diff --git "a/deduped/dedup_0849.jsonl" "b/deduped/dedup_0849.jsonl"
new file mode 100644--- /dev/null
+++ "b/deduped/dedup_0849.jsonl"
@@ -0,0 +1,48 @@
+{"text": "Dobson and colleagues describe how some host species act to reduce the risk of transmission of virulent zoonotic pathogens to humans. Why are cows sacred? Travel anywhere in India and they have the right of way. Travel anywhere in the eastern United States and you'll see squirrels, more than likely, as roadkill. Yet both species serve a similar epidemiological function: they receive bites from infected vectors that might otherwise have bitten humans, and they break the chain of pathogen transmission. In the case of Indian cattle, the bites are from mosquitoes infected with malaria parasites; the squirrels, on the other hand, receive their bites from ticks infected with the spirochetes that cause Lyme disease. In both cases, the presence of a relatively inefficient host species has reduced the rate of infectious disease spread into the human host population.Recently, ecologists have uncovered several other ways in which species diversity can benefit human health. In this Essay, we describe how disease risk is influenced by biological diversity and, specifically, how some host species act to reduce the risk of transmission of virulent zoonotic pathogens to people. This represents an exciting area of study where ecologists, conservation planners, and physicians can work together to reduce disease risk and maintain biological diversity. In a world where climate change may allow vector-transmitted diseases to spread from the tropics into the temperate zone, it may be sensible to conserve biological diversity for the purely selfish reasons of protecting human health.One of the oldest examples of biological diversity reducing disease risk occurs with malaria and domestic livestock in India, and it may partly explain why cows are regarded with deep reverence by Hindus. A variety of historical papers have suggested that sleeping in close proximity to domestic livestock, particularly cattle, may reduce the rate at which mosquitoes bite humans, and thus reduce the likelihood of infection with malaria or other vector-borne pathogens .Anopheles culicifacies . Active zooprophylaxis was undertaken when cattle were deliberately used as a barrier between mosquito breeding sites and human settlements; it was probably most widely used in Soviet collective agriculture [We don't specifically know if this is why cows are sacred in parts of India see; they haculture  and is aA slight problem with this hypothesis is that in many dry areas where malaria exhibits seasonal patterns of abundance, the by-products of cattle supply vital sources of moisture and nutriments that can contribute to the breeding success of mosquitoes. In other words, cattle may divert bites in the short term but increase mosquito abundance in the long term . Determihttp://www.redlist.org). Habitat loss is predominantly driven by the conversion of forests and savannas into agricultural land, cities, and industrial sites. Species are lost by the interaction of two processes: the loss of habitat as conversion proceeds and the fragmentation of the remaining habitat into smaller subdivided patches. Since different species require a minimum area of habitat to meet their energetic and social needs, fragmentation creates many small populations\u2014each of which is highly vulnerable to extinction even when quite large total areas of habitat remain. This creates the central dilemma of conservation biology: species are constantly going extinct locally, but usually only receive major attention when the remaining few individuals are threatened with total annihilation.A variety of human processes contribute to the loss of biological diversity: habitat loss, habitat fragmentation, overexploitation of populations for food or other economic uses, the introduction of invasive species and diseases, climate change, and pollution . HabitatSpecies with larger area requirements tend to be lost first in response to habitat fragmentation (and overexploitation). In the smallest patches, only small species or those with superior dispersal abilities persist. If the predators and competitors that determine the abundance of prey species have disappeared from the smaller patches, then the numbers of prey individuals will increase. If these prey are reservoirs for zoonotic pathogens, then the abundance of these pathogens will also increase. The classic example of this effect occurs with Lyme disease in the forests of the northeastern US\u2014as discussed below, risk of Lyme disease is high in small patches of forest with poor species diversity.Borrelia burgdorferi, which is transmitted through the bite of the blacklegged tick (Ixodes scapularis) in eastern North America. These ticks feed on a wide variety of vertebrate species, including humans. Each of these host species has a different probability of infecting the ticks with the Lyme bacterium. The white-footed mouse (Peromyscus leucopus) has the dubious distinction of being the most competent reservoir species for the bacterium\u2014over 90% of ticks feeding on wild mice become infected with the Lyme bacterium (Sciurus carolinensis) become infected, even though virtually all of the squirrels carry the bacterium [Lyme disease is caused by a spirochete bacterium,cterium . In contcterium . As a cocterium .Where are white-footed mice most common? Several studies have shown that very small patches of forest (less than about two hectares) contain high densities of white-footed mice. These patches are too small to support the predators and competitors that typically determine mouse numbers . So in sApodemus flavicollis) of Europe and the former Soviet Union. When an infectious tick bites a human, the pathogen spills over, causing serious illness. The virus attacks the human central nervous system, causing meningitis and encephalitis. Woodland workers are often at risk, but some of the \u201chot spots\u201d for TBE transmission are also key holiday locations where children have become infected and died.Tick-borne encephalitis (TBE) is a viral infection that circulates among free-living yellow-necked mice  is necessary to sustain the tick population, but deer do not permit successful transmission of TBE . Once agSimilar ecological forces seem to operate with West Nile virus (WNV). This disease first appeared in the US in New York in 1999 when significant numbers of birds, particularly crows, began dropping dead in and around New York City. Quite soon afterward, the first human cases were reported, and several of these patients died . In the The virus is transmitted by a diversity of mosquito species and can replicate in a variety of bird species. Although in some host species the pathology is undetectable, in others, particularly crows, a rapid viremia leads to death in only a couple of days. Humans, horses, and alligators are probably dead-end hosts, meaning that viremia is either too modest or too transient to provide a source of infection for later-feeding mosquitoes.Teasing out whether species diversity affects WNV dynamics will be a thorny problem, as a large number of host and vector species are involved. Several authors have presented initial analyses that suggest there is a decline in prevalence of human WNV cases in areas with high avian diversity . WNV seeAlthough a protective role for high biological diversity has been supported for directly transmitted pathogens such as hantaviruses, we expect that species diversity is most likely to reduce disease risk with vector-transmitted infections. The primary reason we get disease reductions is that the vectors that transmit the pathogen only take a limited number of bites in their lifetime; when some of these bites are taken from hosts that are not competent to amplify the pathogen, these bites are wasted. This reduces the rate at which the pathogen is transmitted. Ecologists have termed this phenomenon, the \u201cdilution effect\u201d . The priFrom one crucial perspective, these transmission dilution effects may be even stronger for WNV than for Lyme disease or TBE. In the case of ticks that transmit Lyme disease and TBE, the prolonged blood meal that the tick receives when it feeds as an adult on large mammalian hosts acts as its primary form of nutrition for tick egg production. For this reason, tick abundance may be determined at least in part by the abundance of the large host species, but, at the same time, these are the species that tend to be noncompetent and unable to either amplify or transmit the pathogen. Therefore, some components of diversity, such as deer, might simultaneously reduce infection prevalence of ticks and boost tick numbers\u2014leading to mixed effects on disease risk. In the case of tick-borne diseases, therefore, species richness alone may be only part of the story, and we need to encompass both species diversity and abundance to identify how wild animal populations influence disease risk to humans.In contrast, the abundance of mosquitoes is often independent of the abundance of the hosts that provide female mosquitoes with blood meals. Although these blood meals are crucial to egg production, the local abundance of mosquitoes may be more strongly dependent on the abundance of pools of water in which to lay eggs. For mosquito-borne zoonoses, therefore, host diversity, per se, is more likely to influence disease risk.Agricultural scientists have been interested in the effects of plant diversity on agricultural diseases for many decades, and several studies have shown that crop diversity can reduce the total burden of disease in agricultural systems. For example, the transmission of plant pathogens that specialize on particular crops can be reduced simply by interspersing other crop species that the pathogen does not readily infect. In essence, the nonhost plants can act as physical barriers to the dispersal of the pathogen, absorbing them without expressing disease or transmitting them further .A classic example of the potential effects of crop diversity on disease was found in corn. In experimental fields, the presence of a diversity of noncorn plants reduced incidence of corn smut, a fungal pathogen . More reThese plant studies illustrate the potential role that adding competitors can have on disease risk, but reductions in disease prevalence also occur in situations when predators are added to an ecological community. For example, we have long known from studies of predators feeding on Dall Sheep or Serengeti wildebeest that predators selectively prey upon sick and diseased individuals that are easier to capture . The remSimilar effects may occur with the recently emerging spongiform encephalopathies of deer (chronic wasting disease) and domestic livestock , which are threatening the future of the agricultural industries worldwide. Either of these could potentially cross the species barrier to humans, causing variant Creutzfeldt-Jacob Disease or chronic brain wasting disease. The primary mode of transmission for these pathogens appears to occur when infected livestock die . Transmission from the infected carcasses occurs when the carcasses are gnawed upon by other creatures that are nutritionally stressed.A curious feature of the spongiform encephalopathies is that their natural range is usually in an area with very poor soil, where hosts naturally suffer bone mineral deficiencies. When scavengers, such as coyotes and buzzards, are abundant, the carcasses will not last long, and it's unlikely that they will be available for transmission. However, when coyote and buzzard numbers are reduced by game managers, the carcasses can persist in the environment, and transmission rates might allow the pathogens to both increase in prevalence and establish themselves in new regions. Intriguingly, dogs seem to be totally resistant to prions. Although many dogs in the United Kingdom probably ingested infected beef, there are no veterinary reports of spongiform encephalopathies in dogs; several records occur for cats. This absence of dog cases may reflect past selection for deletion of prion susceptibility in canid species that obtain significant amounts of their food from scavenging or preying upon weakened individuals.Studies of the effects of diversity on disease are providing important insights into the major role that ecological communities play in regulating the natural abundance of zoonotic pathogens that infect humans and their domestic livestock. The problems are scientifically challenging because they involve understanding the dynamics of complex multispecies systems where birth and death rates operate on a variety of different time scales. Given that significant threats to human health may be buffered by the presence of a diversity of other species, we need to understand the dynamics of species interactions. Unfortunately, this need is increasingly urgent because we are losing biological diversity at the fastest rate ever recorded.Understanding species interactions is particularly important (or urgent) when we consider how the world of infectious diseases is likely to change in the face of ongoing climate change. At present, vector-borne diseases of humans are much more prevalent in the tropics. Tropical infections such as malaria, sleeping sickness, dengue fever, Chagas disease, leishmaniasis, and yellow fever are all diseases that worry Western tourists and military planners. The main health and economic impact of these diseases is felt by the people who live in the world's poorest tropical countries, and many would argue that these pathogens are the principal economic constraint on these countries . The warHere we suddenly discover a supreme irony: although vector-transmitted diseases take a significant toll on human health in the tropics, this toll may be significantly buffered by the presence of the large diversity of other species with which tropical people coexist. Now, as we convert habitats for agriculture or with urbanization, we improve human access to food and infrastructure, but we may also reduce the ability of natural systems to buffer disease. How much worse will things get in the tropics as biodiversity declines there?Finally, we should note that as vector-transmitted diseases disperse into the current temperate zones, they will not only benefit from a wetter and warmer world, but also from one in which the natural level of biodiversity is lower than in the tropics. Certainly, some host species may also spread from the tropics into the temperate zone, but larger species typically spread at a slower rate than smaller ones, so for a significant time, vector-transmitted diseases will be moving down a gradient of biodiversity. Given a restricted choice of hosts on which to feed, they are likely to focus their attention on the most common and most abundant species: humans, and their domestic animals and plants. This provides a strong selfish motivation to conserve biological diversity\u2014our health may depend upon it."}
+{"text": "Bacteria are defined as unicellular organisms, but they don't typically function as single cells in nature. Social behavior among bacteria is well established, and makes a lot of sense when you consider that billions of bacteria\u2014representing as many as 1,000,000 species\u2014can be found in just one gram of fertile soil. Cooperative bacteria coordinate a range of complex behaviors through a density-dependent mechanism called quorum sensing: when bacterial numbers reach a critical mass, individual cells secrete signaling molecules that control the behavior of the colony. Through quorum sensing, individual cells amass into biofilms , and some species are able to form structures called fruiting bodies to weather nutrient-poor conditions.Myxococcus xanthus fall upon hard times due to lack of food, some 100,000 individuals band together and form fruiting structures. This process is marked by distinct gene expression programs, differentiation, and morphological changes. Inside the fruiting body, rod-shaped cells differentiate into spherical, stress-resistant spores designed to wait out a famine. But only a portion of the population turns into spores; the vast majority either commit cell suicide, making the ultimate sacrifice, or remain undifferentiated.One group of bacterial species, known as the myxobacteria, exhibit several sophisticated social behaviors. They socially swarm and hunt other microbes in a manner analogous to wolf pack hunting. Even more dramatically, when cells of the species Myxococcus species are mixed together, the species segregate and form separate fruiting bodies, with one species dominating the other in spore production. Would mixing divergent strains of the same species produce similar results? In a new study, Francesca Fiegna and Gregory Velicer investigated this question using nine strains of the \u201chighly social\u201d ubiquitous soil bacterium M. xanthus isolated from different regions of the world.But how far does this cooperative behavior go? One species of bacteria can comprise many divergent strains, with different genotypes. It's been shown that when two distinct To see how divergent strains behave in mixed company, Fiegna and Velicer placed the divergent strains in nutrient-poor cultures, pitting every possible combination of one strain against another. After starving the mixed cultures for five days, the authors observed each pair's fruiting body formation, as well as the spore production of each strain in the mixtures and in isolation. The shape, size, and distribution of fruiting bodies were different for nearly every mixed pair relative to their clonal cultures, with most pairs producing fewer fruiting bodies than each strain in isolation. Mixing also decreased the overall social productivity  of the pairs, with some antagonistic pairs reducing total spore production as much as 90%. Even though most strains responded poorly to mixing, some performed better in competition than in isolation\u2014revealing that naturally occurring social bacteria are capable of exploiting their neighbors.M. xanthus as a species has diverged into multiple, distinct social types that cooperate with clone-mates (and perhaps close relatives) but have no qualms about exploiting distant relatives of the same species.Fiegna and Velicer went on to rank the dominant strains , based on the possible pairing interactions, and showed that their fitness ratings were largely hierarchical, with only one case of a rock-paper-scissors (circular) fitness relationship among any three strains out of 82 such comparisons. This hierarchy suggests that diversity would be quickly lost if all nine strains resided together in one mixed population, with only one strain  dominating and eliminating the others over time. Thus, these strains do not tend to act as cooperative subunits when mixed, and M. xanthus can travel great distances carried by water, wind, and an array of animals and insects, the authors conclude, it's possible that resulting antagonisms between introduced foreign strains and resident bacterial populations might decimate some native populations. The degree to which this type of mixing occurs in nature is an active area of research. With the help of whole-genome sequencing and molecular techniques, scientists can refine their traditional morphological classifications of this social soil bacterium to better understand its distribution and likely encounters in soil communities\u2014whether the fitness hierarchies seen here are more typical of mixed distant rather than local strains, for example\u2014and to begin unraveling the molecular agents of subjugation. \u2014Liza GrossSince"}
+{"text": "With few exceptions, the major limit to high-dose chemotherapeutic treatments is the severity and duration of drug-induced myelosuppression. We have recently developed a monoclonal antibody, MAD11, which reacts with the potent anti-tumour antibiotic doxorubicin and other anthracyclines. To protect directly pluripotent stem cells and cells of the haematopoietic microenvironment in the bone marrow against doxorubicin cytotoxicity, the monoclonal antibody MAD11 was injected into the tibial bone of mice before chemotherapeutic treatment. All mice pretreated intratibially with MAD11 and injected with 14 mg kg(-1) body weight of doxorubicin survived, whereas 41% of mice treated with doxorubicin alone died. At a higher dose of doxorubicin (18 mg kg(-1)), early mortality (first 6 days) was similar in the groups, but no deaths were observed thereafter in the intratibially MAD11-treated group, whereas most of the mice treated with doxorubicin alone died. Data obtained in mice injected with P388 leukaemia cells showed that the intratibial injection of MAD11 did not compromise the anti-tumoral activity of doxorubicin. Moreover, the administration of the anti-doxorubicin monoclonal antibody before chemotherapeutic treatment effectively reduced apoptosis induced by doxorubicin in the bone marrow cells. These data suggest the usefulness of monoclonal antibodies against chemotherapeutic drugs in the local protection of bone marrow without influencing the anti-tumour properties of the drug."}
+{"text": "REFMAC5 are described.The general principles behind the macromolecular crystal structure refinement program  REFMAC5, which is distributed as part of the CCP4 suite. REFMAC5 utilizes different likelihood functions depending on the diffraction data employed (amplitudes or intensities), the presence of twinning and the availability of SAD/SIRAS experimental diffraction data. To ensure chemical and structural integrity of\u00a0the refined model, REFMAC5 offers several classes of restraints and choices of model parameterization. Reliable models at resolutions at least as low as 4\u2005\u00c5 can be achieved thanks to low-resolution refinement tools such as secondary-structure restraints, restraints to known homologous structures, automatic global and local NCS restraints, \u2018jelly-body\u2019 restraints and the use of novel long-range restraints on atomic displacement parameters (ADPs) based on the Kullback\u2013Leibler divergence. REFMAC5 additionally offers TLS parameterization and, when high-resolution data are available, fast refinement of anisotropic ADPs. Refinement in the\u00a0presence of twinning is performed in a fully automated fashion. REFMAC5 is a flexible and highly optimized refinement package that is ideally suited for refinement across the entire resolution spectrum encountered in macromolecular crystallography.This paper describes various components of the macromolecular crystallographic refinement program  Model parameters that are optimized in the refinement process include atomic coordinates, atomic displacement parameters (ADPs), scale factors and, in the presence of twinning, twin fraction(s). Although refinement procedures are typically designed for the final stages of MX analysis, they are also often used to improve partial models and to calculate the \u2018best\u2019 electron-density maps for further model (re)building. Refinement protocols are therefore an essential component of\u00a0model-building pipelines  assumes independence of the prior phases from the model phases. These shortcomings can be addressed by using experimental information directly from the experimental data, instead of from the P                  pr(\u03b1) distributions obtained in previous steps of the structure-solution process. Currently, SAD and SIRAS likelihood functions are implemented in REFMAC5.The MLHL likelihood is dependent on the reliability and accuracy of the prior distribution et al., 2004E = 2, M = 2, P                  pr(\u03b1) = constant and |F                  1| = |F                  o                  +|, |F                  2| = |(F                  o                  \u2212)*|, F                  3 = F                  c                  +, F                  4 = (F                  c                  \u2212)*, where F                  + and F                  \u2212 are the structure factors of the Friedel pairs. The model structure factors are constructed using the current parameters of the protein, the heavy-atom substructure and the inputted anomalous scattering parameters. Similarly, the SIRAS function  = constant and |F                  1| = |F                  o                  N|, |F                  2| = |F                  o                  +|, |F                  3| = |(F                  o                  \u2212)*|, F                  4\u00a0= F                  c                  N, F                  5 = F                  c                  +, F                  6 = (F                  c                  \u2212)*, where |F                  1| and F                  4 correspond to the observation and the model of the native crystal, respectively, and |F                  2|, |F                  3|, F                  5 and F                  6 refer to the Friedel pair observations and models of the derivative crystal. If any of the E observations are symmetrically equivalent, for instance centric Friedel pair intensities, the equation is reduced appropriately so as to only include non-equivalent observations and models.The SAD probability distribution , represents the probability distribution of observations if \u2018ideal\u2019 structure factors are known. Here, all reflections that are twinned and that can be grouped together are included. Models representing the data-collection instrument, if available, could be added to this term. The second term, P, represents a probability distribution of the \u2018ideal\u2019 structure factors should an atomic model be known for a single crystal. Here, all reflections from the asymmetric unit that contribute to the observed \u2018twinned\u2019 intensities are included. If the data were to come from more than one crystal or if, for example, SAD should be used simultaneously with twinning, then this term would need to be modified appropriately. F               c is a function of atomic and overall parameter D. Overall parameters also include \u03a3 and twin-fraction parameters. f represents the way structure factors from the asymmetric unit contribute to the particular \u2018twinned\u2019 intensity. The above formula is more symbolic rather than precise; further details of twin refinement will be published elsewhere.The function used for twin refinement is a generalization of the Rice distribution in the presence of a linear relationship between the observed intensities. This function has the formREFMAC5 performs the following preparations before starting refinement against twinned data. et al. (2006(i) Identify potential (pseudo)merohedral twin operators by analyses of cell/space-group combination using the algorithm developed by Lebedev  al. 2006.R                        merge for each potential twin operator and filter out twin operators for which R                        merge is greater than 0.5 or a user-defined value.(ii) Calculate (iii) Estimate twin fractions for the remaining twin domains and filter out those with small twin fractions .(iv) Make sure that the point group and twin operators form a group. Strictly speaking this stage is not necessary, but it makes bookkeeping easy.(v) Perform twin refinement using the remaining twin operators. Twin fractions are refined at every cycle.                           All integrals necessary for evaluation of the minus log-likelihood function and its derivatives with respect to the structure factors are evaluated using the Laplace approximation  solvent models. One of them is the so-called Babinet\u2019s bulk-solvent model, which is based on the assumption that the only difference between solvent and protein at low resolution is their scale factor . Here, we used the convolution theorem, which states that the Fourier transform of the convolution of two functions is the product of their Fourier transforms.               F               mask are calculated using an FFT algorithm. These structure factors, multiplied by appropriate scale factors , are added to those calculated from the atomic model. Additionally, various mask parameters may optionally be optimized.The second bulk-solvent model is derived similarly to that described by Jiang & Br\u00fcnger 1994. The basOne should be careful with bulk-solvent corrections, especially when the atomic model is incomplete. This type of bulk-solvent model may result in smeared-out electron density that may reduce the height of electron density in less-ordered and unmodelled parts of the crystal.ks are scale factors, s is the reciprocal-space vector, |s| is the length of this vector, U               aniso is the crystallographic anisotropic tensor that obeys crystal symmetry, F               mask is the contribution from the mask bulk solvent and F               protein is the contribution from the protein part of the crystal. Usually, either mask or Babinet bulk-solvent correction is used. However, sometimes their combination may provide better statistics (lower R factors) than either individually.The final total structure factors with scale and solvent contributions included take the following form: f is as defined in (8)The overall parameters of the solvent models, the overall anisotropy and the scale factors are estimated using a least-squares fit of the amplitude of the total structure factors to the observed amplitudes, Both (11)REFMAC5 estimates the overall parameters of one of the abovementioned likelihood functions and evaluates the function and its derivatives with respect to the atomic parameters. A general description of this procedure can be found in Steiner et al.  of macromolecules and the covalent links between them.(i) Chemical information about the constituent blocks (e.g. NCS).(ii) Internal consistency of macromolecules ((iii) Structural knowledge .The first component is used by all programs and has been tabulated in an mmCIF dictionary , PRODRG  calculated from the model and ib is the ideal value of this particular geometric parameter as tabulated in the dictionary.Standard restraints on the covalent structure have the general formApart from \u03c9 (the angle of the peptide bond) and \u03c7 (the angles of amino-acid side chains), torsion angles in general are not\u00a0restrained by default. However, the user can request to restrain a particular torsion angle defined in the dictionary or can define general torsion angles and use them as restraints. In general, it is not clear how to handle the restraint on torsion angles automatically, as these angles may depend on the covalent structure as well as the chemical environment of a particular ligand.2.6.2.6.1.REFMAC5 is performed using the following procedure.(i) Align the sequences of all chains with all chains using the dynamic alignment algorithm  residues and the sequence identity for aligned residues is more than \u03b1% (default 80%).(ii) Accept the alignment if the number of aligned residues is more than (iii) Calculate the global root-mean-square deviation (r.m.s.d.) using all aligned residues.N is the number of aligned residues, j indexes the aligned residues, jN is the number of corresponding atoms in residue j, n                           j is the number of atoms in the ith group, lr is the vector of differences between corresponding atomic positions and jR and jt are the rotation and translation that give the best superposition between atoms in group i. To calculate the r.m.s.d., it is not necessary to calculate the rotation and translation operators explicitly or to apply these transformations to atoms. Rather, it is achieved implicitly using Procrustes analysis, as described, for example, in Mardia & Bibby  Calculate the average local r.m.s.d. using the formula ibby 1979. When k (v) If the r.m.s.d. is less than \u03b2\u2005\u00c5 (default 2.5\u2005\u00c5), then we consider the chains to be aligned.(vi) Prepare the list of aligned atoms. If after applying the transformation matrix  the neighbours  of aligned atoms are superimposed, then they are also added to the list of aligned atoms.(vii) If local NCS is requested, then prepare pairs of corresponding interatomic distances.               Automatic NCS identification in Steps (i)\u2013(v) are performed once during each session of refinement. Step (vi) is performed during every cycle of refinement in order to allow conformational changes to occur.2.6.2.ijR and ijt) that optimally superpose all NCS-related molecules are estimated and the following residual is added to the total target function,w is a user-controllable parameter. Note that the transformation matrices are estimated using ix and jx and thus they are dependent on these parameters. Therefore, in principle the gradient and second-derivative calculations should take this dependence into account, although this dependence is ignored in the current version of REFMAC5. Ignoring the contribution of these terms may reduce the rate of convergence, although in practice it does not seem to pose a problem.For global NCS restraints, transformation operators (2.6.3.BUSTER) is used for local NCS restraints, r this function is similar to the usual least-squares function. However, it behaves differently for large r: least-square residuals do not allow conformational changes to occur, whereas this type of function is more tolerant to such changes.The following function  structure, particularly in localized regions. In cases where it makes sense, this information can be exploited in order to aid the refinement of the target structure. In doing so, the target structure is pulled towards the con\u00adformation adopted by the known structure. The mechanism for generic external restraints described by Mooij  al. 2009 is used ia belong to the set A of atoms for which a correspondence is known, ijd is the distance between the positions of atoms ia and ja, ij is the estimated standard deviation of\u00a0ijd about d                  max ensures that atom pairs are only restrained within localized regions, allowing insensitivity to global conformational changes. External structure restraints should be weighted differently to the other geometry com\u00adponents in order to allow the restraint strength to be separately specified. Consequently, a weight w                  ext is applied, which should be appropriately chosen depending on the data quality and resolution, the structural similarity between the external known structure and the target, and the choice of d                  max. The Geman\u2013McClure function with sensitivity parameter \u03c3GM is used to increase robustness to outliers, as with the local NCS restraints.In our implementation, structural information from external known structures is utilized by applying restraints to the distances between atom pairs based on a presumed atomic correspondence between the two structures. The following function is used for external structure restraints, PROSMART. Specifically, this includes the atomic correspondence A, distances ij and the distance cutoff d                  max.Prior information from the external known structure(s) is generated using the software tool ij as appropriate. This allows a structure to be refined utilizing information from a whole class of similar structures, rather than just a single source. Furthermore, it opens up the future possibility for multi-crystal co-refinement.Potential sources of prior structural information include different conformations of the target chain  as well as those from homologous or\u00a0structurally similar proteins. It is possible to use multiple known structures as prior information. The combination of this information results in modified values of The employed formalism also allows the application of atomic distance restraints to secondary-structure elements . Consequently, external restraints may be applied without requiring the prior identification of known structures similar to the target. This is intended to help to refine such motifs towards the expected/presumed local conformation.R and R                  free values is expected to decrease in successful cases.This technique has been found to be particularly useful for low-resolution crystals and in cases where the target structure is unable to be refined to a satisfactory level. When used appropriately, external structure restraints should increase refinement reliability. Consequently, the difference between the et al., 2007R                  free. Furthermore, the difference between the R and R                  free values is reduced from 11.5 to 4.3%, suggesting greatly increased refinement reliability.Fig. 32.6.5.R and R                  free values. External structure restraints and the use of experimental phase information (described above) provide ways of dealing with this problem. Unfortunately, it is not always possible to find similar structures refined at high resolution (or at least ones that result in a sufficiently successful improvement in refinement statistics) and experimental phase information is not always available or sufficient. Fortunately, statistical techniques exist to deal with this type of problem. Such techniques include ridge regression . Note that this term does not contribute to the value of the function or its gradient; it only changes the second derivative, thus changing the search direction. It should be noted that a similar technique has been implemented in CNS . Ideally, restraints should reflect the geometry of the molecules as well as their overall mobility. Various programs use various restraints  and Q(x), the symmetrized Kullback\u2013Liebler (KL) divergence  on this atom. Atoms that have fewer restraints have stronger weights on sphericity, since these atoms are more likely to be unstable.To avoid atoms exploding and\u00a0becoming too elliptical or, even worse, non-elliptical, et al., 2010It should be noted that similar restraints on ADPs are used in several other refinement programs . Usually, an extra isotropic displacement parameter  is refined for each atom in addition to the TLS contribution. The sum of these two con\u00adtributions can be output using the supplementary program TLSANL , libration (L) and screw (S) tensors, using a total of 20 parameters for each rigid body. Given values for these 20 parameters, anisotropic displacement parameters can be derived for each atom in the group  and this is the default in R/R               free and the derived libration tensors make biological sense.Fig. 44.REFMAC5 uses the Gauss\u2013Newton method for optimization. For an elegant and comprehensive review on optimization techniques, see Nocedal & Wright             ight 1999. In thiset al., 1997et al. H is used as a preconditioner. This brings parameters with different overall scales  onto the same scale and controlling convergence becomes easier.Once all of the terms contributing to N            maxiter cycles (the default is 1000), then the diagonal terms of the H matrix are increased. Thus, if the matrix is not positive then ridge regression is activated. In the presence of a potential (near-) singularity, REFMAC5 uses the following procedure to solve the linear equation.H and G are modified. Define the new matrix by H                     1 and vector by G                     1.(i) Define and use preconditioner. At this stage, (ii) Set \u03b3 = 0.H                     2 = H                     1 + \u03b3I, where I is the identity matrix.(iii) Define a new matrix: H                     2                     p = \u2212G                     1 using the conjugate-gradient method for linear equations for sparse and positive-definite matrices .(iv) Solve the equation (v) Decondition the matrix, gradient and shift vectors.(vi) Apply shifts to the atomic parameters, making sure that the ADPs are positive.(vii) Calculate the value of the total function.(viii) If the value of the total function is less than the previous value, then proceed to the next step. Otherwise, reduce the shifts and repeat steps (vi)\u2013(viii).(ix) Finish the refinement cycle.After application of the shifts, the next cycle of refinement starts.If the conjugate-gradient procedure does not converge in 5.Refinement is an important step in macromolecular crystal structure elucidation. It is used as a final step in structure solution, as well as as an intermediate step to improve models and obtain improved electron density to facilitate further model rebuilding.REFMAC5 is one of the refinement programs that incorporates various tools to deal with some crystal peculiarities, low-resolution MX structure refinement and high-resolution refinement. There are also tabulated dictionaries of the constituent blocks of macromolecules, cofactors and ligands. The number of dictionary elements now exceeds 9000. There are also tools to deal with new ligands and covalent modifications of ligands and/or proteins.            Low-resolution MX structure analysis is still a challenging task. There are several outstanding problems that need to be\u00a0dealt with before we can claim that low-resolution MX analysis is complete. Statistics, image processing and computer science provide general methods for these and related problems. Unfortunately, these techniques cannot be directly applied to MX structure analysis, either because of the huge computer resources needed or because the assumptions used are not applicable to MX.REFMAC5 allow partial dealing with this problem. These tools include (a) restraining against known homologous structures, (b) \u2018jelly-body\u2019 restraints or refinement along implicit normal modes, (c) long-range ADP restraints based on KL divergence, (d) automatic local and global NCS restraints and (e) experimental phase-information restraints. However, low-resolution refinement and model (re)building is still not as automatic as for high-resolution structures.(i) Reparameterization depending on the quality and the amount of experimental data. Some tools implemented in (ii) Statistical methods for peculiar crystals with low signal-to-noise ratio. Some of the implemented tools, such as likelihood-based twin refinement and SAD/SIRAS refinement, help in the analysis of some of the data produced by such crystals. The analysis of data from such peculiar crystals as OD disorder with or without twinning, multiple cells, translocational disorder or modulated crystals in general remains problematic.et al. . However, since the number of parameters is very large (sometimes exceeding 1\u2005000\u2005000), integration using available numerical techniques is not feasible.(iii) Another important problem is that of limited and noisy data. As a result of resolution cutoff , the resultant electron density usually exhibits noise owing to series termination. If the resolution that the crystal actually diffracts to is the same as the resolution of the data, then series termination is not very serious as the signal dies out towards the limit of the resolution. However, in these cases the electron density becomes blurred, reflecting high mobility of the molecules or crystal disorder. When map sharpening is used, the signal is amplified and series termination becomes a serious problem. To reduce noise, it is necessary to work with the full Fourier transformation. In other words, resolution extension and the prediction of missing reflections becomes an important problem. The dramatic effect of such an approach for density modification at high resolution has been demonstrated by Altomare  al. 2008 and Shel al. 2008. The dir(iv) Error estimation. Despite the advances in MX, there have been few attempts to evaluate errors in the estimated parameters. Works attempting to deal with this problem are few and far between  Multicrystal refinement with the simultaneous multicrystal averaging of isomorphous or non-isomorphous crystals is one of the important directions for low-resolution refinement. If it is dealt with properly then the number of structures analysed at low resolution should increase substantially.         In our opinion, the problems of state-of-the-art MX analysis that need urgent attention include the following.Further improvement may consist of a combination of various experimental techniques. For example, the simultaneous treatment of electron-microscopy (EM) and MX data could increase the reliability of EM models and put MX models in the context of larger biological systems.The direct use of unmerged data is another direction in which refinement procedures could be developed. If this were achieved, then several long-standing problems could be easier to deal with. Two such problems are the following. (i) In general, the space group of a crystal should be considered as an adjustable parameter. If unmerged data are used, then space-group assumptions could be tested after every few sessions of refinement and model building. (ii) Dealing with the processes in the crystal during data collection requires unmerged data. One of the best-known such problems is radiation damage."}
+{"text": "To evaluate the efficacy of cytokine-induced killer (CIK) cell therapy in the treatment of hepatocellular carcinoma.Randomized phase II and III trials on CIK cell-based therapy were identified by electronic searches using a combination of \"hepatocellular carcinoma\" and \"cytokine-induced killer cells\".p < 0.001; two-year survival, p < 0.001; median overall survival, p < 0.001) in favor of CIK-based therapy. Comparison of CIK group versus non-CIK group resulted in a significantly prolonged progression-free survival (PFS) (p < 0.01). A favored disease control rate (DCR) and overall response rate (ORR) were also observed in patients receiving CIK cell therapy (p < 0.01). Meanwhile, patients in the CIK group showed better quality of life (QoL), diminished HBV-DNA content and AFP level (p < 0.01). Comparing T-lymphocyte subsets in peripheral blood, the analysis showed the ratio of CD3+, CD4+, CD4+CD8+ and CD3+CD4+ T cells significantly increased in the CIK group, compared with the non-CIK group (p < 0.01).The analysis showed significant survival benefit (one-year survival, CIK cell therapy demonstrated a significant superiority in prolonging the median overall survival, PFS, DCR, ORR and QoL of HCC patients. These results support further larger scale randomized controlled trials for HCC patients with or without the combination of other therapeutic methods. Hepatocellular carcinoma (HCC) is the third most common cancer globally, with a poor prognosis and limited systemic treatment options . In men,+CD56+ T cells, take advantage of the body's natural ability to eliminate tumor cells by stimulating and restoring the immune system to recognize and kill tumor cells [Cytokine-induced killer (CIK) cells, which are non-major histocompatibility complex (MHC)-restricted CD3or cells . CIK celor cells ,9.Clinical studies indicated that autologous CIK cell therapy could be used as an efficient adjuvant anticancer immunotherapy to eradicate residual cancer cells, prevent recurrence, improve progression-free survival (PFS) rates, and promote the quality of life (QoL) for cancer patients -14. TherTrials were identified by electronic searches in the PubMed database, the Cochrane Central Registry of Controlled Trials, the Wanfang Database, the China Science and Technology Periodical Database, China Journal Net, reference lists of published trials and relevant review articles. The search strategy included the medical subject headings of \"hepatocellular carcinoma\", \"cytokine-induced killer cells\" and free text searches. No language limits were applied. Initial searches were performed in August 2011, with updates in February 2012. In addition, we contacted drug manufacturers, asked experts in the field, and performed manual searches in reference lists, conference proceedings of the American Society of Clinical Oncology (ASCO) Annual Meetings and the European Cancer Conference (ECCO). We excluded abstracts that were never subsequently published as full papers and studies on animals.We gathered information including authors' names, journal and year of publication, sample size per arm, performance status (PS score), regimen used, median age of patients, and information pertaining to study design  for the trials included in the study. Written informed consent was obtained from the patient for publication of this report and any accompanying images.Overall survival (OS) and the PFS were the primary outcome measure. OS was defined as the time from the initiation of treatment until death from any cause. PFS was defined as the time from the initiation of treatment to the first observation of disease progression or death from any cause. The secondary endpoints were the overall response rate (ORR) and disease control rate (DCR). Toxicity was graded according to the NCI Common Toxicity Criteria. QoL was assessed by the Karnofsky performance status (KPS) .Q test) was performed, with a predefined significance threshold of 0.05. If the Q test was statistical significant (p < 0.05), a random effects meta-analysis was performed; otherwise, a fixed effect model was used. All reported p values result from two-sided versions of the respective tests. The revision of funnel plots did not reveal any considerable publication bias.The analysis was performed using a Review Manager Version 5.0 . We defined a statistical test with a p value less than 0.05 as significant. Odds ratio (OR) and 95% confidence interval (CI) as relevant effect measures were estimated directly or indirectly from the given data. Where they were not provided, they were estimated indirectly from other summary statistics or from the data extracted from published Kaplan-Meier curves. To assess statistical heterogeneity among trials, the Cochran's chi-square test . The full texts of 34 articles were selected as potentially relevant and retrieved for more detailed assessment. We excluded a total of 21 studies for the following reasons: 3 trials were excluded for being phase I clinical trials, 18 trials were excluded for being non-RCTs. The selection procedure of the clinical trials is shown in Figure Clinical data of these trials are listed in Table 9 to 5.0 \u00d7 1010 per course. The patient information from two groups (CIK cell therapy and non-CIK cell therapy) of the trials such as gender and CIK cell dose were analysed by \u03c72 test. There was no statistically significant difference between groups (p > 0.05). Different article-origin of the patient information in each group did not interfere with the results of meta-analysis.The CIK cells for all trials were prepared from peripheral blood. The number of CIK cells transfused into patients in these studies ranged from 8.0 \u00d7 10p < 0.001) was observed in patients receiving CIK-based therapy. The results of the pooled analysis showed that CIK arm was associated with significantly improved one-year survival  and two-year survival . However, there was no difference in half-year survival comparing the CIK group versus non-CIK group   and one-year PFS    and ORR  were observed in the patients treated with CIK combined TACE therapy compared with those treated with TACE combined PEI therapy.In the subgroup analysis, a significantly prolonged DCR .In most trials, slight fever and chills could be seen, and the body temperature varied from 37.5\u00b0C to 39.0\u00b0C within 24 hours after CIK cell transfusion. The overall OR of 0.07 (95% CI: 0.01 to 0.53) demonstrated that the incidence of fever in the CIK therapy group was significantly higher than those in the non-CIK group (p = 0.001) when compared with non-CIK therapy. The HBV-DNA content in the analysis was based on two HCC trials [6 copy/ml in the CIK therapy group. Patients in the CIK group had lower HBV-DNA content than patients in the non-CIK group . . Plasma AFP of patients in the CIK group was more likely to drop to a normal level, compared with the non-CIK group , the TACE alone group  and the PEI group  ,-2.00 for CD4+ cells , 0.04 for CD4+CD8+ cells , and -2.02 for CD3+CD4+ cells . Furthermore, the percentage of CD8+ and CD3+CD8+ T cells significantly decreased in the CIK group compared with the non-CIK group  . A favored DCR and ORR were also observed in patients receiving CIK cell therapy (p < 0.01). The mechanism of anti-tumor activity of CIK cells is still unclear. Schmidt-Wolf et al. [Schmidt-Wolf et al.  first ref et al.  demonstrp < 0.01). Although CIK group was associated with more fevers (p = 0.01). However, fever after CIK cell transfusion was light in most trials and lasted only 24 hours or less. In biological treatments, moderate fever is considered to be a normal reaction of immune function and beneficial to treatment [The study also indicated that patients receiving CIK cell therapy had improved QoL compared with patients in the non-CIK group (reatment .p < 0.01). Hepatitis B virus infection can lead to hepatic sclerosis and HCC. AFP is currently widely recognized as a tumor-related prognosis antigen for HCC. HCC patients with high levels of HBV-DNA and AFP have a poor prognosis [We also observed that the HBV-DNA and AFP levels decreased significantly in the CIK group . The percentage of CD4+ T cells significantly increased, CD8+ T cells significantly decreased, and thus the ratio of CD4+/CD8+ increased. Therefore, immune suppression was attenuated, enhancing the immune system's tumor clearance ability.Targeting of the human immune system against tumor mainly depends on cellular immunity. CD4patients ,38. The In present study, CIK cells were cultured in complete medium (CM) supplemented with human blood serum in eleven trials, and other two trials used serum-free medium (SFM) to culture CIK cells. Mitomycin, cisplatin, anthracycline and lipiodol were used for TACE. Most studies showed that the culture of CIK cells amplified more and produced more IFN-\u03b3, IL-4, or IL-5 in CM than in SFM ,40. Our The present meta-analysis was not based on individual patient data and was not subjected to an open external evaluation procedure. Therefore, the analysis is limited in that the use of published data may have led to an over-estimation of the treatment effects. With respect to both response and survival, we could not limit our analysis to intention-to-treat populations as the total number of patients randomized per arm was not always reported. Therefore, for consistency among studies, we elected to use the assessable patients for our analysis. Moreover, all the selected trials in present study were conducted in Asia, lacking multinational larger sample multicenter clinic research with sufficient statistical power. In order to solve this problem, a larger scale international multicenter randomized clinical trial should be conducted in the near future.Taken together, the CIK cells were prepared after in vitro priming and were transfused into patients with HCC. These early results appear very promising, and the side effects related to CIK cell transfusion were few. It will hopefully lead to more large and controlled clinical trials in these settings.CIK cell therapy demonstrated a significant superiority in prolonging the OS, PFS, DCR, ORR and QoL of HCC patients compared with non-CIK therapy. These observations support further larger scale RCTs to evaluate the efficacy of CIK cell therapy in the treatment of HCC with or without the combination of other therapeutic methods.The authors declare that they have no competing interests.LT and YCX performed the computerized search of the trials, contacted experts and participated in the trial selection. YM and ZZ participated in the trial selection and performed the statistical analysis. HXW and JW conceived of the study. All authors read and approved the final manuscript."}
+{"text": "The uses of botulinum toxin in the fields of neurology, ophthalmology, urology, rehabilitation medicine and aesthetic applications have been revolutionary for the treatment of patients. This non-invasive therapeutic has continually been developed since first discovered in the 1970s as a new approach to what were previously surgical treatments. As these applications develop, so also the molecules are developing into tools with new therapeutic properties in specific clinical areas. This review examines how the botulinum toxin molecule is being adapted to new therapeutic uses and also how new areas of use for the existing molecules are being identified. Prospects for future developments are also considered. This review will, however concentrate on the adaptation of the BoNT molecule itself, engineered from the wild-type form to either alter the mode of action or to expand the range of therapeutic targets.Botulinum neurotoxins (BoNTs) have shown considerable clinical efficacy in treating a large range of disorders. Historically, the therapeutic utilization of BoNTs has progressed by administration for novel therapeutic interventions and future progress is likely to follow a similar path. Most recently, BoNT has been increasingly employed for example in the field of urology  and alsoClostridium botulinum and the tetanus neurotoxin (TeNT), produced by Clostridium tetani [\u00ae, Botox\u00ae and Xeomin\u00ae, although several others are currently available in a few countries  and others are being developed , and one Type B toxin exists: Myobloc\u00ae[The clostridial neurotoxin family comprises seven BoNT serotypes (A-G), produced mainly by m tetani . Althoug Myobloc\u00ae. In clinHere, we review the potential of modifying BoNTs to extend their range and number of therapeutic applications and to provide novel therapeutic tools for the future. We will summarize current knowledge of BoNT genetics and discuss the design of novel toxins for application in new therapeutic interventions. Clostridium botulinum form a complex with BoNT that may contribute to toxicity and the stability of the BoNT in the natural environment of food poisoning [BoNTs are synthesized as a single polypeptide chain comprising several domains with distinct functions that contribute to the mechanism of toxicity (discussed in further detail below). Other proteins produced from oisoning ,13,14. TGenes encoding the BoNTs, other members of the protein complex and genes that regulate expression of the toxin, are grouped in clusters. Great variation exists between BoNT gene clusters . Unique Both the BoNT complex and the functional domains of the toxic BoNT peptide are modular in nature . This isC. botulinum strains have now been sequenced [Genomes from several equenced , revealiequenced . Compariequenced , has beeequenced . In contequenced ,16,23, aequenced ,25,26,27C), mediates uptake of the toxin into the neuron, by binding to recycling synaptic vesicles in a stimulation-dependent manner [All BoNT neurotoxins are synthesized initially as a ~150 kDa single chain, which is cleaved by an (unidentified) clostridial enzyme to form the active BoNT complex. This comprises a ~50 kDa light chain, which is a zinc-dependent endopeptidase, and a ~100 kDa heavy chain; the two are linked by a single disulfide bond [t manner ,29. Uptat manner ,31.The highly-expressed gangliosides  represenComparison of the crystal structures of BoNT-A and BoNT-F receptor-binding domains reveals the heavy chain folds of BoNT-A and BoNT-F are similar, except for the region implicated in neuron binding . A similC of BoNT-A, BoNT-B, BoNT-E, BoNT-F and BoNT-G [C of BoNT-D [Despite the variation exhibited by this region, a single, highly conserved ganglioside-binding motif E(D)\u2026H\u2026S(G)XWY\u2026G(S) has been identified in the Hd BoNT-G ,39,40. Af BoNT-D . These mf BoNT-D ,39,42, af BoNT-D ,47,48,49f BoNT-D , an effef BoNT-D . The light chain is catalytically active if introduced to non-neuronal cells via permeabilization ,46, micrSeveral approaches have been used to target non-neuronal cells with BoNT. Co-application with lipid-based DNA transfection reagents resulted in BoNT-A activity in non-neuronal cell lines that are resistant to the toxin when applied alone . Other aN) of BoNT-E with the heavy chain of BoNT-A (chimera E/A) displayed the rapid uptake and block of neuromuscular transmission exhibited by BoNT-E [Generating chimeric proteins from BoNT has combined desired BoNT characteristics within one toxin. A chimera composed of the light chain and N-terminal heavy chain (Hy BoNT-E . This chy BoNT-E . N) consisting of the light chain and heavy chain N-terminus (HN) is of particular interest for the design of novel therapeutic conjugates as this still contains both cell-membrane transportation and catalytic actions of the original BoNT molecule [N heterodimer containing fragments of BoNT-A, BoNT-B and BoNT-C [N of BoNT-A has also been conjugated to lectin from Erythrina cristagalli, which binds to galactose-containing carbohydrates found on the surface of nociceptive afferents, to target pain signalling in vivo [et al. showed that the same BoNT-A LHN conjugated to wheat germ agglutinin inhibited neurotransmitter release from neuronal cell lines normally resistant to the neurotoxin [N was targeted to neuroblastoma cells that are normally refractory to the fragment by conjugation to nerve growth factor, inhibiting neurotransmitter release [Conjugating light chain catalytic domains of BoNT to cell-binding domains of non-toxic proteins has rendered refractory cells sensitive to the toxin. A heterodimer  to inhibit the secretion of mucus from epithelial cells that are refractory to the LHN alone [Providing proof-of-principle that a retargeted BoNT derivative can prevent secretion in non-neuronal cells, Foster HN alone . This BoHN alone .Chimeric BoNTs have also been developed that employ the cellular binding activity of BoNT as a targeting moiety to deliver the activity of a conjugated, non-native protein. Removing or inactivating the catalytic light chain domain of BoNT is required in order to prevent the blockade of neurotransmission. Catalytically-inactive BoNTs are therefore proposed to have prolonged cellular uptake, in contrast to active BoNTs that disable their own uptake . Genetic fusion of the enzymatically-inactive binding domain C2IN of BoNT-C2 to streptavidin allowed delivery of biotinylated molecules into the cytosol of mammalian cells . Full-leVarious tracer proteins have also been conjugated to BoNT peptides, including those containing inactivating mutations . ConjugaThe BoNT cellular-binding activity has also been proposed to deliver an enzyme to cancer cells that activates a prodrug, administered systemically . Howeverin vitro [As TeNT has a similar modular arrangement of functional domains as BoNT, advances in TeNT engineering may also be applied to BoNT. For example, the binding domains of both BoNT and TeNT have been utilized to deliver DNA to target cells and enhance targeting of other transfection methods. The TeNT heavy chain fragment has been conjugated to poly-lysine, which has a high capacity to bind DNA, allowing transfection of a range of neuronal cell lines ,69. Thisin vitro .Recent studies with recombinantly produced BoNT domains show that proteins can be assembled by non-chemical linking, using tagging with helical motifs from the family of soluble N-ethylamide-sensitive factor attachment protein receptor (SNARE) proteins. This may potentially be exploited to use the BoNT-binding domain to deliver future therapeutics or other cargo into neurons, or to facilitate re-targeting of the light chain .BoNT-A has the potential to inhibit the release of multiple, but not all, neurotransmitters ,74. ThusOnce taken up into the neuron, BoNT light chain cleaves members of the SNARE family of proteins which mediate docking of synaptic vesicles with the neural cell membrane . The SNAIn addition to neurotransmission, SNAREs have been implicated in non-neuronal secretory processes. The effectiveness of BoNT on these processes is determined by both the SNARE member mediating secretion and the BoNT serotype. For example, BoNT-A is reported to inhibit insulin secretion from permeabilized \u03b2-cell lines, as this process is mediated by SNAP-25 . In contRegions of BoNT involved in SNARE recognition and cleavage have been identified ,79, inclThe BoNT regions implicated in catalysis are supported by crystal structures of inactive BoNT-A light chain bound to SNAP-25, confirming exosite and active site interactions . Correla(R230K), for example, abolishes activity [Although the minimal substrate size of BoNT-A required for catalysis is relatively large, only a few non-conserved residues proximal to the active site have been shown to influence catalysis of the substrate . Such reactivity . Taken tet al. [(K224D) cleaved non-neuronal SNAP-23, at a similar rate to that at which the wild-type toxin cleaves its native target [In order to target non-neuronal SNARE proteins, Chen et al.  targetede target .C in a \u2018nanometer-sized hydrogel\u2019 (nanogel) [C was released from the nanogel, the peptide was taken up by nasal dendritic cells, without accumulation in the brain [Catalytically-retargeted BoNT may be applied clinically in the future to target non-neuronal cells in concert with novel administration technologies, such as iontophoresis , nasal inanogel) , allowinhe brain . Severalhe brain , releasehe brain  and toxihe brain  and solvhe brain .In most clinical applications, the actions of BoNT are temporary, lasting from several days (BoNT-E) to months (BoNT-A) . The durDifferences in duration of the neuroparalytic effects between BoNT-A and BoNT-E may be due to the nature of the cleavage of the target protein . Both clet al. [et al. reported the catalytic light chain domain of BoNT-A, which is not involved in the neuron-specific endocytotic cellular binding, contains signals in the N- and C-termini that are required for plasma membrane binding [N) of BoNT-A and HC of BoNT-E (chimera AE) possessed similar persistence of SNAP-25 cleavage in vitro and neuromuscular block in vivo to BoNT-A, suggesting regions involved in duration of action are located in the LN. Such regions may be amenable to direct engineering in the future to extend the duration of toxin action in the clinic. In the past, many genetic approaches have been hindered by the number of clostridial species that are amenable to genetic manipulation, although novel techniques have recently been developed.The duration of action is also proposed to be determined by the intracellular persistence of the light chain , which iet al. ,99 compaet al. , indicat binding . ConsistStudying and potentially altering potentially altering the duration of action of the BoNTs is particularly relevant, as there may be a limited amount of toxin that can enter the cell. The toxins mode of entry into the cell is by exploiting the synaptic vesicle pathway that couples exocytosis with endocytosis of synaptic vesicles. Binz and Rummel  claim thC. botulinum sequence data has been hindered by the number of mutations generated for functional genomic studies, owing to a lack of basic molecular biology tools required for directed mutation. Targeted inactivation of clostridial genes has been almost exclusively limited to single crossover knockouts via integration through homologous recombination of a replication-defective plasmid [Exploitation of  plasmid . However plasmid ,104. C. botulinum [C. acetobutylicum [ClosTron provides the facility for positive selection of desired mutants, which are highly stable and reproducible, expanding the current options for functional genomic studies in clostridia. Although use in BoNT engineering is still in its infancy, ClosTron has huge potential. To date, ClosTron has been utilized to generate a non-toxigenic mutant strain of otulinum  and inacutylicum .BoNTs have unique and well-characterized structural properties that make them particularly well suited to engineering for therapeutic use. The potential therapeutic capacity of BoNT is being realized through characterization and genetic engineering to alter the binding, catalysis and duration of the toxin, allowing specific targeting and therapeutic tailoring. Structure-function relationships allow rational design of catalytic specificity, allowing application of BoNT to numerous SNARE-mediated secretory processes, including those involved in diabetes ,77, resp"}
+{"text": "Tumors of the gastrointestinal system represent a significant share of solid tumors worldwide. Despite the advances in diagnosis and treatment, the prognosis of gastrointestinal tumors is still very poor and improved therapies are indispensable. Cytokine-induced killer (CIK) cells are feasible for an immunotherapeutic approach as they are easily available and have an advantageous biologic profile; they are rapidly proliferating and their high cytotoxicity is non-MHC-restricted. We summarize and discuss twenty recent clinical studies applying CIK cells for the treatment of gastric, pancreatic, hepatocellular, and colorectal cancer. Autologous CIK cells were transfused intravenously, intraperitoneally, or via the common hepatic artery. In all studies side effects and toxicity of CIK cell therapy were mild and easily controllable. The combination of CIK cell therapy with conventional adjuvant or palliative therapies was superior to the standard therapy alone, indicating the benefit of CIK cell therapy for cancer patients. Thus, CIK cells represent a promising immunotherapy for the treatment of gastrointestinal tumors. The optimal treatment schedule and ideal combination with conventional therapies should be evaluated in further clinical studies. Tumors of the gastrointestinal (GI) system constitute a major part of the cancer incidence and mortality statistics. Worldwide, colorectal cancer is the most frequent type of GI cancer: it is the third most common cancer in men and the second most common in women. Moreover, colorectal cancer accounts for the largest share of GI cancer-related deaths in women, while liver cancer is the most common cause of death among GI tumors of men .Despite the recent advances in diagnosis and therapy, outcomes for patients with GI tumors remain very poor. Often, GI tumors are diagnosed only at advanced stages due to the lack of specific symptoms and screening methods. As a result, 5-year survival rates are low \u20135.Adoptive cell immunotherapy might be used in combination with standard therapies\u2014as adjuvant postsurgical treatment and as palliative treatment\u2014to improve survival and quality of life of GI cancer patients. Cytokine-induced killer (CIK) cells have the best credentials to be effective in this therapeutic approach. Compared to lymphokine-activated killer (LAK) cells, CIK cells can be obtained more easily and reveal a higher tumor-specific cytotoxic activity \u201310. Simi\u03b3 (IFN-\u03b3), monoclonal antibody against CD3 and interleukin (IL)-2. The heterogeneous cell population gains its potent, nonmajor histocompatibility complex (MHC)-restricted cytotoxicity mainly through expansion of CD3+CD8+CD56\u2212 cells to CD56-positive natural killer (NK) T cells [CIK cells can be easily developed from peripheral blood lymphocytes (PBLs) and stimulated with interferon- T cells , 13, 14. T cells , 16. The T cells \u201319.In the following sections, clinical studies applying CIK cells for the treatment of GI tumors are reviewed and discussed.Helicobacter pylori, a bacterium colonizing the stomach, is the most prominent known risk factor for gastric cancer [Gastric cancer is the third leading cancer-related cause of death among men and the fifth most common among women. It is therefore a major health issue worldwide. Apart from dietary aspects, c cancer , 20. Todc cancer .9) after each chemotherapy. In both treatment groups, serum levels of tumor markers were significantly (P < 0.05) lower after therapy. The decrease was more pronounced in the patient group receiving additional CIK cell therapy. In the beginning, there was an increase in the cumulative survival rate of the patients treated with CIK cell transfer but after two years, there was no difference in survival between the two groups  and all cell populations used for immunotherapy had no less than 30% CD3+CD56+ cells. Patients received six cycles of multidrug adjuvant chemotherapy based on 5-FU. Seventy-four patients additionally received at least three cycles of autologous CIK cell therapy (immunotherapy group). One cycle consisted of five CIK transfusions.A similar study was conducted by Shi et al. a few years later . The fin+ and CD4+ cells and the CD4+/CD8+ ratio increased in the patients' blood and remained at a higher level for up to two months (after three cycles of CIK cell therapy). All side effects occurring during or after transfusion could easily be treated with symptomatic therapy in case they did not resolve on their own within 24 hours. The most common side-effects were fever, chills, headache, rash, nausea, and vomiting (ranging from 5.0 to 20.8%).One week after immunotherapy the mean percentages of CD3P = 0.044) in the immunotherapy group than in the control group. A trend towards an improved overall survival  could be observed in the immunotherapy group as well. Moreover, by retrospective subgroup analysis, patients with intestinal-type tumors could be found to benefit most from CIK cell therapy .The median followup was 50.5 months; in the end 137 patients (90.7%) had died and 143 (94.7%) had relapsed (mostly hematogenous recurrence). The disease-free survival (DFS) rate was significantly better  perfusion of CIK cells . Forty-tP = 0.018). Patients additionally treated with CIK cells showed a longer median time to progression  and a superior OS (P = 0.006).The combination of chemotherapy and CIK cells was well tolerated, and there were no serious adverse reactions after CIK perfusions. Compared to chemotherapy alone, the combined therapy was able to reduce the volume of 2-cycle peritoneal fluid drainage (Another study that was published in 2008 focuses on the side effects occurring during CIK cell treatment . Sixty eSide effects appearing after CIK transfusions included chills (13 patients), fever (9 patients), a general malaise (3 patients), nausea, and vomiting (1 patient). These symptoms could all be managed by symptomatic therapy. The therapeutic results were also quite promising. The total remission rate in the CIK cell therapy patient group was higher than in the group of patients treated with chemotherapy alone (58.6% versus 45.2%). In the CIK cell-treated group, eight patients developed partial remission (PR), nine moderate remission (MR), seven stable disease (SD), and five progressive disease (PD). In the chemotherapy group, only five patients developed PR, nine MR, seven SD, and even ten PD.The same research group performed a retrospective study to analyze the correlation between CIK cell therapy and cancer-related death in patients with gastric cancer . One hunP = 0.007). The 5-year survival rates showed a clear trend towards a superior survival time for patients treated with CIK cells (P = 0.0526). The frequency of CIK cell immunotherapy was found to be significantly associated with the survival of patients (P = 0.002).The 2-year survival time was significantly longer after additional CIK cell therapy than after chemotherapy alone  and for the 5-year OS . The median PFS was 36.0 months in the CIK treated study group versus 23.0 months in the control group (P = 0.028). The OS time was also significantly longer in the study group: 96.0 months versus 32.0 months in the control group (P = 0.003). Within the study group, the frequency of CIK cell therapy, the clinical stage, and the followup therapy were found to be the most important factors for PFS and OS (P < 0.05).No serious side effects were observed after CIK cell transfer. The 3-year progression-free survival (PFS) and OS rates were higher in the CIK cell therapy group compared to the study group, but the differences were not significant. A significant improvement could be seen for the 5-year PFS  along with CIK cells [Qiu et al. report on a new approach of pancreatic carcinoma-specific immunotherapy using synthesized IK cells . In this\u03b1-galactosyl  epitope on the cell membrane, whereas the natural anti-Gal antibody is present in human serum [\u03b1-Gal epitope on tumor cells can result in in situ binding of natural antibodies. This in turn enhances DC phagocytosis and thereby presentation of TAA to T cells, finally generating an antitumoral immune response. Cancer patients often have low immunity; therefore, CIK cells were used for coculturing with the \u03b1-Gal-expressing tumor cell lysate-pulsed DCs.The aim of this clinical approach was to improve tumor-associated antigen (TAA)-pulsed DC therapy. In humans, there is no an serum . Hence, \u03b11,3-galactosyltransferase, \u03b1-Gal epitopes were synthesized on freshly isolated tumor cells from these biopsies. The cells were then incubated with natural anti-Gal antibody and finally lysed. DCs, which were induced from peripheral blood mononuclear cells (PBMCs) using granulocyte macrophage colony-stimulating factor (GM-CSF), IL-4, and tumor necrosis factor (TNF)-\u03b1, were then incubated with the \u03b1-Gal-expressing tumor cell lysate. CIK cells were prepared from bone marrow samples of the patients, harvested on day twelve, and co-cultured with the lysate-pulsed DCs in presence of IFN-\u03b3, anti-CD3, and IL-2 for 72 hours. The DC-CIK cell mixtures were then used for i.v. transfusions.In a first step, metastatic tumor nodules or lymph nodes were surgically obtained from the patients. Using neuraminidase and recombinant 9 to 10 \u00d7 109 cells per injection).The first injection was applied one week after completion of the conventional therapies. Then, depending on the availability of tumor samples, one to five further injections were administered once a week with increasing numbers of cells (2 \u00d7 10+ and CD4+ T cells (P < 0.05) and significant increases of CD3+CD8+ T cells, CD3+CD45RO+ cells, and CD3+CD56+ cells (P < 0.01) could be detected in the patients' peripheral blood one week after the third transfusion, indicating a boosting cellular immunity. These levels returned to the original level (before DC-CIK therapy) six to nine months after the third injection. Moreover, a significant increase in IFN-\u03b3 secretion by PBMCs (P < 0.01) was detected, which remained increased for the followup period of 24 months. Most patients (n = 12) showed a positive delayed-type IV hypersensitivity (DTH) reaction after three injections. The carcinoembryonic antigen (CEA) and carbohydrate antigen (CA) 19-9 levels decreased in most patients.No serious side effects are reported. Moderate increases of CD3P < 0.01). The four patients who survived the followup period showed strong DTH reactions and significantly increased IFN-\u03b3 secretion.The clinical response was evaluated according to RECIST criteria one month after the third injection. Six patients had SD, two PR, and six remained in PD. Interestingly, there were strong correlations between an increasing DTH reaction, a decrease in CEA and CA19-9 levels, respectively, and survival  is the most common histological type of liver cancer and the fifth most common cause of malignancy worldwide. Liver cancer rates are more than twice as high in men as in women and the second most common cause of cancer-related death in men. The majority of cases occur in developing countries, where liver cancer is strongly related to infections with hepatitis B and C viruses (HBV and HCV). In industrial countries, where the incidence of HCC is increasing, the most common risk factors are alcohol abuse and obesity resulting in fatty-liver disease, liver fibrosis, and finally liver cirrhosis. In 80% of the cases, HCC is developing on top of a liver fibrosis/cirrhosis .In most of the cases HCC is diagnosed in an already advanced stage or with decompensated liver cirrhosis. Therefore, the majority of patients can only be treated with palliative therapies. Despite the evolving new medical treatments such as the tyrosine kinase inhibitor sorafenib, therapy of HCC is still challenging.In 2000 a study investigating postsurgical recurrence rates in HCC patients was published . HCC patIn the end, 72 patients received all five CIK cell transfers, two received only four courses of CIK therapy because of detection of extrahepatic metastases, and two received only one cycle and refused subsequent cell infusions. Adverse events occurred in 45 patients and were all WHO grade 1 or 2 and self-limiting.P = 0.01). Also the time to first recurrence was significantly longer in the immunotherapy group (P = 0.008). Hence, adjuvant cell therapy was able to lower the frequency of recurrence and to extend the recurrence-free time after hepatic resection.The median time for followup was 4.4 years. The recurrence rate of HCC was significantly lower in the immunotherapy group  than in the control group . Patients were followedup for up to 108 days after CIK cell therapy. At that time, the composition of lymphocyte subpopulations was still similar to the levels determined ten days after therapy. This indicates that the induced changes in the subpopulations can last for at least 108 days.Autologous CIK cells were reinfused i.v. at days ten, thirteen, and fifteen of CIK cell culture. Before treatment and ten days after CIK cell therapy, the patients' PBMCs were analyzed using a flow cytometer: percentages of CD36 to 1.41 \u00d7 105 copies of DNA/mL three months after therapy. It is well established that DC function is suppressed in patients with HCC and chronic HBV or HCV infections [1 cell differentiation and immunity, and DC2, which induce Th2 differentiation and immunogenic tolerance, were analyzed during this study [P < 0.01). These results suggest that CIK cells are able to play a major role not only in tumor treatment but also in restriction of viral infections.As all patients had a background of chronic HBV infection, the influence of CIK therapy on the HBV viral load was of great interest: on average, the HBV content decreased from 1.85 \u00d7 10fections . Therefois study . The perIn a study by Zhang et al. seventeen patients were treated with autologous CIK cells . Most pa10 CIK cells. Following the transfusion, the patient had decreased nausea, vomiting, and ascites. After three months a tumor specimen of this patient showed large lymphocyte infiltration\u2014much more than before treatment. The cells were stained for T cell, T memory cell, and mono/macrophage markers and all cell types were increased after CIK therapy. This probably indicates the induction of an antitumor immune response. Unfortunately, no clinical parameters or results are stated and therefore no conclusions on the clinical effect of the CIK cell transfer can be drawn from this study.CIK therapy is reported as being safe, effective, and without side effects. Without giving reasons, only the results of one patient are given in detail in this publication. This patient had recurrent HCC with metastases and was treated with i.v. transfusion of 1.3 \u00d7 103 increased from 19 patients before treatment to 29 afterwards. In the control group, the viral DNA content of only one patient dropped below 1 \u00d7 103.Zhao et al. included 64 HCC patients in a CIK cell therapy study . All patAgain, this study gives an idea of what adoptive CIK cell therapy is capable of; it may reduce recurrence, prolong recurrence-free time, and fight HBV. However, the relatively short followup makes it difficult to draw any substantial conclusions.n = 40) received no additional treatment.The research group conducted a similar study in 2008 . Eighty-+, CD3+, CD56+, and CD3+CD56+ T cell populations and the CD4+/CD8+ ratio were significantly increased (P < 0.05). Remarkably, the percentages of these cells were lower in patients who experienced recurrence than in patients who were recurrence-free . Interestingly, the percentage of CD8+ T cells, which was decreased after CIK cell therapy, was increased again in recurrent patients.Following the transfusions, eleven patients developed a light fever and shiver; all adverse effects were grade 1 or 2. The proportions of several T cell subsets in the patients' peripheral blood were measured by flow cytometry two weeks after CIK transfusions. CD4P = 0.001). The median recurrence-free survival was significantly longer for patients who received CIK cell transfer (P = 0.012). Also the recurrence-free survival rates were significantly higher in the immunotherapy group than in the control group .During eighteen months of followup all patients survived. Fourteen patients (31.1%) of the immunotherapy group had HCC recurrence compared to 32 patients (80.0%) in the control group  levels in patients with HCC after TACE/RFA and CIK therapy . AFP is n = 39) and a study group (n = 42); patients within the study group received autologous CIK cell infusions once every week via the common hepatic artery or peripheral veins. At least four infusions were given with >1 \u00d7 1010 CIK cells each. Further AFP levels were examined one and four weeks after TACE/RFA and\u2014only in the study group\u2014before each CIK cell transfer and once every four weeks within one year after CIK cell therapy.Six to eight weeks after TACE/RFA therapy the possibility of residual tumor burden was excluded by imaging techniques. Before randomization, two consecutive AFP measurements assured a stable AFP level. Patients were then randomly divided into a control group (P < 0.05). Within the control group, nine patients experienced recurrence within one year; six of them had AFP concentrations slightly higher than the baseline level. In the study group three patients developed recurrence within one year, with two of them having AFP levels slightly higher than the baseline level.Comparing AFP levels during followup to baseline levels before TACE/RFA, no significant decrease in AFP concentration could be observed in the control group. By contrast, AFP concentrations in patients additionally treated with CIK cells gradually decreased during followup. The differences between the two patient groups were significant (P = 0.04). Therefore, CIK therapy was able to reduce short-term tumor recurrence. Serum AFP levels were also reduced in patients after CIK cell transfusions indicating that a sustainable decrease of AFP might be useful to predict the clinical efficacy of CIK cell therapy.In summary, the one-year recurrence rate was 7.14% in the study group, which was significantly lower than in the control group . The 3-, 5-, and 10-year OS was also significantly higher in the CIK group (P \u2264 0.005).No major complications occurred during treatment and the overall frequency of adverse effects was similar in both groups. The evaluation of the clinical efficacy was based on modified Response Evaluation Criteria in Solid Tumors (mRECIST) . DiffereThe results of this study suggest that additional CIK cell infusions can be beneficial for patients treated with sequential TACE/RFA. CIK cell therapy can prolong recurrence-free survival, which points to a safe and effective treatment option for patients with HCC.Hao et al. published a nonrandomized controlled clinical trial combining only TACE with CIK cell therapy . From 20P < 0.001). Among other factors, CIK cell therapy and times of TACE before disease progression were associated with PFS and OS as identified by univariate analysis. The median OS was significantly longer in the combination group (31 months) than in the TACE group .According to RECIST criteria, short-term responses were similar in both groups: 18% (13 patients) in the combination group and 14.9% (11 patients) in the TACE group had PR; 81.9% (59 patients) in the combination group and 85.1% (63 patients) in the TACE group had SD. The PFS in the combination group was significantly improved compared to the TACE group; the 6-month, 1-year, and 2-year PFS rates were 72.2%, 40.4%, and 25.3% in the combination group versus 34.8%, 7.7%, and 2.6% in the TACE group  hyperthermia in 31 patients with advanced HCC . Twice a+, CD3+CD8+, and CD3+CD56+ cells increased significantly after treatment with CIK cells (P < 0.05). The AFP level (P = 0.001) and the abdominal circumference (P = 0.002) significantly decreased. After a median followup of 8.3 months (range 2\u201312 months), the median TTP was 6.1 months and the median OS 8.5 months. The 3-, 6-, 9-months, and 1-year survival rates were 93.5%, 77.4%, 41.9%, and 17.4%, respectively.No serious adverse events were observed and mild adverse events resolved without intervention. Levels of peripheral blood lymphocytes, the AFP concentration, and the abdominal circumference were recorded every two weeks. The level of peripheral blood CD4Although a control group is missing in order to draw definite conclusions, the authors suggest a benefit of this treatment modality for patients with advanced HCC. They also emphasize the necessity of more clinical trials including higher numbers of patients to provide evidence and evaluate combinations with other therapeutic approaches.n = 43) did not receive any postoperative adjuvant therapy. The patients were followedup for a relatively long period of five to seven years.A relatively large randomized controlled study on postoperative CIK immunotherapy was conducted from January 2000 to 2002 . The aimP < 0.005), but there were no significant differences between the CIK-I and the CIK-II groups (P = 0.345). Comparing the 5-year DFS rates, the results of the CIK-I and the CIK-II groups are relatively close together (23.3% and 19.4%), while the result of the control group is about half the percentage (11.2%). Interestingly, there were no significant differences in the OS rates (P = 0.884). Apart from the treatment modality, liver cirrhosis, tumor size, tumor differentiation, and vascular invasion were identified as significant factors influencing the DFS (P < 0.05).In total, five patients had to stop CIK therapy due to side effects. Still, no long-dated side effects could be observed. The DFS rates were significantly longer in the CIK-treated groups than in the control group . Increases in CD3+, CD4+, CD45RO+, CD8+, and CD56+ cells could be detected in the patients' peripheral blood after CIK therapy.CIK application was safe as no serious side effects were observed. Tumor-specific CIK cell therapy significantly prolonged survival\u2014the median survival of the study group was 17.1 months versus 10.1 in the control group  were measured (P < 0.05). Also an increase in the cytotoxicity of PBLs was observed following CIK cell therapy.CIK cell therapy was well tolerated; only three patients developed WHO grade 2 fever. Transfected cells could be detected in the patients' blood for up to two weeks after immunotherapy. Moreover, significantly increased serum levels of IFN-The clinical evaluation in this study was based on comparison of CT scans before and after treatment and on the WHO Handbook for reporting results of cancer treatment . At the The twenty clinical studies discussed here prove CIK cell therapy to be an effective treatment option\u2014after or along with conventional therapies\u2014for patients with gastrointestinal tumors. In addition, as it was shown to be safe and not to induce major adverse effects, CIK cell therapy is a valuable alternative for patients not able or willing to tolerate side effects of conventional chemotherapy , 33. Wit+, CD4+, CD3+CD8+, CD3+CD45RO+, and CD3+CD56+ cell populations and the CD4+/CD8+ ratio in the patients' blood increased, which indicates a boosting cellular immunity induced by CIK cell transfusions [\u03b3 by PBMCs and the IFN-\u03b3 serum level, respectively, were also shown to increase after CIK cell therapy [\u03b3 secretion lasted for the followup period of two years and elevated CD3+, CD4+, CD3+CD8+, CD3+CD45RO+, and CD3+CD56+ levels returned to normal six to nine months after CIK cell therapy [+CD8+, CD25+ and CD3+CD56+ cells during the whole followup period of up to 108 days [+, CD3+, CD56+, and CD3+CD56+ cells were lower in recurrent patients [Several studies showed that after CIK cell application the levels of CD3sfusions , 35, 45. therapy . In the  therapy . Shi andpatients . TherefoSome types of cancer such as HCC are closely associated with underlying viral infections  making the viral load an important prognosis factor. Therefore, one therapeutic goal is to decrease the viral load in order to improve the clinical outcome. In some clinical studies on CIK cell therapy for HCC, the viral load of HBV has been determined before and after CIK transfusions in order to evaluate the effect of CIK cells on viral replication. After CIK cell therapy, the HBV copies of DNA/mL decreased. This indicates a positive effect of CIK cells on viral infections and thus a clear benefit for patients with tumors and chronic viral disease , 39.In summary, CIK cell therapy provides a promising approach in cancer therapy. CIK cells have a favorable biology with non-MHC-restricted tumor targeting and uncomplicated isolation and cultivation. In all studies, CIK cell therapy was well tolerated and superior to conventional therapies alone. There are several questions yet to be elucidated, for example, the optimal application schedule and the best therapeutic combination with conventional treatment modalities.A few of the abovementioned studies are retrospective studies and many authors stated that more large-scale randomized controlled studies are needed. Indeed, these retrospective studies only give an idea of the effectivity of CIK cell therapy while the improved data quality of prospective clinical studies results in a higher significance. The great advantage of CIK cell therapy is that it is a personalized therapeutic approach\u2014unfortunately, this makes CIK cell therapy very cost- and time-intensive, hampering the conduction of large prospective randomized trials.ex vivo protocols for the generation of CIK cells are heterogenous. For example, Jiang et al. generate CIK cells by addition of IFN-\u03b3 and IL-2 on day 0, anti-CD3 antibody and IL-1\u03b1 on day 1, and then IL-2 every third day [\u03b1, and IFN-\u03b3 at day 0, IL-2 after 24 hours, and then IFN-\u03b3 and IL-2 every five days [\u03b3 at day 0 and anti-CD3 antibody and IL-2 at day 1 [There are many variations in the methodology and in the clinical evaluation between the research groups, which impede the comparison of the trials. The hird day . In contive days . Shi andat day 1 . The samat day 1 . Making"}
+{"text": "Tragelaphus oryx), pointing to the possibility that sexual selection may not be the primary cause of dewlap evolution in ungulates. Here I use a two-pronged approach to test hypotheses on the function of ungulate dewlaps: an interspecific comparative analysis of bovids and deer, and an intraspecific study of eland antelopes in the wild.Dewlaps are iconic features of several ungulate species and, although a role in signalling has been postulated, their function remains largely unexplored. We recently failed to find any age-independent link between dewlap size and social status in the common eland , which agrees with a thermoregulatory function as lower surface/volume-ratio counteracts heat dissipation in large-bodied species. In eland antelopes, large dewlap size was associated with higher, rather than lower, incidence of claw-marks (independently of age), a result which speaks against the dewlap as a predator deterrent and rather indicates a predation cost of the structure.The findings suggest that, although an additional function in communication should not be ruled out, the dewlap of ungulates may contrast with that of lizards and birds in thermoregulation being a primary function. Extravagant ornament-like male morphologies that are sexually dimorphic are often assumed to have evolved by sexual selection to signal individual quality, either owing to female mate choice, male-male combat or both , 2. HoweTragelaphus oryx) shows that dewlaps increase monotonically in size with age and the dewlap could thus provide meaningful information about fighting skills gained through experience ; intercept: 3.67, P\u2009<\u20090.001; dewlap: t\u2009=\u20094.96, P\u2009<\u20090.001, VIF\u2009=\u20092.144; age: t\u2009=\u20091.553, P\u2009=\u20090.122, VIF\u2009=\u20092.596; body size: t\u2009=\u20090.385, P\u2009=\u20090.700, VIF\u2009=\u20092.118; logistic GzLM: N\u2009=\u2009212 males: intercept: 3.05, P\u2009<\u20090.001; dewlap: : \u03c72\u2009=\u20098.53, P\u2009=\u20090.004, VIF\u2009=\u20092.178; age: \u03c72\u2009=\u20090.823, P\u2009=\u20090.364, VIF\u2009=\u20092.602; body size: \u03c72\u2009=\u20090.028, P\u2009=\u20090.868, VIF\u2009=\u20092.113; Fig.\u00a0The incidence of claw-marks was positively, rather than negatively, related to dewlap size  and the water buffalo  regularly cool their body temperature by wallowing, and the wild yak , American bison  and European bison  inhabit boreal and temperate climates.On the balance of the current evidence, benefits from thermoregulation emerge as a plausible main driver of the evolution of the ungulate dewlap Table\u00a0. DewlapsNeither the present interspecific study, nor our earlier results from the intraspecific study, provides support for the Sexual Selection Hypothesis. In male eland antelopes, we found no link between dewlap size and status as master bull in mixed-sex herds, and an association with dominance status in all-male herds disappeared after controlling for age . ConsistGiraffa camelopardalis) in three study areas within the Serengeti-Mara ecosystem was found to be 4\u00a0%, 26\u00a0% and 32\u00a0% [At present, the most parsimonious interpretation of the link between claw-marks and large dewlap size is that benefits of large dewlaps in other contexts trade off against costs from increased predation risk, possibly because of lower running speed. However, conceivable is also an alternative explanation derived from the idea of the dewlap as a sexually selected handicap: rather than signalling the ability to flee, the dewlap could signal the ability to successfully fight off predators, in which case an association between large dewlaps and the presence of scars would indeed be expected. Still, against expectation remains the absence of scars on the dewlap itself since this is where the animals are hypothesized to be seized. At 30\u00a0%, the proportion of adult eland males with claw-marks, presumably primarily from lions, was comparable to figures found in another large savannah herbivore which share the lion as its main predator: the prevalence of claw-marks on adult female giraffes (and 32\u00a0% . The preand 32\u00a0% .All in all, the present evidence suggests that the dewlap in ungulates may be the result of convergent evolution under different selective pressures than those thought to underlie dewlaps in lizards and birds. Attaining very large body sizes in hot environments, the ungulate species in which dewlaps have evolved face a significant challenge to dissipate excess body heat. The structure is thus likely to facilitate temperature regulation, but a trade-off in terms of enhanced predation risk is suggested by the higher incidence of claw-marks in individuals with large dewlaps. Ruling out a communicative function of the dewlap on the basis of the present study would be premature and this remarkable trait, which has attracted considerable scientific attention in other taxa, warrants further study in ungulates."}
+{"text": "In honey bees and many other social insects, production of queens is a vital task, as colony fitness is dependent on queens. The factors considered by honey bee workers in selecting larvae to rear new queens during emergency queen rearing are poorly understood. Identifying these parameters is critical, both in an evolutionary and apicultural context. As female caste development in honey bees is dependent on larval diet (i.e. nutrition), we hypothesized that larval nutritional state is meticulously assessed and used by workers in selection of larvae for queen rearing. To test this hypothesis, we conducted a series of experiments manipulating the nutritional status of one day old larvae by depriving them of brood food for a four-hour period, and then allowing workers to choose larvae for rearing queens from nutritionally deprived and non-deprived larvae. We simultaneously investigated the role of genetic relatedness in selection of larvae for queen rearing. In all the experiments, significantly greater numbers of non-deprived larvae than deprived larvae were selected for queen rearing irrespective of genetic relatedness. Our results demonstrate that honey bees perceive the nutritional state of larvae and use that information when selecting larvae for rearing queens in the natural emergency queen replacement process. As a young virgin, during the only mating event of her life, the queen will mate with 5 to 21 males over a few days9. This polyandrous mating leads to a distribution of multiple patrilines among the fertilized eggs  that a queen produces8. Fertilized eggs develop into larvae that are totipotent for the first through third instars; they could become either queens or workers12. Determination of their development into one or the other is driven solely by diet15. Larvae that are fed large quantities of nutrient-rich royal jelly from a totipotent instar to pupation become queens; those that are fed comparatively nutrient-dilute brood food become workers18. This developmental fork in the road makes it possible for nurse bees to raise selected totipotent larvae as queens if colony conditions are appropriate 23.The social structure of the honey bee colony is such that, ordinarily, reproduction is consolidated to the efforts of a single individual: the queen. She is the only member capable of laying fertilized eggs that develop into females (workers and new queens). Additionally, she is the longest-lived member of the colony, with a lifespan (1 to 8 years) that typically far exceeds that of the other honey bee castes27. A colony that is unsuccessful in their attempts to rear a queen, in any queen rearing context, will eventually die without human intervention.Honey bee colonies rear new queens (i) to replace dead/missing queens or queens that are no longer laying eggs (emergency queens); (ii) to replace injured, old or diseased queens that are not productive (supersedure queens); and (iii) in preparation for reproduction at the colony level even when the current queen is laying well (swarm queens)28. Thus, workers select eggs or totipotent larvae, in worker cells, to raise as queens. Selection is commonly signified by the modification of that worker cell into a vertically oriented, peanut-shaped queen cell30. Once selected, the larva is provisioned with royal jelly. Emergency queen rearing is, as the name suggests, of great urgency. The colony only has about 6 days after the last egg was laid to begin rearing new queens. After that time, the last eggs laid by the queen will have grown into larvae too old to reliably develop into fully functional queens (3 days as eggs and 3 days as totipotent larvae)31. The size, shape and orientation of a queen cell is a strong cue triggering queen rearing behavior 28.If the current queen has died or stopped laying eggs, emergency queens must be reared35. Past work suggests that a contact surface pheromone is the major larval recognition signal in honey bees, and worker bees can differentiate hungry larvae from well-fed larvae35, potentially via detection of the volatile pheromone E-\u03b2-ocimene produced by hungry larvae36. But there is a significant gap in knowledge about the criteria that worker bees use in selecting larvae for rearing emergency queens. Much of the literature on this subject has focused on tests of nepotism and kin discrimination44. However, the experimental design of most studies supporting such a theory involved highly artificial conditions and methodological concerns47. Nepotism and kin discrimination are generally considered improbable in a colony comprised of a naturally occurring distribution of multiple patrilines46 and experimental support for kin selection in queen rearing is weak at best51. Only recently has there been exploration into other potential cues in larvae selection for queen rearing. These recent studies have demonstrated that resource availability affected kin selection of larvae52, larvae originating from eggs with greater weights were preferentially selected for queen rearing53 and larval cell location in the brood nest influenced emergency queen cell construction30. Nonetheless, much of it is yet to be understood. We hypothesized that because larval diet is the all-important determinant of whether a female larva develops into a queen, the nutritional state of larvae may, likewise, affect their selection for queen rearing. Here we tested the premise that well-fed larvae will be preferentially selected over their poorly nourished cohorts for queen rearing. To test this hypothesis we conducted a series of experiments manipulating the nutritional status of one-day-old larvae by depriving them of brood food for a period of 4\u2009hours.Previous studies have shown that honey bee workers can recognize the brood and differentiate the castes and developmental stages of larvae54. Grafting larvae into large, vertically oriented artificial queen cells is a well-established method of mass queen rearing used in apiculture since the late 1800\u2019s57. At least one previous study50 recognized a significant difference in the choices bees make when selecting larvae in natural queen rearing versus maintaining queen rearing in artificially grafted larvae. In natural emergency queen rearing, nurse bees select individual larvae or eggs present in the worker cells and modify the existing wax cell into a queen cell. The vertical orientation of a queen cell is a strong cue triggering queen rearing behaviors17. It is therefore reasonable to hypothesize that, in any examination of emergency queen larval selection, natural queen rearing and artificially grafted queen rearing methods may yield significantly different results. We tested this hypothesis by manipulating the nutritional status of totipotent larvae and rearing them in both a natural queen rearing environment and an artificial queen rearing environment (grafting).Previous studies on nepotism and kin discrimination primarily used a method called grafting to measure queen rearing59. When introducing foreign individuals to a colony, combined odors of their natal colony are important60. These odors come from endogenously produced chemicals and from food sources and other material adsorbed into the surrounding wax comb61. Because our experimental methods included introducing larvae in brood comb into unrelated colonies, it was necessary to observe the potential effects of comb odor on larval choice for queen rearing as well.In studies examining the cues honey bees use to make decisions about the acceptance of new individuals into the hive, nest-mate recognition, when to initiate foraging, the presence of the queen, queen rearing and a myriad other aspects of colony function, chemical mediators have commonly been observedTo address all the questions/hypotheses discussed above, we conducted the following series of experiments. The first experiment (variation in nursing times between same age larvae) was conducted to examine if there were some larvae that were not fed for at least 4\u2009hours in a colony and also to observe variation in feeding times between larvae. The second experiment was performed to investigate the behavior of nurse bees towards deprived (not fed) versus non-deprived (fed) larvae. In the third experiment, we attempted to resolve a critical aspect of the methodology used to test the effects of larval nutritional deprivation on selection of larvae for queen rearing by measuring selection under natural colony conditions versus artificial grafting. Further, in the fourth experiment (comb odor experiment), we tested whether a 12-hour placement of frame (comb) in an unrelated colony would mask the comb odor of the parental colony. This experiment was necessary to discount any comb odor bias during larval selection for queen rearing. Finally, in the fifth experiment, we tested the effects of both relatedness and nutritional status of larvae in selection of larvae for queen rearing. We used colonies headed by open mated queens and colonies headed by super sister, single-drone inseminated queens for this experiment.We used video recordings of observation hives to quantify various aspects of nurse bee visits at 2-day old (young) and 5-day old (older) larvae. For the young larvae (2-day old) we observed visitations of nurse bees to 75 larvae in each of the 4 observation hives (four-frame observation hives) to see if any larvae were not fed (neglected) at all during the 4\u2009hour observation period. In another separate experiment we used 5 two-frame observation hives to measure the total amount of time spent by nurse bees feeding selected individual larvae that were older (5-day old) during a one hour observation period. The overall goal of experiment 1 was to characterize how long a given larva might be neglected and, conversely, for how much time a larva may be fed.Upon analysis of the nurse bee visitation data for each larvae, it was found that 6 larvae out of a total of 75 (8%), 4 larvae out of a total of 75 (5%), 6 larvae out of a total of 75 (8%) and 3 larvae out of a total of 75 (4%) were not visited by nurse bees at all during the observation period (4\u2009hours) in the observation hives 1, 2, 3 and 4 respectively.Distribution of larval feeding times was found to be significantly different from uniform distribution, with a clear right skew . The mean total feeding time per larva was 6.82\u2009\u00b1\u20090.68\u2009minutes. The maximum interval between feeding bouts was 36.57\u2009minutes; the median interval between feeding bouts was 3.86\u2009minutes. Similar to the previous experiment (1a), we found that approximately 10% of the total observed larvae were not visited at all during the observation period.To examine how temporary nutritional deprivation of larvae may influence the ways in which nurse bees allocate their efforts and resources among totipotent larvae, we established observation hives in which we artificially deprived approx. 500 larvae of brood food while allowing approx. 500 larvae to be fed, and then measured nurse bee response to those larvae. We measured time to first feeding, time to first inspection, total number of feeding bouts, total number of inspections, duration of each feeding bout and total time fed for deprived and non-deprived larvae. When there was no significant difference between replicates, we pooled the data from all replicates within a treatment group for analysis.1,5\u2009=\u20096.853, p\u2009=\u20090.047). Also, time to first inspection was significantly shorter for deprived larvae compared to non-deprived larvae . The distribution of time to first inspection and to first feeding in the two groups have been described in Fig.\u00a02\u2009=\u200911.602, df\u2009=\u20091, p\u2009=\u20090.001; Fig.\u00a02\u2009=\u200960.055, df\u2009=\u20091, p\u2009<\u20090.001; Fig.\u00a04,70\u2009=\u2009\u22120.150; p\u2009=\u20090.881, Fig.\u00a01,70\u2009=\u20096.892, p\u2009=\u20090.011; Fig.\u00a0The time to first feeding was significantly less for the deprived larvae than for the non-deprived larvae  and natural (on standard brood frames). For each type of queen rearing method, we created groups of deprived and non-deprived larvae, placed them in experimental colonies experiencing emergency queen rearing conditions and then measured how many queens were reared to pupation from each treatment group. When there was no significant difference between replicates, we pooled the data from all replicates within a treatment group for analysis.2\u2009=\u20098.8, df\u2009=\u20091, p\u2009<\u20090.01; Fig.\u00a02\u2009=\u20090.045, df\u2009=\u20091, p\u2009=\u20090.83).When experimental colonies were allowed to select deprived or non-deprived larvae for queen rearing under the natural emergency queen rearing method, a significantly higher number of queens were reared from the non-deprived treatment group than from the deprived treatment group  after those frames spent 12\u2009hours in a foster colony. As there were no significant differences observed between the replicates, the data in each treatment group was pooled for analysis.There was no significant difference observed in the number of larvae selected for queen rearing from the related and unrelated frames , we forced all colonies into emergency queen rearing conditions after their queens had laid eggs on experimental brood frames. Then each colony received a single frame of brood that contained four different \u201ctypes\u201d of larvae: deprived and non-deprived related larvae and deprived and non-deprived larvae from an unrelated colony. We compared the number of queens reared to pupation from these different larval patches. When there was no significant difference between replicates, we pooled the data from all replicates within a treatment group for analysis.2\u2009=\u20090.86, df\u2009=\u20091, p\u2009=\u20090.35) or the non-deprived larval treatments . However, the number of queens reared differed significantly between larval treatment groups . For both related and unrelated larvae, more queens were reared to pupation from the non-deprived treatment group (3.8\u2009\u00b1\u20090.5) than from the deprived treatment group  or the non-deprived larval treatment groups . For both related and non-related larvae, the number of queens reared differed significantly between larval treatment groups , with more queens reared from the non-deprived treatment group (5.4\u2009\u00b1\u20090.3) than from the deprived treatment group  in order to produce greater numbers of competitive, fit males68. In another study, virgin queen survival was positively correlated with worker-queen interactions; and one specific interaction\u2014again, vibration signal\u2014was positively correlated with her fighting ability and number of rivals killed, thereby increasing the chance of a high quality queen becoming the new laying queen of the colony67.Results from studies investigating worker bee interactions with nest-mates of other castes  support the notion that workers can evaluate the quality of reproductive individuals and modify their behavior toward them accordingly35 and that such differentiation is accomplished by chemical cues36.Our initial observations suggest that even in a normally functioning colony with adequate resources, some larvae are seemingly stochastically ignored for sufficient time to result in some amount of \u201chunger.\u201d Even periods of short-term neglect by nurse bees (and a presumed concomitant deprivation of food), in keeping with the natural variation observed in the hive, was sufficient to elicit distinct patterns of nurse bee behavior towards deprived larvae. This variation\u2014not only in nurse bee response times to initiate inspections and feeding bouts, but also in the number of such bouts over the course of an hour-indicates that nurses perceive subtle changes in larval rearing environment and adjust their responses accordingly. The most likely cue for such changes are chemical, though our experimental methodology cannot rule out other cues, as they were not measured in our study. Indeed, research by others have demonstrated that nurse bees can distinguish between well-fed and deprived larvae73. Brood ester pheromone, for example, has been shown to communicate the presence and number of larvae in a colony, regulating nursing and foraging behaviors over the short- and long-term76. The semiochemical E-\u03b2-Ocimene was first described in honey bee queens78. However, more recent research has demonstrated it to be also emitted by the larvae, for reasons such as to inhibit ovary development in worker bees79, accelerate hypopharyngeal gland development in nurse bees80 and regulate foraging behavior82. Perhaps more germane to the study presented here, it has recently been shown that larvae produce more E-\u03b2-Ocimene after being deprived of food, lending additional support to the idea that larvae communicate nutritional status chemically36. It appears that a deprived larva pheromonally sends a \u201chunger signal\u201d to positively influence its chances of being fed. Conversely, the same pheromone signal may have a negative effect on the likelihood that worker bees will select the signaling larvae for queen rearing.Honey bee larvae have a robust and varied pheromonal profileIn our study (experiments 5), the deprived larvae were not made available to queenless colonies for queen rearing immediately after the deprivation period. Rather, both deprived and non-deprived larvae spent a 12-hour period in foster colonies post-deprivation, and presumably were fed by nurse bees therein, before being placed in the queenless colonies under emergency queen rearing conditions (about 40\u2009hours old at that point). Hence, levels of brood food present in the cells may not have been different enough between the two groups (deprived and non-deprived) to be easily distinguished by workers during the point of time at which they were making decisions to select larvae for rearing queens. It appears that the larvae selected for queen rearing most likely were not chosen based on depleted brood food levels in the larval cells, but more likely based on chemical cues. We speculate that deprived larvae were sending nutritional stress signals in the form of pheromones to workers and workers used those signals while making choices regarding queen rearing. Future work on larval selection for queen rearing should investigate the E-\u03b2-Ocimene levels, and other chemical signatures, of larvae that are preferentially selected for queen rearing when nurse bees must choose between well-fed and potentially malnourished larvae.52, our results support the notion that artificially grafting larvae into queen cells does not appear to be a test for selection, but rather a test for queen rearing maintenance of preselected larvae. The factors that bees use to select larvae for queen rearing and those used to maintain queen larvae may be very different. Likely, in the absence of a queen, the size, orientation and/or shape of queen cells provide a strong signal to nurse bees that larvae contained therein should be reared as queens 17. In our study, larval nutritional status was a significant factor in selection of larvae for emergency queen rearing under natural conditions, but not for artificially grafted larvae, which were placed inside artificial cups resembling the beginnings of natural queen cells.Beyond transient effects of nurse bee attention, short periods of deprivation can have a profound impact on the trajectory of the life of a larva. As predicted, natural emergency queen rearing and larval grafting methods produced significantly different results. The natural queen rearing method (emergency queen rearing) showed a strong bias toward non-deprived larvae for queen rearing selection, whereas there was no significant difference in the number of queens reared from deprived and non-deprived larvae in the artificial grafting method. Like several previous studies52, did not control for the possibility that the foreign comb odor accompanying unrelated larvae in some way discouraged workers from selecting them. We avoided this methodological pitfall in our experiments on relatedness by placing all experimental brood comb in a foster colony for 12\u2009hours.The results from the comb odor experiment indicate that workers did not preferentially rear more queens from larvae in their own comb, signifying that a 12-hour period in another colony masks any potential comb odor associated with the parental colony. Most studies that found worker bees selecting related larvae for queen rearing more often than unrelated larvaeAdditionally, our findings from the experiment pertaining to relatedness and nutritional state of larvae strongly suggest that nutritional state of larvae is a significant factor in selection of larvae for queen rearing when compared to relatedness. These results further strengthen the existing data demonstrating the absence of nepotism during emergency queen rearing process. Thus, within colonies, the primary factors leading to selection of a larva for a replacement queen appear to be those related to larval fitness, rather than relatedness or origin.83. Hence, any new insights about queen production would immensely benefit the beleaguered beekeeping industry. Queen breeders select larvae for queen rearing solely based on age of the larvae84 whereas bees may be assessing several other traits in addition to age of larvae when selecting larvae for queen rearing. Our findings illustrate the importance of larval nutrition in selection of larvae for queen rearing.For the past few years, poor queen quality has been a top management concern for commercial beekeeping in the United StatesAll the experiments were performed during the months of April through September 2008 at Texas A&M University apiary, College Station, TX . A brief summary of the experiments conducted, their objectives and the sample sizes have been provided in Table\u00a0The objective of this experiment was to determine the maximum amount of time any single larva may be neglected by nurse bees and the amount of time nurse bees spend feeding each larva.85. We analyzed these videos to determine the number of larvae that were not visited by nurse bees during the 4-hour observation period.Four colonies were established in separate four-frame observation hives, each containing a queen, approximately 4,000 adult honey bees, and equal amounts of brood, honey, and pollen. In each of the four observation hives, we video recorded a randomly selected brood area consisting of 75 neighboring, two-day old larvae for four consecutive hours, using a digital camera . The four-hour observation period was chosen based on previous studies86 for three or more seconds. We then summed the amount of time nurse bees spent feeding each larva to estimate total time fed during the recorded time. The variance of total feeding times among the larvae was tested against a uniform distribution with Student\u2019s T-test87 using SPSS Statistics (2008) 16.0.Five colonies were established in separate two-frame observation hives, each containing a queen, approximately 2,000 adult honey bees, and equal amounts of brood, honey, and pollen. In each of the observation hives, we video recorded five randomly chosen five-day old larvae for one hour with a digital camera. This was repeated five times for a total of 25 larvae observed per colony. Next, we analyzed the videos for the duration of nurse bee feeding bouts for each larva. A feeding bout was defined as a nurse bee inserting her head and thorax into the larval cell2 area (henceforth referred to as target area) on one side of a frame using a push-in cage constructed of 3\u2009mm hardware cloth on the sides and plastic queen excluder material on top  and made the other with 3\u2009mm hardware cloth, which restricted adult bee access to larvae (depriving larvae of food)  and video recorded them with a digital camera for 30\u2009minutes. These videos were analyzed for nurse bee feeding bouts and cell inspections (as defined in Experiment 1). We measured the following parameters for each larva: time to first feeding, time to first inspection, total number of feeding bouts, total number of inspections, duration of each feeding bout and total time fed.87. Total number of feeding bouts and total number of inspections were analyzed by Chi-squared test87. Mean feeding bout duration was analyzed by Mann-Whitney U test and total feeding time was analyzed by ANOVA87. We performed all statistical analyses using SPSS Statistics (2008) 16.0.Time to first feeding bout and time to first inspection were log-transformed and analyzed by ANOVA2 area (target area) on one side of an empty, drawn-out frame, using a push-in cage as described above (Experiment 2) and allowed her to lay eggs for approximately 12\u2009hours. After 12\u2009hours, we removed the queen from the target area and caged her on another frame to prevent further egg laying in the target area.Six healthy colonies each with approximately 40,000 bees, each housed in their own standard, two-story Langstroth hives, were used for this experiment. We confined the queen of each colony in a 340\u2009cm87 using SPSS Statistics (2008) 16.0. As there was no significant difference between replicates, we pooled the data from all replicates within a treatment group for analysis.The eggs were allowed to hatch naturally in the colony and when the larvae in the target area were one day old, we applied two push-in cages to the target area to create a section of larvae that had been deprived for 4\u2009hours as described above (Experiment 2). Twelve hours after removal of the push-in cages, we moved the frames  from each of the six experimental colonies into six unrelated colonies experiencing natural, emergency queen rearing conditions (made queenless and broodless 24\u2009hours earlier). We then counted the number of queens reared to pupation from the deprived and non-deprived areas of larvae in each colony and compared them by Chi-squared test87 using SPSS Statistics (2008) 16.0. As there was no significant difference between replicates, we pooled the data from all replicates within a treatment group for analysis.For the artificial grafting portion of the experiment, we transferred the deprived and non-deprived larvae obtained from six experimental colonies as described above (Experiment 3 a) to commercially available, vertically-oriented, plastic queen cups  that were fitted to slotted bars positioned horizontally in a foundation-less, comb-less frame. For each of six experimental colonies, we grafted twelve deprived and twelve non-deprived larvae into the plastic queen cups of one grafting frame and then placed the grafting frames in six different unrelated, queenless and broodless colonies as described above (Experiment 3 a). Cups containing deprived and non-deprived larvae alternated along each grafting bar of a grafting frame. We counted the number of queens that were reared to pupation and analyzed these data by Chi-squared test2 area (target area) on one side of a split frame using a push-in cage, and allowed her to lay eggs for approximately 12\u2009hours. After 12\u2009hours, we removed the queen from the target area and caged her on another frame to prevent additional egg laying in the target area.Six five-frame nucleus colonies, each containing a queen, approximately 5,000 adult bees, one pollen frame, one honey frame and three empty drawn frames (including one split frame) were established. A split frame is a whole frame, cut vertically down the middle, then rejoined with screws at the top and bottom bars for easy disassembly  16.0. As there was no significant difference between replicates, we pooled the data from all replicates within a treatment group for analysis.We grouped the six colonies into three pairs of two. When the eggs hatched and larvae were 24\u2009hours old, we removed the split frames from each pair of colonies and placed them in a two-story foster colony (one foster colony for each pair of split frames). This enabled the larvae in the split frames to acquire the odor of the foster colonies. To stimulate queen rearing conditions, we also removed the queens from all experimental nucleus colonies at this time. After 12\u2009hours in the foster colonies, half of the split frame from a given nucleus colony was joined with half of the split frame from its paired colony and vice versa. After swapping respective halves like this, we placed the new combinations of split frames back in the paired, now queenless, colonies , so that adult bees did not have access to the larvae (deprived larvae). We covered the other half of the target area on that half of the split-frame with a push-in 13\u2009mm hardware cloth cage (approx. 78\u2009cm2 area) that gave nurse bees free access to larvae (non-deprived larvae)  16.0. As there was no significant difference between replicates, we pooled the data from all replicates within a treatment group for analysis.To test the effects of relatedness and nutritional status on larval selection for queen rearing in colonies headed by open mated queens, we established twelve five-frame nucleus colonies. We confined the queens in each of these colonies on split frames for 12\u2009hours as described above (Experiment 4). When the larvae were 24\u2009hours old, we covered half the brood in the target area on one half of a given split frame with a push-in 3\u2009mm hardware cloth cage  16.0. As there was no significant difference between replicates, we pooled the data from all replicates within a treatment group for analysis.To test the effects of relatedness and nutritional status on larval selection for queen rearing in colonies headed by single drone inseminated super-sister queens, we followed similar methods as described above (Experiment 5 a). However, the queens used in this experiment were super-sisters  that were each inseminated with semen from a different single drone; whereas the queens used in the previous experiment were open mated. The super-sister queens for this experiment were obtained from Glenn Apiaries, CA. We established these experimental super-sister queen colonies two months before the initiation of the experiment to make sure that the worker bee population at the initiation of the experiment were progeny of the sister-queens. Chi-squared testAll data generated or analyzed during this study are included in this published article (and its Supplementary Information files).Supplementary Information"}
+{"text": "Neutron diffraction shows large site disorder in the honeycomb layer and X-ray absorption spectroscopy indicates a valence state of Os (4.7 \u00b1 0.2), consistent with the nominal concentration. We observe a transport band gap of \u0394\u2009=\u2009243 \u00b1 23 meV, a large van Vleck susceptibility, and an effective moment of 0.85 \u03bcB, much lower than expected from 70% Os(+5). No evidence of long range order is found above 0.10 K but a spin glass-like peak in ac-susceptibility is observed at 0.5 K. The specific heat displays an impurity spin contribution in addition to a power law \u221dT(0.63\u00b10.06). Applied density functional theory (DFT) leads to a reduced moment, suggesting incipient itineracy of the valence electrons, and finding evidence that Li over stoichiometry leads to Os(4+)\u2212Os(5+) mixed valence. This local picture is discussed in light of the site disorder and a possible underlying quantum spin liquid state.Compounds with honeycomb structures occupied by strong spin orbit coupled (SOC) moments are considered to be candidate Kitaev quantum spin liquids. Here we present the first example of Os on a honeycomb structure, Li Whereas magnetic honeycomb-containing compounds have been extensively investigated in 3d and 4d metal oxides11, the strong interaction anisotropy required by Kitaev\u2019s theory has placed a focus on 5d metal oxides, for which strong spin-orbit coupling (SOC), the origin of spatial anisotropy, can be expected18. In the A2MO3 honeycomb structure, where A is an alkali element and M a 4d or 5d element, the AM2 layers form a hexagonal network of edge sharing MO6 octahedra with a single A+ ion at the centers of the hexagons  model incorporating S\u2009=\u2009mentclass2pt{minim2IrO3 and 2IrO3 with effective spin Jeff\u2009=\u20092IrO3 and Li2IrO3 respectively20. The 3D hyper-honeycomb lattice compound 2IrO3, however, demonstrates a ferromagnetic (FM) Weiss temperature of 40\u2009K and weak ordering signatures at 38\u2009K among Jeff\u2009=\u200921. Among non-oxide materials, the layered compound 3 has also been discussed as a possible Kitaev system, though it too undergoes long range order at 7.5\u2009K22. Since the suppression of classical order via geometrical frustration is a requirement for creating a QSL state, the above systems, while possessing important attributes, fall short of the Kitaev criteria23. Due to the ordering seen in other honeycomb compounds and because the specific materials conditions required to produce a QSL are ill-defined at present, it is important to study other honeycomb-containing compounds with sizable SOC.Examples such as reducing the SOC from that of 540\u2009meV in Ir to 480\u2009meV in Os24. In the present work we report on the synthesis, structure, and properties of Li2.15(3)Os0.85(3)O3 which is isostructural to the Ir honeycomb compounds mentioned above. For the stoichiometric compound, Li2OsO3, the Os ion is expected to be in the 4+\u2009=\u2009d4, Jeff\u2009=\u20090 state to maintain charge-neutrality. In our work, we find, in contrast to other honeycomb systems, a lack of long range order above 0.1\u2009K. While this might be due to a frustrated lattice, it also might be due to site disorder among the Os ions. For each crystallographic site representing the LiOs2 layer, an average of 43% of the sites (compared to the expected 33 3.5), a value consistent with our X-ray absorption spectroscopy (XAS) measurements, which yield +4.7 4 (Jeff\u2009=\u20090) and 70% d5  are C2/m, C2/c, and Rm32. Supplemental Figure\u00a02MO3C2/m, C2/c, and Rm unit cells illustrated down the b-axis (top) and corresponding portion of the Li-M layer representing a (bottom) with lithium and metal occupying their ideal Wyckoff positions32. For all three space groups, edge sharing octahedral LiM2 layers alternate with edge sharing octahedral Li layers. The difference in space groups and their associated symmetries can in part be ascribed to stacking of the LiM2 layers, with Rm as the highest in symmetry. The space group assignments of some Li2MO3 systems has been controversial. For example, Li2MnO3 was first refined to be C2/c, but later found to be C2/m on the basis of electron diffraction and transmission electron microscopy27.Common space groups assigned to honeycomb-structure compounds Li2MoO3, which was reported as both C2/c and Rm28. When comparing literature on polycrystalline Li2IrO3 synthesized under standard solid state conditions, discrepancies in C2/c and C2/m space groups exist. Recent work supports the higher symmetry C2/m as the appropriate space group for polycrystalline Li2IrO332. The powder X-ray diffraction pattern of Li2OsO3 is shown in Fig.\u00a0Another example is LiRm, however, close examination of the pattern showed weak and broad diffraction peaks in the 2C2/m and C2/c systems, with no Li-M site exchange within the LiM2 layers, sharp peaks exist within the 19\u00b0 to 33\u00b0 range. However, introducing Li-M site exchange within the LiM2 layers decreases the relative intensities of these peaks, leading to virtually no peak presence at 3030. Such a reduction in diffraction peak intensity is also found for (hk0) reflections past 38\u00b0\u200930. Disorder among Li-M sites is commonly reported for honeycomb layered metal oxides since all corresponding crystallographic sites are octahedral and similar in size28. The presence of stacking faults associated with a shift between successive LiM2 layers will cause the peaks in the region from 19\u00b0 to 33\u00b0 to further broaden asymmetrically30. Thus, with the existence of Li-M site disorder and stacking faults, it is difficult to distinguish between the corresponding space groups using powder X-ray diffraction. The x-ray scattering length for lithium and oxygen are also small due to their low Z. Because of the neutron scattering lengths of lithium, osmium, and oxygen, neutron diffraction is ideal to characterize the Li2OsO3 structure.At first glance, the X-ray pattern pointed to a more symmetric space group, 34. The current synthesis procedure restricted diffraction measurements to the Oak Ridge NOMAD TOF Neutron beamline, which is well-suited for small sample sizes. A pseudo-Voigt peak shape profile was chosen and parameters refined to obtain the best fit to the collected data. The space group was refined to be C2/c, with lattice dimensions a\u2009=\u20095.09 \u00c5, b\u2009=\u20098.81 \u00c5, c\u2009=\u20099.83 \u00c5, and \u03b2\u2009=\u200999.3\u00b0. Rietveld refinements for all collected banks are shown in Supplemental Figure\u00a0wRp\u2009=\u20096.40 %. The atomic coordinates, occupancies, and isotropic displacement parameters are represented in Table\u00a0To determine the crystal structure, Rietveld refinements were performed on room temperature neutron diffraction data using the GSAS program Fig.\u00a033,34. ThC2/c there are three unique atomic positions to describe the Li and Os sites within the LiOs2 layer , with Os4 and Os5 sites describing the honeycomb rings. As shown from Table\u00a02 layer. For each of the three respective crystallographic sites, an average of 432.15(3)Os0.85(3)O3 suggesting an average osmium oxidation state of 4.5 4 through sublimation.Interatomic distances and angles are given in Supplemental Table\u00a035 and the description of the model and analogous XRD patterns are discussed in the SI section. From the discussion presented, the absence of the (020) peak can only be attributed to Li-Os site disorder within the LiOs2 layers and not from stacking faults, consistent with the neutron refinement. As shown in Fig.\u00a0Stacking faults were modeled using the DIFFaX program of the 00 peak caL2,3 absorption edges , provides a measure of the relevance of SOC interactions in the 5d band37. In the absence of sizable SOC interactions, the isotropic branching ratio equals 2 reflecting the different occupancies of the core levels at L3 and L2 edges. We measured BR\u2009=\u20092.9(1) which significantly differs from the statistical value of 2 and indicates that SOC interactions need to be included in order to describe the 5d electronic structure of this compound.The ratio of Eg) for the sample was extracted using Eg/2kBT) with Eg\u2009=\u2009220\u2009meV and 266\u2009meV obtained from low- and high-temperature transport measurements respectively, thus indicating a small band gap insulator  produces the straightest 1/\u03c7(T), resulting in a good fit to the Curie-Weiss form, \u03c7\u2009=\u2009C/(T \u2212 \u03b8), where C is the Curie constant and, The magnetic susceptibility, \u03b8\u2009=\u2009\u221211.5\u2009K and a finite effective moment eff\u2009=\u20090.85 Jeff\u2009=\u20090 state of Os(+4). Given the above XAS and neutron scattering refinement results showing that the average Os valence is 4.7, however, an alternate ionic scenario is for 70Jeff\u2009=\u2009Jeff\u2009=\u20090). This analysis yields \u03b8\u2009=\u2009\u221211.8\u2009K) for the magnetic (+5) ions, which is now significantly less than the expected moment.Fitting the data between 50 and 200\u2009K yields a Weiss constant of \u03c7dc data were augmented with ac-susceptibility (\u03c7ac) data down to 0.1\u2009K, which were calibrated to the \u03c7dc data in the overlapping temperature range 2.0\u20132.5\u2009K. A peak in \u03c7ac is observed at 0.5\u2009K, but is rapidly suppressed by magnetic fields far less than 0.1\u2009T. Given the usual relationship between H and T for a g-factor of two, one expects suppression of an antiferromagnetic ordering feature at 0.5\u2009K for H values an order of magnitude larger than observed. Alternatively, such a cusp in \u03c7ac can be attributed to spin glass freezing, a scenario consistent with the high degree of disorder in this spin system. The spins involved in such freezing may not represent the bulk of the Os(+5) spin population, as we argue below.We discuss possible sources of this discrepancy below. These BT for T\u2009=\u20090.5\u2009K, as suggested by the \u03c7ac peak, is also supported by C, shown in Fig.\u00a0C/T exhibits an upturn below its minimum at T\u2009=\u20096\u2009K. This upturn is only moderately affected by fields up to 8\u2009T, so we model this as C\u2009=\u2009C1(T)\u2009+\u2009C2. Here C1 is a combination of the lattice specific heat and an H-independent electronic contribution. Taking the difference between C(H\u2009=\u20098\u2009T) and C(H\u2009=\u20090), we find that C2 resembles a broadened Schottky anomaly  term, which is calculated using the two different Schottky approximations mentioned above and plotted in the lower inset of Fig.\u00a0C1(T) T\u03b1, where \u03b1\u2009=\u20090.69 and 0.57 for the Jeff\u2009=\u2009The existence of a small subset of spins that are interacting at a mean field energy scale of kt2g subshell Jeff\u2009=\u2009\u03be, all lie in the 0.5\u20131.5 eV range, and studies of the electronic structure and especially the exchange coupling have concluded that the ionic picture provides a challenging starting point at best. The electronic structure of octahedral osmates is complicated by several features. First, the active t2g orbitals are strongly hybridized with the oxygen 2p orbitals, resulting in strongly coupled Os 5d\u2009\u2212\u2009O 2p states as the fundamental chemical unit. Osmates in the Ba2NaOsO6 family, for example, have half of the spin density residing on the O octahedron39. Iridates behave similarly, leading to their characterization as molecular orbital compounds, which can lead to longer range exchange coupling parameters compared to more localized moments40. Second, SOC also affects the electronic structure, creating both single-ion as well as exchange anisotropy, the relative effects of which are difficult to disentangle. Third, the distortion from ideal rhombohedral symmetry introduces new lower symmetry Fourier components of the potential that causes band anti-crossings. These in turn result in very narrow, 0.3 eV, individual bandwidths and the likelihood of small gaps, as shown below.Early model treatments of 5d oxides on honeycomb lattices built on the ionic description of crystal field splitting, additionally with strong SOC among orbitals, focused attention on the 46. Many of the general findings for iridates carry over to osmates. Our compound presents the additional complication of Os possessing a nominal valence of\u2009+4.7, so one must consider a mixture of d3 with d4 ions. The ionic picture of d4 begins with a non-magnetic Jeff\u2009=\u20090 ion and for d3 the ionic value is Jeff\u2009=\u2009Several theoretical studies of honeycomb iridates have concluded that magnetic interactions beyond the Heisenberg-Kitaev model are important, suggesting a more itinerant picture of the electronic structure2OsO3 (see Methods for the description)52. Without magnetism, SOC is strong enough to provide a pseudogap but no gap, within the Os t2g bands. This SOC-driven separation is compromised by crystal subfield splittings, bandwidth effects, and anti-crossings arising from structural distortion away from rhombohedral symmetry leaving two inequivalent Os sites. The resulting band structure (not shown) is that of a very narrow, essentially zero (indirect) gap semiconductor. Due to the molecular orbital nature of the t2g band complex, intra-atomic repulsion effects as treated by the Hubbard U repulsion are ineffective in opening a gap, for reasonable values of U (2\u2009eV or less). Antiferromagnetic order tends to encourage gap opening, producing Os moments of 0.3 In an effort to reconcile the valence state measurements with the magneto-thermal measurements, we have applied density functional theory (DFT) methods including SOC, correlation effects, and a fixed atomic spin moment method in our study of Liabinit code47. This method proceeds not by specifying a value for U for the Os 5d orbitals, but by fixing the spin moment by applying an intra-atomic Zeeman field determined self-consistently; both magnitude and direction can be specified separately for any atom. Magnitudes of 0.8 2. 15Os0.85O3.To include in the modeling the effect of the observed Os moment, we have adopted the constrained atomic moment method as implemented in the 2OsO3.Due to intermixing of Li on the Os honeycomb lattice, we have made an initial study of the effect of intermixing, by replacing 252(Li1/4Os3/4)O3 structure should average to 5+. The periodicity leaves Os[0]-Os[1] chains and comparatively isolated Os[2] ions, which in addition to two Li neighbors the Os neighbor is at a long Os-Os separation. The spectral distribution of Os[2] in Fig.\u00a0We now focus on the effect of Li substitution on the remaining Os ions. This 25This modeling illustrates that the Os valence is sensitive not only to the total charge available, but also to the local environment. Different valence states carry different moments, and sensitivity to the local environment suggests that variation of exchange constants promotes a frustration of magnetic order. Note in Fig.\u00a02.15(3)Os0.85(3)O3, and have characterized it with atomic, structural, and magneto-thermal probes. The Os ions have an average valence state of\u2009+4.7 and large site disorder exists in the honeycomb layers. This compound is a narrow band gap semiconductor. The magnetic susceptibility and specific heat present a picture in which the effective Os moment is reduced to a value well below that expected from the valence-state measurements, which suggests that the valence electrons are on the verge of itineracy, a conclusion supported by our density functional theory calculations. These results strongly suggest that spin orbit coupling of Os is playing an important role in the collective electronic behavior of this honeycomb system, and that further studies of osmates on frustrating lattices are warranted.We have presented the first example of Os on a honeycomb structure, Li2CO3 and OsO2  were intimately ground, pressed into a pellet, loaded into an alumina crucible, and fired in a tube furnace at 700\u2009C under Argon flow. Firing was repeated to 850\u2009C with 50\u2009C increments, grinding the sample before each firing. Each firing was performed under argon flow. Phase analysis of the powder samples was performed by X-ray diffraction using a Rigaku MiniFlex II diffractometer with Cu K4+O2 and Sr2FeOs5+O653.Stoichiometric amounts of LiT), (200\u2009K\u2013350\u2009K) and specific heat, C(T), data (2\u2009K\u201330\u2009K) were obtained using a Quantum Design PPMS. Magnetic ac-susceptibility data down to 0.1\u2009K were obtained in a 3He-4He dilution refrigerator with thermal contact to the mixing chamber made via a copper wire bundle bonded to the sample with Stycast 1266 epoxy. Data were obtained at 143\u2009Hz and with an excitation current low enough to eliminate heating from the coils.The Seebeck coefficient and electrical conductivity data (350\u2009K\u2013600\u2009K) were collected on an ULVAC ZEM-3 under a helium atmosphere. Magnetization measurements (2\u2009K\u2013300\u2009K) were obtained with a Quantum Design MPMS. Resistivity, 48 to perform electronic calculations, with the generalized gradient approximation (GGA)49 for the semilocal exchange-correlation functional and the projector augmented wave method (PAW)50 for core electrons. A Hubbard U repulsive interaction was applied with magnitude as indicated, Hund\u2019s JH\u2009=\u20090.4\u2009eV was applied, on the Os 5d orbitals51. A mesh of 9\u2009\u00d7\u20095\u2009\u00d7\u20099 was used for k-sampling and 500\u2009eV for energy cutoff. The constrained atomic spin moment on Os method52 was used in some calculations to fix moments at or near the observed value. Constraints are managed by the use of Lagrangian multipliers, imposed with constraint parameters; the input parameter \u03bb\u2009=\u20091.0 was used48.We use the open-source package ABINITSupplementary Information"}
+{"text": "We previously showed that nucleotide-binding oligomerization domain-like receptor family pyrin domain-containing 3 (NLRP3) inflammasomes, which regulate caspase-1-dependent interleukin (IL)-1\u03b2 release, mediate the sterile cardiovascular inflammation. Because the Na+/K+\u2013ATPase is involved in inflammatory responses, we investigated the role of NLRP3 inflammasomes in the pathophysiology of cardiac glycoside-induced cardiac inflammation and dysfunction. The cardiac glycoside ouabain induced cardiac dysfunction and injury in wild-type mice primed with a low dose of lipopolysaccharide (LPS), although no cardiac dysfunction was observed in mice treated with either ouabain or LPS alone. Ouabain also induced cardiac inflammatory responses, such as macrophage infiltration and IL-1\u03b2 release, when mice were primed with LPS. These cardiac manifestations were all significantly attenuated in mice deficient in IL-1\u03b2. Furthermore, deficiency of NLRP3 inflammasome components, NLRP3 and caspase-1, also attenuated ouabain-induced cardiac dysfunction and inflammation. In vitro experiments revealed that ouabain induced NLRP3 inflammasome activation as well as subsequent IL-1\u03b2 release from macrophages, and this activation was mediated by K+ efflux. Our findings demonstrate that cardiac glycosides promote cardiac inflammation and dysfunction through NLRP3 inflammasomes and provide new insights into the mechanisms underlying the adverse effects of cardiac glycosides.Cardiac glycosides such as digoxin are Na Cardiac glycosides also evoke vagal activation, resulting in a shift in autonomic balance toward parasympathetic predominance and a negative chronotropic effect. Recent investigations have suggested that in addition to its iron-pumping function, the Na+/K+-ATPase serves as a scaffold protein that interacts with neighboring proteins and potentiates multiple signaling pathways, leading to the activation of transcriptional factors, such as nuclear factor (NF)-\u03baB and activator protein-1. These effects suggest that the Na+/K+-ATPase modulates inflammatory responses [+/K+-ATPase and inflammation is not fully understood.Cardiac glycosides such as digoxin are widely used for the treatment of chronic heart failure and cardiac arrhythmias because of their positive inotropic and negative chronotropic effects ; howeverexchange . This inesponses \u20137, but a+ efflux is a key upstream event in the activation of NLRP3 inflammasomes [+/K+-ATPase modulates intracellular K+ concentrations [+ efflux and the subsequent activation of NLRP3 inflammasomes in macrophages. The findings of this study demonstrate a novel role of NLRP3 inflammasomes in the heart and provide new insights into the mechanisms underlying the adverse effects of cardiac glycosides.Recent evidence indicates that some types of sterile inflammation are mediated by nucleotide-binding oligomerization domain-like receptor family pyrin domain-containing 3 (NLRP3) inflammasomes, which are intracellular, multiprotein complexes that regulate the release of the proinflammatory cytokine interleukin (IL)-1\u03b2 , 9. NLRPmmasomes , 13. Bectrations , we hypo\u2212/\u2212, NLRP3\u2212/\u2212, and Casp1\u2212/\u2212 mice (C57BL/6J genetic background) were kindly provided by Dr. Yoichiro Iwakura , Dr. Hiroko Tsutui , and Dr. Vishava M. Dixit , respectively [in vivo and in vitro experiments . All efforts were made to minimize animal discomfort and suffering.All experiments in this study were approved by the Use and Care of Experimental Animals Committee of the Jichi Medical University Guide for Laboratory Animals (permit number 15082) and were conducted in accordance with the Jichi Medical University guidelines. IL-1\u03b2ectively \u201319. WildTransthoracic echocardiography was performed using a digital ultrasound system  with a 30-MHz probe, as previously described . In brieThe levels of CPK and IL-1\u03b2 were assessed using the chemical analyzer Fuji-dry-chem  and mouse enzyme-linked immunosorbent assay , respectively, according to the manufacturer\u2019s instructions.+ and CD68+ cells was counted in 10 randomly chosen fields at a magnification of 200\u00d7 for each sample.Hearts were embedded in Tissue-Tek O.C.T. compound , and were cut into 4-\u03bcm-thick sections, and fixed with Mildform 10N . The sections were stained with hematoxylin and eosin. Immunohistochemical analysis was performed to detect the pan-leukocyte marker CD45 (BD Bioscience) and the macrophage marker CD68 (Santa Cruz Biotechnology), as previously described . The staIl1b, 5\u2032-TGAAGTTGACGGACCCCAAA-3\u2032 and 5\u2032-TGATGTGCTGCTGTGAGATT-3\u2032; Nlrp3, 5\u2032-CGAGACCTCTGGGAAAAAGCT-3\u2032 and 5\u2032-GCATACCATAGAGGAATGTGATGTACA-3\u2032; and Gapdh, 5\u2032-TGTGTCCGTCGTGGATCTGA-3\u2032 and 5\u2032-TTGCTGTTGAAGTCGCAGGAG-3\u2032. Gene expression was normalized to Gapdh expression using the software provided with the system.Total RNA was prepared from the heart tissues using ISOGEN , according to the manufacturer\u2019s instructions. Real-time RT-PCR analysis was performed using the Takara TP960 PCR Thermal Cycler Dice Detection System  for the measurements of mRNA expression. The primers were as follows: The processing of pro-IL-1\u03b2 into its mature form was analyzed by western blotting as previously described . PrimaryCytotoxicity was determined by measurements of lactate dehydrogenase (LDH) activity using cytotoxicity detection kit .Murine J774 macrophages were obtained from the RIKEN Gene Bank  and cultured in Dulbecco\u2019s modified Eagle\u2019s medium  supplemented with 10% fetal calf serum. Murine peritoneal macrophages were isolated from mice using the thioglycollate elicitation method and then resuspended in RPMI 1640. Z-Tyr-Val-Ala-Asp-fluoromethylketone (YVAD-FMK) was obtained from MBL . All reagents were obtained from Sigma unless otherwise specified.+ concentrations were measured by a polarized Zeeman atomic absorption spectrophotometer .After priming with LPS (100 ng/mL) for 16 h, murine J774 cells were treated with either ouabain (100 \u03bcM) for 3 h or nigericin (2.5 \u03bcM) for 4 h. The cells were washed with saline and lysed in 10% nitric acid. Intracellular Kt-test was used to compare two groups. For comparisons between multiple groups, the significance of differences in between-group means was determined by a one-way analysis of variance followed by the Tukey\u2013Kramer test. All analyses were performed using SPSS software, version 21 . A P-value less than 0.05 was considered statistically significant.Data were expressed as the mean \u00b1 standard error of the mean (SEM). An unpaired \u2212/\u2212 mice and found that cardiac dysfunction and increased CPK levels in response to ouabain were almost completely prevented in IL-1\u03b2\u2212/\u2212 mice  or the potassium channel blocker, glibenclamide (10\u201350 \u03bcM) and showed that the inhibition of K+ efflux significantly prevented ouabain-induced IL-1\u03b2 release  ouabain induces cardiac dysfunction and injury in WT mice primed with a low dose of LPS; (2) ouabain induces cardiac inflammatory responses, such as macrophage infiltration and IL-1\u03b2 release; 3) the aforementioned cardiac manifestations are all significantly attenuated in mice deficient in NLRP3 inflammasome-related molecules, such as NLRP3, Casp1, and IL-1\u03b2; 4) ouabain induces NLRP3 inflammasome activation and subsequent IL-1\u03b2 release in macrophages primed with a low dose of LPS; and (5) ouabain-induced activation of NLRP3 inflammasomes is mediated through K the afor ouabain +/K+-ATPase is a conserved transmembrane protein that maintains the electrochemical gradient using ATP as its energy source; it also functions as a receptor for cardiac glycosides, such as digoxin and ouabain [+/K+-ATPase and have been used in patients with heart failure for more than 200 years. Although digoxin is still widely used to treat heart failure and AF, recent epidemiological studies suggested that digoxin therapy is associated with an increased risk of mortality [+/K+-ATPase in inflammation remains controversial. In the present study, we clearly demonstrate that ouabain induces cardiac inflammation and dysfunction in mice primed with a low dose of LPS, and that these cardiac manifestations are clearly attenuated by deficiency in NLRP3, Casp1, and IL-1\u03b2. With respect to the relationship between cardiac glycosides and inflammatory responses in the heart, Zhang et al. [+/K+-ATPase activates Ca2+-dependent mammalian target of rapamycin signaling and subsequently promotes cardiac tumor necrosis factor-\u03b1 expression in mice treated with LPS. At present, however, no information is available on the role of NLRP3 inflammasomes in ouabain-induced cardiac inflammation. To our knowledge, this study provides the first evidence that NLRP3 inflammasomes contribute to the process of cardiac glycoside-mediated cardiac inflammation.The Na ouabain , 6, 7. Cortality , 4. Howeg et al.  recentlyIn the present study, we showed that macrophages are the predominant effector cells that activate NLRP3 inflammasomes and produce IL-1\u03b2 in the heart; this is based on the following findings. First, deficiency in NLRP3 inflammasomes and IL-1\u03b2 significantly inhibits the infiltration of macrophages into the heart. Second, NLRP3 inflammasomes are mainly expressed in cells of a myeloid lineage, such as macrophages and dendritic cells , 9. Thir+ efflux in macrophages, which mediates the activation of NLRP3 inflammasomes. This finding is understandable because inhibition of the Na+/K+-ATPase induces intracellular K+ depletion. Indeed, we observed that ouabain treatment significantly decreases intracellular K+ concentrations in macrophages. In addition to K+ efflux, however, several common pathways upstream of NLRP3 inflammasome activation have been identified, including those involving lysosomal destabilization and mitochondrial reactive oxygen species (ROS). Of these, Liu et al. [Another issue to be noted is that the mechanisms underlying cardiac glycoside-induced activation of NLRP3 inflammasomes. We clearly show that ouabain induces Ku et al.  reported+/K+-ATPase by ouabain induces cardiac inflammation and dysfunction via NLRP3 inflammasome-driven IL-1\u03b2 release. Because cardiac glycosides including ouabain and digoxin inhibit Na+/K+\u2013ATPase and lead to leads to K+ efflux, which is the common trigger of NLRP3 inflammasome activation [In summary, we demonstrate that the inhibition of the Nativation , 9, we aS1 Fig(PDF)Click here for additional data file.S2 Fig(PDF)Click here for additional data file."}
+{"text": "Compared with the BPNN model, GRNN model to powder samples could be considered very successful for quality control of wheat flour with a correlation coefficient of prediction (rp) of 0.85 and root mean square error of prediction of 0.10%. The results suggest that THz technique association with GRNN has a significant potential to quantitatively analyse BA additive in wheat flour.Investigations were initiated to develop terahertz (THz) techniques associated with machine learning methods of generalized regression neural network (GRNN) and back-propagation neural network (BPNN) to rapidly measure benzoic acid (BA) content in wheat flour. The absorption coefficient exhibited a maximum absorption peak at 1.94 THz, which generally increased with the content of BA additive. THz spectra were transformed into orthogonal principal component analysis (PCA) scores as the input vectors of GRNN and BPNN models. The best GRNN model was achieved with three PCA scores and  The United States Food and Drug Administration, however, considers BA approved for use as food additives safe for humans when consumed in small amounts. But the long-term consumption of wheat flour containing BA additive may cause the accumulation of BA in the liver, resulting in cumulative poisoning. In recent years, debate on the addition of BA to wheat flour has increased in China. Hence, it is necessary to develop a suitable and rapid method for product supervision and sampling inspection to determine BA in wheat flour.\u03c3, the width of radial basis functions. Because of its good performance, the GRNN has been extensively applied in rainfall-runoff modelling and in intermittent flow estimation [With the current method for analysis of food additives, BA is commonly measured accurately by gas chromatography (GC) or high-performance liquid chromatography (HPLC) . But thetimation \u201320. Thes2.2.1.The BA powder was purchased from Sigma-Aldrich Corporation and used without further purification. The wheat flour was purchased from a local supermarket and had been validated without BA powder by HPLC analysis. The BA powder samples were crushed into small particles that were sufficiently smaller than the THz wavelength to reduce baseline offsets at higher frequencies. These partials were mixed carefully with wheat flour at several different concentrations , and three replicates were prepared for each concentration. Then the mixture was compressed into pellets with the diameter of 13 mm under pressure of 10 MPa by use of tablet press. The mechanically determined pellet thickness ranged from 1 to 2 mm to provide a sufficient path length to eliminate the effect of the multiple reflections that occurred between the two surfaces of the pellet sample in the spectra. In addition, 10 real samples were collected from a local oil and food testing institution. These samples were made into tablets according to the same above procedures as the external testing ones.2.2.The absorption spectra were recorded with the TAS7500SU THz-TDS system working in transmission mode, provided by Advantest Corporation. The detail of this system can be found in the literature . The sys2.3.\u03b1) could be calculated with the below equations:c, \u03c9 and d, are the light speed in vacuum, the frequency and the sample's thickness, respectively. The \u03c1(\u03c9) and \u0424(\u03c9) represent, respectively, the amplitude ratio and phase difference between the reference and sample.A fast Fourier transform (FFT) was adopted to acquire the spectral distribution of the THz pulse in the frequency. The sample's absorption coefficient  is the prediction value of input x, yk is the activation weight for the pattern layer neuron at k, and K is the RBF as formulated above.Differing from BPNN, GRNN is a variation to radial basis neural networks and consists of four layers: input, pattern, summation and output layers \u201323. Tera3.3.1.The 160 samples were divided into training and validation datasets according to an approximate scale of 3 : 1. The BPNN or GRNN model is initially fit on the training dataset to fit the parameters e.g. weights of connections between neurons. The validation dataset follows the same probability distribution as the training dataset. The validation dataset provides an unbiased evaluation of a model fit on the training dataset while tuning hyper-parameters, e.g. the number of hidden units in a neural network. And the test dataset is used to provide an unbiased evaluation of the final BPNN or GRNN model fit on the training dataset. The external dataset was provided by a local grain and food testing institution. It was used as an independent dataset that has never been used in training. The distribution and statistical results of BA concentration values are shown in 3.2.r), root mean square error of prediction (RMSEP) and limit of detection (LOD). A better model should obtain higher r, and lower RMSEP and LOD values. According to this principle, further investigation should be executed to mine THz spectra for accuracy improvement. For Lambert\u2013Beer\u2019s law, only the fingerprint peak can give a better relationship equation using the pretreatment liquid sample. In this case, THz spectroscopy cannot obtain a high correlation coefficient because the sample is relatively complex and only fingerprint peak cannot give enough information. Therefore, it requires more variables as the input vectors to improve the performance of the models. The LOD with 99.86% confidence interval can be calculated from the fitting curve based on significant peaks in THz absorption coefficient in formula (3.1) [\u03c3 is the standard error of predicted concentration, and m is the slope of the fitting curve. In a fitting model, \u03c3 equals RMSEP.First Savitzky\u2013Golay derivative with window width of 9 and polynomial order of 2 combinations with smoothing average was adopted to remove the baseline shift and amplify absorption peak. The first derivative absorbance coefficients of mixture, wheat flour and BA samples in the 1.6\u20132.8 THz frequency region were shown in la (3.1) .3.1LOD=33.3.The number of input vectors will influence the architecture and performance of the GRNN model. Generally, the minimal architecture of GRNN makes it easy to obtain a better generalization of data relation. Principal component analysis (PCA) is a bilinear modelling method which gives an interpretable overview of the main information in a multidimensional data table. The information carried by the original variables is projected onto a smaller number of underlying variables called principal components. The first principal component covers as much of the variation in the data as possible. The second principal component is orthogonal to the first and covers as much of the remaining variation as possible, and so on. THz spectrum includes 200 spectral variables in a range of 1.6\u20132.8 THz, and some variables may contain irrelevant information for regression. Therefore, PCA was applied to transform original THz spectra into a new axis and obtain the PCA scores as new variables. The scores show the locations of the samples along each model component and can be used to detect sample patterns, groupings, similarities or differences. The score plots of first and second principal components were shown in The variance is computed as the mean square of deviations from the mean. It is equal to the square of the standard deviation. The PCA scores accounted for the greatest amount of variability and varied from 97.12% to 99.99% , which pnewgrnn in Matlab software. The number of input vectors and smooth factor (\u03c3) of RBF are two important parameters that influenced the performance of GRNN model. The principal component scores were chosen as the input vectors of GRNN model. The number of principal components varied from 1 to 10. The smooth factor behaves as a regularization parameter of RBF. When the smoothing parameter \u03c3 is made large, the estimated density is forced to be smooth and in the limit becomes a multivariate Gaussian with covariance \u03c32. On the other hand, a smaller value of \u03c3 allows the estimated density to assume non-Gaussian shapes, but with the hazard that wild points may have too great an effect on the estimate [spread in the range of 0.01\u20132, and the interval was 0.05. The training and validation datasets were used to create GRNN model and optimize the parameters; the results are shown in GRNN is a highly parallel radial basis network model generated by the function estimate . In this3.4.tansig and purelin functions, respectively. The training and performance functions were trainlm and mean square error (MSE), respectively. The goal error was set as 0.001. The time of training was set as 200. The early stopping is a default method to avoid BPNN networks overfitting. The available data have been divided into the training and validation sets. The former is used for computing the gradient and updating the network weights and biases. The latter is monitored during the training process. The validation error normally decreases during the initial phase of training, as does the training set error. However, when the network begins to overfit the data, the error on the validation set typically begins to rise. When the validation error increases for a specified number of iterations (net.trainParam.max_fail), the training is stopped, and the weights and biases at the minimum of the validation error are returned. The number of input vectors and hidden layers were optimized, and the results are shown in To compare with GRNN model, BPNN was developed with three layers of neurons . Each node in the input and hidden layers is connected to each of the nodes in the next layer with a weighting factor associated with it. These weights are modified using the back-propagation algorithm during the training process. The transfer functions of hidden and output layers were r) of 0.85 and RMSEP of 0.10%. The results are shown in The practical predictive abilities of the best GRNN and BPNN models were subsequently evaluated with an independent dataset, which was provided from a local oil and food test institution. Compared with the BPNN model, GRNN model obtained the highest predictive accuracy with a correlation coefficient of prediction  of 0.26. It could be seen from paired t-test results that the THz spectroscopy combined with GRNN method and reference methods did not show a significant difference for BA content.The paired 4.spread value of 0.20. Compared with BPNN model, GRNN model to powder samples could be considered very successful for quality control of wheat flour with rp of 0.85 and RMSEP of 0.10%. Moreover, BA powder exhibited a maximum absorption peak at 1.94 THz. These results suggest that THz technique in association with GRNN may have commercial and regulatory potential to avoid time-consuming work, and costly and laborious chemical analysis for BA additive in wheat flour.The overall results sufficiently demonstrate that BA concentration values in wheat flour could be determined by THz spectroscopy associated with machine learning method of GRNN. The number of input vectors and spread of RBF were optimized for improving the predictive abilities of GRNN model. And the best GRNN model was obtained with three PCA scores of input vectors and"}
+{"text": "To the Editor,In their recent work, Martin et al.We believe that this work provides a very useful tool for facilitating and automating some parts of the systematic review process, which are usually time-consuming. The proposed interface is clear, user-friendly, and easy to navigate; the authors make their data freely available for registered users, so that it can be re-used in future research.We believe that this work is of high importance, and we would like to ask for some clarifications and to provide some suggestions on how to improve the system.The authors employ a matrix factorization approach using a shared latent space to assess the relevance of trial registry entries for each systematic review. Matrix factorization is a well-established method used in recommender systems. However, it is not commonly used for automating the screening stage of systematic reviews; in the authors\u2019 previous work, it did not outperform the baseline approach (cosine similarity) in terms of work saved over sampling at 95% recall.,There are alternative approaches that can be more suitable for this task and could show better performance, including those using word embeddings . Of course the users do not know which of the data points are part of the gold standard dataset. This kind of quality control test could have been addressed by the authors.One common way of crowd-sourcing quality control is to inject some gold standard data points at random intervals in the dataset and to check that they have been properly processed by the users . A well-elaborated communication and dissemination plan could help tackle this issue.Another point to raise is the difficulty of recruiting contributors, as the authors state in their Limitations section. This is indeed a problem often undermining the development of crowd-sourcing based work, but there are successful crowd-sourcing projects in the biomedical domain, such as Cochrane Crowd , as well as the WHO portal which provides access to a few primary registries. Including only one registry apparently limits the included trials.Another questionable choice is including the trial registration entries from ClinicalTrials.gov only. There is a number of other trial registries (see eg, The obvious reason for using ClinicalTrials.gov is the fact that metadata of articles in PubMed can contain a direct link to it, while links to other registries are not included in the metadata. However, trial registration numbers are often cited in the abstract and follow a fixed pattern including the registry name and the unique registration ID, which can be easily found with the help of regular expressions and used to automatically find the registry entry on the webpage of the corresponding registry.We commend the authors for their work on developing an open source online system to facilitate updating of systematic reviews. With this letter, we would like to encourage further work on this promising initiative to improve the results.This project has received funding from the European Union's Horizon 2020 research and innovation programme under the Marie Sklodowska-Curie grant agreement No 676207.AK and COP contributed to the conception of this work and wrote the first version of the manuscript. PP supervised the project and contributed to the final version of the manuscript."}
+{"text": "Low-back pain (LBP) is one of the most burdensome health problems in the world. Guidelines recommend simple treatments such as advice that may result in suboptimal outcomes, particularly when applied to people with complex biopsychosocial barriers to recovery. Individualised physiotherapy has the potential of being more effective for people with LBP; however, there is limited evidence supporting this approach. A series of studies supporting the mechanisms underpinning and effectiveness of the Specific Treatment of Problems of the Spine (STOPS) approach to individualised physiotherapy have been published. The clinical and research implications of these findings are presented and discussed. Treatment based on the STOPS approach should also be considered as an approach to individualised physiotherapy in people with LBP. Low-back pain (LBP) is recognised as a common and costly problem in the Western world, with a global prevalence of 0.5 billion, the highest ranking cause of years lived with disability contributing 57\u00b76 million years , and an Syntheses of clinical guidelines suggest international consensus in recommending initial exclusion of red flags and radiculopathy, and subsequent management of LBP as a \u201cnon-specific\u201d condition on the basis that a nociceptive cause of symptoms cannot be identified ,8,9. GuiA potential reason for the limited effects demonstrated in RCTs on LBP is a false assumption that non-specific LBP is a homogeneous group. It has been postulated that multiple subgroups exist within the non-specific LBP population that are likely to respond differently to generic treatment . In suchThe argument for the importance of individualised treatment is further strengthened by considering the multi-dimensional nature of LBP. Clinical guidelines for LBP , the WorBased on the scale of the LBP problem, the limited data on treatment effectiveness, and the potential value of individualised treatment, the aim of this paper was to overview the evidence on individualised physiotherapy, including a contextualised presentation and discussion of a series of studies on the Specific Treatment of Problems of the Spine (STOPS) approach.A search on the evidence supporting individualised physiotherapy for LBP was conducted on PubMed using the Boolean term OR for individ*, subgroup*, classif* AND back pain AND \u201creview\u201d in the title. Reference lists of the retrieved papers, as well as recent clinical guidelines ,8,9, werIndividualising treatment for LBP has been identified as a high research priority by a series of international expert panels ,15 and aGiven the limited evidence supporting attempts to develop effective individualised physiotherapy approaches for LBP, exploration of alternative methods has merit.n = 300) published in 2016 that concluded individualised physiotherapy was more effective than guideline-based advice for early persistent LBP [The STOPS trial was a randomised controlled trial , management of inflammation in participants with a clinically determined inflammatory component to their pain, management of work issues, sleep strategies, relaxation and dealing with increases in pain (flare-ups). In participants failing to improve with a pathoanatomical approach initially, the trial physiotherapist determined whether transfer to the MFP treatment protocol was required. These treatment strategies were all applied in a manner individualised to the participant\u2019s presentation as determined by the trial physiotherapist.Based on the above-described research, the STOPS trial aimed to evaluate the effectiveness of individualised physiotherapy compared to guideline-based advice. Advice regarding prognosis and resuming normal activities is recommended in all clinical guidelines for people with LBP of over 6-weeks duration . Prior tOther recent subgrouping approaches based on risk stratification such as STarT Back  and physUsing the STOPS individualised physiotherapy protocol including manual therapy, directional preference management, postural re-education, motor control training, and graded functional exercise ,96,97,98Results  showed tDirect healthcare costs attributable to people with LBP in Western countries seeking healthcare is estimated at billions of dollars annually ,108 and Guideline-based advice is a low-cost treatment that is commonly prescribed by medical practitioners  and physThe STOPS trial showed that individualised physiotherapy was clinically more effective than guideline-based advice . Given tThe results showed that total health care costs were similar for both groups despite individualised physiotherapy being more expensive than guideline-based advice . This waTreatment effect modifier studies are helpful for determining characteristics of patients who respond best to a particular treatment relative to another in an RCT . The STOResearch into individualised physiotherapy is a high research priority that has, to date, yielded disappointing results in RCTs. The series of studies described in this paper support the development and validity of the STOPS subgrouping approach. In addition, three studies on the effectiveness, cost-effectiveness and treatment effect modifiers provide further support for the individualised treatment of LBP using the STOPS approach. We are unaware of any similar body of research on the utility of individualised physiotherapy based on a comprehensive biopsychosocial-based treatment model. There are a range of possible factors that may have contributed to the above-described results.in addition to between-group differences in mean scores [Most RCTs on LBP demonstrating statistically significant results show small effects of questionable clinical importance ,9. Howevn scores ,119,120.within-group improvements on all primary outcomes for both treatment groups [The STOPS trial did not demonstrate clinically important between-group mean differences based on the MCID. However, in accordance with our a priori statistical plan , a primat groups . Given tt groups ,5, it ist groups ,122.The clinical importance of the between-group differences as a measure of significance in the STOPS trial is further strengthened by the cost-effectiveness analysis. Results showed an incremental cost-effectiveness ratio (ICER) of US$422 per quality-adjusted life year (QALY), which compares favourably to other relevant RCTs in the field. Cognitive behavioural therapy is recommended in all clinical guidelines for LBP ,9, but hAnother potential indicator of clinical importance from RCTs is the proportion of participants who complete the intervention. High drop-out rates in clinical trials may indicate that the intervention is not acceptable to participants on the basis of ineffectiveness, patient preferences, the required commitment to comply with treatment, or side-effects. Drop-out rates exceeding 15% have been reported for multiple LBP trials of graded activity , anticonWhen designing and interpreting RCTs, it is important for the researcher and consumer to carefully consider the comparison group. Common trial designs in LBP use no treatment, placebo treatment, advice, usual medical care or various types of physiotherapy interventions. There is no right or wrong approach to designing a comparison group in an RCT; it simply informs the hypothesis being tested. For example, a RCT comparing manual therapy to placebo manual therapy is designed to test the specific effect of manual therapy independent of any non-specific effects such as patient expectations, learning/conditioning effects and neurophysiological effects .It is worth reflecting on the use of guideline-based advice in designing a RCT. Advice to stay active and reassurance regarding prognosis is recommended as first-line treatment in all clinical guidelines for acute and persistent LBP as described in A major difference between the STOPS trial and the majority of the LBP research was the incorporation of pathoanatomical factors into the subgrouping approach and pathoanatomical-based decision making in the clinical protocol. Definitive criteria for pathoanatomical-based diagnosis and/or clinical decision making in LBP are not available . It has One example of this approach is the STOPS protocol, where treatment was individualised based on the hypothesised presence or absence of an inflammatory component to the LBP. The lumbar intervertebral disc is a biologically plausible contributor to LBP . The mecFurther evidence on the presence of and potential importance of inflammatory processes in degenerative discs and DHR  can be sSignificant evidence suggests that inflammatory processes are a potential treatment target in clinical trials ,155,156,Although systematic reviews and guidelines suggest that NSAIDs are only a second-line treatment option for the management of LBP , the litMethods to maximise treatment fidelity in RCTs for physiotherapy interventions are highly variable and often poorly reported ,168,169.Motor control retraining focusing on posture, movement and muscle activation was a significant component of individualised physiotherapy for all participants apart from those in the multifactorial persistent pain (MFP) subgroup. The relevance and effectiveness of this approach is contentious  and therThe clinical implications of the research presented in this paper are potentially substantial but need to be contextualised within an evidence-based framework. In order to make strong recommendations to practitioners, the findings need to be replicated in independent samples and/or systematic reviews updated to incorporate the relevant data into meta-analyses. However, the significance and consistency of the results are sufficient to challenge some of the common perceptions around evidence-based practice for LBP.Guidelines routinely state that the vast majority of LBP patients should be considered as a non-specific condition where consideration of pathoanatomy is not possible or necessary ,9. Some There is sparse data supporting the effectiveness of simple guideline-based advice. It is of interest that the RCT with the largest effect sizes in favour of advice incorporated a pathoanatomical explanation . DespiteThe generalisability of the STOPS trial results should be superior to most recent RCTs on individualised physiotherapy, where only a few experienced practitioners were used  and/or dOn the basis of the STOPS trial, practitioners can provide their patients with an average timeframe for expected treatment outcomes when receiving individualised physiotherapy. Patients are likely to experience rapid reductions in back/leg pain in the first 10 weeks of treatment, but optimal improvements in activity limitation are likely to take longer. Patients will also be reassured regarding the cost-effectiveness of the treatment, particularly with regards to minimising time off work.The results of this series of studies should be highly impactful on future research. Much of the research in LBP develop study designs, eligibility criteria, prognostic factors or treatment protocols that are relatively simplistic in nature. Whilst this approach renders research projects more feasible and potentially more methodologically rigorous, it does not reflect the real-world complexity of LBP and the associated treatment options that are likely to be most effective.A pathoanatomical approach should be considered when planning future clinical research within the context of a truly biopsychosocial model for LBP.More research is required on the relative importance of different components of individualised physiotherapy. Individualised physiotherapy also needs to be compared to other comparison groups and on different populations, particularly persistent LBP where more entrenched psychosocial and neurophysiological barriers to recovery are likely to be relevant.Researchers should be encouraged by the clinical importance of the results in the STOPS trial and be emboldened to develop ambitious research hypotheses based on an in-depth understanding of both clinical and research perspectives.Greater rigour should be applied to the development of clinical guidelines to ensure that low-quality evidence such as the sparse data and questionable cost-effectiveness supporting simple advice is acknowledged.Researchers should follow the lead of the STOPS trial in providing detailed clinical protocols that are feely available in full-text. Such an approach would greatly accelerate the dissemination of evidence-based information to practitioners in the field and substantially improve external validity.LBP is the most burdensome health problem in the world. Prior to the publication of the studies in this body of research, there was limited evidence for the effectiveness of individualised physiotherapy and a focus in clinical guidelines on advice as first-line treatment for LBP. Our series of studies challenge the role of advice alone in early persistent pain and suggests that the concept of non-specific LBP needs to be reconsidered. Furthermore, there are now detailed clinical protocols and quality evidence to support the STOPS approach to individualised physiotherapy in clinical practice and future research studies."}
+{"text": "Human pluripotent stem cell (hPSC)-derived alveolar epithelial cells (AECs) provide new opportunities for understanding lung development and the treatment of pulmonary diseases. However, toxicity assessments using hPSC-AECs have not been undertaken. In this study, we generated functional AECs from hPSCs and evaluated their inflammatory and apoptotic responses to cadmium (Cd) exposure  for 24\u2009h compared with the human bronchial epithelial cell line (BEAS-2B) and primary AECs as controls. Our data showed that Cd (10 \u03bcM) treatment induced substantial inflammatory responses and apoptosis in BEAS-2B cells, but not in both hPSC-AECs and primary AECs. Interestingly, conditioned medium from AEC cultures significantly alleviated apoptotic and inflammatory responses to Cd exposure in BEAS-2B cells. Using cytokine arrays, several potential factors secreted from hPSC-AECs and primary AECs were detected and may be involved in reducing Cd-induced cytotoxicity. We also observed higher expression of surfactant proteins B and C in both hPSC-AECs and primary AECs, which may contribute to protection against Cd-induced cytotoxicity. These results suggested that hPSC-AECs phenotypically and functionally resemble primary AECs and could be more biologically relevant alternatives for evaluating the pathological contribution of confirmed or potential pulmotoxic materials included in smoking and microdust. Smoking is also widely accepted as a primary cause of diseases in the lung and other organs2. In vitro models using primary bronchial and alveolar epithelial cells (AECs) are the most appropriate cells for evaluating the cytotoxic effects of toxic components in microdust and smoking relevant to pulmonary diseases. However, primary cells derived from different donors can show distinct responses depending on genetic background, patient age, and the type of tissue source. In addition, the characteristics of primary cells may change due to multiple passages during in vitro cultivation4. Immortalized cell lines, such as normal bronchial epithelial (BEAS-2B) and lung adenocarcinoma (A549) cells, have been widely used instead of primary cells to evaluate the cytotoxicity of suspected harmful materials8. However, increasing evidence shows that BEAS-2B and A549 cells respond to toxins differently than primary cells, and their phenotypes and functions are altered by culture conditions9. Thus, use of biologically relevant sources to assess the harmful effects of environmental risk factors on the human respiratory tract is needed to understand how they contribute to pulmonary diseases.Microdust is an environmental risk factor for respiratory diseases as air pollution spreads worldwidein vitro predictive models for evaluating environmental toxins and for large-scale screening of novel drugs as well as cell therapies10. Although reports are limited, several differentiated cell types derived from hPSCs may be useful for such toxicity testing. Neural progenitor cells derived from hESCs have been used to study the neurotoxic effects of lead and gold nanoparticles on early brain development11. The toxic effects of short- and long-term drug  exposure have been investigated in hepatocytes and cardiomyocytes derived from hiPSCs and hESCs13. Two independent research groups have developed three-dimensional spheroids as in vitro models using mature hepatocytes or neuronal precursors derived from hPSCs, and have demonstrated their applications for drug toxicity testing15. More recently, hepatotoxicity against the herbal medicines has been evaluated using hESC-derived hepatocytes, which showed similar toxicity patterns to human primary cultured hepatocytes16. All these reports indicated that hPSC derivatives have the potential to be used in cytotoxicity evaluations of various harmful materials and drugs, and could be alternatives for the replacement of cell lines and primary cells.Human pluripotent stem cells (hPSCs), including human embryonic stem cells (hESCs) and induced PSCs (iPSCs), can potentially generate an unlimited number of somatic cells that offer 21. However, toxicity assessments using hPSC-AECs have not been undertaken. In this study, we presented the first investigation of cadmium (Cd) cytotoxicity in hiPSC-derived AECs and compared cellular responses, gene expressions, and secretomes using BEAS-2B cells and human primary AECs after Cd exposure.Recent studies reported the generation of functional AECs derived from hiPSCs and hESCs and their therapeutic applications for acute and chronic pulmonary diseasesTo assess cellular responses after Cd exposure in hiPSC-AECs, BEAS-2B cells, and primary AECs, we performed alveolar epithelial specification, commitment, and maturation from undifferentiated hiPSCs using a sequential differentiation protocol mimicking the process of embryonic pulmonary development Fig.\u00a0. Undiffe22. Thus, we compared the basal transcript levels of genes encoding proteins related to inflammation  and apoptosis (GADD45g and CEBP\u03b3) in BEAS-2B cells, hiPSC-AECs (day 14), and primary AECs. Overall, the basal transcript levels of genes assessed in hiPSC-AECs and primary cells were lower than those in BEAS-2B cells  for the greater toxic potency compared with insoluble Cd compounds such as Cd metal, Cd carbonate (CdCO3) and Cd selenide (CdSe). Dead cells floating on the medium and morphological changes from the typical epithelial shape to round cells were clearly observed after exposure to 10\u2009\u03bcM\u2009Cd in BEAS-2B cells, but not in hiPSC-derived cells and primary AECs  in a dose-dependent manner in BEAS-2B cells  in each cell type after Cd treatment. Similarly, transcript levels of these genes were not changed after Cd  exposure in hiPSC-derived cells and primary AECs, but significantly increased in BEAS-2B cells upon exposure to 10\u2009\u03bcM\u2009Cd  of Cd. SFTPB was strongly expressed in both hiPSC-AECs and primary AECs, but was very weakly expressed or not detected in BEAS-2B and human adult lung fibroblast cell (MRC5) lines  promise a wide range of applications in biomedical sciences as well as in electric engineering and industry. However, the adsorption of pulmonary surfactants on inhaled CNTs enhances recognition of the CNTs by alveolar macrophages, leading to increased inflammatory responses, oxidative stress, and fibrotic changes35. In addition, patients with ARDS that received intrabronchial SFTP treatment showed extensive alterations in biochemical properties of SFTPs and improvement of alveolar surface activity36. These findings support our speculation that SFTPs contribute to gene expression stability and protect cells from Cd in conjunction with surfactant lipids. Indeed, SFTPB was detected in both hiPSC-derived and primary AECs, but not in BEAS-2B cells, and may serve as the frontline defense system of AECs against Cd cytotoxicity.The lungs are vulnerable to pathogens and harmful substances due to their continuous exposure to environmental toxicants through inhalation. However, if the lung mechanisms sensitively counteracted every external stimulus, excessive inflammation and apoptosis could lead to damage and secondary pathology after these reactions occurred. Thus, the lungs appropriately adapt to the environment by maintaining homeostatic equilibrium, which is partially achieved by surfactants that are membrane-based lipid-protein complexes that effectively exchange air and serve as barriers against environmental insultsEDA gene resulted in frequent respiratory infections due to the absence of tracheal and bronchial glands. The administration of recombinant EDA achieved significant correction of the missing tracheal and bronchial glands37. Serpin G1 has anti-histone properties that protect against lung injury by histone-induced cell death38. Coagulation factor \u03a7III A has a positive effect on repairing organ injury in rats after trauma-hemorrhagic shock by reducing lung permeability, neutrophil sequestration, oxidative stress, and pro-inflammatory cytokines, as well as increasing anti-inflammatory cytokines such IL-1039. In addition, the IRF family contains various subtypes, of which IRF3 is associated with host defenses against viral infections. Specially, IRF3 contributes to the clearance of Pseudomonas aeruginosa from the lungs of mice40. All these previous findings suggested that potential defense mechanisms of these secreted factors contributed to the resistance of hPSC-AECs and primary AECs against Cd exposure.In the lungs, there are various protectors against toxins or inducers of repair as well as surfactant proteins. In this study, we showed that treatment with hiPSC-AEC-CM alleviated Cd-induced cytotoxicity in BEAS-2B cells, which might be mediated by paracrine effects. Cytokine arrays revealed that hiPSC-AEC-CM was abundant in cytokines and chemokines, among which EDA-A2, Serpin G1, coagulation factor \u03a7III A, and IRF6 levels were high. Genetic defects in the As air pollution increases, studies of lung pathologies induced by various toxicants are essential for preventing certain respiratory diseases by predicting the substance\u2019s cytotoxicity. In our study, we assessed the reliability of cytotoxicity testing in functional AECs derived from hiPSCs. Additionally, we showed the possibility that some of the secreted factors derived from hiPSC-AECs might be used as protection against toxins, or as inducers of lung repair. In the future, more detailed comparative studies of primary AECs and related cell lines should be performed to alleviate the toxicity of fine dusts and various heavy metals. Further comparisons of genetic and epigenetic changes in both hiPSC-derived and primary AECs due to toxic substance exposure may also enable the treatment of certain respiratory diseases and could aid in biomarker discovery.2.Human iPSCs (iPS-NT4-S1) were kindly provided by CHA University, Seoul, South Korea. The cells were maintained in mTeSR1 serum-free medium  on Matrigel -coated dishes. They were subcultured at 80% confluency and passaged every 5 days by mechanical dissociation. BEAS-2B cells were obtained from Seoul National University Hospital and were cultured in defined keratinocyte serum-free medium  supplemented with epidermal growth factor and 1 U penicillin/streptomycin. Primary AECs were purchased from ScienCell Research Laboratories and were cultured in alveolar epithelial cell medium  containing epithelial cell growth supplement and 10\u2009ml fetal bovine serum  on dishes coated with poly-L-lysine . All cells were incubated at 37\u2009\u00b0C in a humidified atmosphere with 5% CO17. Briefly, undifferentiated hiPSC colonies were prepared with low density of less than 5 colonies per well. When the colonies grew to approximately 1\u2009mm in diameter, AEC differentiation was initiated with exposure to sequential induction medium and was assessed by observing the localization and frequencies of AEC-specific markers on Day 14 post-initiation using immunostaining and flow cytometry. On day 15 of differentiation, AECs were washed with phosphate buffered saline (PBS) and replenished with serum-free induction medium for 24\u2009h prior to harvesting the media for further experiments. Conditioned medium (CM) was centrifuged at 1,500\u2009rpm for 4\u2009min to remove cell debris and filtered through a 0.22\u2009\u00b5m filter. Then, hiPSC-AECs were kept at \u221280\u2009\u00b0C until use.Multistep AEC differentiation was performed as previously described with some minor modificationsUndifferentiated hiPSCs and AECs were rinsed with PBS and fixed with 4% paraformaldehyde (Alfa Aesar) for 20\u2009min at room temperature. Cells were permeabilized with 0.5% saponin (Sigma) and blocked with 10% normal donkey serum  diluted with 1% BSA in PBS. The following primary and secondary antibodies were used: rabbit anti-OCT4 , rabbit anti-NKX2.1 , mouse anti-CPM , mouse anti-EPCAM , Alexa 594 (Invitrogen) donkey anti-mouse IgG(H\u2009+\u2009L), Alexa 488 (Invitrogen) donkey anti-rabbit IgG(H\u2009+\u2009L) and Alexa 594 (Invitrogen) donkey anti-rabbit IgG(H\u2009+\u2009L). Nuclei were counterstained with Fluoroshield with DAPI (Sigma) for 5\u2009min, and fluorescent images were captured with a fluorescence microscope .41. The cells were fixed for 3\u2009h in 0.1\u2009M cacodylate buffer (pH 7.4) containing 4% glutaraldehyde and 1% paraformaldehyde. After three washes in 0.1\u2009M cacodylate buffer, the cells were dehydrated through a gradual gradient series of ethanol, 20\u2009min each step, starting from 50% ethanol and ending with 100% ethanol. The cells were incubated with an increasing gradient of propylene oxide in ethanol and then infiltrated with an increasing concentration of Eponate 812 resin in ethanol. Samples were baked at 65\u2009\u00b0C for 24\u2009h and then sectioned using an Ultra microtome. Sections were observed under a Field Emission Transmission Electron Microscope  at the Korean Basic Science Institute (Chuncheon), South Korea.Human iPSC-AECs were processed as previously described5 cells per 10 mm2 area of dishes). Cryopreserved primary AECs (passage 0) were rapidly thawed in a 37\u2009\u00b0C water bath (<1\u2009min) and seeded into T-75 flask . Then, the cells were allowed to attach overnight and replenished with a fresh medium the next morning. Once the cells reached 90% confluency, the cells were subcultured into 6-well plate and maintained for 2 days. Then, BEAS-2B (passage 15) and primary AECs (passage 1) were changed to a fresh medium and kept for 24\u2009h prior to Cd treatment with various concentrations . On day 14 of AEC differentiation, hiPSC-AECs were rinsed with PBS and replenished with induction medium for 24\u2009h prior to Cd treatment. CdCl2  was dissolved in distilled water to make a stock of 10\u2009mM solution, which was added directly to the culture medium to give final concentrations of 1, 5 and 10 \u03bcM. The cells were cultured in the presence and absence of Cd for 24\u2009h and collected for further analysis.BEAS-2B cells (passage 14) were plated into 35\u2009mm dish (3\u2009\u00d7\u200910TM II flow cytometer (BD Bioscience), and acquired data were analyzed with FlowJo software (Tree Star).Differentiated hiPSC-AECs were incubated with collagenase IV (Sigma) for 2\u2009h, followed by treatment with cell dissociation medium (Gibco) for 20\u2009min at 37\u2009\u00b0C. Cells were passed through a 70 \u03bcm cell strainer and incubated with primary antibodies targeting the following molecules: NKX2.1 , carboxypeptidase M , epithelial cell adhesion molecule , Surfactant protein B , SFTPC (Abcam), T1\u03b1/Podoplanin (Abcam) and CC10 (Santa Cruz). Dead cells were excluded based on staining with 7-aminoactinomycin D (BD Pharmingen). Frequencies of AEC markers were measured using a FACSCantoTM RT DryMIX kit . Transcripts were quantified using TOPrealTM qPCR 2X PreMIX  on the QuantStudioTM 6 Flex Real-Time PCR system . Data were normalized to GAPDH expression, and sequences of all primers used are listed in Table\u00a0Total RNA was extracted from cells using the RNeasy Kit , and cDNA was synthesized from 1 \u03bcg total RNA using the TOPscriptTM solution  and a cooled CCD camera system  were used for visualizing the immunoblots.Cells were rinsed with cold PBS and lysed with Triton-X lysis buffer. Lysates were separated on a 10 or 12% SDS-PAGE gel and transferred onto a polyvinyldifluoride membrane. Membranes were probed with primary antibodies against anti-human SFTPB (EMD Millipore), BCL-xl (Santa Cruz), IRE1\u03b1, Bip/GRP78  and \u03b2-actin (Santa Cruz) overnight at 4\u2009\u00b0C, followed by incubation with HRP-conjugated secondary anti-sera (Sigma). Power-Opti ECLCMs were harvested from BEAS-2B, primary AECs and hiPSC-AEC cultures for secretome anaylsis. The concentration of CMs was measured with BCA protein assay kit  using Multi-Skan FC . The purities of purified CMs were confirmed on UV spectrum. The Human L507 Array slides  were dried for 2\u2009hr at room temperature and incubated 400 \u03bcl of blocking solution at room temperature for 30\u2009min. After decanting the blocking buffer from each sub array, 400 \u03bcl of diluted CM was added and incubated for 2\u2009hr at room temperature. After decanting the samples, all arrays were washed 3 times with 800 \u03bcl of 1X wash buffer I and incubated with biotin-conjugated anti-cytokine antibodies for 2 hrs. Then, the slides were incubated with Cy3-conjugated streptavidin solution and rinsed with de-ionized water. The result was scanned using GenePix 4100\u2009A Scanner  and analyzed with GenePix Pro 7.0 program . Global normalization was conducted in the fluorescent spots to reduce noise and variation among the samples.t-test with p\u2009<\u20090.05 as the cutoff for statistical significance.Results are presented as means \u00b1 SD. Statistical comparisons between groups were conducted using the Student\u2019s Supplementary information"}
+{"text": "The family of heterochromatin protein 1 (HP1) isoforms is essential for chromatin packaging, regulation of gene expression, and repair of damaged DNA. Here we document that \u03b3-radiation reduced the number of HP1\u03b1-positive foci, but not HP1\u03b2 and HP1\u03b3 foci, located in the vicinity of the fibrillarin-positive region of the nucleolus. The additional analysis confirmed that \u03b3-radiation has the ability to significantly decrease the level of HP1\u03b1 in rDNA promoter and rDNA encoding 28S rRNA. By mass spectrometry, we showed that treatment by \u03b3-rays enhanced the HP1\u03b2 serine 88 phosphorylation (S88ph), but other analyzed modifications of HP1\u03b2, including S161ph/Y163ph, S171ph, and S174ph, were not changed in cells exposed to \u03b3-rays or treated by the HDAC inhibitor (HDACi). Interestingly, a combination of HDACi and \u03b3-radiation increased the level of HP1\u03b1 and HP1\u03b3. The level of HP1\u03b2 remained identical before and after the HDACi/\u03b3-rays treatment, but HDACi strengthened HP1\u03b2 interaction with the KRAB-associated protein 1 (KAP1) protein. Conversely, HP1\u03b3 did not interact with KAP1, although approximately 40% of HP1\u03b3 foci co-localized with accumulated KAP1. Especially HP1\u03b3 foci at the periphery of nucleoli were mostly absent of KAP1. Together, DNA damage changed the morphology, levels, and interaction properties of HP1 isoforms. Also, \u03b3-irradiation-induced hyperphosphorylation of the HP1\u03b2 protein; thus, HP1\u03b2-S88ph could be considered as an important marker of DNA damage.  The chromatin of the eukaryotic cell nucleus is a dynamic and highly organized complex consisting of DNA and histones. In the interphase cell nucleus, chromatin appears as two primary and distinct isoforms referred to as euchromatin and heterochromatin. Generally, euchromatin is gene-rich, decondensed, replicates early in the S phase, and contains a histone post-translational modifications (PMTs), including histone acetylation, histone H3 lysine 4 di-/tri-methylation H3K4me2/me3), or H3K36me2/me3, that are associated with active transcription. On the other hand, heterochromatin is gene-poor, highly condensed, and mostly remains transcriptionally silent throughout the cell cycle, replicates in the late S phase, which is the attribute of repetitive sequences. Constitutive heterochromatin preferentially consists of repetitive elements such as satellite DNA in centromeres or telomeric sequences ,2,3. In /me3, or Covalent modification of H3 at lysine 9 position is, in mammalian cells, catalyzed by a family of the SET-domain containing methyltransferases. The histone-lysine N-methyltransferase (SETDB1) and other enzymes, including SUV39H1 and SUV39H2 histone methyltransferases mediate both H3K9me2 and H3K9me3 ,9. The lDrosophila melanogaster, but these proteins are phylogenetically conserved and can be found in almost all eukaryotes, except for the budding yeast Saccharomyces cerevisiae [The mammalian HP1 protein family contains three HP1 isoforms: HP1\u03b1, HP1\u03b2, and HP1\u03b3 that form homo- and heterodimers with each other . All isorevisiae . The HP1revisiae ,14. Thisrevisiae ,18. On trevisiae . For exarevisiae . It is well-known that the CD and the CSD domains of HP1 are connected by a linker, respectively, the so-called hinge region (Hin). This region is of variable length and interacts with histones H1 or plays a role in the nonspecific binding of HP1 to DNA or RNAs ,21,22. TIt is well-known that HP1\u03b1, HP1\u03b2, and HP1\u03b3 are not only localized to different regions of the cell nucleus , but theLater on, Yearim  showed tRecently, it was observed that HP1\u03b2 and HP1\u03b3 play an essential role in the regulation of ribosomal gene transcription ,39,40. YAlso, it is well-known that the HP1 isoforms bind not only to the methylated H3K9 but also to several non-histone proteins . For exaTo contribute to this knowledge, here, we address a question of how phosphorylation of HP1\u03b2 can be changed by \u03b3-irradiation and how radiation affects dimerization between HP1 isoforms. From this view, it is well-known that HP1 isoforms play a role in DNA damage response, as it was published by other authors ,50. More\u00ae CCL-2\u2122) were cultivated in Eagle\u2019s Minimum Essential Medium (EMEM) supplemented with 10% of fetal bovine serum (FBS) and appropriate antibiotics at 37 \u00b0C in a humidified atmosphere containing 5% CO2. 24 h after seeding the HeLa cells were irradiated with either 2 Gy or 5 Gy of \u03b3-rays with cobalt-60  as the irradiation source. Cells were also treated with HDAC inhibitor (HDACi) Suberoylanilide Hydroxamic Acid  at the final concentration 15 \u03bcM. The cells were harvested 10 min and 30 min after irradiation with 2 Gy, two hours after irradiation with 5Gy or two hours after treatment with HDACi and fixed for further analysis by western blots, immunofluorescence, immunoprecipitation (IP), and confocal microscopy. Also, we study an effect of 2 Gy of \u03b3-ray and its combination with SAHA treatment. In this case, we analyzed two intervals .The human cervix adenocarcinoma (HeLa) cell line .For transient transfection, HeLa cells were cultivated on uncoated 50-mm glass-bottomed dishes, used for inverted microscopy , to 70% confluence, and transfected with 2 \u03bcg or 5 \u03bcg plasmid DNA encoding GFP-HP1\u03b1 , GFP-HP\u00ae594-conjugated donkey anti-rabbit IgG (H + L) , Alexa Fluor\u00ae488-conjugated goat Anti-Rabbit IgG (H&L) , Alexa Fluor\u00ae594-conjugated goat anti-mouse IgG (H + L) , for STED microscopy we used secondary antibodies Abberior STAR 580  and Abberior STAR 635P . The secondary antibodies were diluted 1:200 in PBS containing 1% BSA. Cells were fixed in 4% formaldehyde for 10 min at room temperature. Permeabilization of the cell nuclei was performed by incubation with 0.2% Triton X-100  for 10 min and 0.1% saponin  for 12 min. Next, the slides were washed twice in phosphate-buffered saline for 15 min. The 1% bovine serum albumin  dissolved in PBS was used as a blocking solution. The samples were incubated in a blocking buffer for one hour and then washed for 15 min in PBS. For immunofluorescence analysis, we used the following antibodies: HP1\u03b1 , HP1\u03b2 , HP1\u03b3 , KAP1 , anti-histone H2AX phosphorylated at the S139 position , 53BP1 , and fibrillarin . The primary antibodies were diluted 1:100 in PBS containing 1% BSA. As secondary antibodies, we used Alexa FluorThe DNA content was visualized using 4\u2032,6-diamidino-2-phenylindole , and Vectashield  was used as the mounting medium. Additionally, we analyzed the area and number of \u03b3H2AX foci in non-irradiated cells, cells irradiated by 5 Gy of \u03b3-rays (cells were harvested 2 h after irradiation), 2 Gy of \u03b3-rays (cells were harvested 30 min after irradiation), or 2 Gy of \u03b3-rays (cells were harvested 30 min after irradiation) combined with SAHA treatment. We additionally studied the volume and the number of \u03b3H2AX- and 53BP1-positive DNA repair in above-mentioned samples. The analysis was performed by the use of ImageJ software (NIH freeware) which enables to automatically find the individual DNA damage related foci and their number, and volume.We acquired images with Leica TCS SP8 X SMD confocal microscope . Image acquisition was performed using a white light laser (WLL) with the following parameters: 1024 \u00d7 1024-pixel resolution, 400Hz, bidirectional mode, and zoom 8\u201312. For 3D projections, we obtained 30\u201340 optical sections with the axial step of 0.3 \u03bcm. Reconstruction of 3D projection was conducted using the Leica Application Suite (LAS) software.Stimulated emission depletion (STED) microscopy was performed on the TCS SP8 STED 3X (Leica Microsystems) equipped with 660 nm and 775 nm STED lasers, STED White Objective CS 100\u2009\u00d7/1.40 OIL. Image acquisition was performed using depletion laser of 775 nm and 3X\u20133D STED, gating 0.3\u20136 ns for both Abberior STAR 580 and Abberior STAR 635P detection. Images were acquired using LAS X software and deconvolved by Huygens Professional software.TM IP Lysis Buffer , supplemented with protease and phosphatase inhibitor cocktail  for 5 min on ice. The total protein concentration was determined by the DC protein assay kit  and by ELISA Reader \u03bcQuant . IP was performed according to the manufacturer\u2019s protocol . This kit contains a proprietary resin in a microfuge-compatible Spin Column secured by a screw cap top and a breakaway closure on the bottom. The binding between the resin and antigen: antibody complex is mediated via Antibody Capture Affinity Ligand. As the first step in the protocol the Spin Columns with resin were washed twice with 1\u00d7 Wash Buffer, after that the reagents were added at Spin Columns in the following order: 1\u00d7 Wash Buffer, Cell lysate, Specific primary antibody or negative control antibody  and Antibody Capture Affinity Ligand. IP reactions were performed overnight at 4 \u00b0C. The next day Spin Columns were washed three times with 1\u00d7 Wash Buffer and proteins were eluted from Columns by 1\u00d7 Denaturing Elution Buffer containing \u03b2-Mercaptoethanol . Precipitates were fractionated by sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) of western blot. For the IP experiments, we used the following antibodies: HP1\u03b1 , HP1\u03b2 , HP1\u03b3  and KAP1 . To investigate protein\u2013protein interactions, cells were grown to 70% confluence and then 24 h after seeding cells were washed in cold PBS buffer and incubated in Piercet-test was used for statistical analysis . Statistical significance at p \u2264 0.05 is shown by (*).Western blot analysis was performed following . BrieflyD) in fixed cells after immunostaining and then a decrease of fluorescence lifetime of the donor in the presence of acceptor (\u03c4DA). In our experiments, we used transiently transfected HeLa cells with GFP-HP1\u03b1, GFP-HP1\u03b2, and GFP-HP1\u03b3 (donor-only). For donor-acceptor pairs we either co-transfected into the cells GFP-HP1\u03b1, \u03b2 or \u03b3 with mCherry-HP1\u03b2 or performed visualization of KAP1 by immunostaining . For FLIM-FRET measurements, we used Leica TCS SP8 X SMD confocal microscope , supplemented by PicoHarp 300 module  and HyD SMD detectors. A 63\u00d7 oil immersion objective of 1.4 numerical aperture was used for photon acquisition. As the excitation source, we used the pulsed white-light laser  with a repetition rate of 20 MHz. We acquired at least 500 photons/ pixel at resolution 512 \u00d7 512 pixels. We analyzed results by SymPhoTime 64 software , FRET efficiency was calculated as mean fluorescence lifetimes weighted by amplitudes according to the formula [Fluorescence Lifetime Image (FLIM) Microscopy combined with F\u00f6rster Resonance Energy Transfer (FRET) was performed following . By usin formula ,57:FRET\u00a0\u00ae  according to manufacturer instructions. The immunocomplex was washed four times, with 500 \u00b5L of 50 mM ammonium bicarbonate buffer (ABC). On-bead digestion was performed using 20 ng\u00b7\u00b5L\u22121 Glu-C endoproteinase in 50 \u00b5L of 50 mM ABC. The procedure was performed overnight in thermomixer at 37 \u00b0C and 1100 rpm. The beads were magnetically separated, followed by an additional 5 h incubation at 37 \u00b0C and 750 rpm. The samples were acidified, and the sample volume was reduced in a Savant SPD121P concentrator to 10 \u00b5L .Transiently transfected HeLa cells with plasmid DNA encoding GFP-tagged HP1\u03b2  were lym/z). The resolution of the survey scan was 60,000 (400 m/z) with automatic gain control (AGC) target value of 4 \u00d7 105, one microscan and maximum injection time of 50 ms. The selection of precursors for MS/MS mode occurred in the quadrupole. HCD MS/MS spectra were acquired with an AGC target value of 5 \u00d7 104 and resolution of 30,000. The maximum injection time for MS/MS was 500 ms. Dynamic exclusion was enabled for 60 s after one MS/MS spectrum acquisition. The isolation window for MS/MS fragmentation was set to 1.6 m/z. Glu-C digests of three batches represented by independent biological replicates were measured using liquid chromatography tandem mass spectrometry (LC-MS/MS). The samples were spiked with the iRT-C18 reference peptides . The LC-MS/MS equipment consisted of an RSLCnano system, equipped with an X-Bridge BEH 130 C18 trap column , and an Acclaim PepMap100 C18 analytical column , coupled to an Orbitrap Lumos Tribrid spectrometer  equipped with a Digital PicoView 550 ion source , and Active Background Ion Reduction Device. Prior to LC separation, Glu-C digests were online concentrated on trap column. The mobile phase consisted of 0.1% formic acid in water (A) and 0.1% formic acid in 80% acetonitrile (B), with the following proportions of B: 1% for 3 min at 500 nL/min, then with a switch to 300 nL/min for next 2 min, increased linearly from 1 to 30% over 70 min, 30\u201356% over 35 min, 56\u201380% over 5 min and followed by isocratic washing at 80% B for 10 min. Equilibration with 99:1  of the trapping column and the column was done prior to sample injection to sample loop. The analytical column outlet was directly connected to the ion source of the MS. MS data were acquired using a data-dependent strategy with 3 s cycle time based on precursor abundance in a survey scan  with in-house Mascot search engine  to compare acquired spectra with entries in the UniProtKB human protein database , cRAP contaminant database and in-house HP1 database . Mass tolerances for peptides and MS/MS fragments were 10 ppm and 0.02 Da, respectively. For the HP1 database searches, Glu-C enzyme specificity with up to six missed enzyme cleavages and the following modifications were set: acetylation , methylation , dimethylation (K), trimethylation (K), and phosphorylation  as variable modifications. For searches against the cRAP and UniProtKB human databases, Glu-C enzyme specificity with up to two missed enzyme cleavages, and oxidation (M), and deamidation  as variable modifications were set. Rank 1 peptides with Mascot expectation value < 0.01 and Ion Score \u2265 30 were considered. The abundance of peptides was quantified automatically using Proteome Discoverer 2.2 software. The peak intensity corresponding to each precursor ion was calculated from the extracted ion chromatograms (XICs) using the Precursor Ions Quantifier node. Selected HP1\u03b2 peptide identifications were manually verified and quantified from the peak areas derived from the XICs using Skyline 4.2 software, including identification alignment across the raw files based on retention time and  partner  reposito6 per sample) were lysed in 1% SDS lysis buffer containing protease inhibitor cocktail, followed by incubation on ice for 10 min. Lysates were sonicated twice, 5\u20136 times for 10 s. To verify sonication efficiency, the samples were subjected to agarose gel electrophoresis. Optimal fragment sizes ranged from 200 to 1000 bp. The samples used for further analyses were centrifuged at 20,000 rcf for 10 min at 4 \u00b0C. In the next step, 900 \u03bcL of ChIP dilution buffer was added to 100 \u03bcl of sonicated lysate. We used following primary antibodies: HP1\u03b1 , HP1\u03b2 , HP1\u03b3 , KAP1  and negative control . The next day, samples were incubated with 12 \u03bcg of Protein A agarose/salmon sperm DNA (50% Slurry) for two hours at 4 \u00b0C and centrifuged at 200 rcf for 2 min. The agarose beads with antigen: antibody complexes were washed using ChIP assay Kit buffers. Each wash was performed for 5 min with rotation and was followed by centrifugation at 200 rcf at 4 \u00b0C, for 2 min. The immune complexes were eluted from the agarose beads by incubating samples twice with 250 \u03bcL elution buffer (1% SDS and 0.1M NaHCO3) for 15 min at RT with rotation, and then supplemented with 20 \u03bcL of 5 M NaCl. To reverse cross-links, samples were incubated overnight at 65 \u00b0C. The next day, the DNA was isolated using the QIAamp DNA Mini Kit . All analyses included input DNA samples, which originated from a portion (2%) of lysates obtained before IP. The primers for rDNA promoter and rDNA encoding 28S rRNA were adapted following [ChIP-polymerase chain reaction (PCR) was performed following the protocol published by Stra\u0161\u00e1k et al. . Brieflyollowing ,60. PCR ollowing  or by Moollowing .By the use of confocal microscopy, we studied nuclear distribution pattern of HP1 isoforms, including HP1\u03b1, HP1\u03b2, and HP1\u03b3. We addressed a question if irradiation by \u03b3-rays changes the morphology of HP1-positive foci and their localization close to nucleoli a\u2013d. Exce\u00ae kit. Among more than 800 identified proteins, GFP-tagged HP1\u03b2 was found to be the most abundant protein with magnitude higher level than other proteins, and the ~75% sequence coverage. In HP1\u03b2 sequence, following post-translational modifications (acetylation and phosphorylation) were identified with high confidence: K83ac, K85ac, S88ph/S90ph, S161ph/Y163ph, S171ph, and S174ph. The most PTMs were detected in the peptide sequences corresponding to the hinge region and CSD domain while no PTM was detected within the CD domain of the HP1\u03b2 protein , and SAHA-treated HeLa cells. Cell originated from three independent cultivations, and for IP, we used ChromoTek GFP-Trap protein .S88phDSEDKGEE96, A151NVKCPQVVISFY163phEE165, R166LTWHS171phYPSE DDDKKDDKN184, R166LTWHSYPS174phEDDDKKDDKN184, R166LTWHS171phYPS174phE DDDKKDDKN184. Compared to the non-irradiated control samples, significantly increased level of G81\u2013E96 peptide carrying phosphorylation at serine 88  was observed in \u03b3-irradiated samples . Modified sites observed, here, in HeLa cells, were different from those observed by LeRoy et al. [By mass spectrometry, we observed 8 sites in the HP1\u03b2 protein carrying post-translational modifications (GKKQNKKKVE EVLEEEEEEY VVEKVLDRRV VKGKVEYLLK WKGFSDEDNT WEPEENLDCP DLIAEFLQSQ KTAHETDKSE GGK*RK*ADS#DS# EDKGEESKPK KKKEESEKPR GFARGLEPER IIGATDSSGE LMFLMKWKNS DEADLVPAKE ANVKCPQVII S#FY#EERLTWH S#YPS#EDDDKK DDKN), including #phosphorylation and *acetylation. While the presence of S88ph, S90ph, and S174ph was previously detected in the phosphoproteomic studies dealing with different cell types  ,57,58, py et al.  providiny et al. . These ay et al. . Recently et al. . From thy et al.  in U2OS Also, because we noticed a high abundance of KAP1 protein in HP1\u03b2 fraction, and as it was published by Lechner et al. , we analAs the next step, we compared our results from IPs with FLIM-FRET data, and we can only state that results are not identical, especially in the case of HP1 dimerization. Putting together data from IPs and FLIM-FRET, we summarize that in HeLa cells, there is an existence of following protein-protein interactions: HP1\u03b1-HP1\u03b1, HP1\u03b1-KAP1, HP1\u03b2-HP1\u03b2, HP1\u03b2-KAP1, HP1\u03b1-HP1\u03b2, HP1\u03b2-HP1\u03b3, HP1\u03b3-HP1\u03b3. However, by any method, we did not observe an interaction between HP1\u03b1-HP1\u03b3, and interaction between HP1\u03b3-KAP1. This data confirmed a distinct role of HP1\u03b3 in chromatin remodeling when compared to HP1\u03b1 or HP1\u03b2 and their function in heterochromatinization and gene expression, as it was shown by many authors ,65,66,67As mentioned above, isoforms of the HP1 protein has distinct functions, although they are characterized by relatively identical nuclear distribution pattern (Together, in HeLa cells, we showed that \u03b3-irradiation reduced the level of HP1\u03b1 in close proximity to nucleoli, and HP1\u03b2-S88 is prone to phosphorylation that is increased in the genome exposed to \u03b3-rays. Thus, in tumor cells like HeLa, HP1\u03b2-S88ph could be considered as a marker of DNA damage. Importantly, DNA damage does not affect dimerization of HP1 isoforms and HP1-KAP1 interactions, but surprisingly, HDACi strengthened interaction between HP1\u03b2 and KAP1 proteins. Importantly, the combination of both HDACi treatment and irradiation by 2 Gy of \u03b3-rays increased the global level of HP1\u03b1 and HP1\u03b3; thus, it likely affects the function of HP1 isoforms in DNA damage response."}
+{"text": "P = 1.65\u00d710\u22124) and having heart failure (P = 2.18\u00d710\u22124), as well as a 0.059 s.d. increase in BMI (P = 1.04\u00d710\u221210). When testing the association of local Polynesian ancestry with risk of disease or biomarkers, we identified a chr6 region associated with T2D. This association was driven by an uniquely prevalent variant in Polynesian ancestry individuals. However, we could not replicate this finding in an independent Polynesian cohort from Samoa due to the small sample size of the replication cohort. In conclusion, we showed that Polynesian ancestry, which likely capture both genetic and lifestyle risk factors, is associated with an increased risk of obesity, Type-2 diabetes, and heart failure, and that larger cohorts of Polynesian ancestry individuals will be needed to replicate the putative association on chr6 with T2D.Epidemiological studies of obesity, Type-2 diabetes (T2D), cardiovascular diseases and several common cancers have revealed an increased risk in Native Hawaiians compared to European- or Asian-Americans living in the Hawaiian islands. However, there remains a gap in our understanding of the genetic factors that affect the health of Native Hawaiians. To fill this gap, we studied the genetic risk factors at both the chromosomal and sub-chromosomal scales using genome-wide SNP array data on ~4,000 Native Hawaiians from the Multiethnic Cohort. We estimated the genomic proportion of Native Hawaiian ancestry , as well as this ancestral component along each chromosome  and tested their respective association with binary and quantitative cardiometabolic traits. After attempting to adjust for non-genetic covariates evaluated through questionnaires, we found that per 10% increase in global Polynesian genetic ancestry, there is a respective 8.6%, and 11.0% increase in the odds of being diabetic ( Native Hawaiians are one of the fastest growing ethnic minorities in the U.S., and exhibit increased risk for metabolic and cardiovascular diseases. However, they are generally understudied, especially from a genetic perspective. To fill this gap, we studied the association of Polynesian genetic ancestry, at genomic and subgenomic scales, with quantitative and binary traits in self-identified Native Hawaiians. We showed that Polynesian ancestry, which likely captures both genetic and non-genetic risk factors related to Native Hawaiian people and culture, is associated with increased risk for obesity, type-2 diabetes, and heart failure. While we do not endorse utilizing genetic information to supplant current standards of defining community membership through self-identity or genealogical records, our results suggest future studies could identify population-specific genetic susceptibility factors that may elucidate underlying biological mechanisms and reducing the disparity in disease risks in Polynesian populations. Native Hawaiians are the second fastest growing ethnic group in the U.S., growing 40% from the 2000 to 2010 U.S. census . Epidemith and 19th centuries, Native Hawaiians became admixed with European and East Asian immigrants to the islands. The 2010 U.S. census data suggests that only approximately 1.2 million individuals in the U.S. derive some proportion of their ancestry from Native Hawaiians, accounting for about 0.4% of the U.S. population. The small population size may be one of the challenges in recruiting large cohorts, which contributes to the reason that this population is under-investigated from a genetic standpoint.Today, Native Hawaiians are an admixed population. Their ancestors settled the Hawai\u2018i archipelagos approximately 1,200\u20132,000 years ago and remained isolated there until 1778 when they encountered Western explorers who brought novel infectious agents that decimated the Native Hawaiian population before they rebounded over the last couple of centuries \u201316. DuriTo begin filling the missing gap in the genetic understanding of disease risks in Native Hawaiians, we first distinguished a Native Hawaiian-specific component of ancestry from other continental ancestries, and tested the association of this global (genomic) ancestry to complex traits and diseases in Native Hawaiians. We presumed this component of ancestry to be Polynesian in origin, although we cannot discount the possibility that this component of ancestry has diverged from the prevalent ancestry component found in other extant Polynesian populations today. We further stress that associations between estimated global Polynesian ancestry and any phenotype will also capture any non-genetic cultural or environmental effects that are correlated with Polynesian ancestry. These variables are typically measured with considerable error; thus, adjustment for them does not necessarily exclude residual effects. Therefore, an observed association with genetic ancestry is not evidence for a deterministic impact attributed to the Polynesian genetic ancestry alone. Nevertheless, an observed association with genetic ancestry may imply that genetic mapping studies could identify genetic susceptibility factors enriched in the Polynesian populations and elucidate underlying biological mechanisms.We then tested the association of local Polynesian ancestry with complex traits and diseases in what is known as admixture mapping. Admixture mapping assumes that causal variants leading to increased risk or trait values occur more frequently on chromosomal segments inherited from the ancestral population that has higher disease risk or larger average trait values \u201319. ThisMethods) after accounting for other sources of recent admixtures, namely Europeans (EUR), East Asians (EAS), and Africans (AFR). Using this reference panel, we computed a haplotype-based estimate of global genetic ancestry for each of the remaining 3,762 individuals, and kept 3,428 unrelated individuals after excluding for the first-degree relatedness in our dataset (Methods).We used 3,940 self-identified Native Hawaiians from the Multiethnic Cohort (MEC)  that werMethods). Overall, we found that higher PNS ancestry is strongly associated with higher risk of obesity, T2D, heart failure (HF), and consistently, with higher BMI and lower HDL levels among the quantitative traits (Tables S15). The associations are consistent with a broadly linear relationship observed between these traits and proportion of PNS ancestry . For example, we observed in our statistical model that, holding the proportion of EAS and AFR ancestry constant, every 10% increase in the PNS ancestry in our cohort corresponded to a 0.059 s.d. (or 0.35 BMI unit) increase in BMI and a 1.09 times the odds of T2D (after adjusting for BMI). We observed opposite effects of PNS ancestry on waist-to-hip ratio (WHR) in males and females separately, though the statistical significance is marginal (Tables S2). For T2D, HF, hypertension (HYPERT), and ischemic heart disease (IHD), BMI is an established risk factor. In our models, we also found BMI to be strongly associated with disease risk for these conditions . For T2D and HF, we observed a strong association between disease risk and PNS ancestry even after accounting for BMI, suggesting additional risk factors that are specific or correlated to the PNS ancestry (Table 1). For HYPERT and IHD, we observed a weak but nominally significant association between PNS ancestry and disease risk if we do not account for BMI. In fact, for most traits tested, the effect sizes due to PNS ancestry are lower after adjusting for BMI , suggesting that at least part of the excessive risk for these traits may be mediated through BMI.We then assessed in Native Hawaiians the association of each component of ancestries with a set of quantitative and binary cardiometabolic traits. Specifically, we focused on three disease categories for which the Native Hawaiians have shown increased risks in previous epidemiological studies: obesity ,6, T2D , and carTable 1). In some cases, the magnitude of effects due to the EAS component could be larger than the PNS component . Therefore, based on our model at least some of the disease risk or variation in quantitative phenotypes in Native Hawaiians may be partly attributed to or compounded by non-Polynesian components of ancestry .Other components of ancestry found in Native Hawaiians also exert an effect. For example, we observed that a higher East Asian ancestry component are associated with increased risk of T2D, hyperlipidemia, and hypertension, but lower BMI and lowered risk of obesity (Methods). For traits  that showed significant association with proportion of PNS ancestry, adding nSES into the model showed that nSES was statistically significantly associated with each outcome, and accounted for some proportion of the risk. However, the association between proportion of PNS ancestry and each of these outcomes remained highly significant, with the exception of HDL, which became nominally significant (Tables 2 and S1and S11). We did not observe any interaction between nSES and ancestry (S16 Table). These results are again consistent with the possibility that unique Polynesian genetic risk factors exist in the Native Hawaiians that partly explain the elevated risk.Because, as mentioned above, non-genetic factors such as socioeconomic status could confound our analysis, we further tested if adding neighborhood SES could account for these associations. Neighborhood SES (nSES) is a validated composite measure created by principal component analysis that incorporates U.S. Census data on education, occupation, unemployment, household income, poverty, rent, and house values . This nSS17 Table). However, we did observe a strong difference in the strength of association stratified by T2D disease status. Specifically, among T2D cases, we found no significant association between BMI and proportion of PNS ancestry . On the other hand, among T2D controls, individuals were predicted to have 0.087 s.d. (or 0.51 units) or higher BMI per 10% increase in PNS ancestry (P = 1.4x10-13). This is despite the T2D strata having similar sample sizes . A BMI model including interaction between T2D strata and PNS ancestry showed significant negative interaction .As the strongest association with genetic ancestry came from BMI, we further investigated the association between BMI and PNS ancestry in stratified analysis. We found little evidence of difference between sexes (P = 4.88x10-6) and visceral fat (P = 0.014) (Table 3). There was no association with lean-to-fat mass ratio (P = 0.76), suggesting that PNS ancestry is associated with body fat distribution but not necessarily body fat composition. Because anthropometric measures of body fat distribution such as Waist-to-hip ratio often differ between male and females, we also conducted sex-stratified analysis. We observed similar trend of associations between subcutaneous fat vs. visceral fat, though the association seems more strongly driven by males (Table 3).For a subset of ~300 Native Hawaiians in our cohort, we also have measures of subcutaneous fat and visceral fat, as well as lean mass vs. fat mass obtained through dual-energy x-ray absorptiometry and abdominal magnetic resonance imaging . In this-5 to declare genome-wide significance with a trait (Methods).We next examined the impact of local genetic ancestry on cardiometabolic traits in Native Hawaiians through admixture mapping using linear or logistic regression models. We only analyzed the traits that exhibited a significant association with the global PNS ancestry. We used a threshold of 2.2x10Fig 2): 62.7Mb to 65.7Mb on chr6 for T2D . We further defined a broader region encompassing neighboring regions with admixture P-value less than 1x10-4 as potential regions that may harbor causal allele(s). For this broader region spanning 11.4 Mb on chr6 (Table 4), we examined if known variants reported in the GWAS catalog could account for the signals we found through admixture mapping. We found 2 variants in the GWAS catalog for T2D that fall within our admixture peak (S20 Table). We imputed these two variants using 1000Genomes (phase 3) as the reference panel and found that conditioning on these variants did not significantly change our admixture mapping results . These results suggest that our signals detected through admixture mapping may potentially be novel.Across the 2 quantitative (BMI and HDL) and 2 binary  traits examined through admixture mapping, we identified one region that surpassed our genome-wide significance threshold . We imputed the full dataset of 3,940 individuals using 1000 Genomes as reference to increase coverage across the region, and accounted for cryptic relatedness and population structure in a logistic mixed model (Methods). We found that the top associated variant on chr6 for T2D was a well-imputed (INFO score = 0.86) 5\u2019 UTR variant rs370140172 . Its association with T2D was significant after accounting for number of markers tested in this region . This variant showed a large difference in frequency between Native Hawaiians  and European (0%) or East Asian (0.9%) individuals from 1000 Genomes, or Oceania (2.0%) and Southeast Asia (1.2%) individuals from the GenomeAsia Pilot Project [S21 Table). Conditioning on rs370140172 also drastically reduced the admixture association signal . Taken together, these observations suggest that rs370140172 or its proxy could be the allelic association driving the admixture signal.To fine-map the candidate region on chromosome 6, we conducted single variant association tests . However, we noted that the derived allele of rs370140172 had a significantly lower frequency in the Samoans . The lower frequency of the allele and the current sample size does not provide sufficient power to replicate the association signal even at nominal significance level of 0.05 . Because of the difference in frequency between Native Hawaiians and Samoans, we also examined if this locus exhibits signals of positive natural selection in the Native Hawaiians (Methods). We observed that the derived allele is found on the longer haplotypes in Native Hawaiians, although not statistically significantly different from other variants of similar derived allele frequency in the genome . Similarly, the allele frequency difference between MEC-NH and the Samoans for the derived allele at rs370140172 is also marginally insignificant compared to other variants of similar derived allele frequency . Thus, the elevated frequency in MEC-NH may still be the result of genetic drift.We attempted to replicate the single variant signal on chromosome 6 by examining the lead variant and its proxies for association with T2D in another Polynesian population of 2,852 Samoan individuals, including 475 cases and 2,377 controls. We found no significant associations . Polynesian ancestry was also nominally associated with WHR , insulin level, triglycerides, hypertension and ischemic heart diseases, but these associations did not remain statistically significant after Bonferroni correction for the multiple traits that we tested in this study (Table 1).We began our analysis by modeling Polynesian ancestry. We first conducted ADMIXTURE analysis to identify an internal Native Hawaiian ancestry reference panel since there is no appropriate representative panel currently available. Consistent with their known history, we found Native Hawaiians to be a recently admixed population, deriving the largest proportion of their genetic ancestry from a presumed Polynesian ancestral component (on average ~40.2%). We also found that global Polynesian ancestry from MEC-NH is statistically significantly associated with BMI, HDL, Type-2 diabetes, obesity and heart failure after adjusting for other components of ancestries and available non-genetic covariates . Admittedly, these variables are still imperfect proxies for SES. For example, while our composite nSES index has been shown to uncover important SES associations for complex traits [e.g. physical activity, diet, alcohol or medication use) and domain-focused neighborhood-level  non-genetic factors. Therefore we should interpret these associations with global ancestry with caution.The strong associations between global ancestry and disease risks or related quantitative phenotypes suggest the presence of population-specific variants that could contribute to the increased risk observed in these populations. For example, a recently reported, Polynesian-specific, awaiians . Howeverawaiians ,26 . In models including interaction between global ancestry and T2D, we again observed that while T2D cases generally have higher BMI, those with greater PNS ancestry would actually have lowered BMI than those with less PNS ancestry . EAS ancestry is also strongly associated with BMI in Native Hawaiians, but we found no evidence of interaction between EAS and T2D (S19 Table). We explored whether this interaction could be mediated through differential body composition. For example, individuals with increasing PNS ancestry may possess more lean mass, which contributes to BMI, than fat mass, which contributes to BMI and risk for T2D. There are some suggestions that individuals of PNS ancestry preferentially have greater lean mass than fat mass [Table 2). We also considered fat distribution. For example, individuals with increasing PNS ancestry may preferentially store fat subcutaneously, which contribute to general adiposity and BMI but not necessarily to T2D, rather than viscerally, which could lead to insulin resistance and contribute to peripheral insulin sensitivity and further T2D [Table 2), which made it difficult to assess whether there is difference between two types of fat storage. As global ancestry can capture correlated cultural or environment factors in addition to the genetics, perhaps more plausibly, the interaction may signal behavioral modifications correlated with T2D risks. For example, if individuals with greater PNS ancestry are more susceptible to T2D due to a modifiable risk factor that contributes to BMI, but could remove the risk factor after being diagnosed with T2D, there could be a reduced association between BMI and PNS ancestry among T2D cases. Ultimately, more data will be needed to make firm conclusions.One notable observation is the association between global PNS ancestry and BMI. In analysis stratified by T2D status, despite having similar numbers of cases and controls, we found that PNS ancestry is not associated with BMI among T2D cases, but is associated with higher BMI among individuals unaffected by T2D .These caveats nonewithstanding, we conducted admixture mapping to test the association between local PNS ancestry genome-wide with the traits significantly associated with global PNS ancestry. Because admixture mapping had not been previously conducted among Native Hawaiians and the haplotypic pattern and LD structure within Native Hawaiians had not been previously explored, we used permutation as well as a recently published method  to estab-5) after correcting for number of variants tested by permutation . This variant was imputed with high accuracy (INFO score = 0.86), exhibits large frequency enrichment compared to other populations , and explained the admixture mapping signal we detected . Rs370140172 falls within the 5\u2019 UTR (2nd exon) of the gene EYS. Because the genetic risk of T2D has been suggested to be mediated through alleles affecting enhancer activity in pancreatic islet cells, we also examined published Hi-C data [Table 4) were found to form potential enhancer-promoter loops. In all five cases, the target anchor points are relatively nearby, falling between chr6:64.3Mb-65.0Mb within the EYS gene. Mutations in EYS are known to cause recessive retinitis pigmentosa [-6), and a genome-wide association with BMI in a Japanese population  [EYS is a plausible causal gene. However, we failed to replicate the association signal at this variant in a Samoan cohort. The failure to replicate could be due to decreased power as the variant has lower frequency in Samoans and the cohort is relatively small. Furthermore, we may be limited by the availability of imputation panels; we used the 1000 Genome Project as reference panel and, as such, a number of Polynesian-specific variants that could underlie the admixture signal in these region may not be well imputed. Improvements in the genomic resources available for studying Polynesian populations as well as increased sample size from these communities will help validate and delineate the observed association at this locus.Single variant fine-mapping of the chr6 region identified a significant association on chr6  ,37. TakeTable 1). This finding is consistent with previous epidemiological observations based on self-reported recent admixture in the parental generation [Finally, it should be noted that Polynesian ancestry component is not the only component conferring risk to disease in the Native Hawaiian people. In our analysis other components of ancestry could also add to or drive disease risk in Native Hawaiians. For example, we find that T2D risk is independently positively correlated with the estimated proportion of East Asian ancestry in the Native Hawaiians, particularly after adjusting for BMI . MEC is a prospective epidemiological cohort of >215,000 individuals spanning five major ethnicities, including biospecimen samples on >5,300 Native Hawaiians. It is currently the largest single cohort with genetic information on Native Hawaiians, and thus is ideal for our study. In this study, we used a subcohort of >3,900 individuals genotyped on the MEGA genotyping array . The insQuality control of MEGA array was previously described . In gene2 > 0.1 (using window sizes of 50 SNPs with steps of 10 SNPs across the genome), and partitioned the samples to two groups of related (up to and including 2nd degree) and unrelated individuals by KING (default threshold used). We then ran ADMIXTURE (v. 1.3.0) in unsupervised mode for unrelated samples, then projected the estimated ancestral allele frequency to the related samples to infer the genomic ancestries of the related group. We performed ADMIXTURE analysis in five independent runs, retaining the replicate with the highest likelihood estimated by the software. We found MEC-NH individuals at k = 4 exhibited known components of ancestry from European, East Asian and African, as well as a component of ancestry that is unique to the MEC-NH, presumed to be Polynesian ; repeated ADMIXTURE analysis from k = 4 to k = 8 showed this Polynesian component to be stable . We then identified 178 unrelated MEC-NH individuals (kinship coefficient <0.2 estimated from PC-relate [In addition to a predominant Polynesian (PNS) ancestry, Native Hawaiians are known to be recently admixed with individuals of European and East Asian ancestry . In ordeC-relate ) whose PS23 Table). Therefore we used HapMap2 pooled recombination map  to infer local ancestry in Native Hawaiians. To obtain global ancestry estimates, we summed the local ancestry estimates across the genome, after excluding tracts that have any ancestral probability < 0.9. We observed that on average, a self-reported Native Hawaiian individual derived ~29.6% ancestry from EUR, ~29.0% ancestry from EAS, ~1.2% ancestry from AFR, and the remaining ~40.2% ancestry from PNS. These values are similar to previous estimates of proportions of genetic ancestry from MEC using ancestry informative markers [To call local ancestry, we merged the MEC-NH samples with the above 1000 Genomes reference individuals, and rephrased the merged dataset using EAGLE2 (v 2.4.1). Next, we combined the 178 MEC-NH reference with the above 1KGP reference individuals to form the reference panel. Using this reference panel, we then inferred local ancestry used RFMix  . At a given BMI, Polynesians have a higher proportion of lean muscle mass to fat mass than Europeans so we use the recommended BMI cut-off of 32 kg/m2 to define obesity cases and controls [https://www2.ccwdata.org/web/guest/condition-categories. Descriptive summaries of the traits and covariates can be found in S25 Table.We focused on three categories of traits for which the Native Hawaiians exhibit excess risk in past epidemiological studies \u20134,6\u20139:  and abdominal magnetic resonance imaging (MRI) scans. For subcutaneous fat and visceral fat, sex-stratified and age-adjusted residuals were standardized. Lean-to-fat mass ratio were calculated by taking the ratio of sex-stratified, age-adjusted standardized measure of total lean mass and total fat mass..We tested the association of global Polynesian ancestry with quantitative and binary traits using linear and logistic regressions, respectively. We focused on the 3428 unrelated individuals after removing first degree relatives determined by KING  and indiTable 1 , we added nSES in the model to account for confounding in the assessment of the association with global ancestry. Because of the area-based design, Native Hawaiian participants residing in the same census tract were assigned the same nSES measure. We thus used a mixed effect model to account for this spatial clustering by including the census tract ID as random effect. We used lmer and glmer (version 1.1\u201321) function in R (version 3.6.2) with default parameters.To further assess if the association between global ancestry and outcome could be explained by uncaptured non-genetic factors, we included the nSES variable in our regression models . We deteTo identify local genomic segments in which the Polynesian ancestry is associated with a trait of interest, we conducted admixture mapping. We focused on the same 3428 unrelated individuals used in global ancestry analysis (above). We used linear or logistic regression to test the association of estimated dosage of Polynesian ancestry from RFMix at each genomic location, while controlling for estimated global ancestry from EUR, EAS, and AFR. Traits were modeled in the same way as above in the global ancestry analysis, except we focused only on individual-level covariates for computational efficiency of genome-wide testing.-5 using 10,000 simulations in STEAM [-5. The two thresholds are nearly identical . We thus used 2.2x10-5 as the genome-wide significance threshold for admixture.We determined the significance threshold for admixture mapping for a given trait using two approaches: by a recently published simulation-based approach  and by pin STEAM . For per Latinos  (4.8x10-Table 4), we defined the signal region as contiguous variants with admixture P-values lower than the genome-wide significance threshold . We then defined a broad region by extending the signal region to nearby flanking regions that are (1) < 5Mbp away upstream or downstream from the signal region, and (2) with -log10P>4. We then imputed our rephased dataset using Sanger Imputation Service (https://imputation.sanger.ac.uk/). We used 1KGP as the reference panel, and PBWT as the imputation software. We subsequently filtered out indels and loci with low imputation quality (INFO score <0.4), and applied a minor allele frequency filter of 1%. We then investigated whether a previously known variant from the GWAS catalog [For the locus we identified through local ancestry association , assuming the sample size, estimated frequency of rs370140172, a prevalence rate of T2D of 17.1% [The Power of the replication analysis was conducted using the Genetic Association Study power calculator  or proportion of affected (for dichotomous) trait as function of bins of PNS ancestry. The sample size for individual available is given above each bin.(TIF)Click here for additional data file.S2 FigAcross the binary traits tested, even if the effect attributable to PNS ancestry is not significant, the effect sizes are lowered if accounting for BMI, suggesting at least part of the excess risk for these traits among Native Hawaiians are mediated through higher BMI associated with the ancestry. Hyperlipidemia was excluded because BMI is not associated with the disease risk in univariate regression model. HF, heart failure; HYPERT, hypertension; IHD, ischemic heart disease; T2D, type-2 diabetes; TIA, stroke and transient ischemic attack.(TIF)Click here for additional data file.S3 FigS1 Table for BMI and S5 Table for HDL to obtain predicted phenotype residual in units of standard deviation. For dichotomous traits, we used Model 2 in  for Obesity, T2D, HF, HYPERL, and HYPERT, respectively, and converted the fitted log-odds to probability of being affected. Because the covariates are included in the model rather than being regressed out in quantitative traits, we assumed fixed values of age = 50, BMI = 30 (except for obesity), sex = male, and education level = college graduates. Contour plots are shown labeling in each plot to display the fitted trait value or probability of being affected.For the seven traits in (TIF)Click here for additional data file.S4 FigGreen and blue colors denote SNP level P-value in association testing with and without, respectively, conditioning on known GWAS variants.(TIF)Click here for additional data file.S5 FigThe originally reported admixture signal (blue) can be explained by the conditioned variant (green), suggesting that these single variants might be novel variants associated with these traits.(TIF)Click here for additional data file.S6 Fighttp://csg.sph.umich.edu/abecasis/cats/gas_power_calculator/index.html). The prevalence rate of T2D in Samoans set as 17.1%, which was the value averaged over the reported values in both sex [We estimated the power to replicate the top signal rs370140172) from single variant analysis with T2D in the Samoan cohort, using GAS power calculator (40172 fro(TIF)Click here for additional data file.S7 FigMethods). We compared the nSL statistics (left) and the difference in frequency of the derived allele between MEC-NH and Samoans (right) at rs370140172  to the null distribution based on the ~44,000 matched SNP. The evidence of selection for rs370140172 is marginally insignificant by either haplotype length (P = 0.067) or allele frequency differentiation (P = 0.076).We selected ~44,000 variants across the genome from imputed data matched to rs370140172 by derived allele frequency in MEC-NH and by imputation quality ((TIF)Click here for additional data file.S8 Fig3,465 MEC Japanese (MEC-JA), 30 MEC Latinos (MEC-LA), 5,325 MEC African Americans (MEC-AA), and 3,940 MEC Native Hawaiians (MEC-NH) were merged with the 1000 Genomes Project populations. At K = 4 we identified an ancestral component (colored red) that are found largely in Native Hawaiians, presumed to be the Polynesian ancestry.(TIF)Click here for additional data file.S9 FigAt each K, ancestry proportions from the replicate (out of five) with highest estimated likelihood output by ADMIXTURE were visualized using Pong. Notably, the inferred proportion of PNS component in Native Hawaiians (red component at K = 4) remains stable across higher K.(TIF)Click here for additional data file.S10 Fig-5 using permutation, or 2.28x10-5 using STEAM. We thus adopt a threshold of 2.2x10-5 for our study (Methods).We used 1,000 runs of genome-wide permutation (top) or 10,000 runs of simulation of test statistics using STEAM (bottom) to determine the distribution of admixture mapping test statistics under the null hypothesis given the correlation structure of estimated local ancestry in MEC Native Hawaiians. The significance threshold was then set as the P-value threshold in which we would obtain a 5% false discovery rate. The threshold was 2.24x10(TIF)Click here for additional data file.S1 TableMethods. The residual from model 1 is then inverse normalized and tested in model 2. Models 1A and 2A repeats the procedure but included quintiles of nSES levels in a mixed effect model (Methods); in this case, the R2 in Model 1A reported include both the fixed and the random effect. * edu4 was a binary variable created from the original categorical variable of education status by grouping levels 1,2,3 and coded 0, while education status level 4 was coded as 1. This was done because there were no significant associations between education levels 1 through 3 and BMI. See Model 1 models the non-genetic covariates according to the heuristic described in the (DOCX)Click here for additional data file.S2 TableMethods. The residual from model 1 is then inverse normalized and tested in model 2. The top panels were conducted in males only; the bottom in females only. See Model 1 models the non-genetic covariates according to the heuristic described in the (DOCX)Click here for additional data file.S3 TableMethods. The residual from model 1 is then inverse normalized and tested in model 2.Model 1 models the non-genetic covariates according to the heuristic described in the (DOCX)Click here for additional data file.S4 TableMethods. The residual from model 1 is then inverse normalized and tested in model 2.Model 1 models the non-genetic covariates according to the heuristic described in the (DOCX)Click here for additional data file.S5 TableMethods); in this case, the R2 in Model 1A reported include both the fixed and the random effect.Model 1 models the non-genetic covariates according to the heuristic described in the Methods. The residual from model 1 is then inverse normalized and tested in model 2. Models 1A and 2A repeats the procedure but included quintiles of nSES levels in a mixed effect model ((DOCX)Click here for additional data file.S6 TableModel 1 models the non-genetic covariates according to the heuristic described in the Methods. The residual from model 1 is then inverse normalized and tested in model 2.(DOCX)Click here for additional data file.S7 TableModel 1 models the non-genetic covariates according to the heuristic described in the Methods. The residual from model 1 is then inverse normalized and tested in model 2. * edu4 was a binary variable created from the original categorical variable of education status by grouping levels 1,2,3 and coded 0, while education status level 4 was coded as 1. This was done because there were no significant associations between education levels 1 through 3 and BMI.(DOCX)Click here for additional data file.S8 TableModel 1 models the non-genetic covariates according to the heuristic described in the Methods. The residual from model 1 is then inverse normalized and tested in model 2.(DOCX)Click here for additional data file.S9 TableModel 1 models the non-genetic covariates according to the heuristic described in the Methods. Model 2 then includes global ancestries in addition to the significant covariates. * edu4 was a binary variable created from the original categorical variable of education status by grouping levels 1,2,3 and coded 0, while education status level 4 was coded as 1. This was done because there were no significant associations between education levels 1 through 3 and obesity. Model 3 included quintiles of nSES levels in a mixed effect model.(DOCX)Click here for additional data file.S10 TableMethods. Model 2 then includes global ancestries in addition to the significant covariates. Model 3 included quintiles of nSES levels in a mixed effect model. * edu3 was a ternary variable created from the original categorical variable of education status by grouping levels 1 and 2. This was done because there were no significant associations between education levels 1 and 2 with T2D.Model 1 models the non-genetic covariates according to the heuristic described in the (DOCX)Click here for additional data file.S11 TableModel 1 models the non-genetic covariates according to the heuristic described in the Methods. Model 2 then includes global ancestries in addition to the significant covariates. Model 3 included quintiles of nSES levels in a mixed effect model. * edu3 was a ternary variable created from the original categorical variable of education status by grouping levels 1 and 2. This was done because there were no significant associations between education levels 1 and 2 with heart failure.(DOCX)Click here for additional data file.S12 TableModel 1 models the non-genetic covariates according to the heuristic described in the Methods. Model 2 then includes global ancestries in addition to the significant covariates. * edu4 was a binary variable created from the original categorical variable of education status by grouping levels 1,2,3 and coded 0, while education status level 4 was coded as 1. This was done because there were no significant associations between education levels 1 through 3 and hyperlipidemia.(DOCX)Click here for additional data file.S13 TableMethods. Model 2 then includes global ancestries in addition to the significant covariates.Model 1 models the non-genetic covariates according to the heuristic described in the (DOCX)Click here for additional data file.S14 TableModel 1 models the non-genetic covariates according to the heuristic described in the Methods. Model 2 then includes global ancestries in addition to the significant covariates. * edu3 was a ternary variable created from the original categorical variable of education status by grouping levels 1 and 2. This was done because there were no significant associations between education levels 1 and 2 with ischemic heart disease.(DOCX)Click here for additional data file.S15 TableMethods. Model 2 then includes global ancestries in addition to the significant covariates.Model 1 models the non-genetic covariates according to the heuristic described in the (DOCX)Click here for additional data file.S16 TableTable 2 accounting for the impact due to neighborhood SES, we adopted the same model  but dichotomized the nSES variable, grouping quintiles 1\u20133 into the \u201clow\u201d nSES group, and quintiles 4\u20135 into the \u201chigh\u201d nSES group, and included the interaction terms between each of the ancestry component and the dichotomized nSES variable. Mixed effect modeling was then performed. The effect on BMI associated with each ancestry in the low and high nSES groups are provided, as well as the P-value for the interaction terms (Phet). We observed no significant interaction between ancestry and dichotomized nSES measure.For traits we analyzed in (DOCX)Click here for additional data file.S17 TableModel 1 models the non-genetic covariates according to the heuristic described in the Methods, except for sex. The residual from model 1 was then inverse normalized and tested in model 2, which includes global ancestries, sex, and interactions between global ancestries and sex. * edu4 was a binary variable created from the original categorical variable of education status by grouping levels 1,2,3 and coded 0, while education status level 4 was coded as 1. This was done because there were no significant associations between education levels 1 through 3 and BMI.(DOCX)Click here for additional data file.S18 TableS1 Table), except for stratifying based on T2D disease status. Model column provided the final model with association coefficients. * edu4 was a binary variable created from the original categorical variable of education status by grouping levels 1,2,3 and coded 0, while education status level 4 was coded as 1. This was done because there were no significant associations between education levels 1 through 3 and BMI.Model testing was performed in the same manner as the global analysis with BMI ((DOCX)Click here for additional data file.S19 TableModel 1 models the non-genetic covariates according to the heuristic described in the Methods, except for type-2 diabetes status. The residual from model 1 was then inverse normalized and tested in model 2, which includes global ancestries, type-2 diabetes status, and interactions between global ancestries and type-2 diabetes status. * edu4 was a binary variable created from the original categorical variable of education status by grouping levels 1,2,3 and coded 0, while education status level 4 was coded as 1. This was done because there were no significant associations between education levels 1 through 3 and BMI.(DOCX)Click here for additional data file.S20 TableReported P-value, associated trait, and mapped genes were provided by the GWAS catalog. Allele frequencies were either calculated from the imputed data of the 178 reference MEC Native Hawaiian individuals with estimated PNS ancestry > 90%, or obtained from 1000 Genomes Project. Frequencies were reported with respect to the minor allele in the Native Hawaiians, given in parenthesis next to the Native Hawaiian frequency estimates.(DOCX)Click here for additional data file.S21 Tablehttps://www.internationalgenome.org/1000-genomes-browsers/) or the Genome Asia data . Frequencies were reported with respect to the derived allele, given in parenthesis next to the Native Hawaiian frequency estimates.Allele frequencies were either calculated from the imputed data of the 178 reference MEC Native Hawaiian individuals with estimated PNS ancestry > 90%, or obtained from 1000 Genomes Project Click here for additional data file.S22 TableMethods). EAF, effect allele frequency in Samoans. BETA and SE refers to the effect size and standard errors, respectively, from the logistic mixed model association tests in the Samoan cohort. P-val (Samoa) and P-val (MEC-NH) provide the p-value from the logistic mixed model association tests in the Samoan cohort and MEC Native Hawaiian cohort, respectively.We attempted to replicate the association of rs370140172 and nine other proxies showing the strongest single-variant associations with a cross-sectional population based study of Samoans recruited from Independent Samoa ((DOCX)Click here for additional data file.S23 TableTo evaluate the impact of recombination map on local ancestry inference, we used the 1000 Genomes AMR population. Following the same procedure used for Native Hawaiians, we identified through unsupervised ADMIXTURE analysis 49 Peruvian (PEL) and 3 Mexican (MEX) individuals from 1000 Genomes as having > 80% Native American ancestry. We then inferred local ancestry using RFMix in 71 HapMap3 MEX individuals using the constructed reference panel of 99 CEU, 108 YRI, and 52 NA individuals from 1000 Genomes. We used three recombination map in the local ancestry inference: a HapMap2 pooled recombination map, a mis-specified African-American map, and a constant map that assumes a constant rate of 1cM/Mb across the genome. We compared in pairwise fashion the concordance of inferred ancestry across common variants between runs, and calculated concordance rate as the sum of the diagonal of the contingency table. Across all comparisons, even when using a constant rate map, the concordance rate is extremely high , suggesting that the choice of recombination map does not strongly impact the local ancestry inference using RFMix.(DOCX)Click here for additional data file.S24 TableThese traits were studied in PAGE consortium and we thus follow the same criteria and transformation.(DOCX)Click here for additional data file.S25 TableSummary statistics reported after exclusion and transformation as described in (DOCX)Click here for additional data file."}
+{"text": "Osteopathy is commonly used for spinal pain, but knowledge about back pain management by osteopaths is scarce.The aim of this study was to survey osteopaths across the French-speaking part of Switzerland about the scope of their practice and their management of patients with back pain.Setting and participants: All registered osteopaths of the French-speaking part of Switzerland were asked to complete the survey. Outcome measures: In addition to descriptive statistics , we explored variables associated with osteopaths\u2019 practice, such as age and gender.This cross-sectional observational study was based on an online survey conducted from March to June 2017. A total of 241 osteopaths completed the questionnaire (response rate: 28.8%). Almost two thirds of osteopaths were female. Ages ranged from 25 to 72 years with an overall mean of 42.0 (SD 10.7) years. Male osteopaths reported more weekly working hours than female osteopaths did . Almost a third  of osteopaths could arrange an appointment for acute conditions on the same day and 62.0% within a week. Acute or subacute spinal conditions, mainly low back and neck pain, were the most frequent conditions seen by our respondents. For 94.4% of osteopaths, one to three consultations were required for the management of such conditions.Osteopaths play a role in the management of spinal conditions, especially for acute problems. These findings, combined with short waiting times for consultations for acute conditions, as well as prompt management capabilities for acute low back and acute neck pain, support the view that the osteopathic profession constitutes an added value to primary care. Osteopathy has gained popularity over the past decades and is recommended in several national guidelines as a management option for low back pain \u20134. AccesThe yearly use of osteopathy in the population aged 15 and older is slightly rising in Switzerland, as it was reported to be 5.4% in 2007  and 6.2%In Switzerland, the osteopathic profession is in the process of transition. Since 2006, in order to set standards in their professional competences, practitioners with a diploma in osteopathy (D.O) and a two-year internship have been invited to take a two-stage examination at the Swiss Conference of Cantonal Health Directors (GDK-CDS) . Since tDespite its recognition as a primary healthcare profession in Switzerland, osteopathy is not yet covered by mandatory basic health insurance but is part of private supplemental insurance plans. Health insurance companies provide a wide range of supplemental insurance options with no guarantee of admission and only partial reimbursement. To date, private supplemental insurance plans have covered osteopaths with a GDK-CDS diploma, a master\u2019s degree in osteopathy, or a D.O under the same conditions.In Switzerland, a detailed practice review was conducted in 2017 , which oThis cross-sectional observational study was based on an online, anonymous, practice-based survey conducted between March and June 2017. The survey was sent to all osteopaths recorded in at least one of these registries: EMR  and ASCA (Fondation Suisse pour les m\u00e9decines compl\u00e9mentaires). The detailed study design is explained elsewhere ; howeverAll registered osteopaths practicing in the western part of Switzerland and having French as their language of correspondence were eligible for the study (n = 838). GDK-CDS diploma holders, non- GDK-CDS diploma holders (including assistant osteopaths and osteopaths with a D.O), and physicians with an osteopathic diploma were included.We developed an online questionnaire by using LimeSurvey software on the basis of the literature and existing surveys , 26, 27.Standard descriptive analyses  were used to summarize demographic variables, practice characteristics, patients\u2019 profiles, scope of treatment modalities, health promotion, research, and osteopathic practice. Comparisons between subgroups of continuous variables were completed by using independent t-tests or nonparametric tests, depending on normality of distribution. Other associations were explored by using bivariate and multivariate analyses. Associations between the use of techniques and age, gender, years of practice, and GDK-CDS diploma were explored with multivariate logistic regression. In particular, for each technique, the dependent variable was considered positive if the technique was used \u201coften\u201d or \u201cvery often\u201d by the practitioner and negative if it was used \u201cnever,\u201d \u201crarely,\u201d or \u201csometimes.\u201d The four independent variables were all dichotomized: <40 years old versus \u226540 (age), male versus female (gender), <15 years of practice versus \u226515, and GDK-CDS diploma versus no GDK-CDS diploma. Analyses were performed with R (3.4.3) statistical software.Among the 838 osteopaths who received the link to the questionnaire, 241 completed it, for an overall response rate of 28.8%. Almost two thirds of osteopaths were female. Ages ranged from 25 to 72 years with an overall mean of 42.0 (SD 10.7) years. Female practitioners were younger  than male practitioners . The socio-demographic data are reported in The majority of osteopaths were self-employed . Most osteopaths worked in one  or two  practice locations. A majority of osteopaths worked exclusively in a group practice  and 22.4% (n = 54) worked exclusively alone. The mean number of monthly consultations was 117.3 (SD 50.8). The average weekly number of hours of practice was 34 (SD 10.3), including 3.5 hours dedicated to administrative paperwork related to clinical practice. On average, the respondents took 5.7 weeks (SD 1.8) of vacation per year. The mean time spent with their patients was 48.8 minutes (SD 7.5) on the first visit, 45.0 minutes (SD 6.9) for a return visit, and 42.4 minutes (SD 7.3) for a follow-up visit.Over one fourth  of osteopaths could arrange an appointment for an acute condition on the same day, and 62.0% could do so within a week. Regarding nonurgent appointments, 3.8% (n = 9) of osteopaths could arrange a nonurgent appointment the same day, 48.2% (n = 113) the following week, and 44.0% the following month (n = 103).The participants reported that the majority  of patients were 19\u201364 years old, 14.1% (n = 33) were 2 years old or younger, 15.9% (n = 37) were between 3 and 18 years old, and 16.0% (n = 38) were older than 65 years. The mean proportion of female patients reported by osteopaths was 63.4% (SD 9.0).The top three reasons for consultation reported by osteopaths in the past year, rated as often and very often, were low back pain (including sciatic pain and lower limb pain), followed by neck pain and then thoracic spine pain (including thoracic pain and rib pain). The frequencies of the primary reported reasons for consultation for adults are presented in Respondents reported that patients consulted mainly for pain that lasted less than four weeks (acute) and for pain that lasted four to six weeks (subacute) , followed by patients who consulted for chronic pain .For the management of acute low back pain and acute neck pain, 94.4% of responding osteopaths estimated that one to three treatments were required for the management of those symptoms. More precisely, for acute low back pain, 7.7% (n = 18) of participants estimated improvement or resolution to be achievable in one visit, 44.4% (n = 104) in two visits, 42.7% (n = 100) in three visits, and 4.7% (n = 11) in four to six visits. For acute neck pain, 7.7% (n = 18) of participants estimated improvement or resolution to be achievable in one visit, 48.7% (n = 114) in two visits, 38.0% (n = 89) in three visits, and 5.6% (n = 13) in four to six visits. More than 80% (n = 182) of osteopaths considered that every second patient with acute low back pain consulted them exclusively.The frequency of techniques used in osteopaths\u2019 daily practice is presented in All osteopaths reported discussing health promotion and disease prevention in areas such as postural hygiene and physical activity , depression , lifestyle habits and nutrition , smoking prevention , melanoma , alcohol prevention , and breast cancer  as part of their patients\u2019 management. A total of 94.7% (n = 216) of participants felt that osteopathy should be integrated into usual care. More than half of the participants  were not in favor of having consultation costs covered by basic health insurance, 27.7% (n = 66) were in favor, and 18.1% (n = 43) answered that they did not know.Almost all participants  were in favor of research regarding osteopathy. Participants evaluated the importance  of eight research fields. More than two thirds of the participants estimated that the following research topics ranged from important to extremely important: defining the role of osteopathy within the healthcare system  and studying the efficacy of osteopathic treatments , the mechanism of action , and the risks (61.4%) of osteopathic treatment. Half of the participants  felt that research on the cost-effectiveness of osteopathic management was important to extremely important. Less than a third of participants felt that describing practitioners\u2019 profiles  and patients\u2019 profiles  was important to extremely important.In our sample, the mean number of years of practice was higher in male osteopaths than in female osteopaths , as were the weekly working hours . On average, male osteopaths reported more monthly consultations than female osteopaths did , as well as seeing more new patients per month . Female osteopaths reported spending more time during an encounter with a new patient than male osteopaths did , at a follow-up visit , and for a returning patient and a new reason for consultation .In multivariate logistic regression analyses, we explored each technique used by respondents in their daily practice adjusted for age, gender, years in practice, and having a GDK-CDS diploma . Older aOur results provide insights into osteopaths\u2019 profiles and practice activities with an emphasis on their management of patients with back pain. In this study, osteopaths mostly treated patients with acute symptoms, primarily spinal pain, and most of the time, one to three consultations were reported to manage such conditions. Visceral and soft tissue techniques were the most frequently applied, whereas biodynamic and cervical HVLA thrust techniques were less frequently used.Regarding clinical practice characteristics, the mean number of years of osteopathic practice was higher for males than for females, as were weekly working hours. The higher number of working hours for male osteopaths could be explained by more male osteopaths working full time, a gender gap found in other professions . As for Concerning the techniques used, our results present many similarities with comparable studies conducted in Switzerland, Canada, Australia, and the United Kingdom , 16,34. Cervical spine HVLA techniques (thrust techniques) were the second least frequently used method. Indeed, cervical HVLA manipulation is a source of much debate in manipulative therapy because of the potential serious adverse events related to this technique , 37. LesIn this study, osteopaths reported mostly treating patients with acute symptoms, which were primarily spinal conditions, mainly low back and neck pain, as confirmed by a recent Swiss study  and otheRegarding the primary reason for pediatric consultations reported by our respondents, a Canadian study described similar findings, consultations being mostly for plagiocephaly disorders, postnatal torticollis assessment, and otorhinolaryngeal disorders .Osteopaths rated research in osteopathy as important, which is in line with previous results , 15, espAlthough almost all participants considered that osteopathy should be integrated into the conventional care system, the majority also stated that they did not want to have their consultation costs covered by the mandatory basic health insurance. However, in order to be fully integrated in the conventional care system and accessible to the whole Swiss population, osteopathy would have to be part of the mandatory health insurance coverage. This discrepancy might reflect concerns of our respondents regarding loss of professional identity and freedom due to restrictions on practice, as well as increased paperwork. Notwithstanding this, considering the high use of osteopathy for back pain only and the increasing data on the benefits of osteopathy for back pain , 47\u201350, The study has some limitations. The questionnaire was not validated, which has implications on the reliability and the internal consistency of the information collected. In addition, the response rate was relatively low and female osteopaths were overrepresented in our study compared with the number of female osteopaths in the registries (62.8% vs 51.6%); thus, our results might not be generalizable to the entire osteopathic population. Our sample was otherwise representative in terms of age and practice location. A lack of interest in this type of research could explain the low response rate, since only less than a third of participants considered that describing practitioners\u2019 profiles and patients\u2019 profiles was important to extremely important. The length of the questionnaire may also have negatively influenced the response rate. Second, because the questionnaires were collected during a specific three-month period, it is possible that our findings are not representative of an annual consultation. Third, the questionnaire was self-administered which could induce a social desirability bias. Finally, we surveyed only osteopaths who were working in the French-speaking part of Switzerland, as logistical constraints did not allow us to carry out a survey on the whole of Switzerland in two other languages .Our study provides new information about the characteristics of osteopaths in the French-speaking part of Switzerland, particularly about their role in the management of spinal conditions. These findings, combined with short waiting times for consultations for acute conditions, as well as prompt management capabilities for acute low back and acute neck pain, support the premise that the osteopathic profession could constitute an added value to primary healthcare.S1 SurveyPractitioners\u2019 profile and scope of back pain management (an online survey).(DOCX)Click here for additional data file.S2 SurveyProfil des praticiens et prise en charge du mal de dos (un questionnaire en ligne).(DOCX)Click here for additional data file."}
+{"text": "Pathological accumulation of microtubule associated protein tau in neurons is a major neuropathological hallmark of Alzheimer\u2019s disease (AD) and related tauopathies. Several attempts have been made to promote clearance of pathological tau (p-Tau) from neurons. Transcription factor EB (TFEB) has shown to clear p-Tau from neurons via autophagy. However, sustained TFEB activation and autophagy can create burden on cellular bioenergetics and can be deleterious. Here, we modified previously described two-plasmid systems of Light Activated Protein (LAP) from bacterial transcription factor\u2014EL222 and Light Responsive Element (LRE) to encode TFEB. Upon blue-light (465 nm) illumination, the conformation changes in LAP induced LRE-driven expression of TFEB, its nuclear entry, TFEB-mediated expression of autophagy-lysosomal genes and clearance of p-Tau from neuronal cells and AD patient-derived human iPSC-neurons. Turning the blue-light off reversed the expression of TFEB-target genes and attenuated p-Tau clearance. Together, these results suggest that optically regulated TFEB expression unlocks the potential of opto-therapeutics to treat AD and other dementias. MAPT) predominately localizes to axons where it binds to microtubules. Tau is known to promote nucleation, stabilization, and prevent disassembly of microtubules    Fig 1A)5] [Fig 11xNLS or 2xNLS) sequences [2xNLS, showing the most robust induction of luciferase expression in N2a cells  and the pC120-Fluc (referred to as the \u2018light-response element\u2019 or \u2018LRE\u2019), resulted in optically-induced expression of the firefly luciferase reporter. We observed robust luciferase expression and activity driven by the LAP-LRE interaction in HEK293T cells . Howeverequences ,52  0N3R \u2013non-mutant tau, when over-expressed can lead to Pick\u2019s Disease (PiD) [(2) 0N3R (T231D/S235D) tau, which mimics hyperphosphorylation on T231/S335 sites and is known to disrupt tau\u2019s interaction with microtubules [(3) 0N4R \u2013non-mutant tau, but over-expression can lead to progressive supranuclear palsy (PSP) [(4) 0N4R-P301L mutant tau, which cause FTDP-17T [cis-p-Tau  [To test the ability of optically induced transgene expression to clear p-Tau, we chose TFEB, which is a well-established regulator of autophagy, and previously implicated in clearing tau via constitutive activation ,30,53,543 and 10 . Exon 103 and 10 . Exons 23 and 10 . In norm3 and 10 . Besidesse (PiD) , (2) 0N3otubules , (3) 0N4sy (PSP) , and (4)FTDP-17T ,60. Otheat T231) ,61,62, Tat T231)  as well at T231)  characteWe observed that TFEB-GFP distribution appeared homogenous throughout cells, indicating that overall nuclear entry of the TFEB was relatively low. To achieve better nuclear entry of TFEB, we tested S211A mutation in TFEB, which was previously shown to prevent phosphorylation by mTORC1  thereby SV40NLS-LAP or pCMV-LAP-2xNLS and pLRE-TFEB (S211A)-GFP plasmids. The cells were stimulated with blue light for 12h and immunostained to detect the levels of LAP (VP16) and LRE (TFEB (S211A)-GFP). In the initial characterization studies, we tested the Opto-TFEB at three different time points  in N2a cells. Our results suggested that 12 h time point showed optimum levels of light-induced expression of TFEB-FLAG (not shown). Substitution of the SV40 promoter for a CMV promoter, along with the addition of a second cMyc NLS resulted in a significant increase of TFEB expression  with light stimulation compared to the \u2018Dark\u2019 control  in N2a cells, we co-transfected N2a cells with either pCMV control . As expel (2xNLS .5\u2019GTCACGTGAC3\u2019) in their promoter regions [As mentioned, many of the target genes activated by TFEB have been identified, and all carry the consensus CLEAR motif ( regions . To dete regions . The pCL2xNLS and pLRE-TFEB (S211A)-GFP in N2a cells. Analysis of TFEB(S211A)-GFP and Tau12 through western blot revealed statistically significant increase in TFEB expression -GFP) and co-transduced sAD2.1 iPSNs (see methods). Similar to results in N2a cells, light-exposed iPSNs displayed a significant increase in TFEB-GFP and a consequential decrease in both AT8 and AT180 p-Tau levels compared to Dark controls  line from a patient with sporadic AD (sAD2.1) . As prevcontrols . Lastly,ls 2xNLS andigration . On day g levels . Taken tHere we demonstrate the utility of an optical system to transiently regulate expression of TFEB, which is a master transcriptional regulator of autophagy to reduce the load of pathological forms of tau on neurons. We had to optimize the promoter and NLS of the original described system  in orderin vivo, or oxygen-glucose deprivation (OGD) in vitro [Not only have we shown successful light controlled expression of TFEB, but we also effectively enhanced the autophagy flux via mutation of mTORC1 site\u2014S211A, which facilitated nuclear entry of TFEB and robust clearance of p-Tau in the human AD derived iPSNs. AT8 and AT180 show an increase on Day 2 (when the Light is off), which complements with notable tau buildup due to Dark . Considering the reproduction of p-Tau on the day after light was turned off, proves a spatio-temporal dynamic with our Opto-TFEB system and we hypothesize when turning off autophagy, the potential kinases are likely activated again and/or likelihood of re-accumulation of hyperphosphorylated tau. However, to achieve sustained suppression of p-Tau, precise titration of light-dosage is necessary. It is also essential to induce Opto-TFEB in various time-points during the course of p-Tau pathogenesis, to assess cell toxicity besides characterizing the optimum illumination dosage of blue light to achieve precise Opto-TFEB induction to be beneficial. One of the potential limitations of inducing transcription factors is likelihood of strict regulation and compensation . Furtherin vitro . Interesin vitro . Furtherin vitro  or ischein vitro . Lastly,in vitro . Thus, fcistauosis relevant to AD[in vivo studies. Therefore in vivo applications of Opto-TFEB are still questionable. Nonetheless, re-validation of this approach by other independent groups with improved efficacy may likely create a novel platform for optogenetic-based strategies to target multiple cellular signaling cascades that drive a variety of neurodegenerative (and other) diseases.Nonetheless, our study demonstrates the expression and functional efficacy of neuronal Opto-TFEB in inducing the expression of CLEAR network genes for the induction of autophagy-lysosomal pathways and p-Tau clearance. It may be interesting to see if tunable Opto-TFEB expression system would work in other cell types within the CNS. Conversely, it is also important to determine whether or not such regulation is applicable to other genes of interest . Moreover, our current proof-of-concept studies on Opto-TFEB specifically targeted against the shortest isoform of tau with phosphorylation-mimicking mutations (0N3R-T231D/S235D). The 0N3R tau is directly relevant to AD . HoweveS1 FigTau12, GFP and GAPDH specific bands (red arrows) in the uncut blots showing in (PDF)Click here for additional data file.S2 FigTau12, GFP and GAPDH specific bands (red arrows) in the uncut blots showing in (PDF)Click here for additional data file.S3 FigVP16, Tau12, GFP and GAPDH specific bands (red arrows) in the uncut blots showing in (PDF)Click here for additional data file.S4 FigGFP, Tau12, VP16, AT8, AT180 and GAPDH specific bands (red arrows) in the uncut blots showing in (PDF)Click here for additional data file."}
+{"text": "Over the last two decades, activity\u2010based protein profiling (ABPP) has been established as a tremendously useful proteomic tool for measuring the activity of proteins in their cellular context, annotating the function of uncharacterized proteins, and investigating the target profile of small\u2010molecule inhibitors. Unlike hydrolases and other enzyme classes, which exhibit a characteristic nucleophilic residue, oxidoreductases have received much less attention in ABPP. In this minireview, the state of the art of ABPP of oxidoreductases is described and the scope and limitations of the existing approaches are discussed. It is noted that several ABPP probes have been described for various oxidases, but none so far for a reductase, which gives rise to opportunities for future research. Off the beaten track: Activity\u2010based protein profiling (ABPP) is a technique that enables functionally active enzymes to be studied. The specific molecular design of the probe allows the study of different families of enzymes. This minireview describes the successes and challenges of using ABPP to study oxidoreductase enzymes, which still represent an underexplored goal in ABPP. It includes a warhead,The enzyme class of oxidoreductases (EC 1) comprises many functionally different enzymes. Some members are responsible for essential metabolic processes, and others are involved in the synthesis and processing of secondary metabolites. A more detailed insight into the function of oxidoreductases would not only stimulate the understanding of the biochemistry of cells but would also allow to correlate the activity of these enzymes with cellular disease states and offer opportunities for utilizing them in biocatalysis and biotechnology. More than other enzyme classes, oxidoreductases are relying on cofactors such as flavins, NADH, NADPH, PLP, heme, etc. in pursuing its catalytic function. As a consequence, it is more difficult \u2010 and sometimes impossible \u2010 to annotate their function on a gene sequence level as the encoded amino acids are not characteristic for their catalytic function. Therefore, a chemical proteomics platform such as ABPP would be of tremendous value to fill this gap to monitor individual oxidoreductases and to discover new ones. This article aims to review the current status of this field.2So far only a rather limited set of ABPP probes has been developed to investigate oxidoreductases. In the following sections the probes will be discussed in the context of the enzyme family, which they were designed to address.2.11 was developed by introducing a versatile alkyne handle, which allows selective tagging, detection, enrichment and identification of the protein\u2013probe conjugate by Cu\u2010catalyzed azide\u2010alkyne coupling. C8. A P450 enzyme could convert the substrate into anSellars et\u2005al. took inspiration of the known CYP inhibitor furanocoumarin to design the benzofuran\u2010derived probe 8 exhibited the most effective NADPH\u2010dependent binding to CYP3A4, which is also the most abundant P450 in the human body.epoxyfuran, which would be electrophilic enough to be attacked by protein nucleophiles Figure\u2005.[33] P2.29, by attaching a click handle at the phenyl ring para to the propargylamine warhead. I2.52O2. Whereas regular MPO activity is important for the normal host defense mechanism against pathogens, the persistent activation of MPO has been implicated in several disorders such atherosclerosis, rheumatoid arthritis, chronic obstructive pulmonary disease or neuroinflammation, making it attractive as a pharmacological target. Kettle and coworkers have identified 2\u2010thioxanthine (19) as a mechanism based inactivator of MPO.19 into a radical. This reactive species ultimately induces a covalent linkage of the thioxanthine ring to the methyl group of the heme via a thioether bond. Ahn from Pfizer converted compound 19 into the ABPP probe 20  is a heme peroxidase in neutrophils that catalyzes the synthesis of hypochlorous acid (HOCl) from chloride anions and H0 Figure\u2005. This co2.62) into polyunsaturated fatty acids, such as arachidonic acids. An important mammalian representative is 15\u2010lipoxygenase\u20101 (15\u2010LOX\u20101) playing a role in the biosynthesis of leuktorienes, lipoxins, 15\u2010HPETE, 15\u2010HETE and eoxins. 15\u2010LOX\u20101 has gained attention as a drug target as its activity is associated with allergic airway diseases, atherosclerosis, cancer and various CNS diseases. The group of Dekker has designed the ABPP probe 21, which mimics the natural polyunsaturated fatty acid substrate but contains a bispropargylic warhead  are Fe\u2010containing dioxygenases, which catalyze the stereospecific insertion of molecular oxygen , the bioactive form of vitamin A, is the oxidation of retinaldehyde (27) catalyzed by three retinaldehyde dehydrogenases . The oxidation involves the nucleophilic attack of a Cys of the dehydrogenase forming a thioacetal, which is oxidized to the thioester adduct 28, followed by the release of compound 29 by hydrolysis (Scheme\u200529) regulates several cellular functions by binding to the retinoic acid receptor modulating gene transcription. In particular, it influences cancer stem cell proliferation. By analyzing available structural information of ALDH1A1 the group of van der Stelt rationally designed ABPP\u2010probe LEI\u2010945 (30), which features a vinyl ketone warhead as a Michael acceptor addressing the reactive Cys residue and an attached alkyne handle for click chemistry tagging.30 quite selectively binds to the three retinaldehyde dehydrogenases. Importantly, it does not react with other proteins known to have a \u201chyperreactive\u201d cysteine,30 enabled the comparative profiling of retinaldehyde dehydrogenase activity in a series of cancer cells.A crucial step in the biosynthesis of s Scheme\u2005. ATRA (230) proved to be useful as a probe specific for retinaldehyde dehydrogenases, it would also be desirable to have a broad\u2010spectrum probe for aldehyde dehydrogenases. The group of van der Stelt designed an ABPP probe based on the pan\u2010ALDH inhibitor Aldi\u20102 (31), which has a masked warhead. Base\u2010induced elimination converts the \u03b2\u2010aminoketone into vinylketone 32, an electrophilic trap for the reactive Cys in ALDHs. The corresponding pan\u2010ALDH ABPP probe STA\u201055 (33) contains an azide click\u2010handle  was used for the in\u2005situ selectivity profiling of three known ALDH\u2010inhibitors by competitive ABPP.Although LEI\u2010945 \u2010dependent oxygenases are predicted in humans. These Fe\u2010containing enzymes play important roles in collagen biosynthesis, histone modification, lipid metabolism and hypoxic response.34 .35 was labeling LSD\u20101, but when the samples were pre\u2010incubated with a LSD\u20101 inhibitor they could not observe an activity dependence in the observed labeling  is a FAD\u2010dependent amine oxidase acting on histones mediating transcriptional activation and repression. The group of Dekker designed ABPP\u2010probes for the detection of LSD\u20101 activity based on the known inhibitor g Figure\u2005.36  is an enzyme cofactor used for various chemical transformations of biological amines in cellular processes, including the oxidation of amino acids to \u03b1\u2010keto acids. PLP\u2010dependent enzymes are evolutionary diverse, which makes its classification via sequence homology challenging. The group of Sieber has designed a pyridoxal analogue containing an alkyne click tag in the 2\u2019\u2010position which is taken up by cells and phosphorylated to form the PLP analogue 6 Figure\u2005,[53, Bak et\u2005al. have developed a chemoproteomic platform to monitor selenocysteine reactivity by performing iodoacetamide\u2010labeling at low pH (pH\u20055.75), which allows them to suppress the alkylation of the more frequent and abundant Cys\u2010containing proteins. While this approach does not explicitly differentiate for oxidoreductase enzymes, it should be mentioned in this context since a large share of the 25 human selenoproteins have been assigned as oxidases or reductases.31 for P450s, 13 for aerobic flavoproteins, and 33 for aldehyde dehydrogenases are rather general. These compounds follow the general aim in ABPP, providing a universal probe that reacts with most members of the enzyme family to study. This approach could be used for metabolic profiling and comparative ABPP addressing the target\u2010specificity of small\u2010molecule inhibitors. In contrast, it is also desirable to have highly specific probes, allowing to measure the activity of a specific protein and, in the case of a related covalent inhibitor, determine the mode of action and target profile of such a drug. The quite specific probes 9 and 12 for MAO, 20 for MPO, and 30 for retinaldehyde dehydrogenases fulfill this second goal of ABPP research.The examples highlighted in this minireview have shown that for a few of the most important classes of oxidases ABPP probes have been developed. The probes It has to be noted that all examples highlighted in this minireview describe the ABPP of oxidases. So far, no ABPP for reductases has been reported. Mechanistically it is more straightforward to design a warhead for an activity\u2010based probe for an oxidase, as by oxidation of a functional group very often a more electrophilic group is formed .As the field is still at the beginning, there are many opportunities for future research, especially the terra incognita of ABPP of reductases has to be conquered. The work of Sieber with PLP enzymes has shown that with functionalized cofactor\u2010mimics a global understanding of the interactome of a cofactor on proteomic scale could be achieved. This approach could be of special interest for application to oxidoreductases as many of these enzymes are cofactor\u2010dependent and a suitable probe could stimulate the functional annotation of so far uncharacterized proteins. It will be exciting to see how both newly developed pan\u2010family ABPP probes as well as protein\u2010specific ABPP probes will answer unsolved biological questions in the future.Note added in proof35 discussed above) shows promiscuos protein labelling.The group of Sieber very recently reported an ABPP and photoaffinity labelling study in which they could show that the MAO inhibitor tranylcypromine  with M. T. Reetz. After post\u2010doctoral studies at Harvard University with E. N. Jacobsen, he started his independent career at the MPI of Molecular Physiology in Dortmund (Germany). Since 2007, he has been a full professor of Organic Chemistry at Graz University of Technology (Austria)."}
+{"text": "Medicago sativa L.) were investigated following foliar Zn applications. Zinc uptake and redistribution between shoot and root were determined following application of six Zn doses to leaves. Twelve putative genes encoding proteins involved in Zn transport  were identified and changes in their expression following Zn application were quantified using newly designed RT-qPCR assays. These assays are the first designed specifically for alfalfa and resulted in being more efficient than the ones already available for Medicago truncatula . Shoot and root Zn concentration was increased following foliar Zn applications \u2265 0.1 mg plant\u22121. Increased expression of MsZIP2, MsHMA4, and MsNAS1 in shoots, and of MsZIP2 and MsHMA4 in roots was observed with the largest Zn dose (10 mg Zn plant\u22121). By contrast, MsZIP3 was downregulated in shoots at Zn doses \u2265 0.1 mg plant\u22121. Three functional gene modules, involved in Zn uptake by cells, vacuolar Zn sequestration, and Zn redistribution within the plant, were identified. These results will inform genetic engineering strategies aimed at increasing the efficiency of crop Zn biofortification.Zinc (Zn) is an essential micronutrient for plants and animals, and Zn deficiency is a widespread problem for agricultural production. Although many studies have been performed on biofortification of staple crops with Zn, few studies have focused on forages. Here, the molecular mechanisms of Zn transport in alfalfa ( A large proportion of the world\u2019s population suffers from Zn-related diseases , since they rely on cereal-based diets with low Zn content due to poor soil Zn availability ,2,3,4. D2 fixation, protein synthesis, free radical capture, regulation of growth and development, and disease resistance  \u00d7 100, where S is the slope of the standard curve. The evaluation of the reference genes based on the cycle threshold (Ct) values made us choose the actin gene (MsACT-101) for quantifying relative gene expression in the shoots and the elongation factor 1-\u03b1 (MsEF1-\u03b1) gene for quantifying relative gene expression in roots  were designed . The Pri MtMTP1; ,52,86). agnitude . The conin roots . This chectively .\u22121) and the control plants to which no foliar Zn had been applied (24 RNA extractions). Any DNA in the RNA extracts was removed by a DNase treatment . The purity of the RNA extracts was verified by spectroscopic light absorbance measurements at 230, 260, and 280 nm using the NanoDrop 2000  [MsACT-101 and MsEF1-\u03b1 across all cDNA samples. Relative gene expression was calculated using the double standardization (\u0394\u0394Cq) method that requires a reference gene and a control treatment [Total RNA was extracted from 50 mg subsamples of fresh shoot and root tissue using the RNeasy Mini Kit . The extractions were performed from tissues of plants treated with the foliar Zn doses that produced a significant increase in Zn concentration in shoots  . The intreatment .M. truncatula. This allowed for the identification of gene sequences encoding potential metal transporters and chelators in the whole M. sativa genome. The sequences obtained were aligned with the corresponding sequences from M. truncatula, and the length of the M. sativa genes was determined after removing the external unaligned nucleotides. The M. sativa and M. truncatula ZIP gene sequences were also aligned with those of other plant species  obtained from a search of GenBank. Similarly, the M. sativa and M. truncatula gene sequences of ZIF1, MTP1, YSL1, HMA4, and NAS were aligned with their corresponding sequences of other plant species  obtained from a search of GenBank. Sequence alignments were performed using the algorithm ClustalW in MEGA X [M. sativa Zn transport-related gens. This was based on the assumption of a simple equivalence between a minimum similarity threshold in the phylogenetic comparisons and the function similarity between encoded proteins. For some proteins belonging to the same family, this assumption can hold true, since they have been shown to have very tightly correlating functions, such as those considered in this study. Thus, functions are indicated with high probability by annotations based on similarities. The phylogenetic trees were inferred by neighbor-joining (NJ) analysis [A BLAST search was performed in the Alfalfa Gene Index and Expression Atlas database using the ZIP1-7, ZIF1, MTP1, YSL1, HMA4, and NAS coding sequences from n MEGA X . Phylogeanalysis  in MEGA analysis . Branch P-values were calculated using the Monte Carlo test [The effect of the application of the foliar Zn on tissue Zn concentration and on the expression of the selected genes was analyzed in shoots and roots separately by one-way analysis of variance (ANOVA), followed by a Tukey-B test in the case of significance of the response to foliar Zn application. When required, gene expression data were log-transformed to meet the ANOVA assumptions. The data displayed graphically are the means and associated standard errors of the untransformed raw data. All statistical analyses were performed using the software package SPSS version 21.0 . Permutational analysis of variance (PERMANOVA)  was usedrlo test . Since Prlo test ) was perrlo test . Finallyrlo test , using tMsZIP2 as foliar Zn doses increased suggests the detoxification of excess Zn through the accumulation of Zn in xylem parenchyma cells. A decrease in the expression of MsZIP3 as foliar Zn doses increased suggests a reduction in the Zn influx capacity of shoot cells to reduce Zn uptake. An increase in the expression of MsHMA4 in roots and shoots as foliar Zn doses increased suggests an increase in the transport of Zn in the xylem when plants are subject to Zn toxicity, while an increase in the expression of MsNAS1 in the shoot suggests the chelation of excess Zn in the shoot, enabling Zn sequestration in vacuoles or the redistribution of Zn to roots via the phloem. The elucidation of three functional modules of genes involved in (a) Zn influx to cells, (b) sequestration of Zn in the vacuole, and (c) redistribution of Zn within the plant are fundamental to understanding the molecular mechanisms of cytoplasmic Zn homeostasis and might inform the selection of appropriate genotypes enabling greater Zn accumulation in edible portions or increased tolerance of Zn in the environment.This is the first study to characterize the expression of genes related to Zn transport processes following foliar Zn application to a forage legume, providing new molecular insights to the responses of Zn transport-related processes to foliar Zn applications. A significant increase in the expression of"}
+{"text": "These outstanding electrochemical properties enlist zinc-ion batteries constructed with Zn88Al12 alloy anode and KxMnO2 cathode to deliver high-density energy at high levels of electrical power and retain 100% capacity after 200\u2009hours.Metallic zinc is an attractive anode material for aqueous rechargeable batteries because of its high theoretical capacity and low cost. However, state-of-the-art zinc anodes suffer from low coulombic efficiency and severe dendrite growth during stripping/plating processes, hampering their practical applications. Here we show that eutectic-composition alloying of zinc and aluminum as an effective strategy substantially tackles these irreversibility issues by making use of their lamellar structure, composed of alternating zinc and aluminum nanolamellas. The lamellar nanostructure not only promotes zinc stripping from precursor eutectic Zn Aqueous rechargeable Zn-ion batteries are attractive energy storage devices, but their wide adoption is impeded by the\u00a0irreversible metallic Zn anode. Here the authors report lamellar-nanostructured eutectic Zn/Al alloys as reversible and dendrite-free anodes for improved battery performance. Among many electrochemical energy storage technologies, rechargeable battery based on Zn metal chemistry in neutral aqueous electrolyte is one of the most attractive devices by virtue of metallic Zn having high volumetric and gravimetric capacity (5854\u2009mAh\u2009cm\u22123 and 820\u2009mAh \u2009g\u22121), low Zn/Zn2+ redox potential (\u22120.76\u2009V versus standard hydrogen electrode), high abundance and low cost4. Along with high ionic conductivities (up to 1\u2009S\u2009cm\u22121) of aqueous electrolytes and two-electron redox reaction of Zn/Zn2+ that favor high rate capability and high energy density, respectively, aqueous rechargeable Zn-ion batteries (AR-ZIBs) promise safe and low-cost high-density energy storage/delivery at fast charge/discharge rates for stationary grid storage applications6. This has prompted the recent renaissance of AR-ZIBs8, with the development of various cathode materials including polymorphous manganese dioxides13, vanadium oxides19, Prussian blue analogues (PBAs)21 and quinone analogs22 for hosting/delivering Zn2+ and/or H+ via insertion/extraction or chemical conversion reactions25. However, no matter which advanced material is employed as the cathode, state-of-the-art AR-ZIBs are persistently plagued by the irreversibility issues of traditional metallic Zn anode26, such as dendrite formation and growth28 and low coulombic efficiency (CE) associated with side reactions  during the stripping/plating processes31. Although the Zn dendrite formation could be effectively alleviated in neutral electrolytes compared with in alkaline solutions9, it is inherently unavoidable because of the unique metallurgic characteristics of monometallic Zn31. Furthermore, there always take place uncontrollable shape changes to produce abundant cracks or defects in the repeated processes of Zn stripping/plating33. The structural irreversibility triggers further Zn dendrite growth due to uneven distribution and slow diffusion of Zn2+ ions at the Zn metal/electrolyte interface33 and continuously depletes Zn and electrolyte via supplementary side reactions31, leading to rapid and remarkable capacity fading and short lifespan of AR-ZIBs. Therefore, it is highly desirable to explore novel Zn-based anode materials that can circumvent these irreversibility issues for constructing high-performance AR-ZIBs.Widespread utilization of plentiful but only intermittently available solar and wind power has raised urgent demand for the development of safe, cost-effective, and reliable grid-scale energy storage technologies for efficient integration of renewable energy sources2O3 core/shell structure. Therein, the Al protects against irreversible by-product of ZnO or Zn(OH)2 while the insulating Al2O3 shell prevents the electro-reduction of Zn2+ ions on the Al/Al2O3 patterns and thus guides their electrodeposition on the precursor Zn sites, substantially eliminating the formation and growth of Zn dendrites. As a result, the eutectic Zn88Al12 (at%) alloys exhibit superior dendrite-free Zn stripping/plating behaviors, with remarkably low and stable overpotential, for more than 2000\u2009h in O2-absent aqueous ZnSO4 electrolyte. The outstanding electrochemical properties enable the Zn-Mn AR-ZIBs constructed with eutectic Zn88Al12 alloy anode and KxMnO2 cathode to deliver energy density of \u223c230\u2009Wh\u2009kg\u22121 (based on the mass of KxMnO2 cathode) at high levels of electrical power while retaining \u223c100% capacity after more than 200\u2009hours. By adjusting the anode-to-cathode mass ratio to 3:1, the overall energy density of Zn-Mn AR-ZIB can reach \u223c142\u2009Wh\u2009kg\u22121 based on total mass of anode and cathode. The strategy of eutectic-composition alloying could open an avenue to the development of high-performance metallic anodes for next-generation secondary batteries.Here we report that a class of eutectic Zn/Al alloys with an alternating Zn and Al lamellar nanostructure as reversible and dendrite-free anode materials significantly improve electrochemical performance of aqueous rechargeable zinc-manganese oxide batteries (Zn-Mn AR-ZIBs). The unique lamellar structure promotes the reversibility of stripping/plating of Zn by making use of symbiotic less-noble Al lamellas, which in-situ form interlamellar nanopatterns with an Al/Al2+ cations thermodynamically prefer to form nuclei at the dislocated sites and grow into initial protuberances on the surface of Zn substrate with uncontrollable Zn redistribution  is much lower than that of Zn2+/Zn35, the formation of Al2O3 shell on the Al lamellas protects against the dissolution of Al and thus allows the selectively electrochemical stripping/plating of Zn in aqueous electrolyte36. Their distinct electrochemical behaviors enable the different roles of Zn and Al lamellas in the charge/discharge processes: the former supplying Zn2+ charge carriers and the latter serving as 2D hosting skeleton to accommodate the Zn plating  alloys are produced by a facile and scalable metallurgic procedure, viz. alloying pure Zn and Al metals and pouring casting at various cooling rates from \u223c10 to \u223c300\u2009K\u2009s\u22121. Supplementary Fig.\u00a088Al12 alloys, with the major peaks corresponding to the primary hexagonal closest packed (hcp) Zn phase (JCPDS 04-0831), apart from the weak ones attributed to the face-centered cubic (fcc) \u03b1-Al phase (JCPDS 04-0787) , decreases with the cooling rates  Fig.\u00a0. Distingtes Fig.\u00a0. Figure\u00a0\u2009nm Fig.\u00a0, i.e., \u223c\u2009nm Fig.\u00a0. While ilas Fig.\u00a0. Figure\u00a0las Fig.\u00a0 and the las Fig.\u00a0 separate88Al12 exhibits remarkable alloy nature, with a superior oxidation-resistance capability in air and aqueous electrolytes compared with monometallic Zn, because of the formation of stable and passive Al2O3 surface layer, which protects against the further oxidation40. As shown in optical photographs ; in the middle-frequency range, the diameter of semicircle corresponds to the charge transfer resistance (RCT) and the double-layer capacitance (CF); and the slope of the inclined line at flow frequencies is the Warburg resistance (Zw). Based on the equivalent circuit with these general descriptors  because of the outstanding oxidation-resistance property. Even extending the immersion time to 10\u2009h, the Zn88Al12 still maintains \u223c11\u2009\u03a9 whereas the Zn electrode has the RI value to increase to \u223c22\u2009\u03a9 from \u223c18\u2009\u03a9. The large change of RI value indicates the inferior oxidation-resistance capability of the monometallic Zn. Owing to their different oxidation-resistance capabilities, there form distinct oxide layers to depress the Zn stripping/plating kinetics, indicated by the increase of RCT value. When immersed in the O2-present electrolyte for 1 and 10\u2009h, the Zn88Al12 with \u03bb\u2009=\u2009\u223c450\u2009nm exhibits exceptional stability with the RCT value changing from \u223c32\u2009\u03a9 to \u223c36\u2009\u03a9, in sharp contrast with the monometallic Zn electrode with a remarkable change of RCT from \u223c96\u2009\u03a9 to \u223c177\u2009\u03a9  , much lower than the value of symmetric Zn battery (~101\u2009mV). The less polarization is probably due to the unique eutectic structure of alternating Zn and Al lamellas in the Zn88Al12 alloy. Therein, the constituent Al lamellas not only protect against the passivation of the electroactive Zn but reduce the local current density of Zn stripping/plating via the formation of core/shell Al/Al2O3 lamellar nanopatterns 6\u00b7H2O in addition to ZnO43. These observations are in agreement with surface chemical states of Zn or/and Al, which are analyzed by X-ray photoelectron spectroscopy (XPS). After cycling test, the surface Zn of monometallic Zn electrode is completely oxidized because of the formation of Zn4SO4(OH)6\u00b7H2O and ZnO 2\u2009+\u2009Zn2+ + e\u2212 and Zn(OH)2\u2009+\u20092e\u2212 \u2192 ZnO\u2009+\u2009H2O11. Nevertheless, the lamellar structure of alternating Zn and Al lamellas significantly alleviate structure changes, in comparison with the electrodes of hypoeutectic Zn50Al50 alloy and monometallic Zn  cathode material for demonstrating its actual application in Zn-ion full batteries, with an aqueous electrolyte containing 2\u2009M ZnSO4 and 0.2\u2009M MnSO4. Therein, tetragonal \u03b1-KxMnO2 nanofibers are synthesized by a stirring hydrothermal approach intercalation mechanism within the KxMnO2, i.e., \u03b4Zn2+\u2009+\u20092\u03b4e\u2212\u2009+\u2009KxMnO2 \u2194 \u03b4ZnKxMnO212, except for boosting the reaction kinetics of Zn stripping/plating due to the absence of passivation oxide 2) on the Zn lamella surface of the Zn88Al12 , it still retains the capacity of \u223c145 mAh g\u22121, about four-fold higher than the value of the Zn/KxMnO2 battery (~36\u2009mAh\u2009g\u22121). The expectation that the lamella-structured eutectic Zn88Al12 alloy ameliorates the kinetics of Zn strippling/plating is further verified by the EIS analysis  because of ultralow insertion kinetics of Zn2+\u200943. The cycling life of Zn88Al12/KxMnO2 batteries is tested by galvanostatic charge/discharge at current densities of 0.5 and 5\u2009A\u2009g\u22121, respectively 2 by-product but also in-situ form stable Al/Al2O3 interlamellar patterns during the Zn stripping and in turn guide subsequent growth of Zn, the eutectic Zn88Al12 (at%) alloys exhibit superior dendrite-free Zn stripping/plating behaviors, with low overpotential and high coulombic efficiency, for more than 2000\u2009h in O2-absent aqueous ZnSO4 electrolyte. The use of the eutectic Zn88Al12 alloy as the anode enlists the Zn-ion full batteries with the KxMnO2 cathode to deliver energy density of \u223c230\u2009Wh\u2009kg\u22121 (based on the mass of KxMnO2 cathode) at high levels of electrical power and retain \u223c100% capacity after a long-term charge/discharge cycling measurement, remarkably outperforming the battery based on monometallic Zn anode. By adjusting the anode-to-cathode mass ratio to 3:1, the overall energy density of Zn-Mn AR-ZIB can reach \u223c142\u2009Wh\u2009kg\u22121 based on total mass of anode and cathode. The strategy of eutectic-composition alloying can also be extended to other metal anodes for the development of next-generation secondary batteries.In summary, we have proposed eutectic-composition alloying, based on the ZnxAlx100\u2212  alloys made of high-purity Zn (99.994%) and Al (99.996%) were prepared by induction melting in high-purity alumina crucibles within Ar air. These alloy ingots were produced through pouring casting, of which the cooling rates were controlled by making use of different casting moulds, i.e., the heated iron moulds (\u223c10\u2009K\u2009s\u22121) and the copper moulds with air- (\u223c30\u2009K\u2009s\u22121) and water-cooling (\u223c300\u2009K\u2009s\u22121) methods. The as-cast ZnxAlx100\u2212 ingots were cut into alloy sheets with thickness of \u223c400\u2009\u03bcm along the perpendicular direction of lamellar structure and further polished for the use as the anodic electrodes. The synthesis of K0.12MnO2 nanobelts was carried out by a modified hydrothermal method. Typically, the Teflon-lined steel autoclave filled with the mixture of 40-mM KMnO4 and 40-mM NH4Cl was heated at 150\u2009\u00b0C for 24\u2009h in an oil bath and magnetically stirred at a speed of 250\u2009rpm. The as-synthesized K0.12MnO2 nanomaterials were collected and washed with ultrapure water for five times using a centrifuge to remove residues.The ZnxAlx100\u2212 alloy sheets was investigated by using a confocal laser scanning microscope  after conventional grinding and mechanical polishing, followed by chemical etching in acetic picric solution . The electron micrographic structures were characterized by using a field-emission scanning electron microscope  equipped with an X-ray energy-dispersive microscopy, and a field-emission transmission electron microscope . XRD measurements were conducted on a D/max2500pc diffractometer using Cu K\u03b1 radiation. Ion concentrations in electrolytes were analyzed by inductively coupled plasma optical emission spectrometer . XPS analysis was conducted on a Thermo ECSALAB 250 with an Al anode. Charging effects were compensated by shifting binding energies based on the adventitious C 1s peak (284.8\u2009eV).The metallographic microstructure of ZnxAlx100- alloy or pure Zn sheets (0.5\u2009cm\u2009\u00d7\u20090.5\u2009cm\u2009\u00d7\u200940 \u03bcm), which were separated by glass fiber membrane (GFM) in 2\u2009M ZnSO4 aqueous solution with/without N2 purgation. Electrochemical stripping/plating behaviors of Zn/Zn2+ were measured by galvanostatic charge and discharge at various current densities from 1 to 5\u2009mA\u2009cm\u22122. The cycling durability tests were performed at the current density of 0.5\u2009mA\u2009cm\u22122. To prove its feasibility of the lamella-structured eutectic Zn88Al12 alloy anodes in practical aqueous rechargeable Zn-ion batteries, full cells were further assembled with the Zn88Al12 alloy sheet as the anode, the K0.12MnO2 as the cathode, the GFM as the separator, with the 2M ZnSO4 aqueous solution containing 0.2\u2009M MnSO4 as the aqueous electrolyte. Therein, the K0.12MnO2 electrodes were prepared by homogeneously mixing K0.12MnO2 nanobelts, super-P acetylene black conducting agent and poly(vinylidene difluoride) binder with a weight ratio of 70:20:10 in N-methyl-2-pyrrolidone (NMP), and then pasting on stainless steel foil with the loading mass of 1.0\u2009mg\u2009cm\u22122. Cyclic voltammetry was conducted on an electrochemical analyzer (Ivium Technology) in the voltage range of 1 and 1.8\u2009V at scan rates from 0.3 to 5\u2009mV\u2009s\u22121. Electrochemical impedance spectroscopy (EIS) measurements were performed in sealed cells with O2- or N2-saturated aqueous 2\u2009M ZnSO4 electrolytes over the frequency ranging from 100\u2009kHz to 10\u2009mHz with an amplitude of 10\u2009mV at room temperature. The rate capability and cycling performance were carried out on a battery test system. Self-discharge measurements were carried out by charging Zn88Al12/KxMnO2 to 1.8\u2009V, followed by open-circuit potential self-discharging for 600\u2009h. The coulombic efficiency (CE) of Zn plating/stripping was evaluated by chronocoulometry method, in which the eutectic Zn88Al12 alloy or pure Zn electrode were used as the working electrode and the Zn foils as the counter and reference electrodes in the three-electrode cell in the O2-absent 2\u2009M ZnSO4 electrolyte. The chronocoulometry measurements were conducted at the potential of \u22120.2 and 0.2\u2009V (versus Zn/Zn2+) for 600\u2009s, respectively to plate and stripe Zn. The CE was calculated by the stripping/plating capacities.Symmetrical cells were assembled with two identical ZnSupplementary InformationPeer Review File"}
+{"text": "ZIP transporters play a crucial role in biofortification of grains with Zn. Only a very limited information is available on structural features and mechanism of Zn transport of plant ZIP family transporters. In this article, we present a detailed account on structure, function, regulations and phylogenetic relationships of plant ZIP transporters. We give an insight to structure of plant ZIPs through homology modeling and multiple sequence alignment with Bordetella bronchiseptica ZIP (BbZIP) protein whose crystal structure has been solved recently. We also provide details on ZIP transporter genes identified and characterized in rice and other plants till date. Functional characterization of plant ZIP transporters will help for the better crop yield and human health in future.Zinc (Zn) is an essential micronutrient for plants and humans. Nearly 50% of the agriculture soils of world are Zn-deficient. The low availability of Zn reduces the yield and quality of the crops. The zinc-regulated, iron-regulated transporter-like proteins (ZIP) family and iron-regulated transporters (IRTs) are involved in cellular uptake of Zn, its intracellular trafficking and detoxification in plants. In addition to Zn, ZIP family transporters also transport other divalent metal cations (such as Cd In agriculture, the low availability of nutrients has reduced the crop production. The optimal supply of micro-nutrients in soil solutions is vital for normal agriculture production. Zinc (Zn) is one of the most essential micronutrients; it is irreplaceable for plant growth and metabolism , 2011. B2+ , iron (Fe2+), cadmium (Cd2+), cobalt (Co2+), copper (Cu2+), and nickel (Ni2+)  protein as a template. These findings would be a valuable theoretical knowledge for future studies on Zn transporters in crops. We also present details on ZIP transporter genes identified and characterized till date in various plants.To overcome low Zn availability, plants have evolved a complex array of tightly controlled adaptive mechanisms. The Zinc-regulated, Iron-regulated transporter-like Protein (ZIP) family has been identified and characterized in prokaryotes, eukaryotes, and archaeotes and has been validated to be involved in metal uptake and transport including Zn2+ . The prel (Ni2+) . The irol (Ni2+) . The AtIe AtIRT1 , AtIRT2 e AtIRT1 , and AtIe AtIRT1  transporand Cd2+ . The IRTondition . The ZIPondition . In cropondition . The detredicted . So, in Zinc is one of the eight essential micronutrients in plants . In crop2+ ions are directly involved in the synthesis of tryptophan and auxin  from the soil for the normal plant function , but yetnd auxin . Zn defind auxin . It signnd auxin . Cakmak nd auxin , mungbeand auxin , and maind auxin . Zn defind auxin  which isnd auxin . The Zn nd auxin  and wheand auxin . Ekiz et2+ . Zn ions can also be bound with root exudates like malate, citrate, oxalate and other low molecular weight organic acids which aided to move toward the root surface area (2+ ion do not freely diffuse across the lipid bilayer membranes (2+ into the cortex takes place via symplastic or apoplastic pathway (2+ into the cells and transport out of intracellular compartments. They include a low-affinity (Km = 2\u20135 \u03bcM) and high-affinity (Km = 0.6\u20132 nM) membrane transporter systems  and HMA4 transporters of P-type ATPase family are involved in xylem loading of Zn from the xylem parenchymatous cells  transport mechanism was also predicted  domains (\u03b1-helices) with 8 being the most prevalent form . The molredicted . The cryredicted . The binng sites . The topng sites . The invng sites . The Zn2of water . This stArabidopsis (12 ZIPs), rice (12 ZIPs), and maize (10 ZIPs) through a ClustalW alignment  have conserved His117 residue found in BbZIP  based on the homology models  as a template with Znmodeling . The Zn2ransport . Howevery models . Zn2+ bin AtZIP8 . The res modeled . For e.g modeled . Similar modeled . It mighlignment . This reBrassica rapa (BrZIP1), Cucumis sativus (CsZIP1), Medicago truncatula (MtZIP1), and Glycine max (GmZIP1) were clustered with AtZIP1; BrZIP3 is closely clustered with AtZIP3  and SbZIP1. The expression analysis showed the OsZIP1 gene is induced in roots under Zn starvation  is a TF involved in the regulation of many physiological processes including abiotic and biotic stress responses  are found to be essential for regulation of target genes and maintaining Zn homeostasis. Two TFs identified in model plant esponses . These Tesponses . bZIP TFficiency . The TFsficiency . The hisficiency  and suggficiency . TotallyIP19 TFs .Arabidopsis, the TFs AtbZIP19 and AtbZIP23 induce the expression of AtZIP4 gene under Zn deficiency  are found to be expressed under Zn deficiency condition in common bean  under Zn-deficient condition. TabZIPF3b-7BL have slightly increased the growth of the double mutant line under Zn-deficient condition whereas TabZIPF4-7DL did not complement the double mutant lines (bzip19 and bzip23 double mutant of Arabidopsis under Zn deficiency condition (Arabidopsis double mutant (bzip19/bzip23) under Zn deficient condition but the OsbZIP49 does not compliment the Arabidopsis double mutant (bzip19/bzip23) (In ficiency . These T AtZIP12 . Similard bZIP24 . In wholmon bean . But no mon bean . The rolnt lines . Similarnt lines . Among tondition . Recentl/bzip23) .Phosphate 1 (PHO1) are involved in Zn and Fe homeostasis in Arabidopsis  , ZAT6 D, WRKY75 bidopsis . Zn defike of Pi . PHR1 sebidopsis . The crobidopsis . Only a Arabidopsis and rice. Identification and characterization of the ZIP family genes are still lacking for many crops. Expression levels of ZIP family genes showed dynamic pattern in crops. For e.g., a few ZIP transporters are expressed only under deplete Zn conditions, so their expression is declined within 2 h when Zn is added to the medium  than those of in-efficient genotype (Erjiufeng) suggesting that these genes could contribute to high Zn efficiency  in maize genome. All eight ZmZIP proteins are localized to the plasma membrane  were identified by ZmZIP genes  are tissue-specific and are highly expressed in flag leaf except ZmZIP3 and ZmZIP12, under Zn deficient condition , a Zn transporter with higher expression under Zn deficiency (TaZIP genes were identified in bread wheat (Triticum aestivum)  were analyzed for the expression level in shoot and root under Zn starvation. In shoot, expression of all five TaZIPs increased under low Zn conditions but the timing varied between individual genes. In roots, TaZIP3, TaZIP5, TaZIP7, and TaZIP13 showed increased expression under Zn starvation with expression of only TaZIP6 gene remains fairly stable (Triticum durum) genotypes UC 1114 and MACS 3125 under three different foliar application of Zn  decreased and two genes (TdZIP10 and TdZIP15) increased during grain development  . Out of y stable . Similaron of Zn . In flagelopment . Time-dend spike . These sarvation . Till noZIP family genes have been identified and characterized in barely. HvZIP3, HvZIP5, and HvZIP8 are induced in root tissues under Zn deficient condition. These three HvZIP transporters might be involved in Zn uptake under low Zn conditions. HvZIP7 is highly induced in the vascular tissues of roots and leaves under Zn deficiency condition and its protein is localized to plasma membrane  were highly induced in Zn deficient barely (HvZIP genes are significantly increased (3-fold) in roots under Zn deficient condition (0.005 \u03bcM Zn) compared to Zn sufficient condition (0.5 \u03bcM Zn)  medium with low and high Zn treatments  are down-regulated in mycorrhizal roots at low Zn soil (Glomus contrictus or Glomus fasciculatus) enhances the Zn up-take in barely. Further studies are needed to understand the molecular mechanism of AMF-mediated Zn transport and signals and TFs involved in this symbiotic Zn uptake.Barley is a nutritionally and economically important cereal crop. Till date, only a few membrane . In anott barely . The exp5 \u03bcM Zn) . All the5 \u03bcM Zn) . The HvZeatments . Under l Zn soil . Therefo Zn soil . Kaiser SiZIP genes (SiZIP1\u2013SiZIP7) in foxtail millet. The expression pattern of seven SiZIP genes was analyzed in root, leaf, stem and spica tissues of foxtail millet grown under drought stress without any additional nutrient supplementation. All seven SiZIP genes were induced in all four tissues  with various levels of expression. The SiZIP2, SiZIP3, SiZIP4, and SiZIP5 showed relatively higher expression and low level of expression was observed with SiZIP6, in all tissues. SiZIP1 gene is moderately expressed in root, shoot and spica and very least expression was seen in leaf  could be used for the bio-fortification process for the enrichment of Zn into the seeds of foxtail millet. The functional characterization of ZIP genes in foxtail millet could aid to improve the Zn uptake in foxtail millet and other minor millets.Foxtail millet is one of the food security minor cereal crops in low input regions. It is a domesticated diploid C4 crop having a small genome (\u223c515 Mb) with short life cycle . So, it  in leaf . The higCitrus sinensis), four ZIP genes such as CsZIP1, CsZIP2, CsZIP3, and CsZIP4 were identified and expression analysis show that CsZIP3 and CsZIP4 are highly expressed in mild, moderate and severely affected Zn deficient leaf. CsZIP1 gene is down-regulated under mild Zn deficient leaf and up-regulated in moderate and severely Zn depleted leaf. There is no change in the expression of CsZIP2 in all tissues when compared with control (ZIP (PtZIP1\u2013PtZIP3 and PtZIP5\u2013PtZIP14) genes were identified in trifoliate orange (Poncirus trifoliata), another variety of orange fruit crop. PtZIP1, PtZIP2, PtZIP3, PtZIP5, PtZIP6, and PtZIP9 are highly induced in roots, whereas PtZIP1, PtZIP2, PtZIP5, PtZIP6, and PtZIP7 are highly expressed in leaves, under Zn-deficient condition  were identified in common bean. But, only seven PvZIP genes such as PvZIP2, PvZIP6, PvZIP7, PvZIP12, PvZIP13, PvZIP16, and PvZIP18 were analyzed for their expression dynamics. The selection of PvZIP genes is based on their location in the genome relative to the presence of QTLs for seed Zn content  which is defective in both the ZRT1 high\u2212affinity and the ZRT2 low\u2212affinity uptake transporters and is susceptible to Zn deficient conditions, was employed  and AtZIP3 (Km = 14 \u03bcM) confirmed to be low-affinity transporters and AtZIP2 (Km = 2 \u03bcM) as high-affinity transporter (Km = 16.3 \u03bcM) and OsZIP3 (Km = 18.5 \u03bcM) are characterized as low-affinity Zn transporters (Km = 13.8 \u03bcM)  . The hig13.8 \u03bcM) . Similar13.8 \u03bcM) . FurtherAtZIP1, OsZIP1, ZmZIP3, OsZIP4, OsZIP5, and HvZIP7 were used for over-expression analysis in crops (OsZIP1 gene was transferred into finger millet using pGreen0179 vector under the control of Bx17 promoter through Agrobacterium-mediated transformation; the transgenic plants showed significantly improved accumulation of Zn in seeds (AtZIP1 gene in cassava showed an increase of 25% Zn content in the edible part of the plant (OsZIP4, OsZIP5, and OsZIP8 in transgenic rice decreased the Zn content in shoot and seed; but significantly increased the root Zn content (OsZIP4 in rice plants showed the reduction of plant growth under Zn deficient conditions (OsZIP4 over-expressing transgenic rice plants (OsZIP5 and OsZIP8 over-expressing transgenic rice plants are shorter and had fewer tillers (OsIRT1 in rice altered the plant architecture and increased the Fe and Zn contents in mature seeds and vegetative parts of the plant under Zn deficient condition (The plant ZIP genes were over expressed through transgenic modification in some studies. Till now, only a few genes such as in crops . For exain seeds . Similarhe plant . Over ex content , b. It cnditions . Approxie plants . At the  tillers , b. Also tillers , b. Simiondition . These s2+ binding site when compared to BbZIP. The phylogenetic analysis of 113 plant ZIP proteins from 14 plant species revealed that the ZIP family members are mainly clustered together as per their numbers. Monocot and dicot plant ZIPs are clustered in separate clusters and both low-affinity and high-affinity ZIPs are closely clustered. These findings would be a valuable theoretical knowledge for future studies in terms of understanding the gene, protein, functional residues of Zn transporters in crops and might be helpful to overcome the problems associated with Zn deficiency. Many ZIP family genes involved in Zn transport have been characterized in model plants. Identification and functional characterization of certain ZIP genes, their relative expression and localization have been done only in a few crops such as rice and maize. More information on Zn transporters are available for rice plants when compared to other crops so this can serve as a model to study Zn transport in other cereal crops. ZIP family members involved in Zn transport and sequestration represent some of the clearest candidate genes for increased Zn content in crops. But very little information is available on how Zn is transported from leaf xylem to phloem of developing seeds and ultimately unloaded into seeds with the help of ZIP genes. This needs further research in the coming years. Identification and characterization of ZIP proteins and related TFs in many crops would help for the better understanding of Zn homeostasis. A more holistic and high-resolution studies on ZIP transporters in crops will help to overcome the problems associated with low Zn soils and to improve the human health.Zinc is not only essential for plant growth but also crucial for human health. It is estimated that nearly 50% of the world\u2019s population is at the risk of Zn deficiency problems . In humaAll datasets generated for this study are included in the article/TA, TM, and SA conceptualized and wrote the manuscript. TA and SA analyzed the protein sequences with alignment, modeling and phylogeny. GV and SI assisted, and TA, TM, GV, and SA edited, and updated the manuscript. SA and SI contributed critically in revising and improving the manuscript for publication.The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest."}
+{"text": "The effect of Zn + IMI on serum, brain, and intestinal Zn concentrations; Zn transporter  protein levels in the intestine and ZnT in the brain; including BDNF (brain-derived neurotrophic factor) and CREB (cAMP response element-binding protein) protein levels in the brain were evaluated. Finally, the effect of IMI on Zn permeability was measured in vitro in colon epithelial Caco-2 cells. The co-administration of IMI and Zn induced antidepressant-like activity in the FST in mice compared to controls and Zn or IMI given alone. This effect correlated with increased BDNF and the ratio of pCREB/CREB protein levels in the prefrontal cortex (PFC) compared to the control group. Zn + IMI co-treatment increased Zn concentrations in the serum and brain compared to the control group. However, in serum, co-administration of IMI and Zn decreased Zn concentration compared to Zn alone treatment. Also, there was a reduction in the Zn-induced enhancement of ZnT1 protein level in the small intestine. Zn + IMI also induced an increase in the ZnT4 protein level in the PFC compared to the control group and normalized the Zn-induced decrease in the ZnT1 protein level in the hippocampus (Hp). The in vitro studies revealed enhanced Zn permeability  after IMI treatment. Our data indicate that IMI enhances Zn transfer through the intestinal tract and influences the redistribution of Zn between the blood and brain. These mechanisms might explain the enhanced antidepressant efficacy of combined IMI/Zn treatment observed in the FST in mice.Zinc (Zn) was found to enhance the antidepressant efficacy of imipramine (IMI) in human depression and animal tests/models of depression. However, the underlying mechanism for this effect remains unknown. We measured the effect of intragastric ( The co-administration of Zn and IMI (A) induced an increase in the concentration of serum and brain Zn (p < 0.001) compared to the control group. However, in the group that received Zn alone, there was a significant reduction in serum Zn (p < 0.01) and an increase in brain zinc (p < 0.01).The effect of Zn and IMI on serum and brain concentrations of Zn in mice is shown in p < 0.0001] and also brain Zn concentration .One-way ANOVA followed by the Tukey multiple comparison post-hoc test revealed the statistically significant differences in serum Zn concentration , significant effect of Zn ; significant interaction ; ZnT4: significant effect of IMI , no effect of Zn , no interaction ; for ZnT5: significant effect of IMI , no effect of Zn , no interaction ; for ZnT6: no effect of IMI [F = 1.803 = 0.1952], no effect of Zn , no interaction .The effect of Zn, IMI, and Zn + IMI treatment on the levels of ZnT1, ZnT4, ZnT5 and ZnT6 in the small intestine is shown in p = 0.7506], no effect of Zn ; no effect ; for ZIP4: significant effect of IMI , no effect of Zn , no interaction ; for ZIP5: no effect of IMI , no effect of Zn , no interaction ; for ZIP12: no effect of IMI , no effect of Zn , no interaction ; for DMT1: no effect of IMI , no effect of Zn , no interaction .The effect of Zn, IMI, and Zn + IMI treatment on the levels of ZIP1, ZIP4, ZIP5, ZIP12, and DMT1 in the small intestine is shown in p < 0.05) and IMI treatment further enhanced this effect (p < 0.0001).The effect of Zn, IMI, and Zn + IMI on Zn concentration in the small intestine is shown in p < 0.0001], significant effect of Zn , and significant interaction .Two-way ANOVA demonstrated significant effect of IMI , no effect of Zn , no interaction ; for ZnT3: no effect of IMI , no effect of Zn , no interaction ; for ZnT4: significant effect of IMI , no effect of Zn , no interaction ; in the Hp: for ZnT1: no effect of IMI , no effect of Zn , significant interaction ; for ZnT3: No effect of IMI , no effect of Zn , no interaction ; for ZnT4: no effect of IMI , no effect of Zn , no interaction .The effect of Zn, IMI, and Zn + IMI treatment on the levels of ZnT1, ZnT3, and ZnT4 proteins in the PFC and Hp of the mouse brain is shown in Clinical studies have demonstrated that Zn adjuvant therapy can improve the antidepressant activity of IMI in patients with major depression ,2. Preclp.o. Furthermore, we used a dose higher than before \u221240 mg Zn/kg body weight (zinc hydroaspartate). This dose was established in our preliminary data studying dose response effect of Zn administered p.o. (data not shown). The dose  was not effective in FST (when administered without IMI), while for example, in our previous study in mice the dose of 30 mg Zn/kg (but not 15 mg Zn/kg) of Zn administered i.p. was effective [In the present study Zn + IMI induced a significant antidepressant-like effect in the FST in mice. The novelty of this work is the fact that the Zn and IMI were administered ffective .50 value for humans is estimated as 27 g Zn/day [50 after oral administration varied between 86\u2013605 mg Zn/kg depending of salt used [In humans, the recommended dietary allowance (RDA) for Zn is 8\u201311 mg/day in women and men respectively . Howeverg Zn/day . The dosalt used .This behavioral effect of Zn + IMI observed in the FST in mice was accompanied by an increase in BDNF and the ratio of pCREB/CREB proteins in the PFC, which is a common feature of antidepressant drug action . However2+ from the extracellular space or from intracellular vesicles to the cytoplasm while ZnTs (10 members) mediate membrane Zn2+ transport and regulate intracellular and cytoplasmic Zn2+ levels [Zn homeostasis is controlled by a several proteins, including Zn transporters (ZIP and ZnT family of proteins). ZIP and ZnT group of proteins perform opposing functions. ZIP transporters (14 members) transport Zn+ levels ,24,25,26+ levels ,24,25,26+ levels ,28,29, o2+ from the cytosol to the extracellular space during periods of elevated levels of cytosolic Zn2+. ZnT3 is specific to the brain and mainly localized on synaptic vesicles. ZnT4 is found on the plasma membrane of the cell and in endosomal/secretory vesicles. ZnT3 and ZnT4 are involved in the transport of Zn to cellular compartments. ZnT5 and ZnT6 are localized on the membrane of the Golgi apparatus and cytoplasmic vesicles. ZnT5-ZnT6 heterodimers carry out essential biosynthetic functions by delivering Zn into the early secretory pathway, where it is required for the activation of zinc-dependent enzymes [ZnT1 is expressed in the plasma membrane and functions to export Zn enzymes ,25. ZIP1 enzymes ,25.We have shown in this study that Zn administration increases the Zn content in the cells of the small intestine (enterocytes) and concomitantly increases the protein levels of ZnT1, ZnT4, and ZnT5 while reducing ZIP4 once in this tissue. A single administration of Zn can increase Zn exocytosis releasing Zn into the bloodstream via ZnT4/ZnT1 while reducing Zn intake in the intestinal lumen . Thus, ZAdditional administration of IMI enhanced the Zn content in the cells of the small intestine above that elicited by Zn alone. This event was accompanied by a reduction in the Zn-induced increase in ZnT1 and ZnT5 and the normalization of the ZIP4 transporter protein level. Thus, IMI may override the protective mechanisms of cells allowing Zn to be further accumulated.The next parameter measured in our study was serum Zn levels. We observed increased Zn levels in serum after the administration of Zn alone treatment and lower but still high levels of Zn after Zn + IMI treatment vs. control. Increased serum Zn might reflect the effect of treatment on intestinal Zn permeability as the in vitro experiment demonstrated enhanced permeability of Zn following IMI treatment of colon epithelial Caco-2 cells. A statistically significant effect was observed 30 min after the treatment of Caco-2 cells; this trend was still evident 90 min after the treatment. Our results are consistent with those of Opoka et al. , who shoThe second part of this study evaluated the brain effects of treatment. Zn or IMI administration did not affect brain Zn levels; however, the combined treatment with both agents increased Zn levels. This effect prompted us to examine selected Zn transporters in the brain with known involvement in mood activity (PFC and Hp). Co-treatment of mice with Zn + IMI increased ZnT4 levels in the PFC and thus supports the increased accumulation of Zn seen in Caco-2 cells. Our previous report indicated some alterations in the levels of Zn transporters. We demonstrated increased levels of ZnT1, ZnT4, and decreased levels of ZnT3 in the PFC in suicide and depression . SimilarThe data presented in this study strongly indicate that IMI enhances Zn absorption in the intestinal tract , influences Zn redistribution between the blood  and brain, and increases the accumulation of Zn in the intracellular pools  . These m"}
+{"text": "Although 68Ga-PSMA-11 PET is widely used in research and clinical practice, full kinetic modeling has not yet been reported nor have simplified methods for quantification been validated. The aims of our study were to quantify 68Ga-PSMA-11 uptake in primary prostate cancer patients using compartmental modeling with arterial blood sampling and to validate the use of standardized uptake values (SUV) and image-derived blood for quantification.The positron emission tomography (PET) ligand 68Ga-PSMA-11 PET scan of the pelvis with axial T1 Dixon, T2, and diffusion-weighted magnetic resonance (MR) images acquired simultaneously. Time-activity curves were derived from volumes of interest in lesions, normal prostate, and muscle, and mean SUV calculated. In total, 18 positive lesions were identified on both PET and MR. Arterial blood activity was measured by automatic arterial blood sampling and manual blood samples were collected for plasma-to-blood ratio correction and for metabolite analysis. The analysis showed that 68Ga-PSMA-11 was stable in vivo. Based on the Akaike information criterion, 68Ga-PSMA-11 kinetics were best described by an irreversible two-tissue compartment model. The rate constants K1 and k3 and the net influx rate constants Ki were all significantly higher in lesions compared to normal tissue (p < 0.05). Ki derived using image-derived blood from an MR-guided method showed excellent agreement with Ki derived using arterial blood sampling (intraclass correlation coefficient = 0.99). SUV correlated significantly with Ki with the strongest correlation of scan time-window 30\u201345 min . Both Ki and SUV correlated significantly with serum prostate specific antigen (PSA) level and PSA density.Fifteen patients with histologically proven primary prostate cancer underwent a 60-min dynamic 68Ga-PSMA-11 kinetics can be described by an irreversible two-tissue compartment model. An MR-guided method for image-derived blood provides a non-invasive alternative to blood sampling for kinetic modeling studies. SUV showed strong correlation with Ki and can be used in routine clinical settings to quantify 68Ga-PSMA-11 uptake. PSMA-11 targets the prostate-specific membrane antigen (PSMA), which is overexpressed in most prostate cancer cells fluorocholine concluded that SUV could not be used to quantify [18F]fluorocholine uptake due to poor correlation between SUV and Ki [The strong correlation between V and Ki , demonstKi and SUV was not seen for the latest time-window, but rather the 30\u201345 min time-window. This result contrasts from current guidelines and publications, where a standard uptake time of around 60 min, with an acceptable range of 50 and 100 min, is recommended [Interestingly, a comparison of the SUV between time-windows 15\u201330 min, 30\u201345 min, and 45\u201360 min showed that the strongest correlation between ommended , 25\u201327. 68Ga-PSMA-11 are best described by an irreversible two-tissue compartment model. 68Ga-PSMA-11 is stable in vivo, which excludes the need for metabolite correction. The net influx rate Ki, estimated using an MR-guided image-derived input function showed excellent agreement with the arterial input function Ki. Image-derived blood can therefore be used as an alternative to arterial blood sampling in kinetic modeling studies. SUV correlated significantly with Ki and can be used in routine clinical settings to quantify 68Ga-PSMA-11 uptake.The kinetics of"}
+{"text": "The immunopathogenic role of house dust mite (HDM) allergens in the development of skin lesions in atopic dermatitis (AD) has not yet been precisely clarified. We immunohistopathologically evaluated the localization of immunoglobulin E (IgE)-positive epidermal dendritic cells with HDM antigens in the skin lesions of patients with IgE-allergic AD. Using double-immunofluorescence and single-immunochemical staining methods, we analyzed biopsy specimens from the skin lesions of six patients with IgE-allergic AD and HDM allergy and 11 control subjects with inflammatory skin disorders. Inflammatory dendritic epidermal cells  were markedly observed in the central area of the spongiotic epidermis of skin lesions in all AD patients. Furthermore, IgE-positive IDECs with HDM antigens in the central areas of the spongiosis were found in four of the six (66.7%) AD patients. Langerhans cells  with HDM antigens were also observed in the peripheral areas of the spongiosis. Infiltration of CD4+ and CD8+ T cells in association with IgE-positive IDECs and LCs with HDM antigens was seen in the spongiotic epidermis. An IgE-mediated delayed-type hypersensitivity reaction, in combination with IgE-bearing dendritic cells, specific T cells, keratinocytes, and HDM antigens, may lead to spongiotic tissue formation in eczematous dermatitis in AD. Although the pathophysiology of atopic dermatitis (AD) is complex, its basic axis is considered to be T cell-mediated immune reactions in association with immunoglobulin (Ig)E-type hypersensitivity specific to environmental exposures, such as to aeroallergens and food allergens ,2,3. EpiIn the present study, we analyzed the localization of IgE-bearing DCs, mainly LCs and IDECs, in association with HDM antigens from Dermatophagoides species in chronic active skin lesions of adults and elderly patients with AD and allergic sensitization to HDMs. We also discuss the possible role of HDM antigens in the pathomechanism of eczematous dermatitis in IgE-allergic AD.Skin biopsy specimens from six Japanese patients  with IgE-allergic AD and high titers of serum-specific IgEs against HDMs (two Dermatophagoides species: D. farinae and D. pteronyssinus) were analyzed by immunohistopathological methods. As controls, skin biopsy specimens from six patients  with non-eczematous inflammatory skin disorders and serum hyper-IgE and five patients  with inflammatory skin disorders and spongiotic tissue within the epidermis were also analyzed. These subjects were selected to confirm that the localization of IgE-positive DCs and HDM antigens in eczematous dermatitis of IgE-allergic AD could be characteristic findings of AD compared to other inflammatory skin disorders. We did not add healthy participants to the control subjects, because our preliminary analysis did not reveal any specific findings in their skin. In this study, patients over 60 years of age were considered to be elderly. The skin specimens were obtained from chronic skin lesions (lichenified eczema) of the patients with AD and from lesioned skin of the control subjects. All patients with AD fulfilled the diagnostic clinical criteria of Hanifin and Rajka , and theFormalin-fixed paraffin-embedded 3-\u03bcm-thick sections were used for routine hematoxylin-eosin staining and single-immunohistochemical staining. Frozen 7-\u03bcm-thick sections were used for double-immunofluorescence staining. The single-immunohistochemical staining and double-immunofluorescence staining were performed with the same procedure used in our previous studies ,14. The following primary monoclonal antibodies (mAbs) and polyclonal antibodies (pAbs) were used: mouse mAbs against CD4 , CD8 , CD206 , 1:250 for anti-CD11c (rabbit mAb), 1:4000 for anti-CD206, 1:1000 for anti-Derf1, and 1:500 for anti-Mite Extract (rabbit pAb). The other primary antibodies did not need to be diluted before use. Double-immunofluorescence staining was performed with a pair of mouse and rabbit mAbs, or a pair of a mouse mAb and a rabbit pAb by using two suitable primary antibodies for double-staining conditions. The combined secondary antibodies were biotinylated anti-mouse IgG  and biotinylated anti-rabbit IgG . The streptavidin-fluorescein conjugates used were DyLight488 streptavidin  and DyLight594 streptavidin . Nuclei were labeled with 4\u2032,6-diamidino-2-phenylindole. Double-immunofluorescence-stained specimens were observed under fluorescence microscopy .2 area of the epidermis or dermis were counted under a microscope at 200\u00d7 magnification. Cell numbers were counted in the most cell-rich area from among three or more observed areas in the non-spongiotic epidermis or superficial dermis in all cases and from one or more observed areas in the spongiotic epidermis in cases of AD and inflammatory skin disorders with spongiotic tissue within the epidermis. Only cells that were clearly positive for the immune-marker antigen of interest were counted. In this study, for the analysis of DCs in the epidermis, we used both CD11c and CD206 as markers of IDECs, and we used CD207 as a marker of LCs [p < 0.05 were considered to be statistically significant. We performed statistical comparisons mainly for the items associated with AD subjects and the control subjects with non-eczematous inflammatory skin disorders and serum hyper-IgE, since the present study primarily focused on the role of IgEs against HDM antigens. Data analysis was performed using EZR software version 1.54  [The analyses were performed by qualitative and quantitative evaluations of the immunohistopathological findings. In the quantitative evaluations, the numbers of immuno-positive cells in a 0.24 mmr of LCs ,7. For tr of LCs . For sta, Japan) .p = 0.835).Clinical and laboratory data of the AD patients and control subjects are summarized in Results of the double-immunofluorescence and immunohistochemical studies are summarized in Hematoxylin-eosin-stained sections of AD cases showed chronic eczematous reactions with epidermal hyperplasia, mononuclear cell infiltration with a few eosinophils, and increased infiltration of mast cells in the upper dermis in all cases, and obvious spongiosis a: case 1Using serial frozen sections, we confirmed the presence of various degrees (from mild to the severe vesicular form) of spongiosis in the epidermis of the skin lesions in all AD cases. In the sections of double-immunofluorescence staining, a few infiltrating double-positive IgE+ CD11c+ cells and double-positive IgE+ CD206+ cells  were seen scattered in the middle to lower epidermis in the non-spongiotic epidermis, while they were observed to aggregate in higher numbers in the central areas of the spongiotic epidermis b: case 1Using another antibody against HDM antigens (against Mite Extract antigens), we also confirmed the presence of double-positive cells for IgE and Mite Extract antigens, and double-positive cells for CD206 and Mite Extract antigens with the same localization as the double-positive IgE+ CD11c+ cells and IgE+ CD206+ cells  in the central area of the spongiotic epidermis in three  of the five cases  were observed mainly in the papillary and subpapillary dermis in all of the AD cases. A small number of infiltrating double-positive IgE+ Der f1+ cells  were also observed in the papillary and subpapillary dermis.In the control cases with non-eczematous inflammatory skin disorders and serum hyper-IgE, infiltration of only a small number of double-positive IgE+ CD11c+ cells and IgE+ CD206+ cells in the epidermis  and double-positive IgE+ CD11c+ cells in the upper dermis  was seen. Furthermore, infiltrating double-positive cells with HDM antigens  were scarcely found in the epidermis by double-immunofluorescence staining for IgE and Der f1, IgE and Mite Extract antigens, CD206 and Der f1, and CD206 and Mite Extract antigens; in addition, they were rarely found in the upper dermis by the staining for IgE and Der f1  Der f1+ cells in the upper dermis in AD cases were also significantly higher than those in each of the control groups .Using serial paraffin-embedded immunostained sections, we confirmed the presence of various degrees of spongiosis in five (cases 1 to 5) of the six AD cases. Serial sections of hematoxylin-eosin staining and immunostaining demonstrated the infiltration of CD11c+ cells into the spongiotic epidermis in the 5 cases, and infiltrating IgE+ cells, which showed similar localization as the infiltrating CD11c+ cells, were seen to aggregate in the central area of the spongiosis in these cases. In addition, infiltrating CD4+ cells, the numbers of which varied greatly, were also observed in the central area of the spongiosis in the five cases, in agreement with the localization of IgE+ CD11c+ cells. Meanwhile, infiltrating CD8+ cells and CD207+ cells showed a tendency to localize around them in the peripheral areas of the spongiosis : case 1.In the comparisons between the AD and control cases in the mean numbers of CD207+ cells in the epidermis and CD11c+ cells both in the epidermis and upper dermis, only the mean numbers of CD11c+ cells in the epidermis  were significantly higher in the AD cases than in the control cases with non-eczematous inflammatory skin disorders and serum hyper-IgE .Although the pathogenetic roles of HDMs (mainly D. farinae and D. pteronyssinus) in AD remain controversial , clinicaIn the present immunohistopathological studies with double-immunofluorescence staining techniques for adult and elderly patients with IgE-allergic AD and HDM allergy, we confirmed that along with T-cell infiltration, IgE-bearing IDECs (CD11c+ and CD206+ cells) infiltrated and aggregated in the central area of the spongiotic epidermis in active lesions of chronic AD  in all oAlthough it could not be analyzed, we presume that the IgE-bearing IDECs and LCs that have HDM antigens might express some cytokines in the epidermis, or they might move to the dermis and lymph nodes to present the HDM antigens to T cells ,26. FurtIn the analysis of cell infiltration in the upper dermis, infiltrating double-positive IgE+ CD11c+ cells  were mainly observed in the papillary and subpapillary dermis in the lesioned skin of patients with IgE-allergic AD; the numbers were significantly higher in patients with IgE-allergic AD than in the control subjects with non-eczematous inflammatory skin disorders and serum hyper-IgE. In the control cases, results of double-immunofluorescence staining indicated the following: IgE-bearing IDECs and those with HDM antigens were hardly detected in the epidermis of the skin lesions of patients with non-eczematous inflammatory skin disorders and serum hyper-IgE, and in the epidermis of the skin lesions of patients with inflammatory skin disorders and spongiotic tissue within the epidermis, IDECs with HDM antigens were scarcely detected in the spongiotic epidermis in which IDECs without IgE had sufficiently infiltrated .Taken together, we speculate that in IgE-allergic AD with HDM allergy, IgE-bearing IDECs responding to the HDM antigens may play a major role in the formation of the characteristic eczematous reaction, i.e., spongiotic formation with the infiltration of CD4+ and CD8+ T cells; in addition, these T cells may be capable of expressing cytokines, such as interferon-gamma, Fas ligand, perforin, and granzyme B, which induce apoptosis in keratinocytes in the epidermis ,27,28,29There are some limitations in this study, including the inherent technical limitations of immunohistopathological analyses, the lack of a blind method for quantitative evaluations, and the small sample sizes of the AD and control cases. In addition, since the present analysis focused on the role of IgEs, we did not include patients with non-IgE-allergic (intrinsic form) AD or enough numbers of patients with other types of eczematous disorders with spongiotic epidermis  as study and control subjects. We consider that patients with these disease conditions should be analyzed in a future study. Nevertheless, even considering such limitations, we consider that the results of the present study demonstrated the crucial role of HDM allergens in the immunopathogenesis of eczematous dermatitis in IgE-allergic AD, in which the IgE-mediated delayed-type hypersensitivity reaction, together with IgE-bearing DCs , specific T cells, keratinocytes, and HDM antigens, may lead to spongiosis formation."}
+{"text": "Brain metastases (BM) are a frequent complication in patients with advanced stages of cancer, associated with impairment of the neurological function, quality of life, prognosis, and survival. BM treatment consists of a combination of the available cancer therapies, such as surgery, radiotherapy, chemotherapy, immunotherapy and targeted therapies. Even so, cancer patients with BM are still linked to poor prognosis, with overall survival being reported as 12 months or less. Intercellular communication has a pivotal role in the development of metastases, therefore, it has been extensively studied not only to better understand the metastization process, but also to further develop new therapeutic strategies. Exosomes have emerged as key players in intercellular communication being potential therapeutic targets, drug delivery systems (DDS) or biomarkers. In this Review, we focus on the role of these extracellular vesicles (EVs) in BM formation and their promising application in the development of new BM therapeutic strategies. Cancer is amongst the leading causes of death worldwide, causing nearly 10 million deaths in 2020, while metastases are the primary cause of cancer-related death . The typOne of the major obstacles to develop an effective BM treatment relies on the impermeable nature of the blood\u2013brain barrier (BBB), which confers the brain a sanctuary status, where metastatic cancer cells can settle and proliferate as they are protected from most anticancer drugs ,6. In thExosomes are nano-sized (30\u2013150 nm) extracellular vesicles (EVs) formed by a lipid bilayer surrounding an organelle-deprived cytosol with several biomolecules, such as proteins, glycans, lipids, RNA and DNA ,9. Thesewww.exocarta.org (accessed on 04 October 2021) [Exosomes\u2019 lipidic composition shares similarities to that of membrane lipid rafts, and it includes ceramides, sphingolipids, cholesterol and glycerophospholipids ,14. The er 2021) .Exosomes were initially thought to be a mechanism through which cells could eliminate unnecessary proteins ,18. HoweEven though the mechanisms by which exosomes are taken up by recipient cells is not fully understood, several studies bring evidence of a non-random process which is dependent on transmembrane proteins ,23. For Recent reports have demonstrated that the successful development of brain metastases rely on a complex intercellular communication occurring between metastatic cancer cells and brain stroma cells, which involves secreted proteins or small vesicles, namely exosomes ,25. The The TME and its intrinsic complex intercellular communication network, established between stromal and cancer cells, highlights the magnitude of the challenge in understanding and treating cancer. The TME constantly changes during cancer progression as a response to evolving tumors and their oncogenic signals . TherefoOver the past decades, emerging evidence suggests that tumor-derived exosomes (TDEs) and exosomes derived from stromal cells of the TME are crucial in modulating tumor growth, angiogenesis, invasion, survival, and metastases formation ,28. VirtThe metastatic cascade is initiated within the TME, with the activation of EMT process in neoplastic epithelial cells . EMT is Recent studies have been building evidence of TDEs involvement in EMT. More specifically, TDEs have been described to transfer considerable amounts of EMT inducers to recipient tumor stroma epithelial cells, which then undergo biochemical changes consistent with EMT ,36,37,38Alternatively, exosomes secreted by mesenchymal stem cells (MSCs)-derived adipocytes were able to induce EMT in breast cancer cells via Hippo pathway . Even thCollectively, these studies are evidence that the exosome-mediated crosstalk within the TME is crucial for the initiation of metastization process, involving not only TDEs but also exosomes derived from CAFs, macrophages and many other cell types.The formation of metastases, a not fully understood process, has in the last centuries been explained according to different approaches . In the The brain has no classical lymphatic circulation. Therefore, to invade this metastatic site, CTCs must migrate through the BBB to further colonize the brain parenchyma . TherefoSeveral efforts have been made to describe the contribution of exosomes in the process of BBB transmigration by cancer cells ,67. One After BBB transmigration, cancer cells\u2019 survival and progression may be supported by the complex intercellular communication network occurring at the brain parenchyma . Fong anThe ability of CTCs to establish contact with and spread along brain endothelial cells, a process named vascular co-option, is also described to be relevant in the process of metastization ,73. A reIn another study, it is shown that X-inactive\u2013specific transcript (XIST) knockdown in breast cancer cells led to exosomal secretion of miR-503 . MiR-503The intercellular communication between cancer cells and cells from the metastatic niches is a reciprocal process. In a recent work by Xu and co-workers, it was shown that exosomes derived from human brain microvascular endothelial cells (HBMECs) were uptaken by small cell lung cancer (SCLC) cells . As a reConsidering the relationship between exosomes and marked severity/aggressiveness of many different types of cancer, one therapeutic approach relies on controlling exosome circulation within the system. Alternatively, exosomes can be considered as an opportunity to develop a new therapeutic strategy that consists of their use as vehicles for anticancer drugs, taking advantage of their natural features that make them natural nano-sized carriers. Therefore, as pivotal participants in intercellular communication, and in the context of cancer treatment, exosomes can be considered a target or a vehicle. In this section we will first overview some studies where exosomes were used as a target, and then focus on how these EVs can be used as DDS and other alternative therapeutic strategies and applications.When aiming for modulation of the exosome circulation, one obvious step to consider is inhibiting exosomes\u2019 biogenesis. Due to exosomes\u2019 biogenesis complexity, it is challenging to develop a molecule that effectively blocks this process . MoreoveStreptomyces parvulus [The use of inhibitors of formation and release of EVs, including exosomes, is well revised elsewhere . Overallparvulus . Manumycparvulus . Therefoparvulus ,79,80. Oparvulus . Regardiparvulus ,85,86,87parvulus ,83. Ceraparvulus . Therefoparvulus . Howeverparvulus . Interesparvulus .Inhibiting exosome secretion can also be accomplished by silencing pivotal players in this process. For example, Bobrie et al. knocked down Rab27a/b in two mammary carcinoma cell lines\u20144T1 (metastatic) and TS/A (nonmetastatic)\u2014and showed that, in vivo, both primary tumor growth and lung dissemination of 4T1 were significantly decreased . More exAnother theoretical approach to target exosomes and interfere in cancer progression and metastatic cascade is to prevent exosomes\u2019 uptake by the recipient cells. One major limitation to this approach is the fact that the precise mechanism for EV trafficking and target definition remains to be unraveled and, more importantly, several reports point to different uptake mechanism depending on the exosomes and the recipient cells ,89. HoweTM . This approach consists of hollow-fiber plasma separator cartridges with immobilized affinity agents that interact with target molecules in the exosomes surface and selectively adsorbs them, while blood cells and non-bound serum components flow through the device [A more extreme approach is the removal of exosomes as a therapeutic adjuvant through an extracorporeal hemofiltration method. The biotechnology company Aethlon Medical  has developed a hemofiltration system called ADAPTe device . Althouge device .Several methods are available for exosome isolation, from cells or body fluids, focusing on different features of these vesicles, such as size, shape, density, solubility, or surface markers ,99,100. Ultracentrifugation (UC) is the most widely used technique and it can be performed as one of the two types: differential or by density-gradient ,99,100. Additionally based on size, ultrafiltration can be used to isolate exosomes by sequential filtration through membrane filters with specific size-exclusion thresholds ,98,100. Another exosome isolation technique is immunoaffinity capture-based which relies on the use of antibodies for specific exosomes surface proteins ,100. TheExosome isolation by precipitation consists of the use of polymers that can alter exosomes\u2019 solubility, resulting in their precipitation ,98,100. The common challenge to all these isolation methods is sample purification. Efficient separation of exosomes from all the other EVs, protein aggregates or cellular debris is not trivial. Therefore, it is deemed important that each exosome batch is characterized before further application. Exosome characterization is performed with focus on several characteristics, such as exosome size, size distribution, protein concentration, specific surface markers and morphology . AnotherThe currently available drug loading methodologies for exosome and MVs in general can be divided into two main groups: pre-isolation and post-isolation. In pre-isolation methodologies, the cargo is either produced by or loaded into the producer cells and hence, the isolated MVs will be pre-loaded in advance . On the Regarding drug loading by pre-isolation methodologies, it can happen by simply treating the producer cells with the drug intended to load and the cells will naturally secrete drug pre-loaded MVs . In thisSeveral methods can be used to load drugs into exosomes in a post-isolation manner. The simplest method consists of the direct incubation of exosomes with the drug. The main disadvantage of this method is the low loading efficiency, that will depend on the lipophilic properties of the drug and the concentration gradient ,104,105.As an alternative to target exosomes, these EVs can be used as vehicles in DDS. In fact, much evidence is rising to support the promising application of exosomes in drug delivery. This promising role is also strongly reinforced by specific features of exosomes which were previously discussed in this review and extensively reviewed elsewhere, which include small size, nontoxicity, long circulation, low immunogenicity and ability to cross biological barriers as the BBB ,97,114. GAPDH) siRNA using electroporation [GAPDH siRNA alone (siRNA), or siRNA and Lipofectamine 2000 (siRNA + LP), or unmodified exosomes with siRNA or MSP/RVG exosomes loaded with siRNA [In a pioneering study by Alvarez-Erviti et al., exosomes were isolated from dendritic cells (DCs). These exosomes were engineered with peptides from muscle\u2014a muscle-specific peptide (MSP)\u2014and brain tissue\u2013CNS-specific rabies viral glycoprotein (RVG), to favor targeting of these tissues and allow gene therapy, to prevent degenerative diseases . MSP exoporation . Murine th siRNA . The resth siRNA . Importath siRNA . The hypth siRNA ,119. On th siRNA . Notablyth siRNA . This wo\u00ae 2000 transfection reagent [\u00ae filters with astrocytes in the abluminal side and bEND.3 on the luminal side\u2014and an in vivo model\u2014xenotransplanted cancer cells in zebrafish\u2014the authors demonstrated the ability of exosomes to deliver its cargo across BBB and effectively inhibit tumor growth [Recent studies have been using exosomes as DDS for glioblastoma treatment ,122,123.r growth . This str growth . One keyr growth ,120,122.CXCR4 + TRAIL) [CXCR4 + TRAIL (carboplatin + ExoCXCR4 + TRAIL group) or exosomes (carboplatin + exosomes group) was evaluated in breast cancer brain metastases, in vivo [CXCR4 + TRAIL, suggesting that the presence of ExoCXCR4 + TRAIL enhances the anti-tumor effect of carboplatin [In a recent study from Liu et al., exosomes were isolated from MSCs transduced with lentiviral chemokine receptor CXCR4 and lentiviral tumor necrosis factor-related apoptosis-inducing ligand (TRAIL) (Exo+ TRAIL) . CXCR4 a+ TRAIL) . Moreove+ TRAIL) ,126,127.+ TRAIL) . In this in vivo . The resboplatin . In thisMelzer and co-workers recently loaded MSCs-derived exosomes with taxol, to target metastatic breast cancer and other carcinoma cells . In thisIn another study, exosomes isolated from EL-4 cells were loaded with signal transducer and activator of transcription 3 (Stat3) inhibitor JSI-124 (Exo-JSI124) by direct incubation and intranasally delivered to mice bearing intracerebral tumors . Exo-JSIExosomes may also be considered as biomarkers in diagnosis and prognosis. These EVs are widely secreted by cancer cells and they can be found in body fluids, such as blood, saliva and urine ,129. TheA recent systematic review of the clinical significance of exosomes as potential biomarkers in cancer included 47 diagnostic and 50 prognostic markers from 30 and 42 studies, respectively . Among tRecently, exosomes from melanoma patients\u2019 T cells and DCs with increased levels of the immune checkpoints Programmed Cell Death Protein 1 (PD-1) and CD28 were found to be correlated with improved treatment response . DetermiAn alternative approach to use exosomes in brain metastases or brain cancer is the use of vaccines. For example, Bu et al. showed that DCs treated with EVs derived from glioma cells were able to activate anti-tumor response from T cells, both in vitro and in vivo . This aphttp://microvesicles.org/-accessed on 04 October 2021) and Exocarta (http://www.exocarta.org/-accessed on 04 October 2021). However, technical limitations in samples\u2019 purification often leads some authors to use the term \u2018microvesicles\u2019 to refer to a vesicle population which includes MVs and exosomes (excluding apoptotic bodies). Therefore, the use of the term \u2018microvesicles\u2019 and \u2018exosomes\u2019 is not consistent in the literature. In this review, we generally opted to use the same term as in the mentioned published work.One of the biggest limitations when working with exosomes resides on accurately identifying the vesicle which one is working with. Notably, great efforts have been made to describe and classify many types of vesicles and two databases are now available: Vesiclepedia (Regarding technical limitations and with respect to exosome isolation, most of the techniques render a very poor production yield, which poses an obstacle for exosome research work and application in the clinics ,102,103.Despite the notable expansion in the fields of exosomes\u2019 biology and application in biotechnology, there are still a considerable number of challenges to be tackled. Mechanisms of cell uptake, for example, remain not clearly described and they are crucial in the context of drug delivery. In most of the works where exosomes were used as DDS and effectively deliver its cargo across the BBB, the routes and mechanisms underlying BBB crossing are not described ,117. AddTransfer of tumor factors via exosomes supports both primary tumor growth and metastases formation and this critical role renders these EVs diagnostic and prognostic value, also offering a plethora of new therapeutic options for metastatic cancer, including brain metastases. However, many factors, such as the production/isolation yield, loading efficiency, selective targeting, lack of standardized protocols of isolation/characterization and effective methods for production scale-up remain to be improved. Moreover, several mechanistic details of the exosomes\u2019 biological and pathological functions remain unknown. Nevertheless, the field of exosomes and EVs in general has been remarkably evolving considering its short age and the new insights brought to light by this field strongly impacted in the recognition of the importance of intercellular communication in cancer development, paving the way for new therapeutic approaches."}
+{"text": "Exosomes are nano-sized extracellular vesicles (30\u2013160\u00a0nm diameter) with lipid bilayer membrane secrete by various cells that mediate the communication between cells and tissue, which contain a variety of non-coding RNAs, mRNAs, proteins, lipids and other functional substances. Adipose tissue is important energy storage and endocrine organ in the organism. Recent studies have revealed that adipose tissue-derived exosomes (AT-Exosomes) play a critical role in many physiologically and pathologically functions. Physiologically, AT-Exosomes could regulate the metabolic homoeostasis of various organs or cells including liver and skeletal muscle. Pathologically, they could be used in the treatment of disease and or that they may be involved in the progression of the disease. In this review, we describe the basic principles and methods of exosomes isolation and identification, as well as further summary the specific methods. Moreover, we categorize the relevant studies of AT-Exosomes and summarize the different components and biological functions of mammalian exosomes. Most importantly, we elaborate AT-Exosomes crosstalk within adipose tissue and their functions on other tissues or organs from the physiological and pathological perspective. Based on the above analysis, we discuss what remains to be discovered problems in AT-Exosomes studies and prospect their directions needed to be further explored in the future. Literatures have shown that AT, as an endocrine organ, secretes a variety of adipokines that affect the body\u2019s homoeostasis, including leptin, adiponectin, resistin and adipsin . In termnt years ). StudieIn recent years, AT has been proven to play an important physiological function by releasing AT-derived exosomes (AT-exosomes) to other specific tissues and organs. Its hypertrophy changes the miRNA profile of exosomes in plasma and affects glucose absorption and lipid metabolism in mice . The exo2.Given the universality and particularity of exosomes cargoes in adipose tissue, it was divided into two parts. The composition of universal substances is mainly caused by the biogenesis of exosomes, including some membrane proteins and key proteins of vesicle formation, which are contained in all of the exosomes. Specific substances are mainly molecules related to the metabolites secreted by adipose tissue and lipid storage, without in other tissue. In this section, we summarize the universal and specific components of AT-Exosomes.2.1.The universality of exosomal composition is largely determined by its biogenesis. The biological process mainly includes the reverse budding of cytoplasmic membrane to form multivesicular endosome, the fusion of mature endosome and cell membrane, and the secretion of exosomes to the extracellular environment . Accordi2.2.The specificity of the internal components of AT-Exosomes is reflected in their different sources of species and cells, determining their different biological functions . The gluWe conduct a statistical analysis of the AT-Exosomes in the retrieval articles mentioned above , finding3.In recent years, studies on the function of AT-exosomes have become a hot spot. The basic method is successfully isolates and detect them without disturbing natural form. In this part, we briefly summarize the principles and methods of several commonly used AT-Exosomes separation, and further analyse their respective advantages and disadvantages .Table 23.1.Ultracentrifugation is called the \u2018gold standard\u2019 for exosome extraction according to the different sedimentation coefficients of exosomes and other substances ,78. It i3.1.1.The differential ultracentrifugation is based on the size of exosomes. It is suitable for the extraction of exosomes in various body fluids . The dif3.1.2.The gradient ultracentrifugation is based on the size and density of exosomes. Density gradient centrifugation is mainly a combination of differential centrifugation and density centrifugation ,85. The The density of the exosomes extracted by density gradient centrifugation is high in purity, which avoids protein contamination to a certain extent and protects the morphology of exosomes . However3.1.3.The separation of exosomes by ultrafiltration is similar to the traditional filtration principle, mainly using ultrafine nano-membranes with different MWCO (molecular weight cut-off) to separate extracellular vesicles of different sizes . The maiCompared with the ultracentrifugation method, the ultrafiltration method greatly shortens the experimental time, and has lower requirements for experimental equipment. However, this method easily causes vesicle congestion on the nanofiltration membrane to damage the membrane. Pressurization during filtration also destroys the natural form and structure of the exosomes, causing exosomes rupture and reducing the recovery rate ,91. In a3.2another recently reported method for separating exosomes based on size is size-exclusion chromatography (SEC), also known as gel chromatography, molecular exclusion chromatography, etc., which is a type of liquid chromatography [The highlighted advantage of this separation method is that it does not destroy the structure and integrity of exosomes . Under ttography . The sepThe stationary phase ensures a high separation efficiency ,98. Gene3.3.The polymer precipitation method mainly uses highly hydrophilic polymers to interact with water molecules around the exosomes to form a hydrophobic microenvironment, thereby allowing the exosomes to settle down ,102. TheThe advantages of the polymer precipitation method are mainly simple operation, high yield and no need for complicated equipment. Therefore, it is often used in the production of commercial kits ,104,105.3.4.The immunoaffinity capture method mainly uses specific proteins on the surface of exosomes for separation. As mentioned above, all exosomes contain some specific proteins and cell membrane components, so they can be used for the capture of exosomes based on immunoaffinity . This inSimilar to the polymer precipitation method, the immunoaffinity capture method is also simple to operate and does not require expensive experimental machinery . SimultaWe have analysed and summarized the methods of AT-Exosomes separation in a number of studies which is special for adipose tissue, the extraction process are as follows: (1) Centrifuge at a low speed (300\u00a0\u00d7\u00a0g) for about 10\u00a0min to remove impurities and live cells in the sample . (2) Collect the supernatant, centrifuge at 2000\u00a0\u00d7\u00a0g for 10\u201320\u00a0min, and centrifuge at 10,000\u00a0\u00d7\u00a0g for 30\u201340\u00a0min. This process is to remove dead cells and cell debris. (3) Aspirate the supernatant, filter at 0.22\u00a0\u03bcm and enter into ultracentrifugation. (4) The filtered liquid is centrifuged for at least 70\u00a0min by ultra-high speed of 100,000\u2013120,000\u00a0\u00d7\u00a0g, discard the supernatant, and resuspend the pellet in PBS. (5) 100,000\u2013120,000\u00a0\u00d7\u00a0g centrifugation to wash the precipitate, and then resuspend the obtained precipitate (exosomes) using solvents according to different needs.4.According to the structure, size and formation process of exosomes, the identification of exosomes currently mainly includes marker protein expression detection mentioned above, electron microscope observation and nanoparticle tracking analysis (NTA). Of course, these methods were also used to identify AT-Exosomes.4.1.Based on the formation process and principle of exosomes mentioned above, exosomes have a series of specifically expressed proteins. In these years of research, a large number of experimenters have used this feature to carry out preliminary auxiliary identification of the isolated and extracted exosomes . Among t4.2.Electron microscope observation is mainly divided into transmission electron microscope and cryo-electron microscope. Under the transmission electron microscope (TEM), the exosomes show a saucer-like structure, and its size is roughly judged to be between 40\u2013160\u00a0nm . ExosomeHowever, some researchers point out that the saucer-like structure under the transmission electron microscope of exosomes is most likely caused by collapse after drying ,121 Mean4.3NTA is a technology developed based on the principle of light scattering and Brownian motion of particles in suspension ,129. It The detection cycle of NTA technology is very short, and it can measure more than 1000 particles in only 60 s . In addi8\u2013109 /mL [However, NTA testing also has certain limitations. When there are a large number of large-sized vesicles in the sample, the overlapping may affect the identification and tracking of small vesicles by the instrument. Consistent with this, the same problem occurs when the exosomes concentration in the resuspension solution is too large . Therefo\u2013109 /mL ,142. TheAbove all, we introduce three methods to obtain AT-exosome better, but none of them is perfect. Most of the studies use the combination of differential ultracentrifugation, marker protein detection, electron microscope observation, and NTA to isolate and identify exosomes. So far there are no methods to identify specific AT-exosomes, but we can make full use of the multi-omics to exploit the specific marker protein, thereby identifying the AT-exosomes in the future. Furthermore, with the development of the technology, it is possible to identify the specific exosomes. SP-IRIS, with higher sensitivity and accuracy, can characterize the particle size difference exosomes from different sources. Daniel et al use the SP-IRIS to explore the size difference of the exosomes from serum, finding that the exosomes from CD9 were ~10\u00a0nm larger than those from other sources . Further5.As the largest energy storage and secretory organ, adipose tissue has attracted more and more attention to its secretion and function of exosomes. By classifying statistics of research papers retrieved from the database, we summarize the important roles of AT-Exosomes in both physiological and pathological aspects .Figure 35.1.5.1.1.The heterogeneity of cells in adipose tissue determines that there will be crosstalk between cell exosomes in adipose tissue. The hypertrophy of adipose tissue causes the infiltration and activation of ATMs, which further affects body weight and produces insulin resistance. Deng et al first found AT-exosomes and showed that AT-exosomes of obese mice activated ATMs, leading to increased production of proinflammatory cytokines IL-6 and TNF-\u03b1 in 2009. This process enhanced the migration of ATMs to adipose tissue and liver and promotes the development of insulin resistance . Adipocy5.1.2.PHLPP2) in adipocytes [The liver is an organ with complex functions in the organism, playing a vital physiological role in metabolism, detoxification, digestion, lipid synthesis and storage. Adipose and liver tissue interact with hormones and other biologically active factors to jointly maintain the body\u2019s homoeostasis . A studyipocytes . Taken t5.1.3.As the largest organ of mammals, skeletal muscle is responsible for basic functions including exercise, breathing and metabolism. Studies have shown that metabolic disorders of adipose tissue affected the metabolism of fatty acids and the release of adipokines, further causing ectopic lipid deposition in skeletal muscle . Adipocy5.2.5.2.1.APAF1) and giving them chemoresistance [COLGALT2) expression to promote osteosarcoma proliferation and diffusion [AT-Exosomes play an important role in the growth and migration of liver cancer, ovarian cancer, breast cancer and other cancers . ADSCs-Esistance . Howeversistance . ADSCs-Esistance . Global sistance , increasiffusion , inhibitiffusion . As ment5.2.2.in vitro and offered an intriguing possibility for the pathogenesis of NAFLD [AT-Exosomes have been shown to affect diabetes, non-alcoholic fatty liver disease (NAFLD) and cardiovascular diseases induced by insulin resistance . AT-Exosof NAFLD . Althoug5.2.3.VEGF) [Angiogenesis is a key biological process that affects development, skeletal muscle hypertrophy, menstruation, pregnancy and wound healing . It mainVEGF) . In conc5.2.4.AT-Exosomes play an important role in the repair and regeneration of bone tissue and affect the proliferation, apoptosis, differentiation, ageing of osteoblasts, inducing bone damage caused by osteoarthritis and age-related bone loss . ADSCs-E5.2.5.in vitro, and ultraviolet radiation reduced the effect of ADSCs-Exosomes on neurite outgrowth [in vivo [AT-Exosomes have the potential to treat neurological diseases . ADSCs-Eutgrowth . After butgrowth ,182. Addutgrowth . Some re[in vivo . However[in vivo .5.2.6.AT-Exosomes have the potential to treat other diseases. Evidence shows that exosomes derived from MuSCs control important immunomodulatory effects to protect acute colitis induced by DSS . Althoug6.AT-Exosomes are media produced internally by organisms, which have good protection for their contents and target specific organs and cells to exert biological functions. This review introduces the research progress and universal and specific cargoes of AT-Exosomes. To explore the biological function of AT-Exosomes, we summarize the principles and procedures of main methods for the isolation and identification of AT-Exosomes. Importantly, we focus on the effects of AT-exosomes on organism tissues or organs in physiology and pathology.in vivo and phenotypic investigations, and the mechanism of crosstalk between AT-Exosomes and other tissues or organs is unclear. Therefore, exosome research still needs to be performed to further uncover the underlying mechanisms and specific signalling molecules and pathways. Pathologically, ADSCs-Exosomes have been currently used as therapeutic materials. However, target-specific organs, biological safety and inter-species rejection of ADSCs-Exosomes need to be further explored. Meanwhile, to date, the number of organ diseases that can be effectively treated by AT-Exosomes are limited. More studies are needed to explore this promising area. Future studies on the function of AT-Exosomes will not only help us better understand the crosstalk between mammalian different tissues and organs, but also are expected to fully use their biological functions for related cancer diagnosis and diseases treatment.As mentioned above, the methods of separating AT-Exosomes have their advantages and disadvantages. To date, ultracentrifugation is still regarded as the \u2018gold standard\u2019. Moreover, through the analysis of the separation time, cost and purity of various methods, we recommend size exclusion chromatography in addition to ultracentrifugation and commercial kits based on water-soluble extraction. It has the advantages of low cost and short separation time but also has problems of low purity and serious pollution. Therefore, new separation methods also should be developed to maximize the purity of AT-Exosomes and maintain their shape and activity. The physiological functions of AT-Exosomes are currently limited to tracking"}
+{"text": "Exosomes are nano-sized vesicles secreted by most cells that contain a variety of biological molecules, such as lipids, proteins and nucleic acids. They have been recognized as important mediators for long-distance cell-to-cell communication and are involved in a variety of biological processes. Exosomes have unique advantages, positioning them as highly effective drug delivery tools and providing a distinct means of delivering various therapeutic agents to target cells. In addition, as a new clinical diagnostic biomarker, exosomes play an important role in many aspects of human health and disease, including endocrinology, inflammation, cancer, and cardiovascular disease. In this review, we summarize the development of exosome-based drug delivery tools and the validation of novel biomarkers, and illustrate the role of exosomes as therapeutic targets in the prevention and treatment of various diseases. Extracellular vesicles (EVs) are lipid bilayer-bound particles secreted by most living cells . AlthougExosomes have become a new drug delivery tool due to their many advantages compared with traditional delivery systems. Efficient loading of external drugs or molecules into exosomes is another demanding and challenging task . Like syThe study of the expression and regulation of exosomes can contribute to improvements in understanding, diagnosis, and therapy of diseases. This paper reviewed the literature on the occurrence, action, mechanism and potential therapeutic effects of exosomes in diseases. In addition, the current knowledge of the therapeutic applications of exosomes is summarized.EVs are classified into three types based on their biogenesis, size and surface markers: apoptotic bodies, microvesicles and exosomes . Apoptot\u22121 [First found in sheep reticulocytes in 1983, exosomes were named by Johnstone in 1989. Exosomes can be differentiated from microvesicles and apoptotic bodies by their origin and scale. They are biological nanoscale lipid bilayer vesicles secreted by cells that originate from polyvesicles  that are\u22121 ,30,31,32\u22121 ,34. The \u22121 . The ini\u22121 . After t\u22121 . After b\u22121   , a mechaGPA33) vs. EPCAM [Since MISEV2014 , the gros. EPCAM , lipid ms. EPCAM , or tetrs. EPCAM .At present, exosomes are mainly classified on the basis of source. This classification does not take into account the characteristics and functional applications of various types of exosomes. According to high-throughput exosomes studies, exosomes contain many molecules, including proteins, lipids, metabolites, mRNA , mitochoIn recent years, the role of exocrine circRNA in regulating tumor cell proliferation in various kinds of cancers has been identified. In colorectal cancer, circIFT80 promotes the development of colorectal cancer by entering exosomes, promotes DNA synthesis and inhibits apoptosis through the miRNA-1236-3p/HOXB7 axis . The expUnderstanding the immune-suppressive or immune-activating role of exosomes present in the tumor microenvironment can ultimately lead to the identification of exosome-based biomarkers of response and to the design of rational combinatorial therapies . ProgramExosomes can mediate molecular communication and substance transfer between primary tumor sites and distant metastatic sites. Exocrine bodies play an important role in tumor cell metastasis and invasion by regulating a series of cellular activities, including epithelial-mesenchymal transformation  . The resHelicobacter pylori (Hp) infection is the most important factor leading to GC. Recent studies have shown that exosomes are associated with the occurrence of Hp-related diseases, having a tumor-promoting effect on tumor-associated macrophages, and promote GC progression [As one of the important functional vectors of gastric cancer (GC), exosomal RNA plays an important role in the initiation and development of gastric cancer by promoting cell-to-cell communication between gastric cancer cells and the microenvironment . Relevangression . Other sgression . This fiExocrine bodies are closely related to the occurrence and development of cardiovascular diseases such as hypertension, atherosclerosis, pulmonary hypertension, myocardial infarction, and myocardial hypertrophy. The cardiovascular system is an important site for intercellular transmission of exosomes. MicroRNA levels of exosomes related to cardiovascular disease, including miR-499, miR-133, miR-208, miR-192, miR-194, and miRNA-34a, are upregulated in patients with acute myocardial infarction and heart failure. Exosomes ,85,86 caGlioblastoma (GBM), also known as grade IV astrocytoma, is the most aggressive primary intracranial tumor of the adult brain . GlioblaRecent studies have shown that exosomes secreted by cytotoxic T (TC) cells contribute to tumor progression, angiogenesis and metastasis. Exosomes in liquid biopsies can reflect the overall molecular information of the tumor and have natural advantages in the diagnosis of TC . The advIt has been reported that exocrine lncRNA-p21 inhibits the occurrence of prostate cancer and the expression of p53 transcriptional regulatory genes . When biMetabolic syndrome (MetS), obesity and diabetes mellitus, are clinically classified as metabolic disorders . RecentlViruses use exocrine pathways to gain entry, spread, perform viral packaging, and escape from the host immune system ; becauseTransplantation is the treatment of choice for many terminal organ failures. However, it comes with an important risk of chronic rejection. Exosomes are key mediators of donor recognition by the host immune system through protein transfer of the preformed donor MHC-peptide complex in host APC that subsequently activates donor-specific T cells . MoreoveMesenchymal stem cells (MSCs) can interact with the immune system to prevent infection through both direct and indirect mechanisms . MSCs, eEV number, size and their biologically active material is altered in numerous inflammatory conditions and EV can alter the cellular functions of neutrophils, monocytes, macrophages and their precursor hematopoietic stem and progenitor cells (HSCs) . NeutropIn addition to their utilization as therapeutics, exosomes have shown different capacities as biomarkers of rejection. Exosomes content has been observed in heart, lungs, kidney, liver, and bone marrow transplanted patients within proteomic and transcriptomic studies, and multiple biomarkers of chronic rejection have been identified, mostly associated with tissue damage and immune activation .Pascucci et al. loaded exosomes derived from MSCs with paclitaxel by culturing MSCs with a high dose of paclitaxel . These pAccording to proteomic studies, exosomes not only have specific proteins that depend on the type of secreted cells but also have a specific subset of cellular proteins found in exosomes, regardless of cell type . The proValadi and his colleagues reported for the first time that mast cell-derived exosomes contain mRNA and miRNA . In addiLipids are essential components of exosomal membranes, and it is well-known that specific lipids are enriched in exosomes compared to their parent cells . The capNatural medicine monomers (NMMs) are effective components in natural drugs, which have single structure and inherent biological activity in a variety of disease models . Plant eIn recent years, extracellular bodies have attracted much attention due to their ability to target drug delivery. It has been shown that exosomes are promising as a potential tool for clinical diagnosis and treatment. As a non-invasive diagnostic component in medical practice, exosomes can provide a useful biomarker library for a variety of diseases as an important part of circulating biomarkers . AlthougIn addition, tumor-derived exosomes (TDEs) play a key role in the establishment and progression of tumors and are emerging biomarkers for tumor diagnosis in personalized medicine . StudiesTo date, exosome-based nanocarriers have been developed for the treatment of many prevalent and stubborn diseases, delivering small molecule drugs and bioactive macromolecules. Therefore, in order to accelerate the routine use of exosomes as carriers for effective and safe drug delivery to target cells, there is an urgent need for new and improved techniques to effectively load therapeutic drugs into exosomes .In addition, it has been reported that plant liquids and active monomers of natural drugs also play a unique role in the treatment of diseases, but the pharmacological mechanism of active monomers and small molecule RNA of some natural drugs is still not clear , so the"}
+{"text": "Exosomes carry genetic information originating from their parental cells, raising their possibility as novel noninvasive biomarkers for cancer. Tumor-derived exosomes (TEXs) have a variety of endogenous cargos that reflect the pathophysiology status and information of tumor cells. TEXs are increasingly being recognized as potential biomarkers for cancer diagnosis prognosis, and monitoring. It is important to develop a variety of sensitive methods, including probes and biomaterials to isolate exosomes. A variety of approaches for detecting exosomes have been established. By combining exosome DNA and RNA sequencing tools, exosome proteomics analysis and immunoassay technology, it is expected that exosomes will gain widespread use in the diagnosis and treatment of cancer. Exosomes are small extracellular vehicles (EVs) ranging from ~30 to ~200 nm diameter that were released by almost all types of cells, including tumor cells, presenting pathophysiological roles and clinical value. Exosomes participate in mediating cell-to-cell communication, or multiple processes of tumor development, presenting pathophysiological roles and clinical value. They are nanosized membrane-bound nanovesicles that carry genetic information originating from their parental cells, raising their possibility as novel noninvasive biomarkers for cancer Depending on their biogenesis and generation pathways, EVs can be broadly classified into three subpopulations; exosomes, microvesicles, and apoptotic bodies Exosomes, as messengers of intercellular information transmission, are involved in the transfer of materials and information between cells by combining fusion or endocytosis Early diagnosis and efficient therapy for patients are the best options for enhancing their survival outcomes. However, efficient diagnosis and therapy is inhibited by the lack of biomarkers that are highly specific, stable and noninvasive in situ (DCIS) patients are likely to develop invasive ductal carcinoma (IDC). miR-223-3p enhances breast cancer cell invasion, and its exosomes may be used as minimally invasive biomarkers for the diagnosis of IDC patients by biopsy In recent years, liquid biopsies have been widely used in the early diagnosis of tumors, especially in the analysis of tumor-related substances extracted from body fluids of patients, such as miRNAs et al. performed a detailed analysis of the association between the NANOG gene family and exosomes Exosomes are secreted by both viable and dying tumor cells and exosomal DNA (ExoDNA) is likely to be one of the most stable cargos due to protection by lipid bilayer Studies have shown the role for exosomal proteins in clinical diagnosis. Exosomes contain various tumor-associated proteins that reflect tumor statuses. In addition, they also contain proteins from cells. The membrane structure of exosomes protects proteins from external proteases and other enzymes et al. found different levels of ganglioside activity in cancer patients, and evaluated the sialidase NEU2 subtype as a potential biomarker for human cancer diagnosis by enzyme-linked immunosorbent assay (ELISA) in vivo. This method has been used to isolate exosomes from samples, and confirmed that exosomal PS expression is not only a characteristic of vesicle formation, but also a PS mediated immune response on the surface of exosomes from NK cells, which contribute to tumor diagnosis and treatment.Studies on exosomes have addressed the role of glycosylation. The surface of exosomes consists of a polysaccharide canopy attached to surface proteins and certain outer leaflet lipids. Malignancy is best characterized by the feature of aberrant sialylation in glycoproteins and glycolipids, which have been implicated in cancer progression in situ immunofluorescence analysis has been designed in situ electrochemical analysis of exosomes in serum 3O4 NPs was constructed for visual and label-free detection of PCa exosomes from plasma. Exosomes were directly isolated from clinical PCa plasma and detected by the aptasensor for the early diagnosis and staging of PCa. In addition to the new detection technology, there have been advances on the traditional detection methods, such as ELISA, to resolve reproducibility and sensitivity issues Although TEXs characteristics enhance their potential as clinical biomarkers, effective methods for isolation and detection have not been established. Differential ultracentrifugation (UC) has been a classical method for EV separation, at least, until recently The complexity of exosomes bring many challenges to isolate large pure and specific exosomes from mixture. Maybe, only a small subtype of exosomes in an abundance mixture has the feature of biomarkers. It is an important process to determine the specific or characteristic exosomes from the abundance mixture. The concentration of TEXs were an important parameter that indicate the tumor pathological circumstances. This means that the TEXs is more abundant in serum, which is helpful for cancer diagnosis.Compared with conventional biopsy or liquid biopsy, exosome-based diagnosis has higher sensitivity and specificity. By combining exosome DNA and RNA sequencing tools, exosome proteomics analysis and immunoassay technology, it is expected that exosomes will gain widespread use in the diagnosis and treatment of cancer."}
+{"text": "Exosomes are cell-secreted nanoparticles  bearing numerous biological molecules including nucleic acids, proteins and lipids, which are thought to play important roles in intercellular communication. As carriers, exosomes hold promise as advanced platforms for targeted drug/gene delivery, owing to their unique properties, such as innate stability, low immunogenicity and excellent tissue/cell penetration capacity. However, their practical applications can be limited due to insufficient targeting ability or low efficacy in some cases. In order to overcome these existing challenges, various approaches have been applied to engineer cell-derived exosomes for a higher selectivity and effectiveness. This review presents the state-of-the-art designs and applications of advanced exosome-based systems for targeted cargo delivery. By discussing experts\u2019 opinions, we hope this review will inspire the researchers in this field to develop more practical exosomal delivery systems for clinical applications. Nanomaterials have provided new insights to carry biofunctional compounds for different biological applications, such as diagnosis, imaging, as well as therapies. For example, Liposomes have been reported for various passive and active targeted cargo delivery, which provide inspiration on the development of exosome-based targeted delivery system . ExosomeThis review presents a comprehensive introduction on exosome-based delivery systems for targeted therapies. Firstly, the discussion on the biogenesis, composition, functions and appropriate sources of natural exosomes is presented to provide an understanding of therapeutic benefits and features of exosome-related tools. Additionally, the usage of exosome as carriers in therapeutic applications is reviewed according to various loading cargoes specially on genetic substances. In particular, we summarize the currently available methodologies for exosomal cargo loading and the state-of-the-art bioengineering strategies of membrane modification to increase the circulation time and targeting efficiency, which are highly significant in the development of delivery platform. Finally, we shed light on the challenges and potential solutions of exosome-based loading system, as well as the updates on current status of clinical trials. The present review is expected to bring significant value to advance the superior design of nano-complexes consisting of exosomes and therapeutic compounds on their promising pathways in the field of targeted delivery.Extracellular vesicles (EVs) are cell-derived microvesicles basically composed of lipids, which bear biologically active cargoes such as proteins and nucleic acids to achieve the intercellular communications. According to the origin, formation and size, EVs are generally categorized into three groups, including exosomes (30\u2013150 nm), plasma-membrane-budded microvesicles (50\u20131000 nm), and apoptotic bodies (1000\u20135000 nm) . It has The biogenesis of exosomes starts from the inward budding of the plasma membrane, forming intraluminal vesicles (ILVs) within early endosomes, as shown in Generally, exosomes encompass lipids, proteins, and nucleic acids. The exosome membrane mainly consists of lipid layers, containing cholesterol, sphingolipid, ceramide, and diacylglycerol, which differs from the membrane of other EVs . The sur6\u03b21 and \u03b16\u03b24, while integrin \u03b1V\u03b25 of liver tumor exosome was correlated to liver metastasis. The specific surface integrins from parent cells have potentials for targeted guidance in delivery applications.Notably, the protein and nucleic acid profiles of exosomes are diverse, which are strongly correlated to the cell types of the originating cells, as well as to the cell status like inflammation, viral infection, cancerous and neurodegenerative situation. For instance, exosome released from IL-1\u03b2-stimulated synovial fibroblasts could initiate osteoarthritis-changes in articular chondrocytes, and activate migration and tube formation of human umbilical vein endothelial cells . Besidesvia content transfer and interaction with the recipient cells. To date, exosomes have been widely reported to take part in physiological and homeostatic processes . via hyaluronan degradation  in gene therapy. in vivo  . Despitevia stirring the mixture at 500 rpm for 90 min, 4 and 17 h at RT, and found that 90 min of incubation resulted the best for loading the exosomes with chemically synthesized oligonucleotides.By tuning the cells/exosomes-to-drug ratio, the loading capacity of siRNA can range from 73 to 30000 per vesicle . In addiThe viral transduction-based strategy is popular for genetic drugs for therapeutic applications, which has now been applied to exosome-based delivery systems, owing to their stable and definite transfection abilities . After vpre-miR-214, resulting in a significant enhancement of the miR-214 production in MSCs-derived exosomes. As a result, the overexpress of miR-214 enhanced the exosome-conducted neuroprotection against cerebral injury induced by deep hypothermic circulatory arrest (DHCA) . Besides lentiviruses, adenoviruses are another commonly employed vector type for the generation of proposed cargoes in exosomes. With adenoviral vectors, miR-26a with muscle targeting ability.Viral transduction is suitable for a variety of cells to load them with high efficiency, which may solve the problem of chemical transfection that is inefficient for some cells. For example, t (DHCA) . Yi et aAlthough viral transduction-base strategy may extensively enrich the exosome functions, the mechanism is still not fully revealed. In addition, the pathogenicity and teratogenicity of the viruses may be preserved and inherited in exosomes, resulting in safety risks , and it As a natural carrier of nucleic acids and proteins, exosomes have been considered to be crucial in intercellular communication and therefore extensively utilized as vectors for targeted delivery with biological molecules. Compared with the synthetic carriers such as liposomes or other nanoparticles, exosomes as drug delivery systems exhibit advantages of good biocompatibility, low immunogenicity and the capability to cross biological barriers such as the BBB.in vitro and in vivo (in vitro and in vivo (Direct modification of exosomes is carried out mainly through the conjugation reactions (including click chemistry), hydrophobic insertion, receptor-ligand binding and so on.  in vivo . Hydroph in vivo . For exa in vivo .Apart from the chemical modification of exosomal membranes, genetic engineering seems to be another way enabling efficient exosome modification. Modification of exosomes with targeting molecules can be achieved by genetic engineering of exosome producing cells, for example, through transfection with plasmid vectors. There are mainly two different categories of transmembrane proteins on the surface of the exosomes, non-specific proteins and receptor membrane proteins. The non-specific proteins mainly consist of lysosome-associated membrane protein 2b (Lamp2b) and the tetraspanin superfamily CD63/CD9/CD81 which are abundantly present on the surface of different exosomes.in vitro and in vivo. In addition, the same group constituted RBP-linked exosomes (RBP-exo) by linking RBP (a RAGE-binding peptide) to an exosome membrane integral protein Lamp2b, followed by the loading with curcumin. As a result, the curcumin loaded RBP-exo exhibited a higher intracellular curcumin delivery efficacy than curcumin alone or curcumin loaded into unmodified exosomes , Glycosylphosphatidylinositol (GPI), HER2, platelet-derived growth factor receptor (PDGFR), the C1C2 domain of lactadherin, among many others.in vitro and in vivo. 99mTc-radiolabeled exosomes that possessed DARPin G3 (as a ligand for HER2 receptor) not only displayed a higher affinity toward SKOV-3 cells (relatively high HER2 expression) in comparison to MCF-7, HT29, U87-MG, A549 cell lines (low HER2 expression), but were also able of tumor visualization in SKOV-3 tumor-bearing nude mice -enriched cell surfaces in a receptor-independent manner . Since tin vivo, as they are isolated from a variety of biological fluids with unique lipid, nucleic acid and protein compositions. However, recent investigations on exosome biodistribution demonstrated that intravenously injected exosomes are quickly sequestered by the liver, lung, and spleen . CD47-SIRP\u03b1 binding initiates a \u2018don\u2019t eat me\u2019 signal that blocks the uptake by macrophages . KamerkaApart from natural molecules, the coating or incorporation of exosomes with synthetic materials can be another route to modulate the pharmacokinetics and biodistribution. In summary, in order to improve the pharmacokinetics and biodistribution profiles, the physicochemical properties of exosomes can be bioengineered through coating with bioactive ligands or synthetic molecules. Such modulation is pivotal for employing exosome as cargo carriers for certain applications and particular forms of administration.Compared to liposomes and other nanosized carriers, exosome-based delivery platform is superior in compatibility, stability, tissue penetration, targeting capacity and inherent bioactivity. However, it is worth to note that some limitations are restricting their translation into clinical practices for delivering therapeutic cargoes. Some of them are listed below.First, the production yield of exosome is not high. The high cost of cell culture and time-consuming process for exosome release, isolation and purification severely limit the yield of cell derived exosomes. Breakthroughs in instruments and procedures have to be made to realize the large-scale production of exosomes or cargo-loaded exosomes. Recently, some strategies have already been employed to increase the production of exosomes through manipulating the gene expression and cell culture conditions . GeneticSecond, a standardized control on exosome quality is lacking. Depending on the various statuses of different parent cells, exosomes are highly heterogenic in terms of the carrying nucleic acids and proteins. Undesired molecules may affect the function of exosomes and even arise the harmful or unwanted side-effects . In ordeClinicaltrials.gov. For clinical trials of applying exosome as cargo carriers, MSCs and plant cells are commonly used as producer cells to load curcumin or genetic substances for the treatments of cancers and cerebrovascular disorders. A clinical study from Isfahan University of Medical Sciences on miR-124-loaded MSCs-derived exosomes for treating acute ischemic stroke is now at Phase II Trial (NCT03384433). In another study, M.D. Anderson Cancer Center is exploring the use of MSCs-derived exosomes loaded with KRAS G12D siRNA to treat metastatic pancreas cancer (NCT03608631).Third, exosome-based clinical trials remain a challenge. Credible and large-scale clinical trials are necessary and crucial to confirm and evaluate the therapeutic potentials before industrials activities . CurrentTargeted delivery using well-designed carriers enables the therapy of various diseases with high efficiency and reduced toxicity. With the advancements on biocompatibility, deep tissue penetration, multiple cargo loading capability, and surface modification tolerability, exosomes are of great interest and significance as natural carriers. In this review, we introduced exosomes as versatile carriers for targeted delivery. Diverse loading strategies facilitate the establishment of exosome-based carrier platforms to deliver various therapeutic molecules. However, breakthroughs in technologies and instruments should be solved to realize the large-scale production of purified and quality-controllable exosomes and drug-loaded exosomes. Engineering of exosomes with cell-specific recognition proteins or synthetic polymers facilitates targeted delivery and enhanced circulation time, without losing the unique features of exosomes. Current investigations on the pharmacokinetic profile and biodistribution of exosomes are mainly carried out in small animal models like mice. As the required steps toward a practical utility of the engineered exosomes, studies on large animals and then clinical trials should be conducted in the near future. On the other hand, the type of exosomes is one of the key concerns in the development of exosome-based delivery systems. In particular, for therapeutic application of drug/gene-encapsulating exosomes, the source of exosomes needs to be carefully considered. Different origins of exosomes confer them with different features and compositions. On the investigation and evaluation of the side effects and treatment efficacy of exosomes, the potential risk of inducing tumor growth by tumor cell-derived exosomes has to be taken into account. By introduction and discussion on the state-of-the-art designs and applications of advanced exosome-based targeted delivery system, this review aims to further encourage and inspire readers to develop new strategies for efficient, stable and safe targeted delivery systems in the future.HC: writing \u2013 original draft, conceptualization, supervision, and funding acquisition. LW and XZ: writing \u2013 original draft. HS: supervision and writing \u2013 review and editing. HN: project administration, funding acquisition, and writing \u2013 review and editing. XP: supervision, project administration, and resources. YZ: conceptualization, supervision, project administration, funding acquisition, and writing \u2013 review and editing. All authors: read the revised manuscript and approved the submission.The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest.All claims expressed in this article are solely those of the authors and do not necessarily represent those of their affiliated organizations, or those of the publisher, the editors and the reviewers. Any product that may be evaluated in this article, or claim that may be made by its manufacturer, is not guaranteed or endorsed by the publisher."}
+{"text": "In randomized clinical controlled trials, the choice of usual care as the comparator may be associated with better clinician uptake of the study protocol and lead to more generalizable results. However, if care processes evolve to resemble the intervention during the course of a trial, differences between the intervention group and usual care control group may narrow. We evaluated the effect on mean arterial pressure of an unblinded trial comparing a lower mean arterial pressure target to reduce vasopressor exposure, vs. a clinician-selected mean arterial pressure target, in critically ill patients at least 65\u2009years old.For this multicenter observational study using data collected both prospectively and retrospectively, patients were recruited from five of the seven trial sites. We compared the mean arterial pressure of patients receiving vasopressors, who met or would have met trial eligibility criteria, from two periods: [1] at least 1 month before the trial started, and [2] during the trial period and randomized to usual care, or not enrolled in the trial.p\u2009=\u20090.28), baseline Acute Physiology and Chronic Health Evaluation II score  or history of chronic hypertension . Mean of the mean arterial pressure was similar between the two periods .We included 200 patients treated before and 229 after trial initiation. There were no differences in age (mean 74.5 vs. 75.2\u2009years; The initiation of a trial of a prescribed lower mean arterial pressure target, compared to a usual clinician-selected target, was not associated with a change in mean arterial pressure, reflecting stability in the net effect of usual clinician practices over time. Comparing prior and concurrent control groups may alleviate concerns regarding drift in usual practices over the course of a trial or permit quantification of any change.The online version contains supplementary material available at 10.1186/s12871-021-01529-w. When an experimental intervention cannot be compared to placebo, researchers conducting randomized clinical trials have two options: protocolized or usual care control groups . Usual cNCT03431181) . 3431181) \u201314. The Multicenter observational study using data collected both prospectively and retrospectively to compare MAP of patients while receiving vasopressors before and during the Optimal VAsopressor TitratION in patients 65\u2009years and older (OVATION-65) trial .More information regarding the design of the OVATION-65 trial is available in the published protocol . BrieflyFor this observational study, two investigators independently screened medical records to identify patients who would have met the OVATION-65 eligibility criteria 13\u2009months to 1 month before the trial launched . They also identified patients who were potentially eligible for inclusion while the trial was ongoing but not enrolled (\u2018non-enrolled group\u2019). The pre-trial and non-enrolled groups were both identified retrospectively from the list of all patients over 65\u2009years old treated with vasopressors obtained from the medical records departments of participating sites. Of note, not all trial eligibility criteria could be applied retrospectively. For example, as a surrogate for the criterion of an anticipated duration of vasopressor therapy of at least six additional hours, we included patients who received vasopressors for 6 h or more  converting them to norepinephrine equivalents using a previously published formula , 15. SevIn addition to actual MAP values, we collected from medical records hourly MAP targets - as prescribed by treating teams in the physician orders - as well as the following clinical outcomes: complications , duratiWe included patients enrolled in the usual care control group of the OVATION-65 trial from five of the seven sites  and continuous data as mean (standard deviation [SD]) or median (interquartile range [IQR]) as appropriate. For comparisons of categorical variables between groups, Chi-square tests or Fisher\u2019s exact test as dictated by the distribution of the data were used. For the primary analysis, we compared mean MAP of patients while receiving vasopressors in the pre-trial period and the during-trial period  using a Student T-Test. In a secondary analysis, using a multivariable linear regression model, the effect of trial initiation on mean MAP was measured and adjusted for the following prespecified independent variables chosen in function of their plausible impact on vasopressor management: age, chronic hypertension, APACHE II score, site, and time from trial initiation to hospital admission of the patient at each site. These variables were introduced simultaneously in the model. Sensitivity analyses, both adjusted and unadjusted, compared mean MAP values while receiving vasopressors across the three groups .p values less than 0.05 were considered statistically significant. We used SAS 9.4  for all analyses.Two sides Overall, 429 patients fulfilled the eligibility criteria and were included in this nested study: 74 from the trial\u2019s usual care control group, 200 in the pre-trial group, and 155 in the non-enrolled group  and APACHE II score . During the trial period, men outnumbered women , more patients received invasive ventilation , and fewer received non-invasive ventilation . The mean MAP at the begining of data collection was similar between the two periods .Table\u00a0n\u2009=\u200975 [37.5%] vs during-trial: n\u2009=\u200978 [34.1%]; p\u2009=\u20090.46) and hospital length of stay  , duration of vasopressor therapy , and total vasopressor dose  were similar between periods. Comparing between 3 groups, we found no difference in mean MAP while receiving vasopressors .Mean MAP while receiving vasopressors was 72.5 (5.1) in the pre-trial period vs 72.4 (5.0) mmHg in the during-trial period  and higher achieved MAP was almost statistically significant. This finding may be related to chance, due to a smaller sample size in the usual care control group and greater potential for influential outliers. Alternatively, the finding may reflect residual confounding from differences in severity of illness, or potentially an influence of trial initiation on care practices. However, the direction of effect, if related to the initation of OVATION-65, is opposite to our concern that the trial would have led to lower achieved MAP. Therefore, spurious finding or residual confounding are more likely explanations.The study exhibits the following strengths. The sample size was sufficiently large to discern differences in the continuous outcome of MAP. We planned a one-month washout period separating the pre-trial and during-trial periods to minimize contamination between these two periods. Data collection that purposefully spanned winter and summer months, to mitigate the potential effects of seasonal case mix variations is also an important strength. In addition, the fact that mean MAP values were consistent with the results of a previously reported observational study published in 2017 reinforces the plausibility of these contemporaneous observations .This study also has limitations. Although patients across study periods presented similar characteristics, small differences in the distribution of certain comorbidities, such as coronary disease, heart failure, and stroke, were observed and may be owed to the relatively small sample size. Mean MAP was numerically lower in the pre-trial and non-enrolled groups, likely because data collection for those patients started from vasopressor initiation. In contrast, for patients in the trial\u2019s usual care control group, data collection started after randomization, at which time patients had already been partially stabilized. In the multivariable linear regression analyses, a higher severity of illness was associated with a lower mean MAP while receiving vasopressors, which may reflect a more severe cardiovascular compromise. The fact that MAP values varied by site reflects fluctuations in local cultures that have been previously described and is common when the certainty of evidence guiding clinical care is low and subject to interpretation . One sitThe initiation of an unblinded trial comparing a permissive hypotension strategy to usual care in critically ill patients did not impact usual care in the centres where the trial was conducted. The approach consisting of ascertaining potential fluxes in usual care over time and across concurrent control groups would be applicable to other research settings and may alleviate concerns regarding potential biases or permit quantification of said biases.Additional file 1: Supplement Table 1. Number of Patients included per site."}
+{"text": "The Go/NoGo paradigm with event-related potentials (ERPs) and event-related oscillations (EROs) was used to explore the time and neural oscillation courses of response inhibition. Behavioral results revealed that at the 4,890-m altitude area, the soldiers had the highest false alarm rate, the longest reaction time, and the slowest information transmission rate. The electrophysiological results revealed that NoGo-N2 and N2d decreased with increasing altitude, with significant changes at 3,860 m; the amplitudes of NoGo-P3 and P3d in plateau groups were significantly more negative than the plain and changed significantly at 2,950 m. The results of correlation analysis showed that NoGo-P3 was negatively correlated with altitude , positively correlated with SpO2  and information translation rate (ITR) . P3d was negatively correlated with altitude  and positively correlated with ITR . N2d was negatively correlated with ITR . The power spectrum analysis of NoGo-N2 and NoGo-P3 showed that the power of \u03b4 and \u03b8 bands at the plateau area was significantly lower than the plain area and showed a significant step-by-step decrease; the \u03b1-band power increases significantly only in the area of 4,890 m. The effect of chronic hypoxia exposure at different altitudes of the plateau on the response inhibition of soldiers was manifested: 3,860 m was the altitude at which the brain response inhibition function decreased during the conflict monitoring stage, and 2,950 m was the altitude at which it dropped during the response inhibition stage. In addition, the soldier's brain's executive function was closely related to SpO2, and a reduction in SpO2 may lead to a decline in response inhibition.This study investigates the changes in soldiers' brain executive function at different altitude environments and their relationship with blood oxygen saturation. Stratified sampling was conducted in different altitude 133 active-duty soldiers who were stationed in Weinan (347 m,  The plateau is in an important strategic military position. Hypobaric and hypoxia are the plateau environment's main characteristics. The brain is the most sensitive organ to hypobaric hypoxia exposure  studies have shown that the activation of the prefrontal cortex (PFC) and anterior cingulate cortex (ACC) is related to response inhibition  rhythm when the stimulus was locked. The ongoing information processing can reduce or block the brain waves' amplitude in the \u03b1 and \u03b2 rhythms, which is called event-related desynchronization (ERD). Studies have found a positive correlation between ERD intensity and cortical excitation   and event-related oscillations (EROs) was used to investigate the dynamic changes in brain response inhibition and neuron characteristics oscillation at different altitudes, as well as the relationship between physiological indicators and cognitive components. We hypothesized that the effects of varying altitude plateaus on soldiers' inhibitory control and non-attentive tasks show a progressively decreasing trend change with increasing altitude.n = 34), Nyingchi (n = 32), Lhasa (n = 33), and Nagqu (n = 34) for 2 years, were invited in this study. The mean age of the participants was 22.21 years (SD = 0.27). There were no statistical differences for age, body mass index (BMI), and education level among the four groups. More details for the information can be found in Self-compiled general demographic questionnaire was used to register the subject's demographic information, including name, gender, birth date, place of origin, place of residence before enlistment, and education level. A total of 133 soldiers, who were stationed in Weinan (Common inclusion criteria were the following: (1) male, high school education, right-handed Annett, , normal Inclusion criteria for the plateau group  were as follows: (1) birthplace was a low-altitude area (<500 m) after stationed in the current altitude area and (2) permanent residence in the current altitude area for 24 months. Exclusion criterion was the experience of going to the plateau before stationing or returning to the plains during stationing. The plain group's inclusion criteria (Weinan) were that the birthplace and stationing place are low altitude (<500 m). Exclusion criterion was an experience of going to the plateau.The study was conducted following the Declaration of Helsinki, and all procedures were carried out with the adequate understanding and written informed consent of the subjects. The study protocol was approved by the Ethics Committee of the Fourth Military of Medical University.2 and heart rate (HR) were measured by an oxygen saturation meter . The participants were asked to rest for at least 15 min before measuring. The subjects' right index finger was ensured to be dry and clean without accessories before testing. When calculating, the excessive sunlight affecting the fingers' temperature was avoided, and cold was prevented to ensure the fingers' warmth. When the subjects were breathing calmly, the portable fingertip oxygen saturation meter was used to clip the right hand's index finger. The values of SpO2 and HR were read after the reading was stable for at least 10 s.The participants' SpO2). There were four blocks with 60 Go (double triangles) and 40 NoGo (single triangle) stimuli for each. Before EEG recording, participants performed two practice blocks consisting of 40 Go and NoGo trials to ascertain that their operation was correct. The behavior data such as accuracy rate (AR), false alarm rate (FAR), and reaction time (RT) were collected using E-prime 3.0. Each stimulus was presented for 100 ms, with the mean interstimulus intervals (ISI) being 1,200 ms . During the experiment, participants were instructed to watch the center of the screen, relax, and minimize eye blinks or body movements.Participants were seated in a comfortable experimental laboratory and exposed to limited sound and appropriate light. The stimuli were presented on a computer screen ~75 cm away from the participant, with a visual angle of 4\u00b0 \u00d7 4\u00b0. Visual stimuli included single and double triangles in the gray background, presented on a computer screen (light degree = 60 cd/mInformation transfer rate (ITR) was the standard measurement method of measuring communication and control systems. It refers to the amount of data transmitted per unit of time , N is the total number of stimuli, and P is the accurate rate (AR).www.yiransunny.com.cn). All EEGs were continuously sampled at 1,000 Hz with a left mastoid reference and a forehead ground and referenced offline to an averaged reference derivation by mathematically combining the left and right mastoid. The vertical electrooculogram (EOG) was recorded with electrodes placed above and below the left eye, and the horizontal EOG was recorded with the electrodes placed outboard of both eyes. All electrode impedances were maintained below 5 k\u03a9. EEG and EOG were amplified using a 0.05\u2013100 Hz bandpass and continuously sampled at 1,000 Hz/channel for offline analysis. EEGs contaminated with artifacts due to amplifier clipping, bursts of electromyographic (EMG) activity, or peak-to-peak deflection exceeding \u00b175 \u03bcV were excluded from trials.Brain electric activity was measured from 34 channels using a modified 10\u201320 system electrode cap , an open-source toolbox running MATLAB . The processing process consisted of bilateral mastoid reference and a bandpass filter with a low cut of 0.5 Hz and a high cut at 30 Hz. Eye movement artifacts were corrected using individual independent component analysis (ICA) by removing the corresponding components based on the particular activation curve  of visual N2 and P3 waves were measured in 200\u2013340 ms and 340\u2013430 ms time windows. Furthermore, difference waves were computed by subtracting the average Go-ERP from the average NoGo-ERP for midline electrodes for each condition. As in previous studies  in Matlab was used to analyze EEG data's neural concussion. STFT divides the signal into many identical small-time intervals by window function and uses Fourier transform to explore each time interval to determine the time interval frequency and get a series of variation results of signals in the frequency domain. The baseline of (\u2212200 0) ms corrects the oscillation energy value before stimulation. This study focused on the successful inhibition of N2 and P3 components in NoGo stimulation. STFT was used to calculate the power in five frequency bands: \u03b4 (1\u20134 Hz), \u03b8 (4\u20138 Hz), \u03b1 (8\u201314 Hz), \u03b2 (14\u201330 Hz), and \u03b3 (30\u201345 Hz).p-value of 0.05 was considered a significant consequence. The Bonferroni-corrected method was performed for post-hoc testing of significant main effects. Effect size in all ANOVA analyses was reported by partial eta-squared (\u03b72), where 0.05 represents a small effect, 0.10 represents a medium effect, and 0.20 represents a large effect . Kolmogorov\u2013Smirnov test was used to test the normal distribution of each group of data. Comparisons data from the four altitude groups were made using mixed analysis of variance (ANOVA) for normally distributed data. One-way analysis of variance with elevation (Weinan/Nyingchi/Lhasa/Naqu) as a between-subjects factor was conducted for behavior results and physiology indexes. Three-way analysis of variance with elevation (Weinan/Nyingchi/Lhasa/Naqu) as a between-subjects factor and condition , and electrodeposition  as a within-subjects factor for ERP results. Three-way analysis of variance with elevation (Weinan/Nyingchi/Lhasa/Naqu) as a between-subjects factor and five frequencies bands  and electrodeposition  as a within-subjects factor for event-related spectral perturbation (ERSP) results. A p < 0.01). Meanwhile, the false alarm rate and ITR were markedly enhanced in the Naqu group than in the plain group for the NoGo stimuli (p < 0.01). The false alarm rate, RT, and ITR in the Naqu group increased than that in the Nyingchi or Lhasa groups (p < 0.05 or 0.01) for the NoGo stimuli.The behavioral outcomes can be seen in 2 and HR of soldiers from four areas are shown in 2 percentage was significantly decreased in plateau groups  compared with the plain group (p < 0.001). On the contrary, the soldiers' HR in the three plateau groups markedly increased than that in the plain group (p < 0.001). In addition, the SpO2 percentage and HR of soldiers in Lhasa and Naqu presented the same changes as Nyingchi (p < 0.001). However, no significant difference was found between Lhasa and Naqu.The SpOF = 9.352, p < 0.000, MSE = 86.49, \u03b72 = 0.025]. Post-hoc analysis revealed that the amplitude of N2 were larger in electrode Fz showing the minimum amplitude  and electrode CPz showing the maximum amplitude .A 4 \u00d7 3 \u00d7 5(electrode distribution) mixed analysis of variance was conducted for the peak amplitudes of N200. The main effect of the electrodes was significant . Simple main effect analysis found that there was no significant difference under Go condition (p = 0.527), but there was difference under NoGo trial  and a significant difference in difference wave N2d . Further analyses revealed that at NoGo trial, the amplitudes of N2 was positive for Naqu  and Lhasa  regions than that for the plain . The amplitudes of N2d for the plain group  were negative than that for Lhasa  and Naqu .The results revealed interaction effects between altitude and trial type , no interaction effect between electrodes and trial type , or no triple interaction effects among three variables   = 3.702, p = 0.040, \u03b72 = 0.049]. The post-hoc test suggested that the latency of N2 at Cz electrode was significantly earlier than that of Fz and FCz electrode .A 4 \u00d7 3 \u00d7 5(electrode distribution) mixed analysis of variance analysis revealed a significant main effect of electrode on the latencies of N2 . Simple effect analysis indicated that there was a significant difference in the NoGo trial . The latency of N2 in the Nyingchi group was significantly earlier than that in the plain and the Lhasa groups.The analysis also revealed significant interaction effects between the altitude and trial type . The amplitudes of P3 were positive, with electrode FCz showing the maximum amplitude  and electrode Pz showing the minimum amplitude . P3d amplitude were larger, with electrode Fz showing the maximum amplitude  and electrode Pz showing the minimum amplitude .A 4 \u00d7 3 \u00d7 5(electrode distribution) mixed analysis of variance was conducted for the peak amplitudes of P3. The main effect of electrodes was significant . The simple main effect analysis found that there was a significant difference for three conditions at different altitudes . A further analysis revealed that at Go trial, the amplitude of P3 in the plain group  was significantly positive than that in Nyingchi  and Naqu  groups. In NoGo trial, the amplitude of P3 in the plain group  was significantly positive than that in Nyingchi , Lhasa , and Naqu groups , p < 0.000. The amplitude of P3d were significant positive for the plain  than for the Nyingchi , Lhasa , and Naqu   = 0.963, p = 0.403, MSE = 6.51, \u03b72 = 0.003), no interaction effect between trial type and electrodes , or no triple interaction effects among three variables .There was no interaction effect between altitude and electrodes . The post-hoc analysis test suggested that the latency of P3 in the Nyingchi group was significantly earlier than that of the plain, Lhasa, and Naqu groups . The analysis also revealed a significant interaction effects between altitude and trial type . Further analysis indicated that at the Go task, the latency of P3 in the Nyingzhi group was significantly earlier than that in the other three groups . At the NoGo task, the latency of P3 in the Nyingzhi group was significantly earlier than that in the other three groups (p < 0.001). Other main effects and interaction effects were not significant.A 4 \u00d7 3 \u00d7 5 (electrode distribution) mixed analysis of variance analysis revealed a significant main effect of altitude for the latencies of P3 . The results of analysis revealed a significant interaction effect between the altitude and frequency band . Simple effect analysis found that in the \u03b4, \u03b8, and \u03b1 bands, there was a significant difference for N2 at different altitudes . A further analysis indicated that the power of \u03b4 band in the plain group was the highest , p < 0.000], which was significantly larger than that in the Nyingchi , Lhasa , and Naqu  groups. The power of \u03b8 band in plain group was the highest , which was significantly larger than that in Nyingchi , Lhasa , and Naqu . However, the power of \u03b1 band in the Naqu group was the highest , which was significantly higher than that in the plain group , Nyingzhi , and Lhasa . The results of analysis also revealed a significant interaction effect between the electrodeposition and frequency band . Simple effect analysis found that the power of \u03b4, \u03b8, and \u03b1 bands was the highest at the FCz electrode, decreased gradually at the Fz, Cz, and CPz electrode, and dropped up to the minimum Pz electrode  \u00d7 5(frequency band) \u00d7 5(electrodes) mixed ANOVA yielded no triple interaction effects . The results of the analysis yielded significant interaction effects between the altitude and frequency band . Simple main effect analysis found that in the \u03b4, \u03b8, and \u03b1 bands, there was a significant difference for P3 at different altitudes . The power of \u03b4 band in the plain group  was significantly larger than that in the Nyingchi , and Lhasa , p < 0.000. Naqu  was significantly larger than Nyingchi and Lhasa, p < 0.05. The power of \u03b8 band in the plain group was the highest , which was significantly larger than that in Nyingzhi , Lhasa , and Naqu . The power of \u03b8 band in Naqu was the lowest, which is significantly lower than that in Nyingchi and Lhasa. However, the power of \u03b1 in Naqu , which was significantly higher than that in Weinan , Nyingzhi , and Lhasa .A 4 \u00d7 5(frequency band) \u00d7 5(electrodes) mixed ANOVA yielded no triple interaction effect [In this study, physiological indexes and ERPs were used to explore the dynamic brain changes and neurons' oscillating hypoxia hypobaric environment exposure characteristics to varying altitudes on soldiers' inhibition control ability.2 of soldiers in all three plateau areas was significantly lower than the plain group. The results of HR analysis showed an opposite trend to SpO2. Studies have shown that SpO2 was negatively correlated with stationing altitude, and HR was positively correlated with stationing altitude , but it decreases significantly at the altitude of 4,890 m (Naqu). Previous long-term exposure studies using different cognitive tasks have found that reaction times appear shortened at high altitudes (Richardson et al., The ERPs can reflect information on the neural mechanisms of response inhibition in warriors exposed to high-altitude environments for long periods. In this study, significant response inhibition effects were successfully evoked at four groups, that is, NoGo-N2 and NoGo-P3 components induced by NoGo stimulation were successfully inhibited. Comparing the differences between the three plateau groups and one plain group revealed that the three plateau groups' soldiers showed a significant decrease in amplitude both in the N2 component of conflict monitoring and the P3 component of late processing of information. Studies have indicated that N2 and P3 are considered to function as separable processes in Go/NoGo tasks (Randall and Smith, Notably, among the three groups of high-altitude regions, the hypoxic environment in the Nagqu region had the most pronounced effect on the soldiers' inhibitory control function. The primary manifestation was the smallest amplitude of the P3 component of the difference wave, which is considered the neural activity induced by afferent stimuli and reflects the degree of perceptual information processing and an alteration (Godde et al., This study also explored the effects of different altitude plateau on the soldier's response inhibition function near convulsions, focusing on the conflict monitoring and response inhibition phases. Hypoxic exposure can change the neural network's spatial representation and be reflected by EEG's different nervous oscillations (Cvetkovic et al., Studies have shown that EEG activity decreases at the beginning of an acute hypoxic exposure and increases with the emergence of \u03b1-band activity (Schellart and Reits, Several limitations of the present study should be noted. In this study, all the subjects lived at the site for more than 24 months and completed the process of acclimatization at a high altitude. As the experiment was carried out in spring, Nyingchi and Lhasa's oxygen contents are relatively abundant. The sample size involved in the study is relatively small, so the research results may be affected and have some limitations. Second, we did not measure any cerebral oxygen delivery parameters, such as cerebral oxygenation and cerebral blood flow. Future studies should directly measure cerebral oxygenation, cerebral blood flow, and cerebral oxygen delivery and clarify the mechanism of decreased executive function under hypoxia (Ochi et al., 2, and a reduction in SpO2 may lead to a decline in response inhibition.In summary, this study found that chronic hypoxia exposure at different altitudes of plateau affects response inhibition, mainly in the conflict monitoring phase and post-processing phase. Further analysis revealed that 3,860 m was the height of decline in the brain's response inhibition function during the conflict monitoring phase, and 2,950 m was the height of decrease during the response inhibition phase. In addition, the soldier's brain executive function was closely related to SpOThe original contributions presented in the study are included in the article/supplementary material, further inquiries can be directed to the corresponding author/s.The study was conducted following the Declaration of Helsinki, and all procedures were carried out with the adequate understanding and written informed consent of the subjects. The study protocol was approved by the Ethics Committee of the Fourth Military of Medical University.XW and SZ were involved in the field for the data collection, troubleshooting, manuscript finalization, organized the data, carried out the analyses, drafted the manuscript, and took the lead in the manuscript finalization and submission. XN and AC were involved in the conceptualization, design, and planning of the study. All authors went through all the versions of the manuscript and approved them.The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest."}
+{"text": "The most recent emerging infectious diseases originated in animals, mainly in wildlife reservoirs. Mutations and recombination events mediate pathogen jumps between host species. The close phylogenetic relationship between humans and non-human primates allows the transmission of pathogens between these species. These pathogens cause severe impacts on public health and impair the conservation of habituated or non-habituated wild-living apes. Constant exposure of great apes to human actions such as hunting, deforestation, the opening of roads, and tourism, for example, contributes to increased interaction between humans and great apes. In spite of several studies emphasizing the risks of pathogen transmission between animals and humans, outbreaks of the reverse transmission of infectious agents threatening wildlife still occur on the African continent. In this context, measures to prevent the emergence of new diseases and conservation of primate species must be based on the One Health concept; that is, they must also ensure the monitoring of the environment and involve political and social aspects. In this article, we review and discuss the anthropological aspects of the transmission of diseases between people and wild primates and discuss new anthropozoonotic diseases in great apes in Africa from studies published between 2016 and 2020. We conclude that the health of great apes also depends on monitoring the health of human populations that interact with these individuals. The One Health concept proposes the inseparability between human, animal, and environmental health in a cooperative, optimistic, and adaptive approach to achieving health in a disturbed biosphere ,2. In thOn the African continent, many socio-political factors make animal and human populations vulnerable to zoonotic diseases. Zoonotic episodes reported in Africa show that social differences significantly impact health risks in different countries . It is pIn Africa, social inequality and its resulting impacts are impediments to national and human development. Thus, risk factors tend to be perpetuated in African countries . A vicioIn addition to environmental degradation, new relationships between humans and wild animals, especially non-human primates, have increased the exposure of a much larger population, including people living in urban areas, to health risks. These new interactions range from deforestation for the construction of new roads or expansion of agricultural activities to the contact of these animals, or potential vectors of disease, with people who travel in search of ecotourism opportunities . It is iPeople and their environments maintain an inseparable relationship, and thus the practices of a given community are circumscribed within the socio-environmental context in which they exist. This interaction between humans and the environment determines disease patterns as they appear in the population. Despite gaining greater attention in recent years, this concept dates back to Hippocrates and was coined as \u201cOne Medicine\u201d by Schwabe . It is eUnderstanding social issues clarifies that health and disease are based on dimensions beyond biological sciences for humans and animals . TherefoBecause some populations are at a greater likelihood of exposure to certain diseases, such as zoonoses, due to their settlement in specific socio-ecological environments , we mustThe high percentage of people living in rural areas who depend on livestock production  or huntiUnderstanding the transmission of zoonotic diseases between wild animals and humans on the African continent must be understood as involving various factors. Among them are recurring political crises and subsequent social insecurity that results in a continuous movement of people towards exploiting natural resources . In addiHowever, hunting of African wildlife is not limited to conditions of subsistence. Some variables were brought up in wildlife use surveys in four African countries  . The datIn addition to the factors described above, new pathogen transmission dynamics between people and apes have been identified. This is even more complex, as it involves the movement of people from distant regions. Despite the fact that the habituation of great apes and their contact with people is related to the transmission of pathogens, human intervention has contributed to increasing ape populations. This is because veterinary care and awareness of local populations have allowed for better conservation of these groups of primates . FurtherZooanthroponoses are diseases that are transmissible from human to human that can also be transmitted from people to animals; such diseases are also referred to as anthroponotic. Many of these pathogens evolved through different animal species until reaching NHPs and humans. Infection by human pathogens in primates has been related to close contact with humans diagnosed with viral infection . In recePneumoviridae: Metapneumovirus) infection, with a mortality of 12.2%, and human respirovirus 3  infection, without deaths of individuals in the community as a direct result of the infection. In both communities, none of the viruses had been previously diagnosed. Phylogenetic analyses revealed that Ngogo\u2019s MPV and Kanyawara\u2019s HRV3 were closely related to globally circulating human viruses, indicating independent sources for both viruses. However, the origins of infection that caused these outbreaks remain unclear, as these chimpanzee communities usually do not have contact with people, especially tourists. This underscores the importance of adopting \u201creal-time\u201d epidemiologic analyses in mortality episodes in NHPs, for rapid diagnosis and timely adoption of control measures [In the same way that pathogens are transmitted from great apes to people, the reverse also occurs, mainly in respiratory diseases . In factmeasures .Picornaviridae [Another outbreak of severe respiratory diseases in chimpanzees, also in Uganda, resulted in the death of an infant and four adults . In addition, human rhinovirus C, family aviridae , was ideaviridae . In chimaviridae .Human respiratory syncytial virus (HRSV) is another important respiratory virus, identified as one of the main causes of pediatric mortality in humans , which hPan paniscus). Bonobos were not yet habituated in a region that is not protected by law but belongs to local communities that have traditionally not hunted bonobos [Streptococcus pneumoniae. Aspects of these outbreaks in bonobos speak to the threat of HRSV in other great ape species and other NHPs, since co-infection with other agents  could cause severe problems in primate ecological communities.In the DCR, two outbreaks of respiratory diseases occurred in 2014 and 2015 in two groups of wild bonobos ( bonobos . HoweverThese outbreaks of neglected infectious diseases in great apes will continue to occur in Africa unless urgent preventive measures are taken ,47; thesA critical strategic breakthrough is needed in the area of great ape disease prevention. In this context, to prevent the emergence of new diseases, conservation of primate species must be based on the One Health concept. That is, primate conservation efforts include the monitoring of the environment and involve political and social aspects, and anthropological relations in the ape\u2013human interface."}
+{"text": "These cells also showed profound resistance to drugs of other classes. Molecular analysis revealed persistent activation of phosphorylated AKT at threonine 308 in the drug resistant cells and increased expression of markers for tumor-initiating cells. Interestingly, increased intra-cellular ROS levels were observed in the drug resistant cells. Among anti-oxidant molecules, the expression of SOD2 was increased and was associated with the ALDH-positive tumor-initiating cell features. Co-incubation of SOD inhibitors and BEZ235 decreased the stemness feature of the cells in vitro, as shown by results of the spheroid formation assay. In conclusion, dysregulation of SOD2 might contribute to the profound resistance to PI3K inhibitors and the other drugs in HNC cells.The phosphoinositide-3-kinase (PI3K) pathway has widely been considered as a potential therapeutic target for head and neck cancer (HNC); however, the application of PI3K inhibitors is often overshadowed by the induction of drug resistance with unknown mechanisms. In this study, PII3K inhibitor resistant cancer cells were developed by prolonged culturing of cell lines with BEZ235, a dual PI3K and mammalian target of rapamycin (mTOR) inhibitor. The drug resistant HNC cells showed higher IC Head and neck cancer (HNC) is a term commonly used to describe different malignant diseases arising from epithelial cells of the upper aerodigestive tract such as the oral cavity and pharyngeal or laryngeal regions. They share common histology features with squamous cell carcinoma, which is the most frequent type. The worldwide incidence of the disease rapidly grew from 2008, with 263,900 cases, to 2018, with 890,000 cases, causing 128,000 and 450,000 deaths, respectively, and ranking sixth as the most common cancer in the world [KRAS, has been shown to cause cetuximab failure in colon cancer [PIK3CA genes or by loss of the regulator PTEN was also associated with cetuximab resistance [New discoveries in oncology showed certain aberrations in molecular signals that are critical for tumors to survive. Targeting drugs against these factors provide therapeutic opportunities that are more specific to tumors with less interference to the normal tissue. The specific strategies differ from conventional chemotherapies, of which the given doses are often limited by toxicities to reach the optimal treatment dose or must be administered via alternative routes to minimize the adverse effects ,8,9. An n cancer . Similarsistance . All thesistance ,20,21,22sistance ,24.As the PI3K signaling pathway plays multiple roles in the maintenance of cell survival, inhibition of this pathway brings advantages in tumor control . One of In this study, we analyzed the cellular and molecular characteristics, especially the stemness features, of HNC cells with and without PI3K inhibitor resistance. The possible mechanism of drug resistance was studied in these HNC cells. Finally, we proposed a potential treatment strategy to minimize the chance of developing drug resistance, which could warrant future studies.50 of BEZ235, as compared to their parental cells. In addition, the BEZ235-resistant cells showed profound resistance to LY294002 and rapamycin, which are PI3K and mTOR specific inhibitors, respectively. These cells also exhibited resistance against the EGFR inhibitor, gefitinib. These results confirmed that multi-drug resistant HNC cells were developed by prolonged PI3K/mTOR pathway blockage.Human FaDu and UMSCC1 HNC cells were used in the current study. To develop the resistant variants, cells were cultured with prolonged incubation of BEZ235. As shown in To determine the mechanism of resistance, we investigated the expression of various molecules of the PI3K/mTOR signaling pathway. As shown in The AKT/mTOR signaling pathway is associated with functioning of the cancer stemness features . Increaswww.oncomine.org), we found that higher SOD2 expression was generally predominantly expressed, compared to SOD1 and catalase, in HNC tumors versus in normal tissue  and UMSCC1 was a gift from Chia-Jui Yen . DMEM with supplementation of 10% fetal bovine serum and penicillin/gentamicin antibiotics was used as medium . The resistant cells were derived from prolonged incubation with BEZ235  in the concentrations of 200 nM for FaDu and UMSCC1, and 1000 nM for FaDu. The compound in the beginning reduced the cellular proliferation and survival significantly, but eventually ended up with recovery in these parameters. Randomized single-cell clones were then selected and cultured. Both cells, FaDu and UMSCC1, were grown for at least 8 months (200r) and longer (1000r) to establish resistance. The resistant cells were maintained by 200 nM for 200r and 1000 nM for 1000r.Whole cell lysate was separated in the SDS-PAGE by electrophoresis. It was then transferred onto polyvinylidene difluoride membranes . The membranes were then blocked overnight in 5% nonfat milk with primary antibodies against SOD2 , Bmi1 , SOX2 , phosphorylated or total mTOR, phosphorylated or total mTOR, AKT , and beta-actin . After washing with phosphate buffered saline, they were incubated with secondary antibodies. The signals were then elicited with chemiluminescence substrate, and the intensity was detected with Amersham Hyperfilm ECL .\u00ae Green Master Mix  and the primers were the following: SOD2, F:5\u2019-GGCCTACGTGAACAACCTGAA, R:5\u2019-CTGTAACATCTCCCTTGGCCA; Nanog, F:5\u2019-AATACCTCAGCCTCCAGCAGATG, R:5\u2019-TGCGTCACACCATTGCTATTCTTC; Oct4, F:5\u2032-CTTGCTGCAGAAGTGGGTGGAGGAA, R:5\u2032-CTGCAGTGTGGGTTTCGGGCA; Bmi1, F:5\u2019-TGGAGAAGGAATGGTCCACTTC, R:5\u2019-GTGAGGAAACTGTGGATGAGGA; SOX2, F:5\u2019-AAATGGGAGGGGTGCAAAAGAGGAG, R:5\u2019-CAGCTGTCATTTGCTGTGGGTGATG; GAPDH, F:5\u2032-GAAGGTGAAGGTCGGAGTC, R:5\u2032-GAAGATGGTGATGGGATTC. The mixture was amplified and quantified by ABI 7000 Sequence Detection System . The data were then normalized to GAPDH using the 2Ct\u2212\u0394\u0394 formula.Total RNA was isolated from cells by standard procedure with TRIzol . It was then subjected to qRT-PCR with SuperScript II reagent . For preparation, the product was mixed with SYBRCells were cultured in quantities of 400 or 5000\u201320,000 cells/mL/well in a 6- or 24-well plate with or without treatment for clonogenic assay or cell density assay, respectively. For clonogenic assay, the cells were washed after three days and incubated in treatment-free medium to allow them to grow into colonies. The number of colonies was then counted after staining and fixing of the cells with 50% ethanol containing 0.5% methylene blue  for 90 min. For the cell density assay, cells were allowed proliferate with drug treatment. After three days the cells were stained and fixed with the aforementioned solution. For quantification, they were dissolved in 1% N-lauroyl-sarcosine , then the optical density of the wavelength at 570 nm was measured by the microplate reader.Cells were pretreated and dissociated. For evaluation of the tumor-initiating feature, they were stained with ALDEFLUOR  in presence or absence of the inhibitor diethylaminobenzaldehyde  to detect the specific marker ALDH . In brieThe sorting process was through FACSAria\u2122 III  for concomitant isolation of the ALDH-positive and the -negative cells, according to the ALDEFLUOR staining result. The cells were collected in the serum-free, growth factor-supplemented DMEM/F12 medium. At least 20,000 cells were used in each group for immediate RNA preparation, followed by the qPCR as described previously.Cells were cultured in serum-free DMEM/F12 medium containing 2% B27 supplement, epidermal growth factor (20 ng/mL), and basic fibroblast growth factor (20 ng/mL) for supplementation. To promote anchorage-independent spheroid growth, methylcellulose  with the concentration of 0.3% was added to the medium and was cultured in Costar\u00ae Ultra-Low Attachment Plates  . For inhp value equaled 0.05 or less to be considered significant.Statistical analysis of the data were obtained by using Prism 7 . The differences in continuous variables were calculated by Unpaired, Two-Tailed Student\u2019s t-Test, with"}
+{"text": "Routines play a major role in educational change in schools. But what happens if the routines performed by school staff fail to deal successfully with current challenges? What strategies aid adaptation of the routines in a specific situation? Up to now, there exists no comprehensive concept for understanding why and at what points the adapting of routines in schools in a specific situation takes a favorable or unfavorable direction. To address this gap, we propose extending theories on routines by considering theories on self-regulated and collectively regulated learning. We consider these theories to be a beneficial complement because of their broad theoretical, methodological, and empirical research base. We argue that these theories enhance the understanding of adapting routines to specific challenging situations in schools. We present a newly developed theoretical framework for dealing with specific challenging situations in schools as an interplay between routines and regulation processes. Finally, important research questions regarding the suggested approach are discussed. Routines in schools play a major role in educational change  and changing routines in a longer perspective (ostensive aspect), is not sufficiently visible. Accordingly, the literature review can only give a general overview on how routines might be changed.Feldman  describeRerup and Feldman  followedIn contrast, Rerup  focused In the school context, Conley and Enomoto , 2009 idlong-term change of routines (referring to the ostensive aspect) and short-term adaptation of routines in a concrete, specific situation (referring to the performative aspect).Theoretical frameworks and empirical studies are available that address routines and their change in relation to organizational learning, improvement of teaching and learning, and data use. The studies show that routines can be deliberately changed by intentional implementation of strategies. However, in previous studies there has been no sufficient differentiation between To change routines in the longer term (ostensive aspect of routines) an ongoing adaptation of performed situation-specific routines is required, as the ostensive and performative aspects strongly interact  is necessary.Furthermore, only few strategies have been identified, and a comprehensive theoretical concept of strategies for changing routines in schools is missing that conceptualizes individual and collective learning in organizations influenced by social experiences and interactions  Winne and Hadwin\u2019s  theoretiOf the many definitions in the literature, Zimmerman\u2019s , p. 308 first core element is selection of appropriate goals. Individual learners or group of learners selecting appropriate goals have to take into account the conditions of the task and the individual\u2019s and group\u2019s conditions, such as their motivation, their knowledge in the domain, and their standards or the standards set by external authorities.The second core element is purposeful use of regulation strategies. To reach the goals set, individual and groups of learners have to apply learning strategies. Weinstein and Mayer , social context.operations applied, e.g., cognitive strategies and tactics, such as rehearsing, summarizing, outlining, searching, assembling.the standards applied, meaning the criteria to evaluate the result.the The last aspect of Winne and Hadwin\u2019s  \u2018if\u2013thenThis regulation process with the aim of adapting conditions, operations, and standards to the requirements of the learning tasks in order to achieve the goals successfully is exercised by applying cognitive, metacognitive, and motivational regulation strategies \u201d  to better deal with a specific challenging situation?However, theories on regulated learning have the potential to significantly extend previous theories of adapting routines in schools, particularly by describing and analyzing situation-specific learning processes much more explicitly and by focusing on the individual and collective adaptation process and the actors\u2019 way of thinking    or collective practice . In general, we consider a challenging situation to be a demanding situation that is usually multidimensional, rather imprecise, and complex in terms of objectives and results as well as in terms of how to achieve these objectives and results. Challenging situations can occur at different levels and with different scopes and need for action: at the international level, such as the COVID-19 pandemic; at the national level, such as the introduction of national educational standards; at the regional level, such as findings of school-external evaluations; at the school level, such as the results of a parent survey or standardized achievement tests; or at the classroom level, when challenges arise in dealing with diversity or classroom disturbances.The starting point is a In the following, we present our framework by focusing on routines implemented by teachers\u00a0and school leaders, subgroups of teachers, or the whole school\u00a0team that help them deal efficiently with these challenges and on their adaptation of performed routines in a specific situation by applying regulation strategies. Although we describe the different aspects and actions in a linear way, the process is recursive and only weakly sequenced , the level of a subgroup of teachers, or the organizational level of the whole school. In some schools, there might be a routine of understanding classroom disturbances as the individual teacher\u2019s problem. In this case, individual teachers deal with the challenging situation because they are seen as the actor who can best solve the problem. However, in other schools, classroom disturbances might be interpreted as a collective problem, as the students are taught by several teachers in the whole school. In this perspective, classroom disturbances will be solved by taking a collective perspective, and the central actor is the teaching team or the whole school Bryant, .must be contacted if classroom disturbances occur, for instance the school leader.Further, the handling of the challenging situation is dependent on the professional competencies of the actors, including their content knowledge, metacognitive knowledge of regulation processes  regardiReturning to our example, teachers or school teams might have different pedagogical strategies at hand for dealing with classroom disturbances, such as issuing warnings or moving children to different seats or classes. Additionally, teachers or school teams that are experienced in regulated learning may be in the habit of asking colleagues for feedback to help them better understand and handle the challenging situation. They may try to structure the new information, e.g., other teachers\u2019 different ways of dealing with classroom disturbances, and analyze it efficiently, which in turn helps them to modify their pedagogical practice.Ideally, the routines implemented to deal with the challenging situation will lead to a reduction in classroom disturbances and the achievement of the objectives leads to the concluding of the process.identify the challenging situation and the implemented routines; second, they have to analyze them to find out what is not working; and third, they have to adapt the current routine, particularly the content, goals, and standards of the challenging situation, the actors\u2019 conditions and assignments, and the pedagogical strategies and tactics to deal with the challenging situation. In this adaptation process, cognitive, metacognitive, and motivational regulation strategies are important. In the following three sections, this adaptation process is substantiated by referring again to our example of classroom disturbances.However, it can also happen that despite the routines implemented, no positive outcome results. The performed routines failed to achieve the goals in this specific situation. According to Winne and Hadwin , when incontent of the classroom disturbances as the task to deal with are crucial for solving the situation adequately. Tasks vary in terms of complexity, the resources that are available, the time needed, or how well-defined the situation is. For regulation to take place, in-depth identification and analysis of the complex task \u2018classroom disturbances\u2019 are needed. As a regulation strategy, teachers or school teams may look for more information on the classroom disturbances by asking students for feedback or by asking colleagues to sit in on the classes to closely observe teacher-student interactions. Through this, teachers and school teams might discover that it is not individual children who are disrupting the classroom but rather that the interaction between teacher and students is disrupting teaching\u2013learning processes  insufficient routines when dealing with challenges in schools , (2) inThird, considering current discussions on the task- and domain-specificity of regulated learning  influences also the ostensive aspect of routines Feldman,  and how And finally, we need to keep in mind that studying regulated learning processes empirically is challenging (Wirth & Leutner, Taking together, investigating routines in schools theoretically and empirically with a focus on the concepts of self-regulated and collectively regulated learning has great potential in research on adapting routines not only from a research perspective but also regarding real-world practice. Although this approach certainly poses challenges, it may help make it possible to better understand, evaluate, shape, support, and adapt routines in practice and to support teachers and school leaders in developing capacities for sustainable change."}
+{"text": "Cancer\u2010associated fibroblasts (CAFs) are correlated with the immunotherapy response. However, the culprits that link CAFs to immunotherapy resistance are still rarely investigated in real\u2010world studies.This study aims to systematically assess the landscape of fibroblasts in cancer patients by combining single\u2010cell and bulk profiling data from pan\u2010cancer cohorts. We further sought to decipher the expression, survival predictive value and association with immunotherapy response of biglycan (BGN), a proteoglycan in the extracellular matrix, in multiple cohorts.Pan\u2010cancer tumor bulks and 27 single\u2010cell RNA sequencing cohorts were enrolled to investigate the correlations and crosstalk between CAFs and tumor or immune cells. Specific secreting factors of CAFs were then identified by expression profiling at tissue microdissection, isolated primary fibroblasts and single\u2010cell level. The role of BGN was further dissected in additional three bulk and five single\u2010cell profiling datasets from immunotherapy cohorts and validated in real\u2010world patients who have received PD\u20101 blockade using immunohistochemistry and immunofluorescence.CAFs were closely correlated with immune components. Frequent crosstalk between CAFs and other cells was revealed by the CellChat analysis. Single\u2010cell regulatory network inference and clustering identified common and distinct regulators for CAFs across cancers. The BGN was determined to be a specific secreting factor of CAFs. The BGN served as an unfavourable indicator for overall survival and immunotherapy response. In the real\u2010world immunotherapy cohort, patients with high BGN levels presented a higher proportion of poor response compared with those with low BGN (46.7%\u00a0vs. 11.8%) and a lower level of infiltrating CD8+ T cells was also observed.We highlighted the importance of CAFs in the tumor microenvironment and revealed that the BGN, which is mainly derived from CAFs, may be applicable in clinical practice and serve as a therapeutic target in immunotherapy resistance. There are tight correlations between CAFs and immune cells in pan\u2010cancer bulk cohort.Single\u2010cell data reveals regulators for CAFs and frequent crosstalk with other cells.In various cancers, stromal biglycan is dominantly derived from CAFs.Biglycan is an unfavourable indicator for survival and immunotherapy response in cancer. BGNbiglycanCAFscancer\u2010associated fibroblastsccRCCclear cell renal cell carcinomaCIBERSORTcell\u2010type Identification By Estimating Relative Subsets Of RNA TranscriptscMAPThe Connectivity MapDEGdifferentially expressed geneECMextracellular matrixEMTepithelial\u2013mesenchymal transitionEPICEstimate the Proportion of Immune and Cancer cellsESTIMATEEstimation of STromal and Immune cells in MAlignant Tumor tissues using Expression dataFPKMFragments per kilobase per million mapped fragmentsGEOGene Expression OmnibusGTExGenotype\u2010Tissue Expression ProjectGOGene OntologyHER2human epidermal growth factor receptor 2HRhazard ratioiCAFsinflammatory cancer\u2010associated fibroblastsICBimmune checkpoint blockadeIFimmunofluorescenceIHCimmunohistochemistryIRGimmune\u2010related geneMCP\u2010countermicroenvironment cell populations\u2010counterMPMiller\u2013PaynemyCAFsmyofibroblastic cancer\u2010associated fibroblastsOSoverall survivalPCAprincipal component analysisPRprogesterone receptorSCENICsingle\u2010cell regulatory network inference and clusteringscRNA\u2010seqSingle\u2010cell RNA sequencingTCGAThe Cancer Genome AtlasTMEtumor microenvironmentTNBCtriple\u2010negative breast cancerTPMtranscripts per million\u03b1\u2010SMA\u03b1\u2010smooth muscle actin1Cancer has long been recognized\u00a0as a devastating disease. Global cancer statistics estimated that almost 10.0 million cancer deaths and 19.3 million new cancer cases occurred in 2020.CAFs are highly heterogeneous and can be divided into different subpopulations with distinct biological functions, and they are labelled by specific markers. Hence, CAFs exert both pro\u2010tumor and anti\u2010tumor functions in different studies. CAFs are generally divided into myofibroblastic (myCAFs) and inflammatory (iCAFs) CAFs. The former is characterized\u00a0by a high level of \u03b1\u2010smooth muscle actin (\u03b1\u2010SMA), whereas the latter exhibits abundant chemokine and cytokine production without myofibroblastic features.hiCD29med\u2010hiSMAhi) is the only subpopulation characterised by immunosuppressive features in cancer. Further clustering of CAF\u2010S1 revealed eight subclusters. These subclusters included cluster 0/ecm\u2010myCAFs, which showed the up\u2010regulation of the CTLA4/PD\u20101 protein in regulatory T cells and the enhancement of the cluster 3/TGF\u03b2\u2010myCAFs.Although clinical trials have demonstrated that immunotherapies are effective in different cohorts of patients, the mechanism of primary resistance remains poorly understood.Single\u2010cell RNA sequencing (scRNA\u2010seq) has been developed in recent years to facilitate gene profiling analysis at the single\u2010cell level, providing an opportunity to clarify the heterogeneity of the tumor bulk and identify novel potential biomarkers and therapeutic targets. Herein, we sought to systematically assess the landscape of fibroblasts in patients with cancer by combining single\u2010cell and bulk profiling data from pan\u2010cancer cohorts. First, our analyses revealed the relative abundance of fibroblasts in 33 cancers and their intercellular interactions with malignant and immune cells, including secreted signalling, ECM\u2013receptor and cell\u2013cell contacts. Next, we explored the heterogeneity and homogeneity of CAFs in the transcriptional regulation of single\u2010cell clusters and provided insights into the mechanisms underlying CAFs development. We further identified biglycan (BGN), an extracellular protein, as a biomarker for CAFs and immunotherapy response. Finally, the expression, predictive value for survival and association with immunotherapy response to BGN were validated in multiple cohorts.22.1databases. A total of 10\u00a0363 tumor samples from 33 types of cancers that were pathologically diagnosed and had available RNA expression data were included in the TCGA project. The detailed constituent ratios and corresponding abbreviations in TCGA pan\u2010cancer cohort are shown in Figures Transcriptome data of the bulk tumor were retrieved from Genotype\u2010Tissue Expression Project (GTEx), The Cancer Genome Atlas (TCGA) project and Gene Expression Omnibus (GEO) For survival analysis, those without active follow\u2010up information were excluded. Overall survival (OS) was calculated from the date of diagnosis to the date of last follow\u2010up or death.\u00a0The mutation profiles of TP53, BRAF, EGFR and KRAS were obtained, and silent mutations were further removed in the TCGA dataset.https://xenabrowser.net/) and transformed into TPM. The corresponding FPKM of the TCGA cohort was also obtained and transformed. The cohorts were further merged, and cancers with\u00a0< 5 paired normal tissues were excluded.Fragments per kilobase per million mapped fragments (FPKM) data from the GTEx datasets were obtained from the Xena website (https://www.ncbi.nlm.nih.gov/geo/).Microdissection datasets of the epithelium and corresponding stroma from the lung (GSE22863), pancreas (GSE93326), breast (GSE10797), colon (GSE35602) and ovary (GSE38666) were downloaded from the GEO database and the Miller\u2013Payne (MP) criteria. Patients with MP G4\u20105 were classified into pathological responders and G1\u20103 were classified as non\u2010responders.IHC and immunofluorescence (IF) analyses were performed as previously described.2.3Specific CAFs markers have been commonly used to estimate the relative fibroblast abundance in cancer.Epithelial\u2013mesenchymal transition (EMT) markers were employed to show the correlation between fibroblasts and metastatic potential Table .34Immune\u2010related genes (IRGs) were also included in the analysis, including the activation of immune receptors, IFN\u2010\u03b3 signatures, immune modulators, inhibitory immune receptors/ligands and myeloid lineage\u2010related genes. More detailed IRGs, including receptors, ligands, co\u2010stimulators, co\u2010inhibitors, antigen presentation and cell adhesion, were also analyzed Table .15, 32.4http://timer.cistrome.org/) (Table https://xenabrowser.net).The stromal and immune scores were calculated to evaluate the immune and stromal components in the tumor bulk using the \u2018Estimation of STromal and Immune cells in MAlignant Tumor tissues using the Expression data\u2019 (ESTIMATE) method./) Table .41 In 2.5To estimate the relative fibroblast abundance in different cancers, samples from 33 cancers were clustered according to the expression of the commonly used CAFs markers . The ComplexHeatmap package was used for pan\u2010cancer sample clustering.2.614single\u2010cell sequencing datasets were collected as follows: basal cell carcinoma (BCC_GSE123813), bladder urothelial carcinoma (BLCA_GSE130001), breast cancer (BRCA_GSE114727), cholangiocarcinoma (CHOL_GSE125449), colorectal cancer (CRC_GSE146771), liver hepatocellular carcinoma (LIHC_GSE125449), kidney renal clear cell carcinoma (KIRC_GSE111360), head and neck squamous cell carcinoma (HNSC_GSE103322), neuroendocrine tumor (NET_GSE140312), stomach adenocarcinoma (STAD_GSE134520), skin cutaneous melanoma (SKCM_GSE123139), pancreatic adenocarcinoma (PAAD_CRA001160), ovarian serous cystadenocarcinoma (OV_GSE118828) and non\u2010small cell lung cancer (NSCLC_GSE131907) Table .44, 4Tumor bulk\u2010profiling cohorts  and three scRNA\u2010seq datasets reporting the response to immunotherapy were also obtained, following the methods adopted by previous studies Table .16, 1https://github.com/sqjin/CellChat).To analyze the cell\u2013cell interactions, the CellChat method was employed using the CellChat package (https://scenic.aertslab.org/) and pySCENIC in Python 3.8.5 (https://github.com/aertslab/pySCENIC).The single\u2010cell regulatory network inference and clustering (SCENIC) algorithm was used to analyze cis\u2010regulation and identify specific transcription factors.2.7The ggraph and circlize packages were used for the TME network analysis and display.2.8https://portals.broadinstitute.org/cmap/) was used to identify the target drugs that may affect CAFs.p\u00a0<\u00a00.05) influence (activate or inhibit) CAFs (Table The Connectivity Map (cMAP) built 02 of the Broad Institute  or Python 3.8.5.Survival analysis was conducted using the survival and survminer packages. The best cutoff value in each cancer cohort was adopted to draw the Kaplan\u2013Meier plot using the log\u2010rank test. Univariate Cox regression analysis was conducted to calculate the hazard ratios (HRs) for OS. The Shapiro\u2013Wilk test was used to examine the normality of the variables. For comparison between two unpaired groups, Student's 3The overall design of this study is illustrated in Figure\u00a03.1The EPIC algorithm was used to explore the abundance of fibroblasts in TME. Among the 33 cancers, acute myeloid leukaemia and uveal melanoma (UVM) showed relatively low CAFs scores, while most other cancers displayed relatively moderate to high levels of CAFs infiltration Figure\u00a0. In thyrr|\u00a0>\u00a00.3) with other cells (n\u00a0>\u00a02) were shown. The bubble size represented the number of strong correlations of a specific cell with other immune cells estimated by EPIC. Close correlations were observed between CAFs and immune cells in the microenvironment as they were significantly associated with many other kinds of cells in many cancers  according to cMAP, a tool for predicting potentially effective small molecular agents using gene expression signatures. Quipazine, 5279552, and 5255229 were predicted as the most effective agents (in six cancers)  Figure\u00a0, althoug3.2Considering the heterogeneity of CAFs, we used a clustering method to estimate fibroblast enrichment and understand their effects on clinical outcomes and associations with immune parameters. TCGA cohort was clustered into three groups with significantly different CAFs infiltration based on the gene expression of classic CAFs markers Figure\u00a0. There wThe distribution of CAFs infiltration in the different cancer types and immune subtypes was also investigated Figure\u00a0. The thr3.3To facilitate the biological analysis of CAFs at the single\u2010cell level, pan\u2010cancer single\u2010cell sequencing datasets of 14 cancers were collected. The main cell types were malignant, immune and stromal cells Figure\u00a0. The strTo identify specific transcriptional regulation networks for CAFs, a SCENIC analysis was performed. The detailed scores and cluster expression of the top regulons in the CAFs are shown in Figure The cellular interaction signalling consists of three parts: ECM\u2013receptor interaction, secreted signalling and cell\u2013cell contact. The top representative signals are shown in Figure\u00a03.4Given the intense outgoing signalling of CAFs, we sought to identify novel fibroblast\u2010specific secretory signatures. The expression profiles of tissue\u2010derived fibroblasts were collected and analyzed. Comparisons between fibroblasts from normal/benign breast, colon, lung and pancreatic tissues and the corresponding cancer tissues revealed that 16 protein\u2010coding genes were consistently up\u2010regulated in CAFs Figure . Among tWe focused on BGN because the gene and fibroblasts are both closely related to ECM remodelling.To further clarify the specific cellular origin of BGN expression, various single\u2010cell sequencing cohorts were used for analysis. BGN was predominantly expressed in fibroblasts/myofibroblasts (CAFs) in various cancers Figure\u00a0. The exp3.5Pan\u2010cancer expression of BGN in bulk tumors is comprehensively displayed in Figure Considering that BGN is generally upregulated in tumors, we suspected that it may participate in cancer development and further influence patients\u2019 clinical outcomes. Indeed, Kaplan\u2013Meier analysis indicated that lower BGN expression level predicted favourable OS in most cancers Figure . InteresGO enrichment was performed to elucidate the biological functions of BGN. The DEGs between the BGN high and BGN low groups were significantly enriched in ECM and immune\u2010related pathways Figure\u00a0. ConsistTo better characterize the BGN\u2010related immune profile, we examined the associations between the expression of BGN and IRGs and immune cell infiltration. On the one hand, BGN had a positive correlation with many functional IRGs, especially in gastrointestinal adenocarcinomas Figures\u00a0 and S9B.3.6Owing to the close relationship between BGN and immune parameters, we suspected that BGN might serve as a novel biomarker for immunotherapy. Therefore, the correlations between BGN levels and immunotherapy response were analyzed in multiple cancers, including urothelial cancer, basal cell carcinoma, non\u2010small cell lung cancer, clear cell renal cell carcinoma (ccRCC) and breast cancer. Three bulk profiling datasets were used to compare the expression levels of BGN in patients with different responses to ICB Figures\u00a0. As expePrevious studies have reported that specific clusters of CAFs may contribute to resistance to immunotherapy.We further validated our results in a clinical cohort of breast cancer patients. Interestingly, in a patient diagnosed with bilateral breast cancer, cancer bulks on the left and right sides responded differently to neoadjuvant PD\u20101 blockade and chemotherapy Figure\u00a0. MRI sho4Recent studies have provided insights into CAFs and deepened our understanding of their heterogeneity and biological characteristics in cancers.CAFs have historically been regarded as tumor\u2010promoting components because of their effects on the remodelling of ECM and production of growth factors.In recent years, the crosstalk between CAFs and immune cells has attracted a lot of attention. In the current study, the abundance of CAFs had a significant negative correlation with infiltrating cytotoxic CD8+ T cells and activated NK cells in most cancers, indicating that CAFs, as suggested by previous studies, might prevent cytotoxic T cell recruitment within tumors and further attenuate the anti\u2010tumor immune response.Immunotherapies, including therapies with different ICBs, have shown promising therapeutic efficacy against malignancies.This study had several limitations. First, different clusters of CAFs were analyzed as a whole in the scRNA\u2010seq cohorts. Different subsets of fibroblasts and their specific intercellular cross\u2010talk might have been overlooked. Second, all analyses in the current study were based on RNA expression of transcriptome data. However, epigenetic factors, including translational and post\u2010translational modifications, can cause bias at the protein level. In vivo and in vitro experiments are needed to confirm the key findings of this pan\u2010cancer study. Thirdly, we admit that some patients with unresectable tumor might not be suitable for sampling and was not enrolled in these public cohorts. But this bias was common in previous studies and currently hard to resolve. Finally, different ratios of the stroma to tumor in bulk\u2010seq cohorts could cause potential bias, as samples with limited stromal components pose a challenge to the accuracy of the analysis of fibroblasts.5This study focused on depicting the overall landscape of CAFs in various types of cancer. CAFs generally correlated with clinical outcomes and immune activity in cancer. BGN, a relatively CAF\u2010specific secretion signature, correlated with poor prognosis and is a predictive biomarker for poor response to ICB. Further research exploring the modulation of the transcription, translation, transportation, excretion and extracellular behaviour of BGN will further elucidate its role in the TME and its contribution to cancer development and immunotherapy resistance.No conflict of interest is declared.Supporting InformationClick here for additional data file.Supporting InformationClick here for additional data file.Supporting InformationClick here for additional data file.Supporting InformationClick here for additional data file.Supporting InformationClick here for additional data file.Supporting InformationClick here for additional data file.Supporting InformationClick here for additional data file.Supporting InformationClick here for additional data file.Supporting InformationClick here for additional data file.Supporting InformationClick here for additional data file.Supporting InformationClick here for additional data file.Supporting InformationClick here for additional data file.Supporting InformationClick here for additional data file.Supporting InformationClick here for additional data file.Supporting InformationClick here for additional data file.Supporting InformationClick here for additional data file.Supporting InformationClick here for additional data file."}
+{"text": "It is of interest to document the Molecular Dynamics Simulation and docking analysis of NF-\u03baB target with sulindac sodium in combating COVID-19 for further consideration. Sulindac is a nonsteroidal anti-inflammatory drug (NSAID) of the arylalkanoicacid class that is marketed by Merck under the brand name Clinoril. We show the binding features of sulindac sodium with NF-\u03baB that can be useful in drug repurposing in COVID-19 therapy. Sulindac is a non-steroidal anti-inflammatory agent (NSAIA) that can block nuclear factor-\u03baB (NF-\u03baB), a transcription factor (TF) located primarily in the cytoplasm in a complex while in an inactive state. Activation of this TF makesit transition from a latent cytoplasmic form to a nuclear DNA binding state  and has Recently, a study utilizing molecular dynamics simulations (MDS) - based analysis targeting human angiotensin-converting enzyme 2 (hACE2) as a receptor showed interesting results on development of a lead candidate to be used later as a therapeutic drugagainst COVID-19  Though iCoordinates of the X-ray diffraction-based crystal structure of the I-\u03ba-B-\u03b1/NF-\u03baB complex with solvents (PDB ID: 1NFI) at a resolution of 2.70 \u00c5 were downloaded from the Protein Data Bank (PDB). Solvent molecules andchains A, B, and F were removed during protein preparation using the Protein Preparation wizard from Schrodinger Maestro . The remaining structures were processed using the Protein Preparation wizard usingappropriate methodologies. The SARS-CoV-2 structure possessing a loop (residues 376-381) was missing in the PDB structure and hence was modelled using Schr\u00f6dinger's Prime module. Hydrogen atoms were incorporated, and a standard protonation stateat pH 7 was used. Bond orders were assigned using the chemical components dictionary (CCD) database. The heterostate was generated using Epik with a pH of 7 (\u00b12.0), and Prime was used to fill the missing chains and loops. While refining thestructure, PROPKA with pH 7.0 was used along with the sample water orientation. While minimizing the structure, a root mean square deviation (RMSD) of 0.30 \u00c5 with the OPLS_2005 force field was used. The ligand was selected based on publishedinformation regarding its use as a therapeutic molecule for various human diseases. The ligand was prepared using the Ligprep wizard of Schrodinger with the OPLS_2005 force field; the Epik job was submitted with the metal-binding site and includedthe original state. Thirty-two stereoisomers were assigned per ligand with specified chirality's. Glide was used to filter the search to locate the ligand in the active-site region of the receptor. The shape and properties of the receptor wererepresented on a grid to provide a more accurate scoring of the ligand poses. The docked complexes were superimposed on the original crystal structure to calculate the RMSD .The Glide grid generator was used for generating the grid for blind docking. A Schrodinger virtual screening workflow (VSW) was used to score the virtual screening with default parameters employing the Glide program of Schr\u00f6dinger. Use of HTVS modeallowed the elimination of most of the stereoisomers, and only 10% of the total ligands could be retained that passed the screening. Ligands following QikProp and Lipinski's rule were filtered for docking. Docking in the VSW was performed with Epikstate penalties and further passed through HTVS, SP and XP docking modes. The interactions of the selected ligand and protein docked complexes were analyzed by a pose viewer.To study the dynamic behavior of the protein complex under simulated physiological conditions, MDSs of the protein-ligand (PL) complex were performed using Desmond, which is available with Schrodinger Maestro (v12.5). The PL complex (9873 atoms) wassolvated in a 10 x 10 x 10 \u00c5 orthorhombic periodic box built with TIP3P water molecules . The whoThe PDB was used to extract all 3-D structural information. The X-ray diffraction-based crystal structure of the I-\u03ba-B-\u03b1/NF-\u03baB complex with solvents (PDB ID: 1NFI) at a resolution of 2.70 \u00c5 was used for this study. Solvents andchains A, B, and F were removed during protein preparation. The structure of the SARS-CoV-2 spike glycoprotein (closed state) solved using electron microscopy (PDB ID: 6VXX) with a resolution of 2.80 \u00c5 was obtained. Furthermore, all water moleculeswere removed from both structural data sets. The educational version of PyMOL  was used to generate the images derived to understand and analyse the structure and inter chain interactioninformation.The ligand sulindac chosen in the current study for the mentioned reasons has its docking score and binding affinity shown in Figure 3(see PDF). The complex of the drug molecule docked in the pocket of NF-\u03baB was designated S0 and was taken as the reference for further interaction analysis.The molecule NF-\u03baB was found to having multiple pockets, as calculated using the CASTp 3.0 server -31 ThreeProtein-protein docking studies were carried out using ClusPro 2.0  with minLigPlot+ v.2.2  was usedPrime MM-GBSA  calculations were performed with the docked complex of receptor and sulindac. The implicit solvent model used is VSGB which ha1 Rec Strain = Receptor (from optimized complex) - Receptor2 Lig Strain = Ligand (from optimized complex) - Ligand3 MMGBSA dG Bind = Complex - Receptor - Ligand4 MMGBSA dG Bind (NS) = Complex - Receptor (from optimized complex) - Ligand (from optimized complex) = MMGBSA dG BindNS here refers to binding or interaction energy without any involvement of conformational changes occurring in the receptor or ligand. The potential energy of the complex will be reported in kcal/mol.The complex RMSD in the initial phase at 1.63 \u00c5 went to 4.11 \u00c5 while stabilizing the structure for 100 ns of simulation. Initially, at up to 50 ns, the RMSD did not fluctuate much, but after that, the stability fluctuated for 10 ns andstabilized subsequently . The RMSF plot analysis displayed minimal fluctuations in the protein structures . Furthermore, minimal fluctuations were also observed in the PL complex, and the RMSF plot showed fluctuationsin some regions of the protein. The results of the residue interaction analysis after docking are highlighted with specific colours based on the self-explanatory features . The docking interactions of sulindac showed that it docked in the largest pocket of the NF-\u03baB-I\u03baB complex that contains most of the residues interacting with the spike protein. It is possible that drug binding to the complex interferes with the above interaction of the spike protein,however, needs to be ascertained with more robust wet laboratory-based experimental designs. The sulindac was found to bind to other pocket than the one occupied by NF-\u03baB-IkB complex . Moreover, data shows the importance ofNF-\u03baB as a suitable drug receptor for COVID-19 for its proven roles as molecular targets in drug discovery-based in silico studies (Table 1 - see PDF).The interaction made by the drug molecule with the residues of the active site cavity of NF-\u03baB, IkB and P50 peptide chains is dynamic in nature and formed, broke and reformed during the simulation duration . A brief duration of20 ns was observed when no interaction occurred between the drug molecule and the NF-\u03baB active site residues. Although there was an interaction between the ligand (drug) molecule and residues of NF-\u03baB (chain C) and I\u03baB (chain E) in thefirst 50 ns, the interaction between the drug and I\u03baB (chain E) disappeared after 50 ns. This loss of interaction strengthened the ligand-NFkB interaction.The changes in the 3-D structure of the NF-\u03baB-I\u03baB complex due to the binding of the drug molecule and spike protein in the presence of the drug molecule were compared to that of the unbound complex . The binding of thedrug molecule to the NF-\u03baB-IkB complex led to an increase in the compactness of the complex. The area and volume data of the pockets presented in Figure 5A(see PDF) corroborated this observation. The binding of the spike protein in the presence ofthe drug molecule further increased the compactness of this complex, possibly due to increased interaction between the chains of the NF-\u03baB-I\u03baB complex. Additionally, we made a comparison of the amino acid (aa) residues of the spike protein, MAPkinase and pLC gamma during their interactions with the residues of the NF-\u03baB molecule to identify if any common pattern existing in aa selection by sulindac during these interactions. However, all three sets of interactions, such as NF-\u03baB-sulindacdocked with spike protein, NF-\u03baB sulindac docked with MAPK and NF-\u03baB sulindac docked with pLC gamma had different aa residues interacting with the chosen ligand (sulindac), revealing all these as independent events. In ourstudies, MM-GBSA studies on docked complexes revealed dG bind values that were reasonably in agreement with ranking based experimental scores, i.e., binding values We first calculated the MMGBSA dG Bind = Prime Energy (Optimized Complex) - Prime Energy(Optimized Free Ligand) - Prime Energy (Optimized Free Receptor) and second, MMGBSA dG Bind(NS) = Prime Energy (Optimized Complex) - Prime Energy (Ligand Geometry From Optimized Complex) - Prime Energy (Receptor Geometry From Optimized Complex).The values were found to be -2.15 kcal/mol for MMGBSA dG bind and -2.71 kcal/mol for MMGBSA dG bind (NS). The atoms contributing to the binding affinities are shown in Figure 7(see PDF).Our understanding on the involvement of NF-\u03baB signalling pathway in COVID-19 is limited, but NF-\u03baB inhibitors have been increasingly utilized to gain therapeutic benefits in many human diseases-50. Abno"}
+{"text": "JUNE: a detailed model of COVID-19 transmission with high spatial and demographic resolution, developed as part of the RAMP initiative. JUNE\u2009requires substantial computational resources to evaluate, making model calibration and general uncertainty analysis extremely challenging. We describe and employ the uncertainty quantification approaches of Bayes linear emulation and history matching to mimic JUNE\u2009and to perform a global parameter search, hence identifying regions of parameter space that produce acceptable matches to observed data, and demonstrating the capability of such methods.We analyze This article is part of the theme issue \u2018Technical challenges of modelling real-life epidemics and examples of overcoming these\u2019. Various models have been developed to aid decision makers in the assessment of policy options, from simple analytic models up to complex agent-based models (ABMs).  (i)For complex models, the evaluation time of the model is often so long that an exhaustive exploration of the model\u2019s behaviour over its full input parameter space is infeasible. (ii)imperfect model, is required.When comparing models to observed real-world data, an adequate statistical description of the link between model and reality, covering all major uncertainties and allowing for the rigorous use of an  (iii)all locations in input parameter space that lead to acceptable fits between model and observed data, and not just to find the location of a single good match.When calibrating, the appropriate scientific goal should be to identify  We summarize in the next section three UQ methods: (a) Bayes linear emulation, (b) linking models to reality and (c) Bayesian history matching, which address the aforementioned three problems. We then apply these UQ methods to the JUNE\u2009model in \u00a73.This process can be extremely challenging, and in many cases, its intractability precludes the full exploitation of sophisticated models, which may otherwise contain nuanced insights into the system of interest. The problem of calibrating a complex and computationally demanding model is not unique to epidemiology and occurs in a wide range of scientific disciplines including cosmology, climate, systems biology, geology and energy systems \u20135. To so. 2 (a)emulators: statistical constructs that mimic the scientific model in question, providing predictions of the model outputs with associated uncertainty, at as yet unevaluated input parameter settings [Complex models typically have runtimes that can vary from seconds to days or even weeks, greatly inhibiting full model exploration, calibration, forecasting etc. Many of the techniques in UQ therefore revolve around the construction of Bayesian settings . The emusettings ,5.JUNE\u2009in \u00a73, a priori [We represent a general scientific model as the function a priori . This siput xAij . The thiThe emulator form, as represented by equation , has varWe can select the list of active inputs, ions gij , or apprions gij , which cequation , whose v(i)A major issue when emulating complex models is the choice of the set of attributes/outputs of the model to emulate. For example, often an objective function describing the mismatch between model and data has been emulated . However, despite being deceptively simple having just a single output, the objective function typically has a complex form, as it depends on the union of all active inputs and possesses numerous local maxima/minima , renderi samples  or to em samples .(ii)We begin by specifying the region of input space of interest, typically a truction ,13.(iii)We then update our prior emulator structure given by equation  with thefi(x) , and wera priori, or use suitable plugin estimates as described in ref. [However, in most cases, our preferred choice is to use Bayes Linear methods, a more tractable version of Bayesian statistics, which requires a far simpler prior specification and analysis ,16. It dquations  and Most epidemiology models are developed to help explain, understand and predict the behaviour of the corresponding real world system of interest, typically in terms of the progression through a population of an infectious disease. An essential part of determining whether such a model is adequate for this task is the comparison of the model with data formed from observations of the real system. However, this comparison involves several uncertainties that must be accounted for to provide a meaningful definition of an \u2018acceptable\u2019 match between a model run and the observed data. Hence, it is vital to define a clear statistical model describing the difference between the epidemiological model, vailable , here, wvailable \u20135,10,21.The most familiar source of uncertainty is observational or experimental. We represent the features of interest of the real system as a vector of uncertain quantities, structural model discrepancy term. First, we note that even were we to evaluate the model, A critical feature that we must incorporate is the difference between the epidemiological model, fication  would bevailable ,14, alonvailable . Note thWhile the inclusion of the structural model discrepancy is unfamiliar to most modellers, it is now of standard practice in the UQ literature for analyzing complex but imperfect models ,18,23,24 (c) (i)Are there any input parameter settings that lead to acceptable matches between the model output and observed data? (ii)If so, what is the full set  Note the emphasis on finding all such acceptable matches: optimizing to find a single good fit is not adequate for assessing the impact of parametric uncertainty, nor for making predictions.Due to their fast evaluation speed, emulators can be used in a variety of UQ calculations that would be otherwise infeasible. One of the most important is the problem of performing global parameter searches. Here, we outline a powerful iterative emulator-based global search method known as history matching (HM), which has been successfully employed in a variety of scientific disciplines ,3,5,10. implausibility measures [HM proceeds iteratively by ruling out regions of input parameter space that can be discarded from further investigation based on measures . For an quations  and  and add them to the previous set  3.Use the runs to construct new, more accurate emulators defined only over the region  4.The implausibility measures  5.Cutoffs are imposed on the implausibility measures  6.Unless (a) the emulator variances for all outputs of interest are now small in comparison to the other sources of uncertainty due to the model discrepancy and observation errors, or (b) the entire input space has been deemed implausible, and return to step 1. 7.If 6 (a) is true, generate as large a number as possible of acceptable runs from the final non-implausible volume  The history matching approach is powerful for several reasons: (a) while reducing the volume of the non-implausible region, we expect the function JUNE\u2009model.Before performing the  follows :1. DesiSee ref.  for a diSee ref.  for full. 3 (a)JUNE [JUNE\u2009has also been adapted to capture the populations of Cox\u2019s Bazaar [JUNE\u2019s description of the epidemic spread rests on four areas: \u2014the construction of a realistic synthetic population that reflects, as accurately as possible, the population demographic and their geographic distribution; \u2014the simulation of the population sociology, i.e. how the individuals behave: how they spend their time, whom they get into contact with and in which social environment; \u2014the parameterization of the infection, how it is transmitted from infected to susceptible individuals and impact it has on the health of infected individuals; \u2014the mitigation of spread and impact of the infection through pharmaceutical and non-pharmaceutical interventions (NPIs) such as social distancing and vaccinations, respectively. They are discussed in more detail below.JUNE  is an ABs Bazaar , a refugs Bazaar , one of (i)JUNE\u2009builds its synthetic population based on real or parameterized census data\u2014in the case relevant for this contribution, JUNE\u2009constructs the about 55 million residents of England based on the 2011 census data accessible through the NOMIS database provided by the ONS. The data are organized hierarchically, with Output Areas (OAs) the smallest relevant unit, comprising on average about 250 residents with relatively similar socio-economic characteristics. The OAs have a specified geographic location, and their data contain information about age, sex and ethnicity of the area\u2019s residents [1JUNE\u2009uses national averages to correlate age, sex and ethnicity of individuals, which are presented as uncorrelated distributions in the data. In a similar way, information such as the national distributions of age differences of partners [esidents \u201331 and tesidents , in aboupartners , and of partners , are useJUNE\u2009assigns school-aged children to the nearest age-appropriate school; information about school locations and the age ranges for their students is taken from ref. [As additional static properties of the population, rom ref. . Within JUNE\u2009to construct an origin-destination matrix for the employees at the level of MSOAs [JUNE.The OAs are part of Middle Super Output Areas (MSOAs) with about 12\u2009500 residents and 50 OAs constituting one MSOA. The census data provide information about the sectors of companies within MSOAs and about the distribution of the working population over these sectors, using the Standard Industrial Classification (SIC) scheme . The parof MSOAs . Informaof MSOAs  underpin(ii)JUNE\u2019s virtual individuals.Having defined the static properties of the synthetic population\u2014where people live, work and study\u2014their daily lives outside work and education are filled with various activities. These activities include shopping, visiting friends and relatives in their homes, frequenting pubs and restaurants, going to the gym or cinema, to name a few. In the absence of any of these leisure activities, people are supposed to stay at home. Surveys performed, e.g. by the Office for National Statistics , define PolyMod [2 resulting in the renormalized overall contact matrices These schedules are supplemented with contact matrices from PolyMod  and the PolyMod , which iFor the purpose of fitting to data and the quantification of uncertainties in the model, we assume that the construction of the synthetic population and its interactions is well understood and robustly and well parameterized as it is driven by data of relatively high quality.(iii)JUNE, as in many other models, this is described as a probabilistic process. The infection probability for a susceptible person JUNE,\u2009it follows a profile given byThe description of the infection consists of two separate parts. First, the transmission from an infected person 3 In the original formulation of the JUNE\u2009model, significant efforts have gone into the quantification of probabilities for different health outcomes in the population, with some emphasis to also capture the health impact of COVID-19 on the highly vulnerable care home residents; we refer the reader to ref. [JUNE asymptomatic and symptomatic trajectories with varying severity have been identified, the latter ranging from mild, flu-like symptoms over admission to regular or intensive-care wards to death in hospital or at residence. Although there are some uncertainties related to this treatment, we usually do not consider them and treat the health outcomes as fixed by data. We seed initial infections based on the number of fatalities 2\u20133 weeks afterwards, by using the infection-fatality rates obtained from data and encoded in JUNE. The parameter Once an individual is infected, it takes some time\u2014the incubation period\u2014before they can infect others and some additional time before the onset of symptoms. A large range of input data has been used to derive various symptom trajectories for infected individuals, which in the case of high-income western countries in the global North depends mainly on their age and sex.(iv)JUNE, these measures can easily be modelled: social distancing measures and mask wearing can be described by modifying the JUNE\u2009simulation, we refer the reader to ref. [Since the beginning of the COVID-19 epidemic, the UK government\u2014like many other governments around the world\u2014has employed a wide range of mitigation strategies. At the beginning of the pandemic, these interventions were mainly non-pharmaceutical, and these NPIs ranged from relatively simple strategies at the level of individuals, such as mask wearing and other social distancing measures, to more involved and global strategies such as partial or complete lockdowns, involving school closures and the furloughing of parts of the work force. In  on data \u201345, by k (b)JUNE\u2009model can produce acceptable matches to observed data at the national and regional level, from the first wave of the COVID-19 pandemic and the subsequent summer period. We wish to identify the region of parameter space, JUNE would take approximately 10 hours to complete on 64 cores (Intel Xeon Skylake) and 128 GB of memory. This substantial computational expense combined with a relatively high-dimensional input parameter space makes a global parameter search extremely challenging and necessitates the use of emulation. While there are several types of data available for the early pandemic, many of these had questions regarding reliability. For example, case data were substantially affected by the limited and evolving availability of COVID-19 tests, while hospital admission data were, especially during the peak of the first wave, collected with understandably varying levels of diligence across trusts. While it would in principle be possible to incorporate such data sets using a detailed statistical model for the measurement errors, Our primary goal is to test if the equation  that incJUNE\u2009outputs of interest to be the hospital deaths and total deaths from 19 March to the end of August 2020, for England and its seven regions: East of England, London, Midlands, North East and Yorkshire, North West, South East and South West. We choose a subset of dates JUNE\u2009output is noisy, so we smooth them both using a standard kernel smoother  as we wish to compare the underlying trends, and define the smoothed versions to be the target observed data points JUNE\u2009outputs, We define the primary shown in , and theJUNE\u2009model. For example, we can examine the coefficients We design and evaluate a first iteration/wave of 150 runs over the input space, equation , to gain (c)optical depth plots, which simply show the depth in the remaining 18 dimensions of the non-implausible region . The op in ref. . Note thJUNE may well provide acceptable matches after a full HM.While performing a full global exploration of the input parameter space is of course preferable, it is sometimes useful to perform a fast \u2018look-ahead\u2019 stage to check if such an expensive model is capable of fitting the next period of observed data, or whether model improvements are required. JUNE\u2009matches several regions simultaneously, at least over the first wave, without resorting to any region specific parameters, suggests that geographical variations in the relative importance in different types of interaction drove/affected the different epidemic curves in those regions. Further, more detailed investigation to confirm this is of course required. We leave the extension to 2021 and beyond to the future work, as this requires the complex behavioural and partial restrictions  imposed over the December 2020 Christmas period (the \u2018cancelled Christmas\u2019) and the January to April 2021 lockdown and subsequent staggered release to be implemented and tested, possibly requiring additional time-dependent parameters, which is the ongoing work . We also note that the process of using complex models combined with emulators and appropriate uncertainties to make realistic predictions over such periods is a substantive UQ topic in its own right, which deserves separate treatment [To give more detail, reatment .Figure  (d)JUNE, with its high level of demographic and spatial granularity, may become important tools to aid local and national decision makers. However, to fully exploit the nuances of such complex and expensive ABMs, efficient and comprehensive calibration methods are required. We demonstrated the emulation of JUNE, providing insight into the model structure, and employed HM to identify the region of parameter space yielding reasonable matches to national and regional level hospital and total death data for the first COVID-19 wave. Such techniques form an essential tool for the future use of complex epidemiological ABMs, expanding our capabilities to combine detailed models with rigorous UQ. The ability to perform global exploration of the parameter spaces of expensive models of this form and to embed this within a broader UQ framework is vital for making predictions with realistic uncertainty statements and hence vital for subsequent decision support.Models such as . 4Our work represents an important step towards the full exploitation of highly granular and detailed ABMs in health settings and elsewhere, harnessing the full depth of their simulations in providing high-quality understanding of critical dynamics and robust quantitative projections for improved decision support.JUNE,  and to examine smaller geographic regions, in which the stochasticity of JUNE\u2009will become more pronounced, compared to the national/regional level where it is somewhat subdominant. This will require more sophisticated emulator strategies [JUNE state vector using UQ style data-augmentation techniques [JUNE is being employed e.g. by the UN for Cox\u2019s Bazaar [The next steps in this project are to include further outputs of interest within the HM for rategies , and if chniques . Beyond s Bazaar , a refugs Bazaar , one of JUNE. Supplementing the model with the elaborate UQ techniques will allow us to identify, in more detail and with increased certainty, important correlations between socio-economic markers of the population and the infection dynamics and outcomes.In addition, we plan to use the model to investigate in more detail social imbalances in COVID-19 attack rates and infection-fatality ratios, which are relatively easy to trace in a model such as"}
+{"text": "X), quinone oxidoreductase (NQO1) and heme oxidase-1 (HO-1) in ileum. Western-blot results indicated that prior administration of OP significantly up-regulated the Nrf2 production in ileum, and substantially decreased then Keap1 gene expression. In conclusion, intake of OP was found to markedly improve intestinal oxidative stress in vivo, and this effect was primarily mediated through the simulation of antioxidant Nrf2-Keap1 signaling pathway. This study is beneficial to the application of peptide nutrients in the prevention or mitigation of intestinal oxidative damage.Oyster peptide (OP) has exhibited useful biological activities and can be used in multi-functional foods. OP has been reported to play a significant role in intestinal protection, but its specific mechanism is still not completely understood. The aim of this study was to analyze the potential effect of OP on oxidative damage of mice intestine induced by cyclophosphamide (Cy). The experimental results revealed that intragastric administration of OP significantly increased average bodyweight, improved ileum tissue morphology and villus structure, as well as increased the activities of superoxide dismutase (SOD), catalase (CAT) and glutathione peroxidase (GSH-Px) in oxidized mice serum and liver. The content of malondialdehyde (MDA) in the mice serum and liver homogenate was found to be markedly decreased. Moreover, OP significantly increased the relative mRNA expression levels of superoxide dismutase (SOD), glutathione peroxidase (GSH-P The varal (HO\u00b7) . Howeveral (HO\u00b7) . The intal (HO\u00b7) , it is fal (HO\u00b7) . Furtheral (HO\u00b7) \u20139.Cyclophosphamide (Cy) is an alkylating compound, which is often used as an antitumor agent and chemotherapeutic agent , 11. It Marphysa sanguinea have demonstrated significant antioxidant activity and reduced the contents of catalase (CAT), superoxide dismutase (SOD), glutathione peroxidase (GSH-PX) and malondialdehyde (MDA)  . It alsoin vitro . In addiin vitro , hydroxyin vivo. The findings of this study might provide evidence for further understanding the protective mechanism of OP on intestinal mucosal injury, and thus provide a better natural alternative health food both for the prevention and treatment of oxidative stress injury.Here, the potential protective effects of OP on intestinal mucosa were explored by establishing a oxidative injury mouse model of intestinal mucosa, and the underlying mechanism was elucidated. As the advance and the novelty, this study analyzed the relationship between antioxidative peptide and Nrf2-Keap1 pathway Male SPF BALB/C mice aged 5\u20137 weeks and weighing 15\u201318 g were used in the present study. The mice were purchased from Slack Laboratory Animal Co., LTD. , and the license number was: SCXK (Shanghai) 2017-0005. Before the formal beginning of the experiments, the mice were placed in the animal room for adaptive feeding for 7 days, during which they were free to ingest food and water. Environmental conditions were set as: temperature 25 \u00b1 1\u00b0C, humidity 50 \u00b1 3%, light and dark cycle for 12 h. This study was carried out by the guidelines of the Animal Welfare Act and the Guide for the Care and Use of Laboratory Animals, which is approved by the Animal Ethics Committee of Zhejiang University of Technology (20210308038).Cyclophosphamide was obtained from Aladdin Chemical Co., LTD . Catalase (CAT), superoxide dismutase (SOD), glutathione peroxidase (GSH-PX), and malondialdehyde (MDA) detection kits were purchased from Nanjing Jianguo Institute of Biological Engineering . Antibodies against Nrf2 and Keap1 were obtained from Abcam . In addition, monoclonal antibody against \u03b2-actin was purchased from Santa Cruz Biotechnology, Inc. . All other reagents obtained were commercially available and of analytical grade.n = 8): control group (C), Cy model group (Y), OP high-dose group (HP) and low-dose group (LP). Mice were intragastrically administered OP for 21 successive days, and intraperitoneal Cy was injected for 3 days (days 18\u201321). The dose of Cy was determined according to our previous research, as shown in The acclimated mice were randomly divided into four different groups according to body weight /body weight (g) \u00d7 10The fresh ileum of mice was rinsed several times with the normal saline and placed in a clean eppendorf tube. The ileum was fixed in 10 mL 4% paraformaldehyde at room temperature for 24 h. Thereafter, ethanol dehydration, xylene transparent and paraffin embedding were carried out, respectively. Finally, the paraffin blocks were continuously cut by a slicer to obtain intestinal sections with a thickness of approximately 6 \u03bcm. Three sections of each tissue block were randomly selected for hematoxylin-eosin (HE) staining , and theThe ileum was removed after mouse the dissection, washed with PBS solution, and dried with filter article. A section of the empty intestine was obtained and fixed in a centrifuge tube containing glutaraldehyde. Transmission electron microscope (TEM) samples were treated as follows: The ileum of mice was washed several times with PBS solution and fixed in 1% osmium solution for 1 h. After rinsing with the distilled water for three times, the ileum was dehydrated with gradient ethanol and pure acetone successively. The ileum tissue was placed overnight in Spurr resin and polymerized at the temperature of 70\u00b0C. Thereafter, the intestine was cut into slices and then stained with uranium acetate and lead citrate. The ileum tissue was observed by TEM and SEM photographed . The samThe mice were anesthetized and sacrificed by neck amputation, followed by blood collection. The blood was subjected to the centrifugation at 4000 r/min and incubated at 4\u00b0C for 15 min. SOD, GSH-Px, CAT and MDA antioxidant kits were used to detect the contents of the various antioxidant factors in the serum of different groups of mice, according to the manufacturer's instructions.The mouse livers were weighed to about 100 mg and thoroughly ground in a tissue homogenizer. The supernatant was obtained after centrifugation at 3000 r/min for 10 min and stored at the temperature of 4\u00b0C. The contents of antioxidant enzymes SOD, GSH-Px, CAT and MDA were detected on the basis of the manufacturer's instructions of the commercial antioxidant kits.\u2212\u0394\u0394Ct method . The mass and concentrations of extracted RNA were determined via spectrophotometry at 260 and 280 nm, respectively. The first strand of cDNA was synthesized by using a Prime-Script 1st Strand cDNA Synthesis Kit . The different primer sequences were designed by Primer 5 software and synthesized by Shanghai Shenggong Biotechnology Co., Ltd. , the details of which have been shown in t method . The expThe ileum lysates were prepared using the Radio Immunoprecipitation Assay (RIPA) lysate buffer. The protein concentrations of the lysates were analyzed through bicinchoninic acid (BCA) protein determination kit . Approximately 30 \u03bcg of proteins were isolated using SDS-PAGE (10%) solution and then transferred to a 0.45 \u03bcm polyvinylidene fluoride (PVDF) membrane . The membrane was then blocked with 5% skim milk and incubated with the primary antibody  at the temperature of 4\u00b0C overnight. The membranes were washed three times with TBS for 5 min. Thereafter, the membrane was incubated within HRP-conjugated secondary antibody at the room temperature for about 2 h and rinsed three times for 15 min. The chemiluminescence imaging was carried out using the protein using enhanced chemiluminescence (ECL) reagent  . One-way variance (ANOVA) and Tukey tests were adopted for the statistical significance analysis. P < 0.05). Compared with Cy group, early intragastric administration of high-dose OP significantly increased the average daily gain of mice (P < 0.05). However, the mice treated with low dose OP also significantly increased the average daily gain, but the effect was not found to be significant (P > 0.05).The mice in Cy treated group showed significant stress reactions such as hair loss and luster, lethargy, slow movement and yellow feces on the second day after intraperitoneal injection of Cy, compared to the normal group . In addiThe potential effects of OP on ileum tissue morphology of mice were also analyzed and the results have been shown in TEM results of ileum of all mice have been shown in P < 0.05), compared with normal group. The intervention with high dose OP increased the contents of SOD, CAT and GSH-Px in serum of mice (P < 0.05), but significantly decreased the activity of MDA (P < 0.05), compared with the Cy group. Interestingly, low dose of OP intake also increased GSH-Px activity of serum in mice (P < 0.05), and decreased the content of MDA in the serum (P < 0.05), but did not display significant effect on the activities of SOD and CAT in the serum (P > 0.05). These findings suggested that the prior administration of OP boosted the antioxidant capacity in vivo, thereby modulating the oxidative stress response caused by Cy even in a dose-dependent manner.We also investigated the dose dependent effects of OP on the content or activities of serum antioxidant enzyme in mice, as shown in P < 0.05), while the content of MDA was observed to be increased more than 3 times (P < 0.05), thereby suggesting that serious oxidative stress occurred in liver after Cy was injected into the mice. Moreover, Compared with Cy group, CAT, GSH-Px and SOD in the liver of mice increased substantially (P < 0.05), and MDA production was decreased approximately by 50% in LP mice and 70% in HP mice (P < 0.05) under OP prevention. The above findings indicated that OP also exhibited a specific recovery and regulation effect on oxidative damage caused in the mouse liver tissues, and can display a dose-dependent protective effect.In addition, the dose dependent effects of OP on the activities of the various antioxidant factors in the mouse liver tissue was also analyzed . It was P < 0.05). Moreover, compared with the Cy treated group, the relative expression of SOD, GSH-Px, HO-1 and NQO1 genes were significantly increased upon prior intake of OP (P < 0.05) in a dose-dependent manner. These results suggested that OP can regulate the expression of various antioxidant genes and exert substantial protective effect on intestinal oxidation in immunosuppressed mice, which can partially recover the decreased antioxidant capacity caused by Cy.The effect of OP on the relative expression of antioxidant related genes in the ileum of Cy-induced mice was also examined. The experimental results have been shown as in P < 0.05), but the relative expression level of Keap1 protein was significantly increased (P < 0.05) as compared with the normal group. Interestingly, prior intake of OP significantly upregulated Nrf2 protein expression level in ileum of the mice (P < 0.05), while it significantly decreased Keap1 protein expression in a dose-dependent manner (P < 0.05), as compared with the Cy group. These findings suggested that OP might play a protective role on intestinal oxidative stress in immunosuppressed mice through activating Nrf2-Keap1 pathway.Finally, we investigated the dose dependent effect of OP on the relative expression of major proteins of Nrf2-Keap1 pathway in the mice ileum. The result has been shown in Cy is widely employed in the treatment of different cancers as well as autoimmune diseases , and can2O2 and reduce \u00b7OH level, thus reducing the damage caused by free radicals to the body , CAT) and GSH-Px are the key enzymes and regulatory factors involved in the body's antioxidant defense system. For instance, SOD can effectively catalyze superoxide anion and remove free radicals, thereby reducing the lipid peroxidation and maintaining the balance between oxidative and anti-oxidative states \u201336. Meanthe body , 38. MDAthe body , 40. Botthe body , and it the body . AL1-1 cin vitro. By regulating Nrf2-Keap1 pathway in CPP-treated mice, the expression of upstream factor Keap1 was decreased, whereas that of Nrf2 was increased, and then the expression of downstream factors  was found to be enhanced. It prevented oxidative damage induced by Cy in mice. As an effective antioxidant, OP can significantly reduce reproductive oxidative stress damage associated with the Nrf2-Keap1/ARE pathway.Nrf2 is a critical transcription factor which can effectively regulate oxidative stress in the body and restore oxidative damage by modulating the secretion of antioxidant enzymes , 44. Undin vivo, but at the same time, it is necessary to ignore the interference effects of other negative effects. In addition, peptides are hydrolyzed in the gastrointestinal tract into free amino acids, which also have the antioxidant capacity in the body. However, it is worth noting that it is also due to the characteristic products of different peptide sequences that cause the different results.This finding may be some potential limitations. First, Cy-induced long-term intestinal oxidative damage is not equivalent to ordinary oxidative damage. The Cy modeling method has indeed increased the success rate and achieved excellent results In this study, intragastric administration of OP was found to significantly increase the average daily gain of Cy-induced oxidative stress mice. OP treatment also improved SOD, CAT and GSHPx activity levels in the serum and liver, and significantly reduced MDA content. Moreover, OP increased the relative mRNA expression of SOD, GSH-Px, Nrf2, HO-1 and NQO1 in ileum significantly, up-regulated Nrf2 protein expression but down-regulated Keap1 protein expression. Overall, OP can regulate the intestinal oxidative damage induced by Cy in mice, and its mechanism may be primarily mediated by enhancing the expression of various antioxidant genes, antioxidant enzyme activities and activating Nrf2-Keap1 pathway. The results showed that OP might have useful potential in the treatment of intestinal oxidative damage and other similar related diseases.The original contributions presented in the study are included in the article/supplementary materials, further inquiries can be directed to the corresponding author.The animal study was reviewed and approved by the Animal Welfare Act and the Guide for the Care and Use of Laboratory Animals, which is approved by the Animal Ethics Committee of Zhejiang University of Technology (20210308038).HC, XX, and SL provided the project administration and funding acquisition. HZ and XZ designed the research and wrote the manuscript. HZ, TL, and QJ executed the experiments and analyzed the data. HC, XX, and YD reviewed and edited this manuscript. All authors have read and agreed to the published version of the manuscript.This work was supported by grants from the National Key Research and Development Program of China (2020YFD0900902) and the National Natural Science Foundation of China (32101947).The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest.All claims expressed in this article are solely those of the authors and do not necessarily represent those of their affiliated organizations, or those of the publisher, the editors and the reviewers. Any product that may be evaluated in this article, or claim that may be made by its manufacturer, is not guaranteed or endorsed by the publisher."}
+{"text": "The disparity between the demand and supply of organs has necessitated an expansion of the criteria for organ donation. Consequently, numerous guidelines have been proposed for managing brain-dead organ donors (BDODs) to improve their organ function and the organ procurement rate. Therefore, we aimed to evaluate the previously recommended threshold for red blood cell transfusion in BDODs. Medical records of BDODs were retrospectively reviewed from January 2012 to December 2021. We enrolled BDODs who stayed for more than 24 hours at an hospital organ procurement organization. We analyzed their organ function and the rate of organ procurement according to the hemoglobin concentration. A total of 111 BDODs were enrolled and divided into the following 2 groups: hemoglobin (Hb)\u2005\u2265\u200510\u2009g/dL (45.0 %) and Hb\u2005<\u200510\u2009g/dL (55.0 %). There were no significant differences between the groups in the total bilirubin, creatinine, arterial blood lactate, and the rate of organ procurement. A correlation analysis did not reveal any association between the hemoglobin concentration and organ function of the BDODs. Hemoglobin concentration of 10\u2009g/dL cannot be considered a threshold for red blood cell transfusion. Furthermore, organ function is not correlated with a hemoglobin concentration\u2005>\u20057\u2009g/dL. Restrictive transfusion strategy is appropriate for BDOD management. The discrepancy between demand and supply for transplantable organs has been steadily increasing. Researchers have expanded the criteria for organ donation to compensate for organ shortage, additionally proposing numerous guidelines for managing brain-dead organ donors (BDODs) to improve their organ function and the organ procurement rate.;thus, the transfusion threshold has been identified as a parameter to maintain optimal hemoglobin concentration. The Transfusion Requirements in Critical Care (TRICC) trial reported that restrictive transfusion (threshold at hemoglobin\u2005<\u20057.0\u2009g/dL) was superior to liberal transfusion (threshold at hemoglobin\u2005<\u200510.0\u2009g/dL) in 1999. Thus, subsequent studies have established a hemoglobin concentration of 7.0\u2009g/dL as the threshold for red blood cell (RBC) transfusion.,4Strategies for shock resuscitation are centered around the need to enhance tissue perfusion and oxygen delivery regardless of its causes. Hemoglobin plays a key role in oxygen deliveryGuidelines for the management of BDODs consist of ventilator care, hemodynamic support, hormonal resuscitation, and the correction of metabolic derangement; however, most goals were derived from studies on patients experiencing shock and not BDODs. A recommended level of hemoglobin concentration has been inferred from shock resuscitation studies without verification on the BDOD population, despite a substantial effect on organ function. In this study, we aimed to investigate the effectiveness of hemoglobin concentration on organ function in BDODs.The medical records of BDODs were reviewed and analyzed from January 2012 to December 2021. This study was approved by the institutional review board, which waived the need for informed consent as the patients did not undergo additional interventions.We enrolled BDODs who stayed at the intensive care unit of the hospital organ procurement organization (HOPO) for more than 24 hours. Individuals under 16 years of age and with liver cirrhosis or end-stage renal disease were excluded to avoid bias in the laboratory data and the rate of organ procurement.The hemoglobin concentration was determined with the mean value within 24 hours before organ procurement. We evaluated liver and kidney function based on the concluding value of the total bilirubin and serum creatinine. We measured the influence of hemoglobin concentration on the severity of BDODs\u2019 condition through the concluding values of arterial blood lactate and the vasoactive-inotropic score (VIS). VIS was calculated as follows: dopamine dose (\u00b5g/kg/minute)\u2005+\u2005dobutamine dose (\u00b5g/kg/minute)\u2005+\u2005100\u2005\u00d7\u2005epinephrine dose (\u00b5g/kg/minute)\u2005+\u200510\u2005\u00d7\u2005milrinone dose (\u00b5g/kg/minute)\u2005+\u200510,000\u2005\u00d7\u2005vasopressin dose (U/kg/minute)\u2005+\u2005100\u2005\u00d7\u2005norepinephrine dose (\u00b5g/kg/minute).BDODs were divided into 2 groups namely, hemoglobin (Hb)\u2005\u2265\u200510 and Hb\u2005<\u200510, according to hemoglobin concentrations\u2005\u2265\u200510.0 and\u2005<\u200510.0\u2009g/dL to evaluate the reliability of the 10\u2009g/dL-threshold on the outcomes. We performed a correlation analysis to evaluate the relationship between the hemoglobin concentration and outcomes above concentration\u2005\u2265\u20057\u2009g/dL.t test, respectively. We evaluated the correlation among the variables using Pearson\u2019s correlation analysis and Spearman\u2019s correlation analysis. Statistical significance was defined as a 2-sided P value\u2005<\u2005.05.Continuous variables are presented as means\u2005\u00b1\u2005standard deviations, and all data were analyzed using SPSS 24 . Categorical and continuous variables were analyzed using a chi-square test or Fischer\u2019s exact test and Student\u2019s A total of 136 BDODs underwent organ procurement, of which we enrolled 111 BDODs. Twenty-five BDODs were excluded owing to their age, <24-hours stay at the HOPO, end-stage renal disease, and liver cirrhosis  BDODs were classified into the Hb\u2005\u2265\u200510 group, whereas 61 (55.0%) were classified into the Hb\u2005<\u200510 group. There were no significant differences in the baseline characteristics, such as age, sex, causes of brain death, and surgery (Table P\u2005<\u2005.001); however, there were no differences in the arterial blood lactate, total bilirubin, and creatinine. The rate of organ procurement in each organ, as well as the number of procured organs, did not differ between the groups  as an optimal transfusion trigger; The various organs of the body have different susceptibility to anemia and different requirements for hemoglobin concentration in specific situations with varying risk for hypoperfusion, such as acute coronary syndrome, severe hypoxemia, acute hemorrhage, and hyperlactatemia.\u201317 As a large number of BDODs who are critically ill are vulnerable to hypoperfusion, physicians tend to choose the liberal transfusion strategy, which leads to excessive transfusion.Although restrictive transfusion strategy has been widely accepted, RBC transfusion was required in 63.2% and 15.8% of BDODs with trough hemoglobin concentrations of\u2005>\u20058\u2009g/dL and\u2005>\u200510\u2009g/dL, respectively, in a study that demonstrated the actual practice of the transfusion.,19 and can provide supporting data to the guidelines suggesting the lack of evidence-based recommendations of the transfusion threshold in BDOD management.,20 Considering that no hemorrhagic event occurred during the concluding 24 hours, a higher VIS in the Hb\u2005\u2265\u200510 group suggested that physicians maintained a higher hemoglobin concentration owing to the instability of vital signs, following traditional guidelines.In this study, we attempted to evaluate the reliability of the previously recommended threshold for RBC transfusion and demonstrated that there was no difference in organ function according to the hemoglobin concentration. Furthermore, no difference in the arterial blood lactate signified that higher hemoglobin levels did not improve oxygen delivery. Our result was consistent with previous studies, which indicate no positive effects of transfusion on the organ function and prognosis,The application of an appropriate threshold for transfusion not only plays a vital role in reducing excessive transfusion but also in avoiding transfusion-related complications. There is no obvious evidence for the worsening outcomes of transplantation by immunologic adverse effects associated with RBC transfusion. Conversely, a large prospective observational study demonstrated that transfusion in BDODs exerted a protective effect on the initial renal graft function through unclear mechanisms.\u201324 Despite rare donor-to-recipient transmission of infection and no differences in the recipient outcomes,\u201327 infection can increase the burden of septic shock in BDODs. Aggravated shock condition because of sepsis requires greater vasopressor use and aggravates organ function, thus worsening the graft quality and the eventual rate of organ yield.In terms of transplantation, adverse effects of transfusion are a problem of the donor-side with a directly aggravating condition rather than the recipient-side from the immunologic consequences of transfusion. Transfusion-related immunomodulation makes BDODs substantially prone to infections. It can be caused by marginal transfusion and displays a dose-dependent increase in infection risk.\u201330 We did not investigate the influence of transfusion on recipient prognosis; nonetheless, our findings provided the evidence for justifying the restriction of transfusion at a hemoglobin concentration of 7\u2009g/dL.The outcome of lung transplantation is most susceptible to donor transfusion. Donor transfusion can injure the lung parenchyma through transfusion-related acute lung injury, besides resulting in detrimental gas exchange by transfusion-associated circulatory overload. Furthermore, these complications lead to primary graft dysfunction and recipient mortality. Non-organ donor DNA acquired from transfusion can interrupt the reliability of human leukocyte antigen typing. It plays a vital role in organ allocation and outcome; therefore, the misinterpretation of human leukocyte antigen typing causes disastrous results.Furthermore, transfusion can cause laboratory errors. Serologic screening tests have been performed in all donors to prevent transmission of virulent pathogens, such as human immunodeficiency virus, hepatitis B virus, and hepatitis C virus, through transplantation. Large volumes of intravenous fluids and transfusion may result in false negative serological tests.Our study had several limitations. First, the retrospective nature and relatively small cohort size of our single center study limited the statistical power. Second, we analyzed organ functions and concluding 24-hours hemoglobin; thus, we could not evaluate the effects of hemoglobin concentration change prior to the concluding 24 hours and could not obtain information on previous transfusions at other hospitals. Nonetheless, numerous BDODs are transferred to an HOPO for organ donation for a short period. Therefore, our findings can offer pragmatic suggestions for the management of BDODs. Third, we could not analyze the heart and lung function because laboratory assessment of these organs was not usually performed on the concluding day following the declaration of brain death. Fourth, all BDODs had a hemoglobin concentration\u2005\u2265\u20057\u2009g/dL in the concluding 24 hours because organ procurement had been performed after the resuscitation period in most cases. Thus, we could not perform an analysis to investigate the eligibility of the hemoglobin concentration of 7\u2009g/dL as the threshold of transfusion.To our knowledge, this is the first study to evaluate the threshold of RBC transfusion in the BDOD population. Further prospective studies are required to identify the optimal transfusion threshold to optimize graft function.A hemoglobin concentration of 10\u2009g/dL cannot be considered as the threshold for RBC transfusion and organ function is not correlated with a hemoglobin concentration in the range of\u2005>\u20057\u2009g/dL. Restrictive transfusion strategy can be safely applied for BDOD management and may provide better outcomes of transplantation by preventing transfusion-related complications. Further randomized controlled trials are needed to investigate an optimal transfusion threshold to improve graft function and to increase the rate of organ procurement.We thank Sun Kyeong Song, RN, and Eun Kyung Kwon RN for their help with managing data and providing patient care.Conceptualization: Kyu-Hyouck Kyoung.Data curation: Sungjeep Kim, Kyunghak Choi, Min Soo Kim.Formal analysis: Kyu-Hyouck Kyoung , Min Ae Keum.Investigation: Kyunghak Choi, Sun Geon Yoon.Methodology: Min Ae Keum, Min Soo Kim, Sun Geon Yoon.Supervision: Kyu-Hyouck Kyoung.Validation: Min Ae Keum, Min Soo Kim.Writing \u2013 original draft: Sungjeep Kim.Writing \u2013 original draft & editing: Sungjeep Kim, Kyu-Hyouck Kyoung.When originally published, figure 1 and 2 were switched and have been corrected."}
+{"text": "The synthesized PEI1200- and PEI60000-coated ultrasmall Ho2O3 nanoparticles, with an average particle diameter of 2.05 and 1.90 nm, respectively, demonstrated low cellular cytotoxicities, good colloidal stability, and appreciable transverse water proton spin relaxivities (r2) of 13.1 and 9.9 s\u22121mM\u22121, respectively, in a 3.0 T MR field with negligible longitudinal water proton spin relaxivities (r1)  for both samples. Consequently, for both samples, the dose-dependent contrast changes in the longitudinal (R1) and transverse (R2) relaxation rate map images were negligible and appreciable, respectively, indicating their potential as efficient transverse T2 MRI contrast agents in vitro.Water proton spin relaxivities, colloidal stability, and biocompatibility of nanoparticle magnetic resonance imaging (MRI) contrast agents depend on surface-coating ligands. In this study, hydrophilic and biocompatible polyethylenimines (PEIs) of different sizes (M Ethanol (99.5%) was purchased from Duksan  and used as-received for the initial washing of nanoparticles. Triple-distilled water was used for the final washing of nanoparticles and for preparing nanoparticle suspension samples (~30 mM Ho).Chemicals, such as Ho3\u22195H2O and PEI (1.0 mmol of PEI1200 or 0.02 mmol of PEI60000) was dissolved in 20 mL of TEG in a three-necked round bottom flask placed inside a stirring heating mantle  at 80 \u00b0C for 2 h under normal atmospheric conditions. Separately, 7.0 mmol of NaOH was added to 15 mL of TEG at 80 \u00b0C with magnetic stirring until NaOH was completely dissolved in TEG, and the prepared NaOH solution was slowly dropped into the aforementioned precursor solution with magnetic stirring until the pH of the solution reached ~9. After the solution pH became nearly constant, the reaction temperature increased to 120 \u00b0C and was maintained at that temperature for 14 h with magnetic stirring. Then, the solution was air-cooled to room temperature. To remove the unreacted precursors, Na+, OH\u2212, PEI, and TEG from the product nanoparticles, 400 mL of ethanol was added to the product solution, which was then magnetically stirred for 10 min. The solution was then placed in a refrigerator (~4 \u00b0C) until the nanoparticles settled at the bottom of the beaker. The top transparent solution was decanted. This washing process with ethanol was repeated thrice. To remove ethanol from the product\u2019s nanoparticles, 400 mL of triple-distilled water was added to the product solution, which was then concentrated to ~20 mL using a rotary evaporator. For additional purification of nanoparticles, the product solution was dialyzed against 1 L of triple-distilled water using a dialysis tube (molecular weight cutoff (MWCO) = ~2000 amu) for 24 h with magnetic stirring.2O3 nanoparticles was determined by high-resolution transmission electron microscopy (HRTEM) using the Titan G2 ChemiSTEM CS Probe . For measurements, a drop of the diluted nanoparticle sample in ethanol was dropped on a carbon film supported by a 200-mesh copper grid using a micropipette  and allowed to dry in air at room temperature. The copper grid with nanoparticles was then placed in the vacuum chamber of the microscope for characterization.The particle diameter of the PEI-coated ultrasmall HoThe Ho concentration of the nanoparticle suspension sample in the aqueous media was determined by inductively coupled plasma-atomic emission spectroscopy (ICP-AES) using the IRIS/AP spectrometer .A dynamic light scattering (DLS) particle size analyzer  was used to measure the hydrodynamic diameters and zeta potentials of the nanoparticle suspension samples in aqueous media (~0.5 mM Ho).A multi-purpose X-ray diffractometer  with unfiltered CuKa radiation (\u03bb = 0.154184 nm) was used to characterize the crystal structures of the nanoparticle powder samples. The scanning step and scan range in 2\u03b8 were 0.033\u00b0 and 15\u2013100\u00b0, respectively.2O3 nanoparticles was probed by obtaining the Fourier transform infrared (FT-IR) absorption spectra  and using the powder samples pelletized with KBr. The scan range was 400\u20134000 cm\u22121. A thermogravimetric analysis (TGA) instrument  was used to estimate the surface-coating wt.% of ligands in the sample by recording the TGA curves between room temperature and 900 \u00b0C under air flow. The average amount of surface-coated ligands was estimated from mass loss after considering water and air desorption between room temperature and ~105 \u00b0C. Then, the amount of Ho2O3 nanoparticles in the sample was estimated from the remaining mass. After TGA, each sample was collected and subjected to X-ray diffraction (XRD) analysis.The attachment of PEI polymers to the Ho2O3 nanoparticles without the PEI coating) was estimated using the net mass of Ho2O3 nanoparticles obtained from the TGA curve.A vibrating sample magnetometer  was used to characterize the magnetic properties of nanoparticle samples by recording magnetization (M) versus applied field (H) (or M\u2212H) curves (\u22122.0 T \u2264 H \u2264 2.0 T) at 300 K. The measurements were performed using powder samples of 20\u201330 mg; the net M value of each sample . The intracellular adenosine triphosphate was quantified using a Victor 3 luminometer . The human prostate cancer (DU145) cell line  was used. The RPMI1640 was used as a cell culture medium. The cells were seeded on a separate 24-well cell culture plate and incubated for 24 h. Five test sample solutions  were prepared by diluting the concentrated original nanoparticle suspension samples with a sterile phosphate-buffered saline solution and 2 mL aliquots were used to treat the cells, which were subsequently incubated for 48 h. Cell viabilities were measured thrice to obtain the average cell viabilities, which were then normalized in terms of the viability of untreated control cells (0.0 mM Ho).1 and T2 water proton spin relaxation times and R1 and R2 map images were measured using a 3.0 T MRI scanner . Aqueous dilute solutions  were prepared by diluting the concentrated aqueous nanoparticle suspension samples (~30 mM Ho) with triple-distilled water. These dilute solutions were used to obtain both T1 and T2 relaxation times and R1 and R2 map images. Then, r1 and r2 water proton spin relaxivities were estimated from the slopes of the plots of the inverse relaxation times 1/T1 and 1/T2 versus Ho concentration, respectively. T1 relaxation time measurements were performed using an inversion recovery method. In this method, the inversion time (TI) was varied at 3.0 T, and the MR images were acquired at 34 TI values in the range of 50\u22121750 ms. Then, T1 relaxation times were obtained from the nonlinear least-square fits to the measured signal intensities at multiple TI values. The parameters used in T1 relaxation time measurements were as follows: slice thickness = 8 mm, repetition time (TR) = 2000 ms, echo time (TE) = 28 ms, echo train length (ETL) = 17, flip angle = 120\u00b0, matrix size = 320 \u00d7 256, and field of view (FOV) = 250 \u00d7 200 mm. For T2 relaxation time measurements, the Carr\u2013Purcell\u2013Meiboom\u2013Gill pulse sequence was used for multiple spin-echo measurements. Then, 32 images were acquired at 32 TE values in the range of 15\u2013480 ms. T2 relaxation times were obtained from the nonlinear least-square fits to the mean pixel values for the multiple spin-echo measurements at multiple TE values. The parameters used in T2 relaxation time measurements were as follows: slice thickness = 8 mm, TR = 2000 ms, ETL = 1, flip angle = 180\u00b0, matrix size = 320 \u00d7 256, and FOV = 250 \u00d7 200 mm.T2O3 nanoparticles were synthesized using a polyol method [avg) of the PEI1200- and PEI60000-coated Ho2O3 nanoparticles was estimated to be 2.05 and 1.90 nm, respectively, from the log-normal function fits to the observed particle diameter distributions  of the PEI1200- and PEI60000-coated ultrasmall Ho2O3 nanoparticles were estimated to be 30.1 and 52.5 nm, respectively, from the log-normal function fits to the observed DLS patterns . As shown in the HRTEM image  of PEI60000 compared with that (Mw/Mn = 1.1) of PEI1200. The positive zeta potentials (\u03b6) of 19.9 and 20.7 mV of the PEI1200- and PEI60000-coated ultrasmall Ho2O3 nanoparticles  [The crystal structures of the as-prepared nanoparticles before and after TGA were determined via XRD analysis . Both sa74-1829) . \u22121, C\u2013H stretching at 2910\u20132950 cm\u22121, N-H bending at 1620\u20131660 cm\u22121, and C-N stretching at 1100\u20131200 cm\u22121, were observed in the FT-IR absorption spectra of PEI-coated nanoparticles, indicating the presence of PEI on nanoparticle surfaces. The N-H stretching and bending peaks overlap with the water stretching and bending peaks, respectively. The PEI surface coating of the nanoparticles was examined using FT-IR absorption spectroscopy. As shown in p values were 43.1 and 60.3% for the PEI1200- and PEI60000-coated nanoparticles, respectively  [\u22122 for PEI1200- and PEI60000-coated nanoparticles, respectively, using the bulk density of Ho2O3 (8.41 g/cm3) [avg of the nanoparticles estimated by HRTEM, and the p value estimated from the TGA curve. The average number (NNP) of PEI polymers coating a nanoparticle was estimated by multiplying \u03c3 by the nanoparticle surface area (=\u03c0d2avg). From NP values decrease as the ligand\u2019s size increases from PEI1200 to PEI60000 because the larger PEI60000 occupies a larger surface area owing to its higher steric effects than PEI1200. The surface-coating results are presented in The amount of coating  of PEI on the nanoparticle surfaces was determined based on the mass loss seen in the TGA curve b after cectively . The wt.sity (\u03c3) , corresp1 g/cm3) , davg of3+ on the nanoparticle surface)\u2013hard base (NH2 of PEI) type of bonding [2 groups, multiple bondings to each nanoparticle are possible  DMSO diluted in the RPMI1640 cell culture medium exhibited cellular toxicity, thus serving as a positive control  DMSO and 28 \u03bcM PEI1200 clearly exhibited a considerably reduced cell density for 10% v/v) DMSO as a positive control and a slight cell density reduction for 28 \u03bcM PEI1200  at 300 K using a vibrating sample magnetometer  and appreciable r2 values  were synthesized using a one-pot polyol method. In this method, the synthesis of ultrasmall Ho2O3 nanoparticles and surface coating with PEI were achieved via a one-step process in one pot. This method is simple and very useful for preparing hydrophilic and biocompatible ligand-coated ultrasmall lanthanide oxide nanoparticles with biomedical applications. PEI1200 and PEI60000  were used in this study to investigate the ligand-size effects on physicochemical properties and r2 values. The physicochemical properties of the synthesized PEI1200- and PEI60000-coated nanoparticles were characterized using various experimental techniques. Positive zeta potentials (~20 mV) were observed due to PEI coating for both the nanoparticle samples. The grafting density analyses [2 MRI contrast agents composed of ultrasmall nanoparticles that are excretable via the renal system, similarly to the case of molecular agents, is of considerable interest because the conventional iron oxide nanoparticles do not afford this possibility due to their appreciable particle sizes. For renal excretion, the nanoparticle diameter should be less than 3 nm [In this study, PEI1200- and PEI60000-coated ultrasmall Hoanalyses  suggestehan 3 nm ,18.1 and appreciable r2 values  or negligible T1 water proton spin relaxation inductions can be explained by the inefficient interactions between the fast 4f-electron orbital motions of Ho3+ and slow water proton spin motions [2 values or appreciable T2 water proton spin relaxation inductions, which are caused by the fluctuation of local magnetic fields generated by the nanoparticle magnetic moments as per the outer sphere model [Both nanoparticle samples show negligible r2 values , which c motions  as per t2 value depends on multiple factors such as the solvent, sample solution pH, applied MR field, particle diameter, temperature, and surface-coating ligand [NP of ~15 and ~0.49  and L is the distance between the nanoparticles and water proton spins [NP = ~\u03bc(Ho3+) (davg/0.234)3, where \u03bc(Ho3+) is the atomic magnetic moment of Ho3+ [avg values  r2 values because their T1 water proton spin relaxation contribution to MR images is negligible [2 MRI contrast agents. This hypothesis was confirmed in vitro from the negligible and appreciable dose-dependent contrast enhancements in R1 and R2 map images, respectively  were synthesized using a one-pot polyol method and characterized using multiple experimental techniques. Their r1 and r2 values and R1 and R2 map images were measured to explore their potential as efficient T2 MRI contrast agents in vitro.(1)Both nanoparticle samples demonstrated low cellular cytotoxicity and good colloidal stability owing to the PEI coating on the nanoparticle surfaces.(2)2 values of 13.1 s\u22121mM\u22121 for the PEI1200-coated ultrasmall Ho2O3 nanoparticles and 9.9 s\u22121mM\u22121 for the PEI60000-coated ultrasmall Ho2O3 nanoparticles were observed. Negligible r1 values of 0.1 s\u22121mM\u22121 were observed for both nanoparticle samples. Consequently, R1 map images with negligible dose-dependent contrast changes and R2 map images with appreciable dose-dependent contrast changes were obtained for both nanoparticle samples. These in vitro experimental results demonstrate that PEI1200- and PEI60000-coated ultrasmall Ho2O3 nanoparticles can act as efficient T2 MRI contrast agents. In vivo MRI studies will further demonstrate the potential of ultrasmall Ho2O3 nanoparticles as efficient T2 MRI contrast agents.Appreciable rPEI1200- and PEI60000-coated ultrasmall Ho"}
+{"text": "Acinetobacter spp. has been widely reported and become a global threat. However, carbapenem-resistant A. johnsonii strains are relatively rare and without comprehensive genetic structure analysis, especially for isolates collected from human specimen. Here, one A. johnsonii AYTCM strain, co-producing NDM-1, OXA-58, and PER-1 enzymes, was isolated from sputum in China in 2018. Antimicrobial susceptibility testing showed that it was resistant to meropenem, imipenem, ceftazidime, ciprofloxacin, and cefoperazone/sulbactam. Whole-genome sequencing and bioinformatic analysis revealed that it possessed 11 plasmids. blaOXA-58 and blaPER-1 genes were located in the pAYTCM-1 plasmid. Especially, a complex class 1 integron consisted of a 5\u2032 conserved segment (5\u2032 CS) and 3\u2032 CS, which was found to carry sul1, arr-3, qnrVC6, and blaPER-1 cassettes. Moreover, the blaNDM-1 gene was located in 41,087 conjugative plasmids and was quite stable even after 70 passages under antibiotics-free conditions. In addition, six prophage regions were identified. Tracking of closely related plasmids in the public database showed that pAYTCM-1 was similar to pXBB1-9, pOXA23_010062, pOXA58_010030, and pAcsw19-2 plasmids, which were collected from the strains of sewage in China. Concerning the pAYTCM-3 plasmids, results showed that strains were collected from different sources and their hosts were isolated from various countries, such as China, USA, Japan, Brazil, and Mexico, suggesting that a wide spread occurred all over the world. In conclusion, early surveillance is warranted to avoid the extensive spread of this high-risk clone in the healthcare setting.The emergence of carbapenemase-producing  Acinetobacter spp. are ubiquitous in nature and are usually identified in the hospital environment, and some of these species have been reported in a variety of nosocomial infections  when they were found upstream of these IS elements  and further confirmed by PCR and 16S rRNA (GenBank ID: NR_164627.1) gene-based sequencing with specific primers 27F (5\u2032-agagtttgatcctggctcag-3\u2032) and 1492R (5\u2032-ggttaccttgttacgactt-3\u2032) (A flowchart is shown in actt-3\u2032) .Escherichia coli ATCC 25922 served as the quality control strain.Antimicrobial susceptibility testing (AST) was performed by the broth microdilution method and interpreted based on the recommendations of Clinical and Laboratory Standards Institute (CLSI) 2021 guidelines and European Committee on Antimicrobial Susceptibility Testing (EUCAST) 2021 breakpoint tables for tigecycline. The antimicrobial agents used in this study were shown as follows: ceftazidime (CAZ), cefoperazone/sulbactam (CFS), imipenem (IPM), meropenem (MEM), ciprofloxacin (CIP), amikacin (AMI), colistin (COL), tigecycline (TGC), and cefiderocol (CFDC). blaNDM-1, blaOXA-58, and blaPER-1 were transferable, conjugation experiments using E. coli J53 (sodium azide resistant) as the recipient strain were carried out using the filter mating method (To determine whether the plasmids carrying g method . TranscoA. johnsonii AYTCM strain was grown overnight at 37\u00b0C in 2 mL of Luria broth (LB) without antibiotics, followed by serial passage of 2-\u00b5L overnight culture into the 2-mL LB  each day, with a yield 10 generations, lasting for 7 days  and Gentra\u00ae Puregene\u00ae Yeast/Bact. Kit  for Illumina and Nanopore sequencing, respectively. For trimming, quality control, and quality assessment of raw reads, fastp v 0.20.1 was used (De novo assembly of the reads of Illumina and MinION was constructed using Unicycler v0.4.8 (http://www.ncbi.nlm.nih.gov/genome/annotation_prok/) and the Rapid Annotation of microbial genomes using Subsystems Technology (RAST) server (A. johnsonii C6 (accession no. FUUY00000000) and MB44 (accession no. LBMO00000000) strains (Genomic DNA was extracted from was used . De novor v0.4.8 . The assr v0.4.8 . Genome ) server . Annotat strains .https://github.com/tseemann/abricate) based on the ResFinder database (http://genomicepidemiology.org/) (http://www.mgc.ac.cn/VFs/) (A. johnsonii C6 (accession no. FUUY00000000) and MB44 (accession no. LBMO00000000) strains was conducted using an ANI calculator (http://enve-omics.ce.gatech.edu/ani/index) , type IV secretion system (T4SS), type IV coupling protein (T4CP), and relaxase-related encoding genes, were predicted using oriTfinder with default parameter settings (https://www.sanger.ac.uk/tool/dnaplotter/) (http://tools.bat.infspire.org/circoletto/)  . Bactericn/VFs/) . Averagei/index) , and genb server . Insertib server . Conjugasettings . PHAge Ssettings . Typing settings . The plalotter/) . Plasmidoletto/) . Similarb server .A. johnsonii strains. However, a huge difference was found in \u201cPhages, Prophages, Transposable elements, Plasmids\u201d. There are two CDS that belonged to \u201cPhages, Prophages, Transposable elements, Plasmids\u201d in A. johnsonii C6 and MB44 strains. However, 14 subsystems of this function were identified in A. johnsonii AYTCM strain.Genome was annotated using PGAP and RAST. Based on PGAP annotation, there are 3,980 genes in total, of which 3,731 are protein-coding genes, 136 are pseudo genes, and the remaining 113 are predicted RNA-coding genes. Compared with the PGAP server, 4,182 genes, including 109 RNA-coding genes, belonged to 293 subsystems when annotated using RAST. The statistics of the subsystem is shown Figure\u00a01A. johnsonii AYTCM strain possessed a multidrug-resistant (MDR) profile and the meropenem and imipenem MICs are all >128 mg/L. Furthermore, it exhibited resistance to ceftazidime (>128 mg/L), ciprofloxacin (>32 mg/L), and cefoperazone/sulbactam (128 mg/L) but still remained susceptible to tigecycline (1 mg/L) and cefiderocol (<0.03 mg/L). The MICs of colistin and amikacin are 2 mg/L and 32 mg/L, respectively, which were defined as intermediate.Antimicrobial susceptibility testing revealed that A. johnsonii AYTCM strain revealed that, in addition to co-harboring chromosomal blaOXA-652 and aadA27, a series of other antibiotic resistance genes were identified, including blaOXA-58, blaNDM-1, blaPER-1, msr(E), mph(E), aac(3)-IId, aph(3\u2032)-VIa, sul1, arr-3, qnrVC6, ble-MBL, aph(3\u2032)-VI, tet(39), sul2, and blaMCA (bfmRS involved in Csu expression and lpxC-encoding lipopolysaccharide (LPS), were found in AYTCM strain.Analysis of the genome of A. johnsonii AYTCM and A. johnsonii C6 and 95.86% ANI were found between A. johnsonii AYTCM and A. johnsonii MB44 and only 79.89% two-way ANI between A. johnsonii AYTCM and A. baumannii ATCC 17978. Core-genome phylogeny analysis showed a close genetic relationship among A. johnsonii AYTCM, C6, and MB44 strains. However, a huge diversity was observed among A. baumannii, A. pittii, and other A. seifertii strains based on the phylogenetic tree , matching the 92.01% nucleotide identity. The K locus in A. johnsonii AYTCM strain is KL19, to which it matches with an overall nucleotide identity of 72.75%.blaNDM-1, blaOXA-58, and blaPER-1 genes; results showed that only blaNDM-1 could transfer to the recipient strain. The stability assays revealed that all three resistance genes were quite stable even after 70 passages under antibiotics-free conditions.Mating assays were performed to explore the transfer ability of blaOXA-652, was identified in the chromosome. Of note, A. johnsonii AYTCM strain carries 11 plasmids, namely, pAYTCM-1 to pAYTCM-11, with sizes between 2,356 bp and 378,197 bp and GC contents ranging from 34.38% to 42.44%  were found in the pAYTCM-1 plasmid  plasmids  region, class 1 integron region, and mercury resistance region -VI-ISAba125-blaNDM-1-ble-MBL (oriT region (AGGGATTCATAAGGGAATTATTCCCTTATGTGGGGCTT) were identified. pAYTCM-3 could transfer to E. coli J53 via conjugation.The Prophage regions were predicted by the PHASTER tool; results showed two intact, two questionable, and two incomplete regions in the chromosome  were considered as a new approach for the transfer of carbapenem resistance genes, such as blaOXA-24, blaOXA-72, and blaOXA-58 , including ISs, integrons, and transposons, play a particularly important role in the movement and dissemination of resistance genes . ConcernaOXA-58 . Here, 1research . Moreoveresearch , we dedusistance . HoweverblaNDM-1 was located in the chromosome, which was mediated by two ISAba125-based Tn125 composite transposons, highlighting the importance of Tn125-mediated transfer of blaNDM-1 resistance determinants  in the phage fraction and its role on the acquisition and transfer of these resistance genes (blaNDM-1 gene is not part of any of the prophages. Hence, the relationship of these prophages and the blaNDM-1 gene should be further confirmed through induced experiments. Concerning the blaNDM-1-harboring plasmids, we discovered that they were located in diverse sources and hosts and in various countries. These data indicated that a wide spread of blaNDM-1-bearing plasmids has occurred all over the world. However, these plasmids usually transferred among different Acinetobacter species. Concerning the various resistance plasmids in A. johnsonii AYTCM strain, it is revealed that our strain has great potential to capture plasmids that contribute to its resistance. Since our strain is of patient origin, there may be a great possibility that this strain will emerge and further spread between patients and the environment in the hospital. More importantly, Lam et\u00a0al. reported that the Aci1 plasmid usually was found in extensively and pan-resistant A. baumannii isolates which belong to global clones GC1 and GC2 (A. johnsonii strain, further suggesting that the Aci1 plasmid has transferred among various Acinetobacter species.In our previous study, we reported that rminants . HoweveraOXA-23 . In addice genes . However and GC2 . Here, tA. johnsonii AYTCM strain is in clear contrast to the high number of resistance genes. Thus, in the surveillance of A. johnsonii, researchers should probably pay more attention to the antimicrobial resistance when compared with virulence. This is a different aspect from the hypervirulent carbapenem-resistant K. pneumoniae (Apart from resistance determinants, virulence factors should also be paid attention in bacteria. However, the low content of virulence factors in eumoniae .A. johnsonii, co-producing NDM-1, OXA-58, and PER-1 from a patient source. The A. johnsonii isolate AYTCM carried 11 plasmids, which revealed great genome plasticity for this species, which possesses huge potential to capture resistance plasmids. Moreover, the Aci1 plasmid has been identified in A. johnsonii strain using the current plasmid typing system. However, other eight plasmids failed to type. Therefore, the rep genes for the plasmid typing system need to be further explored. Early surveillance of this kind of carbapenem-resistant isolate is warranted to avoid the extensive spread of this high-risk clone in the healthcare setting.This study is the first comprehensive description for the complete genome characteristics of a carbapenem-resistant https://www.ncbi.nlm.nih.gov/; PRJNA953498.The original contributions presented in the study are publicly available. This data can be found here: This study was approved by the local Ethics Committees of the Hospital with a waiver of informed consent since this study mainly focused on bacterial genome and the retrospective nature of the study.CT and JS designed the experiments, analyzed the data, and wrote the initial manuscript. CT, LR, DH, SW, LF, YZ, and YB performed the majority of the experiments. JS collected the bacteria. XF, TM, and JY supervised this study and reviewed and edited the paper. All authors read and approved the final version of the manuscript."}
+{"text": "Ud = 2 \u2013 10 new deleterious mutations. This deluge of deleterious mutations cannot all be purged, and therefore accumulate in a declining fitness ratchet. Using a novel simulation framework designed to efficiently handle genome-wide linkage disequilibria across many segregating sites, we find that rarer, beneficial mutations of larger effect are sufficient to compensate fitness declines due to the fixation of many slightly deleterious mutations. Drift barrier theory posits a similar asymmetric pattern of fixations to explain ratcheting genome size and complexity, but in our theory, the cause is Ud > 1 rather than small population size. In our simulations, Ud ~2 \u2013 10 generates high within-population variance in relative fitness; two individuals will typically differ in fitness by 15\u201340%. Ud ~2 \u2013 10 also slows net adaptation by ~13%\u221239%. Surprisingly, fixation rates are more sensitive to changes in the beneficial than the deleterious mutation rate, e.g. a 10% increase in overall mutation rate leads to faster adaptation; this puts to rest dysgenic fears about increasing mutation rates due to rising paternal age.Each new human has an expected  This estimate is conservative: some mutations to transposable element regions are deleterious, more recent estimates of the human point mutation rate are slightly higher at ~1.25\u00d710\u22128  of sligWmax represents the fitness of a completely mutationless individual , allowing linkage disequilibrium to emerge appropriately. We introduce two new simulation techniques to overcome the computational challenges of such an approach: \u2018linkage blocks\u2019 that avoid the need to track every single segregating site in order to perform fitness calculations, and binary indexed trees that allow both birth-death and selection processes to occur in O(log N) time. While linkage blocks allow us to rapidly compute individual fitnesses without real-time tracking of every mutation, we still need information about all fixed mutations at the end of the run, in order to determine the degree of asymmetry of effect sizes between fixed beneficial and deleterious mutations. To obtain this, we use tree-sequence recording . We assume a multiplicative form of co-dominance and no epistasis, such that lj,1 and lj,2 refer to the effect of linkage block j in haplotypes 1 and 2, respectively. Note that this computationally convenient choice is not precisely equivalent to a typical codominance model, where 1 + si is the fitness of a homozygote and 1 + sihi is the fitness of a heterozygote. While co-dominance is unrealistic for strongly deleterious mutations, which are often highly recessive, it is reasonable for the small-effect deleterious mutations which drive Ohta\u2019s ratchet , although we don\u2019t explicitly simulate a centrosome. Representing a genome as a set of \u2018linkage blocks\u2019 is a good approximation of population genetics in non-microbial species . Realist105 \u2212106 . Once L converge , so for Ud. Our distribution of fitness effects is based on a large empirical study of Europeans . We explore a range of values for Ub and sd that we consider a priori plausible: Ub ~ 0.0001\u20130.01 and sb ~ 0.001\u20130.01.Following recombination, we sample the number of new deleterious mutations in the gamete from a Poisson distribution with mean uropeans , who fitN. An individual chosen uniformly at random dies each time step and is replaced by a child produced by two parents, who are chosen with probability proportional to their fitness Wi. Each generation consists of N time steps. The fitnesses of the population are stored in an unsorted array \u2014 in a na\u00efve implementation, exchanging an element to represent a birth and death would be rapid, but sampling proportional to fitness would be O(N). The current fastest forward-time genetic simulation tools for large population sizes (e.g. both fwdpy (N), it only needs to be performed once per generation. We instead use a binary indexed tree (N). Our scheme is expected to have similar efficiency but is intended to be useful for future expansions of this approach to absolute fitness and more complex life history models  ath fwdpy  preprocexed tree  to samply models , e.g. toy models .N that we visually confirmed to perform well , and so this relatively deterministic method performed well.We calculate the net fitness flux from each simulation as the slope of the regression of log mean population fitness on time after burn-in , produce Ne ~16,000  adaptation rate depends on both Ub and Ud of 2, 5, and 10. Resistance to degradation remains reasonably robust, but the net fitness flux available for adaptation to a changing environment falls by ~13%, ~26%, and ~39%, respectively.We next consider the net fitness flux available for adaptation to a changing environment, above and beyond that required to counterbalance Ohta\u2019s ratchet. N = 20,000, Ub = 0.002, Ub than deleterious fitness flux is to Ud, increasing the total mutation rate helps the population adapt faster. The counter-intuitively increased rate of adaptation directly contradicts dysgenic fears about the consequences of elevated mutation rates on mean population fitness load.Population geneticists have raised concerns about the increase in mutation rate , in partUd ~2 \u2013 10 has only a moderate impact in reducing adaptation rate by 13\u201339%, its impact on variance in load among individuals within a population , but argue that this does not lead to population deterioration because a smaller number of beneficial fixations of greater size successfully counteracts many more small-effect deleterious fixations. We demonstrate the plausibility of this asymmetric compensation scenario under realistic values for deleterious mutation rate and sizes, recombination rate, and beneficial mutation size, and conservative values for the beneficial mutation rate. While population persistence is achieved, the need to counterbalance deleterious mutations does exact an appreciable toll in terms of a 13\u201339% reduction in the speed of adaptation to a changing environment. Our model of realistic deleterious mutation rates logically entails high variance in fitness  within human populations.Ub. E.g. in an asexual model with Ud = 2, s = 0.01, and N = 10,000, an analytic approximation suggests that more than 30% of new non-neutral mutations would need to be beneficial to counteract deleterious load . These  average ). Anothe average . Theory Sexual selection might also assist with purging load . While hOur hypothesis of asymmetric deleterious and beneficial fixations parallels known features of molecular adaptation. For examples, many mutations that each jeopardize the stable folding of a protein can be ameliorated at once by the evolution of chaperones . Many poA pattern of many small mutations, each of which cannot be effectively cleared, being counteracted by compensatory mutations with global effects, has previously been predicted by drift barrier theory . Drift bNe once Ud > 1  by acquiring a smaller number of larger-effect beneficial mutations. Mutation load may therefore not threaten population persistence, but this does still suggest that load is a crucial evolutionary factor with diverse effects. These include driving the evolution of molecular and organismal complexity, and maintaining high rates of fitness variance within populations.Supplement 1"}
+{"text": "Zika virus (ZIKV) epidemic brought new discoveries regarding arboviruses, especially flaviviruses, as ZIKV was described as sexually and vertically transmitted. The latter shows severe consequences for the embryo/fetus, such as congenital microcephaly and deficiency of the neural system, currently known as Congenital ZIKV Syndrome (CZS). To better understand ZIKV dynamics in trophoblastic cells present in the first trimester of pregnancy , an experiment of viral kinetics was performed for African MR766 low passage and Asian-Brazilian IEC ZIKV lineages. The results were described independently and demonstrated that the three placental cells lines are permissive and susceptible to ZIKV. We noticed cytopathic effects that are typical in in vitro viral infection in BeWo and HTR-8. Regarding kinetics, MR766lp showed peaks of viral loads in 24 and 48 hpi for all cell types tested, as well as marked cells death after peak production. On the other hand, the HTR-8 lineage inoculated with ZIKV-IEC exhibited increased viral production in 144 hpi, with a peak between 24 and 96 hpi. Furthermore, IEC had peak variations of viral production for BeWo in 144 hpi. Considering such in vitro results, the hypothesis that maternal fetal transmission is probably a way of virus transmission between the mother and the embryo/fetus is maintained.The  Flavivirus genus and the Flaviviridae Family. Its genome is presented as a positive-sense single-strand RNA (ssRNA+) that has around 11 kb. The genomic RNA is constituted by one strand and presents an ORF that codes for a single polyprotein. When it is cleaved, it produces structural and non-structural proteins.According to the  classification, ZIKV belongs to the Zika virus was discovered in 1947 during a research expedition on Yellow Fever in the Ziika Forest located in Uganda, Africa [Aedes aegypti mosquito circulating in the urban area was registered, for the first time, in Malaysia [, Africa ,3. Only Malaysia . FurtherMalaysia ,7. UntilMalaysia ,9,10. BeMalaysia ,9,10. BrMalaysia ,12.The major ZIKV transmission is vectorial, with a focus of infection on the nervous system ,13. ConsThe Step Growth Curve (SGC) methodology was defined as standard to observe virus behavior over time, since such can be used in silico, in vitro, in/ex situ, and in/ex vivo ,22,23,24Macaca mulatta in 1947 in Ziika Forest, Uganda, Africa (GenBank: AY632535.2) [ZIKV-MR766lp. Low-passage (lp) strain isolated from 32535.2) ,27,28,29ZIKV-IEC-Para\u00edba. Strain isolated from a patient in Para\u00edba, Brazil, clinically diagnosed with ZIKV in the 2015 outbreak (GenBank: KX2800260) ,28,29. T\u00ae) to form viral stocks and to get obtain the necessary amount for complete experimentation. Such stocks were produced in three steps to obtain the maximum yield of infective virions. The first step involved cultivation in five cylindrical tubes of glass with a volume of 1 mL of cells. The second cultivation step occurred in five culture flasks with a 25 cm2 Corning\u00ae filter and volumes between 5 and 7 mL, and the third occurred in five culture flasks with a 75 cm2 Corning\u00ae filter and volumes between 15 and 20 mL. For each step, the supernatant, debris, and cell monolayer were collected together; gathered in a single container; and homogenized to be stored in a 1.8 mL Corning\u00ae cryotube, frozen in a freezer at \u221280 \u00b0C. We separated a small aliquot from the three steps for titration by PFU/mL and tested for the presence of mycoplasma according to Timenetsky et al. [Both strains were cultivated in Vero CCL-81 cells . Considering that BeWo in vitro has a low rate of spontaneous fusion, we used forskolin  [BeWo is a fusiogenic choriocarcinoma cell type\u2014it forms syncytium with human villous trophoblastic cells properties. It shows features common to normal trophoblasts, in addition to expressing IL-6, IL-10, IFN-\u03b1, IFN-\u03b2, hCG, steroids, estrogens, and progesterone. For this reason, it is a good model to study the dynamics of viral infection (ATCClineage) .\u00ae).HTR8/SVneo is a cell type of human extravillous trophoblast immortalized by SV40 virus, and originates from chorionic villi, present between 6 and 12 weeks of gestation . Furthermore, it is characterized as a type of epithelial cell, with hCG production and invasion of maternal uterine tissue .Vero CCL-81 is a type of epithelial adherent cell from the kidney of a normal adult monkey that belongs to the African species Homo sapiens\u2014a hepatocellular carcinoma commonly used for HCV studies (JCRB).HuH-7 (JCRB0403) is an adherent cell lineage that is immortalized and originates from the tumorigenic epithelium of T and PFU/mL or a standard curve was established through titration by PFU/mL performed in triplicate for ZIKV-MR766 and ZIKV-IEC, in plates of in 24-well with a cell concentration of 1 \u00d7 105 cells/mL per well of Vero cells. Moreover, the stock was titrated using 0.2 mL of the viral sample in a serial dilution of 10-fold (10\u22121 to 10\u221211). Then, we incubated the plates for five days in an oven with a temperature at 37 \u00b0C and 5% of CO2. Thereafter, the supernatant was collected and stored for quantification by qRT-PCR  have, considering the following cell lineages: BeWo, BeWo treated with forskolin, HTR-8, and HuH-7.The step growth curve presented seven time points, determined as hour post infection (hpi), starting from two hpi in the incubator and a 24 h interval until 144 h. Therefore, we obtained the following hpi: 2 h, 24 h, 48 h, 72 h, 96 h, 120 h, and 144 h. Sample collection for each time point was performed in duplicate, with the separation of samples between the supernatant and cell monolayer, which was stored in a freezer at \u221280 \u00b0C for later analysis . The mulThe data obtained from the first complete growth curve were used as standard for the analysis of the two remaining replicates at 24, 48, and 72 hpi. Thereafter, we calculated PFU/mL for each time point from qRT-PCR data based on the standard curve, constructed before the beginning of the kinetics experiment . Then, aUninfected cells  were observed and compared with infected cells at each time point. Cell viability was considered visually, with the support from data published in the literature ,33,34,35T to PFU/mL .T of viral RNA for all hpi of triplicate one. Based on these results, we also quantified triplicates two and three but only for three time-points: 24 h, 48 h, and 72 h. Therefore, in the end, the quantification of 96 samples was obtained by the CT result converted into PFU/mL. Since the results obtained after the analysis of triplicates two and three validated those of triplicate one, we proceeded the study , and also the presence of characteristics found in the previous hpi. Furthermore, at and hpi between 72 and 144, there was saturation of the space occupied by the monolayer, augmentation of the cells in the supernatant, and the same characteristics of 48 hpi (Apendix I).On the other hand, BeWo/HTR-8/HuH-7-infected cells displayed cytopathic effects (CPEs) that increased during the time points analyzed. Monolayer detachment, focal degeneration with rounded and refractory cells, partial and total destruction of the monolayer inoculated, as well as the formation of cellular debris, morphological alterations, swelling, and clusters of cells could be observed a,b. ThusRegarding the kinetics curve after infection with ZIKV-MR766lp . Concurrently with the CPE, the cell growth was maintained at the beginning of the kinetics. HTR-8 showed similar dynamics to the other cell types. At 24 and 48 hpi, there was a peak of intracellular viral production, followed by a rapid decline. In contrast, the extracellular medium remained constant throughout the kinetics. Furthermore, after 72 hpi, there were plenty of cells still in the monolayer. HuH-7 presented a peak of intracellular viral production after 24 h hpi and continued to decline until 144 hpi. The extracellular medium showed a lot of cellular debris after the peak of infection .After ZIKV-IEC-Para\u00edba infection, BeWo and BeWo + fork showed different growth curves . The amoHTR-8 maintained a high PFU/mL in the intracellular environment until 96 hpi. In contrast, at 120 and 144 hpi, the number of virions augmented in the extracellular medium and decreased in the intracellular medium, probably indicating cell bursts. The CPE started was observed at 96 hpi, but debris formation only occurred at the next hpi. Most cells remained adhered to monolayers and showed signs of infection .HuH-7 viral production in intracellular and extracellular medium was high between 24 and 72 hpi. A fast decline of growth occurred in the intracellular environment after this period, whereas the extracellular environment remained constant until 144 hpi. The CPE became apparent at 48 hpi and increased up to 144 hpi, when all cells formed cellular debris and there was no longer a monolayer .We considered seven time points to describe the viral infection and, its capacity to generate new infectious progenies and to observe the CPE. After six days, at 144 hpi for ZIKV-MR766lp, the majority of the available cells were infected, which reflected in the considerable decay of alive cells. Regarding ZIKV-IEC, cell death by infection was only high for HuH-7. While in BeWo, BeWo + fork, and HTR-8 alive cells persisted\u2014possible abortive infection? Moreover, BeWo + fork and HTR-8 cells sustained the infection and a possible new round of viral replication, even after the infectious peak. Another fact noticed in the kinetics, for all assays with the exception of HuH-7, is that the cell monolayer remained the same in the last three hpi, when compared to its non-inoculated controls. The most prominent CPEs in infected cells were morphological changes and death. Dead cells were also present in the non-inoculated control, due to the fact that the control trophoblastic cells reached maximum confluence and lost space during monolayer expansion. These results may be an indication that during the replicative cycle of the virus, there was no inhibition of cell multiplication. Moreover, in the kinetics end, the supernatant had dead cells by both the virus and cells, possibly alive, due to the continuity of monolayer.Flavivirus.Considering the results obtained by us, all cell lineages are permissive and susceptible to both lineages of ZIKV with common characteristics CPEs observed in Regarding virus transmission by the placental barrier, the first 12 gestational weeks are the most critical, because the placenta is still developing and its protection depends on maternal antibodies ,33,34,35The percentage of maternal fetal transmission is estimated by 20\u201330% of pregnant women . The hypAedes spp. is presented and discussed in the scientific literature [The comparison of African and Asian lineages in vitro (in different cell types), in vivo, in non-human primates, and in the most common species of terature ,8. The mterature ,47,48,49terature ,12,45. Considering the hypotheses that emerged for ZIKV to have become an infectious agent capable of infecting neural progenitor cells (NPCs), one is due to point mutations in structural genes D67N  and S139Another hypothesis is that the target cells can be modified by ZIKV and induce apoptosis, necrosis, and paraptosis . During T values obtained by qRT-PCR and the plaque assay (PFU/mL). In this way, we have a standard curve that can be used to convert the values in CT for each time point into PFU/mL without performing plaque assays for all time points and the replicas. We can in the future combine this approach with statistical models and other methods as, for instance, High-content Screening/Analysis (HCS).Our study is based on the models by Delbruck and Ellis, and Burleson and has as its mainly aims to bring about an improvement by applying mathematical calculations to quantify virus production originating from bench experiments. Carrera et al.  comparedA practical application combining our method with HCS would be antiviral drug screening, since there are still no antiviral drugs against ZIKV approved for human usage. Moreover, there are potential antiviral drugs that have already been tested with cells such as HuH-7 and Vero. Some of them have the potential to be used during pregnancy ,54,55,56In summary, our study shows that first-trimester placenta cells are permissive and susceptible to African and Asian-Brazilian ZIKV infections in vitro. While ZIKV-MR766lp effectively infects placental cells, leading to fast death, which can be an indication that infection by such a strain is not persistent and is less transmissible to fetus, ZIKV-IEC-Para\u00edba presented a sustained and longer replicative cycle, without inducing cell death. Although it is emphasized here that this type of test does not represent the conditions of the uterine environment, our method allows a better observation of the dynamics of ZIKV infection and, as such, should be encouraged for further in-depth studies."}
+{"text": "At room temperature, ourshort-channel field-effect transistor devices exhibit on/off ratiosas high as 3 \u00d7 105 with on-state current up to 50nA at 0.2 V. Moreover, we find that the contact performance of ouredge-contact devices is comparable to that of top/bottom contact geometriesbut with a significantly reduced footprint. Overall, our work demonstratesthat 9-AGNRs can be contacted at their ends in ultra-short-channelFET devices while being encapsulated in h-BN.Bottom-up-synthesizedgraphene nanoribbons (GNRs) arean emergingclass of designer quantum materials that possess superior properties,including atomically controlled uniformity and chemically tunableelectronic properties. GNR-based devices are promising candidatesfor next-generation electronic, spintronic, and thermoelectric applications.However, due to their extremely small size, making electrical contactwith GNRs remains a major challenge. Currently, the most commonlyused methods are top metallic electrodes and bottom graphene electrodes,but for both, the contact resistance is expected to scale with overlaparea. Here, we develop metallic edge contacts to contact nine-atom-widearmchair GNRs (9-AGNRs) after encapsulation in hexagonal boron-nitride( I14 For example, in 2017, Llinas etal.15 reported on the GNR-FETs with on/offratios as high as 105 at room temperature, while El Abbassi etal.16 reportedon the quantum dot (QD) behavior in GNR-FETs at cryogenic temperatures.The overwhelming majority of FETs realized to date are based on armchairnanoribbons due to their excellent stability in ambient conditions,as well as their relative ease of synthesis and maturity.16 However, many other edge morphologies exist that have been shownto host intriguing physical phenomena.17 For example, GNR superlattices, in which topological boundary statesare periodically coupled, lead to the formation of topologically protectedstates.20 Another appealing example is GNRs with zigzag edges,as they possess a net magnetic moment that leads to electronic edgestates that couple ferromagnetically along the same edge and antiferromagneticallywith the opposite edge.21 Exploring theseGNRs for device application requires not only control over theirchemical structure but also the preservation of their integrity upondevice integration. In particular, due to their extremely small size,contacting GNRs remains a major challenge.22 Several approaches have been developed to date,23 relying on either metallic top contacts15 or bottom graphene electrodes24 and single wall carbon nanotubes13 electrodes. For metallic electrodes,15 photo- or electron-beam lithography is used, followed by a metallizationstep. However, this method can inadvertently cause polymer impuritiesto form at the contact junction and to inflict damage on the GNRs.Similarly, for bottom-fabricated graphene12 and carbon nanotube13 electrodes, polymericresidues on the electrode surface are challenging to avoid. In addition,for all of these contacting methods, the contact resistance is expectedto scale with the area of overlap between the GNRs and the electrodes.Bottom-up-synthesizedgraphene nanoribbons (GNRs), with their chemicallytunable electronic band structure, have received considerable attentionin the past five years for their use in nanoelectronic devices, witha strong focus on field-effect transistors (FETs).h-BN encapsulation combined with edge contactinghas been widely used in the 2D material community to improve deviceperformance by providing an atomically flat and electrostaticallysilent substrate,31 as well as a low contact resistance.32 Moreover, edge contacts have shown immunity to the contact-scalingproblem, with performance that is independent of contact length.30 Finally, h-BN encapsulationis appealing, as it allows for air tightness,33 thereby preventing material degradation due to reaction with air,which is crucial for highly reactive materials that degrade due tothe presence of oxygen. While for most 2D material devices the channellength is on the order of micrometers, GNR device\u2019s channelsare typically only tens of nanometers long at best, smaller than thelength of GNRs themselves. To the best of our knowledge, no edge-contactapproach has been reported for GNR-based devices.h-BN encapsulation anddevice integration of bottom-up-synthesized GNRs, contacted by metallicedge contacts. More specifically, we fabricate and electrically characterizeshort-channel FETs consisting of h-BN/9-AGNRs/h-BN heterostructures with channel lengths as short as \u223c20\u201340nm. The 9-AGNRs are contacted from their ends using metallic edgecontacts, resulting in ultrashort contact lengths. A graphite flakeis placed below the heterostructure to act as a gate.34 At room temperature, our devices exhibit on/off ratios as high as3 \u00d7 105, with on-state current up to 50 nA at 0.2V. This demonstrates that the contact performance of our edge-contactdevices is comparable to that of top contact geometries and betterthan bottom graphene and carbon nanotube contact. At cryogenic temperatures(9 K), our FETs exhibit QD behavior with the presence of CDs, withaddition energies (Eadd.) in the rangeof 16 to 400 meV, pointing toward the contacting of single or fewGNRs per device. Interestingly, temperature-dependent measurementsreveal that the charge transport mechanism is different between cryogenicand noncryogenic temperatures, with a crossover at 100 K. While atcryogenic temperatures electrons are transported resonantly throughsingle levels of a quantum dot, at room temperature, temperature-activatedhopping of charges occurs through the entire network of GNRs.Here, wereport on the IIA35 here, single and/or few 9-AGNRs are expectedto be in contact with both electrodes; (ii) long-channel devices (LCFETs),in which the channel length (1\u20132 \u03bcm) exceeds by far theGNR length. Here, no GNR is expected to bridge both electrodes, andtransport can only occur through the GNR film via hopping betweendifferent GNRs.In this work, two types of devices are fabricated and characterized:(i) short-channel devices (SCFETs), in which the channel length (20\u201340nm) is below or comparable to the average GNR length of 45 nm;h-BN-encapsulated 9-AGNRs. It consists of a film of 9-AGNRssandwiched between two h-BN flakes (light green),with metallic edge contacts acting as the source (S) and drain (D)electrodes. The gate  consists of a thin graphite flakelocated below the bottom h-BN . The top right inset of h-BN flake are transferred to the device substrate followingthe transfer recipe of Wang etal.32 and Zomer etal.27 Nonaligned 9-AGNRs arethen transferred using a polymer-free method from the growth substrate(Au/mica) to the device substrate.36 Thetop h-BN flake is placed on top of the 9-AGNRs afterperforming the thermal annealing of the device, as described in refs  peak .38 The edge contacts are then definedusing a combination of electron-beam lithography (EBL) and reactiveion etching, followed by electron-beam-induced metal evaporation (3/20nm Cr/Pd) . An optical micrograph of the measured device is shownin h-BN (bottom), and h-BN (top), respectively.The source, drain, and channels are labeled for clarity. The thicknessesof the top and bottom h-BN are determined by atomicforce microscopy (AFM) to be \u223c7 and \u223c22 nm, respectively. Thedevice geometry is assessed by using high-resolution scanning transmissionelectron microscopy (STEM), with a cross-section of a device shownin the top panel of h-BN is determined. The actual channel length LC is estimated from the observed length deducedfrom the AFM measurement LAFM and by takinginto consideration the height of the top h-BN (7nm) and the 45 deg angle generated by the RIE process, using LC = LAFM + 2th-BN.32  This AFM-based approach results inan estimate for channel length of LC \u224831 nm, comparable to the value obtained from the STEM image. in refs , 9), an, anh-BN- in refs . After pIDS) as a function of VG at a fixed VDS = 0.2 V. We find that all 18 devices show a p-type semiconductorbehavior, consistent with previous reports.15 Throughout the devices, we find on-statecurrents up to 50 nA. In comparison, the latest devices with metaltop contacts exhibit currents in the range of 5 to 300 nA under thesame bias conditions.15 (More details can be found in Supporting Information Table S1.) IDS\u2013VG curves recorded on our SCFET devices is \u223c3\u00d7 105, while the majority of the devices have an on/offratio in the range of 103\u2013104 . As the current does not saturate in the appliedgate range, it is likely that a larger on-current and hence a largeron/off ratio can be obtained by applying a wider range of VG . The subthresholdswing (SS), used to assess the FET\u2019s switching efficiency,is calculated from the IDS\u2013VG curves. We estimate the effective SS valuesto be \u223c468 mV/dec , comparableto GNR-FETs with a high-k dielectric gate oxide.15 Moreover, from the IDS\u2013VG curve, we extract the chargecarrier field-effect mobility (\u03bcFE), yielding valuesaround \u223c0.08 cm2 V\u20131 s\u20131 .The devices are first characterizedat a temperature of 300 K (moredetails can be found in the BI/dV) as a function of VDS and VG on a logarithmic scale recorded on devices1 and 4, respectively. The two plots exhibit multiple diamond-shapedareas in which charge transport is blocked. This indicates the formationof quantum dots in the SCFETs. As a consequence, the energies of thetransport channels are quantized to discrete values. The regions inthe differential conductance plot in which electron transport is blockedare referred to as CDs. Here, the charge carriers do not possess sufficientenergy to be transported through the device. The edges of these CDscorrespond to the onset of resonant charge transport from the sourceto the drain electrode, occurring when an energy level of the GNRQD enters the bias windows and single-electron tunneling (SET) takesplace. Both the blocking and the SET regime are characteristic ofcharge transport through quantum dots and indicate that the 9-AGNRsin our SCFETs behave as such .Next, to investigate the charge transport propertiesof the devices at low temperature, we perform electrical measurementson 18 SCFET devices  at a cryogenic temperatureof 9 K, where 15 of these devices were functional. 40 In device 4, the latter scenariois more plausible as the neighboring CDs do have well-defined crossingpoints. (iii) Several nonclosing CDs are overlapping. Here, multipleGNRs are connected in parallel and possibly also in series .Throughout the measured samples, we observe differenttypes ofbehavior: (i) the edges of the Coulomb blockade regions meet and crossat zero bias voltage, where the electrochemical potential of the QDis aligned with the electrochemical potential of the two electrodes.This corresponds to the situation in which a single or a few similar9-AGNRs have been contacted by both electrodes and contribute to electrontransport. In this scenario, as exemplified in both devices 1 and4, the electronic structure of the single QD can be assessed, as willbe discussed later. (ii) the Coulomb blockade regions are diamond-shaped,but no crossing points are observed between the CDs at zero bias,as observed for device 4 at a gate voltage of \u22121 V and shownin Eadd.) are extracted . Overall, the addition energies vary significantly withina single device but also from device to device, in a total range between16 and 400 meV. The intradevice variability is a direct reflectionof the electronic structure of the QD, with, depending on the chargestate, contributions to the addition energy from the charging energyand/or the quantum mechanical level splitting. The interdevice variationis attributed to multiple effects: (1) The contacted GNRs may notall have the same length,35 leading todifferent confinement potentials. (2) The local electrostatic potentialsand screening effects can be dependent on the number of electronshosted by the dot. (3) The GNRs in different devices may be in differentcharge states.To studythe electronic structure of the quantum dots, we extractedthe energy spacing between the different transport levels. For this,the size of the CDs for which crossing points are present (type i)are analyzed and the values of the addition energies (41 This provides us with the tunnelcoupling strength (\u0393) between a single GNR and the leads . This indicates that the broadening of the resonancesobserved in our measurement is the result of the combined effect ofhybridization with the electrode and temperature .In addition, we also performed temperature-dependent measurementson our SCFET devices. In Figures S11 and S12 of the Supporting Information, we show that the resonances graduallysmear out with increasing temperature and are completed washed outat temperatures above 120 K.To estimate the quality of the contact betweenthe GNR and metallicelectrodes, we extracted the coupling of the QD to the leads. Fromthe differential conductance map (type i), we extract a line cut atzero bias and fit the resonances with the Breit\u2013Wigner (BW)model for resonant transport through a single-lifetime-broadened transportlevel.eads see . Here, feads see .41 We fiCSupporting Information FigureS13), and such films have been shown to form a network that conductscharges over length scales exceeding the dimension of a single GNR.In these networks, the current is mainly driven by temperature-activatedhopping between localized sites and polaron-assisted tunneling.10 Here, we hypothesize that, in addition to thecharge transport through the quantum dots, a parallel conductancechannel through the GNR network opens up at high temperatures. Toinvestigate this behavior, we studied charge transport between adjacentdevices. Here, the electrode separation is micron-sized, more thanan order of magnitude larger than the average GNR length.35 A schematic of these devices, in the followingreferred to as the LCFET, is presented in IDS as a function of VDS and VG recorded at 300 K on device A. Similar to theSCFET characteristics shown in VDS = 0.2 V. The plot shows that Ion at VG = \u22125 V forthe LCFETs are typically 2 to 3 orders of magnitude lower than theSCFETs. Nevertheless, Ion can be significantlyincreased to \u223cnA for VDS = 1 Vand VG = \u22125 V .In the previous section, we focused on SCFET devicesin which one or a few GNRs are in contact with both the source anddrain electrodes simultaneously. However, GNRs are grown in densefilms (see IDS as a functionof VDS and VG for various temperatures are recorded. For two devices (A and B),we studied the evolution of the charge transport properties with decreasingtemperature from 300 K to 9 K in steps of 10 K, with some examplesshown in Supporting Information Figures S16 and S17. VDS = 1 V for various temperatures  T isthe bath temperature)is used to analyze temperature-activated transport.42 For both devices A and B, the logarithm of the currentdecreases linearly in the Arrhenius plot until reaching the measurementlimit of the system. The inset zooms in the low 1/T range (high-temperature regime). For both devices, the data arefitted to the Arrhenius equation in the temperature range 100\u2013300K. As a comparison, we plot in the same fashion the current throughthe SCFET device 9. For this device, a similar decrease in conductanceis observed in the high-temperature regime until the plot starts todeviate around T = 100 K and eventually flattensout around T = 50 K. In the high-temperature regime,the excellent fit suggests that temperature-activated hopping of chargecarriers between localized sites is indeed the dominant transportmechanism, for both the SCFET and the LCFET devices, with activationenergies (Eact) of 58.28 meV (device A),78.44 meV (device B), and 43.39 meV (device 9). As the activationenergy in the SCFETs and LCFETs under the same biasing conditionsare of similar magnitude, we conclude that the same transport mechanismis at play between 100 and 300 K, namely, temperature-activated hopping.On the other hand, in the lower temperature range, the SCFETs andLCFETs behave very differently. While for the LCFETs the current decreasesto the measurement limit, the SCFET device exhibits a transition around100 K and flattens out around 50 K. Then, the conductance becomestemperature independent. This temperature range corresponds to theformation of quantum dots, as is evident from the differential conductancemaps, for which the temperature dependence is expected to be limited.We, therefore, conclude that throughout the downward temperature sweepof the SCFET, the charge transport mechanism changes from hoppingthrough the film of GNRs to transport through the QD .We plot the data for fixed 43 While hopping transport is present when either temperature or biasvoltage provides enough energy to overcome the classical barrier,it is expected to vanish for temperatures approaching absolute zero.However, in disordered semiconductors with a high charge carrier density,even at low temperatures, finite conductance has been shown to exist.This has been attributed to polaron-assisted tunneling through theclassical barrier.43 Both mechanisms therefore coexist,and the current obeys a scaled master curve for current\u2013voltagecharacteristics with bosonic excitations in 1D.44 Here, for low-bias voltages, charge transport obeys a power-lawdependence on temperature. In the high-bias limit, transport becomestemperature independent. The two limits are illustrated in 46 is equal tothe thermal energy of the carrier.Recently, it was shown that, for the network of GNR, hopping, asdescribed by the semiclassical Marcus electron transfer theory, providesonly a limited description of charge transport.VG = \u22125 V) as scaled current I/T\u03b1+1 versus scaled bias voltage eV/kBT. From the excellent fit , we conclude that also in our case the charge transportmechanism for high charge-carrier density is a combination of semiclassicalelectron hopping and polaron-assisted tunneling through the classicalbarrier. However, for positive gate voltages where the currents arelow, charge transport only occurs in the high-bias limit. This suggeststhat for such low charge carrier densities the activation energy islarger and temperature is not able to drive transport .To identify whether hoppingand polaron-assisted tunneling arealso at play in our devices, we plot in III2 V\u20131 s\u20131. This is more than 1 and 3 orders of magnitudehigher than reported in ref (\u20133 cm2 V\u20131 s\u20131) and ref (\u20135 cm2 V\u20131 s\u20131), respectively. Theextracted \u03bcFE is among the highest values reportedin FETs, with hopping as the dominant charge transport mechanism48 . We note that for both theSCFET and LCFET devices the charge transport mechanism at 300 K istemperature-activated hopping transport, making the comparison ofthe mobility with other work on GNR networks possible. This highermobility may be due to the h-BN substrate, whichoffers an atomically flat and trap-free interface, along with a smalllattice mismatch and protection of the GNRs from the environment.However, care should be taken, as fringe currents are present in organicthin films since the electrically contacted film extends beyond thegeometrically defined transport channel between the source and drain,which may lead to the overestimation of the electron mobility.49Similarly to previouswork on charge transport through GNR networks,we have extracted the field-effect mobilities for our SCFET devices,with values up to \u223c0.08 cmd in ref  -/mica leads tononaligned GNRs.54 Au(111)/mica growth substrates are cleaned in ultrahigh vacuum by two sputtering/annealingcycles: 1 kV Ar+ for 10 min followed by annealing at 470\u00b0C for 10 min. Next, the precursor monomer DITP is sublimed ontothe Au surface from a quartz crucible heated to 70 \u00b0C, with thegrowth substrate held at room temperature. After deposition of 1 monolayerDITP, the growth substrate is heated (0.5 K/s) to 200 \u00b0C witha 10 min holding time to activate the polymerization reaction, followedby annealing at 400 \u00b0C (0.5 K/s with a 10 min holding time) toform the GNRs via cyclodehydrogenation. The average 9-AGNR lengthis around 40\u201345 nm.359-AGNRs are synthesizedfrom 3\u2032,6\u2032-diiodo-1,1\u2032:2\u2032,1\u2032-terphenyl(DITP).h-BN/9-AGNRs/h-BN heterostructurepreparation begins with mechanicalexfoliation of graphite (NGS Trading & Consulting GmbH) and h-BN flakes on substrates from bulk materials, and then the thin graphite andthe bottom h-BN are first stacked using a micromanipulator(hq Graphene 2D heterostructure transfer system) to form the graphitegate. After that, using our chemical vapor deposition system, an annealingstep is performed at 300 \u00b0C with H2/Ar: 35/200 sccmfor 3 h to improve the quality of the heterostructures by reducinginterfacial bubbles, contaminants, etc. We note that no material isdeposited in this step. Then, the transfer of the 9-AGNRs is doneby using a polymer-free method followed by a thermal annealing stepas described in refs  (PMMA)and reactive ion etching (RIE) . We deposit 3/20 nmCr/Pd using an e-beam evaporator for edge contacts, and the patternis lifted off using acetone for 45 min. After that, the second EBLand metal deposition (5/65 nm Cr/Au) are performed for contact pads.Graphite/ in refs , and 37.55 The electronic wave function is expanded inlocalized basis functions, and the electronic structure is describedusing density functional theory with the GGA PBE exchange and correlationpotential, with D3 phenomenological corrections for the van der Waalsinteractions.56 The atoms are displacedusing the BFGS optimization algorithm until all components of theforces are smaller than 5 \u00d7 10\u20134 au. Once thegeometry has been optimized with CP2K, we applied the NEGF proceduredescribed previously57 to compute the electronictransport. This procedure is based on modeling a scattering regionformed by the ribbon and the contacted part of the leads explicitly,where the Hamiltonian and overlap matrix are extracted from the DFTcalculation. The corresponding self-energy and Green\u2019s functionsare computed in the lead region using a periodically repeated metalgeometry. This self-energy and the corresponding Green\u2019s functionare then used to compute the transmission function.Our strategy to compute the electronictransport properties is composed of several steps. First, a Cr(100)slab is prepared with periodic boundary conditions in all directionswith the surface layers allowed to relax and the central layers fixedat the bulk positions. A 9-AGNR bridges the two surfaces so that,thanks to periodic boundary conditions, a cyclic geometry is obtained.The distance between the two surfaces is allowed to adapt to the ribbonlength. The termini of the ribbon (with a zigzag profile) are notsaturated with hydrogens to allow chemisorption to the surface. Itis known that CH termination leads to localized end states in thebandgap. We use the Gaussian basis set-based code CP2K.h-BN layers and the source\u2013drainseparation are characterized by using AFM in the tapping mode (BrukerIcon3 AFM). The STEM image is gained from a FEI Titan Themis 3510.Raman spectroscopy (WITec Alpha300 R) is used to confirm the successfulGNR transfer.58 The presence of the RBLMafter transfer to the device substrate is a strong indicator of theGNRs\u2019 integrity upon device integration.38Exfoliated flakes are opticallyscreened using an optical microscope (Zeiss Axio imager M2m). Thethickness of \u20136 mbar).The devices are measured in a commercially available probe station at various temperatures (9\u2013300K). A data acquisition board  is employed to apply the bias and gate voltagesand read the voltage output of the I\u2013V converter .All electronicmeasurementsare performed under vacuum conditions (<10411 + \u03932 and the QD level detuning:VG(0) is the position of the resonance.Here, \u03b1 is the gate coupling of the gate to the QD, describedby using the following relation:In the Breit\u2013Wignermodel, the peak shape is described by41kB beingthe Boltzmann constant and T, the bath temperature.The conductanceof a thermallybroadened level is described as follows:43\u20131 is the hopnumber and \u03b1 is a scaled version of the Kondo parameter. Twospecific regimes can be identified:(i)In the high-voltage regime, with \u03b2= \u03b1 + 1, hopping transport is present and the current is givenby(ii)In the low-voltageregime, polaron-assistedtunneling takes over:The hopping rate equationand the bias current are described as follows:"}
+{"text": "The formation of the hybrid coating results in the corrosion rate decrease by 18 times (0.007 mm year\u22121) as compared to the blank PEO layer (0.128 mm year\u22121). An inhibitor efficiency was established to be 83.9%. The mechanism of corrosion protection of Mg alloy via smart hybrid coating was revealed.The increase of corrosion resistance of magnesium and its alloys by forming the smart self-healing hybrid coatings was achieved in this work in two steps. In the first step, using the plasma electrolytic oxidation (PEO) treatment, a ceramic-like bioactive coating was synthesized on the surface of biodegradable MA8 magnesium alloy. During the second step, the formed porous PEO layer was impregnated with a corrosion inhibitor 8-hydroxyquinoline (8-HQ) and bioresorbable polymer polycaprolactone (PCL) in different variations to enhance the protective properties of the coating. The composition, anticorrosion, and antifriction properties of the formed coatings were studied. 8-HQ allows controlling the rate of material degradation due to the self-healing effect of the smart coating. PCL treatment of the inhibitor-containing layer significantly improves the corrosion and wear resistance and retains an inhibitor in the pores of the PEO layer. It was revealed that the corrosion inhibitor incorporation method  significantly matters to the self-healing mechanism. The hybrid coatings obtained by a 1-step treatment in a dichloromethane solution containing 6 wt.% polycaprolactone and 15 g/L of 8-HQ are characterized by the best corrosion resistance. This coating demonstrates the lowest value of corrosion current density (3.02 \u00d7 10 The development of biomedical technologies is aimed, in particular, at accelerating the reparative osteogenesis of an injured bone and minimizing the health damage during the healing process. The problem of using traditional non-resorbable implants is caused not only by the need for reoperation to remove them but, as a rule, is associated with allergic reactions, the release of toxic ions or wear microparticles of the implanted material, as well as the insufficient biological and physical-chemical bond between the implant and bone tissue ,2. ConsiOne of the optimal ways to form the coating on a magnesium alloy surface is plasma electrolytic oxidation (PEO) ,44,45,46However, taking into account the period of complete healing of bone tissue (14\u201317 weeks), the level of protective properties of calcium phosphate PEO coatings is not enough to provide the necessary corrosion resistance during the entire rehabilitation period. The penetration of human body fluids to the metal substrate through the pores and microdefects of the coating structure (areas of initiation of corrosion processes) can lead to a significant increase in metal electrochemical activity and further destruction of the implant.At the same time, the described coating morphology makes it possible to modify the oxide layer with various protective agents that contribute to a significant improvement in the corrosion properties of the product. An improvement in the corrosion resistance of a PEO coating can be reached through the impregnation of its porous part with corrosion inhibitors ,53. ChemIt was shown in  that the2 nanoparticles was carried out n. From the results of the analysis of cross-sections of the obtained coatings, it can be concluded that the impregnation of the PEO coating matrix with polymeric material contributes to the complete filling of the pores of the oxide layer. It should be noted that the proposed method of polycaprolactone application makes it possible to obtain a uniform surface layer.For a better interpretation of the results of this study, the detailed process of the base and inhibitor-containing coatings\u2019 formation  and the content of the obtained protective layers are summarized in cI, for HC-D-2 (4.99 \u00d7 10\u22127 A/cm2) and HC-D-1 (3.02 \u00d7 10\u22127 A/cm2) are lower by 3 and 5 times, respectively, as compared to CC-D (1.52 \u00d7 10\u22126 A/cm2). HC-A-1 sample is characterized by more than a 3-fold decrease in the values of this parameter in comparison with CC-A   and HC-D-1 (1.64 \u00d7 10\u22127 A/cm2) was 3 and 6 times, respectively, compared to the values for CC-D (1.02 \u00d7 10\u22126 A/cm2). The values of corrosion current density for HC-A-1 (6.37 \u00d7 10\u22127 A/cm2) were more than 2 times lower than for CC-A (1.77 \u00d7 10\u22127 A/cm2). Analysis of the values of the polarization resistance (RP) confirmed the increase of the protective properties after hybrid coating formation (RP (1.06 \u00d7 105 \u2126\u00b7cm2), which is 35 times higher than for the base PEO layer (3.05 \u00d7 103 \u2126\u00b7cm2).The results of the preliminary estimation of electrochemical properties of the formed surface layers (after 10 min sample exposure to 3.5 wt.% NaCl aqueous solution) by the PDP method are shown in ctively) . The electively) c,d. The ormation . HC-D-1 cE) increased during the 22 h of immersion in the corrosive medium , an intensive increase in current density in the potential range between \u22121.3 V and \u22121.0 V was established. This is the result of the degradation of the formed protective layers and the penetration of an aggressive medium to the material substrate c. The dyCR), calculated on the basis of the PDP data, were detected for the PEO coating (0.128 mm year\u22121). Modification of the PEO layer with a polymer and inhibitor promotes the decrease in the CR. The lowest CR was established for hybrid coatings. The maximum decrease (18 times as compared to the blank PEO layer) in the corrosion rate was detected for the HC-D-1 sample (0.007 mm year\u22121).The highest values of the corrosion rate  was used instead of the ideal capacitance due to the high heterogeneity of studied surface layers. Elements R1 and 1CPE characterize the resistance of the porous part of the PEO coating (outer layer) impregnated with a polymer (CC-D and CC-A) or polymer and inhibitor , and the \u201cgeometric\u201d capacitance of the whole coating. R2\u2013CPE2 chain represents the resistive and capacitive components of the non-porous sublayer of the PEO coating (inner layer), including compounds formed as a result of the interaction of the inhibitor and the polymer with the material of the inner part of the PEO layer.Determining the level of protective properties of samples with composite and hybrid coatings at the initial stage and after the long-term process of immersion  are shown by comparing the impedance spectra presented in the form of Nyquist and Bode plots . Dependeonstants . In thisE chains c. In thiQ and n  during the immersion of the sample vary slightly, which indicates a slight change in the morphology, composition, and properties of the coatings. Such possible processes as an increase/decrease in the thickness of the protective layer, degradation of the coating, formation of a protective film during self-healing, and formation of corrosion products in the defect zone can contribute to the change in Q. A significant increase in the resistance of the outer (1R) and inner sublayers of the coating (R2) is due to impregnation of the coating with a corrosion inhibitor and polymer. During the immersion of the sample in a corrosive environment, the parameters R1 and R2 decrease due to partial degradation of the protective layer. Nevertheless, HC-D-1 and HC-A-1 samples demonstrate high protective characteristics even after 22 h of immersion in a chloride-containing environment  for the HC-D-1 sample  is by 1 order of magnitude higher than the value of this parameter for the CC-D sample  and for the HC-A-1 sample. The value |Z|f=0.1Hz  for the HC-A-1 sample is characterized by a more than 4-fold increase in the corresponding value obtained for CC-A   .|Z|f=0.1Hz for HC-D-1 and HC-A-1 samples  is still higher than the value of this parameter for CC-D (3817 \u03a9\u00b7cm2) and CC-A (3712 \u03a9\u00b7cm2) specimens .An analysis of the obtained data enables one to conclude that the incorporation of an inhibitor into the composite polymer-containing coatings based on a calcium phosphate layer formed by the PEO method contributes to a significant decrease in the electrochemical activity of magnesium alloy samples due to the function of active corrosion protection. Based on the analysis of PDP data , Table 1|Z|f=0.1Hz) for the studied samples (|Z|f=0.1Hz are observed). The self-healing effect is based on the formation of the protective layer on the surface of the defect zone after the coating breakdown. This protective film formed as a result of corrosion inhibitor action prevents the intensive degradation of the material. However, since this newly formed layer is not the initial PEO coating and has a lower protective ability, the EIS results cannot show the increase of the anticorrosion characteristics up to the ones measured before the coating breakdown. This protective layer formed on the defect in inhibitor-containing coating provides the Mg alloy with better protection against corrosion as compared with inhibitor-free coating systems. Therefore, one can see the lower deterioration rate for the inhibitor-containing layers especially for the hybrid coatings as compared to the blank PEO layers  of the formed hybrid coatings  and hydroxide anions (OH\u2212). Further exposure of samples with the composite coating (CC-HQ) and hybrid coating (HC-D-2) to NaCl solution is characterized by the dissolution of 8-hydroxyquionoline sodium salt Na(8-HQ) (deposited during the immersion of PEO-coated samples in an inhibitory solution containing NaOH) due to an increase in pH value. For hybrid coatings , a release of 8-hydroxyquinoline is observed as a result of local pH increase (Stage 2 of the corrosion mechanism). Therefore, as a result of the ion interaction, the healing of the formed pitting is observed with the formation of the protective Mg(8-HQ)2 layer (Stage 3 of the corrosion mechanism). The obtained results are in agreement with the data of [3(PO4)2 was shown during the immersion of the PEO-coated Mg sample in NaCl solution-containing 8-HQ.The schematic interpretation of a self-healing mechanism is presented in  data of , where tRectangular plates made of MA8 magnesium alloy  with a size of 20 \u00d7 30 \u00d7 1.5 mm were used as a substrate in this presented study. Before coating, the samples were mechanically ground by means of TwinPrep 5x grinding/polishing machine  using a SiC abrasive paper with a gradual decrease in the abrasive grain size to P1000 grit. The final stages of the pretreatment were rinsing the samples with isopropyl alcohol and drying them in a desiccator at 40 \u00b0C.3H7CaO6P)\u201425 g/L, sodium fluoride (NaF)\u20145 g/L, sodium metasilicate (Na2SiO3)\u20147 g/L. The coating was formed in the bipolar polarization mode: the anodic component was maintained potentiostatically at U = 400 V, and the cathodic component was changed galvanodynamically in the current density range from 1.3 to 0.71 A/cm2 with the sweep rate of 0.005 A/(cm2\u2219s). The total oxidation time was 120 s, the frequency of the polarization signal was equal to 300 Hz, and the duty cycle was 50%.The base coatings were formed using a program-controlled plasma electrolytic oxidation unit. Oxidation was carried out in a 3-component electrolyte of the following composition: calcium glycerol phosphate . The PEO-coated samples were impregnated with the inhibitory solution by dip-coating method for 2 h under constant stirring.The 3 wt.% and 6 wt.% polycaprolactone solutions in acetone and dichloromethane were used to determine the optimal concentration for impregnating the porous part of the PEO layer. Solutions for creating hybrid coatings were prepared by dissolving 15 g/L of 8-hydroxyquinoline and polycaprolactone at a concentration of 6 wt.% in acetone and dichloromethane. The increase in the inhibitor concentration is due to its high solubility in organic solvents. Samples with the following types of coatings were prepared for experiments:PEO\u2014sample with the base coating obtained by plasma electrolytic oxidation;CC-8HQ\u2014sample with the composite coating obtained by the treatment of a PEO-coated sample in an alkaline solution of 8-hydroxyquinoline;CC-D\u2014sample with the composite coating obtained by the treatment of a PEO-coated sample in 6 wt.% solution of polycaprolactone in dichloromethane;CC-A\u2014sample with the composite coating obtained by the treatment of a PEO-coated sample in 6 wt.% solution of polycaprolactone in acetone;HC-D-2\u2014sample with the hybrid coating obtained in 2 steps by impregnation of a PEO-coated sample in an alkaline solution of 8-hydroxyquinoline, followed by treatment with polycaprolactone dissolved in dichloromethane;HC-D-1\u2014sample with the hybrid coating obtained in 1 step by treatment of a PEO-coated sample in a solution of polycaprolactone (6 wt.%) and 8-hydroxyquinoline (15 g/L) in dichloromethane;HC-A-1\u2014sample with the hybrid coating obtained in 1 step by treatment of a PEO-coated sample in a solution of polycaprolactone (6 wt.%) and 8-hydroxyquinoline (15 g/L) in acetone.To ensure the best filling of the pores of the PEO layer with protective agents, the coating impregnation was carried out using an Epovac vacuum apparatus . The pressure was decreased to 0.1 bar. After that, the samples were smoothly withdrawn from the solution and dried in a desiccator for 42 h until the organic components of the solvent were completely evaporated. The final stage of the coating process was heat treatment in a muffle furnace at t = 65 \u00b0C for 15 min. The polymeric material was applied twice.The morphology of the obtained coatings and elements distribution over the surface area and thickness of the sample was studied by scanning electron microscopy (SEM) and energy dispersive x-ray analysis (EDX) using a Merlin Gemini 2 device  with a Silicon Drift Detector X-MaxN 80 . To obtain the cross-sections, the studied samples were embedded with epoxy resin. After that, the obtained tablet was processed by means of a Tegramin-25 grinding and polishing machine  using grinding paper and polishing cloths with gradual reduction in the abrasive grain size to 3 \u00b5m, according to method presented in .2. The platinized niobium mesh was used as a counter electrode. Monitoring of the electrode potential was carried out vs. silver/silver chloride (Ag/AgCl) reference electrode . Before measurements, to stabilize the electrode potential, the samples were kept in the electrolyte for 10 min. The impedance spectrum was recorded in the frequency range from 1 MHz to 0.1 Hz with a logarithmic sweep of 10 points per decade after 10 min, after 1 h exposure of the sample to the electrolyte, and every 2 h for 22 h. Potentiodynamic measurements were carried out at a sweep rate of 1 mV/s. The sample was polarized in the anodic direction in the potential range from Ec \u2212 0.25 V to Ec + 0.5 V. To calculate the values of the corrosion potential Ec and the corrosion current density Ic, the Levenberg-Marquardt approach was used. This method is appropriate for calculating the corrosion parameters of metals with a surface oxide layer, in particular, magnesium and its alloys [Electrochemical measurements were carried out using the potentiodynamic polarization (PDP), electrochemical impedance spectroscopy (EIS), and open circuit potential (OCP) techniques using the VersaSTAT MC electrochemical system . The tests were performed at room temperature in a three-electrode cell. The 3.5 wt.% NaCl aqueous solution was used as an electrolyte. The area of the exposed sample was equal to 1 cms alloys ,94. PDP s alloys . Calculas alloys  in a sepi\u03b7) was evaluated on the basis of calculated parameters obtained from the results of electrochemical tests in accordance with Equation (1).cI0 is the corrosion current density for coatings without a corrosion inhibitor and cI is the corrosion current density for inhibitor-containing coatings.The effectiveness of the inhibitor (CR in mm year\u22121) were calculated using corrosion current density data (in mA cm\u22122) obtained from potentiodynamic polarization measurements according to Equation (2) [The values of the instant corrosion rate (tion (2) ,95.CR =A 7-day immersion test of the coated samples in 3.5 wt.% NaCl solution was performed. For this test, specimens with the size of 15 mm \u00d7 20 mm \u00d7 1.5 mm were exposed to the 1000 mL of solution at room temperature. At the end of the test, the samples were ultrasonically cleaned in deionized water to remove the corrosion products.2O3) ball with a 10 mm diameter used as a counterbody. Experiments were carried out under dry friction conditions at room temperature.The wear resistance of the formed coatings was estimated using a CSM Tribometer . Tribological tests were performed according to the \u201cball-on-plate\u201d scheme with a corundum (\u03b1-AlWear (in mm3/(N \u00d7 m)) was calculated in accordance with Equation (3).V is the volume of the specimen, which was deleted during the tribological studies, F is the applied load, which was equal to 10 N, and N is the distance. The volume loss of the specimen was measured as \u2206V = S \u00d7 l, where S is the cross-section area and l is the track length. The linear rotation speed and track diameter were 50 mm/s and 10 mm, respectively.The As a result of this study of surface modification of a bioresorbable MA8 alloy (Mg-Mn-Ce system) to reduce the intensity of its corrosion degradation, the following results were obtained.The bioactive hydroxyapatite-containing coating was formed on the surface of the MA8 alloy by the PEO method. It was established that the morphology of the resulting PEO layer, characterized by the presence of pores and microdefects, is suitable for further loading with a corrosion inhibitor and polymer.cI, by more than three times, in comparison with a base PEO layer. According to PDP results, the self-healing effect of the inhibitor-containing coating was established after 22 h exposure of the samples to a 3.5% NaCl solution. This is confirmed by a fourfold decrease in the value of cI compared to the data obtained for the base PEO coating.The method of porous PEO coating impregnation with an inhibitor\u20148-hydroxyquinoline (8-HQ) to increase the corrosion resistance of the processed magnesium alloy was chosen. PEO coating treatment with 8-hydroxyquinoline leads to a reduction of the corrosion current density, To enhance the anticorrosive properties of coatings and retain the inhibitor in the pores of the PEO layer (reducing the spontaneous release of the inhibitor not associated with the corrosion process), the formed layers were modified with a biodegradable polymeric material\u2014polycaprolactone (PCL). Methods for hybrid coatings formation using a system of PCL solutions in dichloromethane or acetone are presented. The optimal concentration of PCL in solutions (6 wt.%) was determined, and the modes of hybrid coatings formation using a combined treatment of PEO layers with PCL and 8-HQ were developed. The method of corrosion inhibitor incorporation (including the number of steps impregnation and the type of solvent) significantly matters to the self-healing mechanism. It was detected that among all the studied coated samples, specimens with hybrid coatings obtained by treatment in a dichloromethane solution containing 6 wt.% of PCL and 15 g/l of 8-HQ are characterized by the highest level of corrosion protection. The inhibitor efficiency for these hybrid coatings was about 80.1\u201383.9%.Treatment of a PEO-coated sample with polycaprolactone contributes to a significant increase in the wear resistance of the studied samples.The detailed mechanism of the self-healing effect of the formed hybrid Ca-P-coatings, which contain a biodegradable polymeric material and a corrosion inhibitor harmless to humans, was established. These protective layers can promote the controlled bioresorption and increase the bioactivity of magnesium-based implant material to its subsequent use in medical practice."}
+{"text": "The oleate-containing polycaprolactone layers (HC-SO 0.1\u20132) demonstrated stable corrosion behavior even after 7 days of immersion in Hank\u2019s balanced salt solution. The corrosion-current density and impedance modulus measured at a frequency of 0.1 Hz for the samples with hybrid coating after 7 days of exposure were equal to 5.68 \u00d7 10\u22128 A\u2219cm\u22122 and 2.03 \u00d7 106 \u2126\u2219cm2, respectively. The developed method of surface modification demonstrates the coating\u2019s self-healing properties. The effectiveness of employing hybrid anticorrosive bioactive PEO coatings for biomedical products made from magnesium and its alloys was demonstrated.A novel approach to surface modification was developed to improve the corrosion performance of biodegradable magnesium alloys. Additively manufactured magnesium samples and Mg-Mn-based magnesium alloys were used in this study. This method involves the combination of plasma electrolytic oxidation to create a porous ceramic-like matrix, followed by treatment with protective biocompatible agents. The most efficient method for the PEO-layer impregnation using sodium oleate and polycaprolactone was selected and optimized. The correlation between the structure, composition, and protective properties of the hybrid coatings was established. The composition of the formed polymer-containing layers was established using XPS and Raman microspectroscopy. The presence of sodium oleate and its distribution across the coating surface was confirmed at the microscale. The corrosion-protection level of the hybrid layers was assessed using potentiodynamic polarization measurements, electrochemical impedance spectroscopy, hydrogen evolution testing, and gravimetry (mass-loss tests)  TM, by Biotronik  solution, both before and after treatment with sodium oleate. The findings indicate that the introduction of oleate significantly reduces the electrochemical activity of steel in the studied electrolyte. Chirkunov et. al. [There are numerous requirements for the materials and surface treatments used in biomedicine, particularly for temporary load-bearing devices utilized to fix bone fractures ,2,3,4. Tin Japan ) demonstin Japan . Howeverin Japan ,10. A hiemployed ,17,18,19employed . Neverthemployed ,22,23. Aemployed . One sucemployed ,26,27. Aemployed . For insemployed  studied  et. al. , formed In our previous work , we demoThe current work is a continuation of the abovementioned study, focusing on the development of new hybrid coatings containing an inhibitor and a polymer to improve the barrier-anticorrosion properties of bioresorbable magnesium alloys. To provide a prolonged protection and the controlled release of the inhibitor when the protective layer is damaged in a corrosive environment, the microcontainers within the PEO coating were sealed by a biodegradable polymer, polycaprolactone (PCL) ,32. PolyIt was observed that there were no previous investigations of the combined effect of sodium oleate and a biodegradable polymer, such as PCL, within the oxide-coating matrix obtained by PEO. This study is intended to establish a method with which to potentially improve the protective properties for magnesium and its alloys, which are promising for implant surgery.Metal plates with dimensions of 15 \u00d7 20 \u00d7 1.5 mm, composed of MA8 Mg alloy  were used for the experiments. The MA8 is a low-alloy Mg-Mn-Ce system that combines high corrosion resistance , satisfactory mechanical characteristics, good machinability, and affordability . PreviouAdditionally, investigations were conducted on plates produced through additive technology using direct laser deposition of MPF-4 Mg powder GOST 6001-79) to form the sample designated hereinafter as AT-Mg. The process used to form AT-Mg samples was described in detail in our previous work [001-79 toThe surface preparation of samples involved mechanical grinding using a TwinPrep 5x\u2122 grinder/polisher . Samples were ground using silicone carbide (SiC) papers successively down to P1000 grit (approximately 15 \u00b5m abrasive size). The final stage of the specimen preparation included washing with deionized water and drying in the desiccator at 40\u201345 \u00b0C.2SiO3 and 7 g/L NaF, employing a combined bipolar mode in two steps [The formation of the base oxide coating was accomplished using a PC-controlled plasma electrolytic oxidation (PEO) unit. The specimens were treated in aqueous solution of 25 g/L Nawo steps . The firDuring the course of the presented study, composite coatings (CC) were formed on the base of the porous PEO-layer, which included either sodium oleate or polycaprolactone, as well as hybrid coatings (HC) that incorporated both the corrosion inhibitor and polymer. Treatment of the porous part of base PEO layer with sodium oleate was conducted using aqueous solutions with inhibitor concentration of 0.05 M and 0.1 M. pH of the solutions was neutralized (7.0\u20137.3) by acidification with 0.1 M HCl. Impregnation of the PEO coating was performed by immersing the specimens in the solutions, followed by vacuum treatment by means of Epovac vacuum-impregnation equipment (5 min)  to eliminate air from the pores. Subsequently, the specimens were immersed in the solutions for 1 h in air under constant stirring to enhance the deposition of the inhibitor within the porous part of a PEO layer. After impregnation, the inhibitor-containing samples were gradually extracted from the solution, dried in air, and treated with the polycaprolactone (6 wt.% in dichloromethane solution) to seal the microcontainers and prevent premature release of the inhibitor from the pores.The polymer layer was formed by immersing the inhibitor-loaded PEO sample in the polymer-containing solution for 5\u20137 s and then slowly withdrawing it. The polymer application was performed twice. As an alternative to the layer-by-layer treatment, hybrid coatings were formed by impregnation of the PEO-treated sample with solution of sodium oleate (concentrations were 0.05 M and 0.1 M) and 6 vol.% polycaprolactone in dichloromethane. The impregnation of the heterooxide matrix with the resulting solution was also carried out by means of vacuum-impregnation apparatus. All modified samples were subsequently dried at 40\u201345 \u00b0C for 24 h [Since the presented work is devoted to the design of novel coating types using the application of different modifying agents, it is necessary to estimate the level of protective properties of different systems, containing only a corrosion inhibitor and a polymer material, or their mixture in the PEO-coating matrix. Various samples were used during the study in order to select the optimal concentrations of inhibitor and polymer, as well as to find the best method of combination of these protective agents. These specimens were used for a comparative evaluation of the level of the anticorrosion protection of the formed coatings and assessment of the efficacy of the proposed method of surface treatment of magnesium alloys. The samples prepared for the experiments are designated in The morphology of the obtained sample surface and elemental composition were studied by means of scanning-electron microscopy (SEM), along with energy-dispersive spectroscopy (EDX). Merlin Gemini II electron microscope  equipped with X-MaxN Silicon Drift Detector Sdd 80  was used. Metallographic cross-sections of the studied samples were prepared for SEM-EDX studies.The sample cross-sections were prepared by cold-pouring the specimens with epoxy resin and subsequently processed using a Tegramin-25 grinder/polisher . The grinding and polishing stages involved the use of abrasive papers, polishing discs , and dia\u03b2 radiation was used. The spectra were recorded at a room temperature within the range of 2\u03b8 = 4\u00b0\u201390\u00b0, with a step of 0.01\u00b0. The generator current and voltage were 140 mA and 42 kV, respectively.The phase composition of the formed PEO-layers was determined by X-ray-diffraction analysis (XRD). SmartLab diffractometer  with CuK+ beam for 600 s (5000 eV) in scanning mode, and a layer approximately 5\u201310 nm thick was removed. This step was used to investigate the chemical composition of the subsurface layers of the anticorrosion coating and clean the area under study.The chemical composition of CC-SO 0.1 sample was analyzed using X-ray photoelectron spectroscopy (XPS). The surface was examined at 0.5 \u00b5Pa using non-monochromatic AlK\u03b1 radiation (1486.6 eV). The measurements were conducted using the SPECS (Germany) spectrometric complex, employing a hemispherical energy analyzer PHOIBOS-150. Calibration of all spectra was performed versus the carbon (C1s) with a binding energy equal to 285.0 eV. The studied area underwent etching with an Ar\u22121 with a power output of 35 mW. The Alpha500 confocal spectrometer  was used. Raman spectra were analyzed using WITec Control software. The selected area of the coating with a size of 35 \u00d7 30 \u03bcm was scanned, resulting in 35 \u00d7 35 spectra. During scanning, the integration time for recording spectra was equal to 1 s.The impregnation of the PEO-coating structure with sodium oleate (CC-SO 0.1) was confirmed using confocal Raman microspectroscopy. The spectra were obtained using a green laser (532 nm) with an acquisition time of 600 s (60 accumulated spectra). The measurements were conducted in the range of 300 to 3300 cm\u2212 contents in the blood. The experiments were conducted by means of VersaSTAT MC system . The scanned surface area was 1 cm2. The platinized niobium mesh was applied as a counter electrode. The reference electrode was the silver chloride (Ag/AgCl) electrode with a potential of 0.197 V (vs. the NHE). Before the PDP and EIS tests, the specimen was kept in the solution for 1 h to achieve a steady state. The sweep rate during PDP testing was 1 mV/s, and anodic polarization of the sample was carried out in the range of potentials from \u22120.25 V up to +0.5 V versus EC . The impedance spectra were recorded in the frequency range of 1 MHz\u20130.1 Hz, employing a logarithmic sweep with 10 data points per decade. Moreover, the impedance spectra were recorded during the 23 h of exposition of the sample to electrolyte. This duration was suitable for a preliminary express estimation of the corrosion behavior of studied samples.The corrosion properties were evaluated using potentiodynamic polarization (PDP) test and electrochemical impedance spectroscopy (EIS), along with monitoring of open circuit potential (OCP) in the 0.9% NaCl solution. This medium was used for corrosion tests of Mg samples that were promising for implant surgery, since 0.9% NaCl solution is a physiological solution with a chloride concentration equal to ClTo simulate the corrosion behavior of specimens with protective coatings in environments that mimicked human-body medium, long-term electrochemical tests were conducted in Hank\u2019s balanced salt solution (HBSS) for 7 days. The EIS spectra were obtained every 2 h during the first 48 h and every 4 h thereafter. After the last EIS measurement (after 23 h of immersion in 0.9 wt.% NaCl solution and 7 days of exposure to HBSS), the PDP test was also performed.EC) and corrosion-current density (IC) by means of Butler\u2013Volmer Equation (1). [RP) were measured in accordance with [The Levenberg\u2013Marquardt approach, known for its suitability for describing electrochemical parameters of valve metals like Mg and its alloys, was applied to determine the values of the corrosion potential (ion (1). ,46. Valunce with .(1)I=IcIc0 and Ic are the values of the corrosion-current density measured for a system without and with inhibitor, respectively.The inhibitor efficiency was estimated in accordance with Equation (2).To determine the corrosion-degradation rate of specimens with protective coatings, gravimetric (mass-loss tests) and volumetric (hydrogen evolution tests) methods were employed. Using these techniques, the material\u2019s weight loss and the volume of evolved hydrogen per unit area of the specimen were measured during immersion in Hanks\u2019 solution for 7 days.The mass loss of the material due to corrosion was estimated using the gravimetric method. Corrosion products formed during the immersion were removed by washing the samples in deionized water for 15 min using the ultrasonic bath. The washed samples were weighed using AUW120D analytical balance .For hydrogen-evolution tests, an eudiometer  was used, ensuring the isolation of the test solution from the air.2 were used simultaneously for volumetric/gravimetric tests. The experiments were conducted at room temperature and under constant stirring in the 500 mL solution [2 did not exceed 10%. After the exposure period, the specimens were removed from the solution, washed with deionized water, and subsequently dried in air. Based on the results of hydrogen-evolution tests, the corrosion rate  and hybrid coatings (HC-SO 0.1\u20132), high-performance liquid chromatography (HPLC) was employed. Five specimens of each type (with dimensions of 1.5 \u00d7 2.0 \u00d7 0.15 cm) were immersed in 300 mL of a 0.9 wt.% NaCl solution for a 21 days. Every day, 3 mL of the solution was collected to evaluate the concentration of the inhibitor released during the sample immersion. The HPLC analysis was conducted using a Shimadzu LC-20A liquid chromatograph equipped with a UV detector SPD-20A (detector wavelengths were set to 210 nm and 275 nm) and a low-temperature laser-light scattering detector ELSD-LT II. The component separation was performed using Agilent Eclipse XDB-C18 column . The temperature of the column was maintained at 40 \u00b0C. A mobile phase consisting of a 50:50 mixture of methanol and water was used. The flow of the mobile phase was set at a rate of 16 \u03bcL/s.2SiO4 , which is consistent with the structure of sodium oleate. The spectra indicated that both the upper layer (prior to the etching) and the underlying layer contained substantial amounts of oxygen and sodium. This composition is attributable to the presence of the corrosion inhibitor in the PEO layer. Oxygen with binding energies of 535 and 533 eV indicated the presence of -O-C- and O=C- bonds, respectively, in the sodium oleate.The chemical composition of formed inhibitor-containing protective layer (CC-SO 0.1) was studied by means of X-ray photoelectron spectroscopy (XPS) ; Table 263H115.5O7Na3.5 was one of the main components of the upper layer in the CC-SO 0.1 sample. This substance had a composition closely matching that of sodium oleate stoichiometry.The relatively low magnesium content suggested the uniform distribution of the inhibitor over the PEO coating. The abundance of sodium, however, indicated the presence of forms distinct from sodium oleate. The increased sodium content after the etching can be attributed to the composition of the PEO coating. Taking into account that all oxygen at 535 eV and ca. 4 at. % of sodium is associated with sodium oleate, the results of the XPS analysis confirmed that C\u22121 was observed, indicating the stretching vibrations of the \u03bd(C-H) bond. Specifically, asymmetric stretching vibrations (-CH2-) were detected at 2850 cm\u22121, while symmetric stretching vibrations \u03bd(-CH3-) were observed at 2930 cm\u22121 [\u22121 represents the bending vibrations of the C-C bond within the hydrocarbon chain of the sodium oleate [\u22121 and 1460 cm\u22121 are attributable to the aliphatic chain of the sodium oleate, indicating bending vibrations of \u03b4(CH2) [\u22121 is related to the stretching vibration of \u03bd(C=O) bond [\u22121, encompassing the stretching vibrations of the \u03bd(C-H) bond, was used. The analysis of the experimental data revealed a high concentration of sodium oleate on the sample surface. The intensity map illustrates areas with a uniform distribution of sodium oleate, as well as agglomerates containing the substance, which appear as lighter regions. The presence of a corrosion inhibitor on the surface of the PEO coating served as an additional barrier layer, thereby enhancing the sample\u2019s anticorrosive properties. The surface area where the Raman spectrum  ,53. The shown in a was acqZ|f = 0.1 Hz  during the specimen\u2019s immersion in 0.9% NaCl solution. The phase angle vs. frequency plots for the PEO, CC-P, CC-SO 0.05, CC-SO 0.1, HC-SO 0.1\u20132, and HC-SO 0.05\u20131 samples exhibited two time constants (R-CPE chains (CPE) was utilized as a representation of the ideal capacitance in the analysis. The R1\u2013CPE1 chain represents the resistance (R1) of the porous layer of the formed PEO coating impregnated with sodium oleate at various concentrations  and the polymer component  or an inhibitor\u2013polymer solution (HC-SO 0.05\u20131), as well as the geometrical capacitance (CPE1) of the whole coating . The R2\u2013CPE2 chain describes the resistive and capacitive behavior of the inner sublayer (the non-porous barrier part of the coating), considering the presence of the inhibitor and the polymer deposited in the PEO coating pores. Furthermore, for the impedance spectra obtained during the exposure of the HC-SO 0.1\u20131 sample, the \u03b8-\u0192 diagrams demonstrate the presence of three time constants (R-CPE chains (depicted in R1\u2013CPE1 chain describes the resistance of the upper layer (including the electrolyte resistance in the pores) formed by the inhibitor and polymer deposited on the surface and within the porous part of the PEO layer, and also reflects the geometric capacitance of the whole coating. The R2\u2013CPE2 chain represents the inner non-porous barrier layer of the formed coating, comprising the inhibitor\u2013polymer composition deposited at the bottom of the pores. Finally, the R3\u2013CPE3 chain describes the inner porous part of the composite coating covered with a polymer/inhibitor. For all the hybrid oleate-containing coatings, slight changes were observed in the values of Q (CPE coefficient) and n  or capacitance (n\u21921)) during the sample exposure  and outer (R1) sublayers of the coating showed changes during exposure to the aggressive destructive environment, suggesting the manifestation of self-healing properties by the coatings. A comparative analysis of the corrosion-resistance results of the formed surface layers revealed the positive effect of incorporating the inhibitor into the coating composition on its protective properties. The impregnation of the pores in the PEO coating with sodium oleate at concentrations of 0.05 M  and 0.1 M  led to an increase in the impedance modulus measured at a frequency f = 0.1 Hz by 3.2 and 5.9 times, respectively, compared to the values obtained for the inhibitor-free PEO layer . However, the direct contact between the modifying agent and the electrolyte stimulated the premature release of the inhibitor from the oxide PEO layer, resulting in decreased barrier properties in the inhibitor-containing coating. This may have led to an early reduction in the corrosion resistance of the implant and, potentially, to the partial loss of its mechanical integrity. These processes may negatively affect osteosynthesis by provoking the formation of undesirable mechanical stresses in the surrounding bone tissue. Therefore, it is necessary to seal nano- and microreservoirs containing the inhibitor with a bioresorbable polymeric material, such as polycaprolactone. The treatment of the CC-SO 0.05 sample with polycaprolactone (HC-SO 0.05\u20132) resulted in a significant increase in the level of corrosion protection . Among the oleate-containing coatings, the HC-SO 0.1\u20132 sample demonstrated the highest resistance to the corrosion processes , which was more than nine times higher than the |Z|f = 0.1 Hz value at the corresponding exposure stage in the corrosive environment for the CC-P sample . Additionally, this type of coating exhibited the highest polarization resistance after long-term exposure to the aggressive environment  for the investigated samples, obtained by fitting the impedance spectra after 23 h of immersion in the NaCl solution using an appropriate EEC. It can be inferred that the protective properties of the PEO sample decreased over time due to the partial degradation of the porous coating. The slight increase in total resistance in the CC-P coating can be attributed to the polymer component swelling in the formed surface layer. However, the anticorrosion properties of the polymer-containing composite coating were still insufficient to provide long-term protection against corrosion. The samples with composite-inhibitor-containing coatings  exhibited higher levels of corrosion protection than the PEO and CC-P during the initial hour of the experiment. This result can be attributed to the early manifestation of active corrosion-protection properties upon direct contact between the coated sample and the aggressive medium. The HC-SO 0.05\u20132 sample as characterized by strong protective properties at an early stage of its immersion in the electrolyte  and inhibitor-containing  coatings, and the samples with hybrid coatings  during the long-term exposure (23 h) to the corrosive environment was studied by EIS. onstants c. TherefE chains d. To acconstants c. Conseqexposure . These cotection . The valrocesses . The maxyte 1 h, . This cayte 1 h, . The resThe changes in the protective properties during the immersion of the HC-SO 0.1\u20132 sample in the sodium chloride solution  indicateThe corrosion parameters of the formed surface layers obtained using the potentiodynamic polarization test  and elec2-evolution tests (2). However, the PEO-coating impregnation with sodium oleate and polycaprolactone resulted in a significant decrease in the amount of released hydrogen volume during the exposure to HBSS  was calculated, considering the exposure time in the Hanks solution (\u22122 day\u22121), which was 3.1 times lower than the corrosion rate for the sample with the PEO coating (0.0415 \u00b1 0.0042 mg cm\u22122 day\u22121). These findings are consistent with the results obtained through the PDP and EIS tests, utilizing exposure to the 0.9 wt.% NaCl solution.Based on the mass-loss tests, the corrosion-degradation rate of the specimens , compared to the corresponding value obtained after 1 h of exposure to the harsh environment. This indicates the presence of self-healing properties in the formed surface layers. Such hybrid coatings ensure stable, prolonged, and active protection for MA8 Mg alloys against destructive external influences.The evaluation of the PDP-study results following the exposure of the samples to Hanks\u2019 solution for 7 days confirmed the effectiveness of the incorporation the inhibitor into the composition of the protective coatings . The corThe oleate-containing surface layer exhibited excellent barrier properties, reducing the penetration of the aggressive environment. Through the partial degradation of the upper polymer layer, the adsorbed inhibitor effectively lowered the degradation rate of the material, leading to the slower formation of the corrosion-product layer. This effect contributed to the enhancement of the corrosion resistance of the material compared to systems in which the formation of surface films occurs more intensively.R-CPE chains for fitting the experimental impedance spectra (NR) and (NCPE) represented the characteristics of the protective layers formed on the Mg. The changes in the calculated parameters of the EEC elements and the impedance modulus detected at f = 0.1 Hz for the AT-Mg+PEO and oleate-containing samples during the 23 h of exposure to the 0.9 wt. % NaCl solution are presented in Z|f = 0.1 Hz) for the AT-Mg+CC SO sample exhibited an increase of more than twofold (|Z|f = 0.1 Hz = 2249 \u03a9\u00b7cm2) compared to the AT-Mg+PEO specimen (|Z|f = 0.1 Hz = 940 \u03a9\u00b7cm2). A comparative analysis of the calculated data obtained from the potentiodynamic polarization test (IC = 3.91 \u00d7 10\u22125 A\u00b7cm\u22122) was 2.9 times lower than that of the PEO-coated specimen (IC = 1.14 \u00d7 10\u22124 A\u00b7cm\u22122). The anticorrosion properties of the AT-Mg+CC SO sample were maintained even after 23 h of exposure to the chloride-containing medium (IC = 3.82 \u00d7 10\u22124 A\u00b7cm\u22122), in contrast to the AT-Mg+PEO specimen, which corroded during exposure to the NaCl  and the IC for the hybrid coating (IC = 3.71 \u00d7 10\u22128 A\u00b7cm\u22122) was more than three orders of magnitude lower, than the equivalent parameters for the sample with the base PEO layer   and outer (R2) layers of the protective coating. The decrease in these parameters during the sample\u2019s exposure to the corrosive environment is attributable to the partial degradation of the protective coating. Nevertheless, the hybrid coating demonstrated superior electrochemical resistance, especially after immersion in a 0.9% sodium chloride solution for 23 h. The corrosion-current density, IC, for the AT-Mg+HC SO sample after the exposure was equal to 2.25 \u00d7 10\u22125 A\u00b7cm\u22122, which was more than an order of magnitude lower than the value of this parameter for the AT-Mg+CC SO (IC = 3.82 \u00d7 10\u22124 A\u00b7cm\u22122).The anticorrosion properties of the coatings obtained on the surface of the Mg sample produced by direct laser deposition were determined through the analysis of the impedance spectra presented in  spectra d. The paion test , Table 7the NaCl . The strthe NaCl . These r A\u00b7cm\u22122) , Table 7Therefore, according to the analysis of the experimental data from the EIS, PDP, hydrogen evolution, and mass-loss tests, the HC-SO 0.1\u20132  and AT-Mg+HC SO (for AT-Mg) samples exhibited the strongest anticorrosive properties. These hybrid coatings formed via the sequential impregnation of the PEO-coated samples in solutions with NaOl and PCL provided the MA8 magnesium alloy and the AT-Mg with the highest levels of corrosion protection. The use of this surface treatment makes it possible to implement the controlled resorption of Mg-based implants while maintaining their mechanical integrity throughout the entire healing process.Studies were conducted with the aim of developing a method to modify the surface of the bioresorbable magnesium alloy, MA8, and magnesium samples obtained with additive technology (AT-Mg). The objective was to create hybrid coatings that incorporate an organic corrosion inhibitor and a biodegradable polymer material, with the goal of reducing corrosion degradation. The following findings were obtained from the study.2SiO4) and periclase (MgO) in the composition of the coating. The surface relief provides a suitable matrix for incorporating modifying agents, such as biocompatible corrosion inhibitors and polymers.The plasma-electrolytic oxidation of the MA8 and AT-Mg surfaces resulted in the formation of ceramic-like coatings with well-developed surfaces. The X-ray-diffraction analysis revealed the presence of forsterite , as well as via the one-stage application of PCL and NaOl, in a dichloromethane solution .The presence of sodium oleate in the composition of the composite-inhibitor-containing coatings  was confirmed using X-ray photoelectron spectroscopy, and its distribution within the coatings was established by means of confocal Raman microspectroscopy.Z|f = 0.1 Hz value for this specimen was 1,140,200 \u03a9\u2027cm2 (after 15 h of exposure to NaCl solution). This sample also exhibited the highest polarization resistance (Rp = 2.99 \u00d7 107 \u03a9\u2027cm2) and the highest inhibitor efficiency (99.4%) after long-term exposure to the aggressive environment.The level of corrosion protection provided by the coatings on the MA8 Mg alloy and AT-Mg was assessed. The HC-SO 0.1\u20132 exhibited the strongest anticorrosive properties, according to the EIS and PDP data. The maximum recorded |\u22128 A\u2219cm\u22122 and 2.03 \u00d7 106 \u2126\u2219cm2, respectively. This indicates the effectiveness of the developed method of surface modification and the manifestation of self-healing properties.The electrochemical behavior of the HC-SO 0.1\u20132 sample with the hybrid coating was evaluated during its exposure to HBSS. The corrosion-current density and impedance modulus detected at a low frequency for the samples with hybrid coatings after 7 days of exposure were equal to 5.68 \u00d7 102) and the lowest weight loss (0.0132 \u00b1 0.0026 mg\u2027cm\u22122\u2027day\u22121) of all the studied layers. These samples also demonstrated the lowest corrosion rate (0.025 mm/y) after 7 days of immersion in HBSS.The volumetric and gravimetric tests revealed that the HC-SO 0.1\u20132 sample exhibited the lowest volume of released hydrogen  in enhancing the corrosion resistance was highlighted. It was revealed that the combination of sodium oleate and polycaprolocatone improves the corrosion behavior of PEO-treated Mg and its alloys. This study established the effectiveness and potential of using hybrid coatings containing a bioresorbable polymer material and a biocompatible corrosion inhibitor for the controlled resorption of biomedical products made of magnesium and its alloys.in vitro, as well as the performance of in vivo studies to confirm the biocompatibility of the formed material.The future research directions based on this study include the monitoring of long-term electrochemical stability in various specific environments  to improve the accuracy of the prediction of the corrosion behavior of samples with the studied types of protective layer"
\ No newline at end of file