone microtubules relative to wild type (Movie\u00a06). Inactivation of air-2(or207) caused cytokinesis failure in 27% of the observed E8 cells and a failure to normally polarize all nuclei at the midline . In air-2(or207) E8 cells that did not fail cytokinesis, weak spindle midzone microtubules moved to the apical surface where microtubules accumulated (Movie\u00a06). In neighboring cells that failed cytokinesis, microtubule accumulation at the apical midline was diminished, which was most obvious when both left and right E8 divisions failed at the same time . Therefore, AIR-2 regulates central spindle microtubules and completion of cytokinesis during the E8-E16 divisions. Furthermore, nuclear polarization and apical microtubule accumulation are disrupted when cytokinesis fails after inactivation of Aurora B.Next, we tested whether AIR-2 was required for the specialized E8-E16 divisions and epithelial polarization. We first asked whether microtubule organization required AIR-2. Movie\u00a07). HMP-1::GFP localized to the furrow and membrane adjacent to the midbody in the first three E cell divisions , indicating that this localization is not specific to the E8-E16 division. This dynamic adhesion localization during cytokinesis may be important to maintain proper cell contacts during the disruptive process of division in the early embryo. In air-2(or207) mutants, furrow HMP-1::GFP was reduced during E8 cytokinesis . In E8 air-2(or207) divisions that completed cytokinesis, HMP-1::GFP signal accumulated at the apical midline . However, in air-2(or207) E8 divisions that failed cytokinesis, accumulation of HMP-1::GFP was delayed especially when pairs of E8 daughters on opposite sides of the midline both failed . Therefore, Aurora B inactivation leads to reduced furrow localization of \u03b1-catenin and disrupts cytokinesis, delaying accumulation of \u03b1-catenin at the apical surface during polarization.The adhesion complex accumulates at the apical surface during polarization to promote gut lumen formation after the E8-E16 divisions . We imagair-2(or207), zen-4(or153), spd-1(oj5) and icp-1(or663) and frequently observed deformed and binucleate cells in air-2(or207) and zen-4(or153) but not spd-1(oj5) mutants . In all cases, ERM-1 was localized to the apical surface of the intestine and pharynx (air-2(or207) embryos (air-2(or207) embryos still had disrupted ERM-1 staining, indicating that these defects are not resolved later in development . Furthermore, the intestine was highly mispositioned within the embryo . zen-4(or153) embryos had penetrant branched and discontinuous apical ERM-1 staining that was mispositioned at a lower rate . spd-1(oj5) embryos displayed a significant but lower rate and severity of lumen defects  despite having no lethality (Table\u00a0S1) and minimal cytokinesis failures. We observed AIR-2::GFP dynamics in spd-1(oj5) E8-E16 divisions and found that AIR-2::GFP was lost from spindle midzone microtubules and instead accumulated at spindle poles, which moved to the apical surface in spd-1(oj5) embryos . Daughter cell pairs did not remain together in spd-1(oj5) embryos, indicating that spindle midzone facilitates polarization . Therefore, AIR-2::GFP can still reach the apical surface through a compensatory mechanism when SPD-1 is inactivated. This compensatory mechanism is not perfect, leading to significant but reduced lumen defects. Finally, icp-1(or663ts) mutant embryos also had abnormal ERM-1 staining . Therefore, we conclude that Aurora B, the spindle midzone and other regulators of cytokinesis are required for normal apical lumen formation in the gut.In order to understand the effect of cytokinesis failure on lumen formation, we performed staining of the polarized gut using apical markers. We shifted mutant E4-E8 embryos to 26\u00b0C and fixed after intestinal polarization. We evaluated the apical surface by staining for the Ezrin-Radixin-Moesin homolog ERM-1 . We stai mutants , Fig.\u00a0S6 pharynx A. Howeve embryos . Comma-se embryo E and then=23 animals), 19.7% in ZEN-4-depleted (n=10), 13.6% in NMY-2-depleted (n=7) and 3% in control (n=10) embryos, indicating significant rates of cytokinesis failure. We stained embryos with ERM-1 after gut polarization to observe lumen defects. We measured four points along the length of the gut lumen and obtained an average width. In control embryos, the apical lumen was 1.15\u00b10.11\u2005\u00b5m wide (n=10); AIR-2::GFP depletion caused lumens to be twice as wide on average , but only 1.27\u00b10.03\u2005\u00b5m in control embryos. Depletion of NMY-2::GFP  or ZEN-4::GFP  did not cause wide lumens, despite having cytokinesis failures . Therefore, tissue-specific depletion of Aurora B but not other cytokinetic regulators in the E8 gut leads to a highly consistent defect in the width of the lumen, consistent with a function for Aurora B at the apical surface.To inactivate AIR-2 more precisely, we tested whether tissue-specific depletion in the gut would cause lumen defects. We used a GFP-degradation system to deplete endogenously GFP-tagged Aurora B starting during the E8 stage . For comMovie\u00a08). We also used lattice light-sheet microscopy, which provides higher spatial resolution during the pharyngeal cell division (Movie\u00a09). PPCs underwent symmetric furrowing that yielded a centrally placed midbody between daughter cells (Movie\u00a08). PPC midbodies migrated from their central position between daughter cells toward the apical midline of the forming pharyngeal bulb (Movie\u00a09). In PPC terminal divisions, AIR-2::GFP appeared on the spindle midzone, migrated with the midbody to the apical midline and persisted there (Movie\u00a09). We confirmed apical localization using endogenously tagged AIR-2::GFP and immunofluorescence against endogenous AIR-2 . ZEN-4::GFP appeared on midbodies, migrated toward the apical surface, and rapidly disappeared . NMY-2::GFP also labeled midbodies and moved to the apical surface, but remained there during apical constriction . AIR-2 partially colocalized with PAR-6 and \u03b3-tubulin::GFP . HMP-1::GFP localized to the furrow and midbody as it migrated to the apical midline where it accumulated after polarization (air-2(or207), zen-4(or153) and icp-1(or663ts) mutant embryos . Therefore, similar patterns of symmetric furrowing, midbody migration and apical localization of AIR-2 are observed during epithelial polarization in the intestine and pharynx in C. elegans.We also observed cytokinesis during the terminal divisions in the pharynx. The pharynx forms from more than 80 pharyngeal precursor cells (PPCs) and the final divisions occur 310-325\u2005min after the first cleavage . PPCs potriction G-K . A group of at least six daughter cell pairs divided, initially forming multiple midbodies as observed with both confocal and lattice light-sheet imaging . These midbodies migrated into a central cluster over a 60-min time window , whereas ZEN-4 rapidly disappeared, suggesting that abscission and MBR internalization had occurred (Movie\u00a010). Cluster staining was observed with AIR-2 immunofluorescence or endogenous AIR-2::GFP . NMY-2::GFP migrated with the midbody to the cluster and persisted at the tip of the dendrites during extension (Movie\u00a010). PAR-6 localized to this cluster, indicating that this site is the apical surface of these cells, which also accumulates \u03b3-tubulin::GFP . Recently, it was found that SPCs form a multicellular rosette with PAR-6 at the center, indicating that the midbody moves to the apical surface at the center of this rosette structure . As dendrites extended, other AIR-2 foci formed within the anterior region of the embryo and migrated toward the tip until six sensilla appeared . Although the individual cell divisions could not be easily discerned, these data suggest that other sensilla in the tip of the animal form through a similar process. Neuronal cell polarization may share mechanisms with epithelial morphogenesis  mutants, we observed numerous defects in neuronal staining (Table\u00a0S2). zen-4(or153) larvae showed severe DiI staining defects, which was dramatically reduced if embryos were shifted after the final divisions at the comma to 1.5-fold stage . spd-1(oj5) animals had weak defects revealed by DiI staining but never showed a complete lack of staining . Therefore, several cytokinetic regulators, including AIR-2, are required for dendrite formation.We tested whether Aurora B kinase and other cytokinesis components were required for sensilla formation. Cilia that form at the end of sensilla dendrites are exposed to the environment and can take up lipophilic dyes such as DiI . We inacstaining B-E, incldyf-7 promoter . The primer sequences were as follows: AIR-2-mScarlet forward: GCAGCAAAAGATTGAAAAAGAAGCAAGTCTTCGAAATCACATGGTCTCCAAGGGAGAGG; AIR-2-mScarlet reverse: AGATGATTGAAAGAAGGACGGGAAAATCAGTAGTTGATCACTTGTAGAGCTCGTCCATTCC; AIR-2-GFP forward: GCAGCAAAAGATTGAAAAAGAAGCAAGTCTTCGAAATCACGGAGCATCGGGAGCC; AIR-2-GFP reverse: AGATGATTGAAAGAAGGACGGGAAAATCAGTAGTTGATCACTTGTAGAGCTCGTCCATTC. The guide RNA sequence is: UUGAAAAAGAAGCAAGUCUU.We followed the CRISPR/Cas9 protocol generated by the Seydoux lab for C-terminus GFP and mScarlet tagging of the r-2 gene . The repFor live imaging, young gravid hermaphrodites were dissected in M9 buffer containing polystyrene microspheres and sealed between two coverslips with petroleum jelly . Live-ceApical marker staining was performed with the freeze-crack methanol protocol . ImmunosDiI staining of wild type and temperature-sensitive mutants was performed as previously described . Two-celC. elegans embryonic lineage timing and adjusted according to DAPI staining to ensure each mutant was shifted at a similar stage of embryo development. To inactivate air-2(or207), mutant embryos were incubated for 5\u2005h at 15\u00b0C and shifted to 26\u00b0C for 3\u2005h to reach the bean stage or for 5\u2005h at 26\u00b0C to reach the comma stage. This was the minimum amount of time required to shift embryos to the non-permissive temperature and observe significant cytokinesis defects by the E8-E16 division, indicating significant reduction of AIR-2 function. Most embryos reached the E4-E8 division at the time of the shift. By live imaging we found that there was little disruption of the E4-E8 division under these conditions as air-2(or207) embryos (n=4/5) have eight normal E8 cells. N2, spd-1(oj5) and zen-4(or153) embryos were incubated for 4.5\u2005h at 15\u00b0C to reach the E4-E8 stage, followed by 3\u2005h at 26\u00b0C to reach the bean stage and 5\u2005h at 26\u00b0C to reach the comma stage. To shift embryos at the comma stage, air-2(or207) embryos were incubated for 12\u2005h at 15\u00b0C and N2, spd-1(oj5) and zen-4(or153) embryos were incubated for 11-11.5\u2005h at 15\u00b0C.Temperature-sensitive mutants were maintained at 15\u00b0C. To perform temperature shifts on staged embryos, gravid adults were transferred to a dissection chamber (<4\u00b0C), which was precooled in an ice bucket with 20\u2005\u03bcl of ice-cold M9 Buffer. Two-cell-stage embryos were quickly transferred (within a 5-10\u2005min time window) via mouth pipette  to Fisherbrand Hanging Drop Slides  on ice. The slide was placed into a humidified chamber and incubated at 15\u00b0C until the appropriate stages were reached, then shifted to 26\u00b0C. Incubation times were determined based on"}
+{"text": "Results showed that efficient removal of SA was achieved in this EMF system. At a charging voltage of 1.5 V and a electrolyte concentration of 15 mM, flow-through operation with a hydraulic retention time (HRT) of 2 h led to a high SA removal efficiency (80.4%), as expected from the improved contact reaction of this compound with ROS present at the anode surface. Cyclic voltammetry (CV) analysis indicated that the direct anodic oxidation played a minor role in SA degradation. Electron spin resonance (ESR) spectra demonstrated the production of \u2022OH in the EMF system. Compared to the cathodic polarization, anodic generated ROS was more likely responsible for SA removal. Scavenging tests suggested that adsorbed \u2022OH on the anode (>\u2022OH) played a dominant role in SA degradation, while \u2022OH. The calculated mineralization current efficiency (MCE) of the flow-through operated system 29.3% with this value much higher than that of the flow-by mode (5.1%). As a consequence, flow-through operation contributed to efficient oxidation of SA toward CO2 and nontoxic carboxylic acids accounting for 71.2% of initial C. These results demonstrate the potential of the EMF system to be used as an effective technology for water decontamination.Removal of sulfanilic acid (SA) from water is an urgent but still challenging task. Herein, we developed a low pressure electrochemical membrane filtration (EMF) system for SA decontamination using RuO Sulfanilic acid (SA) is one of the most widely-used sulfonated aromatic amines in the production of azo dyes, dyeing auxiliaries, food coloring, pharmaceuticals perfumes and pesticides  and ultrafiltration (UF), offers an attractive technology for water/wastewater due to its small footprint, and high efficiency in removing bacteria and colloidal/particulate matter  composite membrane. The performance in removing SA using this low-pressure composite membrane was investigated. Key questions to be addressed in the present work include (i) what about the electrochemical activity of the composite membrane? (ii) how do the operating conditions affect the removal behavior and oxidation efficiency of SA? (iii) what kinds of oxidants accounting for SA degradation?RuO2SO4 or 1 M NaOH when necessary. 1 mM piperazine- N,N\u2032-bis (ethanesulfonic acid) (PIPES) buffer was added to maintain a near-constant solution pH (pH = 7).All chemicals were of analytical reagent grade and used without any further purification. Titanium mesh  was obtained from Hebei Anheng company (China). Polyvinyli-dene fluoride (PVDF) materials were provided by Shanghai 3F (China). Polyethyleneglycole (PEG 600) and Dimethyl sulphoxide (DMSO) were obtained from Sinopharm (China). Sulfanilic acid (SA) (CAS number: 121-57-3) was purchased from Sigma-Aldrich (USA). Deionized water was used throughout the experiment. Solution pH was adjusted to 7 using 1 M HTitanium mesh was used in this study as the substrate of the electrode because of its corrosion resistance, good electrical conductivity and cost-effectiveness, as well as in view of the intrinsic drawbacks of the other metallic or non-metallic substrates, for instance, Ta, Zr, W, and Nb substrates are too expensive, while a Si substrate is quite brittle and has poor electrical conductivity  for 30 s to allow partial evaporation of the solvents and then immersed in a deionized water bath for phase-inversion at room temperature (25 \u00b1 1\u00b0C) to form membrane pores.The composite PVDF membrane was prepared by a phase inversion process. Membrane casting solution was prepared according to the procedure as documented elsewhere  . Linear sweep voltammetry (LSV) and cyclic voltammetry (CV) scans were carried out using the neutral electrolyte solution containing 1 mM PIPES and 15 mM Na2SO4  in a three-electrode cell driven by an electrochemical workstation , to characterize the electrochemical properties of the developed RuO2-TiO2@Ti/PVDF composite membrane and clarify the relevant anodic oxidation mechanism of this membrane, respectively. An Ag/AgCl and a Pt wire served as the reference electrode and the counter electrode, respectively. In particular, in LSV tests, RuO2-TiO2@Ti electrode and pristine PVDF membrane were used as the control.Surface morphologies of RuO2) acting as the physical filter and anode. Two composite membranes were assembled on a bracket to form a membrane module. The distance between the anode and cathodes was 1 cm. The external electric field was supplied by a DC power supply  during the electrolysis experiments. A perforated plexiglas tube was mounted below the membrane module to supply air (or nitrogen gas if needed) and scour the membrane surface.A schematic diagram of the electrochemical membrane reactor is shown in Figure 2O2, reactive oxygen species (ROS) and \u2022OH) were quantified. The membrane fluxes used in flow-through mode were 280, 140, 70, 35, and 28.3 L/(m2\u2022h), resulting in a hydraulic retention time (HRT) of 0.5, 1, 2, 4, and 6 h , respectively. Each experiment was initiated by adding 50 \u03bcM of SA  to 250 mL of air-saturated water  containing 1 mM PIPES buffer and 15 mM Na2SO4. The air or nitrogen gas was provided by an air pump with an aeration rate of 300 mL/min. The influence of electrolyte concentrations (Na2SO4)  on SA degradation was also investigated under flow-through mode. Samples extracted from the reaction cell (flow-by mode) and outlet of the membrane module (flow-through mode) were analyzed intermediately after filtration by 0.45 \u03bcm nylon syringe filters.To investigate the performance of SA removal under different electric field strength, experiments were first conducted with applied voltages of 0, 0.5, 1.0, 1.5, and 2.0 V under flow-by mode, in which the influent and effluent pumps were turned off. Further experiments were performed under flow-through mode with the influent and effluent pumps switched on, in which the concentrations of oxidants . The total organic carbon (TOC) concentrations of samples were analyzed by a TOC analyzer . Based on the TOC determination results, mineralization current efficiency (MCE) of the flow-by and flow-through system was evaluated according to the calculation protocols documented in Section S1.The concentrations of SA and its oxidation intermediates were measured using reversed-phase high-performance liquid chromatography  and/or ion-exclusion HPLC  or gas chromatography  with the detailed testing procedures as described in our previous work  or 30 mM 5,5-dimethypylpyrroline-1-oxide (DMPO)). After filtration, the steady-state concentration of oxidation products of probe compounds in effluent was determined intermediately. DCFH-DA, which is known to non-selectively react with ROS    signals of DMPO-\u2022OH were recorded on a Bruker EMX-10/12 spectrometer  equipped with a Super-X microwave bridge and an irradiation source of Quanta-Ray ND:YAG laser system. The EPR parameters were as follows: microwave frequency, 9.853 GHz; microwave power, 20 mW; modulation amplitude, 1 G; modulation frequency, 100 kHz.The quantification experiments of 2-TiO2@Ti electrode and RuO2-TiO2@Ti/PVDF membrane. It can be seen from Figure 2-TiO2@Ti electrode consisted of numerous fine particles (RuO2 and TiO2), which was confirmed by the EDS and XRD analysis  than TiO2. Figure 2-TiO2@Ti/PVDF membrane and the original PVDF membrane had similar water-permeability performance with this finding in agreement with the results of previous works in which embedding electrodes into polymeric membranes had no adverse influence on the formation of membrane pores in PVDF active layer  scan. As shown in Figure 2-TiO2@Ti anode, while the RuO2-TiO2@Ti anode performed slightly better at higher scanned potentials (>1.1 V), indicating that the casted membrane solution affected the conductivity of electrode though it still had favorable electrochemical properties  and dissolved organic pollutant removal induced by electrochemical oxidation.The electrochemical properties of the RuOKapp) for SA removal under flow-by mode .The charging voltage plays an important role in electrocatalytic reaction which governs the electron transfer rate and the generation of the specific oxidants  equivalent to that used in its flow-by operation. As shown in Figure Further experiments were performed in flow-through operated system in which the reactor was operated with the solution passing through the membrane at a constant membrane flux of 28.3 L mFigure p > 0.05). For lower concentrations (0 and 5 mM), a lower SA removal rate was observed, probably because a much lower concentrations of the electrolyte caused the increase in electric resistance of the solution, thus decreasing the oxidation efficiency.The influence of electrolyte concentration on SA degradation is shown in Figure 2O2, \u2022OH  ROS-mediated indirect oxidation initiated by HAs shown in Figure 2O2 in the flow-through operated system under oxic condition at different charging voltages. It is obvious that H2O2 production in the system was also positively correlated with the applied electric field strength in the range of 0 to 1.5 V. As the membrane anode is electrified, excitation of TiO2 leads to the presence of holes in the valence band (he2 surface (Equation 1). The generated he2O into O2 and H2 (Equations 2 and 3)    was applied. However, higher \u2022OH production gave rise to unobvious increase in SA removal . The use of anoxic condition can exclude cathodic reactions  by N2 sparging, and meanwhile ensure anodic oxidation to occur. As can be seen from Figure 2O2 alone   analysis were further performed to detect l Figure , likely e Figure , though \u2022OH that was diffused from the anode surface played a minor role in SA degradation. In contrast, the adsorbed \u2022OH on the anode (>\u2022OH) that could not be quenched by 2-propanol played a more important role. It is also worth noting that dosing TEMPOL to quench E0 (H2O2/H2O), the direct oxidation of SA by \u2022OH.Figure e Figure , suggest2, leading to production of holes in the valence band and electrons in the conduction band at TiO2 surface, and subsequently generation of ROS such as \u2022OH, 2O2. Meanwhile, the H2O molecule adsorbed on the surface of the RuO2 could lose electrons, being catalyzed to H+ and \u2022OH (Equation 10). Although indirect oxidation process was also observed at the cathode surface, it played a minor role in SA degradation in this system. The dominant oxidant responsible for SA degradation was determined to be the surface-adsorbed \u2022OH (>\u2022OH), while \u2022OH.Based on the above analysis, the electrocatalytic mechanism for SA degradation in the EMF system was proposed Figure . The maiAs discussed earlier, in the EMF system, flow-through operation led to more efficacious SA elimination than its flow-by mode in all conditions. Additional experiments were carried out with consideration given to TOC abatement and mineral current efficiency (MCE) of the EMF system under different operating modes. As can be seen from Figure 2 and nontoxic carboxylic acids, the EMF system developed in this study can be used as an alternative technique for purification of SA contaminated waters.Recent studies have shown that the degradation of SA during electrooxidation processes generates organic byproducts  of 2 h resulted in a high SA removal efficiency (80.4%). Cyclic voltammetry (CV) analysis indicated that the direct anodic oxidation played a minor role in the electrochemical oxidation of SA. Electron spin resonance (ESR) spectra demonstrated the production of \u2022OH in the EMF system. With the contribution of cathodic reactions excluded by N2 sparging, anodic generated ROS is more likely responsible for SA decay. Further scavenging test using 2-propanol to quench dissociated \u2022OH merely resulted in slight decrease in SA removal rates at charging voltages of 0.5~2.0 V, illustrating that the dissociated \u2022OH diffused from the anode surface played a minor role compared to adsorbed \u2022OH on the anode (>\u2022OH). Furthermore, it was found that \u2022OH. The calculated mineralization current efficiency (MCE) of the flow-through operated system was 29.3% with this value much higher than that of the flow-by one (5.1%), as expected from the improved contact reaction of contaminants with ROS present at the anode surface. Additionally, flow-through operation contributed to efficient oxidation of SA toward CO2 and nontoxic carboxylic acids which account for 71.2% of initial C.RuOJZ and KY carried out the experiment and wrote the manuscript; ZWu, JZ, and ML participated in the material preparation; ZWa supervised all the experiments and proofread the manuscript; KY and JZ contributed to the discussion.The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest."}
+{"text": "Leguminosae family. They are secreted peptides that mediate terminal differentiation of the endosymbionts, forming polyploid, non-cultivable cells with increased membrane permeability. NCRs form an extremely large family of peptides, which have four or six conserved cysteines but otherwise highly diverse amino acid sequences, resulting in a wide variety of anionic, neutral and cationic peptides. In vitro, many synthetic NCRs have strong antimicrobial activities against both Gram-negative and Gram-positive bacteria, including the ESKAPE strains and pathogenic fungi. The spectra and minimal bactericidal and anti-fungal concentrations of NCRs differ, indicating that, in addition to their charge, the amino acid composition and sequence also play important roles in their antimicrobial activity. NCRs attack the bacteria and fungi at the cell envelope and membrane as well as intracellularly, forming interactions with multiple essential cellular machineries. NCR-like peptides with similar symbiotic functions as the NCRs also exist in other branches of the Leguminosae family. Thus, legumes provide countless and so far unexplored sources of symbiotic peptides representing an enormous resource of pharmacologically interesting molecules.During endosymbiosis, bacteria live intracellularly in the symbiotic organ of their host. The host controls the proliferation of endosymbionts and prevents their spread to other tissues and organs. In Rhizobium-legume symbiosis the major host effectors are secreted nodule-specific cysteine-rich (NCR) peptides, produced exclusively in the symbiotic cells. NCRs have evolved in the Inverted Repeat Lacking Clade (IRLC) of the  Legumes are particular because they can form symbiosis with nitrogen fixing bacteria, which convert the atmospheric nitrogen into ammonia and satisfy the nitrogen need of the host plant . The symNCR genes are expressed in the symbiotic nodule cells but in different subsets at sequential stages of the differentiation process  and between C1 and C2, or proline (P) after C2. Due to the high diversity of amino acid composition, the isoelectric points (pI) of the M. truncatula NCR peptides vary between 3.5 and 11.25. In M. truncatula, 35% of the NCRs are anionic, 23% neutral and 42% cationic and almost equal numbers of genes code for NCRs with four and six cysteines. The high sequence variation also applies to these subgroups. As illustrated for the cationic (pI > 9) NCRs, the presence of the positively charged amino acids (K/R) is characteristic before C2 and in front of C3 and C4 in NCR 4Cs and 6Cs, respectively. Moreover, threonine (T) is frequent after C1X in NCR 4Cs but not in the 6Cs.There are \u223c700 ositions . In 95% ositions  and Clusositions  where thositions . Beside in planta functions as replacement of a single cysteine with serine resulted in the inactivation of the Medicago-specific NCR169 peptide , altering the position of the disulfide bridges, breaking the bridges by reduction (NCR247red) or omitting the cysteines, all affected but to a different extent the peptides\u2019 activities and stability  that is a hallmark related to their antimicrobial properties  of NCR247 is one of the highest among all known proteins and indeed it possesses extreme protein binding ability . Half ofransport .in vitro for rhizobia, none of the tested anionic peptides, except for NCR211 affected the survival of rhizobia  and Gram-positive  bacteria, including diverse human/animal and plant pathogens. The peptides, added to 107, bacteria for 3 h, killed to various extent all these tested bacteria resulting in their complete elimination or decrease in the number of surviving cells from one to several orders of magnitude, depending on the strain and the peptide  and NCR335 (net charge +14) which were classified with four and two different AMP prediction tools as AMPs, respectively . NCR335  peptide . In geneEnterococcus faecalis, S. aureus, Klebsiella pneumoniae, Acinetobacter baumannii, P. aeruginosa) and E. coli, L. monocytogenes, and S. enterica  retained its activity on E. coli but lost its effectiveness on other bacteria. To improve its antimicrobial properties, NCR247C was fused with NCR3357\u201319 (X1) or mastoparan4\u201314 (X2) deriving from the 14 amino acid long mastoparan, a membranolytic peptide toxin from wasp venom. Each of these chimeric peptides possessed higher antibacterial efficacy and affected the antimicrobial spectrum. In the case of X1-NCR247C the minimal bactericidal concentrations (MBC) varied between 1.6 and 12.5 \u03bcM. C- or N-terminal fusion of NCR247C with X2 made the chimeric peptides very effective on most strains at 1.6 and 3.1 \u03bcM MBCs. The MBCs of these chimeric derivatives were much lower than that of the classical antibiotic carbenicillin, and were comparable or even more effective than levofloxacin, a third generation antibiotic  pathogens. AMPs, like the cationic NCRs, are multifunctional. They can interact with the membranes with or without membrane permeabilization and intracellularly they can affect transcription, translation, enzyme activities causing ultimately microbial death . A few A\u00c9K conceptualized the manuscript. RL and SK analyzed the peptide sequences and provided the The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest."}
+{"text": "Accurately differentiating dementia subtypes, such as Alzheimer\u2019s disease (AD) and Lewy body disease [including dementia with Lewy bodies (DLB) and Parkinson\u2019s disease dementia (PDD)] is important to ensure appropriate management and treatment of the disease. Similarities in clinical presentation create difficulties for differential diagnosis. Simple supportive markers, such as balance assessments, may be useful to the diagnostic toolkit. This study aimed to identify differences in balance impairments between different dementia disease subtypes and normal aging using a single triaxial accelerometer.n = 31), dementia with Lewy bodies , Parkinson\u2019s disease dementia , and normal aging controls (n = 27). Participants were asked to stand still for 2 minutes in a standardized position with their eyes open while wearing a single triaxial accelerometer on their lower back. Seven balance characteristics were derived, including jerk , root mean square , and ellipsis. Mann\u2013Whitney U tests identified the balance differences between groups. Receiver operating characteristics and area under the curve (AUC) determined the overall accuracy of the selected balance characteristics.Ninety-seven participants were recruited, forming four groups: cognitive impairment due to Alzheimer\u2019s disease , mediolateral (p = 0.005), and anterior\u2013posterior (p = 0.001)] and ellipsis scores (p < 0.002) than the AD group (AUC = 0.71\u20130.82). The PDD group also demonstrated significantly impaired balance across all characteristics (p \u2264 0.001) compared to the controls (AUC = 0.79\u20130.83). Balance differences were not significant between PDD and DLB (AUC = 0.69\u20130.74), DLB and AD (AUC = 0.50\u20130.65), DLB and controls (AUC = 0.62\u20130.68), or AD and controls (AUC = 0.55\u20130.67) following Bonferroni correction.The PDD group demonstrated higher RMS [combined (Although feasible and quick to conduct, key findings suggest that an accelerometer-based balance during quiet standing does not differentiate dementia disease subtypes accurately. Assessments that challenge balance more, such as gait or standing with eyes closed, may prove more effective to support differential diagnosis. Assessing motor performance, such as gait and balance, in the aging population may be a useful clinical tool for predicting a range of clinical outcomes, such as falls risk, neurological disorders, cognitive impairment, and mortality . RecentlMotor assessments that require minimal space and time may be an avenue of interest for differential diagnosis, such as balance assessment. Maintaining postural control  requires coordination from multiple body systems, including the vestibular, cognitive, visual, somatosensory, and motor systems ; balanceWith the advent of accelerometer-based wearable technology, conducting balance assessments in constrained settings such as a clinic is increasingly feasible , 2012b. As such, the primary aims of this study were to (1) examine differences in the accelerometer-derived balance characteristics between dementia disease subtypes  and (2) between dementia disease subtypes and normal aging. A secondary aim was to (3) explore the associations between clinical and cognitive characteristics with balance characteristics in dementia disease subtypes. We hypothesize that (1) Lewy body disease groups  will demonstrate significantly larger jerk, RMS, and ellipsis compared to AD; (2) all dementia disease subtypes will have significantly worse postural instability compared to controls; and (3) slower information processing, greater executive dysfunction, worse motor performance, and lower balance confidence will be significantly correlated with impaired balance characteristics in all dementia disease subtypes.via ongoing research studies. The inclusion/exclusion criteria can be found elsewhere (Participants with probable mild cognitive impairment (MCI) or probable dementia due to AD, DLB, and PDD and older adult controls were recruited to the GaitDem Study at Newcastle University. Participants were identified by clinicians in old age psychiatry, geriatric medicine, or neurology services, recruited from a local research case register (the North East DeNDRoN Case Register), or lsewhere . All parvia review of medical notes and assessments; disagreements were adjudicated by a third clinician. The relevant diagnostic criteria for dementia due to AD  . PremorbGlobal cognition was measured using both the standardized Mini Mental State Examination (sMMSE)  and the A small accelerometer-based wearable  was attached to the participants\u2019 lower back in the L5 position using a double-sided hydrogel adhesive and a Hypafix medical plaster. Participants were asked to stand with heels 10 cm apart, maintaining an upright position with arms by their sides and eyes open for 2 min. Participants wore shoes during the assessment. Researchers stood close by in case of adverse events.\u00ae script. Accelerations in the anteroposterior and mediolateral planes were of particular interest. Data were filtered using fourth-order zero phase, low-pass Butterworth filter. The cutoff frequency was 3.5 Hz  . Three cU tests and independent t tests identified where the differences lay between groups. As all balance characteristics were not normally distributed, Kruskal\u2013Wallis tests and Mann\u2013Whitney U tests were used to identify differences between groups. Bonferroni corrections (p \u2264 0.007) were applied to account for multiple comparisons. There was one significant outlier in the control group; we assessed group differences with and without the outlier and found no difference to our interpretation of results, so we retained this participant. Receiver operating characteristics and area under the curve (AUC) were used to determine the accuracy of discrete balance characteristics and were interpreted as follows: 0.5\u20130.7 = low accuracy, 0.7\u20130.9 = acceptable accuracy, and 0.9\u20131 = high accuracy. As the data were not normally distributed, Spearman\u2019s correlations were used to explore associations between balance impairments and the demographic, clinical, and cognitive measures.Normality of data was assessed using the Shapiro\u2013Wilk test and inspection of the histograms and box plots. Chi-squared tests identified differences between groups for sex and faller status. Kruskal\u2013Wallis tests and one-way analysis of variance (ANOVA) examined differences between groups for all demographic, cognitive, and clinical variables. Mann\u2013Whitney n = 3), and inability to complete the balance assessment (n = 13).One hundred twenty-five participants were recruited to the study; 97 participants were included in this analysis. The reasons for exclusion were as follows: clinical diagnosis other than AD, DLB, PDD, or control , withdrawal from the study , and mediolateral (ML) directions see . They alCompared to the controls, both the PDD and DLB groups demonstrated significantly larger jerk in the combined, AP, and ML directions, larger RMS in the combined and AP directions, and larger ellipsis see . The PDDp = 0.018) and AP RMS  and larger ellipsis . Greater motor problems, as measured by UPDRS-III, was associated with greater RMS AP , ML , and AP jerk , greater combined  and ML RMS , and larger ellipsis . Similar findings were found between the FAS verbal fluency test with jerk AP  and RMS ML . Slower information processing, as measured by TMT-A, was significantly associated with greater combined , ML , and AP jerk .In AD, older age was associated with greater combined , as measured by the ACE-III visuospatial subscale, and quicker information processing  were associated with greater jerk ML (see p = 0.035).In DLB, better visuospatial abilities .In PDD, worse balance confidence, as measured by the ABC scale, was associated with greater jerk ML   associatA main strength of this study was that all participants\u2019 diagnoses were confirmed by clinicians\u2019 consensus based on clinical notes and well-characterized clinical and cognitive profiles. However, while this lends confidence to our results, diagnosis of dementia subtype can only be confirmed postmortem, which was beyond the scope of this study. We also looked at groups across the spectrum of cognitive impairment, which was deemed feasible as the MCI and dementia participants were indistinguishable in terms of balance impairments. However, there are limits to this approach; although we applied validated criteria for MCI due to dementia disease subtype , not allIn conclusion, this study found that static eyes-open balance assessments could only acceptably differentiate PDD from AD and controls. Static eyes-open balance assessment is not a useful differential marker of AD and DLB or for distinguishing general cognitive impairment from normal ageing. In line with previous work in PD, associations were found between slower information processing and greater executive dysfunction with balance impairments, suggesting that cognition may play a role in safely maintaining balance. Future research could examine the impact of alternative conditions, such as eyes closed or dual tasks, on balance across dementia disease subtypes as this may prove a more fruitful endeavor.lynn.rochester@ncl.ac.uk).The datasets generated and analyzed for this study can be made available by request with permission of the GaitDem Data Management team (The studies involving human participants were reviewed and approved by the NHS Local Research Ethics Committee, Newcastle and North Tyneside 1. The patients/participants provided their written informed consent to participate in this study.LR, BG, AT, LA, and RM contributed to the conception and design of this study. RM and LA collected the data for this study. RM, CB, SD, and LA organized the database. RM and SP performed the statistical analysis and wrote the first draft of the manuscript. All authors contributed to the manuscript revision and read and approved the submitted version.The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest."}
+{"text": "Amiodarone is known for its efficacy as an antiarrhythmic agent; however, its extensive side-effect profile requires careful selection of patients and frequent monitoring. The purpose of this study was to evaluate the performance of the baseline tests before initiating amiodarone therapy and the on-going monitoring based on the North American Society of Pacing and Electrophysiology guidelines recommendations.A retrospective descriptive charts review study included all patients who are 18\u2009years of age and older and were started on oral amiodarone with a primary diagnosis of any type of cardiac arrhythmia from January 2016 to December 2018 in King Abdualziz Medical City, Riyadh, Saudi Arabia. The medical charts were reviewed\u00a0and evaluated based on the performance of the recommended baseline and follow-up of chest X-ray (CXR), liver function test (LFT), thyroid function test (TFT) and electrocardiogram (ECG).\u00a0The continuous variables were analyzed and presented as mean\u2009\u00b1\u2009SD and the\u00a0categorical variables were presented as percentages.Over the study period, 143 eligible participants on amiodarone therapy\u00a0were included, with an average of 165\u2009\u00b1\u2009207\u2009days on amiodarone. Of patients, 36.4% had the entire recommended baseline assessments before initiating amiodarone. Our results indicated optimal compliance rates to the baseline tests of CXR (79.7%), LFT (79.7%) and ECG (86.7%). However, there was\u00a0a\u00a0lower compliance\u00a0rate to TFT\u00a0recommendations (40.6%). The\u00a0compliance rate to the guideline recommendations related to the\u00a0follow-up tests was minimal. On-going monitoring performance rates were 47.6% of CXR, 49% of LFT, 54.5% of ECG and 22.4% of TFT.The compliance with\u00a0the guideline recommendations related to amiodarone baseline assessments was optimal for all the baseline tests, except for TFT. However, the proportion of patients who received all the recommended baseline assessments was minimal. In addition, the performance of on-going monitoring was suboptimal for all the follow-up tests. Improvements could be made by establishing a\u00a0local protocol for amiodarone monitoring and pharmacists participating in amiodarone therapy assessments. Amiodarone is one of the most commonly prescribed antiarrhythmic drugs to treat supraventricular and ventricular arrhythmias , as wellCurrent practice at King Abdualziz Medical City (KAMC) regarding baseline assessments and frequent monitoring of amiodarone related toxicity is unknown. In addition, data on the compliance with laboratory monitoring for patient starting amiodarone therapy in Saudi Arabia are lacking and has not been previously reported. The study aims to assess the compliance with the baseline and follow-up tests recommended by the North American Society of Pacing and Electrophysiology (NASPE) guideline for patients started on amiodarone therapy. The NASPE guideline was published in 2000 and updated in 2007 .A retrospective descriptive study that\u00a0included the\u00a0patients who received amiodarone therapy with a\u00a0primary diagnosis of any type of cardiac arrhythmia at KAMC from January 2016 to December 2018. All data were collected from the Best-Care electronic medical records system. The extracted patients data were demographics (age and gender), past medical history, date of amiodarone initiation, the\u00a0indication of amiodarone therapy, duration of amiodarone therapy and baseline and follow-up laboratory tests performances, including CXR, LFT, TFT and ECG. Initially, PFTs were collected, but due to the negligible number of performances, they were not analyzed and reported in the study.\u00a0Amiodarone monitoring is defined as performing CXR, ECG, any TFTs including free or total T3, free or total T4, or TSH and any LFTs, which include ALT or AST.Excluded participants were patients younger than 18\u2009years of age, patients with a\u00a0history of abnormal baseline thyroid function (either hypothyroidism or hyperthyroidism), patients with a\u00a0history of abnormal baseline liver function test defined as a\u00a0baseline that is three times upper the normal limit (3\u2009\u00d7\u2009ULN) and patients who were prescribed thyroxin. Abnormal thyroid function is classified as either hypothyroidism or hyperthyroidism based on the following normal ranges which are provided in the Best-Care system: TSH of 0.5\u20136 uU/ml, Free T4 of 0.7\u20131.9\u2009ng/dl and Free T3 of 230\u2013619\u2009pg/dl. Abnormal baseline liver function is defined as either ALT that is 3\u2009\u00d7\u2009ULN of 5\u201355\u2009U/L or AST that is 3\u2009\u00d7\u2009ULN of 5\u201334\u2009U/L.Participants were considered to have a complete functional amiodarone profile in the study if TSH, LFT, CXR and ECG were all performed before the initiation of amiodarone therapy. The appropriate baseline and follow-up monitoring recommended by the NASPE guidelines are provided in Table\u00a0The included patients medical records were evaluated for the recommended baseline laboratory monitoring before the initiation of amiodarone and further follow-up monitoring based on the NASPE recommendations. Data are presented as patient and test-specific variables that were entered into an Excel sheet and descriptive statistics were applied to determine the proportion of the\u00a0patients who received the\u00a0appropriate amiodarone baseline testing and follow-up monitoring..Overall, the study included 143 eligible participants. The mean age of the\u00a0participants is 65\u2009\u00b1\u200914.68\u2009years with males representing 60.1%. Further participants characteristics are listed in Table\u00a03Amiodarone was mainly indicated for atrial fibrillation in 108 (75.52%) of participants. Into lesser extents, it was initiated for ventricular tachycardia, atrial flutter, premature ventricular contraction, atrial tachycardia and ventricular fibrillation in 16 (11.20%), 12 (8.40%), 4 (2.80%), 2 (1.40%) and 1 (0.70%) patient(s), respectively. The\u00a0patients were on amiodarone therapy for an average of 165\u2009\u00b1\u2009207\u2009days.There were optimal compliance rates to the NASPE recommendations in terms of\u00a0preforming\u00a0the baseline monitoring of CXR, LFT and ECG in 114 (79.7%), 114 (79.7%) and 124 (86.7%) patients, respectively. However, baseline assessments of thyroid function were surprisingly suboptimal, as they were only performed to 58 (40.6%) patients. Overall, only 52 (36.4%) patients received the\u00a0complete baseline monitoring tests.The\u00a0compliance with the guidelines recommendations was low in terms of performing the\u00a0on-going monitoring\u00a0examinations. Low performance rates were observed for CXR, LFT and ECG follow-ups in 68 (47.6%), 70 (49%) and 78 (54.5%) patients, respectively. An\u00a0extremely lower performance rate was for TFT, as it was received by 32 (22.4%) patients only.This study aimed to assess the compliance rate to the NASPE guidelines recommendations in\u00a0terms of baseline assessments and follow-up related to amiodarone therapy at KAMC, Riyadh, Saudi Arabia. Locally, similar studies are lacking; raising the necessity for the current study. The compliance was assessed by evaluating the rate of CXR, LFT, TFT and ECG performances at baseline, prior to amiodarone therapy initiation, and as ongoing follow-up. The compliance rate to the baseline\u00a0of CXR and LFT recommendations in our institution was 79.7%. Among the patients on chronic amiodarone therapy, 86.7% had ECG performed and 40.6% had TFT measured. Distinguishably, TFT baseline is rarely evaluated, which is of concern. Despite thyroid toxicity being one of the most amiodarone reported adverse effects, it appears\u00a0that there is a lack of awareness in our institution on TFT monitoring importance . CompariThe limitations of the study include the retrospective nature of the study, performing the study in a single center, the limited sample size and the possibility of overestimating guideline compliance rates as the purpose of some of the performed tests is not certainly intended for amiodarone monitoring.The compliance with the NASPE guidelines on amiodarone baseline monitoring of CXR, LFT, and ECG was optimal. However, the recommendation on baseline TFT assessment was minimally adhered. The number of patients who received all the recommended baseline tests was minimal. The study indicated\u00a0a suboptimal amiodarone follow-up in the local setting. Opportunities to enhance amiodarone monitoring exist. Improvements could be established by implementing a local amiodarone monitoring protocol based on international guidelines. In addition, based on the literature, involving pharmacists in amiodarone monitoring is proven to optimize amiodarone monitoring practice."}
+{"text": "Slipped capital femoral epiphysis (SCFE) is a frequent\u00a0cause of nontraumatic painful hip of the adolescence. It is the result of the separation of the proximal femoral growth cartilage at the level of the hypertrophic cell zone. The femoral neck metaphysis rotates externally and migrates proximally relative to the femoral head epiphysis, which is stably seated in the acetabulum; early diagnosis and in situ stabilization grants the best long term results. Numerous\u00a0factors affect treatment outcomes. Not all implants have the same effect on the slipped physis. Application\u00a0of the traditionally used implants, such as non-threaded pins and cannulated screws, is questioned.\u00a0Modern implants are available, which stabilize the slip without accelerating physis fusion. This allows femoral head and neck growth and remodeling to limit the post-slip sequellae on hip anatomy and function. Femoroacetabular impingement (FAI) complicates almost all slips.\u00a0It\u00a0causes\u00a0progressive labral and articular cartilage damage\u00a0and leads to early hip osteoarthritis and total hip replacement, approximately ten years earlier compared to the general population. Avascular necrosis of the femoral head is a dramatic complication, seen almost exclusively in unstable slips. It develops within months after the slip and leads to immediate articular joint degeneration and the need for total hip replacement. Another serious complication of SCFE is chondrolysis, which is a rapid\u00a0progressive articular cartilage degeneration leading to a narrow joint space and restriction of hip motion. Implant-related complications, such as migration and loosening, may lead to the progression of the slip.\u00a0Though bilateral disease is quite frequent, there is no consensus about the need for preventive surgery on the healthy contralateral hip.\u00a0Diagnosis of SCFE is frequently missed or delayed, leading to slips of higher severity.\u00a0Silent slippage of the capital femoral epiphysis is highly suspected as an underlying cause of cam-type FAI and early-onset hip osteoarthritis. There is controversy, whether asymptomatic implants should be removed.\u00a0Novel surgical techniques, such as the modified Dunn procedure and hip arthroscopy, seem to be effective modalities for the prevention\u00a0of FAI in SCFE. Slipped capital femoral epiphysis (SCFE) is a frequent cause of a nontraumatic painful hip of the adolescence ,2. The fIn spite of the simplicity of SCFE pathology and\u00a0subsequent treatment (\u201cone single screw\u201d!), it seems that this disease bothers the patient for the rest of his life; since long term sequelae\u00a0or complications of SCFE are not always fully reversible, or may even progress, leading to early-onset disability\u00a0and need for early hip reconstruction surgery ,2.Questions are awaiting an answer:1.\u00a0Is the remaining growth of the proximal femur a risk factor for complications or an opportunity to obtain better long term results after SCFE treatment?2.\u00a0Is it possible to curtail catastrophic complications, such as avascular necrosis or chondrolysis?3.\u00a0Is femoroacetabular impingement a part of the natural history of SCFE or a complication?4.\u00a0Is additional surgery, either to prophylactically stabilize a healthy contralateral hip or to remove asymptomatic hardware of the primarily affected hip necessary?5.\u00a0Is the mechanism of slippage of the proximal femoral epiphysis a silent ongoing procedure that ultimately results in the degeneration of a\u00a0previously healthy hip?6.\u00a0What is the role of hip arthroscopy or the modified Dunn procedure in the treatment of SCFE?1. Implants used for the treatment of slipped capital femoral epiphysisSlip stabilization is the main goal of any treatment of slipped capital femoral epiphysis (SCFE).\u00a0This is achieved either with implants routinely used in the orthopedic practice, such as cannulated screws and pins, or implants specifically designed for the treatment of SCFE, such as the telescopic screw and\u00a0the pin-screw. All implants are effective in stabilizing the slip; however, they have different impacts on\u00a0the growing potential of the\u00a0femoral neck growth cartilage.In situ stabilization of the capital femoral epiphysis on the femoral neck metaphysis with one 6-7 mm cannulated screw is the widely accepted treatment for both stable and unstable SCFE Figure  1]. The. The1]. The\u00a0screw is inserted under\u00a0image intensification\u00a0and, ideally, traverses\u00a0the center of the capital femoral epiphysis vertically, as seen in the anteroposterior and lateral hip views. Three to five threads of the screw are anchored into the proximal femoral epiphysis to obtain a stable fixation of the slip\u00a0. The impIntraoperative arthrography or computer navigation may be implemented in order to insert the screw close to the subchondral bone\u00a0without breaching the articular cartilage\u00a0.Multiple (two to three) smooth stainless steel pins through\u00a0the\u00a0growth plate, driven up to 2 mm from the subchondral bone of the capital femoral epiphysis, are also a\u00a0safe option to stabilize the slip  PinsPercutaneously inserted 2-3\u00a0smooth pins (5-6mm) across the femoral neck growth plate\u00a0are effective in stabilizing the slip without accelerating physis fusion ,3.2.b. The Gliding Screw PrincipleA special surgical technique may allow the typical cannulated screw to stabilize\u00a0the physis\u00a0without promoting early fusion. The tip of the screw has only a few threads that are contained in the proximal femoral epiphysis. The shaft of the screw is long enough to protrude 1.5-3 cm out of the lateral cortex of the femur. For an expected residual growth of 2-3 years, the screw, firmly anchored in the capital femoral epiphysis, glides into the growing femoral neck, until the head of the screw abuts the lateral femoral cortex. At this point, the screw stops gliding, and with further growth, the screw practically compresses the physis. If further growth is expected, the screw has to be replaced by a longer one\u00a0- based on the same principle of gliding - to resume growth-preserving stabilization ..28]. TheOn the contrary, radiologic signs of SCFE and post-slip radiologic signs indicating FAI , do not always correlate with the severity of the\u00a0clinical presentation of FAI . This isThe frequency of SCFE in the total number of total hip replacement (THR) is relatively low. Among\u00a0370,630 primary total hip arthroplasties (THAs) reported from the Nordic Arthroplasty Register\u00a0Association for 1995-2009, SCFE and Perthes' disease\u00a0as a group was reported to be responsible for only 0.6% of primary THRs\u00a0. However3.d.\u00a0Implant-Related ComplicationsTreatment for SCFE bears complications that are related to the surgical technique and the type of implant that is used . Non-thr4. Simultaneous stabilization of the asymptomatic contralateral hipThe incidence of bilateral SCFE\u00a0is quite frequent. Most reports agree with an assessment of 50% bilateral hip disease within two years of the primary hip SCFE ,16,32. TSimultaneous contralateral hip treatment is still a controversy among orthopedics. The contralateral hip will always be treated if\u00a0symptomatic , even without radiologic evidence of a slip or a pre-slip.\u00a0It should also be operated\u00a0if it is asymptomatic, but with an x-ray of\u00a0a\u00a0slip or a pre-slip (wide physis). There is no consensus whether the clinically and radiologically normal contralateral hip should receive preventive\u00a0stabilization, simultaneously with the symptomatic index hip,\u00a0in order to\u00a0avoid a future contralateral slip ,34.Studies against simultaneous preventive surgery of the painless contralateral hip state, that this additional procedure may present complications such as AVN and\u00a0chondrolysis\u00a0as well\u00a0,7,16.\u00a0OtStudies that\u00a0favor\u00a0simultaneous surgery of the asymptomatic contralateral hip support the\u00a0rationale that preventive physis stabilization has low perioperative morbidity and\u00a0complications compared with therapeutic SCFE surgery . Other sEfforts have been made to predict the risk of contralateral hip SCFE, in order to select patients with\u00a0for targeted preventive contralateral physis stabilization .The posterior sloping angle (PSA) of the femoral neck is calculated on the frog lateral pelvis view. It\u00a0is the angle between the line of the physis and a line vertical on the femoral neck-shaft axis. The PSA differs between SCFE and healthy hips . StudiesThe modified Oxford score assesses the risk of contralateral SCFE by scoring five radiologic factors on the anteroposterior pelvis projection: Stages of maturation of the iliac crest, the triradiate cartilage of the acetabulum, the proximal femoral epiphysis, the trochanter major and the trochanter minor receive a score. A lower total score indicates a more immature patient with a higher risk of future contralateral SCFE .The maturation of the triradiate cartilage of the acetabulum is useful\u00a0as an independent\u00a0prognostic factor for increased contralateral SCFE\u00a0risk. Wide-Open triradiate cartilage has a probability of\u00a089%\u00a0for future contralateral SCFE .The alpha angle has also been studied as an independent\u00a0prognostic factor for\u00a0future contralateral hip disease: an alpha angle >50.5\u2070 implies a higher\u00a0risk of impending contralateral SCFE and is suggested as a cut-off point for contralateral preventive surgery ,36.Early intervention on the asymptomatic contralateral hip should always be\u00a0considered in the presence of\u00a0obesity , young age , female patient and underlying hormonal\u00a0disease ,34,37.5. SCFE pathology contribution to primary hip osteoarthritis5.a.\u00a0Silent SCFEHip pathology indicating a previous slip has been frequently reported\u00a0in adults. Radiological findings resembling a prior silent SCFE were found in 6.6% of\u00a0a cohort of 2072 healthy young adults . A retroIt has been suggested that this frequent finding of\u00a0SCFE morphology in\u00a0hip osteoarthritis\u00a0may be the result of a subclinical (silent or\u00a0asymptomatic) SCFE, which stops with growth plate closure. Beyond some point, and depending on other patient-related factors, these silent slips cause symptoms of FAI in the adult.\u00a0A slip angle greater than 13\u2070 at growth plate fusion without a\u00a0history of hip pathology  when the patient was an adolescent, confirms the diagnosis of an asymptomatic SCFE .\u00a05.b. FAI-associated Femoral Neck Deformity:\u00a0Post-Slip vs. Slip-LikeThe origin of proximal femoral deformity, which is associated with cam-type FAI, is controversial. It is certain that SCFE leads to proximal femoral deformity, which is termed pistol-grip deformity and leads to cam-type FAI. However, not all cam-type FAIs are the result of SCFE.Decades ago, Murray described the\u00a0\"tilt deformity of the femoral head\", which\u00a0is a deformity of the proximal femur similar to the pistol grip deformity observed after SCFE. Murray examined the radiographs of 200 patients with primary osteoarthritis (no history of hip disease during childhood) and found that the \"tilt deformity of the femoral head\" was present in\u00a039.5% of cases . This deWhether the tilt deformity of the femoral head\u00a0is the result of an undiagnosed SCFE is not clear. A positive fovea sign (the neck axis does not intersect the fovea capitis) and a tilt-angle of the femoral head  greater than 4\u2070 are suggested to define a slip-like deformity, similar to the deformity observed after known SCFE . Among 26. Delayed or missed diagnosis of SCFEDelay\u00a0or even loss of diagnosis of SCFE is probably the most important factor that affects the long-term outcomes of SCFE ,38,40,41Several factors lead to delayed diagnosis of SCFE. The patient and his family may neglect minor hip pain or limping and never seek medical advice. Geographical factors may be an obstacle to easy access to any health care system. Unfortunately,\u00a0in almost half of the cases, the cause of delayed\u00a0diagnosis is\u00a0the physician, who first examines the nontraumatic, limping, obese adolescent. In this case, the delayed diagnosis is a missed diagnosis\u00a0.SCFE is a\u00a0surgical emergency. Nevertheless, very often, the clinical presentation may be mild, such as in case of a stable, slowly evolving slip, which presents relatively mild symptoms. Location of pain\u00a0may mislead the physician: only 50% of patients locate the pain at the hip\u00a0. Pain maBearing in mind that 94-96% of\u00a0mild\u00a0slips (slip-angle <30\u2070) have favorable long term outcomes, that the remaining growth and remodeling of the femoral neck will decrease the slip-angle by 10\u2070-15\u2070 and the alpha-angle by\u00a010\u2070-30\u2070, and that FAI is usually associated\u00a0with a slip-angle >30\u2070 and an alpha-angle >55\u00b0, it is inferred that a delayed/missed diagnosis spares the hip the opportunity\u00a0to correct a minor post-slip deformity and thus to avoid FAI\u00a0,41.\u00a07. Growth and remodeling after treatment of SCFE7a. The Remaining Growth of the Hip After Slip-StabilizationSCFE is a disease of the growing skeleton. It is expected that the remaining growth of the hip will be affected, either primarily, by the process that caused the slip, or secondarily, by the surgical technique or by the delay of treatment -10.Growth disturbance of the hip after SCFE is best assessed on the anteroposterior pelvis view Figure . The art7.b. Remodeling\u00a0of the Femoral\u00a0Head-Neck JunctionThe femoral neck remodeling of the SCFE hip consists of bone absorption at the anterosuperior surface of the femoral neck metaphysis and bone deposition at the posteroinferior aspect of the metaphysis. Femoral neck remodeling starts shortly after the slip initiation ,43. CallBone remodeling of the femoral head-neck junction is evident in the frog-lateral pelvis projection . Bone abThe remaining growth and remodeling potential\u00a0may improve\u00a0the post-slip deformity of the hip Table  and thusFemoral neck remodeling is best assessed on the frog-lateral pelvis view Figure . MonitorGrowth and remodeling are interconnected processes, which end with growth plate closure ,8,45. A The strong correlation between the residual growth and the correction of\u00a0the alpha-angle supports\u00a0growth-sparing slip stabilization techniques, especially in younger patients with significant remaining growth ,44,45. N7.c. Limb Length Discrepancy after SCFELimb length discrepancy (LLD) after SCFE is usually the result of a shorter ipsilateral leg .\u00a0LLD in SCFE may be an apparent LLD or true LLD. True LLD is the result of the primary slip pathology  and to the growth disturbance of the slipped physis. The surgical technique  may also contribute to the final true LLD . A mean Delayed diagnosis and treatment lead to greater LLD due to\u00a0a slip of higher severity and less remaining growth . Signifi8. Is implant removal recommended?Implant removal after physis fusion is an additional surgical procedure, which, not infrequently (34%-50%), is accompanied by special complications . A parti9. Novel surgical techniques for the treatment of SCFETreatment of SCFE has two main goals: preventing further slippage and avoiding future FAI . Growth 9.a. The Role of Hip Arthroscopy in the Treatment of SCFEIn order to avoid FAI, many surgeons suggest that in situ stabilization should be combined with arthroscopic osteochondroplasty of the anterosuperior femoral neck deformity, either simultaneously with the primary procedure, or later, after physis fusion and completion of femoral\u00a0neck remodeling ,27. ArthArthroscopic osteochondroplasty deals only with the femoral neck deformity after the slip. It does not restore the abnormal orientation of the femoral head after the slip , relative to the weight-bearing portion of the acetabulum. Consequently, after the slip, the weight-bearing surface of the acetabulum articulates with a different portion\u00a0of the femoral head instead of the original weight-bearing surface, which is covered by thicker articular cartilage. Thus\u00a0even without FAI, the femoral head cartilage is subjected to abnormal loads, which could harm the cartilage in the long term. Therefore, theoretically, a modified Dunn procedure is superior to arthroscopic osteochondroplasty to prevent\u00a0early hip degeneration .9.b.\u00a0The Modified Dunn ProcedureProximal femoral osteotomies  are late reconstruction procedures of the hip, which\u00a0deal with severe gait disturbance secondary to post-slip FAI. However, these osteotomies do not restore the original hip anatomy. Subcapital neck osteotomy with femoral neck shortening is a procedure, which can be used to restore\u00a0the anatomy of the hip after SCFE and thus treat SCFE, and simultaneously prevent FAI. First described by Green (1945), later described independently and named after Dunn (1964), sub-capital osteotomy with femoral neck shortening has been used in treating both stable and unstable slips ,50. The The modified Dunn procedure is an attractive option for the treatment of moderate and severe slips, provided that\u00a0the physis is open ,18,23,24Several factors affect the outcomes of slipped capital femoral epiphysis (SCFE). Except for devastating complications, such as avascular necrosis of the femoral head and chondrolysis of the hip joint, the most critical factors that must be controlled in order to obtain better results are an early diagnosis of SCFE and prevention of femoroacetabular impingement (FAI). Early diagnosis and treatment lead to less severe post-slip deformity of the femoral neck. Growth and remodeling of the hip may improve the post-slip deformity by correcting the alpha-angle and the femoral head-neck offset and\u00a0decrease\u00a0the risk of FAI and early hip osteoarthritis, especially in case of mild or moderate slips. In case FAI cannot be avoided through\u00a0the remaining growth and remodeling potential of the hip, the restoration of the FAI-associated neck deformity by surgical means is imperative. There is increasing literature support for arthroscopic osteochondroplasty of the femoral neck deformity after stabilization of mild slips and for primary treatment of severe slips using the\u00a0modified Dunn procedure. Moderate slips may benefit from both procedures.\u00a0However, in situ\u00a0growth-preserving one-screw fixation is currently considered\u00a0the treatment of choice for SCFE,\u00a0because it\u00a0provides slip stability with a low risk for premature physis closure\u00a0and implant-related complications.\u00a0The frog lateral projection of the pelvis should always be requested when examining a non-traumatic limping adolescent."}
+{"text": "Establishing a variety of methodologies including illustration of transporter-mediated nutrient and drug uptake and metabolomics approaches, we highlight intestinal organoids as robust and reliable tool in this field of research. Currently used in vitro models to study intestinal nutrient absorption, drug transport and enterocyte metabolism, such as Caco-2 cells or rodent explant models are of limited value due to their cancer and non-human origin, respectively. Particularly species differences result in poorly correlative data and findings obtained in these models cannot be extrapolated reliably to humans, as indicated by high failure rates in drug development pipelines. In contrast, human intestinal organoids represent a superior model of the intestinal epithelium and might help to implement the 3Rs  principle in basic science as well as the preclinical and regulatory setup.Intestinal transport and sensing processes and their interconnection to metabolism are relevant to pathologies such as malabsorption syndromes, inflammatory diseases, obesity and type 2 diabetes. Constituting a highly selective barrier, intestinal epithelial cells absorb, metabolize, and release nutrients into the circulation, hence serving as gatekeeper of nutrient availability and metabolic health for the whole organism. Next to nutrient transport and sensing functions, intestinal transporters including peptide transporter 1 (PEPT1) are involved in the absorption of drugs and prodrugs, including certain inhibitors of angiotensin-converting enzyme, protease inhibitors, antivirals, and peptidomimetics like \u03b2-lactam antibiotics. Here, we verify the applicability of 3D organoids for  Previously, we reported on murine intestinal organoids for assessing nutrient transport and sensing as well as incretin hormone secretion  or rodent explant models  suffer from severe limitations, as they do not reflect human physiology due to their cancer origin  (sodium-proton exchanger (NHE)3 and epithelial sodium channel (ENaC), involved in epithelial transport processes in the small and large intestine, respectively, could be detected in human organoids derived from different intestinal segments  as well as the main apical glucose transporter sodium-glucose co-transporter (SGLT) 1, glucose transporter (GLUT) 2 mediating glucose and fructose fluxes at the basolateral membrane via facilitated diffusion, the apical fructose transporter GLUT5, and peptide transporter 1 (PEPT1) were observed in human organoids derived from the different regions  of the small intestine , a marker for enterodendocrine cells (EEC), was expressed in all intestinal segments investigated  in EECs was rapidly lost. While completely undetectable in small intestinal organoids sampled after the second passage, expression levels were significantly diminished in colon-derived organoids   as well segments . The ratelevance . In linentestine . SGLT1 arganoids  and chrostigated . Mature,stigated . Accordistigated . During stigated . In partrganoids . Organoirganoids  or microrganoids  by addite linage . In lined SPINK1 . SPINK1 d SPINK1 , inflammd SPINK1 . Westernd SPINK1 . A simild SPINK1 , highligSLC5A1) and GLUT2 (SLC2A2), respectively  family and the family of facilitative glucose transporters (GLUT) with partly unknown specificities is involved . Geneticectively . Particuectively . FurtherPreviously, we established a straightforward approach to assess nutrient and drug transport in murine intestinal organoids . By usinGlucose is a substrate for both, apical and basolateral GLUT transporters, with the electrogenic solute carrier SGLT1 as the main apical glucose transporter in the small intestine. GLUT5 represents an exception, transporting exclusively fructose at the apical membrane. Opposing, the uniporter GLUT2 mediates glucose and fructose fluxes at the basolateral membrane via facilitated diffusion, providing import as well as export capacities . Due to Aiming at improving the experimental protocols, a second approach for investigating transport processes was established, using non-enzymatically dissociated (\u201cbroken up\u201d) organoids instead of intact organoids . In thisD- instead of L-amino acids and N-methylation to increase metabolic stability   were synthesized and investigated in a Caco-2 assay (P3) were subsequently functionalized by substitution of neutral Ala residues with the integrin-binding tripeptide sequence RGD. Among them, one compound (P2), has been identified with similar high activity and selectivity as Cilengitide   groups and conversion of the carboxylic side chain of Asp into a neutrally charged methyl ester). The resulting compound P1 showed both, permeability in the Caco-2 assay and biological activity after oral administration in mice   were tes-2 assay . Peptidetegrins) . However in mice . To testrganoids . Subsequn humans . These dn humans . Concomin humans . Accordin humans , in human humans .In conclusion, these results underline the superior properties of human intestinal organoids for studying nutrient and drug uptake. Since organoids retain location-specific properties of their site of origin, absorption could even be determined at an intestinal region-specific resolution.It has been reported that fluorophore-conjugated dipeptides with a high-affinity for PEPT1 were able to block transport of Gly-Sar, however, they failed to be transported . To excl+ by sodium\u2212proton exchangers (NHEs)  . In entes (NHEs) . ImportaMetabolism in IECs has gained increasing attention, not only due to the expression of key drug metabolizing enzymes, including cytochrome P450 3A4 (CYP3A4), in small intestinal epithelial cells, that are prone to diet-drug interactions . IEC andTo test the feasibility of metabolic measurements in intestinal organoids, we applied different experimental schemes to replicate/validate effects described in literature. First, we determined the effect of insulin on amino acid (AA) and acylcarnitine levels in small intestinal organoids. Murine intestinal organoids were deprived of insulin-containing N2 medium supplement  over night, stimulated with 1 \u03bcM insulin and AAs and acylcarnitines were measured after 0, 30, 60, and 120 min . All proNext, we depict the effect of butyrate on acylcarnitine profiles in murine large intestinal organoids. In this approach, 1mM butyrate was added and shifts in acylcarnitines were measured 0, 5, 10, 30, and 60 min afterward . Butyratt = 0), a peak of d31-palmitoylcarnitine (d31-C16:0) was detected, that increased in subsequent time points -derived organoids and (cancer) cell lines, especially in the context of metabolism and diseases, since metabolic properties differ between species and alterations in the cellular metabolism are part of many pathologies. Thus, human organoids hold great potential to answer remaining questions on intestinal metabolism and to identify drug targets to improve overall metabolic health.Taken together, our results demonstrate that intestinal organoids cultured in 3D, embedded in a laminin-rich gel dome, the most basic and probably least cost and labor extensive culture protocol, is suitable for a broad range of measurements in the field of intestinal transport and metabolic studies. Beyond these applications, many other readouts are possible in this setup, for example assessment of proteasome activity , which iSimple improvements and \u201ctricks\u201d like changing the medium composition to promote differentiation or to \u201cbreak up\u201d organoids prior to uptake studies help further enhancing results and reducing costs. Implementing other culture protocols like organoids with reversed polarity   or organin vitro models that already now allow for partly replacement and reduction of animal numbers needed for research and testing.The field of applications for organoids is still rapidly growing, and there is a trend toward more complex and sophisticated organoid-based model systems. For example, co-cultures with bacterial and viral pathogens and immune cells , as wellAlthough the methodologies that we have established are applicable to mouse and human organoids, the human organoid technology should be focused when targeting human-related issues. Drug development success rates are particularly low in widespread diseases such as diabetes  or cancein vitro testing in the field of intestinal research and metabolomics. In particular, the use of human organoids in this context is a highly valuable tool for drug discovery and testing as well as for human-relevant disease modeling.In light of this, we provide innovative approaches for physiologically relevant All datasets presented in this study are included in the article/The studies involving human participants were reviewed and approved by the Ethics Committee of the Medical Faculty of TUM. The patients/participants provided their written informed consent to participate in this study. The animal study was reviewed and approved by the Committee on Animal Health and Care of the local government body of the state of Upper Bavaria (Regierung von Oberbayern).TZ contributed to study conception and design, human organoid culture, data acquisition, analysis and interpretation, and drafting and revising the article. PG contributed to data acquisition, analysis and interpretation, and drafting and revising the article. ME contributed to data acquisition, organoid culture, and analysis and interpretation. FR and MW contributed to synthesis of peptidomimetics. EU contributed to organoid culture and analysis of protein expression. DH contributed to critically revising the article. ID and GC provided material for organoid preparation. HK contributed to study conception and critically revising the article. ER contributed to study conception and design, murine and human organoid culture, data acquisition, analysis and interpretation, and drafting and revising the article. All authors contributed to the article and approved the submitted version.The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest."}
+{"text": "Batrachoseps) in this region. The complex geological history in combination with several organismal traits led us to predict that these species harbor multiple ancient mitochondrial lineages endemic to southern California. These species belong to a clade characterized by fine-scale mitochondrial structure, which has been shown to track ancient splits. Both focal species, Batrachoseps major and B. nigriventris, are relatively widely distributed in southern California, and estimated to have persisted there across millions of years. Recently several extralimital populations of Batrachoseps were found in the San Joaquin Valley of California, a former desert area that has been extensively modified for agriculture. The origins of these populations are unknown, but based on morphology, they are hypothesized to result from human-mediated introductions of B. major.The southern California biodiversity hotspot has had a complex geological history, with both plate tectonic forces and sea level changes repeatedly reconfiguring the region, and likely driving both lineage splittings and extinctions. Here we investigate patterns of genetic divergence in two species of slender salamanders (Plethodontidae: cytochrome b from a geographically comprehensive sampling of the mitochondrial lineages of B. major and B. nigriventris that are endemic to southern California. We used phylogenetic analyses to characterize phylogeographic structure and identify mitochondrial contact zones. We also included the San Joaquin Valley samples to test whether they resulted from introductions. We used a bootstrap resampling approach to compare the strength of isolation-by-distance in both Batrachoseps species and four other salamander species with which they co-occur in southern California.We sequenced the mitochondrial gene B. major harbors at least eight deeply differentiated, geographically cohesive mitochondrial subclades. We identify geographic contact between many of these mtDNA lineages and some biogeographic features that are concordant with lineage boundaries. Batrachoseps nigriventris also has multiple deeply differentiated clades within the region. Comparative analyses highlight the smaller spatial scales over which mitochondrial divergence accumulates in Batrachoseps relative to most other salamander species in southern California. The extralimital populations of Batrachoseps from the San Joaquin Valley are assigned to B. major and are shown to result from at least two independent introductions from different source populations. We also suggest that B. major on Catalina Island, where it is considered native, may be the result of an introduction. Some of the same traits that facilitate the build-up of deep phylogeographic structure in Batrachoseps likely also contribute to its propensity for introductions, and we anticipate that additional introduced populations will be discovered.The northern lineage of  The never-glaciated landscapes of western North America allow for a deep history of lineages within the region. Multiple processes, including seismic activity resulting from contact between the Pacific and North American plates, changes in sea level, riverine flooding, and climate change, have reconfigured the landscape . Range sBatrachoseps) are notable for their high degree of genetic structuring across geography  have ancient mitochondrial lineages endemic to the southern California ecoregion   . The ranecotones . The ranr Ranges . The thiB. major and B. nigriventris identified a deeply diverged mitochondrial lineage in each that is endemic to the southern California ecoregion. In B. major, this is the northern lineage, encompassing most of the California portion of the range; this lineage is distributed across the Peninsular and eastern Transverse Ranges and extends into low basins that experienced repeated flooding through the Pleistocene  is more closely related to mtDNA from other species outside the ecoregion than it is to conspecific mtDNA from the rest of the range , a hot and dry region that is generally inhospitable for salamanders. Both sites were located in residential neighborhoods, with yards currently or formerly landscaped with non-native  plants that receive watering during the dry season. Each of these sites contained a mix of adults and younger individuals, suggesting reproducing populations. These populations are outside the known range of any species of Batrachoseps, and their morphology suggested that they could be B. major, raising the possibility that they are introduced. Introductions of herpetofauna are a growing problem, although the phenomenon is much more frequently documented in frogs than salamanders ; the remaining 49 are newly reported here and have been deposited in GenBank . Most localities were represented by 1 or 2 individuals; 10 individuals were sequenced from one locality (population 7). We emphasized sampling discrete localities over many individuals per locality because studies of Batrachoseps consistently find that mitochondrial haplotypes have very small geographic ranges, while variation within populations is relatively limited in comparison , and subsequently three specimens (MVZ 221043\u2013221045) tentatively identified as B. major were collected. Twenty-three years later (April 2015), three salamanders morphologically consistent with B. major were collected in Bakersfield, Kern County .The sampling also included representatives of two populations of B. major was fully represented, we also selected 10 individuals from our prior work that span the diversity of the southern B. major mtDNA lineage, including B. m. aridus, and eight individuals assigned to the four other taxa  that are descended from the most recent common ancestor of northern + southern B. major mtDNA  to the northern B. nigriventris lineage; and 7 (0 new) to other species in the B. nigriventris group  that carry mtDNA descended from the most recent common ancestor of northern + southern B. nigriventris mtDNA. For the northern lineage, 10  were from the vicinity of the mitochondrial contact zone, while the other 11 were selected to represent the additional mitochondrial diversity present elsewhere in the northern lineage. The published data for B. nigriventris come from our earlier studies  to characterize diversity within B. major and B. nigriventris and to pinpoint the origin of the San Joaquin Valley samples. The targeted fragment is 784 bp corresponding to positions 21\u2013804 of the cytb gene from the B. nigriventris mitochondrial genome (GenBank Accessions NC_028184.1) and is flanked by the primers MVZ15 and MVZ16 . Similarly, the northern B. nigriventris clade was treated as the outgroup for the B. nigriventris dataset based on our prior results  to cytb distances . We tested for a correlation between genetic and geographic distance (the pattern expected under isolation by distance) in each taxon using Mantel tests, as implemented in the R package vegan v.2.5-2  across the northern B. major samples. Divergence between the cytb clades of northern and southern B. major exceeded 9% (K80 distance), while the deepest divergences within northern B. major exceeded 4%  was favored when all outgroups were included. As outgroups were pruned from the dataset, models with fewer parameters were favored: when the southern B. major lineage was excluded, TrNef + I became the preferred model (K80 + I for MrBayes); and when B. incognitus was also excluded, K80 + I was the best fitting model. Relationships within the northern B. major lineage were relatively unaffected by these changes in models and outgroup sampling. Thus we focus on the results that included the complete set of outgroup lineages.PartitionFinder supported the use of separate models for the 1st, 2nd, and 3rd codon positions with all outgroup sets. 2nd and 3rd codon positions were modeled under HKY + I and TrN + G , respectively, for all B. major form a clade (bootstrap percent (BP) = 89/posterior probability (PP) = 1) that in this analysis is sister (76/0.98) to a clade (89/0.98) including an undescribed species from Santa Barbara Co., along with B. minor from San Luis Obispo Co., far to the northwest  is the widest ranging , 4; it eB. major can be clustered into several more inclusive clades . Population 7  is the locality from which 10 individuals were sampled; it had two haplotypes at approximately equal frequencies (6 and 4); these haplotypes differed at a single nucleotide.Both San Joaquin Valley populations (i1 and i2) were nested within the Los Angeles Basin clade (Clade 4), but within this clade they are not closely related. The sequence from the Hanford individual was unique in the dataset. It differed by <1% (uncorrected p-distance) from five samples from Los Angeles Co. (pops. 1\u20135), with which it formed the only definite subclade (89/1) within the Los Angeles Basin clade , Fig. S3B. nigriventris dataset, PartitionFinder supported the use of TrNef + I (K80 + I for MrBayes), HKY + I and GTR + G for the 1st, 2nd, and 3rd codon positions, respectively. The average sequence divergence between the northern (BP = 100/PP = 1) and southern (75/1) mitochondrial clades within B. nigriventris was 8.6% \u00b10.9%. However, mtDNA from B. nigriventris was rendered paraphyletic by a clade comprising the southern Sierran taxa , which is the sister lineage  to the southern B. nigriventris mtDNA lineage  restricted to Santa Cruz Island (the only one of the northern Channel Islands that harbors B. nigriventris) and a mainland clade (67/0.99), which is in turn subdivided into three geographically cohesive subclades . On its eastern edge, it is abutted by the central mainland clade , which is more widely distributed in the western Transverse Ranges, including in the Santa Monica Mountains and Baldwin Hills. The easternmost mainland clade  makes an inland arc from the Sierra Pelona Mountains across the San Gabriels and then into the Peninsular Ranges, where it occurs in the Santa Ana Mountains and reaches the coast in the adjoining San Joaquin Hills. Both the central and eastern mainland subclades display additional geographic substructure that corresponds well to geology , suggesting that it is due to more general patterns of isolation by distance (IBD), rather than simple geographic substructure. According to the Mantel test, isolation by distance was not detected among the southern California populations of A. lugubris and was marginally significant in T. torosa from southern California  with samples from the nearby mainland (the rest of the southern lineage) differs from the pattern in the B. pacificus group, where B. pacificus has much more southern affinities.Southern d breaks . The norr Valley , which fr Valley . This brr Valley , a turtlr Valley  and a snr Valley . The assB. major (or its ancestor), southern B. nigriventris, A. lugubris, and two deeply differentiated lineages within E. eschscholtzii, with E. e. eschscholtzii likely arriving via a coastal route and E. e. klauberi via an inland route  (cytb), both the common ancestor of the two B. major lineages and E. e. klauberi are inferred to have arrived and begun to diversify in southern California and adjoining Baja California well prior to the completed rotation of the Transverse Ranges from their original north-south orientation to their current east\u2013west position  arrived and diversified much more recently and must have dispersed across the Transverse Ranges. These species generally show lower  divergences to their sister taxon outside of southern California than the deepest divergences within southern California observed in the early arrivers  , Fig. S2ifornia) . Using tposition . The splarrivers ; Fig. S2B. major, B. nigriventris, and E. e. klauberi are distributed across much larger geographic distances in the other taxa: across the entire range of E. e. eschscholtzii , Aneides lugubris , and Taricha torosa . This contrast between the early and late arrivers is maintained when analyses are restricted to the largest sampled monophyletic group within southern California for each lineage.In addition to differences in how long they have been present in the region, the southern California salamander lineages differ in the pace at which genetic divergence accumulates over space. This property is dependent on both features of the ecology/geology of southern California and features of the organisms. On large spatial scales, all six lineages show patterns of isolation by distance and geographically cohesive subclades. However, because of differences in the slope of this relationship , Table 3First impressions suggest that southern California offers inhospitable habitat for salamanders, especially those that do not use aquatic retreats. Average annual precipitation in low-lying areas (below about 500 m) south of the Transverse Ranges ranges from 250\u2013550 mm, with rain typically falling on only 30\u201345 days per year. Additionally, precipitation is very unevenly distributed seasonally, and salamanders must endure six to seven months during the hottest months without any precipitation. Year-to-year variation is high and multiyear droughts are common. On the whole, it is surprising relative to typical salamander habitats elsewhere in North America that terrestrial salamanders are as widespread as they are in the region. Historically, however, the climate was wetter , with xeB. attenuatus was found to lose the ability to right itself after an average of only 65 min. in a desiccating environment  climates if subsidized moisture (as in urban gardens) is provided, and its ability to complete its life cycle within very small patches of suitable habitat , most similar to populations from near Santa Cruz, far to the west. These results suggest that additional introductions are likely to have occurred and point to the possibility that some introductions are cryptic because of the general morphological similarity across many species in the genus.The occurrence of two separate introductions suggests that  habitat . These alaus Co. , also halaus Co.  as have laus Co. . RecentlB. major, like all species of Batrachoseps, deposits terrestrial eggs and lacks an aquatic larval stage   (Uta stansburiana)   and a Je n. sp.) , and genburiana) . The onlnch area . An intench area , suggestB. major was also introduced to Catalina Island. The earliest documented specimen of Batrachoseps from the island was collected from the resort town of Avalon and reported in 1905  and the recent Pleistocene connections of these islands to the mainland  to facilitate comparisons across taxa. For Click here for additional data file.10.7717/peerj.9599/supp-3Supplemental Information 3B. major (with full outgroup sampling), with posterior probabilities > 0.5 shown in blue. Sample names include population number, a letter if more than one individual was sampled from the population, museum or tissue voucher and county. See Bayesian tree for Click here for additional data file.10.7717/peerj.9599/supp-4Supplemental Information 4B.nigriventris (with full outgroup sampling), with posterior probabilities \u00bf0.5 shown in blue. Sample names include population number, a letter if more than one individual was sampled from the population, museum or tissue voucher and county; for Sierran taxa, species is indicated. See Bayesian tree for Click here for additional data file.10.7717/peerj.9599/supp-5Supplemental Information 5Genetic (K80) versus geographic distance for the more comprehensive geographic sampling of each southern California lineage based on the full range of the taxon; species is indicated by both color and shape, as shown in the legend.Click here for additional data file.10.7717/peerj.9599/supp-6Supplemental Information 6Click here for additional data file.10.7717/peerj.9599/supp-7Supplemental Information 7Click here for additional data file.10.7717/peerj.9599/supp-8Supplemental Information 8This includes the GenBank numbers for new submissions for which data aren\u2019t yet publicly available.Click here for additional data file.10.7717/peerj.9599/supp-9Supplemental Information 9Click here for additional data file."}
+{"text": "Regional lymph node metastases are the main adverse prognostic factor in patients with rectal cancer without distant metastases. There are discrepancies, however, regarding additional risk factors in the group of ypN\u2009+\u2009M0 patients. The purpose of the study was to assess clinical and pathological factors affecting long-term oncological outcomes in the group of ypN\u2009+\u2009M0 patients after radical rectal anterior resection.112 patients with ypN\u2009+\u2009M0 rectal cancer after neoadjuvant therapy and radical anterior resection were subject to a retrospective analysis. The effect of potential factors on survival was assessed with the use of Kaplan\u2013Meier curves together with a log-rank test and multiple factor Cox proportional hazards model.p\u2009=\u20090.047), presence of perineural invasion  and occurrence of postoperative complications , while a positive factor was the negative lymph node (NLN) count\u2009>\u20097 . In the disease-specific survival (DSS) analysis, an adverse factor was the use of ACEIs , while a positive effect was caused by NLN\u2009>\u20095 .In the multiple factor Cox analysis, adverse factors affecting disease-free survival (DFS) were: the use of angiotensin-converting enzyme inhibitors (ACEIs) (hazard ratio HR: 3.11, 95% CI 1.01\u20139.56, The use of ACEIs may have a negative effect on long-term treatment outcomes in patients with ypN\u2009+\u2009M0 rectal cancer. In this group of patients, the NLN count seems to be an important prognostic factor, as well.The online version contains supplementary material available at 10.1186/s12876-022-02226-9. Regional lymph node metastases are the main adverse prognostic factor in patients with colorectal cancer without distant metastases . HoweverIt turns out that the assessment of nodal staging according to the TNM classification does not clearly stratify subjects after neoadjuvant therapy with regard to long-term survival . TherefoThe purpose of the study was a retrospective assessment of clinical and pathological factors affecting long-term oncological outcomes in patients with rectal cancer at ypN\u2009+\u2009M0, after neoadjuvant therapy and radical (R0) AR.A retrospective analysis was performed on 112 patients with ypN\u2009+\u2009M0 rectal cancer post neoadjuvant therapy and radical (R0) AR, treated at the National Research Institute of Oncology in Gliwice in 2008\u20132016. Patients meeting the following criteria were included in the analysis: histopathological diagnosis of adenocarcinoma , past neoadjuvant treatment, past radical (R0) rectal anterior resection, presence of regional lymph node metastases in a postoperative histopathological examination (ypN+), no synchronous distant metastases. Exclusion criteria: no neoadjuvant treatment, abdominoperineal rectal resection, Hartmann\u2019s procedure, local resection of tumour, non-radical resection (R1 or R2), no regional lymph node metastases in a postoperative histopathological examination (ypN0), presence of synchronous distant metastases, death in the postoperative period (within 30\u00a0days). In addition, subjects with yN1c staging were excluded from the part of analysis regarding the assessment of nodal staging parameters, where it was necessary to provide the metastatic nodal count , since it was not possible to perform a retrospective assessment of the tumour deposits count in all findings of the histopathological examinations. The process of the study group formation is presented on the chart in Fig.\u00a0Patient characteristics is presented in Table All the patients received neoadjuvant therapy: radiotherapy (RT) at a total dose of 25\u201342\u00a0Gy or chemotherapy (CRT) at a dose of 42\u201354\u00a0Gy combined with one or two cycles of chemotherapy based on 5-fluorouracil. Before surgery, mechanical bowel preparation was performed with the administration of an oral antibiotic and perioperative intravenous antibiotic prophylaxis. AR was performed using laparotomy with total mesorectal excision. End-to-end anastomosis of bowel was performed with a circular stapler. AL, in accordance with the International Study Group of Rectal Cancer, was defined as a deficit at the anastomotic site leading to a communication between the intra- and extraluminal compartments and/or presence of pelvic abscess near the anastomosis . AL was Staging was assessed on the basis of the American Joint Committee on Cancer, TNM Staging System, 8th edition, 2017. LNR was calculated as the PLN to LNY ratio, while LODDS was calculated with the formula ln[(PLN count)/(NLN count)]. In the LODDS and LNR analysis in ypN1c patients, the PLN count was treated as no data and was excluded from this part of the analysis. Additional potential risk factors subject to analysis included: age, sex, body mass index (BMI), presence of comorbidities, CCI, medications used, type of neoadjuvant therapy (RT vs. CRT), time from RT completion to surgery, clinical staging of the disease before treatment, tumour distance from the anal verge, presence of loop ileostomy, occurrence of postoperative complications, TRG, perineural invasion (PNI), lymphovascular invasion (LVI), extranodal extension (ENE), width of distal margin, adjuvant chemotherapy.The effect of potential factors on survival was assessed with the use of Kaplan\u2013Meier curves together with a log-rank test and Cox proportional hazards model. The estimation of cut-off points for the parameters related to nodal staging was based on the analysis of Kaplan\u2013Meier curve difference significance for iteratively increased cut-off thresholds. All calculations were made using the statistical package R version 3.5.3.In the study group, 3- and 5-year disease-free survival (DFS) was 71.9% and 59.7%, and disease-specific survival (DSS) was 85.5% and 74.4%, respectively. The mean follow-up period in the study group was 57\u00a0months. Loop ileostomy during the primary procedure was created in 23/112 (20.5%) of patients. Postoperative complications were observed in 39/112 (34.8%) of patients. AL was observed in 23/112 (20.5%) of patients, including 16/23 (69.6%) early and 7/23 (30.4%) late ALs. In 15/23 (65.2%) cases of AL, anastomosis was separated by performing the Hartmann\u2019s procedure. Aside to the above, abnormal wound healing was observed in 6 patients, and there were 3 cases of urinary tract infection, 3 cases of pneumonia, 3 cases of bleeding and 1 case of mechanical obstruction. Postoperative complications are presented in the Additional file p\u2009=\u20090.0045) and the cut-off point 7 (\u2264\u20097 vs. >\u20097) for DFS (p\u2009=\u20090.029). Results of the analysis of nodal staging parameters are presented in the Additional file For the LNY variable, no cut-off point for which Kaplan\u2013Meier curves would significantly differ was found. Similarly, no differences in survival were found while comparing nodal staging (ypN1 vs. ypN2) according to the TNM classification. For the NLN count, significant differences in survival were achieved for the cut-off point 5 (\u2264\u20095 vs. >\u20095) for DSS  , and a positive effect of the use of ARBs (p\u2009=\u20090.042) , occurrence of AL (p\u2009=\u20090.024), and after dividing AL into early and late, of early AL (p\u2009=\u20090.0095) on DFS was shown. Histological grade G3 (p\u2009=\u20090.02) and the presence of PNI (p\u2009=\u20090.00015) had a negative effect on DFS, as well.A negative effect of the use of ACEIs (04) Fig.\u00a0a and met p\u2009=\u20090.04  , occurrence of complications, regardless of the degree in the Clavien\u2013Dindo classification (p\u2009=\u20090.025), occurrence of AL (p\u2009=\u20090.0049), and after dividing AL into early and late, of early AL (p\u2009=\u20090.00027), and histological grade G3 (p\u2009=\u20090.018). No effect of other analysed factors on survival was revealed, including the effect of neoadjuvant treatment regimen  Fig.\u00a0c, metfor Fig.\u00a0c, p\u2009=\u20090.047), presence of PNI , and the occurrence of postoperative complications . And a positive factor was the NLN count\u2009>\u20097 . In the DSS analysis, an adverse factor was the use of ACEIs , while a positive effect was caused by NLN\u2009>\u20095 . The other analysed factors were not significant in the multiple factor analysis. The above multivariate Cox analysis models were then further analyzed using the likelihood ratio test. The course and the results of this analysis are given in Additional file Results of Cox analysis are shown in Table The study showed a negative effect of the use of ACEIs and low NLN count on both DSS, and DFS. Additionally, DFS was negatively influenced by the presence of PNI and the occurrence of postoperative complications.We showed a negative effect of ACEIs on survival independently of comorbidities, analysed both separately and based on CCI. The renin-angiotensin system (RAS) is one of the phylogenetically oldest endocrine systems, whose main task is to regulate water and sodium metabolism. The main component of this system is angiotensin II (AngII), which is developed from angiotensin I (AngI) with the participation of angiotensin converting enzyme (ACE) . Aside tClose interactions were shown between RAS and kallikrein-kinin system (KKS) at several levels . BioactiThe effect of using ACEIS on the interactions between tRAS and KKS in the aspect of their influence on colorectal cancer progression is poorly known. However, summing up, it may be concluded that despite the use of ACEIs, it is possible to activate the procancerous tRAS pathway via AT1R in the neoplastic tumour with the use of chymase. Additionally, local inflammatory process in the tumour microenvironment leads to an increased B1R expression, and the use of ACEIs may lead to increased KKS activation, both via B1R and B2R. This takes place in two mechanisms: inhibiting the kinin breakdown with consequential increase in the level of both receptor agonists, and allosteric enhancement of the transmitted signal. These interactions may lead to a negative effect of ACEIs on the course of the neoplastic disease, and explain our results.There are few reports on the effect of RASIs on treatment outcomes in patients with rectal cancer. Typically, publications discuss subjects with colorectal cancer. Additionally, the effect of both groups of RASIs is assessed jointly (ACEIs/ARBs), which may significantly affect the results and cause conflicting conclusions. The effect of these drugs on the rectal cancer response to neoadjuvant treatment is unclear. Morris et al. showed that the use of ACEIs/ARBs significantly increases the frequency of complete responses after preoperative radiotherapy in a multiple factor analysis , while RTo the best of our knowledge, the effect of ACEIs has not been assessed so far exclusively in the group of subjects with ypN+ rectal cancer. The analysis results point to a need of further studies in this group of patients. If our results are confirmed with larger, independent groups of patients, the exclusion of ACEIs from the therapy of comorbidities could be a simple method of improving long-term oncological outcomes in patients with rectal cancer.We have shown a negative effect of postoperative complications on DFS, regardless of the degree in the Clavien\u2013Dindo classification. Similar conclusions were drawn by Sprenger et al. who showed that the occurrence of any surgical complications  had a significant negative effect on OS and local recurrence free survival among the patients of the German Rectal Cancer Trial, as shown by a multiple factor analysis . PossiblThe only parameter related to lymph nodes which in our analysis had a significant effect on survival was the NLN count in the surgical specimen, which is confirmed by observations of several authors , 43. TheThe analysis has typical limitations of retrospective and single-centre analyses. The neoadjuvant treatment was not performed with the use of a uniform schedule. However, we have shown no effect of this factor on the treatment outcomes. Data on comorbidities and medications taken were obtained from internal and anaesthesiological consultation records prior to surgery. It was not possible to assess the duration of using the medications.The use of ACEIs may have a negative effect on long-term treatment outcomes in patients with ypN\u2009+\u2009M0 rectal cancer. In this group of patients, the NLN count seems to be an important prognostic factor, as well.Additional file 1. Postoperative complications.Additional file 2. Results of the analysis of nodal staging parameters.Additional file 3. Survival analysis depending on neoadjuvant treatment regimen.Additional file 4. Likelihood ratio test.Additional file 5. Dataset."}
+{"text": "Angioedema with macroglossia is a rare complication of anesthesia. We present a clinical case of post-operative development of angioedema presenting as macroglossia in a patient receiving chronic therapy with lisinopril, who developed symptoms in the early post-operative period following surgery in a lateral position, when a laryngeal mask airway was used. Possible mechanisms of angioedema and macroglossia development in our patient are discussed along with potential underlying predisposing mechanisms and available therapeutic approaches. Angioedema (AE) or Quincke's edema is an acute-onset transient edema involving the skin, subcutaneous tissues, and mucous membranes of the face, oral cavity, airway structures or the gastrointestinal tract, the upper and lower extremities \u20135. The uAE related to histamine release presents as an allergic reaction of an immediate type triggered by IgE-mediated release of histamine and other mediators by mast cells and basophils.Cases of AE with increased levels of bradykinin are generally associated with use of specific medications: angiotensin converting enzyme (ACE) inhibitors, angiotensin 2 receptor antagonists, non-steroidal anti-inflammatory medications, and other drugs, including propofol, which increase bradykinin levels in tissues , 4, 6\u20139.Typically, propofol-induced bradykinin release is restricted to the site of injection and manifests as a transient burning sensation during drug administration. Other contributing factors include anxiety, pain, significant physical and surgical stress, infections, and temperature changes .The hereditary AE due to C1 esterase inhibitor deficiency is seen in 1 in 50,000 people in the general population . AcquireLiterature reports describe development of AE during surgery or in the immediate post-operative period. Perioperative AE, especially if the soft tissues of face, neck, oropharynx and airway are involved, is a rare but serious complication which may require continuous monitoring and sometimes, prompt intervention to avoid devastating consequences.While perioperative AE presenting with macroglossia has been reported in cases of general anesthesia with endotracheal intubation, there are only a few case reports when a laryngeal mask airway (LMA) was used \u201313. It iWe present a clinical case of acute onset AE with macroglossia, which developed in the early post-operative period in a patient undergoing surgery in lateral position, when an LMA was used to secure the airway patency and provide ventilatory support. The patient had a history of chronic lisinopril treatment.A 71 year old Caucasian male patient with a past medical history of coronary arterial disease, atrial flutter, ascending thoracic aortic dissection repair, aortic and mitral valve repair, 3-vessel coronary bypass, arterial hypertension, and bifascicular block was scheduled for an elective soft tissue biopsy of the ankle with possible resection and evacuation of the accumulated blood. He had no known history of allergies, complications of anesthesia, or any family history of angioedema. The list of home medications included: amlodipine, metoprolol, tylenol, apixaban, atorvastatin, lisinopril, spironolactone, tamsulosin, magnesium sulfate, and multivitamins. The patient weighed 90.7 kg and had a BMI of 26.39.Following preoxygenation, anesthesia was induced with IV propofol 2 mg/kg and lidocaine 100 mg. A size 5 cuffed LMA was placed without any difficulty. The patient was then placed in right lateral position, and surgery was started. General anesthesia was maintained with inhalation of 0.8\u20130.9 age-adjusted minimum alveolar concentration of sevoflurane in a mixture of oxygen with air. Throughout surgery, the patient received 40 mg of ketamine in divided injections, and his blood pressure was supported with small boluses and low rate infusion of phenylephrine (0.2 mcg/kg/min). No antibiotics were administered during surgery. At the end of surgery, 8 mg of ondansetron was administered as an antiemetic. No narcotic analgesics were used, since the surgeon had used local anesthetic infiltration of the incision site during surgery.The procedure was completed uneventfully with evacuation of collected blood and soft tissue biopsy, the LMA was removed, and the patient was transferred to the post-operative recovery unit fully awake and alert. A routine inspection of the oral cavity at the time of the LMA removal did not reveal any trauma to the mucosa or local edema.In an hour after surgery, the anesthesiologist was notified by the recovery unit nurse that the patient complains on swelling of the tongue.Immediate assessment revealed a progressively worsening swelling on the left half of the tongue without airway compromise. Hemodynamic and respiratory parameters remained within normal limits with SPO2 of 98%, heart rate 72/min, and normal blood pressure. In around an hour, the whole tongue became swollen, again with no signs of respiratory distress.A preliminary diagnosis of AE was made considering the history of chronic lisinopril therapy. As alternative diagnoses, IgE-mediated anaphylactic reaction and macroglossia as a result of the LMA application and patient positioning were considered even though with lower possibility. Eight mg of dexamethasone and 25 mg of Benadryl were given IV, and inhalation of oxygen, 4 L/min was started. The otorhinolaryngology service was contacted to evaluate the patient, and emergency intubation equipment was made available. It was decided to observe the patient in the hospital setting overnight. An endoscopic examination performed by the otorhinolaryngologist revealed no signs of trauma or hematoma, the only finding was the observed isolated edema of the tongue without any airway compromise. A tryptase test was sent immediately, and the results came back normal: 4.3 mcg/L . The time period between the anesthesia induction and blood collection for the test was < 4 h. Empiric epinephrine was not used in our patient because of a history of significant cardiovascular disease and absence of any respiratory distress despite the lingual edema. The drug would be used as a first line choice in case of an apparent anaphylactic reaction with life-threatening airway compromise. A specific anti-bradykinin therapy with Icatibant was not used either, since the vital signs remained stable, and gradual improvement of the edema took place with time. Lastly, the drug has a relatively high cost, and its use in our patient with stable vital parameters and gradual resolution of symptoms would be questionable.1 estherase inhibitor activity and the C4) at that time.With conservative management and observation, the patient's condition improved with complete resolution of the edema within 24 h. No additional laboratory tests were ordered , and oxygen are usually effective. When indicated, bronchodilators and intravenous fluids should be administered.AE of allergic origin results from an allergic reaction of immediate type, when symptoms are caused by antigen-IgE mediated release of inflammatory mediators and histamine from the mast cells and basophils. In such cases, epinephrine, glucocorticoids, antihistamines  has been suggested for treatment of bradykinin-induced AE, because it contains kinases accelerating bradykinin breakdown . However2 receptor antagonist Icatibant  for the publication of any potentially identifiable images or data included in this article.SS provided anesthesia, performed a literature search, and wrote the manuscript. QF participated in patient management, searched literature, and wrote the manuscript. SB provided general supervision, participated in patient management, searched literature, and wrote the manuscript. All authors contributed to the article and approved the submitted version.The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest."}
+{"text": "The gray-to-white matter ratio (GWR) has been used to identify brain damage in comatose patients after cardiac arrest. However, Hounsfield units (HUs), the measurement of brain density on computed tomography (CT) images, may vary depending on the machine type or parameter. Therefore, differences in CT scanners may affect the GWR in post-cardiac arrest patients. We performed a retrospective study on comatose post-cardiac arrest patients who visited the hospital from 2007 to 2017. Two CT, Lightspeed and SOMATOM, scanners were used. Two observers independently measured the HUs of the caudate nucleus, putamen, posterior internal capsule, and corpus callosum using regions of interest. We compared the GWR calculated from the HUs measured at different CT scanners. The analysis of different scanners showed statistically significant differences in the measured HUs and GWR. The HUs and GWR of Lightspeed were measured lower than SOMATOM. The difference between the two CT scanners was also evident in groups divided by neurological prognosis. The area under the curve of the receiver operating characteristic curve to predict poor outcomes of Lightspeed was 0.798, and the cut-off value for 100% specificity was 1.172. The SOMATOM was 0.855, and the cut-off value was 1.269. The difference in scanners affects measurements and performance characteristics of the GWR in post-cardiac arrest patients. Therefore, when applying the results of the GWR study to clinical practice, reference values for each device should be presented, and an integrated plan should be prepared. Target temperature management (TTM) is commonly applied to patients who remain comatose following resuscitation after cardiac arrest since it has been shown to improve survival and neurological outcomes , 2. VariIn the event of cardiac arrest, the patient is placed in a deep hypoxic state. Hypoxia causes lactic acidosis, and a reduced pH causes brain swelling. In computed tomography (CT) images, brain swelling is difficult to distinguish the central sulcus or cisterns, and the ventricle size seems to have decreased \u201316. In aSome studies were conducted on a single scanner with various CT scanner settings, some were conducted with various types of machines, and others provided no details on scanner type or settings \u201310. AddiResearchers have analyzed the brain CT images of normal adults and proved that the Hounsfield units (HUs) values of images obtained from three different machines are different. It was also concluded that the GWR is also affected by inter-scanner variability . The purAfter deliberation, this study was approved by the Local Ethics Committee of the Catholic University of Korea, Yeouido St. Mary\u2019s Hospital (SC18RESI0068). The medical records of patients who received TTM were reviewed from April 2007 to July 2017. The subjects included in the analysis were adults (\u2265 18 years old) patients who received TTM after cardiopulmonary resuscitation and survived until discharge. Patients were excluded if they did not have a brain CT scan performed, had a CT with a contrast agent, died during TTM, suffered structural changes in the brain due to trauma, surgery or cerebrovascular disease, were transferred from other hospitals, or had too many artifacts caused by associated implants or accessories. A total of 86 patients were identified from medical records. Patients were evaluated for age, sex, witnessed the event, initial cardiac rhythm, initial Glasgow coma scale, location of cardiac arrest , the time between CT and arrest, and neurologic outcome at discharge.This hospital used two CT scanners . This study was retrospective, so each CT scanner\u2019s setting channel, current, and voltage were not performed identically. TTM was maintained for 24 hours by lowering the body temperature to 33.0 \u00b1 1\u00b0C using an external cooling device with a standardized protocol. Rewarming was performed slowly for more than eight hours until reaching normal body temperature. There were no patients who received extracorporeal membrane oxygenation treatment. Patients who received all treatments were hospitalized in the intensive care unit and received standard intensive care and monitoring, including mechanical ventilation, central venous catheters, and alternative catheters. Patients received brain CT scans as soon as possible when vital signs had stabilized after ROSC. In addition, all patients used a dedicated CT scanner installed in the emergency room. The neurological outcome of the patients was evaluated by the cerebral performance category (CPC) at the time of discharge, and 1 and 2 were defined as good outcomes. The CPC was evaluated by experts at least 72 hours after the ROSC and at discharge.2 wide, and the average HUs value of the area with a circular region of interest (ROI) was used for analysis. The HUs of the caudate nucleus (CN), putamen (PU), posterior internal capsule (PIC), and corpus callosum (CC) on both sides were measured. As in previous studies, to increase the objectivity of the inspection, color mapping can be implemented in the image viewing software, making each area easier to visualize [Two investigators analyzed images of patients. Investigator 1 is an emergency medicine specialist with over twenty years of experience, and investigator 2 is an emergency medicine specialist with eight years of experience. A radiologist trained the two researchers in related research knowledge for this study. Images were analyzed using commercial image viewing software  that had blinded patient information. The level corresponding to the basal ganglia (BG) was determined by investigator 1, and both investigators measured the images of all patients. The two researchers did not share the results of the measurements, and the measurements were taken independently of each other. The density value was measured at 0.1 cmisualize . The areisualize . We averCategorical variables are expressed as numbers and percentages. Continuous variables are expressed as the mean \u00b1 standard deviation or median and interquartile range (IQR). Chi-squared and Fisher\u2019s exact tests were used to analyze categorical variables. Continuous variables were tested for normality through the Shapiro-Wilk test. Most continuous variables did not follow a normal distribution, so the average value between the two CT groups was assessed with the nonparametric Mann-Whitney U test. The differences between each group were compared with box and whisker plots. Interclass correlation coefficients (ICCs) were analyzed to evaluate the consistency of measurements between the two investigators. A receiver operating characteristic (ROC) curve was created to obtain a cut-off value for predicting poor outcomes. The cut-off values at 100% specificity were analyzed and compared. Two-sided p-values less than 0.05 were considered statistically significant. Statistical analysis was performed with SPSS ver. 20  and MedCalc ver. 15.2.2 .Eighty-six patients were enrolled. Forty-three patients were classified into the Lightspeed group, and others were classified into the SOMATOM group . The medThere was a clear difference in the density of GM and WM between the two CT groups. The GWR-AVE, regardless of the CT scanner used, was 1.256  that of the Lightspeed scanner was 1.217 , and that of the SOMATOM scanner was 1.295 . Similarly, GWR in different areas all showed similar results .The analysis of neurological outcomes clearly showed a difference between scanners. In the good outcome analysis, the GWR-AVE of the Lightspeed scanner was 1.266 , and that of the SOMATOM scanner was 1.328 . In the poor outcome analysis, the Lightspeed scanner was 1.220 , and the SOMATOM scanner was 1.285  . The cutThe authors used color mapping and sectioning methods as in previous studies to minimize errors in the HUs measurement by ROI . The twoMost previous studies have been retrospective in which only one type of scanner was used. However, there are many kinds of machines used in multi-center studies, and the parameters differ. In a recent study, Gentsch et al. determined a simplified measurement method for the GWR, and the authors commented that three types of CT scanners were used and that the results showed variability . In addiThese differences can also be misjudged when clinically predicting poor neurologic outcome. When the SOMATOM scanner was applied with a Lightspeed cut-off, the specificity remained 100%, but the sensitivity was reduced. Conversely, applying the cut-off of Somatom to the Lightspeed scanner will predict good neurologic outcome as poor neurologic outcome.basal ganglia measured with brain CT obtained within one hour of ROSC showed 3.3% at 100% specificity. In contrast, the prediction sensitivity of poor neurologic outcomes in our study, which showed the GWR at the level of the BG at 100% specificity in the CT1 and CT2 groups, was 24.2% and 42.3%, respectively. Furthermore, regardless of the CT scanner used, the sensitivity decreased to 18.6% when all patients were analyzed. In addition, the cut-off value at 100% specificity also differed by 0.097. It matched the value of the Lightspeed scanner, with a low value for the entire patient population regardless of the scanner used. Analyzing data from a multi-center study without considering the scanner used may result in lower sensitivity because GWR converges to the machine\u2019s cut-off value with the lowest cut-off value.Recently, a multi-center study by Korean Hypothermia Network (KORHN) investigators of PCAS patients receiving TTM showed that the GWR did not correlate with neurologic outcomes . In addiThe recent neurological outcome evaluation of patients resuscitated after cardiac arrest involves multimodal approaches, and the GWR is one of them. However, recent GWR studies have tended to report negative results. However, considering the results of this study, the neurologic outcome prediction power of GWR may have been evaluated less than the actual GWR. In addition, recent imaging techniques, such as MRI or CT, undergo a normalization process to compensate for differences in equipment , 22\u201325. This study showed that inter-scanner variability might be observed in post-cardiac arrest patients who received TTM, and the GWR could vary. Therefore, future research on the GWR may need to incorporate a normalization method to correct for differences between machines."}
+{"text": "In-situ spectroscopic characterizations combined with first-principles calculations reveal that electron transfer from the Cu surface to adsorbed acetylene induces preferential adsorption and hydrogenation of the acetylene over hydrogen formation, thus enabling a highly selective E-HAE process through the electron-coupled proton transfer mechanism. This work presents a feasible route for high-efficiency ethylene production from E-HAE.Renewable energy-based electrocatalytic hydrogenation of acetylene to ethylene (E-HAE) under mild conditions is an attractive substitution to the conventional energy-intensive industrial process, but is challenging due to its low Faradaic efficiency caused by competitive hydrogen evolution reaction. Herein, we report a highly efficient and selective E-HAE process at room temperature and ambient pressure over the Cu catalyst. A high Faradaic efficiency of 83.2% for ethylene with a current density of 29\u2009mA\u2009cm 2.This work achieves highly active and selective electrocatalytic hydrogenation of acetylene to ethylene (HAE) under mild conditions over Cu catalyst to replace the classic thermocatalytic HAE route requiring harsh conditions and costly H Thermocatalytic HAE typically requires high temperatures above 200\u2009\u00b0C and high pressures of around 5 bar8, and thus is highly energy demanding. Besides, large amount of H2 consumption makes the process even more costly. Moreover, the selectivity of ethylene is also hardly controllable owing to the undesired but facile excessive hydrogenation of acetylene to ethane under the harsh reaction conditions in the thermocatalytic HAE12. Therefore, it is of great significance to develop a more economical, energy-efficient, and highly selective route for the HAE process.Integrated with technology of acetylene production from natural gas or coal, selective hydrogenation of acetylene to ethylene (HAE) has emerged as a promising non-oil route for producing ethylene, which is one of the most important building blocks in chemical synthesis2 can be avoided . By coating the carbon support with a microporous gas diffusion layer (GDL) to promote mass transfer, a high Faradaic efficiency of 83.2% for ethylene production (j) of 29\u2009mA\u2009cm\u22122 at \u22120.6\u2009V vs. RHE. The geometric current density for ethylene formation  calculations demonstrate that electron transfer from the Cu surface to adsorbed acetylene promotes the adsorption and hydrogenation of the acetylene, while suppressing the competitive hydrogen evolution reaction (HER) and facilitating ethylene desorption, thereby resulting in highly selective ethylene production. The electrochemical hydrogenation proceeds via the electron-coupled proton transfer pathways, which require higher activation energies for further hydrogenation steps than the desorption of the generated ethylene, so that the excessive hydrogenation to ethane is effectively inhibited. This process provides a green route for industrial production of C2H4 from C2H2 beyond the removal of C2H2 impurities in C2H415.Herein, we report a highly efficient and selective electrocatalytic HAE (E-HAE) process at room temperature and ambient pressure over carbon-supported Cu microparticles (MPs). In contrast to the thermocatalytic path, this process is advantageous in being operatable under mild conditions and is environmental-friendly in combination with electroreduction of water based on renewable electricity, in which hydrogen is in-situ generated for the reduction reaction so that extra supply of Hded Fig.\u00a0, which e4\u00b75H2O as precursors. The morphology of the Cu catalyst was characterized by scanning electron microscopy \u00a0using CuSOiR compensation, indicating a poor HER activity of the catalyst. As the solution is saturated by C2H2, the current density increases remarkably with an onset potential of around \u22120.24 and \u22120.15\u2009V before and after the iR compensation, respectively . The linear sweep voltammetry (LSV) was performed to assess the E-HAE activity of the catalyst. In Ar-saturated solution, the current density is close to zero even at an electrode potential of \u22120.3\u2009V vs. RHE with or without 2\u2009g\u22121, which is favorable for constructing gas\u2013liquid\u2013solid interfaces. Though the Cu/GDL-CP and Cu/CP have similar electrochemical active surface areas (ECSAs), which were measured as 6.2 and 6.4\u2009cm2, respectively  and geometric \u22122\u2009h\u22121 and 26.7\u2009mA\u2009cm\u22122, respectively 24. This result is also confirmed by in-situ Raman spectroscopy characterizations at OCP  experiments were performed to investigate the electronic and geometric properties of the Cu catalystell Fig.\u00a0. The proell Fig.\u00a0. At cathOCP Fig.\u00a0, which wOCP Fig.\u00a0.The DFT-OCP Fig.\u00a0, in whic27. The in-situ ATR-FTIR spectrum at different potentials are plotted in Fig.\u00a0\u22121 and two negative peaks at 1594 and 1670\u2009cm\u22121 were observed. The positive peak at 1630\u2009cm\u22121 is assigned to the desorbed H2O from the catalyst surface28. The negative band at 1594\u2009cm\u22121 is assigned to the generated *CH\u2009=\u2009CH2 (*C2H3), a reaction intermediate of C2H2 reduction30. The peak at 1670\u2009cm\u22121 is assigned to the *C2H2 on the Cu surface, which is close to that of the in-situ Raman spectrum  spectroscopy characterizations, which is highly sensitive to surface speciesrum Fig.\u00a0. As the 2H2 prefers to be strongly adsorbed on the hollow sites with much higher adsorption free energies compared with hydrogen adsorption , (110), and (111) surfaces, respectively, by calculating the adsorption free energy (\u0394Gads) of C2H2 on the gradually covered surfaces until no further adsorption is favorable , (100), and (110) were considered according to the XRD analysis , (110), and (111) surfaces, respectively , (110), and (111) surfaces, respectively. These results demonstrate that *H can hardly be formed on the C2H2-covered Cu surfaces, which could explain the poor HER activity at potentials above \u22120.6\u2009V vs. RHE. This also indicates that the *C2H2 is not likely hydrogenated by surface *H, but rather via electron-coupled proton transfer from the water layer (Eq.\u00a0The formation of surface H species (*H) on the Cely Fig.\u00a0. In addiayer Eq.\u00a0.1\\docume2H4 on the three Cu surfaces were calculated as shown in Fig.\u00a02H2 to *C2H3 is the rate-limiting step on all the three surfaces with barriers of 0.79, 0.86, and 1.24\u2009eV on the (100), (110), and (111) surfaces at 0\u2009V vs. RHE, respectively. The highest barrier for the first hydrogenation step on the Cu(111) surface may be due to the much stronger adsorption of C2H2 on the surface  coupling steps, and thus can occur in two pathways: coupling of *C2H3 and *C2H2 (First pathway) or two *C2H3 (Second pathway)  surface.The free energy reaction pathways for the formation of Cace Fig.\u00a0. The sec2H4 against C4H6 is largely affected by the applied negative potential as shown in Fig.\u00a031. At \u22120.6\u2009V vs. RHE, the activation energies of the electrochemical hydrogenation steps are significantly reduced compared with those at 0\u2009V, especially for the rate-limiting *C2H2 hydrogenation to *C2H3, the activation energies of which on the (100) and (110) surfaces are more reduced and become even comparable with those of other steps , ascorbic acid (AA), NaOH, NaCl, ethanol, and polyvinyl pyrrolidone (PVP) K-30 were bought from Sinopharm Chemical Reagent Co. Ltd. Pt/C was produced by Johnson Matthey. Pd/C was bought from J&K Scientific Ltd. The TiO2(P25) was purchased from Degussa. Active carbon was purchased from Sigma-Aldrich. The Cu plate was purchased from Shichun Co. The characterizations of catalysts were presented in Supplementary Figs.\u00a0All chemicals were used without further purification. Ethylene glycol (EG) was purchased from Sigma-Aldrich. Copper sulfate pentahydrate 6Mo7O24\u00b74H2O was dissolved in 20\u2009mL deionized water. Then, this solution and 10\u2009ml CS2 were sealed in a 40\u2009mL stainless-steel autoclave under Ar protection and maintained at 400\u2009\u00b0C for 4\u2009h. The Cu plate was cut into \u201cL\u201d shape with a 1\u2009\u00d7\u20091\u2009cm2 square and a 0.5\u2009\u00d7\u20091\u2009cm2 bar. The Cu plate was polished by silicon carbide papers, followed by alumina polishing powder .The CuO was synthesized by heating the Cu MPs at 500\u2009\u00b0C for 1\u2009h under 20% OSEM characterizations were conducted on Hitachi S4800. TEM measurements were conducted on the FEI Tecnai F20 and FEI talos F200X microscopes operated at an accelerating voltage of 200\u2009kV. To prepare the TEM sample, 100\u2009\u03bcL Cu MPs ink was dispersed in 3\u2009mL ethanol and treated with ultrasound for 0.5\u2009h; then the solution was dropped on a Cu net for TEM and then dried by a heating light for 10\u2009min. The XRD measurements were carried out on a Rigaku Ultima IV diffractometer with Cu Ka radiation at 40\u2009kV and 30\u2009mA.2 square and a 0.5\u2009\u00d7\u20091\u2009cm2 bar , which were then converted to be versus the RHE by the equation U (vs. RHE)\u2009=\u2009U \u2009+\u20090.098\u2009V\u2009+\u20090.059\u2009\u00d7\u2009pH. The potential of the Hg/HgO electrode relative to the RHE was 0.924\u2009V. The Pt net was used as the counter electrode. Before the test, the cyclic voltammetry  was carried out in the Ar-saturated solution. During the test, the acetylene was kept bubbling into the cell. In a typical experiment, the reaction at each potential was carried out for 2\u2009h before analyzing the products. For the analysis with iR compensation, a 90% iR compensation was used. The R for iR correction was determined by impedance measurements.The 4\u2009mg catalysts mixed with 9\u2009\u03bcL Nafion solution  and drip-coated on carbon paper with the GDL-CP (AvCarb GDS3250 with micro-porous layer) were used as the working electrode. The carbon paper was cut into an \u201cL\u201d shape with a 1\u2009\u00d7\u20091\u2009cm2. The surface of glassy carbon was polished by aluminia polishing powder (0.05\u2009\u03bcm). Totally, 2\u2009mg Cu MPs was suspended in 0.5\u2009mL ethanol with 10\u2009\u03bcL Nafion solution to form a homogeneous ink by ultrasound. Then 25\u2009\u03bcL of the ink was drop-casted onto the surface of glassy carbon. The rotation rate is 2500\u2009rpm during the tests.The diameter of the RDE is 5\u2009mm. The surface area of the electrode is 0.196\u2009cm4)2 and 0.1\u2009M HClO433. N2 was kept bubbling into the system to avoid the effect of O2. The 1\u2009\u00d7\u20091\u2009cm2 square part of the electrode was immersed in the solution. The cyclic voltammetry test was repeated from \u22120.375 to \u22120.005\u2009V vs. Ag/AgCl at 10\u2009mV/s until reproducible voltammograms were obtained. The number of charges consumed for the oxidation of Pb atoms was determined by integrating the anodic shadow area as shown in Supplementary Fig.\u00a0\u22122 was used for Pb oxidation34.ECSAs of the Cu MPs catalyst were measured by using the Pb underpotential deposition method in solution with 10\u2009mM Pb equipped with a 50\u00d7 microscope objective. The working electrode was glassy carbon loaded with Cu MPs. The Hg/HgO electrode (filled with 1\u2009M KOH) and the Pt wire were used as the reference electrode and the counter electrode, respectively. 1\u2009M KOH solution was used as the electrolyte. A laser with a wavelength of 637\u2009nm was used as the excitation source. The power of the laser was about 6\u2009mW. A Si wafer was used to calibrate Raman frequencies. The collection time of each spectrum was over 15\u2009s. Each spectrum was obtained as an average of twice measurements.A Nexus-870 spectrometer was used to measure the ATR-FTIR with an MCT-A detector. The temperature of detector was controlled using liquid nitrogen. The basal plane of a hemicylindrical Si prism beveled at 60\u00b0 was deposited on Au film using a chemical method. The catalyst ink was dripped onto the Au film polished by an electrochemical way. 0.1\u2009M KOH solution was used as the electrolyte. The electrode settings and reaction conditions were kept the same as those in the reaction performance tests. The acetylene was constantly introduced into the cell during the test. The reference spectra were collected at OCP.2O3/Na2SO4 column (Kromat 50\u2009m\u2009\u00d7\u20090.53\u2009mm\u2009\u00d7\u200920.00\u2009\u03bcm) on a flame ionization detector which can detect hydrocarbon products. The TDX column was equipped in the GC with a thermal conductivity detector which can detect H2. The chromatograph was equipped with a ten-port valve and sample injection loop. During the experiment, the ten-port valve is periodically switched between Position A and Position B  is the area of products on the GC spectrum, a is the percentage conversion factor based on standard gas, which converts the peak area to the volume percentage of a single product. v is the gas flow rate, t is the reaction time, n is the moles of charges transfer from reactants to products per mole, F is Faraday\u2019s constant 96,485\u2009C\u2009mol\u22121. Q is the total number of charges applied into the systemA typical GC spectrum is shown in Supplementary Fig.\u00a0P0\u2009=\u2009101,325\u2009Pa, R\u2009=\u20098.314\u2009J\u2009mol\u22121\u2009K\u22121, and T\u2009=\u2009298.15\u2009K.v\u2009=\u20094.8\u2009mL\u2009min\u22121\u2009=\u20090.8\u2009\u00d7\u200910\u22127\u2009m3\u2009s\u22121; t\u2009=\u20092\u2009h\u2009=\u20097200\u2009s. In the experiments with tandemly connected cells, v is adjusted to 2.4\u2009mL\u2009min\u22121.For the experiments, (product) is the Faradaic efficiency of a specific product of the electrochemical acetylene hydrogenation, j is the overall current density.The race) was calculated from the formation rates of products using the following equation:n(ace/product) is the moles of acetylene consumed to produce one mole of a specific product, j is the overall current density, FE(product) is the Faradaic efficiency of a specific product, t is reaction time (2\u2009h), z(product) is the moles of transferred charges for producing one mole of a specific product, F is the Faraday\u2019s constant 96,485\u2009C\u2009mol\u22121.The acetylene reaction rate per unit area  of the adsorbed molecular species were calculated using the equation belowE(adsorbate+surface), E(surface), and E(adsorbate) are the energies of the optimized surface containing the adsorbate, the optimized clean surface and the optimized adsorbate in the gas phase, respectively. In addition, free energy corrections were considered to obtain the adsorption free energy (\u0394Gads) and activation free energy (\u0394Gact) using the expression as follows:Eads is the 0\u2009K adsorption energy, \u0394Eact is the 0\u2009K activation energy, \u0394EZPE represents the change in the zero-point vibrational energy, \u0394Uvib represents the change in the vibrational part of the internal energy, and \u0394S represents the change in the entropy, for the adsorption of the adsorbates or between the TSs and initial states at room temperature (T\u2009=\u200925\u2009\u00b0C). The calculated vibrational corrections and frequencies are shown in Supplementary Tables\u00a0NC and NSCu represent the total number of carbon atoms of the surface-adsorbed C2H2 and the number of surface Cu atoms, respectively.The adsorption energies , \u03c1(C2H2), and \u03c1(Cu) are the charge densities of the C2H2/Cu system, and the corresponding parts of C2H2 and Cu, respectively. By using the same atom positions as those in C2H2/Cu, the charge densities of the latter two systems (C2H2 and Cu) were obtained.To estimate the charge transfer after adsorption, we use the Bader\u2019s approach as numerically applied by Henklemann\u2019s groupSupplementary Information"}
+{"text": "Open Biology would like to thank all reviewers who contributed their time by refereeing manuscripts submitted throughout 2021. From previous feedback, we know that most reviewers value recognition of their efforts by the journal and through services, such as Publons, which is integrated with Open Biology.The Editors of To provide an opportunity for recognition, we list the names of all reviewers who opted in. This article is made permanent and citable by its digital object identifier (DOI). We encourage you to quote your contribution in your applications for tenure and grants or other forms of research assessment. Where you have provided it, we have included your ORCID, so your contribution can be unambiguously assigned to you.https://orcid.org/0000-0002-2576-7959Acosta-Serrano A https://orcid.org/0000-0002-1095-8445Ahmad K https://orcid.org/0000-0003-2285-5133Aldred N Ali FAllen Ahttps://orcid.org/0000-0003-0868-8578Alvarsson A https://orcid.org/0000-0002-4395-5232Andersen J Arimura YAzem ABallestrem CBarrachina FBerridge Mhttps://orcid.org/0000-0003-1853-1494Besteiro S https://orcid.org/0000-0003-0857-495XBeynon R Bharti PBin ZBin ZBizard ABlanco-Aparicio CBloom KBodas MBoschetti CBose RBoukhatmi HBrown NBuchwalter Ahttps://orcid.org/0000-0002-3780-8164Bulgakova N https://orcid.org/0000-0003-0038-1985Bunch H Caceres JCallaini GCamins ACampbell CCancio Ihttps://orcid.org/0000-0003-2372-4848\u010capkov\u00e1 Frydrychov\u00e1 R Carmena ACasali Ahttps://orcid.org/0000-0002-3572-7598Catic A https://orcid.org/0000-0002-8701-4995Chamberlain L https://orcid.org/0000-0002-5974-1650Chan K-Y Chen FChen XChen XCheng C-WCheng Y-CClaereboudt Ehttps://orcid.org/0000-0002-0789-2633Claessen D Cohen NColgren Jhttps://orcid.org/0000-0002-8722-9371Contreras O https://orcid.org/0000-0002-9197-8041Cooper C Crow ACyert Mhttps://orcid.org/0000-0001-6671-7600D'Arcy P Deschenes Rhttps://orcid.org/0000-0002-2263-363XDougan S https://orcid.org/0000-0002-1028-7397Du L-L Ducatelle Rhttps://orcid.org/0000-0002-9305-3982Duclos M Dundee MDyson PEl-Danaf RElia Mhttps://orcid.org/0000-0003-1436-5759Engstler M Erhardt SEst\u00e9vez Rhttps://orcid.org/0000-0003-3238-6692Etich J Farge GField CField MFiorani FFisher DFisher RForth J-HFranco SFukagawa TFukata Mhttps://orcid.org/0000-0002-5883-4433Fuller W https://orcid.org/0000-0003-4831-4087Funabiki H Galasko Dhttps://orcid.org/0000-0002-8914-7740Gallego-Delgado J Ganz JGardlik RGazouli MGershenzon JGodinho SGondim KGravholt Chttps://orcid.org/0000-0001-9668-6497Gray R Griffiths Ghttps://orcid.org/0000-0002-4738-0173Grose R Gruneberg Uhttps://orcid.org/0000-0002-7580-5124Hadjantonakis A-K Hammarlund-Udenaes MHamza IHarwood JHemler MHiraoka YHochegger HHolehouse AHolmes MHolthoff Khttps://orcid.org/0000-0003-4332-1640Hoskisson P https://orcid.org/0000-0003-0444-1017Hougland J Hunter TIlan NInestrosa NIsokawa MItzhaki LSJadavji Nhttps://orcid.org/0000-0002-7857-064XJakimowiz D Jin WJin ZJulien EKalsbeek AKathayat RKawaguchi S-YKawashima SKe HKeller SKerr I DKhan FHKim CKim JYhttps://orcid.org/0000-0002-6776-2451Kim JH Kloxin AMKoletas EKuan Y-SKuil Lhttps://orcid.org/0000-0003-4281-5884Kurita T Lackner KLanyon-Hogg TLax GLeigh Nhttps://orcid.org/0000-0001-7317-5651Liang S https://orcid.org/0000-0001-8097-7222Lin G https://orcid.org/0000-0002-7166-9233Loppin B https://orcid.org/0000-0002-7803-8442Lu Z Luty AJFMadrid MMakumi AMarasco DMarco AMartin FMartinez PMartinho RMassana RMcDougall Ahttps://orcid.org/0000-0002-4478-7584Knafo S Min Rhttps://orcid.org/0000-0001-9928-9294Moran Y Morrow ZMullin JMNetherton CNichols JNielsen ONodwell JNorton LOdone APawelec Ghttps://orcid.org/0000-0002-1425-9879Pestov D Pfanner NPlotkin MPolishchuk Rhttps://orcid.org/0000-0003-1507-0936Polymenis M Ranjit MRavindran VRhind NRigden DRikhy RRobinson DRoig Ihttps://orcid.org/0000-0003-2493-3748Rudolph C https://orcid.org/0000-0003-2583-7299Sadej R Sakai DSapio RSanes JSango KSantocanale Chttps://orcid.org/0000-0002-0311-0710Sarkar DS Sarko DSauer J-Dhttps://orcid.org/0000-0001-8999-5451Scheele C Schniepp HCSemenkovich CSeutin VShcherbata HSheng NShenolikar SShu XShutt TSidhu GSobrado PSoldati-Favre DSpencer SSt\u00fclke JSudhof TSusi PSwan ASwelum AA-ATan KTanaka KTandon RTate Ehttps://orcid.org/0000-0002-7757-1739Thatcher GRJ Thomas GTirloni LTodd Rhttp://orcid.org/0000-0001-5779-2449Tommasino M Tsubouchi Hhttps://orcid.org/0000-0003-3048-9241Utrilla J https://orcid.org/0000-0002-1033-1335van der Giezen M van der Goot GVega JLVeit MVendetti SVincent BVlodavsky Ihttps://orcid.org/0000-0001-8730-0003Wang F Wang QWeissman KWeller SWestermann SWilkie Ihttps://orcid.org/0000-0002-4610-8397Williams RS Witte OWWolfner MYan AYan Bhttps://orcid.org/0000-0002-0969-5748Yuan X Zanetti GZechiedrich LZhang BZhang Fhttps://orcid.org/0000-0001-9733-8494Zhang X Zhao YZhu Ghttps://orcid.org/0000-0002-0609-8956Zille M The team really does appreciate all the work our reviewers do on behalf of the journal, and we look forward to working with you again in future."}
+{"text": "To the EditorGJA1 has recently been reported  is a rare skin condition. Classically, it presents at birth or within the first year of life, frequently progressing during early childhood. Diagnostic criteria are erythematous verrucous hyperkeratosis in a fine and whorled Blaschko-linear pattern, intense pruritus, early age of onset, histological features, and resistance to treatment . The caureported . We sougGJA1 variants were not found in any patient. The clinical and histological features of patients 1 and 2 are shown in A total of 15 children with ILVEN and six normal controls  were recruited with written informed consent by their parents or guardians and Research Ethics Committee approval from the Great Ormond Street Hospital Research and Development office. The patients\u2019 parents/guardians consented to the publication of the patients' images. DNA and RNA were extracted from skin biopsies of the affected tissue, DNA was extracted from blood by standard methods and affected skin keratinocytes (KCs) were cultured and immortalized where possible (Lenti-HPV-16 E6/E7 Virus). Deep whole-exome sequencing of blood and affected skin was performed on patient samples, and data were analyzed using an optimized bioinformatic pathway for the detection of low-level somatic variants as previously published . PathogeCARD14 were detected in 2 of 15 patients . The variant in patient 2 is predicted overall likely pathogenic in silico , and since it was to our knowledge previously unreported, we went on to characterize its functional effects. Cultured patient KCs from patient 2 were used to model the variant in the most biologically similar manner. In addition, the patient 2 variant was modeled in a KC cell line (SVK14) that was transfected (Lipofectamine 2000) with CARD14 wild-type and mutant (c.277A > G) pcDNA3.1-HA constructs  heterozygous mutations in soriasis  and pitysoriasis . Variantthe skin . Howevere modest , and note modest . This ine modest  such as ccessful ; howevererformed . Our finPatient 1 had been resistant to multiple therapies , and she had faltering growth . With hospital drug and therapeutics committee approval, we started treatment at the age of 6 years with Ustekinumab . She has had a dramatic and sustained improvement in her skin, now 20 months into treatment, but has required an increase to 8-weekly dosing to maintain effect between doses. She also exhibited catch-up growth, with height and weight improving from the <0.4th to 2\u20139th percentile within 3 months d and f aHistorically, there has been debate about the clinical and histopathological similarities of ILVEN to congenital hemidysplasia with ichthyosiform erythroderma and limb defects syndrome and to psoriasis . We consCARD14 are a recurrent cause of this phenotype, leading to successful targeted medical therapy in one patient. Indications for treatment should be made on an individual patient basis. Genetic counseling should be considered in ILVEN as in these cases, it could be passed on as pityriasis rubra pilaris or psoriasis. These findings underline the power of molecular genetic characterization of rare diseases alongside clinical and histopathological phenotyping.We identify in this study that heterozygous missense variants in No datasets were generated or analyzed during this study.http://orcid.org/0000-0001-7278-1780Melissa Riachi: http://orcid.org/0000-0001-7195-5670Satyamaanasa Polubothu: http://orcid.org/0000-0001-9711-4933Paulina Stadnik: http://orcid.org/0000-0001-9456-1324Hughes Connor: http://orcid.org/0000-0003-0142-4078Sara Barberan Martin: http://orcid.org/0000-0001-6652-7671Carolyn R. Charman: http://orcid.org/0000-0003-1010-8085Iek Leng Cheng: http://orcid.org/0000-0002-8109-6993Karolina Gholam: http://orcid.org/0000-0001-5208-5526Olumide Ogunbiyi: http://orcid.org/0000-0003-3583-020XDavid G. Paige: http://orcid.org/0000-0001-5348-9063Neil J. Sebire: http://orcid.org/0000-0002-8112-2987Alan Pittman: http://orcid.org/0000-0002-4851-1649Wei-Li Di: http://orcid.org/0000-0001-6256-327XVeronica A. Kinsler: The authors state no conflict of interest."}
+{"text": "APS (ATP sulfurylase) and APR (adenosine 5\u2032-phosphosulfate reductase) was upregulated more than 1,000-fold under selenate treatment, while that of CBL (cystathionine-\u03b2-synthase) was upregulated 3.12-fold. Based on the transcriptome analysis, we suspect that the high-affinity sulfur transporter Sultr1;2 plays a key role in selenate uptake in oats. A preliminary regulatory mechanism explains the oat response to selenate treatment was ultimately proposed based on the transcriptome analysis and previous research.Selenium is an essential microelement for humans and animals. The specific processing technique of oats can maximize the preservation of its nutrients. In this study, to understand the genetic response of oats in a high-selenium environment, oats were treated with sodium selenate for 24 h, and transcriptome analysis was performed. A total of 211,485,930 clean reads composing 31.30 Gb of clean data were retained for four samples. After assembly, 186,035 unigenes with an average length of 727 bp were generated, and the N50 length was 1,149 bp. Compared with that in the control group, the expression of 7,226 unigenes in the treatment group was upregulated, and 2,618 unigenes were downregulated. Based on the sulfur assimilation pathway and selenocompound metabolic pathway, a total of 27 unigenes related to selenate metabolism were identified. Among them, the expression of both key genes  Avena sativa L. (oats) ranks sixth in global cereal production statistics, and oats are grown as multipurpose crops for grain, pasture, and forage or as rotation crops in many parts of the world  is an essential micronutrient for humans and animals . It is aIn the present study, a comparison of the gene expression profiles of oat seedlings cultured in Hoagland media supplemented with selenium with those cultured in normal Hoagland solution was expected to reflect the metabolic changes resulting in Se accumulation in oats. The final goal of this study was to identify selenium-related genes and to elucidate the relevant metabolic pathways in oats. The assembled and annotated transcriptome will help to understand the genetic basis of selenium uptake, assimilation, transportation and accumulation in oats.Avena sativa L. cv. Jiayan 2 (Jiayan 2 for short) was selected in this research. This cultivar is a hulled oat widely grown in Qinghai Province, and it produces high yields, displays good quality and is strongly reproducible. The seeds were first soaked in double distilled water (ddH2O) for 24 h and then germinated in sterilized petri dishes with moist filter paper at a constant temperature (25\u00b0C) in darkness  was not treated. Both the control and treatment groups included two biological replications. The roots of all samples were taken, placed into corresponding numbered centrifuge tubes, immediately frozen in liquid nitrogen, and then stored at \u221280\u00b0C for RNA extraction.darkness . Five daDenovo Biotechnology Co.  by using an Illumina HiSeqTM 4000 instrument.Total RNA from the roots of oats in the treatment (T) and control groups (CK) was extracted by using a Trizol Plant RNA Extraction Kit according to the user manual . The quality of the total RNA was then detected using a 1% agarose gel, and its concentration was measured with a NanoDrop 2000C micro-UV detector . mRNA was enriched by oligo(dT) beads and fragmented into short fragments according to the manufacturer\u2019s protocol. In conjunction with random primers, mRNA was reverse transcribed into cDNA . The cDNA library products were subsequently sequenced in paired-end sequencing technology with read lengths of 150 bp by Gene de novo assembled by Trinity, with the default parameters  protein database , SwissPr 0.00001 .Jiayan No. 2 were analyzed by the edgeR v3.32.1 (2(ratio) > 1 were considered DEGs (FPKM (fragments per kilobase per million reads) values were calculated and normalized to estimate the unigene expression abundances by software ERANGE . The dif v3.32.1 . The genred DEGs .p-value < 0.052. Statistical enrichment of differential expression genes in KEGG pathways with a p-value and Q-value < 0.05 was performed by KOBAS v3.0 software  database using Blast2GO v4.1.9 . The sigsoftware .TM RT reagent kit (Takara Bio Inc.) according to the manufacturer. Then, the cDNA was diluted to 100 ng/\u03bcl for relative quantitative real-time RT-PCR analysis. For qRT-PCR validation, a TB Green\u00ae Premix Ex TaqTM II kit (Takara Bio Inc.) was used on an ABI ViiA 7 real-time PCR system  with three replicates per sample. The relative expression level of each unigene was calculated by the 2\u2013\u0394\u0394CT method , and T-2 (treated with Na2SeO4 repeat 2), 216,038,006 raw reads were obtained. After filtering, a total of 211,485,930 clean reads composing 31.30 Gb of clean data were retained, and both the Q20 and Q30 percentages were greater than 95% , CK-2 (control check repeat 2), T-1  unigenes surpassed 1 kb, and 13,169 (7.08%) unigenes were > 2,000 bp . In the All 186,035 unigenes were compared with the sequences in several protein databases, including the Nr, SwissProt, KOG, and KEGG databases, by BLAST, wherein 90,542 unigenes showed high homology with sequences in at least one of the above databases . There wAegilops tauschii, 8,789 (9.94%) unigenes matched genes of Brachypodium distachyon, and 6,183 (6.99%) unigenes matched genes of Oryza sativa  unigenes matched genes of a sativa . We had 2 fold change| of > 1. A total of 9,844 genes were significantly differentially expressed between the CK and Jiayan 2 treatment groups. In total, 7,226 DEGs were upregulated and another 2618 downregulated in the treatment group compared with the control group  with an FDR  of < 0.05 and a | logol group . The logBased on the Nr database, all DEGs were classified into 46 functional groups . Among tAll the DEGs were annotated in five categories with KEGG pathway enrichment analysis . \u201cGlobalSultr1;2 (sulfate transporter), APS (ATP sulfurylase), APR (adenosine 5\u2032-phosphosulfate reductase), SAT/OAS-TL (cysteine synthase complex), CGS (cystathionine-\u03b3-synthase), CBL (cystathionine-\u03b2-synthase), HMT (homocysteine methyltransferase), SAMS (S-adenosylmethionine synthase), SAM-Mtase (S-adenosyl-methionine-dependent methyltransferase), AHCY (adenosyl-homocysteinase), and MARS (methionyl-tRNA synthetase). Arabidopsis mutants and found that sultr1;2 is the only carrier involved in selenate transport in plants. The expression of Sultr1;2 was 5.06 times higher in the T group than in the CK group, which indicated that selenate was taken by oats and could participate in subsequent metabolic pathways , considered the 21st amino acid, was proven to be the active site of all known selenoproteins . Based opathways . APS, APpathways . Among tHMT, and they had a significant change in expression in oats after Se treatment. Unlike Se-enriched plant species such as onion, garlic, and broccoli, where Se-methylselenocysteine (SeMeSeCys) is a major Se compound, SeMet is the predominant Se form in cereal crop species (SeCys is the first molecule for synthesizing selenium-harboring metabolites. Selenomethionine (SeMet) biosynthesis is performed in plants by the sequential action of three enzymes: CGS, CBL, and HMT . CGS and species . Based o species , indicatSultrl1;2, APS, APR, SAT/OAS-TL, CGS, CBL, HMT, SAMS, SAM-Mtases, AHCY, MARS, which were related to selenium metabolism. As shown in R2 = 0.8445) indicated that the DEGs expression pattern obtained by RNA-seq and qRT-qPCR results were in good concordance, which supports the reliability of the RNA-seq data.To validate the RNA-seq results, qRT-PCR was used to quantified analysis the expression of 11 DEGs, Oats are important grain and forage crops worldwide, and oats are grown on 14.1 million hectares, with a grain production that reached 28.3 million metric tons in 2005 . Oatmeal\u2019s unique processing technique allows nutrient elements to be stored in numerous finished products. With more in-depth research on oats, scientists have found that the amino acid composition of oats is more suitable for human nutrition than that of other cereal species and have begun to highly recommend it for human consumption . Se from2SeO4 for 24 h, a total of 9,844 DEGs were detected in the CK and T groups after RNA-seq analysis. To elucidate the molecular mechanisms underlying salt tolerance in oat, + and Cl\u2013 metabolic pathway genes but also stimulate Na+ and Cl\u2013 stress-related genes. In our study, 20 \u03bcM Na2SeO4 was used to stimulate related gene expression, which is not a-inducing stress concentration for oats. The differentially expressed unigenes in the present work are mainly focused on selenium uptake, assimilation, transportation, and accumulation. Among them, 7226 DEGs were upregulated in the treatment group, and another 2618 DEGs were downregulated. The absolute log2(fold change) values ranged from 1 to 14.70. With the help of functional annotation and KEGG pathway analysis, 27 unigenes related to selenium metabolism were identified, and expression models of related structural genes in oats in response to selenate metabolism were constructed. From the expression model, it could be inferred that MSeMet would not be synthesized and that dimethylselenide (DMSe) would not be synthesized, either (In this study, after stimulation with Na, either ; DMSe is, either , and the, either . Selenat, either . KryukovTaSultr1;1, TaSultr1;3, and TaSultr2;1 gene expression is significantly upregulated after supplying selenide to wheat roots (sultrl1;2 was upregulated 5.06-fold under selenate treatment compared with that in the CK group, and the other high-affinity sulfur transporters in oats exhibited no obvious differences. We concluded that sultrl1;2 played a key role in selenate uptake in oats.Because of the similarity of the chemical properties of selenium and sulfur, the absorption of inorganic selenium by plant roots via high-affinity sulfur transporters has been demonstrated by a large number of documents . Shinmacat roots . In the In this research, we utilized the transcriptome to analyze the genetic changes in oats under selenium treatment. The expression pattern of selenium-related structural genes in oats was constructed through KEGG pathway analysis. We speculate that volatile selenium would not be generated in selenium metabolism in oats. To the best of our knowledge, this is the first study to identify the differentially expressed genes related to oat selenium metabolism through combined sequencing in oats. These findings will enrich the understanding of selenium metabolism and lay a foundation for the subsequent identification of key candidate genes for breeding selenium-enriched oat cultivars.The original contributions presented in the study are included in the article/HZ and BZ designed the study. TL conducted the experiments and analyzed the data and drafted the manuscript. XL, RZ, HC, and BZ critically reviewed and improved the manuscript. All authors have read and approved the final version of the manuscript.The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest. The reviewer ZL declared a shared affiliation, with no collaboration, with the authors to the handling editor at the time of the review."}
+{"text": "Akkermansia muciniphila in the mouse intestine. The resistance genes vanRG, tetW/N/W, acrD, and evgS were significantly upregulated in the test group compared with the control group. Efflux pumping was the primary mechanism of drug resistance in the Firmicutes, Proteobacteria, Bacteroidetes, Verrucomicrobia, Synergistetes, Spirochaetes, and Actinobacteria found in the mouse intestine. Our findings indicate that changes in the abundance of the intestinal microbiota are closely related to the presence of antibiotic-resistant bacteria in the intestinal tract and the metabolic health of the host.Phorate is a systemic, broad-spectrum organophosphorus insecticide. Although it is commonly used worldwide, phorate, like other pesticides, not only causes environmental pollution but also poses serious threats to human and animal health. Herein, we measured the blood glucose concentrations of high-fat-diet-fed mice exposed to various concentrations of phorate ; we also assessed the blood glucose concentrations of high-fat-diet-fed mice exposed to phorate; we also assessed the distribution characteristics of the resistance genes in the intestinal microbiota of these mice. We found that 0.005 and 0.5 mg/kg of phorate induced obvious hyperglycaemia in the high-fat-diet-fed mice. Exposure to phorate markedly reduced the abundance of  Organophosphorus (OP) compounds are widely used in China and abroad to protect crops from insects . OP pestPhorate undergoes a P450-mediated desulphurisation reaction to produce oxon metabolites; its primary mechanism of acute toxicity is acetylcholinesterase inhibition mediated mainly by the oxon metabolite phorate\u2013oxon . It remaA recent review of comprehensive studies on intestinal microbiota and antibiotic resistance conducted in a large human cohort in China found that the antibiotic resistance of the intestinal microbiota is closely associated with faecal metabolites and the host\u2019s metabolic health . AntibioTo explore the hazards of pesticide residues with respect to host metabolic health and the correlation between the production of resistance genes and glucose metabolism, in this study, we measured the blood glucose concentrations and assessed the distribution characteristics of antibiotic-resistance genes in the intestinal microbiota of HFD-fed mice exposed to phorate.p < 0.05).To determine the effects of phorate on glucose metabolism, 7\u20138-week-old male HFD-fed C57Bl/6j mice were exposed to 0, 0.005, 0.05, and 0.5 mg/kg bw/day of phorate by oral gavage each day for 5 weeks. We then measured the blood glucose concentrations of the mice in the natural state a. The blPrincipal component analysis was used to study the extent of intergroup similarity or heterogeneity in terms of community structure. A shorter distance between samples indicates a greater similarity in community structure and vice versa. The community similarity was measured based on phylogenetic relatedness using unweighted UniFrac in a principal component analysis plot b. PC1 anAkkermansia was the dominant genus in the control group (7.43%), with the other classifications ignored. However, the abundance of Akkermansia was decreased in the phorate-exposed groups . The abundance of Parabacteroides  and that of Alistipes  were increased in the phorate-exposed groups compared with the control group .The intergroup analysis identified the enrichment of specific genera, indicated by significant intergroup differences in abundance. Gut microbiota genera having a relative abundance of 0.01% in at least one group were scrutinized. Genera with a relative abundance of >0.01% of the intestinal microbiota genera in each group were selected. A Venn diagram was drawn to investigate the distribution of gene numbers among the designated groups and to analyse the common and unique information of the genes in the different groups. Overall, 749,726 genes were shared among the four groups D. In totvanRG, tetW/N/W, acrD, and evgS were significantly upregulated in the phorate-exposed groups compared with the control group. However, the resistance genes IrfA, CMY-98, rpoB2, LRA-2, EdeQ, AAC3-IIa, InuC, Erm31, clbC, APH6-Ic, and cat-resistance genes were significantly downregulated regulated in the phorate-exposed groups.After analysing the drug-resistance genes in the intestinal microbiota in the four groups of mice, the 30 genes with the most obvious expression differences were subjected to further analysis E. The reFirmicutes and Proteobacteria. The abundance of Firmicutes is mainly attributable to the following three mechanisms of drug resistance: efflux pumping, inactivation, and target alternation. Meanwhile, efflux pumping is the main mechanism of drug resistance in Proteobacteria. Bacteroidetes, Verrucomicrobia, Synergistetes, Spirochaetes, and Actinobacteria were also widely distributed in the intestinal microbiota of the mice. Moreover, target protection, replacement, and other mechanisms exhibited by the above-mentioned strains affect the development of drug resistance by the intestinal microbiota.Phorate is a systemic, broad-spectrum OP insecticide. In this study, for the first time, we found that phorate has a hyperglycaemic effect on HFD-fed mice. Diabetes is reportedly induced by environmental and genetic causes, and increasing evidence has shown that the use of global pesticides has increased the risk of obesity and T2D . A previA. muciniphila is associated with the development of metabolic disorders, including obesity and T2D [A. muciniphila secretes a glucagon-like peptide-1-inducing protein to improve glucose homeostasis and regulate metabolic diseases in mice [A. muciniphila was significantly reduced after exposure to phorate, and this may have led to the observed increases in blood glucose concentrations. However, the abundances of Parabacteroides and Alistipes were increased in the phorate-exposed groups compared with those in the control group. Parabacteroides can accelerate the development of diabetes in non-obese diabetic mice as well as increase the macrophage, dendritic cell, and destructive CD8+ T cell levels and reduce the Treg cell levels [Alistipes [Alistipes can improve its glucose tolerance and insulin sensitivity [Upon entry through oral gavage, phorate inevitably affects the intestinal microbiota of mice. The gut microbiome is closely associated with the occurrence and development of chronic diseases . The gut and T2D ,20. A. m in mice . Similarl levels . Feedinglistipes . The enrsitivity . Our resn = 1210) study, a significant overall change was observed in the intestinal antibiotic-resistance structure of the healthy, prediabetic, and T2D groups. The study reported that the levels of vanRG, tetW/N/W, acrD, and evgS were significantly upregulated after exposure to phorate. vanX present in vancomycin-resistant genes is reportedly associated with the risk of T2D [AcrD, which is paralogous to AcrB\u2014which belongs to the RND family of transporters\u2014confers resistance to tetracycline, novobiocin, nalidixic acid, norfloxacin, sodium dodecyl sulfate, and aminoglycosides [vanRG, the tetracycline-resistance gene tetW/N/W, and the multidrug-resistance genes acrD and evgS; these genes have not been previously reported in mice. We believe that the increase in the abundances of these resistance genes is attributable to the use of phorate.Interestingly, we found that phorate may also contribute to the development of resistance genes in the intestinal microbiota as well as the development of hyperglycaemia in mice. According to a recent study  that anaycosides . We founFirmicutes, Proteobacteria, Bacteroidetes, Verrucomicrobia, Synergistetes, Spirochaetes, and Actinobacteria. Notably, Firmicutes, Proteobacteria, and Bacteroidetes have been found to be dominant in the microbiota of mice and humans [For the first time, we found that phorate can lead to the production of drug-resistance genes in the intestinal microbiota. Phorate can also lead to the corresponding drug resistance in bacteria. For instance, tetracycline efflux transporters are a major facilitator of the antibiotic efflux pumps of the aminoglycoside gene superfamily . We found humans . Therefod humans . Herein,Phorate was obtained from Tianjin Alta Scientific Co., Ltd.  . Pure corn oil was purchased from Sigma-Aldrich  Trading Co, Ltd, Shanghai, China). The mice were fed with a HFD .A total of 28 male C57Bl/6j mice aged 7\u20138 weeks were obtained from Beijing Vital River Laboratory Animal Technology Co., Ltd. . The mice were randomly divided into four groups  and fed an HFD. Based on their group, the mice were treated with different doses of phorate or corn oil (control) daily for 5 weeks consecutively. Phorate dissolves well in corn oil and was administered by gavage. All the mice were housed under a 12 h light/dark cycle at 22\u201325 \u00b0C and were provided free access to drinking water and food, except when the food had to be withdrawn for experimental purposes. All of the animal experiments were performed according to the guidelines of Shenzhen TopBiotech Co., Ltd . (TOP-IACUC-2021-0083).Blood glucose concentrations were determined using a FreeStyle Optium Neo meter  at the fifth week of the treatment period. Blood samples were collected from mice through a small cut made at the tip of the tail.n = 28 C57Bl/6j mice fed an HFD). We used the paired-end sequencing mode of the Illumina HiSeq sequencing platform  for high-throughput sequencing of multiple samples. The raw data obtained using this platform were pre-processed using Readfq to acquire clean data for subsequent analyses. Bioinformatic analysis of the sequencing data was conducted using the Quantitative Insights into Microbial Ecology software. Low-quality reads, barcodes, and primers as well as chimera sequences were eliminated using the UCHIME software  with the relevant algorithm, and the effective tags were obtained. Clean data were obtained after pre-processing, and the MEGAHIT assembly software (version 1.0.4-beta) was used for assembly analysis. After quality control of each sample, the clean data were compared with the scaftigs after assembly of each sample using the Bowtie2 software . For the scaftigs generated upon single-sample assembly, fragments <500 bp were filtered out, and statistical analysis and subsequent gene prediction were conducted. Starting from the scaftigs (\u2265500 bp) of each sample, MetaGeneMark  was used for open reading frame prediction, and hits with <100 nucleotides were filtered out based on the prediction results. For the open reading frame prediction results of each sample assembly, the CD-HIT software  was used to eliminate redundancies to obtain a non-redundant initial gene catalogue. By default, 95% identity and 90% coverage were maintained for clustering, and the longest sequence was selected as the representative sequence. Based on the abundance information of each gene in each sample in the gene catalogue, basic information statistics, core pan-gene analysis, correlation analysis between samples, and gene-number Wayne diagram analysis were conducted. The 28 gut microbial metagenome sequence data that support the findings are available in the SRA under the NCBI BioProject ID PRJNA892724.Using the QIAamp DNA Stool Kit , genomic DNA was extracted from the caecum contents. A Thermo NanoDrop One  was used to detect the purity and concentration of the extracted DNA  in the Comprehensive Antibiotic Resistance Database (v2.0.1) was used to compare unigenes with the CARD data (RGI built-in Blastp); bitcore value comparison was performed to score the results [Resistance gene identifier (RGI) software  was used for graphical illustrations and statistical analyses. The non-parametric factorial Kruskal\u2013Wallis rank sum test was used to detect genera with significant abundance differences between groups, and the Wilcoxon rank sum test was then used to analyse the differences between the two groups. Finally, linear discriminant analysis was performed to achieve dimensionality reduction and assess the impact size of the significantly different genera.Based on the data distribution, significance was assessed using the unpaired two-tailed We found that phorate can cause hyperglycaemia in mice. An in-depth analysis of the intestinal microbiota in mice revealed that phorate can affect the abundance of the intestinal microbiota and therefore alter the expression of drug-resistance genes. Moreover, changes in the abundance of the intestinal microbiota are closely related to the presence of antibiotic-resistant bacteria in the intestinal tract and the host\u2019s metabolic health. Taken together, our results can guide pesticide safety evaluations in future studies."}
+{"text": "This study is aimed at exploring the value of magnetic resonance diffusion-weighted imaging (DWI) combined with perfusion-weighted imaging (PWI) for diagnosing melanoma under a three-dimensional (3D) hybrid segmentation algorithm. 40 patients with melanoma were collected as research objects and subjected to magnetic resonance imaging (MRI) examination. A segmentation model was constructed and the original images were input. The noise contained in the images was preprocessed and normalized, and the mixed level set segmentation was performed after linear fusion of the images. Imaging findings were analyzed to find that the combined diagnosis of DWI and PWI with a 3D hybrid segmentation algorithm had the advantage of being clear and accurate. 10 primary cases were detected, which occurred in the cerebral meninges; 30 cases of metastases occurred inside the skull, mostly adjacent to the surface of the brain. The typical T1-weighted imaging (T1WI) and T2-weighted imaging (T2WI) of melanoma showed high signal and low signal, respectively, and the enhanced scan showed obvious enhancement. Atypical melanoma was manifested variously in MRI; a few had cystic necrosis, and an enhanced scan of the solid area revealed significant enhancement. Patients with multiple metastatic melanomas mainly showed low signal on DWI, and patients with primary or single metastatic melanoma mainly showed high signal or mixed high signal. Patients with perfusion imaging showed high perfusion on PWI. The 3D hybrid segmentation algorithm helped to improve the accuracy of DWI combined with PWI in the diagnosis of melanoma. This work provided a certain reference for the clinical diagnosis of melanoma. Melanoma generally refers to malignant melanoma in clinical practice, which is a kind of malignant tumor derived from melanocytes. Its pathogenesis is not yet clear. Relevant studies indicate that its occurrence and development are closely related to the genes, the environment, or the genes together with the environment. The occurrence of this disease is relatively insidious, and the prognosis of patients is poor . MalignaHistopathological examination is the gold standard for diagnosing melanoma, and imaging examinations can accurately locate and quantitatively analyze the lesions. These are helpful for the selection of treatment plans, prediction of therapeutic effect, and follow-up in the latter period, having clinical significance. Computed tomography is a common imaging method in clinical practice. However, some patients think that it is not sensitive to early limited-stage metastases of melanoma, has a low benefit rate, and cannot display limbs and other body parts. Conventional magnetic resonance imaging (MRI) gives a better resolution for soft tissues without radiation and can analyze the tissue source and signal characteristics of lesions on purpose, which is of great value in diagnosing melanoma , 7. It cIn image processing, there are countless algorithms that can be applied for segmentation. The earliest method used for automatic segmentation of cerebral tumor is traditional machine learning, in which the threshold algorithm, clustering algorithm, and deformation mode algorithm are more commonly used than other machine learning algorithms , 14. AutIn this study, 40 patients with central nervous melanoma were included, and they were admitted to hospital from September 2019 to September 2020. All the patients, including 30 males and 10 females, were 37\u201368\u2009years old with an average age of 44.35\u2009\u00b1\u20099.78. At the time of visiting doctor, patients with symptoms like nausea, vomiting, dizziness, headache, weakness of the limbs, visual disturbances, and confusion of consciousness had lesions in the brain. Meanwhile, the patients with stiff necks accompanied by soreness had lesions in the spinal canal. The informed consents were signed by the patients and their families. This study has been approved by the ethics committee of the hospital.The inclusion criteria were as follows: patients were diagnosed clearly by histopathological examination; Patients had the complete clinical and pathological data; Patients had a good physical condition generally. The exclusion criteria were as follows: patients with incomplete pathological diagnosis data and those who cannot cooperate with MRI examination were excluded.A 3.0\u2009T MRI examination was performed. The head was scanned with T1WI, T2WI, water suppression, enhanced scanning, and DWI combined with PWI, respectively; and the spinal canal was scanned with T1WI, T2WI, fat suppression, and enhanced scanning. The MRI enhanced scanning contrast agent was gadolinium diethylenetriamine pentaacetic acid (Gd-DTPA), and the intravenous injection dose was 0.1\u2009mmol/kg of weight. The scanning parameters are detailed in c categories. For an P \u00d7 Q \u00d7 W image, it is assumed that {gi, i=1,2,\u2026, n; n=P \u00d7 Q \u00d7 W} was the set of pixel intensity values in the image histogram, {uj, j=1,2,\u2026, c} was the set of cluster centers, and \u03bcj(gi) was the membership function of gi belonging to category j. Thus, the objective function of FFCM is expressed in the following equation: The traditional fuzzy C-means clustering algorithm had the defects of a large amount of calculation and a long running time for large data samples. Therefore, an improved method was proposed to reduce the number of iterations required for the algorithm convergence, and the data sets involved in the iterations were compressed. Therefore, the running time of each iteration process could be reduced, the operation speed of the fuzzy C-means algorithm was improved, and the clustering effect of the algorithm was not affected. The clustering segmentation algorithm of 3D fast fuzzy C-means (FFCM) was carried out by the FFCM, through which the data was divided into r represented 1-constant>1, which were used to control the fuzzy degree of clustering.Together with the equation , the FFC\u03d5 was used to represent the active contour C={Y|\u03d5(Y)=0}, and the points inside and outside the contour had the positive or negative values. Then the function of minimum need is defined in the following equation:Because the MRI image of intracranial melanoma was extremely complex, a 3D hybrid level set algorithm was applied to integrate the surface and volume information. The zero set of the embedding function k=exp(\u2212c|\u2207U|2) was the surface feature map related to the 3D image gradient, c was the control slope, W(\u03d5) was the Heaviside function, \u03a9 was the 3D image area, and \u03b1 and \u03b2 were the predefined weights to balance the two items. Then \u03bc stood for the predefined parameter indicating the lower limit of the gray level of the target image.U represented the 3D image to be segmented in the equation (\u03ba=div(\u2207\u03d5/|\u2207\u03d5|), and \u2329\u00b7, \u00b7\u232a were the inner product. Since only the geometric changes of the curved surface were of interest in the segmentation, it could be observed that all points on the curved surface moved in the normal direction through the equation (k, which drew the surface to the boundary of the target object. The third term represented the k-weighted curvature flow of the gradient feature map, meaning that the weak part of the support surface was with a smooth boundary.In the equation , Q\u27f6=\u2212\u2207\u03d5/equation . The firequation  represen\u03d5t=\u03b3|\u2207\u03d5| represented the same surface change. If \u03d5 was a signed distance function, the derivative of the level set |\u2207\u03d5|=1 embedding function over time was described as the following equation:In the level set, For the process of multimodal 3D image hybrid segmentation algorithm, firstly, the MRI images of T1, T2, and T1ce models were input. Because there was noise in the image itself, the image is preprocessed with median filtering and gray stretching. The gray stretching was applied under the 3D FFCM algorithm, through which partial boundary information could be effectively retained. Then linear fusion was used, and the fused image was for 3D FFCM clustering segmentation. The part with larger gray value in the clustered image was extracted by automatic threshold value, the under-segmented part of intracranial melanoma was then obtained, and finally the mixed level set was used for the segmentation. The flowchart and the main steps of segmentation are shown in According to the algorithm flow, the image segmentation steps are shown in Among the 40 patients in this study, 5 cases had the primary lesion in the cerebral meninges, 5 cases had that in the spinal meninges, and 30 cases had intracranial metastatic melanoma. 25 cases and 5 cases had skin and eyeballs as the primary lesion location, respectively. There were 10 cases with primary melanoma in this study. 5 patients were with melanoma in the cerebral meninges and the other 5 with melanoma in the cervical spinal cord. The imaging findings are shown in From There were 30 cases with intracranial metastatic melanoma, including 25 patients with the primary lesion in the skin and 5 patients with the primary lesion in the eyeballs. 20 patients of them were diagnosed with solitary lesion, and 10 patients with multiple lesions. The results of their imaging examinations are shown in From All the patients were diagnosed with melanoma through surgical pathology. The pathological images of some patients are shown in From The relevant literature stated that primary melanoma of the central nervous system is rare, and it proposed three basic diagnostic conditions, including no melanoma on the skin and eyeballs, no melanoma history of tumor resection, and no melanoma metastasis in internal organs . All theMRI shows great differences in the presentation of melanoma, and it can be divided into four types. The first is the melanin type, with T1WI and T2WI with high signal and low signal, respectively. The second is the nonpigmented type, as T1WI and T2WI show equally low signal and equally high signal, respectively. The third is mixed type with the mixed signals; and the fourth is the blood type, with only hemorrhage manifested , 21. WheMetastatic melanoma is more common in the central nervous system, which is the third largest intracranial metastatic tumor, only after that of lung cancer and breast cancer. It may occur in every part of the central nervous system, especially the junctions of the cortex and medulla. The MRI signal performance of it is similar to that of primary melanoma and is also related to bleeding and the content of melanin in tumor tissue , 26. In PWI of MRI is applied for the evaluation of the angiogenesis in brain tissues, by measuring cerebral blood volume; while DWI can be used for the analysis of specific tissues. However, the diagnosis of melanoma by PWI combined with DWI is rarely reported at home and abroad , 28. In In this work, a multimodal 3D image hybrid segmentation algorithm was utilized for observing the MRI findings of melanoma patients. It was discovered that the MRI manifestations of most melanoma patients were complex and diverse, showing different low, high, or mixed signals. DWI combined with PWI examination under the 3D hybrid segmentation algorithm had the advantages of great clarity and accuracy, providing certain value in the diagnosis of melanoma. The disadvantage was that the sample size of this work was small, which needed further supplementation and improvement in the future. This work offered a theoretical reference for the clinical diagnosis and treatment of melanoma."}
+{"text": "The multi-sectoral nature of urban health is a particular challenge, which urban family planning in sub-Saharan Africa illustrates well. Rapid urbanisation, mainly due to natural population increase in cities rather than rural\u2013urban migration, coincides with a large unmet urban need for contraception, especially in informal settlements. These two phenomena mean urban family planning merits more attention. To what extent are the family planning and urban development sectors working together on this? Policy document analysis and stakeholder interviews from both the family planning and urban development sectors, across eight sub-Saharan African countries, show how cross-sectoral barriers can stymie efforts but also identify some points of connection which can be built upon. Differing historical, political, and policy landscapes means that entry points to promote urban family planning have to be tailored to the context. Such entry points can include infant and child health, female education and employment, and urban poverty reduction. Successful cross-sectoral advocacy for urban family planning requires not just solid evidence, but also internal consensus and external advocacy: FP actors must consensually frame the issue per local preoccupations, and then communicate the resulting key messages in concerted and targeted fashion. More broadly, success also requires that the environment be made conducive to cross-sectoral action, for example through clear requirements in the planning processes\u2019 guidelines, structures with focal persons across sectors, and accountability for stakeholders who must make cross-sectoral action a reality. In a majority-urban world with new and recurrent health challenges, urban health should be a global political priority. The reasons for which it has fallen short of that include as follows: competition with a dominant development agenda which still has a rural focus, paucity of disaggregated urban data, lack of evidence on cost-effective interventions, and researchers\u2019 and policy-makers\u2019 challenges in effectively tackling the multi-sectoral nature of urban health . It is tThe source of data for this paper is a project on urban fertility and family planning in sub-Saharan Africa implemented 2018\u20132022) by the International Union for the Scientific Study of Population (IUSSP). The project supported mid-career African researchers to undertake research and to engage with policy-makers \u2026 However, some may believe that factors such as education, access to basic services and cost of living, more so than access to family planning, are the principal drivers of urban fertility decline and demographic dividends\u2019  high fertility rates include rapid urbanisation, urban poverty, poor waste management, unemployment, environmental degradation, urban insecurity, inadequate urban infrastructure, inadequate transportation and inadequate financing. The challenges associated with high fertility rates also lead to inadequate housing, overcrowding and increased poverty and this leads to some interventions to control our population such as family planning services. It is on this basis that my ministry supports family planning interventions to reduce or control family sizes .Of course, the mere existence of a policy, or (even more so) a reference therein, does not guarantee implementation; real cross-sectoral action may still be absent. We examined, for example, whether the extent of cross-sectoral action on urban FP in Uganda was commensurate with its Third (2020\u20132025) National Development Plan\u2019s mandate for cross-sectoral action, and with statements such as that by the permanent secretary of the Ministry of Lands, Housing and Urban Development who said at a Kampala workshop on Uganda\u2019s population challenge:The dissonance between such a clear grasp of the issues and the fact that our research found no cross-referencing between urban planning and family planning in Uganda policy documents invites closer examination.For this study, in-depth interviews were conducted with ten urban planning and family planning stakeholders in Uganda at various levels  in 2020. The interviews revealed a disconnect between the urban and family planning stakeholders. \u2018There is no connection\u2026 because these are different sectors working differently. Health is doing its own work, and urban development is doing its own work\u2019.  \u2018No, we don\u2019t have a direct linkage\u2026 Family planning is not of our direct interest, although we are interested in a quality population. Now there are more people coming to urban areas, and we need to be concerned about these things, otherwise our service delivery will be poor\u2019.  The disconnect was reinforced by what interviewees perceived as a poor, unclear means of engagement across the sectors, thereby sustaining separate ways of operating. This created a lack of appreciation of areas of common interest that could foster cross-sector collaboration. \u2018The linkage with urban planners may not be very clearly spelled out. For example, what are the family-planning activities in the urban planning department? And yet urban planning is something which you can\u2019t separate from the healthcare system where we are providing services\u2019.  Interviewees noted that although there are existing bodies whose mandate is coordination across sectors, implementation of such coordination was lacking. \u2018The national planning authority drives all of us. But sometimes you find that we are not working well across the sectors\u2019.  Coordination was described as an unimplemented mandate. Interviewees from both sectors were concerned with their core business, and generally had an inward-looking perspective. Urban-planning respondents were mainly concerned about feeding the growing population, spatial maps, making population projections, land use, and infrastructural development. \u2018It\u2019s our responsibility to make sure that we plan for the people that are projected to be here tomorrow. We get worried, but the way the government works, it\u2019s not our mandate to control population\u2019.  \u2018Urban planners don\u2019t have any role in family planning, apart from providing spatial data based on population projections. It\u2019s health that is concerned with family planning\u2019.  Urban planners acknowledged that a slower-growing population would be preferable in order to reduce pressure on service delivery: \u2018All we can do is sensitise and create awareness. We just plan, but there is pressure between population growth and general planning, and we definitely need to match our growth to the planning\u2019.  Neither urban nor family planning interviewees in Uganda expressed taking account of intra-urban differentials \u2014 heterogeneity amongst urban dwellers especially those living in informal settlements. Urbanisation was perceived as automatically leading to fewer children per woman; urban women were assumed to have lower fertility and a higher demand for contraceptives than their rural counterparts. Thus, urbanisation was viewed as contraception in itself.Some interviewees in Uganda acknowledged the need for cross-sectoral collaboration. \u2018There is a need for integrated planning. It would help if we talk from the same document. So, if you\u2019re the health guy, you\u2019re going to do health from the same document as the urban planner\u2019.  \u2018Can we do it like we did for HIV prevention? Everywhere and everyone played a part\u2026in schools, in the church, politicians, mosques etc. I think we need that kind of concerted effort by every sector\u2019.  Urban planners aimed at accommodating population growth, while family planners were concerned with containing population growth. There was a lack of appreciation of the urgency for reducing urban population growth, possibly inadvertently abetted by family planning research, insofar as it has emphasised a simple rural\u2013urban divide showing higher uptake of family planning in urban areas than rural. Although Uganda\u2019s Third National Development Plan attributes low FP use to lack of a multi-sectoral approach to health, family planning and urban planning professionals continue to operate in silos.Stronger signs of real cross-sectoral action, or at least explicit planning therefor, are evident in these two countries, where the relationship between the FP and urban development sectors is changing. Ghana is currently revising its national urban policy, adopted in 2017 to reflect the SDGs . The IUSAn important activity proposed under this new section in the national urban policy is management of the urban population by intensifying information, education, and communication on family planning as well as on an array of sexual and reproductive health issues. A stakeholder from the Ministry of Local Government, in an interview for this study, articulated this activity\u2019s rationale: \u2018any intervention in this area [FP] that allows for improvement in the conditions of life, standard of living and providing more than just facilities [which would come under the remit of the Ministry of Health] is considered to be urban development\u2019.Possibilities for cross-sectoral links between FP and urban development may be present in policies and yet thwarted by complicated urban-governance politics. An example is Kenya, whose governance structure is a devolved two-tier system with the national government in charge of policy formulation and 47 county governments in charge of localisation and implementation of government policy. County-level \u2018integrated development plans\u2019 provide opportunities for cross-sectoral links between FP and urban development through the localisation of the national urban development policy and the national health policy. Nairobi county plans over two policy periods (2013\u20132017 and 2018\u20132022) address both high urban population growth and unmet need for family planning amongst the urban poor: \u2018The unmet needs for family planning amongst the urban poor remains a big challenge due to the question of commodity accessibility and affordability\u2019  \u2014 is very likely to influence discussions and eventual policy around FP expanding into urban specificities. While such climates would be difficult to measure and rank amongst countries, a proxy may be found in SDG Indicator 5.6.1, \u2018Decision making on sexual and reproductive health and reproductive rights: Percentage of women aged 15\u201349\u00a0years who are married (or in union), who make their own decisions on three areas \u2013 their healthcare, use of contraception, and sexual intercourse with their partners\u2019. Amongst this study\u2019s eight countries, Kenya (56%) and Uganda (62%) rank highest on this indicator; Niger (7.3%) and Burkina Faso (20.3%) rank lowest; and the rest are clustered between 46 and 52% . All of The asymmetry of FP cross-referencing urban more than vice versa suggests that awareness of the need for cross-sectoral collaboration on UFP is greater in the FP sector. Current bodies of evidence should suffice to sway both sides and move each towards the other \u2014 that FP cannot succeed unless it succeeds in cities, and that urban development will struggle unless it addresses urban population growth and unmet need for FP. But it is the FP side that is producing the evidence, and thus perforce is more aware of it. Also, FP is more bounded, discrete, and professionally coherent than the sprawling urban-governance domain which must encompass not only many sectors but also the dimensions of politics, culture, technocracy, and bureaucracy. In trying to penetrate urban governance to raise its awareness, FP contends with several other specialisations that also have evidence that their sector can contribute to urban development, and are similarly vying for attention in the complex urban domain.Nonetheless, this same urban complexity offers multiple arguments and potential entry points for advocates of urban FP, armed with evidence that FP contributes positively to several urban-governance preoccupations Fig.\u00a0 17]. Th. Th17]. Furthermore, to defuse arguments that greater resources to UFP would subtract from other urban priorities, UFP advocates may wish to emphasise FP\u2019s potential cost-effectiveness: according to a study of low- and middle-income countries , \u2018Every dollar spent on contraceptive services beyond the current level would reduce the cost of pregnancy-related and newborn care by three dollars\u2019  (page 5)Finding the right pathways for advocacy to emphasise is a cross-sectoral undertaking: FP specialists need the insights and commitment of urban-development specialists  to formulate the arguments most likely to succeed in a given urban polity. This study\u2019s finding that a city\u2019s preoccupations  tend to be distinct, and therefore advocacy strategy and entry points will differ from city to city, does not imply that the importance of cross-sectoral collaboration is uneven. Solid evidence on and coherent advocacy for UFP are necessary in any context, and cross-sectoral collaboration may be a necessary if insufficient condition for both.As a practical matter, successful cross-sectoral advocacy for urban family planning requires not just solid evidence, but also internal consensus and external advocacy. FP actors and their urban-development collaborators must cohere to agree on the best framing of the issue per local preoccupations, and then communicate the resulting key messages in targeted and concerted fashion.More broadly, success also requires that the environment be made conducive to cross-sectoral action, for example through clear requirements in the planning processes\u2019 guidelines, structures with focal persons across sectors, and accountability for stakeholders who must make cross-sectoral action a reality.In the \u2018Making Urban Health a Political Priority: the Illustration of Urban Family Planning\u2019 section, we suggested that addressing the cross-sectoral impediments in this UFP example may help ease other hindrances to prioritizing urban health \u2014 a predominantly rural development paradigm, paucity of disaggregated urban data, and lack of evidence on cost-effective interventions. A cross-sectoral espousal of UFP, against prevailing currents that focus FP on rural populations, is a step towards balancing urban and rural development paradigms. Cross-sectoral collaboration on UFP can inform design of the collection and analysis of disaggregated urban data. Spreading UFP practice will offer more opportunities to assess interventions\u2019 cost-effectiveness. Cross-sectoral collaboration on UFP will not be a keystone that solves all the other challenges of urban health, within and beyond UFP; but unblocking such collaboration is likely to have complementary effects on the other challenges.This study\u2019s chief limitations are a relatively opportunistic sample of countries (being where project fellows are based), and the fact that UFP is unevenly developed in them. The latter has at least two implications for this and future studies: first, a paucity of successes, and second, a dearth of organised information that would allow more objective cross-country analysis. Nonetheless, this study has found several elements that address its research question of how to begin to link FP and urban development in SSA: the need to understand the challenges ; institutional and policy measures to overcome cross-sectoral barriers; and how to capitalise on urban complexity by identifying the evidence and arguments most likely to resonate beyond the health sector. These findings on strategies to win attention and multi-sectoral action amidst crowded urban-governance agendas can be relevant to urban health in general, and in particular to urban health problems such as urban mental health and gender-based violence. These, like urban FP, are culturally sensitive, need a degree of behavioural and/or social change, and (with their multiple determinants and intervention paths) require multi-sectoral action."}
+{"text": "Concurrent chemoradiotherapy with high\u2010dose (HD) cisplatin is the standard treatment for locally advanced head and neck squamous cell carcinoma (LA\u2010HNSCC). Due to the higher treatment\u2010related adverse effects with standard therapy, alternative regimens (non\u2010standard therapy), namely, lower dose weekly cisplatin, carboplatin/paclitaxel, or cetuximab are considered. There is, however, no consensus on non\u2010standard regimens. We aimed to investigate the efficacy and safety profile of these regimens.This single centre retrospective cohort study included all consecutive adult patients with newly diagnosed LA\u2010HNSCC treated with either standard or non\u2010standard regimens between January 2016 and April 2021. The primary outcome was 2\u2010year failure\u2010free survival (FFS). The secondary outcomes included acute toxicities, hospitalisation rates, dose modifications, treatment failure rates (TFR), and overall survival.p\u00a0<\u2009.001) and lower European Cooperative Oncology Group (ECOG)\u20100 (p\u00a0=\u2009.003). There was no difference in 2\u2010year FFS , hospitalisation and grade\u20103 toxicity rates between the two regimens. Nausea and vomiting were lower in the non\u2010standard regimen . Dose reductions, adjusted for age, sex, and CCI, were less likely in the non\u2010standard regimen .About 235 patients were included in the final analysis; median age was 61\u2009years (IQR 55\u201367), and 87% were male. Most had oropharyngeal tumours (85.5%) and p16\u2010positivity was frequent (80%). About 56% received non\u2010standard regimens: weekly cisplatin\u00a0=\u00a079 and non\u2010cisplatin\u00a0=\u00a048. These patients had higher Charlson Comorbidity Index (CCI; We demonstrated similar efficacy of lower dose weekly cisplatin and carboplatin/paclitaxel regimens and better safety profile of weekly cisplatin compared to standard HD cisplatin regimens for LA\u2010HNSCC. Multicenter randomised control trials are required in HD cisplatin\u2010ineligible patients. This study aimed to evaluate the efficacy and safety of SOC and non\u2010SOC regimens in all patients with LA\u2010HNSCC undergoing definitive chemoradiotherapy with a hypothesis that non\u2010SOC regimens are non\u2010inferior to SOC regimens.22.1This study was approved by the Monash Health Human Research Ethics Committee (ID: QA/67140/MonH\u20102020\u2010224\u2009253) with a waiver of informed consent.2.2We conducted a retrospective cohort study of all consecutive adult patients aged \u226518\u2009years) with newly diagnosed LA\u2010HNSCC 8\u2009years w2.32, every 3\u2009weeks for up to 3 doses) was commonly employed in definitive treatment regimens, whilst weekly LD\u2010cisplatin  was commonly used as an alternative in situations where HD\u2010cisplatin was perceived to potentially result in significant toxicities that could compromise the completion of RT treatment, based on the treating clinician's clinical judgement. There was no difference in terms of antiemetic use and fluid replacement for both cisplatin schedules, which were according to the standard Australian practice guidelines.2) [c/p] were opted for based on patient comorbidities that precluded cisplatin altogether, such as pre\u2010existing renal or hearing impairment or both; or if there was any other absolute contraindication to cisplatin. Cetuximab (400\u2009mg/m2 loading dose followed by 250\u2009mg/m2 weekly dose given concurrently with RT) was preferred in patients with absolute contraindications to any chemotherapy, such as significant organ dysfunction or corticosteroid\u2010sparing in patients with comorbidities.The treating clinicians determined the chemotherapy regimen. HD\u2010cisplatin  and baseline comorbidity as measured by the Charlson Comorbidity Index (CCI). The site of primary tumour was recorded as well as its staging, according to the AJCC TNM 8th edition. HPV status for oropharyngeal primaries was recorded using the standard p16 immunohistochemistry (IHC) scoring system.2.5Treatment failure (TF) was defined as persistence or recurrence of the same disease at either locoregional or distant sites. Time\u2010to\u2010event analyses included time to treatment failure . Failure free survival (FFS) was defined as the absence of relapse , non\u2010relapse mortality or addition of another systemic therapy for the same cancer. Overall survival (OS) was defined as the time from diagnosis to death from any cause. Disease\u2010specific survival (DSS), defined as time from diagnosis to death from HNSCC was also calculated.2.6Patients were followed up for a median of 30.4\u00a0months (range 12\u201376\u2009months).2.7The primary outcome was 2\u2010year FFS comparing the SOC and non\u2010SOC groups, with an added focus across four commonly used chemotherapeutic regimens. Secondary outcomes included incidences of grade\u20103 toxicities, hospitalisation rates, dose modifications, and OS comparison between treatment groups. Separate subgroup analysis of the P16+ OP cohort were also performed.2.8t\u2010test or the Mann\u2013Whitney U test was used to compare two groups and the Kruskal\u2013Wallis H test for data belonging to more than two groups involving a continuous dependent variable. The Chi\u2010square (\u03c72) test of independence was used to test associations between categorical variables. Patients alive or lost to follow\u2010up were censored. The Kaplan\u2013Meier method was used to calculate survival and the log\u2010rank test was used to compare survival curves. Logistic regression analysis was performed for outcomes of interest for non\u2010standard treatments in relation to HD\u2010cisplatin therapy, adjusting for confounders . All p\u2010values presented are two\u2010sided and threshold for statistical significance was set at p\u00a0<\u2009.05. The cutoff date for the analysis was 30 April 2022. Statistical analysis was performed using IBM\u00ae SPSS Statistics for Windows, Version 26.0.Descriptive statistics were used to summarise patient characteristics, treatment variables and safety. Patient characteristics, safety and survival outcomes were compared across chemotherapy groups (cisplatin vs. non\u2010cisplatin) and subgroups . The independent sample The study was conducted in accordance with the Declaration of Helsinki (as revised in 2014).3n\u00a0=\u00a0233, 99%). The breakdown of tumour characteristics as well as patient demographics is summarised in Table\u00a0During the study period, 378 patients were diagnosed with head and neck cancers. Of these, 235 patients with LA\u2010HNSCC were included in the final analysis Figure\u00a0. The pat3.13.1.1n\u00a0=\u00a0183, 90%) treatment. The majority of tumours  were HPV\u2010related (p16+) and 201 (85%) were of oropharyngeal origin. One hundred and eight patients (46%) received HD\u2010cisplatin while 127 (54%) received non\u2010SOC regimens. Within the non\u2010SOC group, the majority  received LD cisplatin, 30 (23%) received c/p while 19 (15%) had cetuximab based treatment (Table\u00a0All patients were treated with definitive CRT (nt Table\u00a0. As expe2 (100\u2013300\u2009mg/m2) for those treated with the HD\u2010cisplatin regimen and 280\u2009mg/m2 (238\u2013280\u2009mg/m2) for the weekly LD\u2010cisplatin regimen. The majority patients treated with HD or weekly LD\u2010cisplatin regimens achieved a cumulative dose \u2265200\u2009mg/m2 . The dose intensity and modifications are summarised in Table\u00a0The median cumulative cisplatin dose was 279\u2009mg/m3.1.2All patients were treated with highly conformal RT, either intensity modulated radiotherapy or volumetric arc therapy. Patients received a radical dose of 70\u2009Gy in 35 fractions, concurrently with chemotherapy. All patients completed the planned doses of radiotherapy, except for one patient (<1%) in the definitive treatment group, who died from an unrelated medical cause.3.23.2.1p\u00a0=\u2009.60) . Forty\u2010one (17.4%) patients experienced treatment failure: 15 (6.4%) locoregional, and 32 (13.6%) distant. The 2\u2010year FFS rates were similar between the HD\u2010cisplatin and non\u2010SOC treatment groups  Figure\u00a0. In the 3.2.2p\u00a0=\u2009.53)  Table\u00a0.n\u00a0=\u00a031), similar in the SOC (12%) and non\u2010SOC groups (14.2%); p\u00a0=\u2009.63. Within the non\u2010SOC group, mortality was highest in the non\u2010cisplatin group (25%), and lowest is the weekly LD\u2010cisplatin group (7.7%)  in the non\u2010cisplatin group, were not cancer related, and the disease specific mortality was similar in the SOC (11%) and 7.8% in non\u2010SOC groups   Figure\u00a0.3.2.3n\u00a0=\u00a024) versus 7.1% (n\u00a0=\u00a09) when compared with the non\u2010SOC group (p\u00a0=\u2009.003). Similarly, the SOC regimen caused higher rates of acute renal failure  and nausea and vomiting .A total of 100 42%) patients experienced at least one TRAE of grade 3 severity, accounting for a total of 139 (59.1%) separate TRAEs  . Grade 3 skin rash was more common in cetuximab group  Tables\u00a0.n\u00a0=\u00a079) had unplanned hospital admissions within 30\u2009days of radiotherapy completion. Common causes of hospitalisation included: composite trigger of oral mucositis, dysphagia, and malnutrition , infection and sepsis ; febrile neutropenia ; and nausea and vomiting . Hospitalisation rates were similar amongst the SOC (31.5%) and non\u2010SOC (35.4%) treatment groups (p\u00a0=\u2009.52). Within the treatment subgroups, hospitalisation rates were significantly lower (26.6%) in the weekly LD\u2010cisplatin and higher in the non\u2010cisplatin (50%)  Table\u00a0.Efficacy and safety outcomes of interest for non\u2010SOC compared to SOC HD\u2010cisplatin  are summarised in Table\u00a03.2.4n\u00a0=\u00a0144, 95%) were stage 1/2 and underwent definitive CRT. There were relatively more patients in the weekly LD\u2010cisplatin group (p\u00a0=\u2009.05), but no significant difference was found in terms of efficacy  or safety profile amongst the subgroups  were compared to the SOC HD\u2010cisplatin regimen. There was no difference in FFS and OS rates amongst the treatment groups; however, the outcomes in terms of toxicity and compliance were worse in the SOC HD\u2010cisplatin group. Weekly LD\u2010cisplatin resulted in a similar efficacy with a better safety profile, but the non\u2010cisplatin regimens had relatively poor clinical outcomes in terms of safety profiles, compared to the cisplatin groups.Despite HD\u2010cisplatin being the accepted SOC for more than two decades,2) and underestimated the efficacy,2) were comparable to a recent Japanese phase 2/3 trial which showed non\u2010inferiority of weekly cisplatin (40\u2009mg/m2) and a favourable safety profile, compared to HD\u2010cisplatin for post\u2010operative patients with high\u2010risk LA\u2010HNSCC.Contrary to the phase 3 randomised control trial that used a lower weekly dose of cisplatin  antibody, cetuximab showed benefit when combined with RT, compared to RT alone in a prospective phase 3 trial,Another viable treatment option, supported by clinical research is carboplatin plus fluorouracil.Further novel strategies in cisplatin\u2010ineligible patients with LA\u2010HNSCC are already being investigated. Immune checkpoint inhibitors have shown promise in recurrent metastatic HNSCC, and are being studied in LA\u2010HNSCC. So far, pembrolizumab has failed to offer benefits over cetuximabOur study provides a contemporary pragmatic overview of LA\u2010HNSCC treatment in an Australian setting and highlights the challenges of appropriate chemotherapy selection for concurrent chemoradiation. This study has a few limitations that need to be acknowledged. First, the study was conducted in a single centre, and the results may have been influenced by unmeasured factors such as illness severity and hospital\u2010specific policies, procedures and resource capability that drive clinical decision\u2010making. Care must therefore be taken when generalising the results of this study to other healthcare institutions, particularly smaller communities, and rural hospitals. Second, the population was skewed in favour of cisplatin\u2010based regimens with some baseline differences in patient characteristics between the groups. However, this does reflect an accurate real\u2010world sample in countries with similar epidemiological spreads. Third, the short follow\u2010up could have resulted in the inability to capture late toxicities, as despite relatively high cure rates for patients with LA\u2010HNSCC, the late toxicity profile has been associated with a negative impact on quality of life.5Our study demonstrates that weekly LD\u2010cisplatin has similar efficacy to HD cisplatin but is less toxic. Other \u201cless toxic\u201d regimens had higher toxicities than weekly LD\u2010cisplatin but possibly had similar efficacy. There is an urgent need for newer treatments in patients unable to receive cisplatin, and further randomised trials are required.Conceptualization, M.A., E.S.; Data Curation, M.A., A.C., C.G., L.M., A.S., Y.W., A.S.; Formal Analysis, M.A., A.C., Y.W.; Methodology, M.A., A.S.; Project administration, M.A.; Supervision, M.A., A.S.; Writing \u2013 Original Draft, M.A., L.M., A.S.; Writing \u2013 Review and Editing, M.A., A.C., C.G., L.M., A.S., E.S., Y.W., A.S.; Software, A.C., A.S.The authors have stated explicitly that there are no conflicts of interest in connection with this article.Figure S1 FFS and OS comparison of all four treatment groups HD\u2010cisplatin, weekly cisplatin, carboplatin/paclitaxel (c/p), and cetuximab.Table S1 Baseline characteristics of Non\u2010SOC regimensTable S2 HD\u2010cisplatin\u2010based versus LD\u2010cisplatin\u2010based therapyTable S3 Non\u2010cisplatin\u2010based versus LD\u2010cisplatin\u2010based therapyTable S4 HD\u2010cisplatin\u2010based versus non\u2010cisplatin\u2010based therapyTable S5 Chemotherapy cumulative dose, intensity, and modificationsTable S6 Analysis of outcomes in P16+ OP SCC cohortClick here for additional data file."}
+{"text": "In general, IBD increases arteriovenous thromboembolic events, though the association between UC and cerebrovascular complications remains inconclusive. Some studies suggest young women with UC have an increased risk of cerebrovascular accidents (CVA). The focus of this study was to characterize the rates, anatomic distribution, and risk factors for CVA in patients with UC. We developed a retrospective cohort of patients with UC at a single health care system from June 2010 to June 2015. Neuroimaging was used to document presence, location and type of stroke and traditional risk factors were considered. Prevalence of CVAs in patients with UC was compared to that of the general population of Minnesota (MN) and the United States (U.S.). A total of 2,183 UC patients were identified . The prevalence of CVA in UC patients  was higher than in the U.S.  and in Minnesota  . The prevalence increased in both sexes with a peak prevalence of 24.7% (95% CI 17.1\u201334.4) in women with UC over the age of 80. Older age, cancer and atrial fibrillation were risk factors for CVA in univariate analysis for both sexes. In multifactorial analysis, both age and atrial fibrillation were risk factors for CVA in the m-UC cohort, but only age was associated with CVA in f-UC. The most common type of CVA was ischemic stroke (77.7%). The most common locations for CVAs in UC patients were frontal and occipital lobes . UC patients have an increased risk for CVA, with women over 80 demonstrating the highest risk. Providers should be aware of these risks in making treatment decisions for UC. IBD is considered a prothrombotic state and is associated with an increase in both venous and arterial thromboses4. This prothrombotic state is driven by a combination of acquired risk factors (e.g. corticosteroids and cigarette smoking), abnormalities of the coagulation cascade (increased fibrinogen and decreased tPA), inflammation, and endothelial dysfunction5. Clinical risk for thromboembolism in general is securely linked to IBD, especially in the setting of active disease. However, the drivers of cerebrovascular accidents (CVAs) in these patients remain less well understood.Ulcerative colitis (UC) and Crohn\u2019s disease (CD) are the two most common forms of inflammatory bowel disease (IBD) and are thought to arise from an abnormal immune response to the intestinal microbiota in a genetically susceptible host8. The literature remains incomplete regarding the universal association between IBD and CVA, with some studies suggesting an increased risk of CVA only in certain subsets of IBD patients. For example, some studies found an increased incidence of CVA in CD, while UC patients were comparatively spared13. On the other hand, specific subgroups of UC patients seem to be more affected than others, including younger women (controlling for contraception use), those with concurrent AF, and those with active inflammation14. Moreover, most of the above population-level studies investigating the association between IBD and CVA were conducted outside of the United States (U.S.) which leaves a gap in the literature regarding the distribution of IBD-associated CVAs in this country. Additionally, the typical vascular location of CVAs is not known in IBD patients. The variable CVA rates in subgroups of IBD patients are not at this time fully described or understood.IBD is associated with chronic inflammation, higher prevalence of atrial fibrillation (AF), hypercoagulability, and various vasculitides; all of which are independently related to the risk of CVAOur study analyzed primary source data to assess prevalence of CVA in a cohort of patients with UC seen in a large academic and community health care system in Minnesota (MN). We sought to define the nature of CVA in these patients  and to further characterize the associated risk factors.This study was approved by the Institutional Review Board of the University of Minnesota (IRB#1501M59201) and underwent ethical evaluation. Informed patient consent was obtained for participation in research and all patient data was de-identified. Our work adhered to the STROBE guidelines for observational studies and was performed in accordance with the Declaration of Helsinki. See appendices for Strobe checklist. We extracted data from a Clinical Data Repository (CDR) cultivated via the University of Minnesota/Fairview Health System electronic medical record (EMR). The CDR consists of EMR data from over 2.5 million patients across 8 hospitals and 40 clinics including a large tertiary care academic center and its community affiliates. All patients who had an encounter at University of Minnesota and its affiliated clinics between June, 2010 and June 2015, with ICD 9/10 codes of 556.9/K51.xx, were eligible for inclusion in the study. Patients were excluded if their diagnosis of Inflammatory Bowel Disease (IBD) was not confirmed by a biopsy or diagnosed by a gastroenterologist or a colorectal surgeon through endoscopic features.Demographic and clinically relevant data were extracted from the EMR. Relevant clinical information included age, sex, race, specific medical comorbidities  and presence/absence of CVA. All patients with radiographic studies of the brain were identified, and these images were secondarily reviewed for evidence of CVA, specifically ischemic or hemorrhagic stroke.Given our group\u2019s previous findings of increased prevalence of strokes among female Ulcerative Colitis (f-UC) patients, we wanted to explore if this finding extends beyond Ulcerative Colitis (UC). We identified all female patients with Crohn\u2019s Disease (CD) and randomly matched female patients with documented Crohn\u2019s Disease females (f-CD)  by age to f-UC patients seen at the same institution within the same time period. Comparisons between f-UC and f-CD patients were also analyzed using Pearson\u2019s test.Figure Diagnoses of UC and CD were established based on typical endoscopic and histologic findings consistent with IBD as interpreted by the treating gastroenterologist or colorectal surgeon. CVA was defined as the presence of hemorrhagic or ischemic stroke on neuroimaging, venous sinus thrombosis, amaurosis fugax, TIA, or history of alteplase administration during a stroke code and/or neurological deficits documented by a neurologist.The prevalence of CVA in the UC patient cohort was compared to the national and state-level (Minnesota-MN) prevalence of stroke reported by the American Heart Association (AHA) and the Centers for Disease Control and Prevention (CDC) over the same period of time. Patient sex, presence of AF, and cancer were treated as binomial variables and Pearson\u2019s test was used for this analysis. Kruskal\u2013Wallis test was used when age was treated as a continuous variable. Variables that were statistically significant on univariate analysis were analyzed via multivariate analysis to identify variables that were independently associated with CVA in patients with UC.All statistical analyses were performed with the use of JMP software . When multiple comparisons were done, Bonferroni correction was used and only p-values less than 0.006 were considered significant, otherwise, p-values\u2009<\u20090.05 were considered significant.Our work adhered to the STROBE guidelines for observational studies. See Appendices. Further, our study was performed in accordance with the Declaration of Helsinki.The IRB of the University of Minnesota reviewed and approved this study.Our study was approved by the IRB of the University of Minnesota, adhered to the STROBE Guidelines, and was performed in accordance with the Declaration of Helsinki.A total of 2183 UC patients were identified. Patient demographics, comorbidities, prevalence and location of CVAs per sex are illustrated in Table Cerebral imaging was obtained in 19.9% of UC patients. The prevalence of CVA in UC patients was 4.7%, which was higher than the reported prevalence in the U.S. (per AHA and CDC) and in Minnesota. Fig.\u00a0a.. PrevaKnown thrombogenic risk factors for ischemic CVA, specifically cancer and AF, were investigated. The prevalence of both comorbidities was similar between f-uc and m-uc Table . On univ3. In contrast, our study found traditional risk factors for CVA to be common in UC. The fact that our study captured a significant degree of community (outside of tertiary center) UC cases may account for this difference.In this large, single health system, retrospective chart review, we found that CVA prevalence was higher in our cohort of UC patients than in Minnesota and the U.S. at large. The prevalence of CVA in all UC patients increased with age and the most common stroke subtype was ischemic (70%). The predominantly ischemic nature of infarction in our dataset agrees with most studies. However, the majority of stroke literature in IBD patients has presented CVAs as an issue of younger, otherwise healthy patients with severe IBD16. A small series of patients with CD identified recurrent posterior circulation strokes, but the three cases described were derived from patients with recurrent strokes, which may have led to biases in the selection of patients with a predilection for this area17. In future studies, cerebral imaging with vascular reconstruction should be included for all patients with IBD experiencing CVAs, to better inform this issue. While it would have been ideal to classify the strokes by TOAST criteria, the data was not available in the EMR to do so. This would have further informed as to the mechanism of the strokes in IBD and should be the focus of future studies. The data we had matched the AHA and CDC data and made for perfect comparison. Current AHA and CDC data does not include TOAST classification18.Patterns of stroke localization are important to understand underlying pathophysiology. A relatively recent review article demonstrated that the majority of strokes identified in IBD patients were in the left or right middle cerebral artery, making anterior circulation events the most commonly affected area, similar to the general population14. Specifically, Ha et al. compared women with IBD (pooled UC and CD) under age 40 to age-matched healthy controls and found young women with IBD to have a greater risk of stroke3. Variations in hormone levels and/or varying degrees of other cumulative sex-specific risk factors, such as hormone contraception use, may be important contributing factors to this finding. Other investigators have demonstrated that women with IBD are at increased risk for cardiovascular disease and it is presumed that hormonal variations may impart a degree of this risk19. Possible explanations are hormonal disequilibrium, inflammation, and endothelial dysfunction20. In this way, estrogen has myriad effects on cardiovascular health as women age and this dynamic may persist and possibly be exacerbated in the setting of IBD21. This is evidenced by literature supporting the role of estrogen in TNF-alpha modulation as it relates to inflammation and interactions within the gut microbiome22. Further, murine studies have shown that estradiol downregulates TNF-alpha and subsequently is protective against acute colitis23. These findings represent an intriguing avenue of investigation to further link post-menopausal women with IBD, variations in hormone levels, and increased cerebrovascular risk. Due to the retrospective nature of this investigation impact of other stroke risk factors like physical activity, BMI, and cholesterol levels were not studied. A prospective study will be needed to further elucidate these and other important risks for strokes in IBD patients.Stroke prevalence increased with age in IBD patients, as it also does in the overall population. The unexpected finding was the high stroke prevalence in post-menopausal women with UC. This phenomenon was even more pronounced in women over 80\u00a0years old with a much higher stroke prevalence than the overall population of the same age, and over double the number of strokes seen in elderly females with CD. The prevalence in stroke in males with UC was not significantly increased when compared with overall population. The presence of atrial fibrillation and cancer increased with age, but their prevalence was similar among males and females with UC and with female with CD, and therefore could not explain why elderly females with UC presented with increased CVAs. This finding contrasts with previous work that showed younger women with UC at greatest risk24. Further, increased disease activity is also linked to higher risk of myocardial infarction, stroke, and cardiovascular-related death, with elevated CRP levels acting as a surrogate for disease activity25. Lastly, while it is important that we incorporated active cancer and atrial fibrillation, a more comprehensive co-variate model including additional known risk factors for CVA may have yielded a more comprehensive analysis.Limitations of our study include both its retrospective nature and lack of correlative data to indicate degree of disease activity in the IBD patients at the time of CVA. Further, more generally, our data did not capture personal history of thrombophilia, tobacco smoking history, immobilization, recent surgery, use of central venous catheters, VTE prophylactic measures, IBD medications, and overall compliance. Missing data and differential loss to follow up may be products of our retrospective design. Our strict definition of stroke prioritized specificity over sensitivity and could have resulted in a lower stroke detection rate in our UC and female CD cohorts. However, an artificially low stroke detection rate should have favored the hypothesis that thromboembolism would not be increased in both cohorts, which suggests that our findings are not spurious. Further, IBD disease activity as illustrated via serum C-reactive protein (CRP) levels, fecal calprotectin levels or better yet, endoscopic impression would allow inferences to be made concerning degree of inflammation and thrombotic risk. This is important, as while quiescent disease exhibits a measurable degree of risk, active IBD flares generate the highest risk of VTE propagation, atrial fibrillation, and strokeIn conclusion, we have demonstrated that, compared to state and nationwide general populations, females with ulcerative colitis are at an increased risk for stroke, especially as they age beyond 80. Therefore, mitigation of risk factors for ischemic stroke, including aspirin prescription as stroke prevention, should be addressed by gastroenterologists, cardiologists and neurologists taking care of patients with UC. In our study, although cancer and atrial fibrillation were prevalent in UC patients experiencing strokes, only older age persisted as a risk factor for strokes in women with UC. Also, atrial fibrillation may exist as a contributor to strokes in men with ulcerative colitis. Further studies are needed to determine the distinct etiologies for the increased prevalence of CVA in patients with all subtypes of IBD and to further delineate sex-related risk. Ideally, these future investigations will help to design individualized primary and secondary stroke prevention strategies to improve cardiovascular outcomes in patients with IBD."}
+{"text": "We identified positive impacts on manager attitudes and behavioral intentions related to preventing mental ill-health and promoting good mental wellbeing at work. The next step is to explore the feasibility and acceptability of Managing Minds at Work with line managers in diverse employment settings.Mental ill-health is the leading cause of sickness absence, creating a high economic burden. Workplace interventions aimed at supporting employers in the prevention of mental ill-health in the workforce are urgently required. Managing Minds at Work is a digital intervention aimed at supporting line managers in promoting better mental health at work through a preventative approach. This intervention was developed as part of the Mental Health and Productivity Pilot, a wider initiative aimed at supporting employers across the Midlands region of the United Kingdom to improve the future of workplace mental health and wellbeing. The aim of the study is to describe the design and development of the Managing Minds at Work digital training program, prior to feasibility testing. We adopted a collaborative participatory design involving co-design (users as partners) and principles of user-centred design (pilot and usability testing). An agile methodology was used to co-create intervention content with a stakeholder virtual community of practice. Development processes were mapped to core elements of the Medical Research Council (MRC) framework for developing and evaluating complex interventions. The program covers five broad areas: (i) promoting self-care techniques among line managers; (ii) designing work to prevent work-related stress; (iii) management competencies to prevent and reduce stress; (iv) having conversations with employees about mental health; (v) building a psychologically safe work environment. It was considered by stakeholders to be appropriate for any type of organization, irrespective of their size or resources. Pilot and usability testing ( Mental health problems affect one in six workers each year and are the leading cause of sickness absence, with stress, anxiety, and depression being responsible for approximately half of the working days lost ,2. MentaPreventing and managing mental ill-health at work is therefore a priority, not only from a public health perspective, but for organizations and their \u2018bottom line\u2019 (net profits). Yet, many employers are unaware of their important role in supporting workers\u2019 mental health . InterveLine managers play an important role in the primary prevention of mental ill-health . They caSeveral studies have examined the effectiveness of line manager training to improve the mental health of employees using trial methodology ,21,22,23Online approaches to workplace training are advocated to allow for greater flexibility in learning and increase workplace training capability . E-learnOur overall aim, therefore, is to develop and test a digital intervention aimed at supporting employers in the prevention of mental ill-health at work. This primary prevention research was conducted as part of the Mental Health and Productivity Pilot (MHPP) , a widerThis study reports on a rigorous intervention development process adopting a collaborative participatory design , involviIntervention development took place between February and July 2021. The study adhered to the development phase of the Medical Research Council (MRC) framework for developing and evaluating complex interventions  and was The intervention development was informed by the four critical elements of co-design outlined in Chisholm\u2019s co-design model  Figure 1Figure 1.Order of modules and materials.Frequency and timing of module delivery.Content revisions .Targeting of information .What are the barriers that could prevent line managers from accessing/engaging in the training?What are the facilitators that could support line managers in completing the training?After preliminary discussion with stakeholders, the initial outline of module headings was drafted by the research team as subject matter experts. Module headings were created using a \u2018Wall Storm\u2019 approach, in which key topic areas were proposed by team members and processed as a group through interactive virtual meetings. A storyboard was then co-created together with stakeholders. A storyboard is a document used to describe the text, visuals, audio, interactive elements, and navigation that will be used in a digital training program. The Managing Minds at Work storyboard was co-ordinated by the project researchers and co-created through multiple methods including a design charette (larger group meeting to sketch storyboard ideas), design jams , an onlThis process was agile, with multiple co-creation and review activities being undertaken concurrently. Reviews and revisions were made iteratively, until a final storyboard was agreed that aligned with the program\u2019s theory of change see . The proTechnical development was then undertaken by the project team, by creation of a prototype using Xerte, a multimedia authoring tool. In line with prototype development processes described elsewhere , design An explanation of the value of the training was included in the introductory text to line managers to encourage institutional \u2018buy-in\u2019. Further revisions by module are shown in Since the study was undertaken during the global coronavirus pandemic (COVID-19), we were guided by published practical actions to promote and maintain meaningful exchange with stakeholders in times of social distancing and lockdowns . As descThe intervention was pilot tested by the project team between October 2021 and March 2022, with the aim of testing the acceptability and usability of MMW to line managers in \u2018real-world\u2019 settings. The design was a single group intervention study with post-intervention data collection, aligned with the Technology Acceptance Model (TAM ) Figure.TAM is an information systems theory that models how users come to accept and use a technology. Participants were organizations (site participants) and line managers . Since the entire study was conducted during a pandemic, which was a challenging time for organizations, we adopted opportunity sampling. There is no established consensus for the sample size required for usability testing, with a range of suggested options  depending on the approach taken. We therefore opted to recruit the largest suggested sample size (16 \u00b1 4) given the diversity of workplace training needs across organizations and sectors, and the changing needs in the context of the COVID-19 pandemic and its aftermath\u2014it has been proposed that group size should typically be increased along with the study\u2019s complexity and the criticality of its context .Intervention reporting aligns with the Template for Intervention Description and Replication (TIDieR) checklist and guide  Supplem. The res\u201cManaging Minds at Work will develop line manager\u2019s knowledge and confidence in preventing work-related stress and promoting mental health at work. This will be achieved through learning activities to increasing line managers\u2019\u2019 awareness of mental health , encouraging the creation of psychologically safe working environments and work designs that promote mental wellbeing, and increasing managers\u2019 competencies in preventing work-related stress and having open conversations about mental health in the workplace. Ultimately, the longer-term outcomes of this will be to reduce the prevalence of mental ill-health in working-age adults, and related economic burden of presenteeism and sickness absence to individuals, employers, and society\u201d.The program was developed using Xerte, a multimedia authoring tool focused on accessibility and simplicity. It consists of an introduction followed by five modules of online learning , accesseThe content is designed to be relevant to any line manager, in any organization and any sector. Therefore, it intentionally provides generic advice rather than sector-specific or tailored advice, which will allow for future intervention scalability. The modules are independent and stand-alone, although it is recommended that they are completed in succession , at a rate of 1 module per week, undertaken over a period of 6 weeks. Each module takes approximately 30 min to complete. The training is designed in this way so that learning can be undertaken flexibly during working hours. The training is self-led (requiring no prior knowledge or training to access and engage with it), so each participant can progress individually through each module at their own pace and at a time that suits them. Module content can be revisited at any time.The final Managing Minds at Work content is shown in In October 2021, we approached three organizations that were taking part in mental health initiatives organised by MHPP  and then = 11), module 2 (n = 10), module 3 (n = 5), module 4 (n = 6), and module 5 (n = 5). Age of managers ranged from 24\u201359 years . Participants had worked in a managerial role between 6 months and 30 years . Managers currently supervised up to 25 employees; half of the managers supervised \u226410 people (n = 9). Quantitative survey data were analyzed using descriptive statistics, in IBM SPSS Statistics for Windows, version 26.0 )The participatory design and rigorous co-creation processes have been described in detail, including the practical actions taken for managing the effects of the COVID-19 pandemic on participatory research. The importance of documenting intervention development processes, as a key research activity, has been outlined by O\u2019Cathain and colleagues . This isA strength of the study was the rigorous process for content and technical development, involving participatory design with multi-method approaches to co-creation, adapted in line with guidance for conducting participatory research during the COVID-19 pandemic. Our intervention was based on a \u2018theory of change\u2019 and user-centered active learning pedagogy, and the research was theoretically informed, using Chisholm\u2019s co-design model , and TAMManaging Minds at Work is a new digital training program for line managers which aims to support employers in preventing mental ill-health and promoting good mental wellbeing at work. The intervention was deemed to have high usability and fidelity by managers from the public, private, and third sectors. The next step is to fully explore the feasibility and acceptability of the Managing Minds at Work intervention with managers in diverse employment settings, explore the mechanisms for its most effective delivery, and examine whether and how the intervention can be tailored for different types of organizations and integrated alongside existing polices, practices, and interventions."}
+{"text": "This was the impetus for the original ScanFold algorithm, which provides maps of local RNA structural stability, evidence of sequence-ordered  structure, and unique model structures comprised of recurring base pairs with the greatest structural bias. A key step in quantifying this propensity for ordered structure is the prediction of secondary structural stability for randomized sequences which, in the original implementation of ScanFold, is explicitly evaluated. This slow process has limited the rapid identification of ordered structures in large genomes/transcriptomes, which we seek to overcome in this current work introducing ScanFold 2.0. In this revised version of ScanFold, we no longer explicitly evaluate randomized sequence folding energy, but rather estimate it using a machine learning approach. For high randomization numbers, this can increase prediction speeds over 100-fold compared to ScanFold 1.0, allowing for the analysis of large sequences, as well as the use of additional folding algorithms that may be computationally expensive. In the testing of ScanFold 2.0, we re-evaluate the Zika, HIV, and SARS-CoV-2 genomes and compare both the consistency of results and the time of each run to ScanFold 1.0. We also re-evaluate the SARS-CoV-2 genome to assess the quality of ScanFold 2.0 predictions  Seconding RNAs  and in ting RNAs .via its secondary structure. Both tasks require the identification of robust structural models of RNA folding which, for large genomes/transcriptomes, is an immense challenge. Several rapid and robust algorithms for RNA secondary structure prediction are available  and in therapeutically modulating RNA biology vailable  as well vailable , 2020. Svailable . Despitevia the thermodynamic z-score, which reports the difference between the predicted minimum free energy (MFE) of folding for a native/ordered RNA and the expected MFE based on the nucleotide content alone . The native MFE is subtracted from the expected and the resulting value is divided by the standard deviation   that are used in MFE calculations  . Mono- vz-scores . Dinucleulations . Mononuculations ; howeverScanFold , found lScanFold2.0 (SF2) uses the same approaches as ScanFold1.0 (SF1) without the need for explicit MFE calculations of randomized sequences to determine thermodynamic z-scores. To bypass the computationally expensive explicit z-score calculations, we have implemented a machine learning approach: Google\u2019s publicly available TensorFlow algorithm  or for use through a webserver hosted at: https://mosslabtools.bb.iastate.edu/scanfold2.lgorithm , 2016b. old-Fold , which iold-Fold . This neScanFold window sizes (RNAfold version 2.4.18 (An overview of the training process can be seen in ow sizes ) in 20 nn 2.4.18 . Two difn 2.4.18 . Twenty RNAfold is used to calculate MFEs, while https://colab.research.google.com/github/moss-lab/ScanFold2.0/blob/main/SF2_notebook.ipynb).All 20 features were used during training of culation . All traculation  and can culation  or usinghttps://mosslabtools.bb.iastate.edu/scanfold2). Similar to SF1, any sequence longer than the chosen window size can be uploaded (or pasted) in FASTA format, all parameters can be set by the user, and the scan can be started by clicking the submit button at the bottom of the page. Once the prediction is complete the results are output in an Integrative Genomics Viewer (IGV.js) window  from both versions of ScanFold were compared using an in-house python script, ct_compare.py (https://github.com/moss-lab/SARS-CoV-2). This comparison allowed us to evaluate the percent of paired nucleotides and the percent similarity or consistency between the output files of both versions of ScanFold as well as determine the improvements in speed for each run. Additionally, we were able to compare the outputs from SF1 (mono- vs dinucleotide shuffling and different number of randomizations) and the outputs of SF2 (mono- vs dinucleotide shuffling) to themselves to evaluate their performance using different shuffling methods. In total, 13 different comparisons were completed for each genome. All accuracy and speed results can be found in SF2 was tested to determine its accuracy and speed compared to that of SF1. Testing was performed on HIV-1, Zika, and SARS-CoV-2 genomes, which had been previously analyzed using SF1 . To ensuScanFold-Fold results for SF1 mono- and dinucleotide shuffling using 100 and 10,000 randomizations as well as SF2 mono- and dinucleotide shuffling models following a previously establish protocol  for various SHAPE and DMS reactivity datasets generated from SARS-CoV-2 probing experiments (Receiver Operating Characteristic (ROC) curve analysis was performed on protocol . Brieflyeriments . The \u22121 paired in the ScanFold \u22121 z-score CT file and paired at the defined reactivity threshold. The false negative (FN) is defined as being paired in the ScanFold \u22121 z-score CT file and unpaired at the reactivity threshold. The false positive (FP) is defined as being unpaired in the ScanFold \u22121 z-score CT file and paired at the reactivity threshold. The true negative (TN) is defined as being unpaired in the ScanFold \u22121 z-score CT file and unpaired at the given reactivity threshold. When the reactivity threshold is set to 0%, the TPR and FPR will equal zero, and when the reactivity threshold is set to 100%, the TPR and FPR will equal one. Thus, if a ScanFold predicted RNA secondary structure model is truly random, when compared to increasing reactivity thresholds from a probing data set, then the TPR and FPR will increase proportionately and produce a linear trend in the plot and a small area under the curve (AUC). However, if the ScanFold predicted RNA secondary structure model agrees with the reactivity data set, the TPR will initially rise faster than the FPR, producing a curve on the plot and therefore a larger AUC. This allows for a quantitative assessment and comparison of each ScanFold predicted model\u2019s ability to fit the data via their respective AUCs. All the ROC and AUC analyses can be found in The true positive (TP) is defined as being SF2 requires significantly less time than SF1 using only 100 randomizations, with increases in speed being even greater when compared to SF1 using 1,000 and 10,000 explicitly shuffled RNA sequences for z-score calculations. In both cases, increasing sequence length does increase the time needed, but this effect is seen to a lesser degree in SF2. When comparing the times, SF1 using 100 randomizations with mononucleotide shuffling takes 8.70, 1.02, and 1.75 h to complete all predictions for SARS-CoV-2, HIV, and Zika, respectively . SF2 on Gross comparisons of the percent of predicted pairs by SF1 and SF2 using 100, 1,000, and 10,000 randomizations with mononucleotide shuffling displays an average difference of 2.00% (0.03% to 4.5%) between all z-score cutoffs across the three genomes analyzed, regardless of the number of randomizations. HIV is the most consistent between versions, displaying less than a 1.25% difference in \u22122 z-score pairs, 3.2% difference in \u22121 z-score pairs, and 0.5% difference in all pairs (no filter) across all randomizations . In a siThe same analyses were carried out between SF1 and SF2 using dinucleotide shuffling. Comparing the percentage of predicted paired nucleotides using 100, 1,000, and 10,000 randomizations with dinucleotide shuffling displays an average difference of 5.26% (0.57% to 10.26%) between all z-score cutoffs across the three genomes analyzed. HIV showed the least variance with a 4.38% difference in \u22122 z-score pairs, an 8.72% difference in \u22121 z-score pairs, and a 1.85% difference in all (no filter) pairs across all randomizations . The perWhen comparing SF1 and SF2 results for mononucleotide shuffling there is an average difference in percent paired of 2.00% (0.03% to 4.5%) and in the majority of cases SF2 is predicting more pairs than SF1. For all results other than HIV and SARS-CoV-2 all pairs (no filter), SF2 consistently predicts more pairs than SF1. When comparing SF1 and SF2 results for dinucleotide shuffling, there is an average difference of 5.26% (0.57% to 10.26%) and similar to mononucleotide shuffling, all results other than Zika no filter , show that SF2 is always predicting slightly more pairs. These small differences serve as evidence that SF1 and SF2 are producing an almost identical number of pairs when the same shuffling method is used .mononucleotide shuffling to SF1 dinucleotide shuffling, on average, mononucleotide shuffling finds more pairs than dinucleotide shuffling, but this does not always hold true\u2014as is the case with all iterations of Zika results for all pairs  with that of SF1 mono- and dinucleotide results across all three genomes, with HIV demonstrating the most consistency . The genScanFold models  values . We ini) values . The ROC) values . After c dataset  to a max dataset . No large.g., comparative analyses, structure probing, and functional assays).As with all scanning window analyses, it is important to understand the impact of selecting different window and step sizes. In general, the use of 120 nt windows has been found to be optimal as it allows for the identification of local structures and reduces the prediction of spurious longer-range interactions . In prevSF2 produces effectively indistinguishable results to that of SF1 in a fraction of the time. The implementation of a machine learning approach has also eliminated the need to optimize the number of randomizations for each scan. Based on our results, we see that SF2 using the dinucleotide shuffling model tends to produce results more similar to mononucleotide than SF1; however, both SF1 and SF2 results are generally similar to each other, with slight bias toward lower z-scores in SF2 arising from the very large training data sets used . ROC analysis using several SHAPE and DMS datasets against SF1 and SF2 predictions also suggests that, regardless of the model, SF2 detects robust structural elements that persist between experimental conditions. Here, we have demonstrated that the improved SF2 algorithm performs similarly to SF1 but in a fraction of the time. Although this analysis was focused on viral genomes, SF2 has general applicability for any RNA sequence of interest. We hope that this improved speed can provide the RNA community with a fast, accurate, and user-friendly tool that will help in finding potentially functional structures across any gene or transcript of interest and drive forward RNA research.10.7717/peerj.14361/supp-1Supplemental Information 1The results from all CT files comparisons for HIV-1, ZIKA, and SARS-CoV-2. These comparisons include SF1 to SF2, SF1 to SF1, and SF2 to SF2 using both shuffling methods and 100, 1,000, and 10,000 randomizations. Additionally, the results are summarized for each genome in a separate tab of the file, which includes all the raw comparisons, tables, and calculated differences in percent of paired nucleotides for all conditions, and SF1 and SF2 run time tables and bar charts.Click here for additional data file.10.7717/peerj.14361/supp-2Supplemental Information 2All training code for SF2 that was ran in Google Colab. This Python notebook can used to view and run all training code.Click here for additional data file.10.7717/peerj.14361/supp-3Supplemental Information 3The results of the ROC analysis displayed in Figure 2. This includes all tpr, fpr, and AUC calculations for every dataset and all SF1 and 2 conditions used. Both of the ROC curve plots can also be found at the end of the document.Click here for additional data file.10.7717/peerj.14361/supp-4Supplemental Information 4The scanning \u201c.out\u201d output data from all SF1 and SF2 run conditions for HIV-1, ZIKA, and SARS-CoV-2. All of the per window z-score data from each of the .out results were added to separate tabs genome tabs and average values were calculated. These values can be found in the last 4 tabs of the excel document.Click here for additional data file.10.7717/peerj.14361/supp-5Supplemental Information 5The percent of nucleotides paired and the percent similarity in pairing from the comparison of SF1 to SF1 and SF2 to SF2 using both shuffling methods as well as 100, 1,000, and 10,000 randomizations for SF1. All plots on the left side are percent paired and all plots on the right are percent similarity in pairings. From top to bottom (A-C), the plots show results for SARS-CoV-2, ZIKA, and HIV-1. All plots are organized as follows from left to right: SF1 mono- to di- 100 randomizations for -2 z-score cutoff, SF1 mono- to di- 1000 randomizations for -2 z-score cutoff, SF1 mono- to di- 10000 randomizations for -2 z-score cutoff, SF2 mono- to di- for -2 z-score cutoff, SF1 mono- to di- 100 randomizations for -1 z-score cutoff, SF1 mono- to di- 1000 randomizations for -1 z-score cutoff, SF1 mono- to di- 10000 randomizations for -1 z-score cutoff, SF1 mono- to di- for -1 z-score cutoff, SF1 mono- to di- 100 randomizations for no filter z-score cutoff, SF1 mono- to di- 1000 randomizations for no filter z-score cutoff, SF1 mono- to di- 10000 randomizations for no filter z-score cutoff, and SF2 mono- to di- for no filter z-score cutoff.Click here for additional data file.10.7717/peerj.14361/supp-6Supplemental Information 6Box and whisker plot of the average window z-score for all genomes analyzed. The plots show that in general mononucleotide shuffling produces lower z-scores, dinucleotide shuffling produces higher z-scores, and SF2 mono- and dinucleotide shuffling produce more similar z-scores than SF1 mono- and dinucleotide shuffling. From top to bottom (A-C) the plots represent ZIKA, HIV, and SARS-CoV-2. Each plot is organized in the same way. From left to right SF1 100 randomizations with mono-, SF1 100 randomizations with di-, SF1 1000 randomizations with mono-, SF1 1000 randomizations with di-, SF1 10000 randomizations with mono-, SF1 10000 randomizations with di-, SF2 with mono-, and SF2 with di-.Click here for additional data file.10.7717/peerj.14361/supp-7Supplemental Information 7Each cell in the table is the percent difference in percent of predicted nucleotides that are paired. Positive values indicate mono- predicted more pairs and negative values indicate that di- predicted more pairs for the respective genome, version of SF, randomizations, and shuffling method. From left to right SF1 100 randomization difference in percent paired for -2 z-score pairs, SF1 1000 randomization difference in percent paired for -2 z-score pairs, SF1 10000 randomization difference in percent paired for -2 z-score pairs, SF2 difference in percent paired for -2 z-score pairs, SF1 100 randomization difference in percent paired for -1 z-score pairs, SF1 1000 randomization difference in percent paired for -1 z-score pairs, SF1 10000 randomization difference in percent paired for -1 z-score pairs, SF2 difference in percent paired for -1 z-score pairs, SF1 100 randomization difference in percent paired for no filter z-score pairs,SF1 1000 randomization difference in percent paired for no filter z-score pairs, SF1 10000 randomization difference in percent paired for no filter z-score pairs, and SF2 difference in percent paired for no filter z-score pairs. From top to bottom ZIKA, HIV-1, SARS-CoV-2 genomes that coincide with the differences in percent paired nucleotides. Click here for additional data file.10.7717/peerj.14361/supp-8Supplemental Information 8The average z-scores for all windows in every ScanFold run were determined and the average difference between shuffling techniques was calculated from all analyzed genomes. From left to right SF1 using 100 randomization mono-, SF1 using 100 randomizations di-, difference between SF1 using 100 randomizations with mono- and dinucleotide, SF1 using 1000 randomizations with mono-, SF1 using 1000 randomizations with di-, difference between SF1 using 1000 randomizations with mono- and dinucleotide, SF1 using 10000 randomizations with mono, SF1 using 10000 randomizations with di-, difference between SF1 using 10000 randomizations with mono- and dinucleotide, SF2 mono-, SF2 di-, and difference between SF2 with mono- and dinucleotide. From top to bottom ZIKA, HIV, SARS-CoV-2, and the average difference in z-score between shuffling techniques.Click here for additional data file."}
+{"text": "Results: No correlations were found between age, gender, previous extraction, tooth site (maxillar on mandible), pain score, and pain area. Patterns of third molar pericoronitis pain among 86 patients were reported. A significant correlation was found between pain score and pain area . Conclusions: Pain intensity has indeed some kind of responsibility in determining the orofacial distribution of pain. The pain area referral patterns of the present article could be considered as a pain model resulting from the pericoronitis of maxillar and mandibular third molars.Background: Mandibular third molar (M3M) removal and the management of postoperative complications represent a common matter of interest in oral and maxillofacial surgery. Pain represents a great symptom for patients affected by pericoronitis and it is the most common indication for third molar removal. The aim of the present article is to search for patterns of pre-operative pain in patients before undergoing third molar surgery and to test for a relation between some patterns of symptoms, such as pain intensity, site of symptomatic tooth, and referred area of pain. Methods: This retrospective observational study enrolled a total of 86 patients, aged (mean \u00b1 SD) 34.54 \u00b1 13.62 years (range 17\u201378 years), scheduled for outpatient third molar extraction at the Oral Surgery School, Department of Medical Biotechnologies, Policlinico \u201cLe Scotte\u201d, University of Siena. Pericoronitis and pain were the symptoms of the patients and the indication of extraction. Inclusion criteria were the presence of partially impacted third molars, confirmed with a preoperative panoramic radiograph, and preoperative pain. Exclusion criteria were known neurological disease , impaired communicative or cognitive disease, diagnosed diabetes mellitus, and oral surgical intervention within 30 days before data collection. Patients were visited and asked to answer a morphometric analytic questionnaire about their perception of pain referred to the third molar. Analyses were performed on statistical evaluation on age, age ranges, patient gender, prior third molar extraction, site of pericoronitis, pain score (1\u201310), and pain area. Two-tailed  Third molar removal is one of the most common interventions in oral and maxillofacial surgery. The most frequent pathology of the third molar is dysodontiasis and pericoronitis; dysodontiasis regards alterations related to the tooth inclusion, the lack of dragging competence of the periodontal ligament, and probably an eruptive deficit during dental root development . This paPericoronitis is a typical inflammatory pathology of the impacted or partially impacted third molar that influences the quality of life of the patients before the extraction of the tooth, more commonly in the 20s and 30s [The common symptoms of third molar pathology are pain, swelling, and trismus; a characteristic of this pathology is the difficulty for the patient to refer to the upper or lower tooth, as trigeminal innervation often confuses the patient due to the maxillary and mandibular branches . The impAs important as the pre-operative symptoms of the third molar, the post-operative conditions after third molar surgery raise relevant issues; several studies have underlined the correlation of many factors  with oral disability and severe pain after third molar surgery ,6,7,8. FApart from correlations with postoperative complications, the entity and facial distribution of preoperative pain due to third molar pericoronitis, in our opinion, has often been underestimated in the international literature. We hypothesize that this condition may be due to the fact that third-molar-referred preoperative pain has not been studied in detail, and a better definition could lead to a more confident diagnosis and a better understanding of the pathology.With regard to pericoronitis pathology, Caymaz and Buhara in their paper reported evidence of a positive association between the amount of dental plaque and third molar pericoronitis; therefore, they encouraged the improvement of oral hygiene and control of dental plaque in order to prevent third molar pericoronitis . The intPericoronitis appears to be a bacterial infection that commonly evokes the most common pain in third molar impaction; however, a recent article reported the presence of viral infection in pericoronitis . Even ifThe implementation of clinically relevant preoperative pain studies in patients with symptomatic third molars has been advocated over the past years: Rudin et al. in their paper on 38 consecutive patients reported with a multiple regression model that the combination of psychological vulnerability and heat pain perception rendered a predictive model that could account for 15 to 30% of the variance in postoperative pain during resting and dynamic conditions . Yuasa aIn order to lead to a better comprehension of pain derived from third molar pericoronitis, the authors of the present article conducted a retrospective observational study with a morphometrical, analytical evaluation of preoperative pain on 86 patients with symptomatic third molars. The purpose of this research was to evaluate pain intensity as a function of symptomatic tooth site (maxillar or mandibular) and to test the possible relationship between pain intensity and the referred area of pain.The study had an observational retrospective design. This study enrolled subjects previously visited and scheduled for outpatient third molar surgery at the Oral Surgery School, Dentistry and Dental Prosthodontics, Department of Medical Biotechnologies, University of Siena. All participants signed an informed consent agreement. For all cases, acute pericoronitis was the indication for surgery.Inclusion criteria were the presence of partially impacted third molars, confirmed with a preoperative panoramic radiograph, and preoperative pain.Exclusion criteria were known neurological disease , impaired communicative or cognitive disease, diagnosed diabetes mellitus, and oral surgical intervention within 30 days before data collection. The presence of a previous extraction was evaluated if in the past.Patients were referred to the oral surgery service, Policlinico \u201cLe Scotte\u201d, Siena for third molar pain and requested clinical evaluation. All patients provided a preoperative panoramic radiograph for diagnosis of an impacted third molar and pericoronitis. At the preoperative evaluation, patients were asked to answer a questionnaire about their perception of pain referred to the third molar. The morphometric analytic questionnaire (MAQ) we realized consisted of 5 parts. The first part of the MAQ concerned the possibility that the patient already underwent third molar surgery, as we thought that previous pain sensitization could influence the modulation of pre-operative pain. The second part concerned the third-molar-referred pain as perceived by the patient on a subjective scale from 1 to 10. The third part requested the patient to display over two graphs depicted with a standard face   the percAll patients received an explanation of their third molar pathology and symptoms after the clinical evaluation, with referral of the maxillary or mandibular third molar. This explanation and clinical evaluation were performed before the filling and compilation of the questionnaire, in order to reduce possible influences on the patient.Analyses were performed on statistical evaluations regarding patient gender; patient age, both linear and by age range; prior third molar extraction; and site(s) of pericoronitis (maxillar and/or mandible).As it concerns pain parameters, the evaluated items were pain score (1\u201310) and pain area  .The observational retrospective design did not require the approval of an ethics committee, as per Italian legislation on clinical investigations at the time of the study. Nevertheless, the investigation was carried out following the rules of the Declaration of Helsinki of 1975, revised in 2013, and performed according to the principles of the ICH Good Clinical Practice.t test , Mann\u2013Whitney rank sum test , chi-square statistics  of Fisher\u2019s exact test , one-way analysis of variance (ANOVA), Student\u2013Newman\u2013Keuls post hoc test, or Kruskal\u2013Wallis test. Associations between variables were tested by univariate regression analysis, and two-tailed p values of less than 0.05 were considered significant if not otherwise specified. The MedCalc version 11.3.0.0 statistical software package  was used.All variables were tested for normal distributions (D\u2019Agostino\u2013Pearson test) and data were presented as means with 95% confidence intervals (95% C.I.) for normally distributed variables or median means with 95% C.I. for non-normally distributed data. Differences were evaluated using the independent-sample All the 86 patients completely filled the questionnaire. A summary of anagraphical data of the patient population is reported in Between January and October 2019, a total of 86 patients, aged (mean \u00b1 SD) 34.54 \u00b1 13.62 years (range 17\u201378 years), were included in this study: 36 patients were male, aged (mean \u00b1 SD) 37.38 \u00b1 14.73 years (range 19\u201378 years); 50 patients were female, aged (mean \u00b1 SD) 32.50 \u00b1 12.51 years (range 17\u201368 years).The mean pain score was (mean \u00b1 SD) 5.9 \u00b1 2.5, with a mean pain area of 9.9 \u00b1 14.4 (range 2\u2013112). Male patients referred a pain score of 5.9 \u00b1 2.5, with a mean pain area of 12 \u00b1 20.6 (range 2\u2013112). Female patients referred a pain score of 5.9 \u00b1 2.5, with a mean pain area of 8.3 \u00b1 6.6 (range 2\u201328). No correlations were found between age and age range with pain area. However, greater values were reported in the 16\u201320 age range, with reduced values for the greater ranges . Age andp = 0.0111, rs = 0.3131, A significant correlation was found between pain score and pain area  seeking third molar extraction due to orofacial pain . As compIn this study, no correlations were found between age, gender, previous extraction, and tooth site, while the results suggested a strong influence of pain score on orofacial pain distribution (pain area). This influence of high pain that leads to a diffuse orofacial distribution of pain could let the authors speculate on possible influences of postoperative recovery after third molar surgery ,4,5,6,7.The main limits of this paper are the exclusive study of preoperative pain, without examination of postoperative recovery. Further, even if 86 patients represent an interesting number for statistics, the age and patient gender were not completely equally matched; this limit especially was felt in the age range evaluations of pain area pain score, where in some ranges, the distribution of patient gender was not homogeneous. Further, the greater presence of the mandibular third molar over the maxillary third molar impacted the study in some ways. Diabetes mellitus was reported among the exclusion criteria from this retrospective study. Diabetes mellitus is an endocrine disease with documented evidence of interference in nerve sensitivity and transmission that takes the name of diabetic neuropathy . As far On the basis of this research, the authors suggest different characteristics of preoperative pain to investigate. Future prospectives of third molar pericoronitis pain research should begin with the examination of different possible pathologies of the follicular sac surrounding unerupted third molars. We advocate the use of the histological study of the follicular sac and pericoronitis symptoms with evaluation of the state of pericoronitis. The study of these preoperative conditions could be correlated with postoperative conditions, such as postoperative non-pain complications, swelling, and infection. For this purpose, a recent study underlined a different bacterial retention on sutures after third molar surgery, and we advocate studies of pericoronitis and postoperative bacterial retention .Further, the study of preoperative pain versus no pain in third molar impaction should be investigated in order to relate with postoperative pain; this information could be useful for the clinician in order to counsel properly patients with regard to oral disability after tooth extraction .The present research study investigated and reported the intensity, distribution, and correlations between variables of preoperative-third-molar-related pain. The results of the present article allow the authors to link the third molar preoperative pain and the third molar orofacial distribution of preoperative pain by a direct correlation."}
+{"text": "The most common and challenging chief complaint in the emergency department is abdominal pain. Intussusception, although rare in adults, is an important etiology to consider. The diagnosis is often delayed because of the nonspecific symptoms, especially in adults. This case highlights a rare case of intussusception in a middle-aged male with a colonic lipoma as a leading point. Endo-loop was applied to the colonic lipoma, leading to the resolution of intussusception. Therefore, this can be an effective alternative to surgery in select cases. Intussusception is a significant medical entity characterized by the invagination of the proximal segment of the gastrointestinal tract into the lumen of the neighboring segments . IntestiIn this report, we provide a clinical case involving a male individual of middle age who received a diagnosis of colo-colonic intussusception, with a leading point identified as an ascending colon lipoma. The lipoma was encircled using an endoloop through an endoscopic procedure, and the patient was placed under postoperative observation. After a period of eight weeks, both the lipoma and intussusception were resolved, with the latter resolving immediately after the procedure. Hence, our case exhibited distinctive characteristics in terms of the primary focus of interest. Furthermore, it involved the use of an endo-loop using an endoscopic approach, which served as an alternative to the conventional surgical intervention often employed as the ultimate therapy. This case report demonstrates that endoscopic intervention can serve as a viable therapeutic option for select intussusception patients.A 55-year-old male presented with severe, diffuse, and non-radiating abdominal pain for three days, with no association with food intake and no aggravating or relieving factors. He had a past history of chronic constipation with no alarming symptoms . He was taking laxatives daily. On physical examination, there was tachycardia (heart rate 112/min). He had a respiratory rate of 18/min, a blood pressure of 110/70 mmHg, a soft abdomen that was mildly tender to palpation, and positive bowel sounds. Initial laboratory tests were within normal limits; the workup was non-significant with a normal white cell count. A CT of the abdomen was suggestive of colo-colonic intussusception with ascending colon lipoma as the leading point. A surgical consult was obtained, and a colon resection was recommended. The patient refused to undergo the procedure. The decision to use air insufflation was then made to un-telescope the intussusception and relieve the obstruction. On further investigations, a colonoscopy was done, which revealed a 4 cm sub-mucosal mass with a 'pillow sign' being positive, most likely lipoma  in the lumen of a continuous segment of the intestine after peristalsis is known as intestinal intussusception . IntussuColonic lipomas with a size less than 2 cm often do not exhibit symptoms; however, those above 4 cm are symptomatic in the majority of cases. These symptomatic lipomas manifest with non-specific symptoms including abdominal discomfort, perforation, constipation, blockage, and bleeding -7.The diagnosis of intussusception in adults is a challenging task that necessitates a heightened level of clinical suspicion. Typically, colonic lipomas are asymptomatic and are commonly identified as accidental findings during procedures such as colonoscopy, surgery, and autopsy ,9. The oThe present case exhibits a distinct nature due to the rarity of colo-colonic intussusception in the adult population. The uniqueness of our case lies in its distinctive leading point as well as the resolution achieved with the endoscopic use of an endoloop, thereby preventing the need for surgery, which is typically considered the ultimate therapy. Hence, the use of endoscopic intervention for the treatment of intussusception may serve as a viable therapeutic approach in some instances.Although intussusception is a common entity in the pediatric population, it is relatively rare in the adult population. Moreover, colonic lipoma as the leading entity is even rarer. This is an unusual case of a patient with classic symptoms of intussusception with a colonic lipoma as the etiology. The patient recovered well after the endoscopic treatment. This establishes endoscopic treatment as an upcoming modality for the same, which can be an effective alternative to surgery."}
+{"text": "The coronavirus disease (COVID-19) pandemic leveraged telemedicine worldwide mainly due to the need for social distancing, patient safety, and infection prevention. The Hospital das Cl\u00ednicas da Faculdade de Medicina da Universidade de S\u00e3o Paulo (HCFMUSP) was a key reference site in the treatment of COVID-19 severe cases in the country. To continue patient's health care, it became necessary to increase the number of teleconsultations and standardize it institutionally. Herein, we briefly described how the HCFMUSP improved the teleconsultation health care service during the COVID-19 pandemic, highlighting the implementation of important innovations and the throughout standardization process, including patients and professional workflow. We also detailed the methodology used to implement or improve teleconsultation in a medical/multidisciplinary specialty at HCFMUSP. All these efforts made the HCFMUSP reach the goal of converting 15% of all face-to-face consultations into teleconsultations only in 2021. In addition, there were more than 370,000 teleconsultations until the end of 2022. Our experience has shown that having a supporting team, a digital certification process, and the data integration were key factors toward the successful implementation of the teleconsultation services. We believe that progressing toward teleconsultation will improve the population covered by health care services in Brazil, as well as contribute to a reduction of waiting time, and solving costs to health care institutions and patients. We expect this report of our experience in teleconsultation implementation could inspire and guide other health care institutions in the development of telemedicine. The SUS was created in 1988 and is responsible for providing free access to health care services to all Brazilian citizens. It is one of the largest public health systems in the world, covering more than 200 million people. Almost 71.5% of Brazilians do not have any private health insurance, and they rely on SUS for medical treatments, health assistance, and other health care services.5 In this context, telehealth projects emerged, with the purpose of facilitating access to health services, by expanding and speeding up diagnosis and early detection of diseases.6\u20138In addition, Brazil is a large and diverse country, with vast differences in geography, economic development, and population density, which affect access to health care.9 During the pandemic, teleconsultation favored social distancing, ensuring the safety of all patients involved.8 It also contributed to a significant reduction in the flux of people visiting the HCFMUSP hospital complex.10HCFMUSP provides medical care locally, in the state of S\u00e3o Paulo, but also to people coming from all over the country. For example, it was carried out around 1.3 million outpatient medical consultations in different specialties; 125 thousand emergency services; 11.8 million pathological exams; and 842.4 thousand imaging exams only in 2019.11 Thus, in December of 2022, the Brazilian Federal Government published the law N\u00b014.510, which authorizes and regulates telehealth practices in the country.12 Therefore, we aimed herein at detailing the implementation of teleconsultations in the HCFMUSP, presenting goals and perspectives so far.However, at that time, there was no approved regulation for the practice of teleconsultation in Brazil. While facing a public health emergency of huge proportions, the Brazilian Ministry of Health, in a joint effort, formulated and approved guidelines for the telehealth practice.Instituto do C\u00e2ncer do Estado de S\u00e3o Paulo\u2014ICESP), the Central Institute , the Children Institute (Instituto da Crian\u00e7a\u2014ICR), Heart Institute (Instituto do Cora\u00e7\u00e3o\u2014InCor), the Orthopedic Institute (Instituto de Ortopedia\u2014IOT), the Physical Medicine and Rehabilitation Institute (Instituto de Medicina F\u00edsica e Reabilita\u00e7\u00e3o\u2014IMREA), and the Psychiatry Institute (Instituto de Psiquiatria\u2014IPq) and Radiology Institute (Instituto de Radiologia\u2014InRad).The HCFMUSP is composed of eight institutes divided according to the assistance area, including the Cancer Institute  was established. In detail, the \u201cGlobal Better Health programme\u2014BHP\u201dAmong the strategic endorsed areas, there are digital health initiatives, education, and training of health care professionals. HCFMUSP was already projecting and implementing digital health initiatives in the Brazilian public health system at that time. Therefore, HCFMUSP was selected by the BHP program to participate in a consultancy process by a third-party company to map those initiatives and help the hospital complex to implement and mature the ongoing digital health projects. In this partnership, 20 digital health solutions were proposed , aiming The first step included carrying out a proof of concept for teleconsultations. For this, the board of directors of the HCFMUSP, together with the Digital Health Board verified the capacity to perform teleconsultations, mapped the eligible specialties, as well as the current structure and the equipment needed, and then chose a \u201cFocal Point\u201d from each medical specialty responsible for implementing the initiative.Basically, \u201cFocal Point\u201d is defined as an institutional leader of a medical specialty who is responsible to report the state of the digital health implementation process in his field at the designated institute of HCFMUSP. The teleconsultations occurred preferentially by videoconferences. As a management strategy, weekly meetings were scheduled with the focal point to monitor the status report of the implementation of the teleconsultations and to adjust it according to each medical specialty.14 This decision was driven by concerns related to controlling the security and privacy of patient data within the HCFMUSP, but also ponder over the costs involved in the acquisition of a commercially available platform. By using a platform developed in house, the institution could ensure that all data registered in the services were stored securely and not shared or manipulated by third parties. This is extremely important in health care, where sensitive personal data, test results, and patient diagnoses must be kept confidential.The standardization of the teleconsultation process involved the development of an institutional platform for teleconferences (iConf).iConf offers a range of features that are useful for teleconsultations, including audio and video sharing, allows sharing presentations with extended whiteboard functionalities, such as pointer, zoom, and drawing tools, as well as public and private chat, screen sharing, and voice channels over the network with Internet Voice Over Internet Protocol (VoIP). The platform supports the presentation of documents in PDF and Microsoft Office formats, which is also a helpful feature for clinicians to share information with patients during a teleconsultation.iConf platform was developed to provide real-time communication capabilities for telemedicine sessions through a standard Hypertext Mark-up Language user interface. Therefore, the platform is supported by many web browsers like Google Chrome, Firefox, Opera, and Safari. All communication between participants is encrypted using the Secure Socket Layer protocol. In addition to these features, the iConf also allows recording of telemedicine sessions, which can be useful for auditing and traceability purposes, as it allows health care providers to review past sessions and maintain records of patient care.iConf is allocated in two web pages/mobile apps, named \u201cPatient Portal\u201d and the \u201cHC at Home,\u201d which were developed specifically to facilitate the patients' and health care professionals' access to the patient's journey, respectively. These web pages/mobile apps hosted information regarding scheduled consultations and exams, exam results, prescriptions, and an instruction guide. They also have a \u201cteleconsultation tab,\u201d where the patients and health care professionals can visualize the scheduled teleconsultations and access the video conference room.In addition, for the patient to access the iConf system, they need to agree on the institutional terms of free and informed consent; otherwise, their admission to the videoconference room was blocked. After completing the teleconsultation, the patient received a satisfaction survey to answer about our service. This strategy allowed us to periodically verify the quality of the services provided through the teleconsultation aiming at its improvement.Behind the teleconsultations, there was a multi-professional supporting team responsible for scheduling the teleconsultations, including send an appointment reminder to the patient on the day of the teleconsultation. In detail, an iConf link was sent to the patient before the teleconsultation, which allowed them to test their access to the platform and to provide individualized support in case of any technological issue arise. There was also a Technology Information (TI) department responsible for maintenance of computers and system operations, and to allow the virtual environment ready for the teleconsultation.The HCFMUSP decided to create a \u201cDigital Certification Process\u201d to guarantee the teleconsultation in a secure and efficient virtual environment. For this, several measures were defined and validated, which included the use of the two institutional web portals  for registered patients and health care professionals, individual security keys for the health care professionals involved in the teleconsultation and required for releasing electronic prescriptions, and for using electronic systems for handling medical records and for digital scheduling.One important ongoing step is the teleconsultation data integration. For this, the HCFMUSP TI department developed a unified dashboard that assemble and compile information and indicators to be evaluated, allowing a proper visualization of the teleconsultation implementation and help monitoring the process. In detail, the data compiled of each institute in the designated dashboards allowed the visualization of the number of teleconsultations performed, the absenteeism rate, the average time of teleconsultation, the type of service employed , and the results obtained from the satisfaction survey.15 At the HCFMUSP, medical specialties verified the need to start the implementation of teleconsultation practices.The process for implementing teleconsultation at HCFMUSP was designed by considering that digital transformation initiatives require changes in the mindset of health care professionals, as well as in the institutional values and principles.As the demand increased, the recently created Digital Health Board started to manage and organize the individual teleconsultation initiatives, to improve and standardize the practice across the whole hospital complex. Briefly, new recruited support professionals received an onboarding training in good practices in telehealth using institutional standardized guidelines created with the purpose to help them get their first steps in the teleconsultation.16Hands-on workshops were performed at the HCFMUSP to help implement teleconsultation in the institutes of pre-determined medical specialties. The content of the workshops included the introduction of good practices in telehealth, the national regulation on telehealth and the respective bill, as well as practical training activities in teleconsultation.In addition, to optimize the teleconsultation process, the HCFMUSP prepared a manual for patients and health care professionals, explaining in detail the teleconsultation procedures and its importance.In regard to the content of the bill covered during the workshops, it provides guidance on the autonomy of the health care professionals involved in the telehealth activity, the formal agreement at disposal of the patient, the right for refusal for both parts and replacement for face-to-face consultations, the imbued values in health care assistance and treatment, and the confidentiality of the patient's data. In addition, HCFMUSP produced an online asynchronous training on digital health with 20\u2009h of duration, and fully dedicated to all health care professionals requiring qualification in the topic.Focusing on the workshops and meetings, they were designed aiming at the engagement of health care professionals in the development and in the decision-making process for a rapid teleconsultation implementation in the most demanding medical specialties of HCFMUSP. For this, a decision tree strategy helped define patient eligibility criteria and guide the overall teleconsultation implementation process.The workshops resulted in the definition and selection of additional focal points responsible for sharing the decision tree with other professionals within the medical specialty and to adjust it in their work routine. Follow-up meetings were held to ensure the decision tree's feasibility and to collect feedback, updates, and status reports. In addition to the improvement of the teleconsultation workflow in the medical specialty, the workshops allowed to increase the health care professional's perception of the benefits in adopting digital strategies, and bringing digital health and remote assistance to patient care.This was an important goal, as digital technologies can greatly enhance health care delivery and improve the patient outcomes. By involving health care professionals in the development and implementation of digital health strategies, the workshops increased the professional's adhesion and facilitated technological integration into clinical practice.The conversion from face-to-face consultation into teleconsultation depends on several factors, including the particularity of each medical specialty, the patient profile, the available infrastructure, and the technological capacity. The experience acquired by the HCFMUSP professionals in digital health affairs allowed us to figure out some essential patients' eligibility criteria to perform teleconsultations. The patient must stay in a private room with a stable internet connection. If the patient is under 18 years old, elderly, or with any type of visual, hearing, or motor difficulty, the presence of a companion to assist at the time of the teleconsultation is important.The journey of the patients and health care professionals involved in the teleconsultations can be seen in The ambitious endeavor of HCFMUSP is implementing, optimizing, and expanding the health care assistance in the Brazilian public health system, leading the institution setting the goal of converting 15% of face-to-face consultations into teleconsultations by 2021. As a result of this institutional effort, this goal was reached in 2021, considering a sum of all teleconsultations performed in the entire institution. The multi-professional specialties  showed a higher conversion rate when compared with medical specialties. We verified that medical clinic was the specialty with the highest adherence to the teleconsultation practices among all available medical specialties at the HCFMUSP.By the end of 2022, 52 workshops with a digital health and teleconsultation scope were performed, totalizing more than 100 working hours and involving more than 215 health care specialists. Also, more than 2000 health care professionals were certificated for electronic prescriptions. These efforts resulted in more than 370,000 teleconsultations, including more than 180,000 registered patients and 11,322,144 virtual interactions through the Patient Portal by the end of 2022.17The Net Promoter Score (NPS) was used to evaluate the patient's satisfaction with the HCFMUSP teleconsultation service. To briefly introduce the concept, the NPS is a measure of customer loyalty developed by Reichheld in 2003. This metric assumes that customers are either promoters (80\u2013100), defined as satisfied users or detractors (0\u201360), unsatisfied users. These metrics can be used as indicators for qualifying service according to customers' feedback.According to our metrics, a 58 NPS was obtained in the end of 2022, indicating a good acceptance with the patients' HCFMUSP assisted. In detail, 69% gave positive feedback in regards to the easiness and quality offered by the virtual platform, 69% also approved the option to have online prescriptions, 71% answered that their expectations were matched with the teleconsultation service, and 74% approved the work done by the digital health TI team.We estimated that more than $500,000 were saved by the patients in travel costs, considering round trips via public transport. This value could be even higher if indirect costs were considered, such as absence of working days, food, supplies, and security. We achieved this estimated amount by multiplying the number of teleconsultations performed in 2022 by the minimum value spent by the patients in round trips to health centers for face-to-face consultations, and we then divided this number by the dollar quotation on that time.Overall, the process to implement the teleconsultation service at the HCFMUSP faced several challenges. Among them, we highlight the traditional institutional culture and the reluctance in adopting the new telehealth practices, slowing down the implementation process.We found that educational workshops held at the HCFMUSP were essential for convincing institutional leaders by demonstrating a governance strategy focused on Digital Health and Telemedicine approaches, which helped quicken the implementation process and shape a new institutional culture. In addition to these joint actions, guided weekly virtual meetings among the institutes facilitated their integration during the teleconsultation implementation process.Other relevant actions taken involved the investment and the development of a devoted infrastructure for the teleconsultation practices. For example, the feasibility study to create adapted spaces for different medical specialties to assist patients during the teleconsultation and facilitate the institutional adherence. The data integration among the institutes represented another important challenge to standardize the process; however, we overcame this by the implementation of the digital certification process across all the institutes.One of the current challenges we are facing is to attract funds to expand the teleconsultation process in some of the HCFMUSP institutes and increase the services provided to other health care institutions. Therefore, we are tackling this challenge by developing and testing strategies to attract investment from partners, either from the private sector or from public funds available for the national health care system.Besides the promising results we have had so far, the standardization and implementation of the teleconsultations in the HCFMUSP is still an ongoing process. We noticed the need to increase the workforce and its qualification to continuously improve and expand the provided telehealth practices for the public health system, and then help to create a broad digital health culture among health care professionals and patients.In addition, from now on we intend to introduce new technological solutions, such as telemonitoring strategies, to improve the patient's follow-up. We expect this new initiative will favor the teleconsultation by increasing the services provided and reducing even more the necessity of face-to-face consultations.Our experience demonstrated good acceptance and satisfaction of patients with teleconsultations services. The availability of a support digital health team was essential to make teleconsultations feasible, as well as to provide individualized attention to the patient's technological needs. In addition, the digital certification and data integration in digital informative dashboards were decisive steps to conclude on the teleconsultation implementation cycle, contributing to decision making and better planning and improvements in the implementation processes.The perspective of the HCFMUSP is to completely overhaul the patients' journey by implementing digital health practices supported by multi-professional health care, and then create a complete digital health care line and eliminate unnecessary face-to-face consulting and long and costly patient hospital trips.We believe that a mature teleconsultation service provided by the HCFMUSP will lead to an increase of population covered by specialized health assistance, including economically deprived regions of this vast country, and contribute to an even fairer Brazilian health system. Finally, we expect that HCFMUSP experience, shared in this work and future reports, can help countries in the development to consider implementing telehealth solutions as a public health strategy."}
+{"text": "In patients with Common Variable Immunodeficiency, malignancy has been reported as the leading cause of death in adults, with a high risk of B-cell lymphomas and gastric cancer.We conducted a five-year prospective study aiming to update the incidence and mortality of gastric cancer and the incidence of gastric precancerous lesions in 512 CVID patients who underwent a total of 400 upper gastrointestinal endoscopies.In the pre-pandemic period, 0.58 endoscopies were performed per patient/year and in the COVID-19 period, 0.39 endoscopies were performed per patient/year. Histology revealed areas with precancerous lesions in about a third of patients. Patients who had more than one gastroscopy during the study period were more likely to have precancerous lesions. Two patients received a diagnosis of gastric cancer in the absence of Helicobacter pylori infection. The overall prevalence of Helicobacter pylori infection in biopsy specimens was 19.8% and related only to active gastritis. Among patients who had repeated gastroscopies, about 20% progressed to precancerous lesions, mostly independent of Helicobacter pylori.While gastric cancer accounted for one in five deaths from CVID in our previous survey, no gastric cancer deaths were recorded in the past five years, likely consistent with the decline in stomach cancer mortality observed in the general population. However, during the COVID-19 pandemic, cancer screening has been delayed. Whether such a delay or true decline could be the reason for the lack of gastric cancer detection seen in CVID may become clear in the coming years. Due to the high incidence of precancerous lesions, we cannot rely on observed and predicted trends in gastric cancer mortality and strongly recommend tailored surveillance programs. In a Starting in 2018, we planned a prospective five-year cohort study enrolling 512 CVID patients, with the aim of updating the incidence and mortality related to GC and the incidence of precancerous gastric lesions.22.1https://esid.org/).We conducted a five-year prospective study in a cohort of 512 adult CVID patients (>18 years old), regularly followed in four University-based Inborn Errors of Immunity (IEI) referral centers located in Central Italy (Rome), Southern Italy (Naples), Northern Italy (Padua-Treviso), and Sardinia Island (Cagliari). To be considered for analysis, subjects needed to fulfill the 2016 ESID/PAGID revised criteria for CVID  pre\u2013COVID-19 period (January 2018 - December 2019), and b) COVID-19 period (January 2020 - December 2022). During the study period, we collected demographic and clinical data and histological findings from gastric and duodenal biopsies from upper GI endoscopy. For each patient, we collected gender, date of birth, date of CVID diagnosis, data on cancer diagnosis and histology, date of last follow-up, vital status information, date and cause of death, and past medical history of Helicobacter Pylori (HP) infection. For each endoscopy, histological findings, and the presence of HP were collected. Crude mortality ratio for GC was calculated as ratio of number of deaths for GC and the mean number of CVID patients at risk in a five-year period.The study was approved by the Ethical Committee of the Sapienza University of Rome, Prot. 316/2016, and Prot. 0279/2021, and was performed in accordance with the Good Clinical Practice guidelines, the International Conference on Harmonization guidelines, and the most recent version of the Declaration of Helsinki.2.2Sociodemographic and clinical variables were summarized with descriptive statistics. Continuous variables were described using median and interquartile ranges (IQR) and categorical variables using frequencies and percentages. Group differences were analyzed by the Mann-U Whitney test to compare continuous variables for non-normally distributed data and by Student\u2019s t-test for normally distributed data; the \u03c72 test was used for categorical variables. A p-value of <0.05 was used to consider differences statistically significant. For mortality analysis, the time since diagnosis was determined using the age at the time of CVID diagnosis. The endpoint used was the time of the last known follow-up or the date of death. Probabilities of survival after the diagnosis of CVID were estimated from the Kaplan-Meier life Table. Statistical analyses were performed with SPSS 18.0 software for Windows  and GraphPad Prism version 8.0.0 for Windows, GraphPad Software, San Diego, CA USA.33.1In the study period January 2018 - December 2022, 512 subjects with a CVID diagnosis were included in the dataset. Participants\u2019 characteristics Table\u00a01 3.2During the whole study period a total of 400 upper GI tract endoscopies were performed in 263 patients. At the enrollment, 64% of patients who underwent gastroscopy had CVID for \u226510 years, 21% for \u22655 years and 15% were diagnosed during the study time. Forty-seven percent (n=123) were aged over 50 years.The main indication for the initial gastroscopy was cancer surveillance screening (55%), with 39% of patients having at least one risk factor for GC . Other indications included gastrointestinal symptoms (39%) or portal hypertension follow-up (7%).In the pre-pandemic period (January 2018 - December 2019), a total of 166 upper GI tract endoscopies were done in 142 patients (0.58 per patient/year), and in the COVID-19 period, a total of 234 upper GI tract endoscopies were performed in 197 patients (0.39 per patient/year). In particular, 77 patients underwent upper GI endoscopies in 2018, and 89 in 2019. In 2020, the first year of the pandemic, the number of patients who performed an upper GI endoscopy was 46 . This fall was partially reversed, rising to 74 in 2021, and to 114 in 2022 Figure\u00a013.3Gastric histology. Among 263 patients who underwent one or more upper GI tract endoscopies, two patients were diagnosed with GC. Areas with precancerous lesions were identified in 72 (28%), as 17% of patients had intestinal metaplasia (IM) (n=46), 2% had dysplasia (n=6), and 19% (n=50) had atrophic gastritis. Active gastritis was recorded in 51% (n=134) of patients. Histological features of gastric ulcers were not recorded. Moreover, nodular/follicular lymphoid hyperplasia (NH/FH) was found in 29% (n=77). One patient had a diagnosis of gastric HP-positive MALT Table\u00a02.The overall prevalence of HP infection in biopsy specimens of gastric mucosa was 20% n=52). The positivity rate of active gastritis, atrophic gastritis, and intestinal metaplasia with HP-positivity was 28%, 18%, and 24%, respectively. HP infection was significantly related to the histological feature of active gastritis  but was not related to the presence of precancerous lesions . To note, none of the six patients with dysplasia was found to have a positive stain for HP Table\u00a02.2. The poMoreover, in the CVID cohort, being male  and being > 50 years of age were not associated with an increased risk to develop gastric precancerous lesions .3.4The GC was diagnosed in two CVID patients, already included in the previous retrospective survey.GC was diagnosed in December 2022 in a 55-year-old male with a 30-year history of CVID. Histology showed HP-negative early gastric adenocarcinoma with surrounding areas of active gastritis, atrophic gastritis, IM, dysplasia, and nodular hyperplasia. Indication for gastroscopy was cancer gastric screening. The previous upper GI tract endoscopy, performed in April 2021, showed areas of active gastritis, atrophic gastritis and IM, HP negative. No additional risk factors for GC were identified .The second GC was diagnosed in December 2022 in a 69-year-old female with a 57-year history of CVID. Histology showed HP-negative advanced gastric adenocarcinoma with surrounding areas of active gastritis, atrophic gastritis, IM, and dysplasia. The indication for gastroscopy was weight loss and progressive anemia. The previous upper GI tract endoscopies done in 1984, 1994, 2000, and 2012 revealed areas of intestinal metaplasia and active antral gastritis. Afterwards, the patient refused further endoscopic GC screening. Additional risk factors included a smoking habit without a history of HP infection.Overall, compared to data reported in the previous periods in our cohort , we reco3.5During the study time, 109 (21%) patients underwent more than one upper GI tract endoscopy , malignancy has been reported as a main cause of death in adults , 4, 6\u201312In the last few years, in the general population, stomach cancer predictions showed consistent mortality falls in both sexes in many countries \u201317. As sA second explanation might be linked to cancer screening delays during the COVID-19 pandemic . In factCancer immunosurveillance plays an indispensable role in preventing GC , but fewGastric carcinogenesis has been widely recognized as closely related to HP , 25. TheAggressive programs of screening and eradication of HP infection may lead to a dramatic decrease in GC mortality . HoweverGastric mucosa has been shown to have areas of lymphocytic gastritis and higher rates of inflammatory immune cells with alterations in a selected cytokine profile induced by HP that might impact epithelial cell biology and carcinogenesis , 29. AltIn conclusion, in the last five years, no death for GC has been recorded. We cannot rule out that the findings could be attributable to the year variability in a rare condition such as gastric cancer in CVID and to the short observation time. If this fall in mortality for GC might be real or related to underdiagnosis, it will become evident in the next few years. Moreover, this ongoing prospective study might clarify if our observations align with the GC decline recorded in the general population. In fact, despite the large number of gastroscopies analyzed, a major limitation of our study is the high number of CVID patients who did not undergo cancer gastric screening for low adherence to invasive diagnostic procedures. However, due to the high incidence of precancerous lesions, we cannot rely on the observed and predicted GC mortality trends , 18, andThe raw data supporting the conclusions of this article will be made available by the authors, without undue reservation.The studies involving humans were approved by Sapienza University of Rome Ethical Commitee, Prot 316/2016 and Prot 0279/2021. The studies were conducted in accordance with the local legislation and institutional requirements. The participants provided their written informed consent to participate in this study.Conceptualization: CM, and IQ. Methodology: CM, IQ, FP. Formal analysis: FP. Investigation and data curation: GG, ES, GL, AP, CD and GC. Writing\u2014original draft preparation: CM, IQ, and FP. Writing\u2014review and editing: GG, FC, DF, CF, GS and SF. All authors have read and agreed to the published version of the manuscript."}
+{"text": "The surface acoustic waves, i.e., surface phonons may have huge potential for future spintronic devices, if coupled to other waves  or quasiparticles. In order to understand the coupling of acoustic phonons with the spin degree of freedom, especially in magnetic thin film-based heterostructures, one needs to investigate the properties of phonons in those heterostructures. This also allows us to determine the elastic properties of individual magnetic layers and the effective elastic parameters of the whole stacks. Here, we study frequency versus wavevector dispersion of thermally excited SAWs in CoFeB/MgO heterostructures with varying CoFeB thickness by employing Brillouin light spectroscopy. The experimental results are corroborated by finite element method-based simulations. From the best agreement of simulation results with the experiments, we find out the elastic tensor parameters for CoFeB layer. Additionally, we estimate the effective elastic parameters  of the whole stacks for varying CoFeB thickness. Interestingly, the simulation results, either considering elastic parameters of individual layers or considering effective elastic parameters of whole stacks, show good agreement with the experimental results. These extracted elastic parameters will be very useful to understand the interaction of phonons with other quasiparticles. Today, SAWs are commonly used in microelectronics devices, sensors and filters because of their low power consumption, high sensitivity and broad tunability of operational frequency. SAW-based sensors can be utilized for characterizing various physical  and chemical properties of materials2. Moreover, these sensors can be used to sense micro-pressures3 and to detect bacteria spores such as Bacillus thuringiensis and E. coli4. Apart from these, SAWs also promise to develop future spintronics devices if coupled to other waves, e.g., spin waves (SWs), i.e., the collective precessional motion of ordered magnetic spins in magnetic materials. It has been demonstrated that the SAWs can be a very useful tool for exciting9 and manipulating12 SWs and vice versa15, which can be a compliment to current CMOS based technology. Furthermore, SAWs have also proven to be a potential tool for the nucleation of magnetic skyrmions16, the creation of magnonic crystals, i.e., artificial crystals for tailoring magnonic band structures18, domain wall driving20, spin current generator21, nano-oscillator based reservoir computation22. Recently, magnetic thin films and their heterostructures are promising to be potential candidates for future spintronics applications because of their fascinating interfacial properties. Therefore, it is quite essential to understand how acoustic phonons couple with SWs, i.e., magnons and spin degree of freedom, especially, in magnetic thin film heterostructures. At the same time, it is also important to increase the coupling efficiency between phonons and spin degree of freedom.Surface acoustic waves (SAWs) are elastic waves that propagate along the surface of elastic materials with their displacement amplitude decaying with depth into the materials, so that the energy of acoustic phonons, associated with SAWs, is mostly confined in the vicinity of the surface. There are many types of SAWs such as Rayleigh waves, Sezawa waves, Pseudo-SAWs, Lamb waves, Love waves, and so on. One of the most used SAWs in modern devices is the Rayleigh waves, which is named after Lord Rayleigh who first reported the propagation and properties of SAWs in 188526. Generally, the coupling strength can be increased by maximizing the overlapping area of magnon dispersion curves with the phonon dispersion curves. This can be achieved by tuning the dispersion curves for phonons and magnons by playing with the elastic and magnetic parameters of the materials, as properties of acoustic phonons and magnons strongly depend upon the elastic and magnetic parameters of the materials, respectively. CoFeB thin films are known to be one of the most promising ferromagnetic materials for future spintronics devices due to compelling features such as low Gilbert damping27, negligible magneto crystalline anisotropy, high tunnel magnetoresistance28 and large spin polarization29. They have shown potential for many applications like magnetic tunnel junctions27, racetrack memory30, magnetic random-access memory31, read head32, and so on. Therefore, it will be quite promising to investigate magnon\u2013phonon coupling in CoFeB thin films and their heterostructures. While doing so, one should separately investigate phonon and magnon dispersion relations in CoFeB thin film-based heterostructures as a first step. Hence, we have adapted CoFeB/MgO heterostructures in this study for the investigation of phonon dispersion. This is stimulated by the fact that the elastic parameter of one thin layer may be drastically different from its bulk values. Moreover, the effective elastic property of the whole stacks could also be very different than the single layer.A significant amount of research has been dedicated to the investigation of the coupling between magnons and acoustic phonons in magnetic thin films. It was observed that the magnetic anisotropies and spatial profiles of SWs and acoustic phonons play a crucial role in the coupling phenomena33, SnO2 and SnS234, ITO35, TiN36; as well as for magnetic multilayers such as [Ni80Fe20/Au/Co/Au]1037, [CoFeB/Au]N38 and topological insulators39. Trzaskowska et al. observed that the change in the effective thickness of the layer (by varying the number of the repetitive layer) has an influence on the dispersion relation of the SAWs leaving the profiles of the elastic wave to be the same38. It was also observed that for multilayered thin films, the elastic properties strongly depend on their synthesis condition42, materials of the deposited layers, and the type of substrate44. Hence, estimating these elastic properties experimentally as well as theoretically is very important from the application point of view. In this study, we investigate the dispersion relation (the frequency versus wavevector) of SAWs in CoFeB/MgO heterostructures with varying CoFeB thickness by employing BLS. Finite element method (FEM) based simulations are performed to corroborate experimental results. From the best agreement of simulation results with the experiments we find out the elastic tensor parameters for CoFeB layer and estimate the effective elastic parameters of the whole stacks for varying CoFeB thickness.The most used technique to study SAWs and estimate the elastic properties of thin films is Brillouin light spectroscopy (BLS). This method allows us to measure acoustic phonons in a non-invasive manner and provides information about the frequency and wavevector of SAWs. Several studies have been performed using the BLS technique on the estimation of elastic parameters for different thin films such as ZnO2 on it. The multilayer stacking is as follows: Ta (10)/Co20Fe60B20 /MgO (2)/Al2O3 (10), where the numbers in parentheses denote the thickness of the layers in nanometers. The Co20Fe60B20 will be denoted as CoFeB in the rest of the manuscript. The multilayers were deposited by radio frequency (rf) sputtering at a base pressure of 10\u22128\u00a0Torr at room temperature. The details of the sample preparation can also be found in Refs.46. A schematic view of the sample is presented in Fig.\u00a0The samples for this study are multilayer structures deposited on a Si 001) substrate with 700\u00a0nm SiO substrat48. The incident light source was a Nd:YAG single-mode diode-pumped laser of 200\u00a0mW output power, which emits the second harmonic of wavelength \u03bb0\u2009=\u2009532\u00a0nm . Measurements were performed in the backscattering geometry with pp polarization of light and the scattered light was collected using f/8 optics with a focal length of 58\u00a0mm. The solid angle of the lens was 0.63 steradians and the free spectral range was 20\u00a0GHz. A detailed description of the experimental setup can be found in Refs.50. BLS employs the inelastic scattering of incident photons from thermally excited phonons. The wavevector and frequency of the phonons in the studied samples can be characterized by measuring the projection of incident light wavevector q and frequency shift \u0394f of scattered light. Due to momentum conservation in the scattering process, the wavevector of acoustic waves is equal to the projection of the incident light wavevector in the sample plane. Thus, the wavevector q of the acoustic waves can be expressed as:q of the measured phonons in the range of 4\u201323\u00a0\u00b5m\u22121. The phase velocity (\u03bdSAW) of SAWs can be correlated with 51.The thermally excited SAWs were studied using a six-pass, tandem Brillouin spectrometer (JRS Scientific Instruments), which ensures a contrast of mentclass2pt{minim52. Such criteria perfectly work for homogeneous materials. However, in the case of multilayer films on the substrate, linear dispersion relations are not usually observed. These systems can be divided into two categories: slow-on-fast  and fast-on-slow system (vice versa)53. The next criterion for Rayleigh SAW is that \u03bdSAW should be lower than that of the velocity (\u03bdT) of the slowest transverse bulk waves.For transparent materials, the incident light is mostly scattered in the bulk of the material via the photoelastic coupling mechanism, while for opaque materials, the light is scattered from the surface of the material by the surface ripple mechanism. This fact provides an opportunity to probe SAWs in opaque materials. One of the criteria to identify the type of waves is that the Rayleigh-type SAWs in a given material must show a linear relationship between frequency and wavevectorThe typical spectra for the studied sample are presented in Fig.\u00a0qh) is shown in Fig.\u00a0q is the wavevector  in the layer and asymptotically decrease to the Rayleigh wave velocity (\u03bdR) in the layer deposited on the substrate54. By fitting the experimental data points with an exponential decay function, we extract that the \u03bdT  in the studied layer is about 5000\u00a0m\u00a0s\u22121, whereas the surface Rayleigh wave velocity in the overall stacking layer tends to be about 2500\u00a0m\u00a0s\u22121. In our study, the penetration depth of Rayleigh waves is in the range of 250\u00a0nm to a few micrometers. According to the thickness of the SiO2 layer, we consider the substrate as Si/SiO2. To calculate the Rayleigh wave velocity, all the stacking layers should be considered as an effective layer instead of considering individual layers. This is worth mentioning here that the Rayleigh surface wave velocity in the overall stacking layer is quite different than in any individual layer of the stack. As the problem is not so trivial, we perform FEM-based simulations to determine the velocities of SAWs for large qh as described in section \"The negative slope of phase velocity dispersion with 55. The unit cell selected for simulations consists of a long rectangular bar with dimensions 100 (x)\u2009\u00d7\u2009100 (y)\u2009\u00d7\u20093742 (z) nm3 made of a multilayer or effective layer /MgO/Al2O3 sample. In the studied multilayers both: the Rayleigh and Sezawa surface waves are visible. To calculate the dispersion characters of SAWs and understand the profile of the acoustic modes we first adapted the elastic parameters and densities of each layer as given in Table Figure\u00a02/Ta/CoFeB (t\u2009=\u200920)/MgO/Al2O3 film are plotted. Here, the red points represent the experimental results, whereas the blue points represent the results obtained from FEM simulations. The dispersion plots reconfirm that the studied multilayer is a slow-on-fast system. The main criterion of the above classification is 53. For slow-on-fast systems, the presence of an elastically soft layer on an elastically hard substrate leads to the reduction of Rayleigh SAWs velocity and formation of higher-order modes known as Sezawa waves, whose displacement profile is presented in Fig.\u00a0\u22121 and 5740\u00a0m\u00a0s\u22121, respectively. The phase velocity of Rayleigh SAW in the multilayer is estimated to be 2350\u00a0m\u00a0s\u22121. Here, the substrate is defined as Si/SiO2, and the layer is defined as Ta/CoFeB/MgO/Al2O3. The estimated values of velocities for all studied samples are the basis for calculations of the elastic parameters of the CoFeB layer and effective layers.In Fig.\u00a02O3 can be treated as an effective layer on the substrate. In that way, the effective elastic parameter of the multilayer can be estimated. To do so we first calculate the elastic parameters of CoFeB under two conditions. The best agreement between the experimental results and FEM simulations is treated as the first condition. The second condition is to fulfill the Cauchy relations62. We started performing simulations with the value of elastic tensor components of CoFeB as proposed in Ref.23. However, these parameters didn\u2019t fulfill our first condition. So, we modified the parameters in such a way that it fulfills both the above-mentioned conditions. The estimated elastic tensor components for CoFeB are (in GPa):For an in-depth understanding of the effect of CoFeB layer thickness on the velocity of SAWs in the studied materials, some additional simulations on SAW propagation were performed by FEM. The penetration depths of Rayleigh-type SAWs in the materials partly depend on the wavevector. We have previously mentioned that the substrate must be taken into account while calculating the characters of SAWs, especially for smaller wavevectors. As the penetration depth is way larger than the total thickness of the multilayer (which is a maximum of 42\u00a0nm for a multilayer with 20\u00a0nm thick CoFeB layer), the studied multilayers Ta/CoFeB/MgO/AlBased on these parameters, the calculated phase velocities of bulk acoustic modes and Rayleigh SAW, which propagate on the surface (001) are presented in Fig.\u00a0\u22121 , You, You7), With the estimated elastic components, Young\u2019s modulus 65. There is no unique way to do this, and different literatures propose different procedures67. We used ELATE68, which is an open-source online tool for the analysis of elastic tensors, to calculate Young\u2019s modulus and Poisson\u2019s ratio of each layer. Then, we calculated their weighted average based on the thickness of each layer.We calculate the elastic parameters of the effective layers for varying thicknesses of the CoFeB layer. This is done by adapting the proportion method, where elastic parameters of individual layers are multiplied by the volume fraction of the effective layer, added thereafter, and averaged out with the total volumeh), which shows a significant variation of effective elastic parameters with h. The accuracy of the elastic tensor values is in the range of 5 GPa. Next, we compare the phase velocity dispersion of SAWs calculated by considering the elastic parameters of individual layers and the elastic parameters of the effective layer /MgO/Al2O3 heterostructures with varying CoFeB thickness (t) from 1 to 20\u00a0nm. The thermally excited acoustic phonons are detected by employing Brillouin light spectroscopy in backscattering geometry. Both Rayleigh-type and Sezawa-type SAWs are detected in the experiment and their frequency versus wavevector dispersions are measured up to a wavevector of 23\u00a0\u03bcm\u22121. The experimental results are corroborated by finite element method based COMSOL simulations. The simulated mode profiles of Rayleigh and Sezawa waves show very distinct spatial features. We calculate the elastic tensor parameters for the CoFeB layer from the best agreement of simulation results with the experiment data points. We further estimate the effective elastic parameters  of the whole stacks for varying CoFeB thickness by considering the whole stack as a uniform layer. It is observed that the effective elastic parameters significantly vary with the CoFeB layer thickness. Interestingly, the simulation results, either considering elastic parameters of individual layers or considering effective elastic parameters of whole stacks, show good agreement with the experimental results. These extracted elastic parameters will be very useful to understand the interaction of phonons with other quasiparticles such as magnons and skyrmions in a similar type of heterostructures.In conclusion, we have studied frequency versus wavevector dispersion of thermally excited SAWs in Si/SiO"
\ No newline at end of file