diff --git "a/cluster/364.jsonl" "b/cluster/364.jsonl"
new file mode 100644--- /dev/null
+++ "b/cluster/364.jsonl"
@@ -0,0 +1,87 @@
+{"text": "Streptococcus pneumoniae is the leading cause of bacterial meningitis. Pneumococcal meningitis is associated with the highest mortality among bacterial meningitis and it may also lead to neurological sequelae despite the use of antibiotic therapy. Experimental animal models of pneumococcal meningitis are important to study the pathogenesis of meningitis, the host immune response induced after infection, and the efficacy of novel drugs and vaccines.S. pneumoniae were 3.2 \u00d7 10, 2.9 \u00d7 10 and 1.9 \u00d7 102 colony forming units, respectively. Characterisation of the disease caused by the type 4 strain showed that in moribund mice systemic dissemination of pneumococci to blood and spleen occurred. Histological analysis of the brain of animals infected with type 4 S. pneumoniae proved the induction of meningitis closely resembling the disease in humans.In the present work, we describe in detail a simple, reproducible and efficient method to induce pneumococcal meningitis in outbred mice by using the intracranial subarachnoidal route of infection. Bacteria were injected into the subarachnoid space through a soft point located 3.5 mm rostral from the bregma. The model was tested with several doses of pneumococci of three capsular serotypes , and mice survival was recorded. Lethal doses killing 50 % of animals infected with type 2, 3 and 4 The proposed method for inducing pneumococcal meningitis in outbred mice is easy-to-perform, fast, cost-effective, and reproducible, irrespective of the serotype of pneumococci used. Neisseria meningitidis, Haemophilus influenzae and Streptococcus pneumoniae [S. pneumoniae in humans and especially in children [S. pneumoniae in mice may also occur through retrograde axonal transport along olfactory neurons [Bacterial meningitis is an important infection of the central nervous system (CNS), and the three major responsible bacteria are eumoniae . Despiteeumoniae ,3. Develchildren . The patchildren ,2. Howev neurons . Once th neurons ,2.S. pneumoniae infection, and (iv) test the efficacy of novel antibiotics and vaccine candidates. Both infant and adult rats [S. pneumoniae [S. pneumoniae in humans. However, those models present the disadvantage that PM is induced in about half of the animals, while the remaining mice may die of sepsis without developing meningitis. Models of meningitis induced by the i.p. route were employed to carry out therapeutic studies [et al. [et al. is an useful and reliable system for causing PM in the mouse [et al., who induced meningitis via inoculation of S. pneumoniae (type 3) into the cisterna magna of C57BL/6 mice and investigated the function of nitric oxide in the disease [Animal models of PM have been developed in order to: (i) characterise the pathogenesis of meningitis, (ii) analyse the role of pneumococcal virulence factors in the disease, (iii) understand the host immune response to ult rats -9, and ault rats -13 have eumoniae . Howevereumoniae -17, (ii)eumoniae ,19, or  as a model strain. The proposed method is precise, simple, cost-effective, fast and reproducible, and the disease induced closely resembles PM in humans.i.e. lethargy, paralysis) for several weeks after inoculation (data not shown).The bregma is the intersection of the coronal and sagittal sutures of the skull and can be recognised in mice by visual examination of the exposed skull Fig. . We inocThese data allowed localisation of the anatomical coordinates of the inoculation site and proved the suitability of the i.c. subarachnoidal infection technique.After characterisation of the inoculation site and technique, mice were infected with pneumococci, and the establishment of PM was evaluated and clearly evidenced by histological analysis (see below).50) were calculated. We chose three commonly used S. pneumoniae strains, such as D39, HB565, and TIGR4. The D39 strain (type 2) is the encapsulated parent of the rough type 2 R36A strain used by Avery [50 of 3.2 \u00d7 10 and 2.9 \u00d7 10 colony forming units (CFU), respectively (data not shown). The TIGR4 strain was less virulent in the i.c. subarachnoidal infection model compared to D39 and HB565, as its LD50 was 1.9 \u00d7 102 CFU (data not shown).In order to test the model with different pneumococcal serotypes, dose-dependent survival studies were performed, and the lethal doses killing 50% of animals , while it considerably decreased at the highest dose (105 CFU) leading to rapid death of all mice.To describe the features of PM in detail following i.c. subarachnoidal infection of mice, we chose to characterise PM induced by the TIGR4 genome strain. For this purpose, we performed time-dependent survival studies, bacterial counts in different organs/tissues, and histological analysis of brain and spleen (see below). In order to study animal survival, five groups of MF1 mice were infected with doses of TIGR4 increasing from 10 to 10rve Fig. . After i5 CFU of TIGR4 were sacrificed, samples collected and appropriately treated, and viable counts were carried out. Moribund animals showed comparable bacterial counts in the brain (3.1 \u00d7 106 \u00b1 1.3 \u00d7 106 CFU/organ). Similarly, dissemination from the brain to vital organs occurred and was consistent in all animals, with bacterial counts of 3.8 \u00d7 106 \u00b1 4.8 \u00d7 106 CFU and 2.1 \u00d7 108 \u00b1 3.0 \u00d7 108 CFU in the spleen and blood, respectively (data not shown).To determine the number of pneumococci in brain, spleen and blood at the final stages of the disease, moribund mice infected with 10i.e. hunchbacked, photophobic, lethargic), but they did not develop hemiparesis or plegia. Moribund mice that had received 102, 103, 104, and 105 CFU were humanely killed at 72, 72, 48, and 24 hours post-infection, respectively. Two animals for each pneumococcal dose and three additional control mice were sacrificed. Brains and spleens were excised and treated for both haematoxilin-eosin and Gram staining.In order to prove the establishment of PM and study the features of the disease, we performed histological analysis on the brain of moribund mice inoculated with several doses of the TIGR4 strain and sacrificed at various time-points after infection. Animals at the final stages of the disease showed typical signs of meningitis , edema, and wisps of fibrin Fig. . Inflammulp Fig. , compareulp Fig. . These dS. pneumoniae is one of the causative agents of bacterial meningitis responsible for death and sequelae worldwide. The mouse has largely proved to be a reliable animal model for studying two major pneumococcal diseases such as pneumonia [neumonia -44 and sneumonia -47. In tneumonia -9,14 andneumonia -13 have neumonia , only reneumonia ,23.Cryptococcus neoformans [S. pneumoniae, and because the use of outbred strains is cost-effective. Another research group had previously used CD-1 outbred mice in a study on the efficacy of clinafloxacin against PM; however, the authors did not provide a detailed description of the model [In the present work, starting from an experimental method used to study meningitis caused by oformans , we deveoformans  and ratsoformans , as fronoformans ,51,52 anoformans  challenghe model .S. pneumoniae strains. The strains chosen are the serotypes routinely employed by researchers in the pneumococcal field, and have proved to be highly pathogenic in different mouse infection models [50 ranging from 2.9 \u00d7 10 to 1.9 \u00d7 102 CFU. Then, PM was further characterised and standardised by using TIGR4 as a model strain. Kaplan-Meier survival analysis of animals inoculated with different doses of TIGR4 showed that 105 CFU was lethal for all mice within 48 hours from infection  in the hippocampus of a few animals.The actual induction and subsequent characterisation of PM caused by the TIGR4 strain was then carried out by histological analysis of the brain tissue from moribund animals. We chose not to analyse PM by viable counting of pneumococci in the CSF, due to the difficulty of sample collection  and to the brain . In thathe brain . In anotna magna . In thatna magna . This firocesses . In our The present work proposes a method to induce experimental PM in outbred mice by using an i.c. subarachnoidal route of infection. The stereotaxic coordinates of the injection site are provided to allow easy recognition of the inoculation point in the mouse. The model is simple and fast, and the technique assures the development of meningitis, as demonstrated by histological analysis, survival data, and microbiological parameters. No significant differences were observed in the ability of the three pneumococcal strains used to cause disease, emphasising the value of the model. It is worth noting that the use of outbred mice still results in data reproducibility, as replicates in this model closely paralleled each other in terms of survival, CFU counts per organ, and histopathological features. In addition, experiments in outbred mice are cost-effective and can be performed in larger animal groups thereby improving statistical significance. This experimental PM model may be particularly useful for all researchers involved in studies that will investigate the host-pathogen interaction at the cerebral level, with emphasis on both pathogen-associated virulence factors and host-specific brain defences.S. pneumoniae was cultured in Tryptic Soy Broth  at 37\u00b0C with 5 % CO2. Solid media were obtained by addition of 1.5 % agar and 3 % defibrinated horse blood  to TSB. When necessary, streptomycin was used at the final concentration of 500 \u03bcg/ml.Survival studies were performed with the D39, HB565 and TIGR4 strains. TIGR4 was chosen as a model strain for histological characterisation of PM and CFU counts in organs. ad libitum. All animal experiments were approved by the Local Ethical Committee . Animals were allowed to settle in the new environment for one week before performing the experiments, they were caged and given food and water S. pneumoniae strains were prepared by using a modified version of a previously described method [2O. Passaged bacteria were grown to mid-exponential phase, centrifuged for 20 minutes at 1500 \u00d7 g, resuspended in fresh TSB containing 10 % glycerol, and stored in aliquots at -70\u00b0C. Numbers of bacteria were determined by viable counting of serial dilutions in sterile phosphate-buffered saline, pH = 7.4 (PBS), and plating onto blood-agar plates. Before inoculation, bacteria were thawed at room temperature, harvested by centrifugation, and resuspended in sterile PBS at the appropriate dilutions.Mouse-passaged d method . BrieflyC. neoformans in mice [PM was induced in lightly anaesthetised mice (50 mg/kg ketamine and 3 mg/kg xylazine) by modifying a method previously used to establish meningitis by  in mice ,55. Anim4 CFU per mouse were used to infect mice (n= 4) with strains D39 and HB565. In the case of TIGR4, groups of 6 to 10 animals each were inoculated with doses ranging from 10 to 105 CFU per animal. Control mice were inoculated with PBS (30 \u03bcl). Mice were closely monitored twice a day for clinical symptoms . Mice were humanely killed before reaching the moribund state. Survival was recorded for 10 days (240 hours).Different bacterial doses ranging from 10 to 10Infected mice were sacrificed either for microbiological or histological analysis. Animals were humanely killed before being moribund, and various samples were collected. For CFU counts, blood was withdrawn by cardiac puncture before sacrifice and added to a tube containing 3.8 % of sodium citrate. Brains and spleens were excised and homogenised in 2 ml of sterile PBS. Bacterial counts in blood, brain and spleen were performed by plating 10-fold dilutions onto blood-agar plates. For histopathological analysis of tissues after infection with TIGR4, brains and spleens were immediately fixed in formalin for 24 hours and then embedded in paraffin according to standard procedures. The brains were entirely sectioned along a coronal plane. Sections were stained with both haematoxilin-eosin and Gram according to standard techniques. Morphological changes were assessed by using routine light microscopy. The presence and degree of inflammation were carefully evaluated.50 values were performed by using both the method by Reed and Muench [Calculations of LDd Muench  and Probd Muench . SurvivaDC, animal experiments, microbiological analysis, writing of manuscript. ST, histological analysis, writing of manuscript. RP, animal experiments, microbiological analysis. MRO, experimental design. EB, development of methodology for induction of meningitis. MC, co-ordination of histological analysis. GP, co-ordination and design of the study, data evaluation. SR, co-ordination and design of the study, data evaluation, direct supervision of experimental work, writing of manuscript.All authors read and approved the manuscript.Document stating the ethical approval for animal experimentation conceded to the Laboratory of Molecular Microbiology and Biotechnology (LA.M.M.B.) from the University Hospital of Siena, the Medical Faculty and the Local Ethical Committee .Click here for file"}
+{"text": "Several reports indicated that non-thermal electromagnetic radiation such as from mobile phones and base stations may promote cancer. Therefore, it was investigated experimentally, whether 900 MHz electromagnetic field exposure influences lymphoma development in a mouse strain that is genetically predisposed to this disease. The AKR/J mice genome carries the AK-virus, which leads within one year to spontaneous development of thymic lymphoblastic lymphoma.320 unrestrained female mice were sham-exposed or exposed  to GSM like 900 MHz electromagnetic fields for 24 hours per day, 7 days per week, at an average whole body specific absorption rate (SAR) value of 0.4 W/kg. Animals were visually checked daily and were weighed and palpated weekly. Starting with an age of 6 months, blood samples were taken monthly from the tail. Animals with signs of disease or with an age of about 46 weeks were sacrificed and a gross necropsy was performed.Electromagnetic field exposure had a significant effect on body weight gain, with higher values in exposed than in sham-exposed animals. However, survival rate and lymphoma incidence did not differ between exposed and sham-exposed mice.These data do not support the hypothesis that exposure to 900 MHz electromagnetic fields is a significant risk factor for developing lymphoma in a genetically predisposed species, even at a relatively high exposure level. The use of mobile phones is increasing worldwide, although electromagnetic fields emitted by mobile phones and base stations are a source of great concern. However, so far it is unclear, if non-thermal exposure has a direct influence on public health. French et al.  developePim1 transgenic mice [It was suggested that non-thermal exposition to high-frequency electromagnetic fields may rather have a tumor promoter than an initiator effect , since Dnic mice , which anic mice .The differences between the studies may indicate that various species or strains as well as cancer types differ in their sensitivity to electromagnetic field exposure. The sensitivity to electromagnetic fields may result from an acquired lower resistance against adverse effects or a genetic predisposition . DiffereAKR mice are widely used in cancer research for their high leukaemia incidence (60\u2013100%) . Mice of320 female AKR/J mice were airfreighted from the Jackson Laboratory , at an age of 4\u20135 weeks. After arrival, animals were randomized and housed in groups of 6 or 7 on softwood bedding  in polycarbonate cages , enriched with paper. Mice were allowed free access to mice standard food pellets  and tap-water. Twice a week cages were cleaned and water changed. Temperature was controlled at 21\u00b0C \u00b1 2\u00b0C. The light was on a 12 hours light-12 hours dark cycle, with light on at 8 am. No sterilization measurements were taken, since AKR/J mice are not especially sensitive for pathogens. However, to prevent a possible transfection from humans to mice or mice to mice, respectively, masks and gloves were worn, which were sterilized between handling of different cages. Animals were inspected daily for signs of moribundity and were weighed (accuracy \u00b1 0.1 g) and palpated weekly. Starting with an age of 6 months, blood samples were taken monthly from the tail. A tattoo in the ear allowed individual identification. The Bremen state commission for animal welfare according to \u00a78a of the German animal welfare legislation approved the experiments (522-27-11/2-0).In order to accomplish whole body exposure of a large number of non-restrained animals, one approach is to design exposure setups based on radial waveguides. Inside the waveguide the animals are kept in cages which are arranged at a constant distance from a radiating antenna in the centre, thus uniform exposure of the cages can be achieved. Another advantage is that the radial waveguide is an electromagnetic shielded system, on that score no costly shielding of any laboratory is necessary. The height of the waveguide is preferably chosen smaller than half a wavelength . TherebyTherefore, special modifications of the fundamental geometry of radial waveguides had to be performed to avoid the propagation of the unwanted higher order modes. In order to produce a well defined field distribution the cage region was excited only by the fundamental TEM-mode in a first step, i.e. for small radii the plate distance was kept below 14 cm and for larger radii the height was increased to the required value of 17 cm Figure . Since iBoth implemented waveguides  of ca. 4 m diameter and 17 cm vertical plate distance were placed within the same room and carried up to 24 cages measuring 425 mm \u00d7 265 mm \u00d7 160 mm (L \u00d7 W \u00d7 H) each of them housing 6\u20137 mice. The cage area was covered with trapezoidal lids (3 cages per opening) with wire mesh . The total level was 69 dB (lin), and less than 25 dB at frequencies between 8 and 40 kHz. Thus possible disturbing effects of ultrasound were excluded.2 gas when signs of a developing disease became evident or at an age of about 46 weeks, after a last blood sample was taken. A gross necropsy was performed focusing on main tissues of disease involvement  and tumor infiltration . Tissues were immersion-fixed in Bouin's solution for up to 24 h and subsequently in ethanol (70%), embedded in paraffin and sectioned at 5 \u03bcm. Blood smears were stained with Pappenheim's stain and tissue slices using hematoxylin and eosin. When a mouse was found dead in its cage  a necropsy was performed, but no tissues were fixed.Animals were sacrificed by COGroup mean body weights were tested for a possible exposure influence in dependence of time, using multiple regression analysis . An unpaired t-test was applied to compare the loss of weight associated with lymphoma development. Survival curves and lymphoma incidence were plotted according to the method of Kaplan and Meier. Differences between curves were compared using the logrank test, with animals censored, which were still alive at the end of the study . Two-way ANOVA was used to test for possible changes in differential leucocytes counts with time and exposure.Statistical significance of differences was tested two-sided at the p \u2264 0.05 level. If not indicated otherwise, data are given as means \u00b1 standard error of the mean. The exposure code was broken only after completion of the analyses.Chronic exposure to 900 MHz electromagnetic fields had no influence on the absolute body weight of female AKR/J mice; however, its influence on the relative weight change was significant (p < 0.001) Figure . The rapWater consumption was approximately 4 g per day and mouse, and not different between exposed or sham-exposed animals (data not shown). This value is in accordance to the water intake measurements published by the Jackson Laboratory , and obvSimilar survival rates were seen in both groups of AKR/J mice Figure . The firIn female AKR/J mice lymphoma developed rapidly, usually associated with lymphadenopathy. In 28.2% (exposed) and 30.3% (sham-exposed) of all animals, lymphomas were restricted to the thymus, followed by respiratory distress and protrusion of the eyes. 13 animals  died in their cages without any earlier sign of distress, although autopsy revealed enlarged mediastinal mass compressing the thoracic space. The lung was affected in 10% of the exposed and sham-exposed animals; 8 exposed and 6 sham-exposed animals developed macroscopically visible metastatic tumors in the liver or spleen Figure . Other cWhen the animals reached an age of about half a year, differential counts of leucocytes were performed monthly using blood smears from tail blood. As seen in Figure The present study was designed to test the hypothesis that 900 MHz electromagnetic fields, modulated according to the global system for mobile communication (GSM), increases the risk of lymphoma incidence in female AKR/J mice. According to the results this hypothesis has to be rejected, since compared with sham-exposed females of this strain, a mean exposition of 0.4 W/kg SAR neither influenced the risk to develop lymphoma, nor the malignancy of the disease, only an influence on the growth pattern of the animals was observed. However, the present experiment does not allow any conclusions about tumor onset or the kinetics of tumor development, since for such type of study animals would have to be sacrificed and examined at fixed intervals irrespective of clinical symptoms.Caenorhabditis elegans [Pim1 mice was not changed due to exposure to electromagnetic fields [Exposure to electromagnetic fields increased the growth rate in the nematode  elegans , but dec elegans . In contc fields ,18. Duriad libitum, and various studies described effects of electromagnetic fields on the nervous system in humans or rodents [Food was available  rodents -39. It mMitochondrial heat production is one of the main energy consuming processes in endotherms like mice ,41. The Pim1 transgenic mice, which are known to develop spontaneous lymphoma with a high incidence rate. Lymphoma risk was found to be significantly higher in the exposed E\u03bc-Pim1 mice than in the controls, mostly pronounced for non-lymphoblastic lymphoma. Humans are presently not known to carry an activated Pim1 gene, but other inherited gene defects are known that predispose carriers to develop cancer [Pim1 mice from the same supplier  as Repacholi et al. [A demonstration that long-term exposure to electromagnetic fields derived from mobile phones or base stations increases the incidence of tumors in animals would provide direct evidence that such radiation is carcinogenic. The most positive evidence of an effect of exposure to high frequency electromagnetic fields similar to that used by mobile phones was reported by Repacholi et al. , using Ep cancer . Howeveri et al. , did noti et al. . Becausei et al. .A Japanese study showed that neither 1.5 GHz nor 929.3 MHz electromagnetic field exposure promotes liver carcinogenesis in a medium-term bioassay system, using partially hepatectomised F344 rats . A monopIn the present study non-restrained mice that are genetically predisposed to develop lymphoma with a high incidence were exposed to a \"far-field\" similar to both Australian studies ,18, withThe present study does not support the hypothesis that chronic exposure to high-frequency electromagnetic fields, similar to those emitted by mobile phones and base stations promote neoplastic development in the hematopoietic system in genetically predisposed mice. However, we cannot rule out that exposure to electromagnetic fields may be risk factors for other neoplastic development.The authors declare that they have no competing interests.AS carried out the study, performed the statistical analyses and drafted most of the manuscript. AL conceived the study, participated in its design and coordination, and drafted some parts of the manuscript. JS, AB and VH developed the technical set up and delivered the dosimetry for the experiment. All authors read and approved the final manuscript.The pre-publication history for this paper can be accessed here:"}
+{"text": "Cytology slides are often unique and irreplaceable. Unlike surgical pathology cases, where additional paraffin sections can be cut, cytology slides often cannot be duplicated because there are only a few direct smears or the diagnostic material is present on a single slide. Cytology slides are often \"sent out\" to other physicians, laboratories or hospitals, typically so that the pathologist at the institution where the patient will receive treatment can review the slides. Less often, a cytology lab sends out the slides for a second opinion or as part of the discovery process in a lawsuit, where they may or may not be defendants. Rarely, unique and irreplaceable cytology slides are lost. This article presents a hypothetical scenario that is based on reported state appellate court decisions. The article discusses some of the legal issues that will affect the defendant cytologist/cytology lab and the \"expert cytologist,\" and suggests some steps a cytologist/cytology lab can take to minimize the risk of repercussions from a lost unique and irreplaceable cytology slide. A WestLaw search  uncovered only a handful of reported appellate cases that directly applied to the issue of lost cytology slides. There are many cases and statutes dealing with lost and altered evidence (other than cytology slides), but the circumstances surrounding cytology slides are unique. I did not see any previous reviews or commentary specifically addressing the topic. Notwithstanding the relative paucity of on-point legal authority, the issue is one commonly addressed by cytology laboratories and cytologists and many have approached the issue thoughtfully and prudently.This review synthesizes the available legal cases and presents to practicing cytologists a short, relatively concise summary in the format of a hypothetical case. The review seeks to incorporate the legal issues with the practical aspects of running a cytology laboratory. The review answers how some state courts might approach the problem of lost and irreplaceable cytology slides, and offers general ideas to cytologist for minimizing the risk from lost slides.The issues surrounding the decision whether to send out diagnostic patient slides are more important in cytology than in surgical pathology because the cytology slides are typically unique and irreplaceable. Unlike surgical pathology cases, where additional paraffin sections can be cut, cytology slides often cannot be duplicated because there are only a few direct smears or the diagnostic material is present on a single slide.Slides are routinely \"sent out\" for a variety of reasons. Most commonly, slides are sent to another institution because the patient's pathology slides will be reviewed before treatment. Some smaller laboratories with only one or two pathologist may send out slides as part of their quality assurance procedures. More rarely, but increasingly, slide's are requested as part of existing or contemplated litigation. Slides might be lost in any of these circumstances. A laboratory or hospital might loose the slides and not discover their absence until the slides are requested.This article will discuss the approach the US legal system takes in addressing what happens when cytology slides are lost, and what steps a prudent laboratory might take to manage the risk. The article also intends to improve cytopathologists' awareness and understanding of some of the legal issues that arise when evidence is missing and perhaps promote an international comparative discussion of alternative legal approaches.In the US, most of medical malpractice law is made and interpreted by state legislatures and state courts. What follows is a hypothetical story based on several legal decisions made by appellate state courts in the United States and reported in the legal literature. Although based on real cases and available to the public, the names have been changed. Importantly, none of this is intended as legal advice and readers should consult their attorney about specific questions.Rugged Labs (RL) is a small, independent laboratory. Part of Rugged Labs' work involves providing Big Giant Lab (BGL) with overflow services for cytopathology. In December of 1995, BGL bought out RL.In 1994 and 1995, a RL cytotechnician interpreted two Pap smears from 30-year-old Ms. Penny as normal. In 1996 a cervical biopsy from Penny showed adenocarcinoma. Ms. Penny underwent a radical hysterectomy, which confirmed the invasive endocervical adenocarcinoma. Ms. Penny is alive today, but endured extended post-operative hospitalization.At the time of the hysterectomy, Penny Plaintiff's oncologist requested that the 1994 and 1995 PAP smear slides be sent to Dr. Experta, who interpreted both Pap smears as containing \"abnormal cell groups consistent with adenocarcinoma.\" Dr. Experta also reviewed the biopsy and in a note concluded that the cells on the Pap smears were consistent with the adenocarcinoma diagnosed on the cervical biopsy.Approximately 6 months later, Plaintiff Penny decided to sue for medical malpractice based on failure to diagnose her endocervical adenocarcinoma on the Pap smears.At some time before the plaintiff filed her lawsuit Dr. Experta's assistant apparently mailed the slides back to BGL. The Pap smear slides are lost, presumably in the mail, by BGL or Dr. Experta's office.RL, the independent laboratory, asked the trial court to grant it summary judgment on the basis that the evidence was lost and no questions of fact remained. Summary judgment means that there are no outstanding questions of fact and the court needs to decide only questions of law. Summary judgment means there is no trial with a jury or judge hearing and weighing evidence. The question of law RL wanted the court to determine on summary judgment was that the lost slides substantially prejudiced RL and summary judgment was, therefore, appropriate. RL included in its motion for summary judgment an affidavit from an expert stating that she could not give an opinion without having the slides to look at. An affidavit by Dr. Experta's secretary stated that the slides were returned to BGL by US mail. BGL submitted an affidavit attesting they did not lose the slides. The parties to the lawsuit stipulated that the slides were lost. The trial court agreed with RL that there should be summary judgment in RL's favor, reasoning that no questions of fact needed to be answered and that a trial would unduly prejudice RL because of the spoliation of evidence. For a summary of the facts, please see Fig. 1.The Plaintiff appealed and the state appellate court reversed the trial court, concluding that the trial court made a mistake in not allowing the case to go to trial. The appeals court reasoned that the case turned on a question of fact; \"The slide either showed the presence of cancer cells or it did not.\" The appellate court envisioned the trial as follows: the cytotechnologist from RL would \"testify to her conclusions\" and the plaintiff would have Dr. Experta testify to her conclusions. There should be a trial because there were questions of fact including, in the words of the majority, whether the slide had \"cancer cells\" or not.The majority also discounted the affidavit from BGL, stating that the conclusory statement that BGL had not lost the slides was not valid; just because BGL couldn't find the slides did not mean they never had them. In a footnote, the majority noted that although they aren't accusing anyone, they couldn't help but notice that missing the slides benefited BGL and RL.One judge dissented in the three-judge panel that decided the case. The dissent focused on two points. First, the dissent emphasized that the defendant RL had nothing to do with loosing the slides. Although the plaintiff, Ms. Penny, had no \"direct role\" in the loss of evidence, the dissent treated Dr. Experta as an agent of the plaintiff and concluded that Dr Experta should have sent the slides back to RL not GBL. The dissent also reasoned that its approach would \"encourage experts to treat more carefully evidence delivered into their hands.\"Secondly, the dissent emphasized that the defendant RL is disadvantaged by the loss of the slide and the plaintiff has gained a significant advantage. The dissent sees a trial where the cytotechnologist's faces a serious credibility problem because her testimony will come across as blatantly self-serving. The cytotech will be limited to \"opining that he made no error.\" Moreover, the fact-finder may conclude that the cytotechnologist is wrong since many may presume that the expert pathologist must be right. Finally, the defendants cannot obtain their own expert to bolster their case, because no cytology slides remain for review.The dissent concludes that summary judgment for RL was proper because the trial court had good reasons to conclude that the lost evidence was going to unduly prejudice the defendant RL.The most obvious issue this case brings up is the difficulty in deciding what to do when it isn't clear who lost the evidence, or when a third party lost the evidence. In contrast, is the situation where one party is responsible for inadvertently losing the evidence or, even worse, where one party deliberately loses or destroys evidence. This is called spoliation of evidence and includes meaningful alteration of the evidence.The court will determine the severity of the sanction for spoliation by the degree of willfulness or bad faith and the extent of the prejudice suffered by the non-responsible party. For example, in one case, surgeons performed a hepatectomy after a small needle core liver biopsy was interpreted as cancer. The hepatectomy specimen showed only cirrhosis and no cancer was found. The small needle liver biopsy was subsequently lost by the hospital. The patient sued for medical malpractice, claiming that the core biopsy was misdiagnosed and lead to an unnecessary hepatectomy. The trial court instructed the jurors that they could \"draw the strongest possible inference against [the hospital] as to what the lost cytology slides would have shown.\" In other words, losing the slide means your opposition can make the slide show whatever they want. Interestingly, in the hepatectomy case, the defendants prevailed by arguing that the diagnosis of cancer and the decision to undergo resection were reasonable, regardless of the cytology results, because the patient had active hepatitis B and a suspicious liver mass on imaging. They argued that even with a negative cytology result the surgeons would have gone ahead with the hepatectomy.But our case is different. Neither party, according to the majority, is responsible for losing the slides, or put another way, either party might be responsible for losing the slides. Several judicial options exist and none are neutral. One is to impose no sanctions and to proceed as usual, only without the slides, as the majority opinion advocated. This likely favors the plaintiff, particularly when there is a subsequent surgical specimen with cancer. A second option is to try to determine which party the court thinks is more prejudiced by the lost slides and then impose a legal remedy, as the trial court did in our hypothetical case by granting summary judgment. The difficulty is that it will not be clear which side is more prejudiced until the slide is recovered. The critical question of whether the negative diagnosis fell below the standard of care can likely be adequately answered only if the parties and their experts can review the slide. A third option might be to not allow Dr. Experta's testimony if the defendant can show that the expert knew or should have known that there was going to be litigation . ArguablInterestingly, each option leads to a different result based on bias about which party is ultimately more responsible or more likely responsible for loosing the slides and a bias about the standard of care. The majority's opinion included a note that the benefit to BGL from losing the slides can't be ignored, a clear statement that the plaintiff had no responsibility for losing the slides, and a simplistic view about the standard of care reflected by the statement that \"the slide either showed the cancer cells or it did not.\" The majority's subtext is that the plaintiff did nothing wrong and they weren't completely sure about the laboratory. The dissenting opinion, in contrast, treated Dr. Experta as the plaintiff's agent and was dissatisfied that Dr. Experta returned the slide to BGL instead of RL, even though at the time BGL had purchased RL. The dissent also showed a more nuanced understanding of the standard of care, conveying skepticism about Dr. Experta's look back conclusion that the Pap smears were \"consistent\" with adenocarcinoma. The dissent reasoned that perhaps the cells are consistent with malignancy only in the retroscope and that a defense expert might reasonably conclude that it was \"not below the standard of care to determine the biopsy negative\" were the slides available for review.Penny vs. GBL, a court does not dismiss the plaintiff's case, the absence of the cytology slide will likely impact the defendant cytologist more adversely because many people will assume that the cancerous cells were on the slide and the cytologist or cytotechnologist missed the cancer, which, after all, was present on the subsequent biopsy. In the hypothetical's facts, this was particularly true since Dr. Experta had already opined that the Paps were \"consistent with adenocarcinoma.\" The defendant cytologist/cytology lab is at a serious disadvantage if the court allows Dr. Experta's opinion as admissible evidence. The majority's comment that GBL benefited from the lost slides and the appellate court's decision to allow the plaintiff to go to trial, suggests the court's bias that they believed Dr Experta's interpretation was the correct one.The facts often surrounding a cytopathology medical malpractice case are that there is a subsequent biopsy or surgical specimen with a discrepant diagnosis. If, as in the hypothetical Admittedly, a cytology lab or cytologist does benefit if slides are lost and the court does not attach any responsibility for losing the slides to the potential laboratory or cytologist defendant, because the plaintiff will not have enough evidence to prevail. Similarly, if the slides are discarded after the legal time periods the likelihood of a successful lawsuit is slim because the plaintiff will not have enough evidence, and the defendant complied with legal requirements regarding slide retention. The hypothetical case of Penny vs GBL differs. Remember that once the court allows the case to go to trial, GBL only benefits from absent slides if the defendant initially misinterpreted the slides. If the slides contained no malignant cells, and Dr. Experta over-interpreted the slides, then GBL is prejudiced by not being able to show the slide.Cytology slides are typically in possession the cytology labs. The slides may be sent out for a variety of reasons, but at least initially the lab has possession of the cytology slides. This is both an advantage and a disadvantage for the lab. The disadvantage is that if slides are lost while in the lab's possession a court will typically see it as the lab's responsibility to safeguard the slides. This allows the plaintiff to have the jury infer whatever is best for the plaintiff's case; that the slide had malignant cells when the cytology diagnosis was benign or that there were only benign cells when the diagnosis was malignant, as in the hepatectomy case.The advantage for the cytology lab is that it is in a position of relative control. The lab can implement a system to help reduce the chances of losing a slide and reduce the risk if a slide is lost. Although the lab may want to employ the help of an attorney experienced in these matters, there are several steps every cytology lab can take. First, the lab should ensure that cytology slides are retained for the time that the current federal CLIA regulations, applicable state regulations and the CAP checklist require. All glass cytology slides must be retained for at least 5 years and fine needle aspiration slides retained for 10 years. (Some state regulations may require longer times.) The CAP checklist also requires policies for \"protecting and preserving the integrity and retrieval of original slides in cytopathology\" and \"to ensure defined handling and documentation of the use, circulation, referral, transfer and receipt of original slides to ensure availability of materials for consultation and legal proceedings.\" Keeping careful records about when and which slides are released to whom is essential for reducing the risk of losing slides. In the send out cases where slides are sent out for a routine second opinion not sought in contemplation of a law suit or because a patient will be treated elsewhere, the lab might obtain the borrower's explicit written agreement that the borrower has responsibility for the slides with an explicit provision about a duty to indemnify the cytology lab for any losses due to a lost slide or slides. A documented telephone call to request the return of tardy slides may also be worthwhile. In cases where slides are requested in contemplation of a lawsuit, the lab may be able to implement a policy that review of slides is done at the lab, ensuring that the lab retains possession. Alternatively, the lab may pursue or agree to a court order requiring production of the slides that clearly addresses who is responsible for the slides and includes an indemnity clause in the event the slides are lost.It is reasonable to make a distinction between sending out non-reproducible slides to an institution that will treat the patient and sending out non-reproducible slides to the plaintiff's expert witness. It is, therefore, important that the lab understands the purpose for which the slides are requested. A documented telephone conversation may clarify the purpose of the outside review and allow the lab to appropriately \"triage\" the case.Laboratory administrators should understand that the cytology lab serves a public function in safeguarding cytology slides. Court's have recognized a public policy reason to have the laboratory safeguard slides, in part so that the slides are available in the event of malpractice litigation. At the same time, many states have statutes that give patients the right to examine and copy their medical records . These two propositions are not mutually exclusive. One state case considered the question of whether a patient/plaintiff had a right to \"immediate possession of pathology slides\" and concluded that the plaintiff did not. The court decided that the patient's rights did not exceed the patient's statutory right in the slides. In other words the court was not going to find a common law, or customary, right in the slides that gave the patient a greater right than the applicable statute. The decision noted that the legislative history of the statute included remarks that pathology slides were part of the medical record. The judges then approached the second question about what to do when the \"medical record\" cannot be duplicated, as with a Pap smear or other cytology slide. In answering this question, the court noted that hospitals and laboratories have public as well as private duties. One of their public duties is to retain slides so that the slides are available in the event of malpractice litigation. This meant that patients do not have a legal right to possess parts of the medical record that cannot be duplicated. The court, however, did not grant the lab complete authority to never release the slides. Since the public policy reason depended fundamentally on preserving slides to help the legal system run smoothly, the decision reminded the laboratory or hospital that, pursuant to the clear terms of a statute, it must send the original slides to a \"licensed institution, laboratory or physician\" at the patient's written request.Moore vs Regents of the University of California [The dissent characterized the pivotal issue differently and concluded that the patient had a right to immediate possession because the slides contained the patient's cells and she had the right \"to control one's body.\" The dissent reasoned that recent advancement in genetic science and the accompanying difficult privacy issues raised by genetic information strengthened the patient's right to possession of the cells on the glass slide. The majority addressed this argument and, citing the well known case of lifornia , remindePenny v GBL illustrates, lost slides can result in problems for cytologists and the cytopathology laboratory A good place to start is to ensure that existing CLIA regulations, applicable state regulations and other guidelines, such as the CAP checklist, are in place in the laboratory. Thinking about the issue and implementing appropriate risk management strategies with the help of an attorney are also prudent measures.In summary, lost slides can be a problem for cytology laboratories and cytologists, whether responsible for losing the slides or not. The prudent cytologist will minimize the risk of lost slides, because, as the hypothetical case of"}
+{"text": "Binocular vision requires an exquisite matching of projections from each eye to form a cohesive representation of the visual world. Eye-specific inputs are anatomically segregated, but in register in the visual thalamus, and overlap within the binocular region of primary visual cortex. Here, we show that the transmembrane protein Ten_m3 regulates the alignment of ipsilateral and contralateral projections. It is expressed in a gradient in the developing visual pathway, which is consistently highest in regions that represent dorsal visual field. Mice that lack Ten_m3 show profound abnormalities in mapping of ipsilateral, but not contralateral, projections, and exhibit pronounced deficits when performing visually mediated behavioural tasks. It is likely that the functional deficits arise from the interocular mismatch, because they are reversed by acute monocular inactivation. We conclude that Ten_m3 plays a key regulatory role in the development of aligned binocular maps, which are required for normal vision. The visual world is represented within the brain as a series of maps of visual space. In species with binocular vision, the inputs from the two eyes are aligned to form a cohesive map; little is known about how this organisation is achieved during development. We show that a transmembrane protein, Ten_m3, plays an important role. Ten_m3 is required for the guidance of uncrossed retinal axons: uncrossed projections from the eye to the brain map aberrantly in mice that lack Ten_m3, although crossed projections map normally. Consequently, projections from the two eyes are not aligned in these mice. We show that this mismatch has devastating consequences for vision. Mice lacking Ten_m3 perform very poorly in behavioural tests of visual function. The deficits are a direct result of the mismatch, because acutely silencing inputs from one eye restores visual behaviour. This remarkable and rapid recovery suggests the mismatch of the inputs from the two eyes leads to functional suppression in the brain. We conclude that Ten_m3 acts as an eye-specific guidance cue for retinal axons and is required to produce aligned projections from the two eyes, and further, that this is critical for normal visual function. Ten_m3, a transmembrane protein, has a newly discovered role in guiding retinal axons, aligning projections from the two eyes, and thereby mediating binocular vision. The functional capabilities of the central nervous system are critically dependent on highly specific patterns of neural connectivity that are established during early development. In many parts of the brain, axonal projections form a topographic map whereby relative spatial relationships between afferent and target fields are maintained. This spatial mapping is thought to be important in maintaining the integrity of information at successive levels of processing. Molecular gradients have been shown to play a key role in establishing normal topography in the developing visual system \u20135. BinocDrosophila pair-rule gene Ten_m/Odz [We recently identified Ten_m3 in a microarray screen for molecules that are differentially expressed between visual versus nonvisual pathways . The Tenen_m/Odz ,26. Receen_m/Odz . Both Teen_m/Odz ,29. The p < 0.05, Pairwise fixed reallocation randomisation test [We first analysed the normal expression of Ten_m3 in the developing visual pathway using in situ hybridisation. Ten_m3 mRNA was expressed in the innermost layer of the developing retina, corresponding to the developing RGC layer at embryonic day (E)16 A. The diion test ). Withinion test  and termion test  of ipsilion test . Quantifp < 0.001, Pairwise fixed reallocation randomisation test) compared to wild type (WT), suggesting that it may be targeted for degradation rather than synthesized into protein. Western blots using an antibody directed against the extracellular domain of Ten_m3 on brain lysates from WT mice showed a single band of approximately 300 kDa corresponding to the Ten_m3 protein, whereas homozygous KO mice lacked this . Many adult Ten_m3 KO mice have a slightly curly tail and/or a humped back. The appearance of the brain is normal, and histological observations did not reveal any major changes in brain structure or organisation. Most importantly, no differences in size, cellular density, or lamination were apparent in Nissl-stained sections through retina, dLGN, or visual cortex of Ten_m3 KOs compared to the WT mice .To investigate a role for Ten_m3 in regulating the formation of visual projections, the organisation of ipsilateral and contralateral retinal projections was examined in Ten_m3 KOs during the fourth postnatal week when the projection is adult-like . RGC axon = 5; KO: 14.7% \u00b1 1.02, n = 5; p > 0.5, t-test). It thus seems that the ipsilateral zone of the dLGN is elongated rather than expanded per se.In WT mice, the ipsilateral and contralateral projections are anatomically segregated; contralateral projections fill all regions of the dLGN not occupied by ipsilateral terminals, including the ventrolateral region of the nucleus I\u20133I\". Gi2, n = 3; KO: 1.62 \u00b1 0.17 mm2, n = 3; p > 0.9, t-test; n = 3) or their density within the VTC . These numbers provide an estimate of just under 1,000 ipsilaterally projecting RGCs in both WTs and KOs, similar to previously published values in pigmented mice [In mice, over 95% of RGCs project contralaterally. The adult ipsilateral projection arises from RGCs within the peripheral ventrotemporal retina known as the ventrotemporal crescent (VTC). Within the VTC, approximately 15% of RGCs project ipsilaterally and the remaining RGCs project contralaterally . In normted mice . The lacp < 0.01, Wilcoxon rank sum test, comparing ipsilateral sections in KOs versus ipsilateral sections in WT, and contralateral sections in KO and WT). The position of the contralateral patch along the DV-ML axis was similar between WTs and KOs, supporting the suggestion that there is no major shift in topography of contralateral projections. As an additional control, focal injections into the dorsal retina were also performed. These experiments revealed no change in the topography of contralateral retinal projections from this region . Follows region . No ipsi5 pixels, n = 9; KO: 6.7 \u00b1 1.2 \u00d7 105 pixels, n = 8; p > 0.5, t-test). That is, although there may be a subtle decrease in the precision of geniculocortical connectivity, the overall topography of the pathway appeared normal in Ten_m3 KOs.The dLGN receives inputs from the retina and sends outputs to the primary visual cortex (area 17). We therefore examined the topographic relationship between visual thalamus and cortex in Ten_m3 KOs. This was of particular interest both because Ten_m3 is expressed in geniculocortical neurons and in developing visual cortex , and becIn order to confirm these results with respect to the potential transfer of information from the aberrantly mapped ipsilateral eye to the visual cortex, retrograde tracing from the cortex was combined with anterograde tracing from the retina. In WTs, injections of green CTB into the lateral (binocular) zone resulted in a patch of retrogradely labelled cells in the dorsomedial region of the dLGN. Notably, all of the retrogradely labelled cells were contained either within, or immediately adjacent to, the ipsilateral patch . To test the ability of Ten_m3 KOs to perform this task using the visual system, the task was repeated under normal (ambient) light with the whiskers trimmed so they could not rely on somatosensory cues. WTs scored significantly better than KOs under these conditions . In many cases, KOs did not reach out until their nose touched the bar .We wished to determine whether the observed retinogeniculate mismatch affects vision in the Ten_m3 KO mice. Three visually mediated behavioural tasks\u2014vertical placement, horizontal placement, and a modified version of the visual cliff test \u2014were per the bar B. The hon = 31), whereas Ten_m3 KO mice spent approximately half their time  in this region  and suggests that, unlike WT mice, KOs do not exhibit a preference for the patterned half of the box. A more detailed analysis of the behaviour of the mice showed that although KOs approached the cliff less often than WTs , they crossed it significantly more frequently . In addition, the average time spent on the cliff side of the box per crossing was almost 10-fold higher in KOs . As a control for possible differences in absolute activity levels, the average linear displacement of a randomly chosen subset of KOs and WTs was also determined; this did not differ between the groups of mice .The visual cliff test also revealed a clear difference in the behaviour of Ten_m3 KOs D. For ths region D. This dn = 7; KO: 925 \u00b1 249 cm/min, n = 5, p > 0.5, t-test; time on patterned side: WT: 55.9 \u00b1 2.9%, n = 7; KO: 54.0 \u00b1 3.8%, n = 5; p > 0.5; approaches: WT: 17.0 \u00b1 2.8, n = 7; KO: 17.0 \u00b11.4, n = 5; p = 1, t-test; percent crossings: WT: 88.7 \u00b1 3.4%, n = 7; KO: 90.8 \u00b1 0.9%, n = 5; p > 0.5, t-test). When these values were compared to those for each group under normal light conditions, it was found that mean activity levels were markedly higher for both groups, although this did not reach statistical significance for either WTs or KOs . The number of approaches in WTs showed no difference when compared to WTs under light conditions , but KOs approached the border significantly more often in the dark compared to light conditions . Both groups also crossed the cliff significantly more often than under normal light . Most significantly, both groups of mice spent approximately half their time on the patterned side , but essentially identical to those for KOs under ambient light. Together, these results suggest that the marked difference in the behaviour of the WTs and KOs in the visual cliff test is indeed mediated by visual cues. They also indicate that the KOs have the capacity to distinguish light from dark, even though they show little behavioural response to the visual cliff.To determine whether the observed differences in the behaviour of WTs and KOs in the visual cliff test are mediated by visual cues, the same test was conducted under dark conditions (red light). The two groups performed almost identically to each other for all parameters examined , suggesting that the drug did not compromise the mobility of the mice. The number of approaches to the cliff made by WT mice with monocular TTX (n = 6) showed no difference to WT mice without TTX . The proportion of times they crossed the border  and total time spent over the patterned surface  were, however, both noticeably different. Although the differences were not statistically significant, the change in behaviour associated with monocular TTX was of concern.We postulated that, given the relatively normal histological appearance of the visual pathway, the defect in the performance of the visual cliff test may be a direct result of the interocular mismatch in the retinogeniculocortical pathway see  rather tn = 6), were associated with the mouse crossing the border when the cliff was predominantly within the field of view of the active eye. Expanding the criteria to include cases where the cliff was within the field of view of both of the active and inactive eye produced similar results . These values are not different from the percent crosses made under normal light conditions . In contrast, a very high proportion of approaches made where the active eye was facing away from the cliff were associated with a crossing . This value is significantly higher than the percent crosses under normal light , and the percent crosses made when approaches were made using the active eye  or both eyes , and is in fact similar to the percent crosses made under dark conditions. These results show that the decrease in the performance of the WTs with monocular TTX is directly associated with the loss of part of the visual field, rather than with other effects of the drug. The time spent on the cliff side of the box per cross did not show a significant difference compared to untreated WTs .To see whether the decrease in the performance levels of the WTs with TTX was a direct consequence of the loss of part of the visual field, the data were analysed to see whether the behaviour of the mice correlated with the eye that was facing the cliff as they approached the border. For example, the mice often approached the cliff either at an acute angle, or close to one of the side walls. If the active eye was facing away from the cliff, or towards the wall, the cliff would be largely or completely out of the field of view of the active eye. The number of approaches, and associated crosses, were therefore subdivided into those made while the cliff was predominantly within the field of view of the active versus the inactive eye. When the analysis criteria were restricted such that only approaches where a clear bias for one eye versus the other was apparent, we found that only a minority of these  to KOs without TTX  and appeared to actively investigate the cliff before retreating (n = 7). This value is significantly less than for KOs without TTX . The KOs with TTX also exhibited a more than 10-fold reduction in the time spent over the cliff per crossing compared to KOs without TTX , a value similar to WTs under normal light. On average, KOs spent 90.6 \u00b1 7.9% (n = 6) of time on the patterned side during monocular blockade, almost identical to the values obtained for WTs under normal conditions. The difference between this value and that obtained from the KO mice under control conditions is significant . As with the WTs, the KO mice crossed the cliff much less frequently when it was in the field of view of the active versus the inactive eye . To confirm that this remarkable apparent recovery of visually mediated behaviour was due to the monocular blockade rather than individual variation, two KO mice were tested both before and during the blockade. Both of these mice spent far less time on the cliff side  during the monocular blockade than before the blockade.The behaviour of the Ten_m3 KO mice following monocular activity blockade was dramatically altered in comparison to their behaviour without TTX. Under these conditions, the KOs approached the border a similar number of times  The visual cliff test employs the ventral visual field , which is not part of the binocular visual field in mice . (2) TheBased on our anatomical data, we suggest that the mistargeting of ipsilateral axons in the dLGN in Ten_m3 KOs results in a more widespread representation of ipsilateral inputs to the visual cortex rather than being confined to the lateral third of area 17 as in WTs . Cells tAll experiments were performed on mice. Protocols were approved by the animal ethics committees of University of Sydney, Australia, Massachusetts Institute of Technology, United States of America, and/or Lund University, Sweden, and conformed to the National Institutes of Health and the National Health and Medical Research Council guidelines.http://www.perkinelmer.com). Antibody staining was performed using a rabbit anti-Ten_m3 [http://www.vectorlabs.com) and a TSA plus (fluoroscein) kit.Embryos were obtained from timed matings of C57/Black6 mice. Mothers were anaesthetised with 4% isofluorane and the embryos delivered by Caesarean section and then decapitated. Neonatal mice were anaesthetised with an overdose of sodium pentobarbital and the brains removed. For PCR analysis, the retinas were subdivided and relevant regions were dissected. RNA was extracted, and quantitative real-time PCR for Ten_m3 and a control gene was performed as described in . For in i-Ten_m3  at 1:25,\u2212/\u2212Ten_m3 mice were generated with a targeting construct in which the transmembrane-containing exon 4 of the Ten_m3 gene was disrupted with a neomycin gene (+/\u2212Ten-m3 and subsequently homozygous Ten_m3\u2212/\u2212 (KO) mice. Third generation backcrosses into C57/Bl6 were performed, but KO mice did not survive well on this background. Consequently, these mice were crossed with Sv129 mice, and the strain was maintained on this background. Animals are of varied pigment. Because alterations in the ipsilateral pathway of pigmented and albino mice have been reported [cin gene . The tarreported , all quareported .All surgical manipulations were performed under anaesthesia induced and maintained by inhalation of 2%\u20134% isofluorane in oxygen. Intraocular injections of 0.5\u20131 \u03bcl of 1% CTB conjugated to Alexa Fluor 594 (red) or Alexa Fluor 488 (green) were made into the right and left eyes of Ten_m3 KO and WT littermates at P21\u201323. For combined anterograde and retrograde labelling, injections of green CTB were made into subregions of visual cortex and red CTB was injected into one eye as above. Animals were euthanised 1\u20133 d later and perfused with 0.9% saline followed by 4% paraformaldehyde in 0.1 M phosphate buffer. Coronal sections, 60 \u03bcm thick, were cut using a freezing microtome. Focal injections of a 10% solution of 1,1\u2032-dioctadecyl-3,3,3\u2032,3\u2032-tetramethylindocarbocyanine perchlorate (DiI) in dimethyl formamide were made in peripheral VT retina of P11\u201312 mice under isofluorane anaesthesia; animals were perfused 1\u20132 d later. This age was chosen because topography is largely adult-like by this stage . CoronalImages were analysed using Image J (NIH). The freehand selection tool was used to outline the perimeter of the dLGN, and the area contained within this region in arbitrary units was determined. Analyses were performed across the entire rostrocaudal extent of the nucleus. Care was taken to exclude the optic tract, intergeniculate leaflet, and vLGN from this analysis. To isolate ipsilateral projections, background was subtracted using the rolling ball function, and the area containing the ipsilateral projections was selected using the wand tool. To determine shifts along the DM-VL axis, the image was cropped at the borders of the dLGN, thresholded as above, and the coordinates of each non-zero pixel were written to a file along with information on the size of the image in arbitrary units. The DM-VL axis was divided into 100 bins, and the proportion of label in each bin, expressed as a percentage of the total ipsilateral label contained within each bin, was plotted using Matlab. Means and standard errors for five KOs and five WTs were calculated and plotted. For the analysis of focal injections, all sections containing label from four KO and four WT animals were used. Thresholded data were binned as above, and Matlab was used to generate a heat map of the distribution of label. For an objective analysis of patch number, the Image analysis toolbox (Matlab) was used to calculate the number of clusters of label in images from KO and WT animals from the thresholded images. The area of labelled regions in BDA-injected animals was calculated by thresholding all labelled images in ImageJ. Labelled pixels were written to a text file and summed across all labelled sections for each animal. Means and standard errors are presented unless otherwise stated. For determination of the area of retina containing a high proportion of ipsilaterally projecting RGCs, this region was outlined in low-power photomicrographs of retinal whole mounts using ImageJ. For estimates of cell density, two fields of view within the region containing ipsilaterally projecting RGCs were photographed using the 20\u00d7 objective for three KO and three WT cases. Images were thresholded to isolate individual RGCs. The number of thresholded patches was calculated using ImageJ software.\u22122) light with whiskers trimmed and under red light with whiskers at normal length. For the horizontal placement test, mice were moved horizontally toward the bar and scored as above.For the vertical placement test, mice were held by the tail and lowered towards a horizontal metal bar. Scores were given by two independent observers who were blind to genotype, according to when mice made a clear reaching motion for the bar with their forepaws. A score of 2 was given for mice that reached more than 1 cm from the bar and a score of 1 for mice that reached within 1 cm, but before their nose touched the bar. A score of 0 was given for mice that touched the bar with the nose before reaching for the bar. The vertical placement test was performed under 2 conditions: normal  base. A high-contrast grating was attached to the underside of one half of the box. The box placed such that the clear half of the base protruded from the laboratory bench, revealing a drop to the floor of approximately 90 cm. Mice were placed in the centre of the box and their behaviour monitored for 10 min via a digital video camera mounted 1 m above the floor of the box. The data were analysed, blind to genotype, from video recordings. An approach was defined as moving from the patterned region towards the \u201ccliff\u201d such that the nose was within 5 cm of the midline. Crossing was defined as the animal completely crossing the midline from the patterned to the clear half of the box. Retreating was defined as moving such that the head was within 5 cm of the midline and retreating without the entire body crossing the border. Subsequent approaches were not scored until the mouse had moved outside the 5-cm range. To confirm the role of the visual system in this task, the test was also performed under dark (red light) conditions. The effect of monocular blockade of activity was determined by injecting 0.5 \u03bcl of 1 mM tetrodotoxin into the left eye under isofluorane anaesthesia as above. Some mice appeared lethargic for a few hours postinjection and so were allowed to recover from any systemic effects of the procedure for 2\u201316 h before testing to ensure that this would not bias the results. Activity levels were monitored to confirm this was the case by calculating the movement of the mice for 1 min. For this, a scaled grid was placed over the video monitor, and the points at which the mouse crossed the grid were plotted and measured. In addition to the other analyses performed, the approaches and crosses during monocular inactivation were subdivided into cases where the mouse approached the cliff such that it was predominantly in the visual field of the active versus the inactive eye. Approaches to the cliff that were made such that the mouse was parallel to and within 10 cm of a side wall, and thus the cliff was largely out of the field of view of the eye facing towards the wall, were included in this analysis. Approaches made at an angle such that the cliff was predominantly within the field of view of one eye rather than the other were also included. Approaches where there was no clear bias for one eye versus the other were scored separately. The effectiveness of the blockade at the time of the test was confirmed by checking that the pupillary light reflex was absent in the injected eye.Figure S1Sections through the dLGN following a focal injection of DiI into the dorsal retina in a WT (A) and a KO (B) mouse. Terminals are seen in ventral dLGN in both cases. Scale bar indicates 100 \u03bcm.(1.3 MB TIF)Click here for additional data file.Figure S2p > 0.5, t-test; n = 9 for WT and n = 8 for KO). Scale bar in (D) indicates 200 \u03bcm, which applies to all images.Coronal sections through the dLGN following injections of the neuronal tracer BDA into medial (A) and (B) or lateral (C) and (D) area 17 in WTs (A) and (C) and KOs (B) and (D). A dense patch of label containing retrogradely labelled cells and anterogradely labelled corticothalamic fibres (arrows) is seen in the dLGN (borders indicated by dashed line). The positions of the labelled regions are similar following injections into a particular part of the visual cortex: medial injections label ventral dLGN (A) and (B), whereas lateral injections label dorsal dLGN (C) and (D). The labelled area appears slightly larger in Ten_m3 KOs, but this difference was not significant ((5.1 MB PDF)Click here for additional data file.Video S1The mouse is allowed to move freely around a box with a clear acrylic base. A contrast grating is appended below half of the box. The animal pauses when it reaches the border between the patterned and nonpatterned halves, appears to inspect the border region but does not cross over, then retreats to the patterned region.(1.2 MB MPG)Click here for additional data file.Video S2Unlike the WT mouse, when the KO mouse approaches the border region, it crosses onto the nonpatterned side with no hesitation.(1.1 MB MPG)Click here for additional data file.Video S3Under these conditions, the KO mouse appears to inspect the border region and retreats to the patterned side. This behaviour is very similar to that observed in WT mice under normal conditions see .(7.7 MB AVI)Click here for additional data file.http://www.ncbi.nlm.nih.gov) accession number for Ten_m3 is NM_011857.The National Center for Biotechnology Information (NCBI) ("}
+{"text": "Survival remains an issue in pulmonary hypertension, a chronic disorder that often affects aged human adults. In young adult mice and rats, chronic 50% hypoxia (11% FIO2 or 0.5 atm) induces pulmonary hypertension without threatening life. In this framework, oral dehydroepiandrosterone was recently shown to prevent and reverse pulmonary hypertension in rats within a few weeks. To evaluate dehydroepiandrosterone therapy more globally, in the long term and in old age, we investigated whether hypoxia decreases lifespan and whether dehydroepiandrosterone improves survival under hypoxia.240 C57BL/6 mice were treated, from the age of 21 months until death, by normobaric hypoxia (11% FIO2) or normoxia, both with and without dehydroepiandrosterone sulfate (25 mg/kg in drinking water) . Survival, pulmonary artery and heart remodeling, weight and blood patterns were assessed.In normoxia, control mice reached the median age of 27 months . Hypoxia not only induced cardiopulmonary remodeling and polycythemia in old animals but also induced severe weight loss, trembling behavior and high mortality . Under hypoxia however, dehydroepiandrosterone not only significantly reduced cardiopulmonary remodeling but also remarkably extended survival . Weight loss and trembling behavior at least partially remained, and polycythemia completely, the latter possibly favorably participating in blood oxygenation. Interestingly, at the dose used, dehydroepiandrosterone sulfate was detrimental to long-term survival in normoxia .Dehydroepiandrosterone globally reduced what may be called an age-related frailty induced by hypoxic pulmonary hypertension. This interestingly recalls an inverse correlation found in the prospective PAQUID epidemiological study, between dehydroepiandrosterone blood levels and mortality in aged human smokers and former smokers. In human beings, pulmonary hypertension (PH) is a chronic and life threatening disorder in which a progressive increase of pulmonary vascular resistance leads to right ventricular failure. When detected, PH is often an already irreversible chronic pathology and leads to death after several years of severe illness and treatment -5. AmongTherapies under development may be studied in rats and mice by their effects on pulmonary arterial pressure or cardiopulmonary remodeling. Survival has been studied in rats with the use of monocrotaline injection to model PH -17, but Therefore we decided to use hypoxia, up to death in mice, starting at an age when they naturally start dying, in order to evaluate long-term positive or negative survival effects of hypoxic PH and a potential therapy. We considered dehydroepiandrosterone (DHEA), that has recently been shown to prevent and treat chronic hypoxic PH in rats when administered orally in its free  or sulfHypoxic pulmonary vasoconstriction helps oxygenating the blood but increases pulmonary arterial pressure. By relaxing contracted pulmonary arteries ,26,27, DMice were obtained at the age of 17 months  and randomly distributed into 4 groups (N = 60) in cages containing 7 to 9 mice each with ad libitum standard diet  and water. At the age of 21 months \u2013 which we will refer to as t = 0 \u2013 each group received a different environmental condition, defined by a combination of hypoxia or normoxia and DHEA or not. Cages were changed weekly and food and drink renewed every other week. All procedures concerning animal care and use were carried out in accordance with the European Community Council Directive (86/609/EEC). All animal procedures were approved by the animal care and use committee at the institute. All treatments and measures were performed by investigators blinded to the treatment.We chose normobaric hypoxia (11% FIO2) to avoid potential harmful consequences of rapid pressure variations. Hypoxic mice were housed in a home-made chamber homogeneously supplied by a flow of a filtered mixture of air and nitrogen  at ambient pressure and 11 \u00b1 1% oxygen . Control normoxic mice were housed in a similar chamber supplied by a flow of filtered air. Gas flowed sufficiently fast (15 l/min) into the chambers to ensure low carbonic gas levels (less than 0.05%). Hypoxia was interrupted weekly for roughly one hour for animal care.DHEAS  was incorporated at 0.25 mg/ml  into thSurvival was checked every one to three days until t = 180 days . From time to time mice were weighed and their food and drink consumption was approximated by giving 350 g food and 500 ml drink per cage and measuring how much remained one week later.Cardiopulmonary remodeling was measured in mice that died before t = 90 days . Right ventricular hypertrophy was assessed by the right ventricle to left ventricle plus septum weight ratio (RV/LV+S) . Lungs wBlood sampling was performed on one initially randomly chosen cage per group. Additional cages were randomly chosen if needed to have at least 5 mice tested per group. The mice to be tested were placed in clean cages with their usual drink but no food overnight, and were excluded from survival analysis. Blood sampling (300 \u03bcl) was performed retro-orbitally under inhaled isoflurane anesthesia, in the morning. Blood was mixed with 10% ethylenediaminetetraacetic acid at 0.5 M. A blood analyzer  provided hematocrit, hemoglobin content, and the count, volume and hemoglobin concentration of red blood cells.Values are expressed as mean \u00b1 SEM. Statistics were performed with JMP 6.0 . Comparisons between two and several groups were done by Student and one-way ANOVA tests, respectively. Survival curve characteristics and comparisons were based on the proportional hazards Cox model. The method for choosing the number of animals is provided in an online additional file see .Survival is clearly the main global health indicator. Note that mortality may affect the significance of results by death selection.It is rather unusual to start lifespan experiments with animals that are already aged. We wanted to start treatment (hypoxia or normoxia and DHEA or not) when the rate of 'natural death' becomes signifiant in C57BL/6 laboratory male mice. Starting with mice that are too old would imply that selection by death has comenced and that only resistant mice are being studied. If the mice are too young then in the short term no natural death will occur and any survival improvement due to a therapy may not be detected.It appeared from the literature ,32 that Survival curves are shown in Figure Over the next 3 months of treatment . Pulmonary artery remodeling  is shown in figure Compared to the control group, hypoxic mice had higher pulmonary artery  and heart  remodeling. DHEA had no effect on the normoxic cardiopulmonary system but under hypoxia DHEA significantly reduced pulmonary artery and heart remodeling .Overall, the mean daily consumption was of 3.0 \u00b1 1 g and 3.25 \u00b1 0.28 ml per mouse, with no particular distinction over groups and time. The consumption may have been lower because the determination did not take into account food and drink remaining at the bottom of the cage, which depend on the number of mice per cage, on their activity and on cage manipulation during the week. For DHEA-treated mice weighing ~30 g, we estimate that the DHEAS consumption was on the order of 25 mg/kg/day.Sick mice generally lose weight and as such body weight figure  may be uWhen the mice arrived, we observed that they were thin . The mice regained normal appearance within a month. When measured two months before treatment, all groups had similar weights (27.9 \u00b1 0.12 g) and food and drink consumption.Weights of control mice gradually increased until the age of 25 months . After two or three months, the -remaining- mice regained normal size  at t = 5 weeks and t = 5 months. The same trend was observed for red blood cell counts and blood hemoglobin content, while cellular hemoglobin content remained unchanged.DHEAS did not affect the hematocrit nor red blood cell properties, neither in normoxia nor in hypoxia, at t = 5 weeks and t = 5 months.1. Hypoxia induced PH in old mice and DHEA prevented it. 2. Hypoxia drastically induced mortality and weight loss in old age. 3. In its sulfate form and at the used oral dose DHEA was detrimental to long-term survival in normoxia. 4. DHEA however largely prevented hypoxic death during the whole experiment.This is not particularly surprising as it also does it in young adult mice  and ratsDHEA has already been shown to prevent and reverse PH in rats ,24. DHEAPH in old age. Old age is a common factor for PH incidence and low endogenous blood DHEA(S) levels in humans ..We are nAlthough DHEAS administration appeared to be detrimental in the long term , and although hypoxic animals treated by DHEA still lost weight and trembled, DHEA largely (but not completely) prevented the hypoxic mortality over the whole experiment. This overall beneficial survival effect is the best possible answer to our questions: DHEA not only treats hypoxic PH but also hypoxic (old) mice.The vasorelaxation of pulmonary arteries by DHEA could have led to overall negative effects since hypoxic vasoconstriction of pulmonary arteries is useful to improve blood oxygenation. The question arises of whether, with DHEA treatment, the body managed without the oxygen provided by vasoconstriction or another mechanism for providing an adequate oxygen supply came into play. The high blood hemoglobin content here may play a role. By preventing cardiopulmonary remodeling but permitting increased hematocrit under hypoxia, DHEA could be favorable to the animal's health by preventing heart failure (due to PH) while allowing high oxygenation.The prevention of hypoxic death by DHEA in mice recalls us the prospective PAQUID study in humans, where a strong inverse correlation between natural DHEA(S) blood levels and the ten year mortality in old male smokers and former smokers has been reported [reported . There ireported . TherefoThere seems to be a frailty to hypoxic PH that is particular to old age, in mice and possibly in humans. This suggests that survival studies with aged mice under hypoxia may be pertinent for evaluating therapies for aged patients having PH. In that framework, DHEA was found to remarkably improve survival under hypoxia. The comparison between mice and humans is not obvious, but our findings interestingly resemble human observations, that together suggest trials of DHEA treatment to PH and COPD in humans.FIO2: Fraction of Inspired OxygenPH: Pulmonary HypertensionCOPD: Chronic Obstructive Pulmonary DiseaseDHEA(S): DeHydroEpiAndrosterone (sulfate)This work was financed by the Association pour la Recherche sur les Nicotian\u00e9s .EHD carried out the design of the study, performed the statistical analysis, carried out the environmental setting, participated in blood analysis, anatomopathological analysis and drafted the manuscript. JQ carried out the anatomopathological analysis and helped to design the study. EEB participated in design and coordination of the study and helped to draft the manuscript.SurvivalPowerClick here for file"}
+{"text": "Alzheimer's disease (AD) is a progressive neurodegenerative disorder that primarily strikes the elderly. Studies in both humans and animal models have linked the consumption of cholesterol and saturated fats with amyloid-\u03b2 (A\u03b2) deposition and development of AD. Yet, these studies did not examine high fat diets in combination with reduced carbohydrate intake. Here we tested the effect of a high saturated fat/low carbohydrate diet on a transgenic mouse model of AD.Starting at three months of age, two groups of female transgenic mice carrying the \"London\" APP mutation (APP/V717I) were fed either, a standard diet (SD) composed of high carbohydrate/low fat chow, or a ketogenic diet (KD) composed of very low carbohydrate/high saturated fat chow for 43 days. Animals fed the KD exhibited greatly elevated serum ketone body levels, as measured by \u03b2-hydroxybutyrate (3.85 \u00b1 2.6 mM), compared to SD fed animals (0.29 \u00b1 0.06 mM). In addition, animals fed the KD lost body weight . In contrast to earlier studies, the brief KD feeding regime significantly reduced total brain A\u03b2 levels by approximately 25%. Despite changes in ketone levels, body weight, and A\u03b2 levels, the KD diet did not alter behavioral measures.Previous studies have suggested that diets rich in cholesterol and saturated fats increased the deposition of A\u03b2 and the risk of developing AD. Here we demonstrate that a diet rich in saturated fats and low in carbohydrates can actually reduce levels of A\u03b2. Therefore, dietary strategies aimed at reducing A\u03b2 levels should take into account interactions of dietary components and the metabolic outcomes, in particular, levels of carbohydrates, total calories, and presence of ketone bodies should be considered. Alzheimer's disease (AD) is an age-associated neurodegenerative disease that is very common in the US, affecting up to 50% of people between the ages of 75 to 84 years . The numThe development of AD and the accumulation of A\u03b2 have been linked to dietary factors. Diets rich in saturated fat have been repeatedly implicated in epidemiological studies -8, thougad lib and variable in composition. Despite these differences, low carbohydrate diets may also be effective in preventing seizures and may work through similar mechanisms as a KD  C57Bl \u00d7 FVB female mice of 3 months of age were used for this study. Mice were housed under a reversed day-night rhythm: 14 hours light/10 hours darkness starting at 7 p.m. in standard metal cages type RVS T2 (area of 540 cm2). The number of mice per cage was limited in accordance with legislation on animal welfare. All mice were genotyped by polymerase chain reaction (PCR) at the age of 3 weeks. Mice were blind randomized and age-matched and had free access to pre-filtered and sterile water (UV-lamp). Mice had free access to either ketogenic (KD)  or standard (SD) chow . The F3666 chow is a runny paste and was given in special designed liquid food suppliers and was refreshed daily. F3666 is a liquid chow and the animals frequently spilled the chow in the cage. Also, since all the animals in a given group were housed together in a single cage, measuring chow intake per animal was not possible and was not recorded. Due to some problems with weight loss in animals in the KD group, these animals were fed a mixed chow 1(SD):3(KD) starting at day 16 until day 20. From days 21\u201327 the amount of SD chow was reduced to a few crumbs sprinkled over the KD chow. After day 28 the animals were returned to KD chow only. However, one mouse in the KD group refused food intake and died despite attempts of feeding via gavage. One control animal died during blood draw.Blood was collected from anesthetized mice from either the orbital plexus or via a heart puncture. \u03b2-hydroxybutyrate levels were measured spectrophotometrically using the Stanbio liquicolor \u03b2-hydroxybutyrate kit .et al. [The novel object recognition test was performed after 38 days of treatment using the method described by Dewachter et al. . Briefly\u00ae (Ketamin), Rompun\u00ae (Xylazin 2%) and Atropine (2:1:1) and flushed trans-cardially with physiological serum at 4\u00b0C. This was performed to remove blood from the brain vessels, a procedure which has no influence on organ integrity. Blood was collected via a heart puncture and a 1 ml syringe in heparinized Eppendorf tubes. The brain was removed from the cranium and hindbrain and forebrain were separated with a cut in the coronal/frontal plane. The forebrain was divided evenly into left and right hemisphere by using a midline sagittal cut. One hemisphere of each animal was homogenized using a Potter, a glass tube  and a mechanical homogenizer (650 rpm). A volume of 6.5 \u00d7 1/2 brain weight of freshly prepared 20 mM Tris/HCl buffer (pH 8.5) with Proteinase Inhibitors  was used as homogenization buffer. The homogenates were collected in Beckman centrifuge tubes TLX and collected on ice prior to centrifugation. Before the samples were centrifuged, 10 % of the sample was used for determination of the total protein concentration of the homogenate whereas 90 % of the samples were centrifuged to process further for biochemistry. The supernatant (soluble fraction containing secreted APP and amyloid peptides) was separated from the pellet by centrifugation (membrane fraction containing membrane-bound APP-fragments). The supernatant was processed further by column chromatography to concentrate the amyloid peptides using small reversed phase columns . Amyloid peptides were eluted with 75% A-TFA and the eluates were collected in 2 ml tubes on ice. Eluates were freeze-dried in a speedvac concentrator  overnight and resolved in 240 \u03bcl of the sample diluent furnished with the ELISA kits. To quantify the amount of human A\u03b240 and human A\u03b242 in the soluble fraction of the brain homogenates, commercially available Enzyme-Linked-Immunosorbent-Assay (ELISA) kits were used . Quantification of the A\u03b2 content of the samples was obtained by comparing absorbance to a standard curve made with synthetic A\u03b240 or A\u03b242. Total protein concentration in the brain homogenate was measured using Bradford solution (Pierce Inc.).The mice were anaesthetized with a mixture of KetalarAD, Alzheimer's disease; APP, amyloid precursor protein; A\u03b2, amyloid beta; SD, standard diet; KD, ketogenic diet; CR, caloric restriction; BHB, \u03b2-hydroxybutyrate.As co-founder of Accera, Inc., STH holds shares in an organization and may gain or lose financially from the publication of this manuscript. In addition, STH has applied for patents relating to the content of the manuscript and may gain or lose financially from publication of this manuscript."}
+{"text": "Declining reproductive performance is a serious breeding concern in many countries. To reveal the situation in Norwegian cattle, trends in reproductive performance were studied using insemination reports from 1985 to 2005 and data based on herd recording files from 1989 to 2005. The total number of first services was 469.765 in 1985 declining to 335.712 in 2005. The number of recorded herds and animals declined from 21.588 to 14.718 and 360.289 to 309.452 from 1989 to 2005, respectively. Sixty days non-return rate after single inseminations (NR60) increased from 68.1 in 1985 to 72.7% in 2005 (p < 0.001) and the number of services per inseminated animal (NIA) decreased from 1.8 to 1.6 (p < 0.001) from 1985 to 2005. However, return rates 0\u20133 days post insemination (RR0-3) increased from 6 to 12% in the same period (p < 0.001). NR60 was higher and the RR0-3 was lower in the summer season compared to the winter season during the whole period. A fertility index (FS), has been calculated from the herd recording files each year from 1989 to 2005. The average FS-index did not show a significant trend and the calving interval was also fairly constant between 12.4 and 12.6 months during this period. The average interval from calving to first and last insemination, respectively, increased from a low of 79 and 102 days in 1990 to a high of 86 and 108 days in 2005. Both intervals were consistently longer for cows in first lactation than for cows in later lactations. The percentage of inseminated animals reported culled because of poor fertility decreased from 6.0% in 1989 to 4.6% in 1996 and thereafter again increased to 6% in 2005. In conclusion, most fertility measures, mainly comprising the Norwegian Red (NRF) breed, show a relatively high level of reproductive performance with a positive or a relatively constant trend during the last two decades. In many countries there has been a decline in reproductive performance in dairy cattle. Several studies show increasing number of days from calving to first service and decreasing pregnancy rates, e.g. -5. As a The results obtained in the present study are based on insemination reports and herd recording files in Norway comprising 66.8% of the herds in 1985 increasing to 94.2% in 2005  declininTrends concerning age of heifers at first insemination, average number of days from calving to first (CFI) and last insemination (CLI), respectively, number of animals inseminated (I), calving interval and animals culled because of failure to breed (AC) were obtained from herd recording files from 1989 to 2005. During this period there was a decline in number of recorded herds from 21.588 to 14.718 and animals from 360.289 to 309.452. A fertility index, Fertility status (FS), was also calculated for each herd from the herd recording files every year from 1989 to 2005. FS index is expressed by the formula:Comparisons of NR60, RR0-3 and NIA between years or groups were performed using chi-square analysis.th year from 1985 to 2005 is shown in figure st services remained similar  and cows with >1 lactation (n = 127252) were 1.5, 1.8 and 1.7  respectively for controlled animals in 2005. Data from 1989 to 2005 show each year similar differences in NIA between heifers, cows in 1st and >1 lactation. Fig Figure The percentage of inseminated animals reported culled because of poor fertility is shown in Fig et al. [et al., studying phenotypic and genotypic trends in heifers and first lactation cows [st lactation and >1 lactation cows were 68.8, 56.0 and 58.7% respectively. These results show that the pregnancy rates in NRF is relatively high when compared to studies from many other countries, e.g. [The aim of the present study was to describe some trends in reproductive measures in Norwegian cattle the last two decades. Since NRF has been by far the most dominant breed during this period, the data presented mainly reflects the reproductive performance of this breed. To describe the fertility trends, 60 days non return rates and number of services per inseminated animal are used among others. As a measure of fertility, non return rates have some disadvantages, as described by Salisbury et al. . Cows, oion cows . Howeverion cows ,5. The nion cows . In thises, e.g. -17.The improvement in NR60 is probably caused by a variety of reasons, one of them being the breeding strategy, which gives increasing weight to fertility and health traits. In Norway, fertility has been emphasised in the total merit index from the 1970's based on progeny testing utilising large daughter groups of the NRF breed . Other rThe increasing trend in CFI, and consequently also CLI, is probably mainly caused by managerial factors and farmer decisions. However, partly it is probably also caused by a small and undesirable genetic change for CFI, which has been observed in first lactation cows . In thisst lactation animals, but also >1 lactation cows, is in accordance with the differences in pregnancy rates after single first inseminations registered by Refsdal et al. [The study shows that reproductive performance in Norway is consequently higher in the summer months compared to the winter season. This is in contrast to many countries under subtropical and tropical conditions experiencing decreased fertility in dairy cows inseminated during the hot summer months -29. The l et al. . The FS-l et al. ,30.In conclusion, most fertility measures in Norwegian cattle, mainly comprising the NRF breed, show a relatively high level of reproductive performance and a positive  or relatively constant trend  during the last two decades. This is probably caused by a variety of reasons, one of them being the breeding strategy, which gives increasing weight to fertility and health traits. However, the interval from calving to first and last insemination, respectively, has slightly increased during the period and the RR0-3 has increased. The calving interval has been relatively constant in spite of increasing non return rates and lower number of services per animal inseminated, mainly because of a longer interval from calving to first insemination. This is also the main reason why the FS-index has been relatively constant. In contrast to many countries under subtropical and tropical conditions the reproductive performance in Norway is higher in the summer months compared to the winter season. This pattern has been similar over time and is probably caused by a variety of environmental factors."}
+{"text": "No significant effects on osteoclast number or activity were observed. We conclude that Pb delays fracture healing at environmentally relevant doses and induces fibrous nonunions at higher doses by inhibiting the progression of endochondral ossification.Lead exposure continues to be a significant public health problem. In addition to acute toxicity, Pb has an extremely long half-life in bone. Individuals with past exposure develop increased blood Pb levels during periods of high bone turnover or resorption. Pb is known to affect osteoblasts, osteoclasts, and chondrocytes and has been associated with osteoporosis. However, its effects on skeletal repair have not been studied. We exposed C57/B6 mice to various concentrations of Pb acetate in their drinking water to achieve environmentally relevant blood Pb levels, measured by atomic absorption. After exposure for 6 weeks, each mouse underwent closed tibia fracture. Radiographs were followed and histologic analysis was performed at 7, 14, and 21 days. In mice exposed to low Pb concentrations, fracture healing was characterized by a delay in bridging cartilage formation, decreased collagen type II and type X expression at 7 days, a 5-fold increase in cartilage formation at day 14 associated with delayed maturation and calcification, and a persistence of cartilage at day 21. Fibrous nonunions at 21 days were prevalent in mice receiving very high Pb exposures. Pb significantly inhibited  Despite stringent governmental regulations, lead exposure continues to be a major public health problem, with blood levels being elevated in a bimodal distribution predominantly affecting young children 1\u20135 years of age and individuals > 50 years of age . The CenIn addition to children, many adults maintain elevated blood levels due to past occupational or environmental exposure. With the reduction of Pb in fuel and soldered cans as well as increased awareness and vigilance, acute environmental Pb exposure has decreased dramatically . HoweverIn vivo models have demonstrated a decrease in bone density with Pb exposure , for intramembranous ossification, and undifferentiated mesenchymal cells, for endochondral bone formation . Fracturinvolved .Given the known effects on cells involved in bone formation and remodeling and the absence of literature on Pb in skeletal repair, the purpose of the present study was to evaluate the effects of elevated blood Pb levels on fracture healing. We employed an established murine tibia fracture model  to charaAll Pb solutions were made using Pb acetate  dissolved in distilled water. All mice had unrestricted access to the normal rodent diet supplied by the vivarium staff, and drinking water was replenished at least one time per week by the investigative staff to ensure continuous Pb exposure. All Pb waste solutions were disposed of appropriately. Mice were housed in groups of \u22645 animals per microisolator cage in the vivarium and maintained on a 12-hr light/dark cycle. All procedures were carried out in accordance with the regulations of and following the approval of the University of Rochester Animal Use and Care Committee.n = 32) at 6 weeks of age were divided into eight groups of four mice each. Each group was exposed to one of the following doses: 0, 55, 230, 580, 1,160, 1,750, 2,300, or 5,800 ppm Pb in the drinking water. This preliminary exposure was carried out to determine the whole-blood Pb (BPb) concentrations needed to approximate environmentally relevant levels of human exposure. This cohort is referred to as group A. Pb exposures of 0, 55, and 230 ppm Pb in the drinking water were selected as most environmentally relevant. A second cohort (group B) of female C57/Bl6 mice (n = 54) was divided into three groups of 18 animals and housed under conditions as outlined above. All experiments related to the analysis of the fracture healing process were performed with group B except one, which documented chronic nonunions in mice exposed to 2,300 ppm Pb.Female C57/Bl6 mice . This method was adapted by Parsons from the Department of Environmental Health and Toxicology, SUNY at Albany . All ins3, and the total volume was brought to 10 mL with distilled water and analyzed.After 6 weeks, four animals from each of the 0, 55, 230, 2,300, and 5,800 ppm Pb groups were sacrificed. The femora and tibiae were removed, the epiphyses and soft tissues were discarded, and the bone marrow was flushed out with a 25-gauge 5/8-inch needle . The remaining diaphy-seal bones were washed with phosphate-buffered saline (PBS) to remove all marrow elements and blood cells. The bones were then processed as described previously . Briefly6 cells per 6-cm plate for nodule formation assays, and medium was changed every 3 days. After 17 days in culture, triplicate cultures were fixed with 10% formalin, rinsed in distilled water, and stained by von Kossa\u2019s method . Total nodular area was quantified by histomorphometry.Group B animals were sacrificed after 6 weeks of Pb exposure. The femora and unfractured tibiae were excised, and the soft tissues were removed. Primary bone marrow cells were isolated and prepared as described previously . Bone maOsteoclast progenitor cells (OCPs) were prepared from splenocytes as described previously . Animals5 cells/well in a 96-well plate in \u03b1-MEM supplemented with macrophage-colony\u2013stimulating factor  and receptor activator nuclear factor \u03baB ligand . Fifty percent medium was added the next day, and medium was changed every other day thereafter. Cultures were incubated at 37\u00b0C for 6\u20137 days and then fixed and stained for tartrate-resistant acid phosphatase (TRAP) using the leukocyte acid phosphatase kit (Sigma). The number of TRAP+ multinucleated cells was then counted to quantify osteoclast formation as described previously  supplemented with M-CSF (30 ng/mL) for 12 days. Individual colonies, defined as > 40 cells, were then quantified under an inverted microscope. The total number of colonies represents the original number of monocyte/macrophage and osteoclast precursors , RANKL (100 ng/mL), 1% l-glutamine, 1% penicillin/streptomycin, and 1% nonessential amino acids (Gibco). Fifty percent medium was added the next day, and medium was changed every other day thereafter. After 12 days, the wafers were scraped, dried, stained with toluidine blue, and examined under a 40\u00d7 objective. Wafer images were captured, and resorption pits on the wafer surface were traced to determine the total pitted area using Osteometrics software  as described previously  was placed into the tibia. The pin was trimmed proximally at the level of the tibial plateau. The wound was then closed with 4\u20130 nylon sutures. The left tibiae were placed in a modification of the guillotine three point-bending device described by Fractured tibiae were harvested at 7, 14, and 21 days. The tissues were fixed in 10% formalin for 24 hr and decalcified in 10% EDTA at pH 7.2 for 2 weeks. Samples were then processed, embedded in paraffin, and cut in 3-\u03bcm sagittal sections. Three contiguous sections (100 \u03bcm apart) for each specimen were stained with Alcian blue and counterstained with hematoxylin, orange G, and eosin (ABH/OG) as described previously . Additio+ osteoclasts was then expressed per total area of fracture callus.Quantitative analysis was performed on the sagittal ABH/OG- and TRAP-stained sections by histomorphometric analysis using Osteometrics software. Bone and cartilage formation was quantified on ABH/OG-stained slides by outlining the perimeter of the fracture callus under the 2\u00d7 objective. Areas of new woven bone and cartilage were then traced. This procedure was repeated until the entire fracture callus had been evaluated. The areas of woven bone, cartilage, and total fracture callus were obtained directly in square millimeters from the software. The amount of mesenchymal tissue was then calculated by subtracting bone and cartilage area from the total callus area. Bone, cartilage, and mesenchymal tissue areas each were expressed as a percentage of total fracture callus. Osteoclast quantification was performed on the TRAP-stained slides. Using the 10\u00d7 objective, the perimeter of fracture callus was outlined and individual TRAP positive osteoclasts were identified and counted. The entire fracture callus was evaluated. The number of TRAP35S-labeled sense and anti-sense riboprobes as described previously , and collagen type X (Col X) were used to synthesize eviously . Cut seceviously . Emulsiot-test and analysis of variance (ANOVA) where appropriate. A value of p \u22640.05 was accepted as statistically significant.Data are expressed as mean \u00b1 SEM. Statistical significance was determined using the Student in vivo. Additionally, mice appear to be very tolerant to these Pb exposures. No gross physical or behavioral changes were noted in animals with BPb levels three to four times greater than a lethal human exposure, in preliminary experiments. There was no statistically significant difference by ANOVA testing in body weight among the various dose groups in unpublished preliminary experiments (data not shown).We established a reproducible murine Pb dosing protocol by introducing various concentrations of Pb into the drinking water of group A animals and determining BPb levels, similar to our rat exposure protocol . We noteBy 14 days after fracture, all animals showed radiographic evidence of fracture callus formation . HoweverConsistent with our radiographic findings, histologic analysis revealed no remarkable differences at 7 and 21 days because all fracture sites consisted of undifferentiated mesenchyme and fibrocartilage at the early time point and remodeling bone at the latter time point . In our In situ hybridization and TRAP staining in the 14-day fracture group helped assess phenotypic gene expression and quantify osteoclasts in the fracture callus, respectively  were exposed to 2,300 ppm Pb and analyzed radiographically and histologically. In contrast to the lower-dose treatment groups (group B), the radiolucency in the day-14 X rays was not accompanied by surrounding fracture callus  healed. Because it is well known that mice have an extremely robust ability to heal fractures, we speculate that mice healed fractures at Pb exposures at which humans could not.In this study, remarkable effects of Pb on fracture healing were clearly apparent, even at the lowest dose \u20135. The pin vitro studies (in situ osteoclast numbers (in vivo Pb exposure renders this possibility less likely.Although the precise mechanism by which Pb inhibits fracture-healing remains a topic for future investigation, the phenotype is very reproducible and is somewhat reminiscent of phenotypes described in other mouse models. The increased chondrogenesis observed is similar to that seen in the fracture callus of parathyroid hormone and prostaglandin-treated mice, indicating that Pb may be an agonist of protein kinase A signaling in chondrocytes, as predicted in our  studies . The lit studies . The sec studies . The thi studies , which i studies . An addi numbers , 5 and O numbers  are unafThe overall clinical significance of Pb inhibition of fracture healing relates to persons with osteoporosis. We have argued that because of the high environmental Pb exposures from the 1940s to 1960s, women currently going through menopause are at an additional risk of osteoporosis . It is n"}
+{"text": "The aim of this study was to investigate the effects of prenatal alcohol exposure on radial-maze learning and hippocampal neuroanatomy, particularly the sizes of the intra- and infrapyramidal mossy fiber (IIPMF) terminal fields, in three inbred strains of mice .Although we anticipated a modification of both learning and IIPMF sizes, no such effects were detected. Prenatal alcohol exposure did, however, interfere with reproduction in C57BL/6J animals and decrease body and brain weight (in interaction with the genotype) at adult age.Prenatal alcohol exposure influenced neither radial maze performance nor the sizes of the IIPMF terminal fields. We believe that future research should be pointed either at different targets when using mouse models for Fetal Alcohol Syndrome  or involve different animal models. In 1968, Lemoine et al. published a paper, in French, that described \"des anomalies dans les infants de parents alcooliques\"  followedSince then literally thousands of studies have been done and substantial advances in the understanding of FAS have been made, not in the least because of animal models, among them the mouse ,5. TheseThe aim of this study was to determine whether different genotypes with varying hippocampal anatomy are oppositely affected by similar exposures to prenatal alcohol. To this end, pregnant females of three highly inbred mouse strains, C57BL/6J, BALB/cJ, and DBA/2J, which vary in hippocampal anatomy e.g. ,10), wer, wer10])2 = 9.5, df = 2; p < 0.01).Table F2,96 = 5.0; p < 0.01). C57BL/6J made fewer errors than BALB/c  and DBA/2 . Treatment had no effect, neither alone, nor in interaction with strain. Figure F2,96 = 13.9; p < 0.001) with again C57BL/6 males differing from the other two strains .Figure F2,96 = 104.3; p < 0.001; brain weight: F2,91 = 86.1; p < 0.001). BALB/c weighed more than C57BL/6  and DBA/2 . The latter strain, in turn, weighed less than C57BL/6 . C57BL/6 males had higher brain weights than BALB/c  and DBA/2 . In addition, BALB/c had higher brain weights than DBA/2 . Prenatal exposure to alcohol affected both variables. Body weights were affected independently of the origin of the genotype  with mice exposed to ethanol prenatally weighing less than control  and pair-fed  animals. The effect on brain weight depended on the background of the strain . This interaction effect was mainly caused by the BALB/c strain where prenatal alcohol decreased brain weight , whereas no significant effects were seen in the other two strains.Body and brain weights are presented in Figures F2,73 = 8.0; p < 0.001), stratum lacunosum-moleculare , stratum radiatum , suprapyramidal MF  and IIPMF . DBA/2 showed a smaller regio inferior than C57BL/6  and BALB/c . C57BL/6 showed a larger stratum lacunosum-moleculare than DBA/2  and BALB/c  while BALB/c males had a larger stratum lacunosum-moleculare than DBA/2 males . C57BL/6 exhibited smaller stratum radiatum and suprapyramidal MF than DBA/2  and BALB/c . C57BL/6 showed larger IIPMF sizes than DBA/2  and BALB/c . BALB/c had larger IIPMF sizes than DBA/2 .The results of the hippocampal data are presented in Table Prenatal alcohol exposure did not affect any of the hippocampal variables, neither as main factor, nor in interaction with the background.These data demonstrate that, in three inbred strains of mice , prenatal exposure to alcohol does neither affect spatial memory nor hippocampal neuroanatomy. Prenatal alcohol exposure did influence body and brain weight in some strains and dramatically reduced live birth rates in C57BL/6 animals.A first caveat is, of course, the observation that the low number (2) of C57BL/6 pups prenatally exposed to ethanol precludes any strong conclusions for that strain. We still decided to include these animals in the present report because simple visual inspection of the data shows that even for these two lone survivors there is not even a trend towards any differences in behavior or hippocampal morphology, just as is the case for the other two strains. Of course, sample sizes are much more adequate for strains BALB/c and DBA/2, so that the conclusions based on those strains are much stronger.In short, our results on both behavior and neuroanatomy appear not to be in line with those, for instance, summarized in Berman and Hannigan , who conAnother explanation for the lack of an effect on learning might be that this type of radial maze is not sufficiently demanding and that other spatial learning tests would be more appropriate to detect prenatal alcohol effects. However, Wainwright et al.  did not Another striking result of this study is the low delivery rate of C57BL/6J females. Out of 13 pregnancies only one female gave birth to a viable litter. The other twelve pregnancies resulted in still-born pups, or the mother died while giving birth, or the pups were eaten by their mothers immediately after birth. Whether this finding reflects a higher sensitivity in developing C57BL/6J embryos to alcohol or higher blood alcohol concentrations in the mother or a combination of both cannot be inferred from these experiments. Although the only litter born might not be a representative sample, males from this litter appeared to perform equally well in the radial maze as their pair-fed and control counterparts; neither were the sizes of the IIPMF terminal fields affected.Summarizing, in this experimental design, which used three distinct inbred strains of mice, prenatal alcohol exposure influenced neither radial maze performance nor the sizes of the IIPMF terminal fields. We believe that future research should be pointed either at different targets when using mouse models for FAS  or involve different animal models, including zebrafish  or guineSubjects were male mice from the inbred strains C57BL/6J, BALB/cJ, and DBA/2J that are known to differ in their sensitivity to ethanol (e.g. ). The miEight days before mating, female mice of all three stains were habituated to alcohol solutions as their only source of liquid . Females were then mated with experienced males from the same strain and, throughout gestation, exposed to a 12% ethanol solution as their only source of liquid. Two control groups were included: first, a pair-fed group which consumed an isocaloric solution of dextrin (Amisol) and a same amount of food as consumed by the alcohol-exposed dams and, second, a control group which received food and tap water ad libitum. Although food and liquid consumption were not specifically measured, no obvious differences in consumption were noticeable. It has been shown that voluntary drinking paradigms lead to significantly elevated blood alcohol levels in pregnant females . PregnanAt the age of 3\u20134 months animals were tested in the radial maze. The 8-arm radial maze used in these experiments was similar to the original one used by Schwegler and Crusio . TheTwenty-four hours prior to the experiment animals were moved to the test room. Animals were habituated for 1 day and subsequently trained for 5 days. The habituation consisted of a 15-min exploration trial with free access to all arms but without a food reward. Immediately afterwards companion females were removed from the home cages and all experimental animals, now single housed, were deprived of food. During the training sessions animals were weighed daily and kept at 80\u201390% of their original body weight. In between sessions the maze was cleaned with a dry cloth. On the first two days, trials were terminated after 15 minutes or after the animal had eaten all rewards, whichever came first. Thereafter, no time limit was imposed and trials were terminated when animals had found all 8 food rewards. The situation of animals not eating all rewards occurred frequently on the first two days, but never on days 3 to 5. For this reason, data from days 1 and 2 were not included in the analyses. Previous experiments have shown that significant learning occurs very rapidly and that strain or mutational effects can reliably be shown with this method Two variables were sampled, one representing learning performance and the other running speed. Learning was measured by the number of errors while activity was depicted as the mean distance traveled (cm) per second. An error was counted if an animal entered an arm previously visited or did not eat the reward. Average running speed was estimated by dividing the distance traveled by the amount of time needed to complete a trial.Histological treatments were performed as previously described by Schwegler and Lipp  see alsoMethods used for visualization and measurements of the hippocampal terminal fields were similar to those described previously (e.g. ). Sampli2-tests the number of breeding pairs used (pairings), pregnancies, and births were compared for each strain. Pregnancies were compared relative to the number of pairings, and births relative to the number of pregnancies. The radial maze data of days 3 to 5 were analyzed using two-way repeated measures ANOVAs with strain and treatment as main factors. Both between subjects factors consisted of three levels . The hippocampal data were analyzed by means of two-way ANOVAs, both factors being identical to the above-mentioned analysis. When necessary, pair-wise comparisons were made using least square means. All ANOVAs were performed using the SAS GLM procedure.Using \u03c7FS participated in the interpretation of the data and drafted the manuscript, LJ carried out the radial maze tests and performed the histology, JYB participated in the design of the study and carried out the morphometrical analyses, and WEC conceived of the study, participated in its design, carried out the statistical analyses, and participated in the interpretation of data and drafting of the manuscript. All authors read and approved the final manuscript."}
+{"text": "Male C57BL/65 mice received a basal diet supplemented with 4% soya-bean oil, linseed oil or fish oil, in which the major polyunsaturated fatty acids were linoleic acid, alpha-linolenic acid and long chain omega-3 fatty acids, respectively. Groups of animals were injected into the right flank with EL4-lymphoma cells, others with thymoma cells. Tumour implantation caused a gradual decrease in food consumption with both types of tumour, while body weight increased, especially in the EL4-bearing animals receiving the soya-bean diet. The weight gain was due to body water accumulation and was accompanied by decreases in body fat and minor changes in carcass protein and ash contents. The dietary treatments did not produce significant differences in tumour incidence and mortality, but tumour size was decreased by diets supplying omega-3 fatty acids: in the EL4 mice tumour weight was markedly depressed by linseed oil, compared to soya-bean oil, whereas thymoma tumour weight was lowest in mice receiving fish oil and highest in the soya-bean oil group. Both types of tumour caused pronounced hypoglycaemia and hyperinsulinaemia in the hosts, and the effect was modulated by the diets in the EL4 but not in the thymoma animals: the plasma glucose level was especially low in the linseed oil group and relatively highest in the soya-bean oil treatment. The degree of hyperinsulinaemia depended on the diet only in the thymoma-bearing mice, with linseed and fish oils producing higher insulin levels than soya-bean oil. A slight hyperinsulinaemia was also observed in linseed and fish oil-fed control mice. Serum triglycerides were elevated in tumour-bearing animals, without consistent differences between dietary treatments. Although no clear pattern emerged concerning total cholesterol and LDL levels, HDL values were strongly affected by the type of oil: in the control animals linseed oil caused an increase in HDL-cholesterol compared to the other two oils. The thymoma-bearing mice responded to the linseed and fish oil diets with greatly elevated HDL-cholesterol levels. The results point to important differences in the responses of the two implanted tumours and hosts not only to the omega-6 and omega-3 fatty acids, but also to the type of dietary omega-3 fatty acids, namely alpha-linolenic acid and long chain fish oil polyunsaturated fatty acids."}
+{"text": "Due to cost and duration, relatively little is known about whether dietary polyphenols are beneficial in whole animals, particularly with respect to aging. To address this question, we examined the effects of blueberry polyphenols on lifespan and aging of the nematode, Caenorhabditis elegans, a useful organism for such a study. We report that a complex mixture of blue-berry polyphenols increased lifespan and slowed aging-related declines in C. elegans. We also found that these benefits did not just reflect antioxidant activity in these compounds. For instance, blueberry treatment increased survival during acute heat stress, but was not protective against acute oxidative stress. The blueberry extract consists of three major fractions that all contain antioxidant activity. However, only one fraction, enriched in proanthocyanidin compounds, increased C. elegans lifespan and thermotolerance. To further determine how polyphenols prolonged C. elegans lifespan, we analyzed the genetic requirements for these effects. Prolonged lifespan from this treatment required the presence of a CaMKII pathway that mediates osmotic stress resistance, though not other pathways that affect stress resistance and longevity. In conclusion, polyphenolic compounds in blueberries had robust and reproducible benefits during aging that were separable from antioxidant effects.The beneficial effects of polyphenol compounds in fruits and vegetables are mainly extrapolated from  Plants synthesize an array of chemical compounds that are not involved in their primary metabolism. These \u2018secondary compounds\u2019 instead serve a variety of ecological functions, ultimately to enhance the plant's survival during stress . In addiCaenorhabditis elegans, which has become a popular model for studying aging and longevity, due to its short 2- to 3-week lifespan, rapid generation time and experimental flexibility -enriched fraction from BB, could prolong adult lifespan and delay aging in Vaccinium angustifolium) or a C18 column fraction containing their bulk polyphenols, mean lifespan of wild-type animals was lengthened by 28% . Similar results were obtained using a crude extract of a different species of blueberry (Vaccinium asheii) (not shown).Adult wild-type animals grown under our standard laboratory conditions at 25 \u00b0C have a mean lifespan of 12.7 days and average maximum lifespan of 19.7 days. On media containing either crude BB extract . However, treatment with the PAC-enriched fraction increased lifespan to a similar extent as the starting BB polyphenol mixture or the remixed fractions , proanthocyanidins (PAC) or hydroxycinnamic esters, mainly chlorogenic acid (CA). Major components of each of these fractions have been shown to confer significant antioxidant activity and ATC can protect cells against oxidative stress in vitro . To deteongevity   animals, which have a mutation in the cytochrome b large subunit of mitochondrial complex II (mev-1(kn1) animals . Together, these gene expression analyses show that BB treatment did not cause a general induction of stress-response genes under normal growth conditions, but appeared to increase overall health, which may have promoted greater survival under thermal stress. However, we cannot rule out the possibility that BB polyphenol treatment may increase expression levels of stress-response genes during old age.We next considered the possibility that BB treatment acted as a mild stressor that induced expression of protective enzymes and this increased gene expression delayed aging  animals which lacked sir-2.1 gene activity, showing that BB polyphenols and resveratrol did not act through the same mechanism to increase C. elegans lifespan  animals, suggesting that BB polyphenols might act through osr-1 (sek-1(ag1) or unc-43(n1186) animals  and skn-1(zu67) animals, showing that BB may act independently of these genes (daf-16(mgDf50) animals . Interestingly, BB and ampicillin had additive effects on daf-16(mgDf50) lifespan, further supporting the conclusion that BB polyphenols do not act through simple antimicrobial effects  mutation, consistent with our finding that BB also did not protect wild-type animals against oxidative stress from paraquat or hydrogen peroxide treatments. In addition, we found that three stress-response pathways were dispensable for the beneficial effects of BB polyphenols upon lifespan. These pathways were represented by: (i) sir-2.1, which promotes longevity during calorie restriction, (ii) daf-16, which promotes longevity and stress resistance, and (iii) skn-1, which promotes oxidative stress resistance. Specifically, BB treatment was able to extend lifespan of animals lacking any of these three genes. In contrast, BB treatment did not prolong lifespan of animals with defects in the osr-1/unc-43/sek-1 pathway that promotes resistance to osmotic stress. One interpretation of this latter finding is that the effects of BB treatment are mediated, at least in part, through these genes. Alternatively, mutations in the osr-1 pathway could place animals under some stress that is not affected by BB treatment. To date, osr-1 pathway mutants have not been thought to suffer from different causes of death than wild-type animals, suggesting that the latter explanation is less likely. Therefore, we propose that BB exerts beneficial effects through interactions with the osr-1 pathway.By using in vitro. These findings may either show that (i) the antioxidant effects of these compounds in vitro are not relevant to their in vivo effects in this model, or (ii) differential bioavailability of these compounds is a major determinant of their effects in whole animals. Due to the structural diversity in these fractions, we did not attempt to directly measure the levels of polyphenols inside the animals. However, we did observe the accumulation of BB pigments (primarily ATC) inside the intestines of treated animals, leading us to conclude that components of BB extracts could enter the body of these animals. Our analysis showed that BB did not protect animals against oxidative stress from paraquat, hydrogen peroxide or genetic mutation [mev-1(kn1)], which increases superoxide production in vivo ; GR1307, daf-16(mgDf50); TK22, mev-1(kn1); VC199, sir-2.1(ok434); EU1, skn-1(zu67)/nT1; AM1, osr-1(rm1); AU1, sek-1(ag1); and MT2605, unc-43(n498n1186). Before analysis, the sir-2.1(ok434) strain was backcrossed twice against wild type.All strains were maintained at 15 \u00b0C on nematode growth medium (NGM) as described . StrainsVaccinium angustifolium) was applied to a preconditioned C18 column . The C18 column was washed with water to remove fructose, glucose and organic acids, which are abundant in blueberries, then with 100% methanol to obtain the total polyphenolic fraction. Methanol was removed under vacuum using a rotary evaporator  at 30 \u00b0C. To obtain the proanthocyanidin fraction, the total polyphenol fraction was dissolved in 50% ethanol and applied to a column of Sephadex LH20 , preconditioned with 50% ethanol. The column was washed with 60% ethanol until the eluant was colorless, and then with 70% aqueous acetone to elute the blueberry proanthocyanidins. To obtain the anthocyanin fraction, the total polyphenol fraction was dissolved in acidified water and washed four times with three volumes of ethyl acetate. Anthocyanins were partitioned into the water fraction, which was subsequently freeze dried. Pure chlorogenic acid  was used instead of blueberry chlorogenic acid since the chlorogenic acid fraction obtained from blueberry fractionation is contaminated with minor flavonol, and flavonol glycoside components. These components are all contained in the ethyl acetate fraction obtained during anthocyanin isolation.Commercially prepared single strength wild blueberry juice (fem-1(hc17), as the wild-type strain to avoid progeny overgrowth in lifespan assays. Therefore, eggs were shifted to 25 \u00b0C, the nonpermissive temperature for fertility of fem-1(hc17). Lifespan scoring was initiated after hermaphrodites completed the final larval molt, on the first day of adulthood. For aging assays with BB extracts, treatments were added to NGM agar plates on the first day of the lifespan assay. For lifespan assays with fertile strains, hermaphrodites were transferred daily for the first 4 days of adulthood to avoid progeny overgrowth. In these cases, all treatment plates were prepared on day 0 of adulthood. Statistical analyses and survival plots of lifespan data were performed with JMP analysis software . Pharynx pumping rates were scored on adults at room temperature (24 \u00b0C) under a Nikon SMZ1500 stereomicroscope .For aging assays, synchronous populations were obtained by allowing 5\u201310 hermaphrodites to lay eggs for 4 h to overnight. For ease of analysis, we used the adult sterile strain, fem-1(hc17) hermaphrodites at 25 \u00b0C as for aging assays, except paraquat was added to NGM medium to 10 mm final concentration . For hydrogen peroxide, we scored 5-h survival of adult day 5 fem-1(hc17) animals in S-basal medium with indicated concentrations of hydrogen peroxide.Thermotolerance assays were performed with hermaphrodites on adult day 5, after the majority of egg-laying had ceased. Animals were transferred onto 3-cm NGM agar plates supplemented as indicated and then incubated at 35 \u00b0C for 16 h. Survival was scored as the number of animals responsive to gentle touch as a fraction of the original number of animals on the plate. Animals that had died from dessication on the sides of the plate were censored. Paraquat-induced oxidative stress assays were performed with To determine lipofuscin levels, adult hermaphrodites were anesthetized in 0.2% sodium azide and mounted on 2% agarose pads for visualization of intestinal fluorescence on a Nikon E800 microscope using an Endow GFP filter with a mercury UV source (Nikon). Images were captured using a constant exposure time with a Hamamatsu ORCA digital CCD camera  using OpenLab software . Lipofuscin levels were measured using ImageJ software (NIH Image) by determining average pixel intensity in each animal's intestine.To measure levels of 4-HNE, animals were collected, fixed with 4% formaldehyde and permeabilized by digestion with type IV collagenase , as described . Fixed afem-1(hc17) animals were grown at an approximate density of 200 animals/plate in the presence or absence of 200 \u00b5g mL\u22121 BB polyphenols. Animals were kept at 25 \u00b0C except for heat-stressed samples, which were transferred to 35 \u00b0C for 2 h before collection and processing. Animals were washed from plates with cold M9 buffer into Eppendorf tubes, and allowed to settle on ice. The worm pellet was resuspended in 300 \u00b5L Absolutely RNA lysis buffer  and stored frozen at \u221280 \u00b0C. RNA was prepared as per kit instructions. Complementary DNA was prepared with the ProStar Ultra HF RT-PCR kit (Stratagene). Real-time PCR was performed in an MJ Research Opticon thermal cycler , using SybrGreen 2x master mix  with 1 \u00b5m primers and 0.5 \u00b5L cDNA in a 25-\u00b5L reaction volume using the following gene-specific primers (T04C12.6), GTGTGACGACGAGGTTGCCGCTCTTGTTGTAGAC (F) and GGTAAGGATCTTCATGAGGTAATCAGTAAGATCAC (R); hsp-12.6(F38E11.2), ATGATGAGCGTTCCAGTGATGGCTGACG (F) and TTAATGCATTTTTCTTGCTTCAATGTGAAGAATTCC (R); hsp-16.1(T27E4.8), GTCACTTTACCACTATTTCCGTCCAGCTCATCAACGTTC (F) and CAACGGGCGCTTGCTGAATTGGAATAGATCTTCC (R); hsp-16.49(Y46H3 A2), GCTCATGCTCCGTTCTCCATATTCTGATTCAAATGC (F) and GCAACAAAATTGATCGGAATAGAACGTGATGAG (R); and hsp-70(F44E5.4), CGTTTCGAAGAACTGTGTGCTGATCTATTCCGG (F) and TTAATCA ACTTCCTCAACAGTAGGTCCTTGTGG (R).For reverse transcriptase PCR (RT-PCR) analysis of gene expression,"}
+{"text": "The role of circulating complement in host defense and immune disease is well established. Although a number of cells and tissues are capable of synthesizing complement components locally, the importance of such local synthesis in immune disease has been difficult to establish.We used bone marrow transplantation (BMT) between C3 knockout (C3KO) and wild type (WT) mice to construct animals that were discordant for systemic (hepatic) and local (monocytic) C3 synthetic capacity. An immune complex glomerulonephritis (GN) was then induced using intraperitoneal injections of horse spleen apoferritin (HSA) with a lipopolysaccharide (LPS) adjuvant. All HSA/LPS animals developed a proliferative GN with glomerular infiltration by monocytes. By sensitive ELISA, monocyte C3 synthesis could be detected in C3KO animals transplanted with WT bone marrow cells. Despite this, there were no significant differences among groups of mice in measures of clinical  or histologic  disease severity.In this model of GN, local synthesis of C3 by infiltrating cells does not appear to be of pathologic importance. The complement proteins are major effectors of inflammation in glomerulonephritis, both in humans and in animal models. The bulk of complement deposited in the glomerulus in acute glomerulonephritis is presumed to come from the circulation, and is synthesized in the liver. This constitutes \u201csystemic\u201d complement synthesis.A variety of other cells, however, are capable of synthesizing complement components. Most of these are epithelial; we have shown that renal proximal tubule epithelial cells (PTEC) synthesize a variety of components in humans and mice Many glomerulopathies are characterized by a mononuclear cell infiltrate. It has been suggested that complement synthesized by these infiltrating cells could be an important mediator of glomerular injury interstitiumglomerulus has not been addressed. In the experiments reported herein, we employ a novel strategy by which animals deficient in C3 undergo hematologic reconstitution with bone marrow from C3 replete animals. This strategy makes it possible to separate the contribution of systemic (liver-derived) complement from that potentially produced by monocytes.Although we have reported several studies addressing the role of locally synthesized complement by tubular epithelium in the renal C57BL/6 mice, either wild type (WT) or homozygous C3 knockout (C3KO), were purchased from The Jackson Labs . The protocol was reviewed and approved by the Committee for the Humane Use of Animals at SUNY Upstate Medical University.4CL, 10 mM KHCO3 and 0.1 mM EDTA, pH 7.35). The BMC were washed, resuspended in DMEM, counted, and injected intravenously via a tail vein using a 26-gauge needle.Eight week old male mice were irradiated with 11 Gray, a lethal dose which is split into two half doses delivered four hours apart. Such a dose regime avoids a substantial amount of gut induced radiation disease, and minimizes gastric distress. To prevent death from nasal pseudomonas, twenty-four hours prior to, and for one week after irradiation, the animals were given tetracycline . On the day following irradiation, each animal received approximately four million bone marrow cells (BMC) that had been harvested by flushing the marrow cavity of femurs and tibiae of donor WT or C3KO mice with DMEM  supplemented with 1% fetal calf serum . The BMC were washed several times with PBS and then contaminating red blood cells were lysed with AKC buffer  were delivered by the same route three days per week as adjuvant. Each group of transplanted animals was composed of six male mice who were approximately 12 weeks old at the time of induction of glomerulonephritis. Additional groups of six WT and six C3KO animals  served as vehicle control groups and received 0.2 ml injections of 150 mM NaCl, IP, five days per week. All six groups of mice were injected by this protocol for a total of six weeks.The irradiated and transplanted animals were allowed to recover for 4 weeks, at which time immune complex glomerulonephritis was induced using a method we have described previously 2 narcosis. For 24 hours prior to euthanasia, they were placed in metabolic cages for collection of urine. Immediately after death, blood was obtained by vena cava puncture, and tissue was obtained from kidney and spleen. Some tissue samples were place in 10% buffered formalin. American Histolabs, Inc., , performed embedding, sectioning and staining with either hematoxylin and eosin, or periodic acid-Schiff (PAS) stain for histology. Additional tissue samples were quick frozen in M-1 embedding matrix  for immunohistochemistry.Nine weeks after starting injection, animals were euthanized by COA series of digital images representing the complete cortex from a periodic acid-Schiff-stained kidney section from each animal was collected with a SPOT Diagnostics camera , as we have previously described \u25aa Glomerular cellularity, defined as the total cells in ten representative glomerular cross sections.\u25aa Glomerular crescents, defined as two or more cell layers surrounding the glomerular tuft, in 50 glomeruli.o-phenylenediamine in PBS-glycerol.Frozen sections of kidneys were thawed slowly and washed with PBS, followed by incubation with either 10% normal goat serum (for C3c slides) or 10% normal rat serum (for CD14 slides) for 30 minutes at 37\u00b0C. Excess serum was blotted and the slides were incubated for one hour at 37\u00b0C with either goat anti-mouse C3c with a FITC label , or rat anti-mouse CD14 , both antibodies diluted in PBS. Slides were again washed with PBS, and the CD14 slides were incubated with goat anti-rat IgG\u2013FITC  for an additional 30 minutes at 37\u00b0C. Following incubation with antibodies, slides were washed with PBS and then mounted with 0.1% The concentration of C3 in the plasma was measured by Mouse High-Sensitive Complement C3 ELISA , following manufacturer's directions. For this double antibody sandwich ELISA, samples from WT background mice were diluted 1\u223650,000, and samples from C3KO background mice were diluted 1\u223650.The bone marrow transplantation process created chimeras that survived to undergo the injection protocol. Examination of peripheral blood smears and reticuloendothelial structures (spleen) of selected animals confirmed hematologic reconstitution .All animals receiving HSA/LPS developed proteinuria . There wIR/WT and WTIR/C3KO; All animals receiving HSA/LPS injections developed a proliferative glomerulonephritis (HSA/LPS treated mice are shown in IR/C3KO and WTIR/WT). On the other hand, when C3KO animals were reconstituted with WT bone marrow cells, detectable C3 was present in plasma, albeit at only a fraction (0.67%) of that found in WT animals. C3KO animals and C3KOIR/C3KO chimeras had C3 concentrations below 0.001 mg/ml, approaching the lower limit of the assay.Plasma C3 concentrations in the experimental animals are shown in Several lines of evidence support a role for the complement system in many forms of glomerulonephritis The liver is the source of most circulating complement. For several years, however, it has been appreciated that there is extrahepatic synthesis of a variety of components, both in humans and in experimental animals A number of published studies of extrahepatic complement synthesis have dealt with the kidney and monocytes. Renal complement synthesis was first demonstrated in lupus-prone (NZB) mice by Passwell and colleagues The role of this tubular complement synthesis has been examined in experimental animals, based upon observations in human disease. Chronic glomerulonephritis that progresses to ESRD is always accompanied by tubulointerstitial disease: peritubular edema, fibrosis, inflammatory cell infiltration, and tubular atrophy. We have employed experimental animals models to support an important role for such tubular complement component synthesis in tubulointerstitial disease IR/WT chimeras, similar to those we have employed, have suggested a role for local (presumably monocyte/macrophage-derived) C3 in the reticuloendothelial system in the immune response to viruses The in vivo role of monocyte-derived complement, specifically C3, has been studied much less. Studies in C3KOThe synthesis of monocyte C3 and other complement proteins could theoretically be important in the glomerular component of glomerulonephritis. Many glomerulonephritides, both in humans and in animal models, are characterized by monocytic infiltrate. In vitro, monocyte C3 synthesis is enhanced by stimuli such as cytokines Testing this hypothesis in intact animals would be difficult. The presence of circulating liver-derived C3 in plasma would make it impossible to establish the presence of what would likely be quantitatively smaller amounts of locally synthesized protein. Moreover, the known strong in situ hybridization signal from tubular C3 mRNA could overwhelm a weaker glomerular signal To overcome this problem, we employed the construction of \u201cchimeras\u201d, similar to work done by Verschoor et al. who studied the immune response to herpes virus IR/WT chimeric mice, they did not have immunohistochemical evidence of glomerular C3 deposition.As we have noted previously, the glomerulonephritis model we have employed resulted in marked glomerular hypercellularity. Using immunofluorescent techniques, we demonstrated that much of this hypercellularity is derived from infiltrating monocytes. Additionally, animals with wild type background had evidence of C3 deposition in their glomeruli. Our previous studies have also shown such deposits of C3 in the glomerulus, beginning at about three weeks after induction of glomerulonephritis IR/WT chimeric mice confirms this, although the concentration is unlikely to be physiologically important. Some workers have suggested a role for C3 synthesis by monocytes in local inflammatory conditions such as glomerulonephritis and transplant rejection As would be expected from the work of Drouin and colleagues First of all, immunohistochemistry for C3 in C3KO animals reconstituted with WT bone marrow cells shows no C3 glomerular deposition, despite active inflammation and trace C3 protein in infiltrating cells. Such experiments are critical to establishing this, since the strong C3 deposition in C3 replete (i.e. WT) mice would overcome any locally synthesized proteins.The other important observations relate to the severity of the histologic and clinical disease. There was no difference in two histologic markers of severity (glomerular cell counts and crescents) between C3KO and WT animals, regardless of whether they were reconstituted with WT or C3KO bone marrow cells. Furthermore, there was no difference among groups in proteinuria or renal function. The glomerular histology in these animals did not differ from our previously published observations in untransplanted animals It could be argued that, despite glomerular deposition in WT animals, C3 is not critical to the glomerular component of this model. As our previous studies have shown The rationale of these studies, however, was to develop a model that would permit differentiating the effect of systemic synthesis, activation and deposition of a complement component from that which is produced locally, in much smaller quantities and mediates its effects in the immediate microenvironment. Thus, our results suggest that in our specific model of immune complex glomerulonephritis, neither systemic nor locally synthesized C3 is critical to the glomerular inflammatory process. A similar bone marrow transplant strategy could be employed in other models in which the glomerular role of C3 appeared more critical.glomerular and monocytic C3. Our previous studies have suggested that the importance of locally synthesized complement is most likely in the tubulointerstitial component of inflammatory renal disease, where it is synthesized by the renal tubular epithelium Finally, it should be noted that the focus of these experiments was exclusively on These studies demonstrate the importance of examining intact animal models of disease, in addition to in vitro work, when considering the role of locally synthesized inflammatory mediators. Although monocytes clearly are capable of synthesizing the central protein of the complement cascade in response to inflammation, this ability does not appear to have an important role in vivo."}
+{"text": "The Cognitive Vulnerability Model holds that both clinical and sub-clinical manifestations of animal fears are a result of how an animal is perceived, and can be used to explain both individual differences in fear acquisition and the uneven distribution of fears in the population. This study looked at the association between fear of a number of animals and perceptions of the animals as uncontrollable, unpredictable, dangerous and disgusting. Also assessed were the perceived loomingness, prior familiarity, and negative evaluation of the animals as well as possible conditioning experiences.162 first-year University students rated their fear and perceptions of four high-fear and four low-fear animals.Perceptions of the animals as dangerous, disgusting and uncontrollable were significantly associated with fear of both high- and low-fear animals while perceptions of unpredictability were significantly associated with fear of high-fear animals. Conditioning experiences were unrelated to fear of any animals. In multiple regression analyses, loomingness did not account for a significant amount of the variance in fear beyond that accounted for by the cognitive vulnerability variables. However, the vulnerability variables accounted for between 20% and 51% of the variance in all animals fears beyond that accounted for by perceptions of the animals as looming. Perceptions of dangerousness, uncontrollability and unpredictability were highly predictive of the uneven distribution of animal fears.This study provides support for the Cognitive Vulnerability Model of the etiology of specific fears and phobias and brings into question the utility of the harm-looming model in explaining animal fear. Fear of animals is prevalent in many countries. In Australia, studies have found up to 40% of children suffer from fear of animals such as spiders and snakes  while inAlthough fears and phobias of dangerous animals may be readily understandable, fear of non-dangerous animals is poorly accounted for in the literature. However, Armfield  has arguThe Cognitive Vulnerability Model neatly explains two traditionally vexing questions regarding the characteristics of fears and specific phobias. First, why is it that some people fear a given stimulus when others do not, despite apparently similar learning histories? According to the Cognitive Vulnerability Model, it is the perceptions of a stimulus as uncontrollable, unpredictable, dangerous and disgusting which directly determine fear of that stimulus. While learning experiences may help shape these vulnerability-related perceptions they are not causal per se.The second question addressed by the Cognitive Vulnerability Model is what causes the uneven distribution of feared stimuli and situations in the population? Although the idea of biological preparedness , an inbuet al.[et al.[Some support for the Cognitive Vulnerability Model of the etiology of fear comes from a study by Armfield and Mattiske  which foet al. combinedl.[et al. found scet al.[Despite the consistency of the findings of Riskind et al.,20 with et al., the stuet al.. This anet al.,20. It iet al.[There is now an extensive body of research investigating the harm-looming model and the more recent extension dealing with looming maladaptive style ,22. Overet al., the finDemand characteristics may also affect the study by Riskind and Maddux , which aet al.[Another study taken to support the harm-looming model has been reported by Riskind and Maddux . Howeveret al. where thWhile the harm-looming model continues to attract considerable attention in the literature on the etiology of fear, several other theories and models are also prominent. Neo-conditioning theories of fear acquisition assume an important place for the concept of latent inhibition ,26 and hLatent inhibition is well documented in the animal conditioning literature, having been demonstrated with a variety of animals using a number of indices of conditioning . HoweverNon-experimental studies have also failed to find a strong relationship between prior familiarity and fear. Doogan and Thomas , for exaOne variable which is rarely studied in relation to fear is negative evaluation. It is possible that some animals are perceived negatively whereas other animals are seen more positively. The possible dimensions of evaluation are many. Animals might be seen as more or less ugly, intelligent, useless, soft, aggressive, desirable, spiteful, etc. Negative evaluation is a potentially important variable in fear research due to the possibility that many of the relationships found between fear and other variables are in fact spurious. If there is a relationship between fear and negative perceptions  of the feared stimulus, the finding of a relationship between, for example, fear and unpredictability may occur merely because unpredictability is perceived as a negative characteristic. For this reason there is a need to examine the relationship between fear and other variables after controlling for the potentially confounding effect of negative evaluation.Armfield and Mattiske  found stThe current study tested several hypotheses. First, it was predicted that each of the vulnerability variables  would be significantly positively correlated with subjective fear of a number of different types of animals. Second, it was hypothesised that the four vulnerability variables would account for a significant amount of the variance in fear of each of the animals beyond that accounted for by perceived loomingness and after controlling for gender, negative evaluation, and prior familiarity. Finally, it was proposed that perceptions of unpredictability, uncontrollability, dangerousness, and disgustingness across a number of animals would exhibit significant positive correlations with fear of those animals. That is, the Cognitive Vulnerability Model would be able to explain the uneven distribution of fear across a number of animals.SD = 7.6).A total of 162 first-year university students in Adelaide volunteered for participation in the study. Sixty-five subjects were male and 96 were female, with one subject not identifying his/her gender. The ages of all participants ranged from 17 to 47 with a mean of 22.9 years . One version investigated spiders, ducks, rabbits, and cockroaches while the other version used cats, snakes, rats, and guinea pigs. The two versions were used in order to reduce the amount of time required for completing the questionnaire. Participants were randomly allocated one of the two questionnaire versions.The variables measured were subjective fear, perceptions of dangerousness, disgustingness, uncontrollability, and unpredictability, loomingness, negative evaluation, familiarity, and learning history. All the variables were measured using self-endorsing items with possible response scores ranging from 1 to 7. Each item required a rating for all four animals used in each questionnaire. The internal reliability coefficients for each scale for each animal are given in Table None, and the values 2 to 7 assigned respectively to points on the scale described as Very Little, A Little, Some, Much, Very Much, and Terror. This scale has been extensively cited [Following Geer , the parly cited  and has ly cited .Perceptions of dangerousness were assessed using four questions. Two of these questions referred to the potential dangerousness of the animal while the other two questions measured the subject's perceived likelihood of actually being harmed. In an attempt to obtain a general measure of perceived dangerousness for each animal the questions either referred to situations where the specific breed or genus of the animal was unknown or were related to thoughts concerning the majority of these animals. The four items used to measure disgust in this study consisted of a short version of an eight-item scale employed by Armfield and Mattiske . This meet al.[et al.[Loomingness was measured using the five-item scale developed and employed by Riskind et al.. An examl.[et al. found a Participants were asked four questions designed to measure negative evaluations of each animal. These evaluation items were obtained from the Semantic Differential Scale developed by Osgood, Suci, and Tannenbaum . The fouConsiderable experience to No personal experience.Familiarity was assessed by asking the participants how much personal experience they had had with each animal, with responses ranging from None inflicted to Extremely serious) or degree of fear (No fear to Terrified). An option of Unknown was provided for ratings of mother's and father's fear.Six types of learning events were assessed, which may be classifiable as classical, vicarious, and informational conditioning experiences. These items required ratings of the worst harm/pain/illness ever inflicted on oneself, seen or heard about being inflicted upon another, the degree of mother's and father's fear, and the most fear ever seen being demonstrated by another person. This method of eliciting historical and experiential factors in the development of animal fears has been commonly used ,48. UnliEthical approval was obtained for the study and informed consent was obtained from the participants who were told that participation was voluntary, that they would not be individually identifiable and that they were free to both discontinue their participation at any time and to decline to answer any particular question. Participants were tested in a group format in a university setting and were given brief information regarding the questionnaire, being told that it concerned beliefs that may or may not be related to animals. In an attempt to reduce demand characteristics, the participants were not informed that the questionnaire related to fears of animals. In addition, items relating to uncontrollability, unpredictability, dangerousness, disgustingness, loomingness, negative evaluation, and familiarity were presented in a mixed order prior to the questions relating to fear and learning history.R correlations were used to assess the association between fear of each animal and the Independent Variables (IVs), including possible conditioning experiences. Two series of hierarchical multivariate regression models were constructed for fear of each animal. For one series, the cognitive vulnerability variables were entered as the last step, after controlling for perceived loomingness and other possible confounders. In the other series, perceived loomingness was entered as the last step after controlling for the cognitive vulnerability variables and other possible confounders. Statistical significance was assessed via the change in R2. Finally, aggregate data were used to determine the linear associations between the fear of animals and the various IVs. Because of the large number of analyses, the criterion alpha for rejecting the null hypothesis was set at 0.01 to reduce the risk of Type 1 error.Descriptive statistics were calculated for the fear, negative evaluation, perceptions of dangerousness, disgustingness, uncontrollability, unpredictability, loomingness, and familiarity associated with each of the eight animals. Pearson The descriptive statistics for the high-fear animals on all the measures are presented in Table None and Very Little on average. Of the low-fear animals, ducks were the most feared (mean = 1.67) while rabbits were the least feared. Guinea pigs were perceived as the most disgusting and unpredictable of the low-fear animals and were evaluated the most negatively. Ducks were rated as the most uncontrollable of the low-fear animals and cats obtained the highest rating of loomingness and dangerousness.As expected, all the low-fear animals were feared less than the high-fear animals Table . All feaAll the low-fear animals were rated as less dangerous, disgusting, uncontrollable, and unpredictable than the high-fear animals and were evaluated less negatively. Although the low-fear animals were rated as less looming than the high-fear animals there was little difference between cats  and cockroaches . Finally, although cats were rated as the most familiar of any of the eight animals, spiders  were rated as more familiar than the remaining low-fear animals, and cockroaches were rated as more familiar to participants than were guinea pigs.All of the vulnerability variables were significantly correlated with fear of each of the high-fear animals Table . UncontrPerceptions of loomingness were significantly, albeit moderately, correlated with fear of each of the high-fear animals Table . HoweverR correlations between fear and potential conditioning experiences for each animal. Overall, there were very few statistically significant associations. Only one association between fear of high-fear animals and possible learning experiences reached statistical significance, while no significant associations were evident for low-fear animals.Table In order to test the effects of the vulnerability variables on fear after controlling for the other variables, a series of hierarchical multiple linear regression analyses were conducted. For each animal, the vulnerability variables were entered as a block at Step 3, following the forced entry of gender and negative evaluation at Step 1 and loomingness at Step 2. Due to its non-significant effect on fear of most of the animals used in this study, Familiarity was not used in the regression equations. In addition to testing for the independent effects of the vulnerability variables on each animal, the independent effect of loomingness was also determined. Once again, a series of hierarchical multiple linear regression analyses were conducted, this time with gender and negative evaluation at Step 1, uncontrollability, unpredictability, dangerousness, and disgustingness at Step 2, and loomingness at Step 3. These analyses were done for each animal using fear as the DV. Because of the correlations between many of the variables, checks for multicollinearity were carried out as recommended by Tabachnick and Fidell . HoweverA summary of the full series of multiple regressions is given in Table R2 = 0.98) and uncontrollability (R2 = 0.94) while dangerousness and loomingness were also good predicators of fear  declare that they have no competing interests.JMA conceived, researched, performed the statistical analysis, and wrote this manuscript.1. I think that _____ would feel pleasant to touch.2. If I touched a _____ it would be important for me to wash my hands afterwards.3. I think that _____ are dirty or unclean animals.4. I would be revolted or disgusted if a _____ came into contact with my skin.1. I believe that I would be able to deal effectively with a _____ by myself when encountered.2. If a _____ was nearby I would not feel in control of the encounter.3. I do not believe that I would lose control over my actions in any way (e.g. panic or freeze) if a _____ came as rapidly as it could towards me.1. I find most _____ to be predictable in their movements.2. I think that the movement of _____ can be guessed in advance.3. I never know what a _____ is going to do.1. How potentially dangerous do you think that most _____ are to you?2. I believe that if I came into contact with an unknown _____ I would be harmed.3. I think that the majority of _____ are harmless to me.4. I think that if I encountered an unknown _____ I would not be harmed in any way.The pre-publication history for this paper can be accessed here:"}
+{"text": "This research was conducted on ten glass slides selected from the histopathology evaluation chickens. Five slides of control's chickens healthy and five slides of chickens infected experimentally with chicken anemia virus (CAV slide) between one and twenty-one days post infection (PI), they were analyzed in magnifications of 200\u00d7 and 400\u00d7. Histopathology showed severe bone marrow hypoplasia to complete aplasia, fully depletion of the erythrocytic and granulocytic series, both accompanied by space occupying adipocytic replacement. Foci of erythropoietic hyperplasia with intense mielopoietic activity, some hemocytoblast increased of size, with large nucleus. A quantitative analytical technique by Positive Pixel Count Algorithm was applied. It demonstrated that measures area stained of control slides were higher than CAV slides . So, the control slides showed strong positivity, due to the presence of bigger quantity of cells of erythrocytic and granulocytic series. The CAV slides of seven days PI had high positivity (average: 94%), it was explained because the chicken anemia virus takes place severe lesions between ten to seventeen days PI, after 21 days PI the cellular regeneration is observed that is evidenced by means of focuses of erythroblastoid cells hyperplasia. This technique demonstrates in a quantitative way the severe decrease of the cellular components of the bone marrow in presence of the infection for CAV, supporting with numeric data the histology image evaluated by the pathologist. Therefore, it can be used as support to the histopathology of field samples to evaluate the presence of lesions taken place by CAV and this way to improve the quality and efficiency of the veterinary pathology services. Chicken anemia virus (CAV) is a small, non-enveloped, single-stranded DNA virus, first isolated by Yuasa et al. 1979), a Gyrovirus, within the family Circoviridae 979, a Gy. The vir10 glass slides stained with H&E, selected of the histopathology evaluations of chickens. Five slides coming from chickens healthy controls and five slides coming from chickens infected experimentally with chicken anemia virus (CAV slide) between one and twenty one days PI, they were analyzed in m agnifications of 200\u00d7 and 400\u00d7.Positive Pixel Count is a multipurpose algorithm that measures area and intensity of staining for two-colored slides. Pixels are classified according to colour and intensity of staining. Pixel counts (area) are calculated for strong positive (Red), positive (Orange), weak positive (Yellow), and negative (Blue) pixels. This is useful for measuring positivity as a fraction of total stained area.Histopathology showed bone marrow with abundant cells of the erythrocytic and granulocytic series from chickens healthy controls Figure  and seveThe results demonstrated that the number of Strong Positive and Positivity (%) of control slides were higher than CAV slides . The control slides showed strong positivity, due to the presence of bigger quantity of erythroblastoid cells. The CAV slides of 7 days PI had high positivity (average: 94%), because the CAV produces the lesions but severe starting from the 10 days PI up 21 days PI, after the cellular regeneration is observed, being able to be evidenced by means of focuses of erythroblastoid cells hyperplasia.This technique demonstrated in a quantitative way the severe decrease of the cellular components of the bone marrow in presence of the infection for CAV, supporting with numeric data the histology image evaluated by the pathologist. Therefore, it can be used as support to the histopathology of field samples to evaluate the presence of lesions taken place by CAV in the farms and this way to improve the quality and efficiency of the veterinary pathology services."}
+{"text": "We have studied the motor abilities and associative learning capabilities of adult mice placed in different enriched environments. Three-month-old animals were maintained for a month alone (AL), alone in a physically enriched environment (PHY), and, finally, in groups in the absence (SO) or presence (SOPHY) of an enriched environment. The animals' capabilities were subsequently checked in the rotarod test, and for classical and instrumental learning. The PHY and SOPHY groups presented better performances in the rotarod test and in the acquisition of the instrumental learning task. In contrast, no significant differences between groups were observed for classical eyeblink conditioning. The four groups presented similar increases in the strength of field EPSPs (fEPSPs) evoked at the hippocampal CA3-CA1 synapse across classical conditioning sessions, with no significant differences between groups. These trained animals were pulse-injected with bromodeoxyuridine (BrdU) to determine hippocampal neurogenesis. No significant differences were found in the number of NeuN/BrdU double-labeled neurons. We repeated the same BrdU study in one-month-old mice raised for an additional month in the above-mentioned four different environments. These animals were not submitted to rotarod or conditioned tests. Non-trained PHY and SOPHY groups presented more neurogenesis than the other two groups. Thus, neurogenesis seems to be related to physical enrichment at early ages, but not to learning acquisition in adult mice. Interactions between an organism and its environment can lead to important neurobehavioral changes, and for several decades environmental enrichment  has been used to induce these changes in both intact and injured central nervous systems. The term \u201cenriched environment\u201d as an experimental process was introduced in the late 1940s by Donald Hebb The positive effects of environmental stimulation are not restricted to the cellular level, but also reach brain functioning. Behavioral studies have shown that exposure to enriched environments enhances memory capabilities in various tasks, particularly in spatial learning tests Although it is assumed that environmental enrichment enhances learning and memory, this is a general assumption taken from the observation that these housing conditions also improve spatial memory performance. Nevertheless, little is known from a quantitative point of view regarding the effects of environmental stimulation on other associative learning tests in which the hippocampus is also involved. To determine whether an enriched environment has consequences on associative learning tests similar to those previously described for spatial learning, we studied here the effects of different living conditions on classical eyeblink conditioning as well as on instrumental conditioning, two associative learning paradigms in which the hippocampus seem to be involved One week after arrival, 3-month-old animals were assigned randomly to one of the following four experimental groups: alone (AL), physical (PHY), social (SO), and social-physical (SOPHY). For the AL group, animals were placed in individual cages provided exclusively with the regular soft-wood mouse bedding. For the PHY group, animals were also placed in individual cages, but provided with a wheel, a tunnel, a ladder, a dummy mouse, and nesting material. For the SO group, animals were caged together , provided exclusively with mouse bedding. Finally, for the SOPHY group, animals were caged together (n\u200a=\u200a3 per cage), but in an enriched environment, as for the PHY group. Animals were maintained in this situation for 30 days before the beginning of the experimental tests. For experiments, a total of 20 animals per group were selected at random for the rotarod test. Those animals were further divided for classical (n\u200a=\u200a10 per group) and instrumental (n\u200a=\u200a10 per group) conditioning. At the end of the behavioral study, animals were prepared for the immunohistochemical study see .In addition, 1-month-old animals were divided into the same four groups (n\u200a=\u200a10 per group) and maintained for 30 days in the four types of environmental conditions. These animals were not used in any motor or learning test . After the 30-day period, these animals were directly prepared for the immunohistochemical study, without any additional manipulation or training.F\u200a=\u200a13.487; P<0.001; P\u200a=\u200a0.678) or between the AL and SO groups (P\u200a=\u200a0.246). By the 5th session, all PHY and SOPHY animals had already reached the selected criterion, whilst 42\u00b112.5% of AL and 54\u00b116.4% of SO mice reached criterion only during this session.The rotarod test is a behavioral task assessing motor coordination performance. F\u200a=\u200a13.487; P<0.01] larger (261\u00b145.3 s and 267\u00b154 s) than those collected from the AL and SO (79\u00b110.1 s and 114\u00b125.9 s) during the first session. The differences were still significant (P<0.01) during the 5th session between the PHY (380\u00b120.2 s) and the SOPHY (305\u00b160.5 s) versus the AL (255\u00b139.6 s) and the SO (270\u00b146.5 s) groups.With regard to the mean time spent on the rod during a session per group, the PHY and SOPHY groups presented values significantly  larger from the 2nd to the 10th conditioning sessions for the AL and PHY groups, and from the 5th to the 10th sessions for the SO and SOPHY groups, as compared with values collected during habituation sessions.In a second series of experiments, we carried out the classical conditioning of eyelid responses in the four  experimental groups  following the design illustrated in F\u200a=\u200a2.533; P\u200a=\u200a0.78]. Thus, neither physical nor social enrichments had any beneficial effect on animal performance during the classical conditioning test.Although the SO and SOPHY groups showed learning curves with lower values than those reached by the AL and PHY groups , no signF\u200a=\u200a138.551; P\u22640.002] larger from the 4th to the 10th sessions for the AL and PHY groups, and from the 7th to the 10th sessions for the SO and SOPHY groups, compared with values (considered as 100%) collected during the two habituation sessions.F\u200a=\u200a1.219; P\u200a=\u200a0.198] with respect to the slopes of fEPSPs evoked across conditioning sessions. According to these results, physical and social enrichments have no significant effects on the activity-dependent synaptic plasticity evoked at the CA3-CA1 synapse by classical eyeblink conditioning.In coincidence with what was described above for the percentage of CRs, the SO and SOPHY groups again yielded fEPSP curves with values slightly lower than those achieved by the AL and PHY groups. However, there were no significant differences between the four experimental groups . No significant differences were observed between the PHY and SOPHY groups (P\u200a=\u200a0.182) or between the AL and SO groups (P\u200a=\u200a0.517). In summary, physical, but not social, enrichment had a positive effect on animal capabilities of acquiring an instrumental task using a fixed-ratio schedule.F\u200a=\u200a3.495; P\u200a=\u200a0.016] difference between these four groups of animals 20 days after the BrdU labeling. Furthermore, the mean number of double-labeled NeuN-BrdU neurons was rather low: AL, 6.41\u00b10.59; PHY, 5.53\u00b10.88; SO, 3.35\u00b10.85; and SOPHY, 5.12\u00b10.82 (not illustrated). A possible explanation for this low number of double-labeled neurons, and for the lack of a significant effect of physical and/or social enrichment on dentate gyrus proliferation and survival of newborn neurons, is that these mice were too old at the time of the test (\u22486 months at the time of the immunohistochemistry).To determine putative changes in neurogenesis in the dentate gyrus of rotarod-trained and instrumental-conditioned animals , we developed an accumulative BrdU-pulse labeling . These animals were <3 months old at the time of immunohistochemistry. In this case, we obtained significant differences between groups. Firstly, no pycnotic nuclei were seen in BrdU-labeled cells in any of the experimental groups after the immunohistochemical processing. After DAB-Ni development, numerous BrdU-positive cells were observed in the subgranular zone in the PHY-n  and \u2014 esThe present study was designed to determine the effects of an enriched environment on motor performance and on different forms of hippocampal-dependent learning. We also studied whether there is a causal relationship between these types of learning and hippocampal neurogenesis. The results show that motor performance and instrumental conditioning are improved by the physical factors of the enrichment, but the retention of classically conditioned memories is not. Furthermore, the improvement of some forms of learning does not seem directly related with the increase of newly generated neurons in the dentate gyrus of the hippocampus, since increasing social interaction is able to modify the number of hippocampal new neurons without affecting the learning paradigms assessed here.Enriched environment usually includes increasing motor stimulation through access to running wheels. Several studies even indicate that this increased physical activity is a key factor of the enrichment, since the use of a wheel, without any other enriching element, is sufficient for regulating both learning and hippocampal neurogenesis Besides motor coordination performance, we also assessed two associative learning tests: trace classical eyeblink and instrumental conditionings. Although both paradigms are hippocampal-dependent, we found that physical enrichment has clear effects on operant conditioning abilities, without affecting the acquisition of classical conditioning of eyelid responses. Again, the social factor did not influence the learning processes. Taken together, spatial learning, rotarod, and instrumental conditioning are the learning paradigms in which acquisition is improved after exposure to enriched environments. According to these results, it can be hypothesized that only those forms of learning which require precise motor abilities are improved by an enriched environment. This is not the case of the classical conditioning of the eyelid responses, for which no special motor capacity is necessary.The question of whether newly born neurons in the dentate gyrus of the adult hippocampus participate in learning and memory has been discussed for years However, differences in the number of adult-born dentate gyrus granule cells became evident when the immunohistochemical study was carried out in younger, non-conditioned mice. In fact, it is well known that neurogenesis declines with age Enrichment can also include increased social stimulation through larger numbers of animals per cage. Although it was claimed that social interaction alone cannot elicit the cerebral effects of enriched environments ad libitum. Electrophysiological and behavioral studies were carried out in accordance with the guidelines of the European Union Council (2003/65/European Union) and current Spanish regulations  for the use of laboratory animals in chronic experiments. Experiments were also approved by the ethical committee of the local institution .Experiments were carried out on male C57Bl/6 mice obtained from an official supplier . Animals were 1 or 3 months old at the moment of arrival, weighing 17\u00b13 and 25\u00b12 g respectively. Before experimental manipulations, animals were housed in separate cages (n\u200a=\u200a10 per cage). All mice were kept on a 12/12 h light/dark cycle with constant ambient temperature (21\u00b11\u00b0C) and humidity (50\u00b17%). Food and water were available In this study, we used an accelerating rotarod treadmill for mice  were prepared as follows. Firstly, they were anesthetized with 0.8\u20131.5% isoflurane, supplied from a calibrated Fluotec 5  vaporizer, at a flow rate of 1\u20134 L/min oxygen  and delivered by a mouse anesthesia mask . Once anesthetized, animals were implanted with bipolar recording electrodes in the left orbicularis oculi muscle and with stimulating electrodes on the ipsilateral supraorbital nerve. Electrodes were made of 50 \u00b5m, Teflon-coated, annealed stainless steel wire . Electrode tips were bared of the isolating cover for 0.5 mm and bent as a hook to allow a stable insertion in the upper eyelid. In the same surgical step, mice were also implanted with bipolar stimulating electrodes in the contralateral (right) Schaffer collateral/commissural pathway of the dorsal hippocampus  was used for fEPSP recordings.Experimental sessions were carried out with three animals at a time. Animals were placed in separate small (5\u00d75\u00d710 cm) plastic chambers located inside a larger (30\u00d730\u00d720 cm) Faraday box. Both the electromyographic (EMG) activity of the orbicularis oculi muscle and fEPSPs were recorded with Grass P511 differential amplifiers , at a bandwidth of 0.1 Hz-10 kHz. A high-impedance probe  was presented as a conditioned stimulus (CS), whilst the unconditioned stimulus (US) consisted of a 500 \u00b5s, 3\u00d7 threshold, square, cathodal pulse applied to the supraorbital nerve 500 ms after the end of the CS . A totalDuring habituation and conditioning sessions, fEPSPs were evoked in the CA1 area by single 100 \u00b5s, square, biphasic (negative-positive) pulses applied to Schaffer collaterals 300 ms after CS presentation . Pulse iAt the end of the experiments, and in order to determine the location of hippocampal electrodes, mice included in this test were deeply re-anesthetized  and perfused transcardially with saline and 4% phosphate-buffered paraformaldehyde. Brains were dissected out, postfixed overnight at 4\u00b0C, and cryoprotected in 30% sucrose in PBS. Brain sections were obtained in a microtome  at 50 \u00b5m. Selected sections including the dorsal hippocampus were mounted on gelatinized glass slides and stained using the Nissl technique with 0.1% toluidine blue.A total of 10 animals per group were assigned for operant conditioning. Training and testing took place in basic Skinner box modules (n\u200a=\u200a3) measuring 12.5\u00d713.5\u00d718.5 cm . The operant chambers were housed within a sound-attenuating chamber (90\u00d755\u00d760 cm), which was constantly illuminated (19 W lamp) and exposed to a 45 dB white noise . Each Skinner box was equipped with a food dispenser from which pellets  could be delivered by pressing a lever. Before training, mice were handled daily for 7 days and food-deprived to 80% of their free-feeding weight. Shaping took place for 15 min during successive days, in which mice were shaped to press the lever to receive pellets from the food tray using a fixed-ratio (1\u22361) schedule. Animals were maintained on this 1\u22361 schedule until they reached the selected criterion \u2014 namely, until they were able to obtain \u226520 pellets for 2 successive sessions. Mice reached criterion after 4\u20137 days of training (see ref. 15 for details).Once criterion for the 1\u22361 schedule was reached, conditioning was carried out for 10 days using a fixed-interval (FI30s) schedule. For this, the first lever press carried out by the mouse after each period of 30 s was rewarded with a pellet. Each session lasted for 15 min. The start and end of each session was indicated by a tone  provided by a loudspeaker located in the recording chamber. Conditioning programs, lever presses, and delivered reinforcements were controlled and recorded by a computer, using a MED-PC program . Those animals were further used for the immunohistochemical study (see below).et al. 2006). In a first set of experiments we injected animals  that received instrumental conditioning. In this case, BrdU injections were carried out during the four days following the end of the experiments. These animals were maintained for 20 additional days in the same physical and environmental situation comprising the survival period after proliferation when the newborn cells develop differentiated phenotypes To determine cell proliferation and neurogenesis in the hippocampus of trained mice, a daily BrdU  pulse by intraperitoneal injection was administered for four days , using a freezing microtome (Leica), and were further processed for immunocytochemistry. For BrdU immunohistochemistry, sections were processed essentially as described In the case of classical conditioning experiments, EMG and hippocampal activities and one-volt rectangular pulses corresponding to CS and US presentations were stored digitally on a computer through an analog/digital converter , at a sampling frequency of 11\u201322 kHz and an amplitude resolution of 12 bits. Commercial computer programs  were modified to represent EMG and fEPSP recordings. Data were analyzed off-line for quantification of CRs and fEPSP slopes with the help of homemade representation programs For the rotarod test, collected data  were collected by computer and stored for off-line analysis Computed results were processed for statistical analysis using the Sigma Stat for Windows package . Unless otherwise indicated, data are represented by the mean \u00b1 s.e.m. Collected data were analyzed using a two-way ANOVA test, with time or session as repeated measure, coupled with contrast analysis when appropriate. One-way ANOVA allowed checking the statistical differences between different groups. Regression analysis was used to study the relationship between the fEPSP slope and the percentage of CRs."}
+{"text": "Caenorhabditis elegans. Here we review general principles of genetic screens in C. elegans, and use a modified binomial strategy to obtain a general expression for the number of mutagenized gametes examined in a genetic screen. We use this expression to calculate optimal screening parameters for a large range of genetic screen types. In addition, we developed a simple online genetic-screen-optimization tool that can be used independently of this paper. Our results demonstrate that choosing the optimal F2-to-F1 screening ratio can significantly improve screen efficiency.In genetic screens, the number of mutagenized gametes examined is an important parameter for evaluating screen progress, the number of genes of a given mutable phenotype, gene size, cost, and labor. Since genetic screens often entail examination of thousands or tens of thousands of animals, strategies for optimizing genetics screens are important for minimizing effort while maximizing the number of mutagenized gametes examined. To date, such strategies have not been described for genetic screens in the nematode  The identification of mutant animals is usually the first step in the genetic analysis of a biological process. In animals amenable to genetic study, such mutants are commonly identified by random mutagenesis, followed by screening for the trait under study. The mutation frequencies conferred by different mutagens in different organisms have been extensively documented Caenorhabditis elegans, typical mutagenesis regimens require isolation and examination of thousands of animals to approach saturation. Depending on the screening approach, examination of such numbers of animals can be quite labor intensive. In these situations, therefore, it is advantageous to identify optimal screening strategies that maximize the number of genomes screened, while minimizing the work involved. Indeed, as we show here, choosing a reasonable, yet suboptimal ratio of F2 to F1 animals, can double or triple the work involved in screening a given number of mutagenized F1 animals, as compared to screening using optimal parameters. Thus, suboptimal screen strategies may unnecessarily prolong screens, and use up excess reagents.For screens in the nematode C. elegans is not available. We therefore set out to develop a general algorithm for optimizing genetic screens in this organism. Here we examine such an optimization approach. We begin by reviewing the variables affecting the number of mutagenized haploid genomes needed to achieve saturation screening. We then derive a general expression, valid for most genetic screening approaches used in C. elegans, for counting the number of mutagenized F1 animals examined in a genetic screen. The expression we derive is, as we show, essentially independent of the total number of animals scored during the course of the screen, and is independent of variations in locus mutability. Although the number of mutagenized F1 animals is often approximated by the Poisson distribution, we demonstrate that for at least one major screen class, the Poisson approximation leads to large errors.Currently, a description of how to optimize genetic screens in F2-to-F1 screening ratio always exists for these screens, and that this ratio is dependent neither on the total number of animals scored, nor on the number of mutagenized gametes examined. Rather, the optimal screening ratio depends only on the type of mutation sought  and on the relative work involved in picking and scoring F1 and F2 animals. We use our results to delineate a simple algorithm for setting up and following the progress of genetic screens in C. elegans.Using the generalized expression described above, we solve optimization equations to maximize the efficiencies of two common genetic screen types. Our solutions reveal that an optimal C. elegans, our results can be simply extended to genetic screens in other organisms.Although valid for C. elegans). are exposed to a mutagen inducing mutations in sperm and oocytes C. elegans gene at an average frequency of one every 2,500 mutagenized P0 gametes The nematode P0 animals are allowed to self-fertilize, to produce F1 progeny. If mutations in either copy of a gene under consideration can be revealed in subsequent analysis, and if n F1 animals are examined, then the number of haploid genomes screened, defined as the number of P0 gametes examined, is given by 2n. More generally, however, the number of haploid genomes examined is given by a times n (an) where a takes on the value of either 1 or 2. For example, if a mutation in a gene of interest is suspected to be lethal or sterile, attempts to induce it on a marked chromosome, opposite a balancer chromosome, are often undertaken a\u200a=\u200a1.Next, F1 animal heterozygous for a mutation in a specific gene of interest is influenced by a number of parameters, and can often vary greatly from gene to gene. Thus, for example, smaller genes may be less likely to be hit by mutagen. Furthermore, some mutagens, such as EMS, preferentially alter certain nucleotides F1 animals to be screened is difficult, and screens are generally considered near saturation when multiple alleles of a given gene have been identified.Following mutagenesis, the probability of finding at least one Nonetheless, in many instances, assuming an average mutagenesis frequency can lead to useful estimates regarding screen progress, and deviations from these estimates can often hint at unique features of a gene, such as unusually large or small size F1 animal heterozygous for a mutation in a gene of interest among n F1 progeny of mutagenized P0 animals, assuming a\u200a=\u200a2, is 1\u2212\u2212. For common mutagenesis frequencies, the last term is exceedingly small and can be ignored without significant loss of accuracy. Thus, the probability of finding a heterozygous F1 animal, \u03c0(n), is given byF1 animals expected, on average, to carry a mutation in a gene of interest. As described above, r\u200a=\u200a1,250 for loss-of-function mutations obtained by EMS mutagenesis.The probability of finding at least one F1 animals should be examined, on average, to obtain at least one animal carrying a loss-of-function mutation in a gene of interest. For example, to achieve a 95% probability (\u03c0(n)\u200a=\u200a0.95) of obtaining an F1 carrier, we subtract 1 from both sides of equation (1), divide both sides by \u22121, take the logarithm of both sides of the equation, and rearrange to obtain n\u200a=\u200aln0.05/ln(1\u22121/r). For large values of r, as is the case for most mutagenesis regimes, ln(1\u22121/r)\u2248\u22121/r. We thus obtain the expression n/r\u200a=\u200a\u2212ln0.05, or n/r\u22483, a commonly used result , we can calculate how many a\u200a=\u200a1 (see example above) is more complex if the F1 animals, in which the mutation of interest is induced on the balancer chromosome, cannot be readily distinguished from those in which the mutation is induced on the marked chromosome, and we proceed as follows. Of a collection of n F1 animals, assume that q are heterozygous for mutations in a given gene. The odds that this is the case are given by the probability of obtaining q heterozygotes, (1/r)q, multiplied by the probability of the remaining n\u2212q F1 animals being non-carriers, (1\u22121/r)n\u2212q, multiplied by the number of ways such an arrangement can occur, given by the binomial coefficient q animals carries the mutation on the marked chromosome is given by 1\u2212(1/2)q, where (1/2)q is the probability that all q heterozygotes carry the mutation on the balancer chromosome. Thus, the probability that of n F1 animals, q are heterozygous for mutations in a given gene, and at least one of these q animals carries the mutation on the marked chromosome is F1 animal is present among the n F1 animals picked, we sum the individual probabilities for each value of q to obtainA similar calculation for n and r, equation (2) can be accurately approximated using the Poisson distribution > \u03c0a\u200a=\u200a1(n), a result illustrated in n) are plotted for values of n between 1 and 20,000, assuming r\u200a=\u200a1,250.For a given F1 animals must be sifted through to identify a mutant of choice. However, the question arises as to whether an optimal screening strategy, independent of locus mutability, might exist, and if so, what are its properties.The discussion of the previous section suggests that gene-to-gene variations in mutability make it difficult to predict precisely how many mutagenized F1 animals have been examined during a genetic screen. In this section and the following sections we make a distinction between the number of F1 animals picked for analysis, n, and the number of F1 animals whose mutation content has actually been examined, actn. If the mutation being sought is predicted to behave in a simple dominant fashion, then counting how many F1 animals were examined is trivial, and is precisely equal to the number of F1 animals picked, that is, actn\u200a=\u200an , (2), and (3) to obtain \u03c0(n).To begin to address this issue, we must first determine how many mutagenized =\u200an e.g.. Howeveractn, we begin by considering, as an example, a genetic screen in which all n F1 animals are picked to a single plate, from which m F2 animals are then scored for the mutant phenotype. We assume that all F1 animals produce approximately the same number of F2 animals. Indeed, for standard EMS screens in C. elegans, only about 5% of F1 animals have greatly reduced fertility, and fewer than 1% of F1 animals have reduced fertility using one common protocol for trimethylpsoralen and ultraviolet light mutagenesis . Furthermore, for many mutagenesis schemes, only healthy F1 animals are picked for subsequent screening, further reducing the number of animals producing low brood counts.To obtain a general expression for actn can be approximated fairly accurately in two limiting cases. First, we consider a screen in which m\u226bn. In this case, many F2 progeny have been scored for each F1 animal, making it very likely that the mutation content of all F1 animals has been established. Therefore, actn\u2248n.For such a screen design, n\u226bm. Here, the likelihood that two or more of the F2 animals scored derive from the same F1 animal is small. Thus, actn\u2248m(1\u2212p), where p, is the probability that a scored F2 has failed to reveal whether its F1 parent had the mutation of interest. In the case of simple screening schemes involving recessive mutations, p\u200a=\u200a3/4.Second, we consider the case for which F1 animals, F2 animals, or both, may fail to satisfy the limiting conditions considered above. To calculate actn for the general case of this example, we proceed as follows.Although these limiting cases have important uses, genetic screens that involve manually picking m scored F2 animals are represented q progeny of a particular F1 animal is given by the binomial termn)q is the probability of scoring q progeny of a particular F1 animal, (1\u22121/n)m\u2212q is the probability of the remaining scored F2 animals not being progeny of the particular F1 animal under consideration, and The probability that among the q scored F2 animals is informative about the presence of a mutation of interest in the particular F1 animal under consideration, is given by 1\u2212qp, where p is the probability of the F2 animal not being informative. Therefore, by analogy to the calculation in the previous section, the probability that at least one informative F2 progeny of a particular F1 animal is found among the m F2 animals scored is given byThe probability that at least one of the F2 to F1 animals, y\u200a=\u200am/n. It will become useful, therefore, to represent the functions B and P as functions of y and N\u200a=\u200an+m, the total number of animals picked in the screen. By making the appropriate substitutions we can rewrite these functions asIn this paper we aim to describe optimal genetic screening strategies, and are, in general, interested in the optimal screening ratio of F1 animals examined for possession of a mutation in a specific gene, then, is given byandactn/N as a function of log10y for a simple recessive mutation with p\u200a=\u200a0.75 and N\u200a=\u200a1000. As expected, for n\u226bm, actn/N is asymptotic to the curve m/(4N)\u200a=\u200ay/(4(1+y)) (red line). For m\u226bn, actn/N is asymptotic to the curve n/N\u200a=\u200a1/(1+y) (blue line). As is evident from the figure, for p\u200a=\u200a0.75, the asymptotic curves overestimate actn by only 5% or less for n and m such that y\u200a=\u200am/n\u22640.4 or m/n\u226512.2. However, in between these values, a very large error, that may exceed 100% of the true value of actn, can occur (not shown), justifying the more detailed analysis presented in this section. For large m and n, equations (7) and (8) are very closely approximated using the Poisson distribution  shows that actn/N is dependent on the value of N, m and n, actn/N becomes entirely independent of N, making actn/N useful for the analysis of most screens.p\u200a=\u200a0.75 are the most commonly sought mutations p\u22600.75. For example, if the F1 animals are heterozygous for a balancer chromosome and an unmarked homologous chromosome, such that animals homozygous for the balancer are dead, or easily identifiable, then p becomes 2/3\u200a=\u200a0.67 for a fully penetrant recessive mutation. As another example, dominant mutations that are rescued by a wild-type maternal genotype cannot be isolated in the F1 generation, but can be sought among F2 animals. For strictly dominant mutations of this type, p\u200a=\u200a0.25.Although fully penetrant recessive mutations for which p\u200a=\u200a0 occurs when F1 animals are heterozygous for a balancer and a marked chromosome, with the mutation of interest induced on the latter. In this case, only marked F2 animals are scored, and these should all be homozygous for the mutation of interest. The condition p\u200a=\u200a0 also holds for rare screens where dominant maternal-effect mutants are sought. In such screens, heterozygous F1 animals do not have the phenotype of interest, but all of their progeny do.The case p\u200a=\u200a0 arises frequently in genetic screens of haploid organisms. In this case, actn/N is a measure of the representation of an initial pool of mutagenized organisms in the progeny that have been examined.The condition actn/N vs. log10y for a number of possible values of p. The curves agree with the expectation that the more informative an F2 animal is about the mutation state of its F1 parent , the fewer F2 animals must be examined to achieve a specific value of actn/N.In F1 animals are placed on a single plate, from which F2 progeny are sampled. However, usually, it is necessary for F1 animals to be placed individually, or in groups, on multiple plates. F2 animals are then drawn from each plate. Individual plating of F1 animals is a particularly common scheme that is utilized if the expected mutation is lethal, and heterozygous F2 siblings need to be recovered, or in a situation where males are present in the population and mating between F1 animals must be avoided. Should F1 plating strategy affect actn? Consider the case where single F1 animals are placed on individual plates, and equal numbers of F2 progeny are drawn from each plate. Because we know for certain that in such a scheme F2 animals scored are derived from every F1 animal picked, it is predicted that for a given y, actn should be greater than in a scheme in which all F1 animals were plated on a single plate, where some F1 animals may not be sampled in the F2 generation. Thus, for the same number of F1 and F2 animals, actn will indeed be dependent on plating strategy.The analysis described in the preceding two sections holds for the specific case in which all actn explicitly, we let \u03bd equal the number of F1 animals picked to a plate, and \u03bc equal the number of F2 animals scored per plate. In general, \u03bd and \u03bc can be different for every plate. F1 animals examined on the ith plate, is given, as in equation (8), byactn/N, is, therefore, obtained by summing the actual number of F1 animals examined over all plates, orTo calculate the general expression for F1 and F2 animals are plated and scored per plate. In this case, \u03bdi, \u03bci, and \u03b2 are identical for each plate, and equation (13) can be written ask is the number of plates examined.Equation (13) is valid for essentially every type of genetic screen, involving any plating strategy. The equation can be significantly simplified if we assume that the same number of y as follows. To express \u03bc as a function of y we note that y\u200a=\u200am/n\u200a=\u200ak\u03bc/(k\u03bd)\u200a=\u200a\u03bc/\u03bd. Rearranging terms yields \u03bc\u200a=\u200a\u03bdy. Also, k\u03bd/N\u200a=\u200an/(n+m)\u200a=\u200a1/(1+m/n)\u200a=\u200a1/(1+y), yieldingEquation (14) can be expressed in terms of F1 animal/plate, equation (15) can be reduced toF1 animals on the same plate, \u03bd becomes n, and \u03b2 becomes B, as in equation (8).Four points regarding equation (15) are of note. First, for the common plating strategy of one N, is not well-approximated by the Poisson distribution if a small number of F1 animals is plated per plate, which is generally the case for clonal screens. In actn/N by using the Poisson approximation for different values of p for the case of one F1 animal per plate. Note that for p\u200a=\u200a0.25, the error can be nearly 30% off the exact value. Indeed, it can be shown that the fractional error, [(actn/N)exact\u2212(actn/N)Poisson]/(actn/N)exact, plotted in p\u2212ep\u22121)(/(p\u22121) as y\u21921  and (8), equation (15), even for large  y\u21921 see .actn/N is independent of N, although for a given N only values of \u03bc+\u03bd that are divisors of N are possible.Third, equation (15) reveals that N, the larger the number of F1 animals per plate (k\u00d81), the better is equation (15) approximated by equation (10). Simulations for different ratios of n to k reveal that for n/k\u226530 equation 10 gives an excellent estimate of actn .Fourth, for a given C. elegans. In general, a measure of screen efficiency should take into account the amount of work performed in a screen as well as the total number of mutagenized F1 animals examined, actn. Work can be defined in a number of ways. Here, we will generally define work as the amount of time spent picking and scoring animals. Alternatively, work can be a measure of the total amount of reagents needed for the screen, etc., and much of the analysis that follows would still be valid using this definition. Regardless of the precise definition of work used, the work expended in a screen must be of the form \u03b3n+\u03b1m, where \u03b3 and \u03b1 represent work per animal and have values between 0 and \u221e. If we measure work in such a way that \u03b3\u200a=\u200a\u03b1\u200a=\u200a1 defines a unit of work, we can write the total work expended as W\u200a=\u200a\u03b3n+\u03b1m. Given this definition, we now propose to define the efficiency of a genetic screen asF1 animals examined per unit of work. As we will demonstrate below, this definition allows us to make quantitative estimates of the optimal screening ratio, y, for use in a broad range of genetic screen types.The results described in the previous sections provide us with the appropriate tools to consider how to optimize genetic screens in F1 and pick and score F2 animals, we define \u03b3\u200a=\u200a\u03b1\u200a=\u200a1; then, W\u200a=\u200aN, and \u03b5\u200a=\u200aactn/N, which is the parameter we have used throughout this paper  that a maximum indeed exists for every value of \u03b3 and \u03b1>0.We can now pose the optimization problem for genetic screens as follows: what is the actn as a function of log10y for three different values of W where \u03b3\u200a=\u200a\u03b1\u200a=\u200a1. The minimal amount of work, minW, required to screen 5,000 mutagenized F1 animals, reqn\u200a=\u200a5,000, occurs at W\u200a=\u200a37,642. Values of W smaller than this will never achieve reqn, while values of W greater than 37,642 do not minimize W, by definition. We can therefore formulate the following general criteria: minW is the value of W satisfying the two conditions, actn\u200a=\u200areqn. Although these equations can be numerically solved for the general case represented by equation (13), we restrict our analysis below to the two most common screen cases for which either equations (10) or (16) are valid.Consider F1 animals on a single plate or on a small number of plates relative to the total number of F1 animals examined, we can use the Poisson approximation to write the efficiency of a screen as:For genetic screens involving plating all y and set the result equal to 0 to obtain the following transcendental equation for maxy, the optimal F2-to-F1 screening ratio:We differentiate this equation with respect to maxy is only dependent on the relative values of \u03b3 and \u03b1. Thus, the optimal screening ratio, maxy, is independent of the absolute work expended to pick and pick and score F1 and F2 animals, respectively.Two features of this equation are of interest. First, the equation cannot be solved analytically, and must be evaluated numerically. Second, and more importantly, the value of maxy always exist? Inspection of equation (19) reveals that it is of the general form x\u200a=\u200aln(a+x), where x\u200a=\u200ay(1\u2212p), and a is always greater than 1. Consider the range of possible values of x, from 0 to \u221e. At x\u200a=\u200a0, the left hand side of the preceding equation is always smaller than the right hand side (lna). As x\u2192\u221e, ln(a+x)\u2248ln(x), and thus the right hand side of the equation is always smaller than the left hand side. Since both x and ln(a+x) are continuous functions, these observations mean that there always exists an intersection point of the functions x and ln(a+x), defining maxy. Therefore, maxy exists for all values of \u03b1 and \u03b3. Differentiation of \u03b5 twice with respect to y shows that maxy, guaranteeing that maxy indeed represent a global maximum of \u03b5.Does maxy into equation (18) yields \u03b5max for given values of \u03b1 and \u03b3. max for a range of values of \u03b1 and \u03b3 and for different values of p. As expected, the smaller the values of \u03b1 and \u03b3, the larger is \u03b5, and the more efficient the screen.F1 animal per plate, the Poisson approximation cannot be used (see above), and instead we use equation (16) to write the efficiency of a screen as:For genetic screens involving plating one maxy:As above, we differentiate equation (20) to obtain the following transcendental equation for y. However, the value of y obtained here cannot be used directly to compute maxy or to calculate \u03b5max, for two reasons. First, unlike the previous section, y cannot be treated as a continuous variable here, and the maximum calculated in equation (21) makes this assumption. Second, y can only take on integer values \u22651. Thus, to identify maxy, we numerically calculate the solution to equation (21). We then check whether the obtained value of y is smaller than 1. If so, then maxy\u200a=\u200a1. If not, we calculate the efficiency of screening, using equation (20) for the two nearest integer values of y, and choose maxy as the value giving the highest value of \u03b5. The results of these calculations for \u03b5max and maxy are presented in Similar reasoning to that of the previous section guarantees the existence of a solution for W, to the minimal work, minW, calculated using equations (17), (18), and (19), as a function of m/n, for a screen in which scoring and picking F2 animals requires ten times more work than picking F1 animals (\u03b1/\u03b3\u200a=\u200a10). Such parameters are often encountered, and may serve as a model for screens in which F2 animals need to be examined individually on a compound microscope, for example. As the figure demonstrates, relatively small deviations in the screening ratio can have a large impact on the amount of work carried out to screen the same number of mutagenized F1 animals. For example, screening five F2 animals for every F1 parent for recessive mutations nearly doubles the work required to screen the same number of mutagneized F1 animals compared to the optimal screening ratio of 0.86. The differences are even more dramatic when dominant mutations are sought.In C. elegans.These results clearly show that using optimized screen parameters can have a significant impact on the progress and output of genetic screens in C. elegans. We demonstrate two key points. First, an optimal screening strategy always exists for every genetic screen of the types considered here. Second, calculation of this optimal strategy is possible. F2-to-F1 screening ratios for a large range of screen parameters. As shown in F1 animals and picking and scoring F2 animals; and when the mutations sought manifest themselves in the F2 population in increased proportion ), that is valid for a large number of genetic screens. Fourth, we demonstrate that two limiting cases of this equation, in which a large number of F1 animals are placed on a small number of plates, or in which F1 animals are plated individually, yield simplified equations (equation (10), based on the Poisson approximation, and equation (16)), that are well known and of considerable practical use. Finally, analysis of these limiting cases also reveals that the number of mutagenized F1 animals examined is dependent on the mode in which F1 animals are plated. In general, we show that plating F1 animals individually, followed by scoring their F2 progeny, allows more mutagenized F1 animals to be examined than plating the same number of F1 animals on a single or small number of plates. However, it should be noted that because plating F1 animals individually can be more time consuming and may require more reagents, the overall screen efficiency may or may not be higher using this strategy (see below).In addition to the key results discussed above, we have also derived a number of other useful results. First, we have shown that the optimal screening strategy does not depend on the total amount of effort expended in a screen, but only depends on the ratio of the work involved in picking C. elegans can be divided into three general categories, based on the difficulties involved in picking F1 animals  and (16), can be used to determine actn and follow screen progress.Picking F1 animals is much harder than picking F2 animals (\u03b1/\u03b3\u21920). As shown in F2 animals should be scored for each F1. As we showed in the beginning section of the paper, under such conditions actn\u2248n, and screen progress is limited by the number of F1 animals that can be examined.Picking F2 animals is much more difficult than picking F1 animals (\u03b1/\u03b3\u2192\u221e). F1 animals picked should be much greater than the number of F2 animals scored. Under these conditions, actn\u2248m(1\u2212p), and progress is determined by the type of mutation being sought , and by the number of F2 animals screened.Picking/scoring actn) is very simple and does not depend on plating strategy. Screens of type I, however, require a more detailed study of the screen and plating parameters.The merits of the classification system described above are that it allows a quick determination of whether an in-depth analysis of screen parameters is required to follow screen progress. Specifically, for screens of types II and III, calculating screen progress . The table illustrates a number of points. First, it provides estimates of the amount of work expended for each screen. Although the table provides exact numbers, it is important to note that these numbers only approximate the actual work involved because some of the parameters used in calculating the work, such as \u03b1 and \u03b3, may not be exact. Second, it provides specific applications of the different screen strategies to common screens undertaken in C. elegans. Third, the table demonstrates that strategies that minimize both \u03b1 and \u03b3 are, as expected, most efficient , of screens of type II approaches 1/\u03b3, whereas the efficiency of screens of type III approaches (1\u2212p)/\u03b1. Thus, if one is debating between screening strategies of type II and III where \u03b3(type II)\u2248\u03b1(type III), screens of type II will always be more efficient.Interestingly, examination of F2-to-F1 screening ratio. Indeed, as equations (19) and (21) show, only the ratio of \u03b1 to \u03b3 is relevant. It turns out, however, that even an exact measurement of this ratio is not needed in practice. The reason for this is shown in F2-to-F1 screening ratio by two orders of magnitude . Thus, the screening ratio is not very sensitive to variations in \u03b1 and \u03b3. This observation is of clear practical importance, since it is not always easy to precisely compare the work involved in picking F1 animals and picking and scoring F2 animals. These results suggest that order-of-magnitude estimates of the relative work involved will give good estimates of the appropriate screening ratio.As we describe in the Results section, precise values of \u03b1 and \u03b3 are not important for calculating the optimal F1 animals and pick and score a fixed number of F2 animals. Each work segment is then divided, respectively, by either the number of F1 or F2 animals to obtain \u03b3 and \u03b1, respectively. Values for these parameters can also be adjusted as a screen proceeds, based on estimates derived from earlier stages of screening.In C. elegans can follow a simple set of rules. In F1 animals will be plated onto individual plates  or onto a small number of plates (bulk). This choice is usually not driven by efficiency, but by constraints of the screen. For example, screens that require a clonal strategy, because the identity of the F1 parent is important , demand plating F1 animals individually.Our results suggest that the design of many types of genetic screens in F1 parents, and for which F2 animals must be picked to individual plates for scoring , and these are used to identify the optimal F2-to-F1 screening ratio (\u200a=\u200am/n)  . From thhttp://b5.rockefeller.edu/cgi-bin/labheads/shaham/genetic_screens/screenfrontpage.cgi\u201d.To aid with the calculations described here, in C. elegans, and calculated optimal F2-to-F1 screening ratios for a large range of screen parameters. Calculation of these parameters was aided by obtaining a general expression for counting the number of mutagenized gametes examined in the course of a genetic screen. The strategies described here can, in principle, be applied, with relevant modifications, to the evaluation of equivalent parameters in genetic screens in other organisms.We have presented a systematic approach for optimizing genetic screens in m and n,m and n, we simplify the expression above toIn this paper, we employ expressions of the following formf\u200a=\u200a[(actn/N)exact\u2212(actn/N)Poisson]/(actn/N)exact. Using equations 10 and 16, the fractional error is written asy approaches 1, this expression, therefore becomesThe fractional error in using the Poisson approximation is defined as"}
+{"text": "The cerebellum in transgenic mice expressing pseudorabies virus immediate-early protein IE180 (TgIE96) was substantially diminished in size, and its histoarchitecture was severely disorganized, resulting in severe ataxia. TgIE96 mice can therefore be used as an experimental model to study the involvement of cerebellar circuits in different learning tasks. The performance of three-month-old TgIE96 mice was studied in various behavioral tests, including associative learning , object recognition, spatial orientation (water maze), startle response and prepulse inhibition, and passive avoidance, and compared with that of wild-type mice. Wild-type and TgIE96 mice presented similar reflexively evoked eyeblinks, and acquired classical conditioned eyelid responses with similar learning curves for both trace and delay conditioning paradigms. The two groups of mice also had similar performances during the object recognition test. However, they showed significant differences for the other three tests included in this study. Although both groups of animals were capable of swimming, TgIE96 mice failed to learn the water maze task during the allowed time. The startle response to a severe tone was similar in both control and TgIE96 mice, but the latter were unable to produce a significant prepulse inhibition. TgIE96 mice also presented evident deficits for the proper accomplishment of a passive avoidance test. These results suggest that the cerebellum is not indispensable for the performance of classical eyeblink conditioning and for object recognition tasks, but seems to be necessary for the proper performance of water maze, prepulse inhibition, and passive avoidance tests. Varicellovirus of the subfamily AlphaherpesvirinaePseudorabies virus is classified into the genus Pseudorabies virus expresses a single immediate-early protein, IE180, consisting of 1460 amino acid residues Based on these findings, we had hypothesized that expression of pseudorabies IE180 would cause the developmental neurological abnormalities in host animals without viral infection and replication. In fact, we previously found that transgenic expression of IE180 in two months old mice caused severe ataxia and cerebellar defects, such as size reduction and disorganized lamination, without any abnormality in other parts of the brain such as hippocampus and cerebral cortex Accordingly, we used TgIE96 mice here as an experimental model to study the involvement of cerebellar circuits in different learning tasks. Classical conditioning of eyelid responses was carried out in wild-type and TgIE96 mice, using both trace and delay paradigms ad libitum access to commercial mice chow and water. All the experiments were carried out during the light cycle and according to EU (2003/65/CE) and Spanish  guidelines for the use of laboratory animals for chronic behavioral experiments. All experimental protocols were also approved by the Ethics Committee of the Pablo de Olavide University (07/4-20/12/2008).Experiments were carried out on male TgIE96 mice and on wild-type littermates having a C57BL/6 genetic background, obtained from the Laboratory of Biomedicine Center of Biomedical Research, Kyushu University . Animals were three months old upon their arrival at the Animal House of the Pablo de Olavide University , and were kept on a 12-h light/dark cycle with constant temperature (21\u00b11\u00b0C) and humidity (50\u00b17%). Animals were allowed Under deep anesthesia , animals were implanted with four electrodes in the upper eyelid of the left eye. Electrodes were made of Teflon-insulated, annealed stainless steel wire . One pair of electrodes was aimed at the supraorbitary branch of the trigeminal nerve, and served for the presentation of electrical stimuli. The second pair of electrodes was implanted in the ipsilateral orbicularis oculi muscle, and served for recording its electromyographic (EMG) activity. The four electrodes were connected to a 4-pin socket  which was fixed with dental cement to the cranial bone. For a week after surgery, animals were kept in independent cages, with free access to food and water, for a proper recovery before the beginning of the experiment. They were maintained in individual cages for the rest of the experiment.For classical conditioning of eyelid responses, animals were placed individually in a (5 cm \u00d715 cm \u00d715 cm) plastic chamber, inside a larger Faraday box (30 cm \u00d730 cm \u00d720 cm) to eliminate electrical interferences. Both trace and delay conditioning paradigms were carried out . For this, animals were presented with a tone  as a conditioned stimulus (CS), followed 250 ms from CS onset by an electrical stimulation  as an unconditioned stimulus (US). Intervals between paired CS-US presentations were separated at random by 30\u00b15 s. For habituation and extinction sessions, the CS was presented alone, also at intervals of 30\u00b15 s. A total of two habituation, five conditioning, and four extinction sessions  were presented to each animal across eleven successive days. Only the first fifty trials of each session were analyzed. An additional group of wild-type animals (n\u200a=\u200a8) were pseudoconditioned to test the reliability of the task. For pseudoconditioning, unpaired CS and US presentations were carried out for 5 sessions . Pseudoconditioned animals also received two habituation and five extinction sessions as indicated above The EMG activity of the orbicularis oculi muscle was recorded using differential amplifiers with a bandwidth of 1 Hz to 10 kHz . Data were stored directly on a computer through an analog/digital converter , at a sampling frequency of 11\u201322 kHz and an amplitude resolution of 12 bits. Data were analyzed off-line for quantification of conditioned responses (CRs) with the help of the Signal Average Program . We considered a response to be conditioned when the rectified EMG activity, during the CS-US period, presented the following conditions: i) the EMG activity lasted >10 ms; ii) the EMG was not preceded by any spontaneous activity in the 200 ms preceding CS presentation; iii) the EMG activity was initiated >50 ms after CS onset; and iv) the integrated EMG activity was at least 2.5 times greater than the activity recorded 200 ms before CS presentation For the object recognition task, all the animals (n\u200a=\u200a10 per group) were individually habituated to an open field (40 cm \u00d725 cm \u00d715 cm), under low illumination conditions, and with no objects, for 5 min. During the training session, two unknown but identical objects (O1 and O2) were placed into the open field, and the animals were allowed to explore them freely for 10 min. The time spent exploring each object and the total approach time were quantified. After each trial, the apparatus and the objects were thoroughly cleaned with 70% ethanol to avoid odor recognition. One hour after the first training, mice were allowed to explore the open field for another 10 min, when one of the two familiar objects (O1 or O2) was replaced by an identical object (O3), and the other (O1 or O2) by a novel object (B1). The time spent exploring each object and the total approach time were quantified again. Within each experimental group, the object O1 was replaced by the new object for half of the animals, whereas object O2 was changed for the other half. The aim was to avoid any issue related to spatial preference associated, or not, with the location of the two objects. Twenty-four hours after the initial training, mice were tested again, with a new object (C1) and an object identical to the old one (B2). The same procedure was carried out 72 h after the initial training  unless the animal reached the platform in a shorter time. The time taken by the animal to reach the hidden platform was quantified. If an animal failed to find the platform within 60 s, the test was ended and the animal was helped to reach the platform by hand. In either case (whether it reached the platform by itself or not), the mouse was maintained on the platform for 30 additional seconds. The time spent on reaching the platform was recorded on-line, and its percentage with respect to the time limit (60 s) was computed.The different parameters of the startle reflex and the prepulse inhibition tests were assessed in both wild-type and TgIE96 mice (n\u200a=\u200a10 wild-type and 9 TgIE96). Animals were placed individually inside a startle chamber . The startle response was measured using a piezoelectric accelerometer controlled by a computer, using the protocol described elsewhere Experiments were carried out in a passive avoidance device . In accordance with procedures described elsewhere Data collected from classical conditioning experiments were quantified, through a purpose-designed Excel worksheet, as the percentage of CRs per session \u2013 i.e., the proportion of paired CS-US stimulations within a session of 50 presentations that generated an EMG activity satisfying the above-mentioned criteria post hoc test was performed when necessary For data collected from object recognition, water maze, prepulse inhibition, and passive avoidance tasks, we compared the statistical differences between groups, using the two-way repeated measures ANOVA test, performed with the same SPSS package. In addition, the Bonferroni P \u2264 0.814, one-way ANOVA) were observed between reflexively evoked blink responses in the two groups of animals, it was possible to use the classical conditioning of eyeblink responses to test their learning capabilities. Although systematic differences in reflexively evoked eyelid responses would not preclude the possibility of examining whether blink responses may be acquired in an associative task, putative differences in the acquisition process between both groups of animals could be ascribed to the learning process and not to any performance deficit.In a preliminary series of experiments, we checked whether the neural premotor circuits involved in the generation of eyelid responses functioned normally in both wild-type and TgIE96 mice. The blink reflex can be characterized by measuring the latency of its early (R1) and late (R2) components \u200a=\u200a0.60; P\u200a=\u200a0.44]. In contrast, the two-way ANOVA applied to the conditioning data showed a significant difference in the evolution of the percentage of CRs for the two experimental groups with respect to values collected during the habitation sessions . As shown by the Bonferroni post hoc test, the wild-type group presented values significantly greater (P \u2264 0.01) than those collected during the habituation sessions from the 3rd to the 5th conditioning sessions, whilst the TgIE96 group presented percentages of CRs significantly (P \u2264 0.01) different from habituation values from the 2nd to the 5th conditioning sessions. During the extinction process, animals presented a decrease in the percentage of CRs, reaching 20.6\u00b15.8% for the wild-type group, and 18.2\u00b14% for the TgIE96 group by the 4th extinction session. No significant statistical difference could be detected between the two groups during the extinction sessions , suggesting a similar evolution of the percentage of CRs during the extinction process. Moreover, for both experimental groups no statistical difference was found between CR values collected during the 4th extinction session and those corresponding to the habituation session .During conditioning sessions using a trace paradigm A, C, co\u200a=\u200a1.62; P\u200a=\u200a0.22]. The two-way ANOVA applied to the conditioning data showed a significant difference in the percentage of CRs for the two experimental groups with respect to values collected during the habituation sessions . As shown by the Bonferroni post hoc test, the wild-type group presented values significantly higher (P \u2264 0.01) than those collected during the habituation sessions from the 2nd to the 5th conditioning sessions, whilst the TgIE96 group presented percentages of CRs significantly (P \u2264 0.01) different from habituation values from the 1st to the 5th conditioning sessions. During the extinction process, animals presented a decrease in the percentage of CRs, reaching 53.4\u00b18.8% for the wild-type group and 47.6\u00b18.4% for the TgIE96 group by the 4th extinction session. No statistical difference could be detected between the two groups during extinction sessions , suggesting a similar decay in the percentage of CRs during the extinction process. In addition, no statistical difference was found between CR values collected during the 4th extinction session and those of the habituation session for the two experimental groups .For the delay paradigm B, D, wi\u200a=\u200a1.12; P\u200a=\u200a0.35; data not illustrated]. This result confirms the reliability of the conditioning protocols used in the present study.Finally, the percentage of CRs for the pseudoconditioned animals (n\u200a=\u200a8) did not present differences between habituation, conditioning, or extinction sessions  and TgIE96 animals .In another series of experiments, we compared the learning capabilities of wild-type and TgIE96 animals for object recognition. As illustrated in \u200a=\u200a15.5; P<0.001] and TgIE96  animals presented a significant increase in the percentage of attention devoted to the novel object \u200a=\u200a15.8; P<0.001] and TgIE96 animals .During the first choice trial, 1 h after the initial training session, mice were allowed to explore a novel object (B1) and a familiar one (O3). In this case, both wild-type .During the last choice trial, 72 h after the training session , mice weIn summary, and as already described for classical eyeblink conditioning, TgIE96 mice performed the object recognition task with the same efficiency as the control group (or \u2015 during the 72 h session \u2015 even better).\u200a=\u200a96.5; P<0.001] shorter times than the TgIE96 group. For example, during the first training day, the control group reached the hidden platform at an escape latency (62.3\u00b17.1%) significantly (P<0.001) shorter than that for the TgIE96 group (95.6\u00b12.9%). Results collected during the following two tests showed that while wild-type animals improved their performance across training (P<0.001 when comparing the 1st vs. the 3rd session), the TgIE96 group did not improve their performance (P\u200a=\u200a0.23). Taken together, these results indicate that TgIE96 animals presented evident spatial learning and memory deficits as compared with their littermate controls.To determine spatial learning and memory abilities of the two groups of animals included in this study we used a modified version of the Morris water maze test. Animals had to find a hidden platform with the help of the visual cues provided. The task consisted of three sessions (three days) each of four trials, separated by 20 min, with each trial lasting a maximum of 60 s. The score obtained in each session was the average of the four scores for each animal. Data were expressed as the percentage (%) of the time limit (60 s). As shown in In accordance with previous descriptions \u200a=\u200a1.43; P\u200a=\u200a0.24] and peak  latencies between wild-type and TgIE96 groups. Nevertheless, the index for maximum peak response was significantly  greater for wild-type (performance index\u200a=\u200a27.5\u00b15) than for TgIE96 (index\u200a=\u200a9.3\u00b12) animals. Moreover, there were significant  differences between the two groups with regard to the index for total response area (indexes\u200a=\u200a32.4\u00b16.3 for wild-type and 14.7\u00b14.6 for TgIE96 mice). Thus, TgIE96 mice presented some functional deficit in the elaboration of prepulse inhibition when compared with the performance of wild-type animals.For the sake of homogeneity, and as explained in the \u200a=\u200a8.5; P<0.05]. As shown in \u200a=\u200a2.7; P\u200a=\u200a0.1] were observed between the two groups. Therefore, it can be concluded that in the passive avoidance test, TgIE96 animals present a significant memory deficit as compared with their wild-type littermates.We determined the putative differences in the passive avoidance test for the two experimental groups by measuring the time taken by a mouse to enter the dark compartment after door opening . For theAccording to the present results, TgIE96 mice have marked deficits in spatial learning  as shown by their poor performance in the water maze test. In contrast, they performed the object recognition test \u2015 another task involving the participation of hippocampal circuits \u2015 similarly to controls. Moreover, they also presented significant deficits in two tests (prepulse inhibition and passive avoidance) more directly related with selected cerebral  cortical and subcortical  structures. As already reported for Lurcher mice pcd (Purkinje cell degeneration) mice pcd mice also present affected inferior olivary neurons and some other neuronal groups located far from the cerebellum , the reported deficits cannot be confidently ascribed to cerebellar circuits. As shown in a recent study using classical conditioning of eyelid responses and sumultaneous recordings of multiunitary activity in the red nucleus and in the cerebellar interpositus nucleus The classical conditioning of eyelid responses allowed us to test the effects of cerebellar damage on the acquisition of this type of associative learning. Neural circuits involved in the generation of reflexively evoked eyeblinks were functionally active in TgIE96 animals generating both components (R1 and R2) of the reflex response following electrical stimulation of the supraorbitary nerve As already described in Lurcher mice The involvement of cerebellar circuits in object recognition tasks has been shown using functional MRI The presence of noticeable deficits in the proper execution of water maze, prepulse inhibition, and passive avoidance tasks in TgIE96 animals raises interesting questions regarding cerebellar contributions to those different learning tasks. Indeed, these three learning tests involve the participation of many different cortical  and subcortical  structures TgIE96 animals presented a noticeable learning and memory deficit for acquisition and retention of the Morris water maze task, a fact that cannot be ascribed to their ataxic syndrome, since they were capable of swimming like their littermate controls, as also observed in other cerebellar-deficient mice Although the startle response to a severe tone Neural mechanisms involved in emotional reactivity, such as those mediating passive avoidance tasks, are classically assumed to take place in amygdalar circuits Finally, it can be indicated that in order to properly determine the contribution of cerebellar structures not only to the improvement of motor skills, but also to the acquisition of new motor and cognitive abilities, it will be necessary to use many different associative and non-associative learning tasks as shown by the present study. In addition, it has been recently reported that the cerebellum contributed to the ongoing functional states"}
+{"text": "Bovine tuberculosis (BTB) today primarily affects developing countries. In Africa, the disease is present essentially on the whole continent; however, little accurate information on its distribution and prevalence is available. Also, attempts to evaluate diagnostic tests for BTB in naturally infected cattle are scarce and mostly complicated by the absence of knowledge of the true disease status of the tested animals. However, diagnostic test evaluation in a given setting is a prerequisite for the implementation of local surveillance schemes and control measures.Mycobacterium bovis.We subjected a slaughterhouse population of 954 Chadian cattle to single intra-dermal comparative cervical tuberculin (SICCT) testing and two recently developed fluorescence polarization assays (FPA). Using a Bayesian modeling approach we computed the receiver operating characteristic (ROC) curve of each diagnostic test, the true disease prevalence in the sampled population and the disease status of all sampled animals in the absence of knowledge of the true disease status of the sampled animals. In our Chadian setting, SICCT performed better if the cut-off for positive test interpretation was lowered from >4 mm (OIE standard cut-off) to >2 mm. Using this cut-off, SICCT showed a sensitivity and specificity of 66% and 89%, respectively. Both FPA tests showed sensitivities below 50% but specificities above 90%. The true disease prevalence was estimated at 8%. Altogether, 11% of the sampled animals showed gross visible tuberculous lesions. However, modeling of the BTB disease status of the sampled animals indicated that 72% of the suspected tuberculosis lesions detected during standard meat inspections were due to other pathogens than Our results have important implications for BTB diagnosis in a high incidence sub-Saharan African setting and demonstrate the practicability of our Bayesian approach for diagnostic test evaluation. Mycobacterium bovis is the causative agent of bovine tuberculosis (BTB) and belongs to the Mycobacterium tuberculosis complex (MTBC) of bacteria M. bovis infections are of public health concern due to the pathogen's zoonotic potential M. bovisBTB control and surveillance is scarce in sub-Saharan Africa and mostly limited to abattoir meat inspections. However, the performance of meat inspection is rather poor and depends on the disease stage in which infected animals reside, the accuracy of the carcass examination and the presence of other lesion causing pathogens M. bovis antibodies has been described recently Current ante mortem diagnosis of BTB mainly relies on the single intra-dermal comparative cervical tuberculin (SICCT) test, which, although imperfect, could not yet be replaced by any other more accurate diagnostic method Attempts to evaluate diagnostic tests for BTB in naturally infected cattle in Africa are scarce but a prerequisite for the implementation of surveillance schemes and control measures. Gobena et al. have used detailed post mortem examination to define the BTB disease status of Ethiopian cattle for the evaluation of SICCT in this setting Choi et al. A total number of 954 sequentially selected slaughter animals from Southern Chad were subjected to multiple tests for the diagnosis of BTB. Three ante-mortem tests with continuous numerical outcome values (continuous outcome) were used, namely, SICCT and two recently developed FPA tests termed SENTRY 100 and GENios Pro Before slaughter, blood samples were collected and animals underwent SICCT testing. Altogether, 8% (CI: 6%\u201310%) of the animals tested, reacted positively to SICCT when the official OIE cut-off >4 mm;  was usedBased on the same data, we have previously reported the evaluation of SICCT, SENTRY 100 and GENios Pro using a subset of animals with either PCR confirmed MTBC infections or no visible lesions Model estimates for tests with binary outcome were highly sensitive to the priors. We therefore decided to consider solely tests with continuous outcome for Bayesian modeling .Based on the estimates for the means and variance-covariances of SICCT, SENTRY 100 and GENios Pro test results for the diseased and non-diseased animals in model 2A see , ROC curM. bovis infected animals  and false positive (CFP) diagnosis, which we were not able to accurately do. However, the cost of a false negative diagnosis is likely to exceed the cost of a false positive result by several folds as disease transmission amplifies the total economical losses due to BTB. We found that, assuming a disease prevalence of 8.4% (10.0%), a cut-off >2 mm would be ideal if CFN/CFP lies between 8 and 16 (7 and 13). This suggests that our chosen cut-off values may be acceptable for a broad range of reasonable CFN/CFP ratios.Our results indicated that the most appropriate cut-off for positive SICCT test interpretation was significantly lower then the OIE suggested standard cut-off (>2 mm versus >4 mm). However, our criteria for cut-off selection attributed equal weights to sensitivity and specificity and did not consider the disease prevalence and the cost of misclassifications. As an alternative approach for cut-off selection, the misclassification-cost term (MCT) can be calculated for each point of the ROC curve. The point with the lowest MCT value would then be most appropriate for positive test interpretation A cut-off >2 mm was also found to be most appropriate for positive SICCT test interpretation in a recent study in Ethiopia M. bovis infection and visible lesions (N\u200a=\u200a30), 9 or 19 (30% or 63%) did not show a positive reaction to SICCT depending on whether a cut-off >2 mm or >4 mm was applied, respectively. This indicates a considerable proportion of SICCT anergic animals . Unfortunately, our sample size was too small to conclusively assess the ability of the FPA tests to detect such animals.SICCT showed a relatively low sensitivity irrespective of whether our suggested or the OIE cut-off was used . ComparaM. bovis. For 72% of the animals in which lesions have been detected, no M. bovis infection was modeled. This finding was in line with the relatively low amount of MTBC strains detected in animals with lesions . This observation could suggest that Mbororo breeds in fact, are not more likely to be infected with M. bovis but more often develop advanced stages of the disease. Host genetic factors as well as environmental factors or animal husbandry could account for this observation.In a previous study on BTB in Chadian cattle we have reported that the prevalence of BTB was significantly higher in Mbororo zebus than in Arab zebus th breed . NeverthM. bovis.In summary, the present study shows the practicability of a Bayesian method for the evaluation of multiple tests for the diagnosis of BTB in naturally infected cattle and in absence of knowledge of the true disease status of the animals. Our model allowed us to compute the disease status of each sampled animal and the modeling results supported our previous observation that the cut-off for positive SICCT interpretation should be lowered to >2 mm in many countries of sub-Saharan Africa. Moreover, we provide evidence that an unexpectedly high proportion of BTB suspect lesions detected during slaughterhouse meat inspection was due to other pathogens than The animal population subjected to this study has previously been described, in detail All 954 animals were physically examined before slaughter. Body condition was assessed by assigning one of the following three scores: 1 \u2013 good body condition, 2 \u2013 bad body condition, 3 \u2013 very bad body condition Valid SICCT testing results were available for 930 animals. SICCT testing and reading was carried out as explained previously and according to standard protocols Valid SENTRY 100 and GENios Pro FPA results were available for 953 and 954 animals, respectively. The methods have been previously described in detail After slaughter, all 954 animals underwent meat inspection, which included organ and lymph node palpation, visual inspection and incision of organs and lymph nodes according to standard procedures Specimens from all 108 animals with lesions were subjected to direct microscopy and processed as previously described Specimens of lesions from altogether 102 animals were subjected to culture and microscopy. Decontaminated samples were inoculated into two Middlebrook 7H9 medium flasks containing OADC and PANTA and either glycerol (0.75%) or pyruvate (0.6%) AFB containing cultures from 50 animals were subjected to molecular characterization. Heat inactivation of the cultures was carried out as previously explained M. bovis infection status of all sampled animals. The model combined the results of the continuous as well as the binary diagnostic tests for BTB , applied to the same animal population without considering a gold standard. It also allowed the estimation of the true disease prevalence in the sampled population as well as the sensitivities and specificities of the diagnostic tests. A mathematical description of the model and the WinBUGS code are provided in A Bayesian model was developed to estimate the true M. bovis infection status were identified by univariate and multiple logistic regression analysis in Stata (Stata/IC v10.0). Association between lesion localisation and modeled M. bovis infection was assessed by the Fisher's exact test in Stata.Risk factors for the modeled M. bovis infected animals  and tried to directly model their sensitivities and specificities . The mathematical description of the model and the WinBUGS code are shown in We assumed that the distribution of the test values of SICCT, SENTRY 100 and GENios Pro was trivarite normal with means and variance-covariances separately estimated for the diseased and the non-diseased animals. The normality assumption was verified via the shape of the histogram of the test values. In an initial model we have included the data from the multiple post mortem tests for the detection of k , respectively; k, respectively.From the estimates of the means and variance-covariances of the multivariate normally distributed continuous test values of SICCT, SENTRY 100 and GENios Pro for the diseased and non-diseased animals, a ROC curve was calculated in Stata. Pairs of 1-specificity and sensitivity were calculated and plotted for all possible cut-off points according to the following formula:FN/CFP) P (1\u2212Se)+(1\u2212P) (1\u2212Sp)] was chosen, with CFN and CFP being the cost of false negative and false positive diagnosis, respectively and P being the disease prevalence in the target population FN/CFP but the cost of false-negative diagnosis is likely to exceed the cost of false positive diagnosis. Therefore, MCT values for each possible cut-off point and different ratios of CFN/CFP were calculated and compared, assuming a disease prevalence of 8.4%, as estimated by our model. In addition, MCT values for different CFN/CFP ratios were calculated for a 10.0% disease prevalence.We considered the point of the ROC plot with the greatest distance from the diagonal line (sensitivity\u200a=\u200a1\u2212specificity) as the best cut-off; this corresponds to the point with the largest Youden index (J\u200a=\u200asensitivity+specificity\u22121) Table S1d: Mean diagnostic value for non-diseased (d\u200a=\u200a0) and diseased (d\u200a=\u200a1) animals, respectively. \u03c4d: precision of the diagnostic values for non-diseased (d\u200a=\u200a0) and diseased (d\u200a=\u200a1) animals, respectively. mS/\u03c3S, mC/\u03c3C, m\u03c0/\u03c3\u03c0 : Mean and standard deviation of the test sensitivity, specificity and true disease prevalence, respectively. The normal distribution is parametrized in terms of mean and variance. The Gamma distribution is parametrized in a non-conventional way in terms of mean and variance instead of the shape and scale parameters. Model-based estimates correspond to the posterior mean and standard deviation in brackets.Priors and model estimates for different parameters. \u03bc(0.04 MB XLS)Click here for additional data file.Text S1Mathematical model description(0.12 MB DOC)Click here for additional data file.Text S2WinBUGS code(0.03 MB DOC)Click here for additional data file."}
+{"text": "Ureaplasmas and urogenital tract disease in humans. Since healthy humans can be colonized with Ureaplasmas, its role as a pathogen remains controversial. In order to begin to define the role of the host in disease, we developed a rodent model of urinary tract infection (UTI) using Fischer 344 (F344) rats. Animals were inoculated with sterile broth, 101, 103, 105, 107, or 109 log CFU of a rat-adapted strain of Ureaplasma parvum.Epidemiologic studies show a strong association between U. parvum affected the incidence of UTI, and 50% to 57% of animals inoculated with \u2265 107 CFU of U. parvum remained infected (p < 0.04). However, inoculum dose did not influence immune response to U. parvum. Asymptomatic UTI was characterized by a minimal immune response that was predominantly monocytic and lymphocytic, with limited lesions, and elevated urinary levels of IFN-\u03b3, IL-18 and MCP-1 (P \u2264 0.02). UTI complicated with struvite formation was characterized by an exaggerated immune response that was mostly neutrophilic (P \u2264 0.0001), with lesions that showed extensive uroepithelial hyperplasia (P \u2264 0.0001), and a predominance of IL-1\u03b1, IL-1\u03b2, and GRO/KC in the urine (P \u2264 0.02). Animals with asymptomatic UTI also had a significantly high rate of kidney infection (P \u2264 0.0005).Infected animals exhibited two distinct profiles, asymptomatic UTI and UTI complicated with struvite urolithiasis. Inoculum dose of U. parvum infection are primarily dependent upon host-specific factors rather than Ureaplasma microbial load. The immune response in F344 rats is similar to that which occurs in humans with ureaplasmal associated disease. Therefore, this model of infection is a useful tool for elucidating U. parvum-host interactions that confer UTI and disease.Complications associated with  Ureaplasma species are among the most common isolates from the human urogenital tract . All animals within the Struvite group had bladder stones, which were composed of 89 to 95% magnesium ammonium phosphate (struvite), 1 to 5% calcium phosphate (carbonate apatite) and 3 to 10% protein and blood. No animal had macroscopic evidence of kidney stones at time of necropsy. Although not statistically significant (P \u2264 0.11), animals inoculated with 107 or greater CFU tended to have the highest frequency of struvite uroliths.Animals inoculated with us Table . The NegU. parvum did not impact the distribution of animals that developed either UTI or struvite uroliths . However, there was a significant difference (P \u2264 0.006) in the inflammatory cell type score and inoculating dose of U. parvum . There also was no correlation between the total area affected score and clinical profile , additional file Scoring of kidney tissues on the basis of total area affected did not reveal any patterns that could be correlated to local/active infection or clinical profile. Specifically, there was no correlation between the total area affected score and U. parvum were examined by Spearman Correlation analysis. There were no correlations between urine cytokine levels and degree of inflammation score among animals inoculated with sterile 10B broth (data not shown). However, there was a significant correlation . Control animals had significantly higher levels of MCP-1 than animals in either the Negative or UTI groups Figure . AnimalsIn order to identify distinctive chemokine/cytokine patterns between clinical profiles associated with active infection, samples from animals within the Negative group were excluded from this analysis. Each urine cytokine multiplex from each animal was normalized prior to analysis by one-way ANOVA using row by row modeling and Fischer C correction for multiple comparisons. Figure U. parvum (P \u2264 0.05). Figure Urine cytokine data from control and culture negative animals was normalized prior to statistical analysis and analyzed as described above. There was a significant difference in the overall pattern of IL-2, IL-4, IL-10, TNF-\u03b1, IFN-\u03b3, and GRO/KC in the urine of culture negative animals that received different inoculating doses of Ureaplasmas is confounded by the isolation of the microbe from the lower urogenital tract of normal, asymptomatic individuals. In addition, the severity of disease for most mycoplasmal infections depends on the host immune response. Therefore, experimental infections in genetically defined animal models will be critical to unraveling the key interactions in the host/parasite relationship that contribute to disease severity. By using a combined approach involving histopathology and cytokine profiling, we were able to further characterize the immune response associated with asymptomatic UTI and UTI complicated with struvite formation.Ureaplasmas are an underappreciated pathogen of the urogenital tract. Despite strong epidemiological evidence and even experimental infections in humans that fulfilled Koch's postulates , the etiU. parvum [U. parvum significantly affected the frequency of animals that remained colonized two weeks after inoculation. Therefore, the initial microbial load is important in establishing infection. However, once infected, the proportion of animals that developed complicated UTI in response to varying inocula of U. parvum did not show a definitive dose response effect. More importantly, the immune response to infection in this group of animals with complicated UTI was consistent, regardless of initial inoculating dose. For example, the cytokine profile and urinary tract pathology of a struvite positive animal that was inoculated with 101 CFU was indistinguishable from a struvite positive animal that was inoculated with 109 CFU. This suggests that the initial microbial load of U. parvum is not a critical factor in the development of complicated UTI in this rat strain. Further, it supports the concept that, once infection is established, the host inflammatory response is a key determinant of lesion severity in the urinary tract.The F344 rat strain is highly susceptible to development of complicated UTI following experimental inoculation with . parvum . In thisU. parvum, and 65% exhibited an ascending infection into the kidneys. Further, the microbial load of U. parvum in animals with asymptomatic UTI was equivalent to animals in the Struvite group. Another intriguing feature in animals with asymptomatic UTI was the overall lack of uroepithelial proliferation that was present in varying degrees in the Negative group as well as the Struvite group. A primary defense mechanism of uroepithelium exposed to bacteria involves desquamation, necrosis or apoptosis followed by proliferation [U. parvum.As previously reported , animalsferation . TherefoF344 rats with struvite uroliths had a similar clinical profile to what we have previously described . SpecifiU. parvum infected animals. Therefore, these cytokines may be critical in directing a more efficient immune response that leads to bacterial clearance with minimal tissue damage. The second cytokine cluster in the negative group included IFN-\u03b3 and GRO/KC, which are significant cytokines in the UTI and Struvite groups, respectively. Except for animals that were inoculated with log 9 CFU of U. parvum, the expression pattern of IFN-\u03b3 and GRO/KC was not inversely related as they were in culture positive animals. This may be reflecting a more balanced immune response than what is seen in U. parvum positive animals, and we suggest that this balanced response may be critical to resolution of infection and prevention of severe disease.The immune response of animals within the negative group was highly variable and most likely comprises a mixed population of rats, including animals that never became colonized as well as animals that cleared the infection at various time points post-inoculation. Therefore, interpretation of data from this group of animals is difficult and is done with caution. In spite of this limitation, profiling urine cytokine data and bladder lesion scores by inoculum dose was informative. The threshold dose for successful colonization appears to be between log 5 and log 7 CFU, since 64% and 43% of rats respectively were culture negative 2 weeks post-inoculation. The animals within the log 5 and log 7 CFU inoculation groups also had the greatest flux in both pro-inflammatory  and anti-inflammatory  cytokines. Interestingly, pattern analysis of urine cytokine data showed two distinct clusters. The first cluster identified in the negative group included IL-2, IL-4, IL-10, and TNF-\u03b1; these cytokines were notable as they were not part of the cytokine cluster groupings of U. parvum in the F344 rat is an interesting phenomenon since this is an inbred strain. In this study, both genetic and environmental influences on disease were minimized to the extent possible. All of the animals in this study originated from the same colony. Further, rats were housed under the same barrier maintained conditions in order to minimize environmental variability. Despite our efforts, it was common to find that a rat that developed asymptomatic UTI had co-habited the same cage with a rat that developed struvites or was culture negative at time of necropsy. Therefore, external environment could not account for the varying clinical outcome in our study. However, our experimental inoculation procedure may be a critical source of variability. Although attempts were made to reduce mechanical trauma caused by catherization, it is possible that the trauma may have been sufficient to shift the immune response towards a pro-inflammatory profile in a subset of animals. Once this occurred, the pro-inflammatory cycle progressed until infection was resolved (Negative group) or the study was terminated (Struvite group). Another possible explanation for our findings may involve the actual placement of ureaplasmas within the urinary tract at time of inoculation. For example, if the catheter disrupted the uroepithelial barrier so that a sufficient number of ureaplasmas were deposited into the submucosa instead of the mucosal surface, this could elicit a different inflammatory response cascade than what would normally occur if the microorganisms were only present on the mucosal surface of the bladder. The results of this study were similar to what we have previously reported, thus showing the consistency and reproducibility of this model of infection. Moreover, the clinical outcome to ureaplasmal infection in the F344 rat is similar to what occurs in humans. The complex interactions between most mucosal pathogens and the host that lead to uncomplicated colonization versus inflammation and disease are largely unknown. Therefore, this model may be particularly useful for identifying the molecular events that confer asymptomatic infection, complicated infection as well as resolution of infection with an opportunistic pathogen of the urogenital tract.The variable clinical outcome to experimental inoculation with Ureaplasma and the host that lead to uncomplicated colonization versus inflammation and disease are largely unknown. We characterized the F344 rat immune response in the urinary tract to varying inoculum concentrations of U. parvum. Establishment of UTI was influenced by microbial load, but the host immune response was independent of microbial load. Two distinct innate immune profiles were identified with two different clinical outcomes: asymptomatic UTI and complicated UTI with struvite formation. Asymptomatic UTI was characterized by a minimal immune response that was predominantly monocytic and lymphocytic and was accompanied by a significantly high rate of kidney infection. UTI complicated with struvite formation was characterized by an exaggerated immune response that was predominantly neutrophilic and was accompanied by uroepithelial hyperplasia and extensive tissue damage.The complex interactions between The authors declare that they have no competing interests.LR designed and executed animal infection studies, data analysis and manuscript preparation. MR performed histopathologic evaluation of tissues and developed the lesion scoring system implemented in this study. MBB participated in the design and coordination of the study, and helped draft the manuscript. All authors read and approved the final manuscript.The pre-publication history for this paper can be accessed here:http://www.biomedcentral.com/1471-2334/9/9/prepubU. parvumDistribution of kidney lesion scores in F344 rats inoculated with varying doses of . Lesion score analysis of kidney tissue was based on total area affected. The data provided represents the raw lesion scores for each biological replicate. Horizontal bars demarcate the median value for each clinical profile group. Lesion scoring of each sample was performed without prior knowledge of the clinical profile. Data is a summation of 5 separate experiments. Nonparametric lesion scores were grouped according to the clinical profile and analyzed by Kruskall-Wallis test .Click here for file"}
+{"text": "Caenorhabditis elegans, is known to mutate to resistance to pathogenic bacteria. However, its role in responses against bacterial toxins and PFTs is as yet unexplored. Here we reveal that reduction of the DAF-2 insulin-like pathway confers the resistance of Caenorhabditis elegans to cytolitic crystal (Cry) PFTs produced by Bacillus thuringiensis. In contrast to the canonical DAF-2 insulin-like signaling pathway previously defined for aging and pathogenesis, the PFT response pathway diverges at 3-phosphoinositide-dependent kinase 1 (PDK-1) and appears to feed into a novel insulin-like pathway signal arm defined by the WW domain Protein 1 (WWP-1). In addition, we also find that WWP-1 not only plays an important role in the intrinsic cellular defense (INCED) against PFTs but also is involved in innate immunity against pathogenic bacteria Pseudomonas aeruginosa and in lifespan regulation. Taken together, our data suggest that WWP-1 and DAF-16 function in parallel within the fundamental DAF-2 insulin/IGF-1 signaling network to regulate fundamental cellular responses in C. elegans.Pore-forming toxins (PFTs) are the single largest class of bacterial virulence factors. The DAF-2 insulin/insulin-like growth factor-1 signaling pathway, which regulates lifespan and stress resistance in  Staphylococcus aureus, Streptococcus pyogenes, Clostridium perfringens, and Enterococcus faecalisBacillus thuringiensis (Bt) are a large family of PFTs Caenorhabditis elegansPore-forming toxins (PFTs) are bacterial toxins that damage the plasma membrane of host cells and play important roles in the pathogenesis of many important human pathogens including C. elegans\u2013Cry toxin interaction system opened up the first, and to date the only, whole-animal genetic model for studying PFTs in vivo and led to the discovery of signal transduction pathways that protect cells against PFTs, including the p38 mitogen-activated protein kinase (MAPK) pathway and the unfolded protein response (UPR) pathway, which are also protective against and/or activated by PFTs in mammalian cells C. elegans against PFTs e.g., modulation of signal transduction cascades) have been recorded, the roles of these responses in coping with PFTs as yet poorly understood This C. elegans and is homologous to the mammalian insulin and IGF-1 signaling pathway C. elegans daf-2 gene encodes the worm homolog of the insulin/IGF-1 receptor. C. elegans strains that carry reduction-of-function or loss-of-function mutations in daf-2 or the downstream phosphoinositol 3-kinase (PI3K) age-1 are long-lived and are also resistant to a variety of stresses and bacterial pathogens The DAF-2 insulin/insulin-like growth factor 1 (IGF-1) receptor pathway is part of a neuroendocrine system that regulates longevity, metabolism, and development in C. elegans. Unexpectedly, this resistance does not solely rely on the canonical DAF-2 insulin/IGF-1 signaling pathway through AKT/PKB and DAF-16 but that rather, at least in part, deviates form the main pathway at PDK-1 and that includes WWP-1. We demonstrate that WWP-1 may be a novel signaling arm that diverges from PDK-1 and functions in parallel to DAF-16 in the DAF-2 insulin/IGF-1 signaling network. Furthermore WWP-1 is functionally important for the intrinsic cellular defenses (INCED) against pathogenic attacks since loss of this pathway leads to animals hypersensitive to PFTs and pathogenic bacteria Pseudomonas aeruginosa in C. elegans.Here we demonstrate that reduction of the DAF-2 insulin/IGF-1 signaling pathway confers resistance to Bt Cry PFTs in C. elegans against the PFTs, C. elegans daf-2 reduction-of-function mutant daf-2(e1370) were qualitatively compared to wild-type N2 animals in their susceptibilities to the nematicidal PFT, Cry5B  mutant animals were qualitatively healthier and appeared resistant to Cry5B.To address whether the DAF-2 insulin/IGF-1 signaling pathway plays a role in T, Cry5B . Fourth earances . However50  values were obtained (daf-2(e1370) mutant animals are at least an order of magnitude more resistant to Cry5B than wild-type N2 animals (P<0.01). In order to test whether daf-2(e1370) mutant animals were also resistant to another Cry PFT, we also quantitative analyzed the LC50 values of daf-2(e1370) animals to the nematicidal Cry PFT, Cry21A daf-2(e1370) animals are 7X more resistant to Cry21A than wild type N2 animals  . This result implies that Cry21A at least partly might require a different receptor than Cry5B for intoxication of C. elegans.To independently confirm the importance of DAF-2 in PFT responses, DAF-2 function was reduced using RNA interference (RNAi) in the RNAi-sensitive strain (pk1426) . The resdaf-2 are totally suppressed by loss-of-function mutations in daf-16, which encodes a Forkhead transcription factor daf-2(e1370) mutant, the daf-16 null mutant, mu86daf-2(e1370);daf-16(mu86) double mutant were exposed to Cry5B and Cry21A and scored for viability at the single dose of 40 \u00b5g/ml purified Cry5B daf-2(e1370) animals are significantly more resistant  to Cry5B than wild-type N2 animals (P<0.01) whereas loss-of-function daf-16(mu86) mutant animals are as sensitive as N2 (daf-2(e1370);daf-16(mu86) double mutant animals had an intermediate phenotype that was statistically more sensitive than daf-2(e1370) animals (P<0.001) but statistically more resistant  than daf-16(mu86) or wild-type animals in response to Cry5B (P<0.001 and P<0.001). Similar results were also seen in the animals treated with 8 \u00b5g/ml of the Cry21A. daf-2(e1370);daf-16(mu86) double mutant animals also had an intermediate phenotype that was statistically more sensitive than daf-2(e1370) animals (P<0.05) but statistically more resistant  than daf-16(mu86) or wild-type animals in response to Cry21A (P<0.05 and P<0.05)  , Table 2C. elegans, DAF-2 regulates DAF-16 through the activation of PI3K, encoded by age-1 and aap-1 for the catalytic subunit and the regulatory subunit respectively. PI3K potentiates the activity of PDK-1, which in turn activates the three downstream serine/threonine kinases: the Akt/PKB homologs AKT-1 and AKT-2, and the serum- and glucocorticoid-inducible kinase homolog, SGK-1. These three serine/threonine kinases than inhibit the nuclear translocation and transcriptional activity of DAF-16 by phosphorylating DAF-16 at different serine/threonine residues Caenorhabditis Genetic Center (CGC) and exposed them to E. coli expressing Cry5B in liquid medium. In this Cry5B toxicity assay, the daf-2(e1370), age-1(hx546), aap-1(m889), pdk-1(sa680), pdk-1(sa709), and daf-2(e1370);daf-16(mu86) animals are all statistically resistant to Cry5B compared to the wild-type N2 animals (daf-18(e1375) mutant animals , are hypersensitive to Cry5B compare to wild-type animals. Thus, animals from the insulin-receptor down to PDK-1 behave as expected from what is known about the pathway. However, animals with mutations in the three serine/threonine kinases immediately downstream of PDK-1, including akt-1(sa573), akt-1(ok525), akt-1(mg144), akt-2(ok393), and sgk-1(ok538), were not resistant to Cry5B (akt-1(ok525) and akt-2(ok393)) were hypersensitive to the PFT.In the canonical DAF-2 insulin/IGF-1 signaling pathway for the regulation of lifespan, energy metabolism, and dauer development in  animals , Table 2to Cry5B , Table 2pdk-1, akt-1, akt-2 and sgk-1 genes were quantitatively assessed using the Cry5B dose-dependent mortality assay  and pdk-1(sa709), were statistically more resistant to Cry5B than wild type N2 animals. A gain-of-function mutation in pdk-1(mg142) was, as predicted, sensitive to Cry5B. As above, we found animals with the loss-of-function mutations in akt-1, akt-2 and sgk-1, including akt-1(sa573), akt-1(ok525), akt-2(ok393), and sgk-1(ok538) were either as sensitive or hypersensitive to Cry5B compared to N2 animals  for novel PDK-1 interacting proteins CarboxyMethyltransferase), were identified from high-throughput yeast two-hybrid screens using H42K12.1(PDK-1) as the bait , and human WWP1 and WWP2 pcm-1 gene encodes an L-isoaspartate O-methyltransferase orthologous to human PCMT1 wwp-1 and pcm-1 genes were quantitatively assessed using the Cry5B dose-dependent lethality assay and LC50 values were obtained (wwp-1(ok1102) loss-of-function mutant animals are significantly hypersensitive to Cry5B PFT compared to wild type N2 animals , but the sensitivity to Cry5B PFT of pcm-1(qa201) mutant animals are statistically indistinguishable from N2 animals. Two additional wwp-1 mutant alleles, wwp-1(gk372) and wwp-1(gk397)  , were alry5B PFT , Table 1rrf-3(pk1426);glp-4(bn2) mutant worms were used to knock down the wwp-1 genes by two independent E. coli RNAi feeding clones (8A5 and 8A15) from the Ahringer RNAi library rrf-3(pk1426);glp-4(bn2) animals were used because the rrf-3(pk1426) mutant is hypersensitive to RNAi and the glp-4(bn2) mutant does not produce progeny that would otherwise complicate the assay . We have demonstrated that both mutants have roughly normal response to Cry5B wwp-1 RNAi clones target different sequence regions of the wwp-1 gene , we predict WWP-1 would also play a role in response to P. aeruginosa and be antagonistic to DAF-2. We exposed wwp-1 mutants to the pathogenic bacteria P. aeruginosa strain PA14 . These data also demonstrate that WWP-1 is involved in promoting innate immunity against pathogenic bacteria.The DAF-2 signaling network in ain PA14 . As we pC. elegans. It also has been suggested that signal transductions in the DAF-2 insulin/IGF-1 signaling pathway for longevity and innate immunity can be interrelated C. elegans lifespan, again antagonistic to DAF-2. As predicted, we found that wwp-1(gk372) and wwp-1(ok1102) mutant animals had statistically significant shorter lifespan compared with wild-type N2 animals  2O2 (a toxic insult that kills much more rapidly). All wwp-1 mutants, including wwp-1(gk372), wwp-1(gk397), and wwp-1(ok1102), have the similar sensitivity as wild type to killing by either CuSO4 or H2O2  against PFTs and the innate immune response against pathogenic bacteria in C. elegans.To confirm that the hypersensitivity of WWP-1 mutant animals to aging,  or H2O2 ; Table 4P. aeruginosa results are consistent with WWP-1 acting in the DAF-2 pathway antagonistic to and downstream of DAF-2. If true, then we predict that knock-down of WWP-1 should suppress a DAF-2 mutant phenotype. We therefore knocked down wwp-1 in daf-2(e1370) and daf-2(e1370);daf-16(mu86) mutant animals and exposed these wwp-1 knockdown animals  to purified Cry5B (wwp-1 RNAi can partly suppress the daf-2(e1370) resistant phenotype and that the combination of daf-16 knock out (via mu86 mutation) and wwp-1 knock down (via RNAi) can completely suppress daf-2(e1370) resistance back to a response similar to wild-type . These data are consistent with both daf-16 and wwp-1 acting in parallel daf-2-dependent pathways to mediate resistance to Cry5B PFT. Furthermore, that wwp-1 RNAi can not further sensitize the wwp-1(ok1102) worms in this experiment also confirmed that this mutant allele is a total loss-of-function mutant.The two-hybrid interactome data and the Cry5B/aging/ed Cry5B , Table 3daf-2 PFT defense pathway bifurcates at PDK-1 into DAF-16-dependent and DAFT-16-independent branches. This is the first report of a bifurcation of the daf-2 insulin/IGF-1 pathway at this junction. We furthermore find a protein, WWP-1, that appears to be involved in the DAF-16 \u2013independent branch of the INCED/innate immune response. Loss of WWP-1, a protein in the ubiquitin E3 ligase family, leads to hypersensitivity to the PFT Cry5B and the pathogen P. aeruginosa and that, based on double and triple knock out/knock down analyses with daf-2 and daf-16 mutants, appears to work in parallel with DAF-16. A model summarizing our findings is shown in Here we demonstrate for the first time that the DAF-2 insulin/IGF-1 pathway is involved in intrinsic cellular defenses (INCED) against PFTs. Furthermore, our data suggest that the P. aeruginosa, and aging, and on our genetic pathway data. A similar conclusion is evidenced from a previous genome-wide RNAi screen in which it was shown that knockdown of wwp-1 gene decreased median lifespan by 24% in daf-2(e1370) mutants, 5% in daf-2(e1370);daf-16(mgDf47) mutants, and 9% in wild-type N2 animals wwp-1 gene more significantly shortened the lifespan of daf-2 animals but still decreased the lifespan of daf-2;daf-16 mutant and wild-type N2 animals. This suggested that wwp-1 functions in parallel to daf-16 and converging within the DAF-2 insulin/IGF-1 signaling network to regulate longevity, which is reminiscent of our data. In addition, recently ubiquitin ligase activity has been shown for WWP-1, as well as demonstration that WWP-1 is involved in a daf-16-independent life span extension in response to diet restriction P. aeruginosa, as well as longevity in C. elegans.The assignment of WWP-1 as downstream of the DAF-2 insulin/IGF-1 pathway is based on two-hybrid interactome data with PDK-1, on phenotypic analyses of responses to PFT, daf-2 mutants is completely dependent upon daf-16sgk-1 mutants are long-lived Our results also show that regulation of PFT defense and lifespan can clearly be decoupled. First, we note that lifespan extension of C. elegans dauer development. That Eak-3 mutants have normal lifespan indicates EAK-3 decouples insulin-like regulation of development and longevity daf-2, such as pdk-1 and sgk-1, show wild-type resistance to the human opportunistic pathogen, Pseudomonas aeruginosa strain PA14. However, mutants of akt-1 and akt-2 show enhanced resistance to P. aeruginosa PA14 akt-1 and pdk-1 alleles can uncouple the dauer arrest, adult longevity and stress resistance phenotypes of age-1(mg109) mutants age-1(mg109); mg227 animals required only akt-1, and pdk-1 activity was dispensable in this background. These findings suggested larval and adult phenotypes of DAF-2 signaling are fully separable in these mutants. Finally, the other possible PDK-1 interacting protein identified in the interactome database, PCM-1, has also been demonstrated to participate in the repair of age-damaged proteins and overexpression of PCM-1 increases adult life span C. elegans.That DAF-2 signal can be decoupled from the conical pathway is reminiscent of several recent reports. Firstly, it has been demonstrated that EAK-3 (Enhancer of AKT-1 null) functions in parallel to AKT-1 to inhibit the expression of Forkhead transcription factor DAF-16 target genes involved in P. aeruginosa PA14 but also the INCED against PFTs as well as perhaps some yet unknown responses.In summary, we have identified specifically WWP-1 and the DAF-2 insulin/IGF-1 signaling network as components of INCED against PFTs. The biological functions of the DAF-2/DAF-16 signaling pathway in longevity and pathogens resistance have been extensively studied for years Caenorhabditis elegans strains used in this work were provided by the Caenorhabditis Genetics Center (CGC), which is funded by the NIH National Center for Research Resources (NCRR). C. elegans strains were maintained on NG plates using Escherichia coli strain OP50 as the food source daf-2(e1370), age-1(hx546), aap-1(m889), daf-18(e1375), pdk-1(sa680), pdk-1(sa709), pdk-1(mg142), akt-1(ok525), akt-1(sa573), akt-1(mg144), akt-2(ok393), sgk-1(ok538), daf-16(mu86), daf-2(e1370);daf-16(mu86), bre-3(ye28), rrf-3(pk1426), rrf-3(pk1426); glp-4(bn2), pcm-1(qa201), wwp-1(ok1102), wwp-1(gk372), and wwp-1(gk397) were each backcrossed at least 4 times. Bacteria expressing dsRNA directed against bre-3 and wwp-1 were part of a C. elegans RNAi library in E. coli strain HT115 . All RNAi clones have been confirmed by plasmid DNA sequencing. Escherichia coli HT115 transformed with the pAD48 construct, which expresses dsRNA targeting the daf-2 gene, was kindly provided by A. Dillin  Some E. coli-expressed Cry5B as described E. coli that did not express Cry5B (pQE9 vector control) or on plates prepared with E. coli expressing Cry5B (pQE9-Cry5B) 50 values for each toxin. E. coli-expressed Cry5B liquid toxicity assay: N2 wild-type and various daf-2 pathway mutant worms were exposed to E. coli-expressed Cry5B in S media in 48-wll plates to quantitative scored the survival. Similar conditions were used as the quantitative mortality assays described above, except that E. coli JM103 Cry5B expressing bacteria at 0.6 OD600 in stead of purified Cry5B and E. coli OP50 were used in this assay. The survival rate of each well was scored after incubating at 25\u00b0C for 6 days.All assays were performed at 25\u00b0C unless indicated elsewhere. Qualitative toxicity assays based on visual comparison of worm intoxication were performed on plates with E. coli-expressed Cry5B Plates. E. coli strain HT115 transformed with RNAi plasmids were spread on NG-IC plates [NG plates with 25 \u00b5g/ml carbenicillin and 0.1 mM isopropyl-\u03b2-D-1-thiogalactopyranoside (IPTG)] and incubated at 25\u00b0C overnight to induce the dsRNA expression. E. coli HT115 with pL4440, an empty vector, was used as negative control of RNAi. Synchronized rrf-3(pk1426) L1 larvae were obtained using standard protocols pL4440, bre-3, or daf-2 genes dsRNA expressing RNAi-plates at 20\u00b0C until L4 stage. These L4 stage worms were transferred to either control plates with E. coli HT115 that did not express Cry toxins (empty vector) or plates prepared with E. coli HT115 expressing either Cry5B or Cry21A ;glp-4(bn2) animals ;glp-4(bn2) RNAi knock down animals were washed out by S medium and transferred to the wells of 48-well plate with S medium containing E. coli HT115 RNAi bacteria at 0.6 OD600 and 20 \u00b5g/ml of purified Cry5B. After incubating at 25\u00b0C for 6 days, the survival rate of each well was scored.For daf-2(e1370), daf-16(mu86), daf-2(e1370);daf-16(mu86) and wwp-1(ok1102) mutant worms were used. Synchronized L1 animals were cultured on the NG-IC wwp-1 RNAi or pL4440 E. coli HT115 plates at 20\u00b0C until L4 stage. L4 stage RNAi knock down animals were washed out by S medium and transferred to the wells of 48-well plate with S medium containing with either wwp-1 RNAi or pL4440 E. coli HT115 bacteria at 0.6 OD600 and 20 \u00b5g/ml of purified Cry5B. After incubating at 25\u00b0C for 6 days, the survival rate of each well was scored.For C. elegans with hypochlorite/NaOH solution and transferring the resulting eggs to NG agar plates covered with E. coli strain OP50. When these had reached the young adults, \u223c150 nematodes were transferred to fresh plates, which also represents the first day of life span analysis. Nematodes were transferred to fresh plates daily during the progeny production period and after that were transferred every second to third day but monitored daily for dead animals. Nematodes that did not respond to gentle prodding and displayed no pharyngeal pumping were scored as dead. Animals that crawled off the plate or died due to internal hatching or protrusion of the gonads through the vulva were censored. Censoring describes an event where partial information on the life span of an individual animal is lost as a consequence of premature death. Thus, censored animals were included in statistical analysis only until the day of the censoring event. Survival analysis was performed using GraphPad Prism 5.0 . The Mantel-Cox logrank test was used to assess statistical significance of difference in survival. Only p-values<0.01 were considered significant to minimize type I errors.Lifespan analysis was conducted according to standard protocols P. aeruginosa killing assay was performed on slow-killing plates as described The 4, E. coli OP50 at an optical density of 0.2\u20130.25 OD600, and \u223c30 L4 larvae were used per well in 48-well plates. Lethality was determined after 6 days of CuSO4 exposure at 25\u00b0C.Assays were carried out as described 2O2 exposure at 25\u00b0C.Assays were carried out as described 50 values were determined by PROBIT analysis All experiments were performed a minimum of three times. LC"}
+{"text": "Caenorhabditis elegans intoxication by Crystal (Cry) protein PFTs. We mutagenized and screened for C. elegans mutants resistant to a Cry PFT and recovered one mutant. Complementation, sequencing, transgenic rescue, and RNA interference data demonstrate that this mutant eliminates a gene normally involved in repression of the hypoxia (low oxygen response) pathway. We find that up-regulation of the C. elegans hypoxia pathway via the inactivation of three different genes that normally repress the pathway results in animals resistant to Cry PFTs. Conversely, mutation in the central activator of the hypoxia response, HIF-1, suppresses this resistance and can result in animals defective in PFT defenses. These results extend to a PFT that attacks mammals since up-regulation of the hypoxia pathway confers resistance to Vibrio cholerae cytolysin (VCC), whereas down-regulation confers hypersusceptibility. The hypoxia PFT defense pathway acts cell autonomously to protect the cells directly under attack and is different from other hypoxia pathway stress responses. Two of the downstream effectors of this pathway include the nuclear receptor nhr-57 and the unfolded protein response. In addition, the hypoxia pathway itself is induced by PFT, and low oxygen is protective against PFT intoxication. These results demonstrate that hypoxia and induction of the hypoxia response protect cells against PFTs, and that the cellular environment can be modulated via the hypoxia pathway to protect against the most prevalent class of weapons used by pathogenic bacteria.Pore-forming toxins (PFTs) are by far the most abundant bacterial protein toxins and are important for the virulence of many important pathogens. As such, cellular responses to PFTs critically modulate host-pathogen interactions. Although many cellular responses to PFTs have been recorded, little is understood about their relevance to pathological or defensive outcomes. To shed light on this important question, we have turned to the only genetic system for studying PFT-host interactions\u2014 Bacteria make many different protein toxins to attack our cells and immune system in order to infect. Amongst them, pore-forming toxins (PFTs), which punch holes in the protective plasma membrane that surrounds cells, are by far the most abundant and constitute important virulence factors. Since the integrity of the plasma membrane is fundamental to maintaining the normal intracellular environment, the breaching of the plasma membrane by PFTs results in many and dramatic intracellular responses. However, we know little about the relevance of these responses to cell survival or cell intoxication. Here, using the only genetic system for studying pore-forming toxin effects in a whole animal, we show that the same response that protects cells against low oxygen stress unexpectedly also protects cells against pore-forming toxins. Mutations in the animal that hyper-activate the low oxygen response actually make animals resistant to pore-forming toxin attack, whereas mutations that inactivate the low oxygen response make animals more susceptible. Furthermore, a low oxygen environment itself is protective against pore-forming toxins. These data show a new and powerful connection between low oxygen responses and defense against the single most common mode of bacterial attack. Clostridium septicum, streptolysins by Group A and B Streptococci, \u03b1-toxin by Staphylococcus aureus, Vibrio cholerae cytolysin (VCC), \u03b1-hemolysin from uropathogenic E. coli, cytolysin from Enterococcus faecalis, and crystal (Cry) proteins from Bacillus thuringiensis (Bt).Pore-forming toxins (PFTs) are by far the most abundant and amongst the most important bacterial protein virulence factors 2+ influx, K+ efflux, increased endocytosis/exocytosis, vacuolization, necrosis, and apoptosis Although they are expressed by many bacterial pathogens and are broadly important as potentiators of infection, the effects of these toxins on host cells have been vastly understudied. There are several reasons for this lack of attention. First, their mechanism of action is deceptively simple. Second, most of the attention has been given to understanding how PFTs can change conformation from secreted, soluble proteins to insoluble proteins embedded in the plasma membrane. Third, because breaching of the plasma membrane is a major insult to a cell, a multitude of cellular responses to PFTs have been reported, including CaBacillus thuringiensis (Bt) Crystal (Cry) PFT \u2013 Caenorhabditis elegans toxin-host interaction system C. elegans has become an important genetically tractable organism for studying immune responses to bacterial pathogens C. elegansC. elegans allowed for the first molecular PFT defense pathway identified, p38 mitogen-activated protein kinase (MAPK) pathway C. elegans and was subsequently shown to result in loss of protection against PFTs in mammalian cells as well C. elegans and mammals To address many of these limitations, an excellent genetic system for studying PFT responses in an intact animal has recently emerged: the C. elegans mutants hypersensitive to PFTs C. elegans mutants resistant to PFTs. The reason for this assumption is that no intracellular pathway mutants were known that can make cells resistant to PFTs in general. Here we report on the results of a PFT resistance screen and find, unexpectedly, that resistance can be achieved by mutations that up-regulate the C. elegans low oxygen (hypoxia) response. Elimination of HIF-1 (hypoxia inducible factor 1), the main effector of the hypoxia pathway, abrogates this resistance and can lead to PFT hypersensitivity. This protection applies to multiple different PFTs and is clearly distinguished from the role of the HIF-1 pathway in other stress responses and aging. Furthermore, the hypoxia pathway is activated in response to PFTs, and low oxygen is itself protective against PFT attack. Our results indicate that the hypoxia/low oxygen response is likely to be of general importance for cellular responses to small-pore PFTs.Since, when studying intracellular PFT response pathways in the past, we have screened for To identify pathways important for cellular responses to PFTs, we screened for mutants resistant to the PFT Cry protein, Cry21A. Cry21A is a three-domain Cry protein that targets nematodes and is in the same family as Cry5B C. elegans hermaphrodites were mutagenized with EMS and allowed to self-fertilize for two generations. Sixty eight thousand F2 mutagenized hermaphrodites were fed an intoxicating dose Cry21A PFT and then screened for those that resisted intoxication. One mutant line, allele ye49, was identified that bred true and is resistant to Cry21A PFT produced either from Bt or E. coli  and found that ye49/egl-9(sa307) animals are resistant to Cry21A PFT, indicating ye49 fails to complement egl-9(sa307) and most probably mutates the same gene  that upon translation is predicted to truncate the protein in the prolyl hydroxylase domain, thereby eliminating protein hydroxylase function  results in animals resistant to Cry21A  pathway (C. elegans) is hydroxylated by a prolyl hydroxylase  that then increases HIF-1's affinity for von Hippel-Lindau tumor suppressor protein , part of an E3 ubiquitin ligase complex. Association of HIF-1 with VHL-1 eventually leads to HIF proteasomal degradation. When EGL-9 is disabled by mutation, HIF-1 is stabilized at constitutively high levels even under normoxic  conditions The EGL-9 protein is a prolyl hydroxylase and functions in the  pathway . The abiSince loss of EGL-9 function confers resistance to Cry21A PFT, we hypothesized that other elements of the hypoxia pathway might be important as well. We therefore performed quantitative dose-dependent mortality assays using null or putative null alleles of all the above elements of the hypoxia pathway. L4 staged animals from each genotype and wild-type N2 were placed in numerous doses of Cry21A PFT or Cry5B PFT and scored for viability after a few days .egl-9(sa307) and egl-9(ye49) animals are resistant to PFT-induced mortality relative to wild-type animals, with resistance strongest at higher PFT doses , loss of EGL-9 results in 3\u20135 fold resistance over wild-type animals to Cry21A or Cry5B PFTs  mutant animals are resistant over a similarly wide range of Cry21A and Cry5B PFT doses  mutant animals on Cry21A PFT. RHY-1 (regulator of hypoxia-inducible factor) antagonizes HIF-1 function by inhibiting expression of some HIF-1 target genes via a VHL-1 independent pathway 50 values, animals lacking RHY-1 are 5.7\u00d7 resistant to Cry21A PFT  and egl-9(sa307) hif-1(ia04) double mutant animals to Cry21A and Cry5B PFTs. When fed Cry21A, hif-1(ia04) animals have a response that is indistinguishable from wild-type animals (egl-9(sa307) hif-1(ia04) double mutant animals have a statistically identical response to Cry21A as wild-type animals at all doses except at 8 \u00b5g/mL  and egl-9(sa307) hif-1(ia04) animals on Cry21A PFT are statistically identical (P>0.05) but both statistically different than that of egl-9(sa307)  mutant animals subject to egl-9 RNAi are not (egl-9(sa307) mutants are resistant to Cry21A, this resistance is suppressed by RNAi of hif-1. Thus, HIF-1 is required for Cry21A resistance mediated by loss of EGL-9.To confirm that the resistance associated with  animals ; Table 1 are not . Similari.e., loss of HIF-1 suppresses Cry5B PFT resistance associated with loss of EGL-9). There is, however, one striking difference between the hif-1 results with Cry21A and Cry5B. Both hif-1(ia04) and egl-9(sa307) hif-1(ia04) animals are hypersensitive to Cry5B PFT relative to wild-type animals. That is, animals lacking HIF-1 are more readily killed by Cry5B PFT than wild-type animals, especially at doses \u223c5\u201310 \u00b5g/mL  The results with Cry5B PFT are similar to those of Cry21A ; Table 1 P<0.05; ; Table 1C. elegans two V. cholerae strains that differ primarily in their ability to produce another small-pore PFT, VCC. VCC is a virulence factor of V. cholerae and mutants lacking VCC are attenuated for pathogenesis in vivo, especially for strains lacking cholera toxin C. elegans lacks sialic acid that the B subunit binds to as part of its GM1 receptor C. elegans, CVD109(VCC+) is more virulent than CVD110(VCC\u2212), demonstrating that VCC is a virulence factor for C. elegans  animals are resistant relative to wild-type animals (egl-9(sa307) animals are not resistant (hif-1(ia04) and egl-9(sa307) hif-1(ia04) animals are, as with Cry5B PFT, hypersensitive relative to wild-type animals on CVD109(VCC+)  mutant animals are hypersensitive compared to wild-type animals to CVD110(VCC\u2212) strain  protects the animals against VCC and PFTs (hence egl-9 mutants are resistant to the VCC+ strain), activation of the hypoxia pathway may make the animals more susceptible to other V. cholerae virulence factors. The relative contribution to these responses (protection versus susceptibility) is dependent upon which virulence factors are present and their relative contribution to virulence. In the VCC+ strain, the PFT has important function. Hence, the protective role of pathway activation can be discerned. In the VCC\u2212 strain, the PFT defense is no longer needed. Hence, the susceptible role can be discerned. It is this give-and-take interaction between the host and virulence factors that could partly explain why constitutive mutation in egl-9 is not selected in the wild. In any event, taken together, our Cry PFT and VCC data demonstrate that stabilization of HIF-1 results in resistance to VCC PFT whereas loss of HIF-1 results in hypersensitivity to VCC PFT.Our results with hypoxia pathway mutants on CVD109(VCC+) and CVD110(VCC\u2212) are striking and parallel those with Cry PFTs. When feeding on CVD109(VCC+), esistant ; Table 2egl-9 mutant animals might show resistance to other stressors as well. We found that, relative to wild-type animals, animals lacking EGL-9 are resistant to killing by 1) the pathogen Pseudomonas aeruginosa PA14; 2) heat stress; and 3) oxidative stress (daf-2 mutant egl-9(ye49) and egl-9(sa307) mutant animals live longer than N2 wild-type when feeding on the standard E. coli strain (Because loss of EGL-9 results in resistance to PFTs (here) and cyanide e stress . Since ci strain , Table 2hif-1(ia04) loss-of-function mutant animals as well as egl-9(sa307) hif-1(ia04) mutant animals are resistant to P. aeruginosa PA14 infection, heat stress, and oxidative stress  animals , is sufficient to rescue the egl-9(sa307) Cry21A resistance phenotype. Control animals in which green-fluorescent protein (GFP) was expressed from the cpr-1 promoter did not result in rescue. Quantitative mortality assays using two independent lines of cpr-1::egl-9-transformed egl-9(sa307) mutant animals confirm that intestinal-specific expression of EGL-9 rescues Cry21A PFT resistance to a level statistically indistinguishable from N2 wild-type (not shown). These data are consistent with the hypoxia pathway acting to directly counteract the effects of PFTs and not, for example, providing protection via altered behavior.Bt Cry PFTs attack intestinal cells  animals , but notC. elegans and asked if any of these are involved in PFT defenses. One pathway immediately surfaced, the unfolded protein response or UPR C. elegansTo address how the hypoxia pathway might function in protection against PFTs, we sought in two ways to find functional downstream effectors of the pathway. First, we compared known functional targets of the hypoxia pathway in xbp-1 mRNA, which is spliced upon activation of the pathway xbp-1 levels in egl-9 mutant animals . However, to date no functional role of nhr-57 for any HIF-1-regulated pathway has been shown.We conversely asked if any of the genes known to be involved in PFT INCED are known to be important for the hypoxia pathway. From over 100 PFT INCED genes we have identified in our lab, we found one and only one currently known to be regulated by the hypoxia pathway, nhr-57 results in animals slightly but statistically hypersensitive to Cry5B PFT . We find that 4 and 8 hours of treatment with PFT significantly induces nhr-57 expression 5.3 and 3.6 fold respectively  oxygen levels minus or plus the presence of E. coli-expressing Cry5B PFT. We find that low oxygen is indeed protective against PFT intoxication in that animals exposed to PFT in a low oxygen environment for 24 hours are significantly healthier than animals exposed to PFT in normoxia (hif-1(ia04) mutant animals exposed to Cry5B PFT do not get any protection when placed in a hypoxic environment  could be achieved by up-regulation of HIF-1 and/or by hypoxia. The identification of the hypoxia pathway as an important PFT INCED pathway thus unexpectedly provides a novel and potentially powerful means of protecting against the single most common mode by which bacterial pathogens attack us.To our knowledge, these results are the first to demonstrate that an intracellular pathway can be altered to promote general egl-9(sa307), hif-1(ia04), egl-9(sa307) hif-1(ia04), vhl-1(ok161), rhy-1(ok1402), the Hawaiian strain CB4856 and HT1593 [unc-119 (ed3)] were obtained from the Caenorhabditis Genetic Center (CGC). All strains were either previously outcrossed or outcrossed here at least six times , rhy-1(ok1402)). egl-9(sa307) is a null allele of egl-9 that carries an internal 243-bp deletion removing part of exons 5 and 6 hif-1(ia04) allele removes exons 2, 3 and 4 of hif-1, including the DNA binding domain, and is believed to be a null allele vhl-1(ok161) allele removes exons 1 and 2 of vhl-1 and is believed to be a null allele rhy-1(ok1402) allele deletes exons 2, 3 and 4 of rhy-1 and is also believed to be null Strains were maintained at 20\u00b0C under standard conditions cry21A gene was cloned under 700 bp of the cry6A promoter region and subcloned into the Bt/E. coli shuttle vector pHT3101. The plasmid was transformed into a nontoxic host Bt strain (4D22). Cry21A SCLs were prepared using standard procedures For production in Bt, the Mutagenesis and selection of Cry21A resistance mutants was carried out as described for Cry5B egl-9(sa307) males and dpy-17(e164);ye49 hermaphrodites. As a control, cross-progeny from egl-9(sa307) males into dpy-17(e164) and from N2 males into dpy-17(e164);ye49 were also tested. ye49 was mapped between dpy-11(e224) and unc-76(e911) using standard three-factor mapping. A dpy-11(e224) ye49 unc-76(e911) triple mutant was then made in order to perform single nucleotide polymorphism mapping with the Hawaiian strain (CB4856) Complementation tests were performed by testing F1 progeny from the cross between egl-9(ye49) animals were used to sequence the egl-9 gene. For transformation rescue, a 13.4kb-PCR fragment covering from 3kb upstream to 2kb downstream of egl-9 transcript was amplified with primers GAGCAACTCGTGGGTTTGTT and CTTCCAGAGGCGTTGTCTTC using the LongAmp Taq (Biolabs) from N2 genomic DNA and injected in egl-9(ye49) worms as described Genomic DNA and cDNA prepared from egl-9 rescuing plasmids were constructed by PCR amplification of unc-31 and cpr-1 promoters and then fused to egl-9 and gfp open reading frames using the Multisite Gateway cloning system (Invitrogen) and pCG150 (containing unc-119 rescuing fragment) unc-119(ed3);egl-9(sa307)] by ballistic bombardment For tissue-specific rescue, E. coli toxin assays, we used E. coli JM103 with pQE9 empty vector or a cry21A gene insert under control of the lacZ promoter E. coliFor Cry21A Dose-dependent mortality assays with purified Cry5B were performed as described V. cholerae lifespan assay was performed as described \u0394(ctxAB zot ace) and CVD110 r\u0394(ctxAB zot ace) hlyA::(ctxB mer) Hg strains, derived from V. cholerae El Tor E7946, were used P. aeruginosa lifespan assays were performed on slow-killing plates as described E. coli strain HT115 expressing double-stranded (ds) RNA  testing on Cry5B PFT was performed slightly differently . Briefly, rrf-3(pk1426) animals were fed E. coli-expressing dsRNA in liquid media with 1mM IPTG at 25\u00b0C for \u223c30 h. 20 \u00b5g/ml of Cry5B or 20 mM HEPES control were then added, as well as 200 \u00b5M FUdR. Hermaphrodites viability was scored after 6 days at 25\u00b0C.  and 50 \u00b5g/mL ampicillin spread with hif-1(ia04) mutant animals were pipetted onto toxin plates spread with 30 \u00b5l of a mixture of E. coli OP50 strains expressing or not Cry5B at the ratio 1\u22361. Plates were placed immediately in a 2% O2 chamber for 24 hours, while control plates were placed in room air. Images were taken with an Olympus BX60 microscope as described To test worms under hypoxia, L4 wild type and xbp-1 mRNA, we used primers xbp-1_sqf2 GCATGCATCTACCAGAACGTC and xbp-1_sqr2 GTTCCCACTGCTGATTCAAAG to amplify cDNA from wild-type and egl-9(sa307) animals. The forward primer xbp-1_sqf2 anneals to exon 1 and the reverse primer xbp-1_sqr2 anneals to the exon1-exon 2 junction sequence produced when intron 1 is spliced out. The experiment was carried out using two independent sets of cDNA and two repeats within each set. Primers TTATCGAGTTTCTCGCATTGG and AAGTCTGCAATCACGCTCTGT were used to quantify expression of nhr-57. Induction of expression of nhr-57 by Cry5B was tested in glp-4(bn2) animals treated for 1, 2, 4 and 8 hours on E. coli OP50 strains expressing Cry5B or not. The experiment was carried out using three independent sets of cDNA. Normalization in all cases was to eft-2 transcript levels.Real time PCR was performed as described 50 values were determined by PROBIT analysis LCFigure S1egl-9 mutant animals resist Cry21A PFT-induced sterility. Numbers given are the relative brood sizes of wild-type N2 and egl-9(ye49) animals on Cry21A normalized to no-toxin controls (mean of three independent assays). For brood size assays, L4 hermaphrodites from N2 and egl-9(ye49) were picked one each to four to six plates and incubated at 20\u00b0C. Every 24 h, the originally picked worms would be picked to a new plate; progeny from the old plate were counted 24 h later. This process was continued until the original parents ceased to produce progeny. On E. coli plates expressing Cry21A, N2 animals show a 6.2-fold reduction in fertility, while egl-9(ye49) show only a 1.5-fold reduction in fertility. Error bar represents standard error of the mean. P\u200a=\u200a0.03 (one-tailed T test).(0.87 MB PDF)Click here for additional data file.Figure S2rhy-1 mutation confers resistance to Cry21A PFT. Dose-dependent mortality assays were performed using Cry21A spore crystal lysates to quantitatively compare sensitivities of wild-type N2 and rhy-1(ok1402) mutants. Each data point shows the mean and standard error of the mean from three independent experiments . Statistical differences between mutant strains and N2 are given for each concentration using P values represented by asterisks as follows: * P<0.05; ** P<0.01; *** P<0.001. LC50 values and % alive at specific doses are reported in (1.98 MB PDF)Click here for additional data file.Figure S3egl-9(sa307), and hif-1(ia04) mutant animals were treated with RNAi of either empty vector (L4440), egl-9, hif-1 or dpy-3 (positive control for RNAi effectiveness) and exposed to E. coli expressed Cry21A PFT for 48 hours. When put on toxin plates, only wild-type animals on egl-9(RNAi) and egl-9(sa307) on either empty vector, egl-9(RNAi), or dpy-3(RNAi) display a resistance phenotype. RNAi of hif-1 in the presence of egl-9(sa307) suppresses Cry21A PFT resistance. RNAi of egl-9 in the presence of hif-1(ia04) does not confer resistance to Cry21A. Scale bar is 0.5 mm.RNAi confirmation that Cry21A resistance associated with loss of EGL-9 is mediated through HIF-1. Wild-type N2, (4.07 MB PDF)Click here for additional data file.Figure S42) for 72 hours (bottom two rows). Worms co-treated with hypoxia and Cry5B are significantly healthier  than worms treated with Cry5B under normoxia. Scale bar is 0.2 mm.Hypoxia confers protection against Cry5B PFT. Resistance to Cry5B PFT was compared among wild-type N2 worms in normoxia (top two rows) and in hypoxia (1.5% O(0.55 MB PDF)Click here for additional data file.Table S1Data and analyses of VCC, PA14, and lifespan repeat assays.(0.10 MB PDF)Click here for additional data file."}
+{"text": "A series of experiments on rats have been performed, to study the effects of long time (50 days) exposure to electromagnetic fields of extremely low frequency  and amplitude , testing whether the metabolic processes would be affected. The background lies on recent observations on the behaviour of isolated enzymes in vitro exposed to EFL fields. In these experiments, the cyclotron (or Larmor) frequency of the metallic ion has been used to \"stimulate\" the metalloproteins redox-active site, thus obtaining a clear variation of the enzyme functionality. In this paper we have extended for the first time the check to more complex animal metabolism. The novelty of this approach implies that a large amount of data had to be analyzed since it was not possible, in principle, to select only a few parameters among all the potential effects. Several biochemical parameters have been evaluated by comparing their values during the periods of exposure (field ON) and non exposure (field OFF). The evidence that long term exposure to electromagnetic fields with a well defined frequency may have relevant effects on parameters such as body weight, blood glucose and fatty acid metabolism has been obtained. Exposure to artificially generated electromagnetic (e.m.) fields is a common occurrence for a large number of individuals: its biological consequences, still largely unknown, are being studied in experimental animals -4 and inc q and m are respectively the electrical charge and the mass of the ion, and B0 is a constant magnetic field. Furthermore, according to Zhadin and co-workers [ac, which has a frequency matching the cyclotron frequency fc. Such a mechanism should be a good candidate to explaining the selective enhancement of the ions flow through the cell membranes, and would consequently affect the rate of biochemical reactions and the enzymatic activities.In the '80s, it has been recognized ,10 that -workers ,12 an iom and charge e in a constant magnetic field of strength B0 leads to the superposition of a uniform precession of angular frequency fL (known as Larmor precession) about the direction of the field on the original motion. The Larmor precession provides a mechanism by which biological systems become sensitive to small static and resonating magnetic fields extensively described by Edmonds [More recently, these observations have been checked by applying e.m. fields to isolated enzymes studied in vitro. The cyclotron (or Larmor) frequency of the metallic ion has been used to \"stimulate\" the metalloproteins redox-active site . The sim Edmonds . As cleaIn order to investigate the possible consequences of such findings on living organisms, a series of experiments with rats exposed to fields of very low intensity and frequency were carried out, aimed at testing whether such non-thermal e.m. fields may influence the basic metabolic processes. The novelty of our approach leads to the analysis of a large amount of data since it was not possible, in principle, to select only a few parameters among all the potential targets. In these experiments, it has been observed that biochemical and morphological parameters have been affected by 50 days exposure, even though the amplitude and frequency of the field was largely under the threshold usually considered to be effective by the medical community. In order to maximise the likelihood that preliminary experiments might reveal biological effects of some relevance, aging animals were also studied, considering that adult animals may be more resistant to external interventions than aging animals.Experiments on the effects of the ELF (Extremely Low Frequency) weak electromagnetic fields have been performed by using the electronic equipment QUEC-PHISIS QPS1\u2122, provided by PROMETEO S.r.l. .The electronic device being used is able to generate waves in the range where the cyclotron frequencies of the ions involved in metabolic processes lie. Moreover, it is well known from clinical impedencymetry  that e.mThe magnetic field produced inside the cage was measured during the exposure with a gauss meter F.W Bell (Sypris Q3 Test and Measurements) Mod. 7010 equipped with a low field Hall sensor MOX 71-2506-05, with the resolution of 0.1 nT.\u03bcT, in order to stimulate the Ca2+ dynamics. The amplitude was set equal to the amplitude of B0 in order to accomplish to the range of validity of the Edmonds model.In order to study the influence of a prolonged exposure to these fields, initially one coil of 75 cm of diameter was used, which allowed the exposure of two rats in one cage positioned just in the middle of the coil Such a dimension let us to dwell easily a cage for long time, thus avoiding disturbing the animal's daily life. The field produced had a frequency of f = 31.6 Hz and an amplitude of about 40 2+ ion dynamics. In fact the q/m ratio of Ca2+ ion is 4.81 \u00d7 10-6 Coul/kg, the corresponding fc/B0 is 0.76 (Hz/\u03bcT) and the resonant frequency has been calculated being the measured geomagnetic field of 41.5 \u03bcT.In a subsequent experiment, a set of identical Helmoltz coils arranged on a rack Fig.  was asse0 magnetic field amplitude, accurately measured during the exposure, ranged between 35.5 and 51.6 \u03bcT, as it can be seen in details in Fig. 3+ and Mn3+ having an fc/B0 ratio quite similar to the Ca2+ might have been activated.However, the peculiar geometry and the materials of the rack and of the grids of the cages (stainless steel) did not allow a uniform static magnetic field level to be reached neither along the ax of the rack nor on the plane of the five cages. Thus, the BThis Research Project was communicated on July the 7th 2005. to the Ministry of Public Health as stated by Laws (D.lgs 116/92).ad libitum with water at disposal, was utilised.The animals were kept in stabulary controlled conditions all over the duration of the experiments : temperature 21\u00b0C \u00b1 1; hygrometry between 40% and 70%; air change per hour 8 to 12 volumes; nyctohemeral cycle 12 h/12 h; lightning 300 to 600 lux at 1 meter over the floor; noise < 60 db. The cages bases were made out of polypropylene while the ceilings were in stainless steel. In each cage up to 4 adult animals, or 3 aging animals, could be housed. A complete maintenance diet for rats , administered dry In a preliminary experiment two WISTAR SPF(Specific Pathogen Free)/VAF(Virus Pathogen Free) male rats (age at the beginning 50 weeks) were exposed to a field specifically designed to modify calcium dependent enzymatic activities as indicated in the previous paragraph, for 35 days continuously. The animals were then observed without any other intervention for 182 days after the exposure. The limited number of animals used was due to the necessity of a constant exposure and the availability of a small set up. Furthermore, two animals of the same strain, used as controls, were kept in the same conditions without exposure.In the main protocol, 13 male OFA (Oncins France Strain) SPF/VAF rats, from Charles River Laboratories Italia , were exposed for a total time of 50 days.st blood drawing . After this first drawing 2 adult rats and 1 aging rat died. From 2nd to 29th day, all rats were subjected to continuous irradiation by low intensity and frequency electromagnetic fields (ELF) (field ON); on 15th and 29th day respectively, 2nd and 3rd blood drawing was carried out. From 30th to 36th day ELF were deactivated (field OFF); on 36th day 4th blood drawing was carried out. From 37th to 50th day of trial ELF were reactivated (field ON); on 50th day 5th blood drawing was carried out. After the third and fourth drawing two other aging rat were lost. On 50th day of trial all rats were sacrificed by intracardiac inoculation of embutramide + mebezonium iodide + tetracaine hydrochloride.Eight animals were 8\u201312 weeks old, and Eight animals were 68\u201372 weeks old. They were hosted into the cages according to the scheme: 4 adult rats in cage 1; 4 adult rats in cage 2; 2 aging rat in cage 3; 3 aging rats in cage 4; 3 aging rats in cage 5. After 15 days of adaptation, all rats were subjected to 1After each blood drawing the rats returned to the same cage. During the experiment, it was decided to submit to euthanasia subject 3 of cage 5 before the others for its health status, while rat 2 of cage 4 died twenty days before the end of the trial.st, 15th, 29th, 36th, and 50th day together with blood drawing, and the amount of food consumed by each group was noted during the trial.The individual body weight was controlled on 1The data shown in the Figures are the averages on the animals which survived along the whole duration of the experiment, i.e. 6 adult and 5 aging rats.\u03bcm thickness, and stained with H&E. Liver sections were also stained with periodic acid-Schiff (PAS)/diastase techniques to assess hepatic glycogen.A complete post-mortem examination of all the animals was performed after euthanasia and lungs, heart, spleen, liver, pancreas, kidneys, skeletal muscle and brain samples were fixed in buffered 10% formalin. Half of the brain, ocular tract and eyes were frozen and stored at -80\u00b0. Tissues were then processed in routine manner for histological evaluation, cut at 5 2-EDTA were utilized to determine several haematology and biochemical parameters (see below). Blood sampling was performed in animals with no restriction to food availability. In order to reduce variability due to recent food uptake, care was taken to obtain samples at the same time of the day, namely between 3 and 4 pm, i.e. 7\u20138 hours after light start.All blood samples were obtained by intracardiac drawing after anaesthesia with tyletamine hydrochloride and zolazepan hydrochloride combined with xilazine hydrochloride. Blood samples added to K2-EDTA, by ADVIA 120 HEMATOLOGY SYSTEM  provided with specific veterinary software for rats.Haematological parameters  were measured in blood samples, added up with K2-EDTA, by automatic analyser ROCHE HITACHI 912 PLUS .Biochemical parameters (Alanine aminotransferase (ALT), Aspartate aminotransferase (AST), Creatine kinase (CK), creatinine, cholesterol, glucose, total protein, tryglicerides, urea) were measured in plasma samples, obtained after centrifugation of blood samples added with K\u03c99), linoleic acid (C18:2\u03c96), linolenic acid (C18:3\u03c93), eicosatrienoic acid (C20:3\u03c99), arachidonic acid (C20: 4\u03c96), docosaesanoic acid (C22: 6\u03c93), and nervonic acid (C24: 1\u03c99)), derived as methyl esters, were measured in plasma samples according to Carnielli [Fatty acids , stearic acid (C18:0), oleic acid  and a relatively long follow up (182 days), both animals reached a weight of over 900 grams, while the two control animals reached a value of about 400 grams.2+, Mn3+ and Co3+ might be involved. Such a circumstance makes it more difficult to relate the effect observed on metabolism to a specific ion and, trough the ion to a specific metabolic reaction. Furthermore, exposure was applied for selected periods (ON) followed by a short periods without any exposure (OFF). Everything but the AC field was kept constant during ON and OFF periods. A control group could not be used in this experiment, thus variations between on and off periods were considered as a built-in control. The OFF periods are quite well visible as changes in the rate of the monitored issues: they signal a different adaptation time of the organism in case of an external perturbation. Furthermore, the strain of rats we used in this experiment are very well characterized in their physiological parameters, hence what we observed and reported here can be compared with a large amount of historical data. Among a number of parameters recorded, in this paper are only discussed which who showed striking variations.After this exploratory experiment another experiment was performed by using animals of two different ages. In this case, exposure was not characterized by a unique frequency of exposure field, because of the disposal of the cages along the rack as discussed above, but a quite broad number of ions, including CaWith regard to body weight, the initial values observed were in agreement with the historical set (338 \u00b1 19 gr. for adult and 599 \u00b1 46 gr. for aging rats). Exposure appears to modify severely such an integrated parameter, as shown in Figure Exposure appears to modify also blood glucose content, both in adults and in aging rats, as shown in Figure The effect of e.m. field on lipid metabolism is the most interesting finding of this research. Cholesterol and triglycerides appear to be only marginally affected by the stimulus applied, in fact, both parameters did not change throughout the experiment in both groups, however total free fatty acids and single fatty acids analysis showed visible changes. While exposure did not change substantially these parameters in adult animals, clear differences between the initial values and the final ones appear in aging animals. Figure With reference to haematology data, samples were available only for some of the rats, however in general terms we observed that leukocyte count tends to decrease during the experiment.Finally, it is interesting to mention that at post-mortem examination no relevant gross findings were observed. In fact, most noticed lesions, in both age groups, are minimum blood collections in the pericardium  and in the thorax (5 rats). In 3 rats hemorrhagic findings were seen also in other sites. These findings are related to blood sampling and euthanasia.Main findings of histopathological studies can be summarised as follows. A frequent finding was hepatic glycogenosis: PAS/diastase showed a mild multifocal staining in young animals (12 weeks old), while glycogen amount in hepatocytes cytoplasm was higher and diffusely distributed in 72 weeks old rats. Other changes did not show any significant difference between the two groups.The ultimate goal of our research is the possible application of electromagnetic fields in the treatment of human and animal diseases, where ionic regulation of enzymatic activities have been altered and their restoration to normal is potentially useful for the patient. The present results give several helpful suggestions, both in terms of selection of possible patients and in terms of safety in order to reach this purpose. The present experimental work was carried out in order to have a coarse evaluation of the effects of the exposure, thus no defined experimental end point was selected a priori. Such an approach was mainly due to the fact that this kind of exposure had not been previously studied by other researchers and there is no available literature. This aspect not only makes it difficult to compare our findings with other results, but it also influenced the experimental design, preventing the possibility to choose in advance the most significant parameters to be measured. Nevertheless, the novelty of the observations and their relevance  deserve, in our view, the preparation of the present report.\u03bcT and a frequency of about 31 Hz is reported here for the first time. The animals exposed had their weight doubled as compared to the weight of control animals of the same strain, while no other negative effect has been observed in their physiology after 182 days of follow up and during the post mortem examination. This effect has been observed in two different experiments even though the second group was exposed for 50 days with an interval of 15 days (field OFF) and the weigh increase (about 150 grams) was observed only in adults and not in aged animals. The weight increase observed is clearly higher than expected on the basis of the historical data available for these particular strains in the IFFA CREDO database.First, a huge effect in the growth of rats exposed to e.m. field having an amplitude of 40 Second, changes in several metabolic parameters as a consequence of exposure to e.m. fields have been also observed. The frequency of the field was such to \"stimulate\" several ions in the sense of the cyclotron frequency. These ions may be involved in the enzymatic chains experimentally affected. This issue needs to be analyzed in detail in the future through well designed experiments.Even though the data available are not exhaustive, because of the limited number of animals observed up to now, no major pathological signs related to exposure have been observed in post mortem analysis. Indeed, as far as authoptic findings are concerned, most of the findings described were noticed in both groups, independently from age, and they could be iatrogenic or aging-related. In fact, gross hemorrhagic lesions and some of the described microscopic changes  are possibly related to intra-cardiac blood sampling and to injections of anaesthetic drugs. In particular, changes observed in nervous tissues could be due to an early mild hypoxic condition .From a regulatory point of view, the intensity of the fields applied is considerably below the threshold risk value, our preliminary new data seem to agree with this view and at present there is no reason for concern. From the point of view of patient selection, our findings cannot be directly extrapolated to human pathologies. In general terms, aged animals appear to be more sensitive to the exposure: major changes have been observed in this group and not in the adult animals. In particular the derivatives of the individual responses are much higher in the ON-OFF transient especially for aging animals, In order to explain these observations, we suggest that adult young animals have the capability to reach homeostasis even in the presence of external stimulation, like the one we applied, while aging animals have a reduced capability to cope with external stimulation and thus measurements of several variables are likely to reveal alterations.By analyzing the observed changes in aging animals, it can be said that: a) body weight increased during the first and the second period of exposure and decreased in the off period this results confirms the first experimental run described; b) blood glucose substantially increased in this group more than in young animals; c) the circulating levels of specific free fatty acids clearly show the effect of the exposure.It is interesting to mention that in a recent paper Torres-Duran et al  showed aKnowing that the total free fatty acid content of the blood may be affected substantially by stress, the data were analyzed as the ratio between different fatty acids, in particular as the ratio between single acids and their metabolic precursors. By applying this kind of analysis, the most interesting findings were related to arachidonate/linoleic ratio, most likely a direct consequence of the enzymatic activity of elongase and desaturase. The baseline of aging rats showed substantially higher values than in adults, likely indicating enhanced conversion, furthermore, exposure did not substantially modify the values in adult rats, while decreased the ratio in aging rats, thus bringing the ratio closer to that observed in adults. The importance of such a difference in the comparison between adults and aging rats is further outlined by the fact that other calculated ratios, such as eicosatrienoic/oleic acids ratio and docosaenoic/linolenic acids ratio, were different neither at baseline, nor after exposure.In conclusion, we provide initial evidence that long term exposure to well defined electromagnetic fields may have relevant effects in mammals, thus affecting parameters like body weight, blood glucose and fatty acid metabolism. The present findings have to be confirmed and extended to fully understand their importance; nevertheless, they indicate that this line of research may lead to important results. The clinical consequences of these observations cannot be precisely estimated yet, even tough they point out towards a rational target for possible therapeutic interventions, to be analysed in further studies.Authors disclose any financial and non-financial competing interests  related to the publication of the manuscriptGG carried out the experiments and helped to draft the manuscript. ADN analyzed the results and drafted the manuscript. MP analyzed the results and drafted the manuscript. VF carried out the experiment and helped to draft the manuscript. FB supervised the electronic equipment. SM carried out the histopathological studies. DB analyzed the results and helped to draft the manuscript. GT conceived of the study, and participated in its design and coordination. All authors read and approved the final manuscript"}
+{"text": "The objective of this study was to compare the utility of Thin-Prep (TP) cytologic preparation with that of Cell Block (CB) preparation in the diagnosis of thyroid lesions, mainly follicular epithelial lesions, by fine needle aspiration biopsy (FNAB). Feasibility of using the TP slides for immunocytochemical stains is also discussed.A total of 126 consecutive cases of thyroid FNAB with TP slides and 128 consecutive cases of thyroid FNAB with CB slides were reviewed blindly by two cytopathologists. The presence of colloid, follicular cells, macrophages and lymphocytes/plasma cells were recorded and scored 0\u20134 on each case based on TP or CB slide review. The cytologic diagnoses were grouped as follows: cyst, colloid nodule, colloid nodule with cystic change, chronic thyroiditis, atypical/neoplastic and non-diagnostic.The TP slides had higher diagnostic rate than CB slides. The diagnostic yield was 68% of the TP slides whereas only 24% of the CB slides were diagnostic. Also, only 4 atypical/neoplastic lesions were diagnosed on the TP slides and the corresponding direct smears, while 5 cases of atypical/neoplastic lesions were diagnosed on the smears but could not be diagnosed on the corresponding CB slides. Additionally, the TP slides revealed cytologic features that were not observed on the direct traditional smears of the same case.In thyroid FNAB cases, TP slide preparation is superior to CB slide preparation and is more likely to have greater cellularity for diagnosis and detect atypical/neoplastic thyroid lesions, particularly those of follicular cell origin. Furthermore, TP slides appear to detect helpful diagnostic cytologic features and should be considered complementary to, rather than replacing, direct smears. FNAB is a cost effective and perhaps the best procedure for the initial evaluation and diagnosis of thyroid lesions ,2. It isA major advantage of the CB method is the ability to perform multiple immunocytochemical stains or other special stains if needed . HoweverWe retrieved the slides and cytology reports of the first 126 cases of thyroid FNA biopsies since converting to the TP method, and also the last 128 cases of thyroid FNA biopsies made with CB method. These FNAB cases were all office procedures done by experienced endocrinologist, with or without ultrasound guidance, usually using 22 or 23 gauge needles connected to a 10 c.c. syringe. The direct smears were mostly alcohol fixed (spray fixation) and stained with Papanicolaou stain. In few cases, half of the smears were air-dried and stained with Diff-Quik stained. The remaining aspirate specimen was rinsed in Saccomono's fluid for CB preparation. After converting to the TP method, the remaining aspirate material was rinsed in the physician's office in buffered fixative, Cytolyt Solution . In the lab, the specimen was spun down, resuspended in a buffer PreservCyt (Cytyc Corporation) and then processed in Thin Prep Processor 2000 (Cytyc Corporation). The TP, CB and direct smear slides were evaluated blindly by two independent cytopathologists without knowledge of the original diagnosis. The examined slides were scored 0\u20134 on specific cytologic features as follows: cellularity ; colloid ; macrophages ; and lymphocytes/plasma cells . The individual value of each cytologic feature was entered in a designed grid immediately after microscopic examination. The cytologic findings of both pathologists were compared and had high interobserver agreement. In few cases, there were minor differences in scoring, the slides of these cases were jointly reviewed and diagnostic concurrence was obtained. The final cytologic diagnoses for both the TP and CB on each case were classified into the following categories according to previously published cytologic criteria: 1. cyst, 2. colloid nodule, 3. colloid nodule with cystic change, 4. chronic thyroiditis, 5. atypical, 6. neoplastic and 7. nondiagnostic.Table The TP slides were more likely to detect colloid nodules and chronic thyroiditis. There were 52/126 (41%) TP slides diagnostic of colloid nodules/colloid nodules with cystic change compared to only 10/128 (8%) diagnosed on CB slides. Most of the cases had more follicular cell groups on TP slides than on the direct smears of the same case  of TP slides displayed cytologic features consistent with chronic thyroiditis, in contrast to only 4/128 3%) of CB slides  of the cases, while CB slides were diagnostic in only 31/128 (24%) of the cases. The CB and TP slides had similar diagnostic yield only in cases of degenerative thyroid cysts, 17/128 (13%) vs. 16/126 (13%), respectively. In cases of colloid nodules or colloid nodules with cystic change, CB had diagnostic yield of 10/128 (8%) compared to 52/126 (41%) on TP slides. We also found that CB slides were diagnostic of chronic thyroiditis in only 4/128 (3%), while TP slides were diagnostic in 14/126 (11%). More significantly, we found that 5 CB slides failed to identify atypical/neoplastic lesions, including 2 follicular neoplasms that were diagnosed on the corresponding smears. On the other hand, 4 TP slides detected atypical/neoplastic lesions, including 1 papillary carcinoma, that were also diagnosed on the corresponding smears. This sharp contrast is perhaps the most important finding in our study showing that TP slides are more likely to detect atypical/neoplastic lesions than CB slides in thyroid FNAB cytologic evaluation.Our results are essentially in agreement with those of previous studies which demonstrated good diagnostic yield of TP slides of thyroid aspirates. Frost et al found that TP slides of thyroid aspirates have an 85% diagnostic accuracy, and that preparation of only two TP slides is sufficient for accurate cytologic interpretation . Yet, inA major advantage of CB preparation is the ability of performing special stains or immunocytochemical stains if needed . This haSome authors have also elaborated on the cytologic features of specific thyroid lesions, such as follicular lesions and papillary carcinoma, on TP slides of thyroid FNAB specimens and described the differences from the features seen on traditional smears or CB slides ,27.In summary, we conclude that TP slide preparation in thyroid FNAB is more useful than CB slide preparation. Our study shows that the diagnostic yield of TP slides is at least twice that of CB slides in detecting thyroid lesions on FNAB, including atypical/neoplastic lesions, except for degenerative cysts. We further believe that TP slides should be made in addition to but not in lieu of direct (Diff-Quik and Papanicolaou stained) smears as they complement each other.FNAB: fine needle aspiration biopsyTP: Thin PrepCB: cell blockThe authors verify that they have no connection or interests to any company or product mentioned in this article."}
+{"text": "Derryck Klarkowski and Daniel Orozco describe the M\u00e9decins Sans Fronti\u00e8res program for monitoring the quality of microscopy for malaria, pulmonary tuberculosis, and leishmaniasis. The international humanitarian medical aid organization M\u00e9decins Sans Fronti\u00e8res/Doctors Without Borders (MSF) supports a wide network of medical laboratories in resource-constrained countries. Although MSF has always prioritized quality control (QC) for laboratory testing, prior to 2005 we were constrained by two significant limitations. First the QC workload was unsustainable in many programs, as MSF used the traditional protocol of reexamining 10% of negative slides and all positive slides. This is no longer considered practical In May 2005, MSF Operational Centre Amsterdam (MSF-OCA) developed and implemented a standardized, centrally reporting QC program to monitor the quality of microscopy for malaria, pulmonary tuberculosis (TB), and leishmaniasis. The malaria component of this protocol has been adapted by the World Health Organization (WHO) as the recommended international standard for malaria microscopy QC The QC protocol was designed to (1) have a small sample size to be feasible across all settings; (2) enable reliable analysis; (3) monitor both false-positive (FP) and false-negative (FN) results; and (4) be applicable to all microscopy testing.The MSF-OCA protocol is based on a sample size of ten slides/month/site (for each test), as field experience has demonstrated that this QC workload is sustainable in most settings, and on the premise that it is better to perform less QC well than more QC poorly. A small sample size is also important to avoid overloading the limited capacity of the reference laboratory in many resource-constrained settings. Programs are encouraged to include more QC slides if this can be achieved without compromising the quality of the reexamination.In summary, each month for each test: (1) Five weak positive slides are selected randomly from all weak positive slides; or if <5 weak positive slides, then all weak positive slides are selected. (2) Five negative slides are selected randomly from all negative slides; or if <5 negative slides, then all negative slides are selected. (3) If there are <5 weak positive (or negative) slides, then the number of negative (or weak positive) slides is increased to give a total minimum sample size of ten. (4) Strong positive slides are excluded from selection in the QC sample. (5) Laboratories unable to perform QC on a minimum of ten slides are assessed on an individual basis.Blinded QC slides are reexamined within 4 weeks in the field by either a reference laboratory or an independent skilled laboratory technician.Weak positive slides are defined as \u22649 trophozoites/acid-fast bacilli (AFB)/10 high power fields. These definitions were consistent across laboratory sites. Postimplementation experience now suggests that the criteria for a weak positive should be reduced to \u22649 trophozoites/AFB/100 high power fields.While small sample QC has the important advantage of practicality, maintaining reliable analysis is also essential. To compensate for the small number of QC slides reexamined each month, our QC protocol uses analysis of cumulative data over 4-month periods , referred to here as \u201ccohort analysis\u201d. These 4-month cohorts are used to increase the sample size analyzed, and as a compromise between the greater statistical stringency of analyzing a larger number of results over a longer duration  versus the greater immediacy of detecting real-time laboratory performance by analyzing QC over a shorter period.To enable FP analysis on small samples, our protocol uses biased sampling to increase the number of positive slides available for reexamination, and the targeting of weak positive slides to increase discriminatory power.QC protocols that use a small sample size with random sampling of all slides, such as lot quality assurance sampling (LQAS) The protocol selects only weak positive slides because errors of false positivity are most likely to occur during routine microscopy through microscopists reporting negative findings as weakly positive (to be \u201con the safe side\u201d) However, because FP results are more likely to occur among weak positive slides, reexamining only weak positive slides  may overestimate the FP frequency in routine microscopy. We correct for this by using the formula:A primary objective for MSF-OCA was to develop a protocol that could be used for all microscopy testing. Although LQAS is recommended by WHO and others for AFB direct-smear TB analysis All QC results were reported to the central office in Amsterdam, which enabled comparative monitoring of results across all programs and the identification of poorly performing laboratories. Summarized analysis was reported back to the field to enable individual laboratories to compare their performance to other laboratories in similar settings.We use percentage agreement because it is simple, direct, and understandable at all levels In contrast to stable programs, such as government health laboratory networks, MSF operates as an emergency humanitarian organization, and laboratory programs open and close according to changing priorities. Therefore the QC analysis presented here reflects the overall performance of MSF-OCA programs over 2005\u20132008 with a changing composition of laboratories.Because only a limited number of laboratories performed leishmaniasis testing, these findings are not presented here.To improve statistical reliability, we only analyzed percent agreement on cohort data that included at least three monthly reports in the 4-month period, and FP and FN on cohort data that included at least ten positive or ten negative slides, respectively . Fifty-sDuring the reported period, the internal MSF-OCA standards were set at \u226595% agreement for all slides (percent agreement) and \u22645% FP and FN slides.Tests of difference between two proportions were performed using the Pearson's Chi-squared test. Analysis was performed using Epi Info 6 (US Centers for Disease Control) and STATA version 8.2 (StataCorp).p<0.001) in the proportion of laboratories meeting each QC target, with the results of 95.7% (45/47), 86.7% (13/15), and 91.3% (42/46), respectively.Marked progressive improvement in the overall malaria microscopy QC performance was seen over the period ; Table 2p\u200a=\u200a0.033) and 77.1%  of laboratories, respectively, met these targets. In contrast, the FN frequency remained relatively constant throughout the period (p\u200a=\u200a0.527).Progressive improvement in the overall AFB microscopy QC performance was seen over the period ; Table 2e period , with no We found the design of our QC protocol to be practical in field settings and easily understood and implemented by laboratory staff with limited training. We attribute this to a combination of a small QC sample size, a fixed number of slides independent of the workload, and use of simple percentage agreement for statistical analysis. The small sample size considerably decreased the QC workload while maintaining statistical reliability by using targeted sampling of only weakly positive slides and 4-month cohort analysis.Our findings show a significant improvement in the accuracy of malaria and AFB microscopy comparing the periods May\u2013December 2005 and January\u2013August 2008. We attribute this improvement to the strengthening of our protocols, field support, and training over this period. However our QC protocol also played a central role by providing key information on a timely basis allowing us to prioritize those laboratory support activities. Also, and we believe critically, the reporting of compiled data back to the field provided the laboratories with clear performance indicators and enabled field laboratories to directly compare their performance against other laboratories working in similar circumstances. In our experience, this generated an environment of positive \u201ccompetition\u201d among laboratories that we believe has also contributed significantly to the improvement in laboratory quality performance.For malaria microscopy, the number of FP and FN results decreased markedly. We attribute this to active follow-up of poorly performing laboratories identified by the QC protocol. In contrast, the frequency of FN results for AFB microscopy did not change significantly, and the improvement in percentage agreement reflects the decrease in the frequency of FP results. Laboratories for AFB also entered the analysis period at a higher level of performance compared with malaria microscopy . This may be because AFB microscopy is relatively easier to perform than malaria microscopy as accurate malaria microscopy requires greater microscopy resolution and has a technically more demanding staining procedure.However we also speculate that the random selection of negative AFB smears, which is the standard methodology for AFB QC protocols and is used in our protocol, may be problematic. Saliva smears are in general more likely to be negative or have an AFB density below the threshold of microscopy detection than sputum smears For the future, we are currently incorporating clerical error monitoring into our laboratory QC protocol, as this can also be a major source of error. With the increasing emphasis on disease eradication, we are also developing QC protocols to accommodate low positivity. Finally, we have implemented a pilot study to exclude saliva smears from the AFB QC sample.From this recent field experience, our laboratory QC protocol was found to be well accepted and understood by all levels of field staff, practical in a wide variety of contexts, able to improve performance, and able to provide valuable program management information. As with all QC, implementation and sustainability requires commitment from field staff and project managers. Ongoing supervision and support are critical for central monitoring, ensuring compliance, and regular feedback reporting. The implementation of this centralized-reporting, standardized QC program has provided the catalyst for MSF-OCA to develop a laboratory \u201cculture of quality\u201d over the past 3 years, which in turn has strengthened the commitment and interest of laboratory field staff to ensure the success of health care programs."}
+{"text": "Tracheal defects may occur after trauma or prolonged intubation. Resection of tracheal tumors also poses a major challenge for substitution. In an effort to solve this problem, different techniques have been tried with little success. We report on a new animal model which showed acceptable results with fewer complications.We replaced 5 cm of cervical trachea in 10 dogs with harvested infra-renal aorta and repaired the aortic defect with Dacron graft.Necropsy of the grafted aorta and anastomotic site revealed well healed anastomosis in all animals together with ciliated columnar epithelium coverage of grafted aorta and neovascularization of aortic wall.Aortic graft is preferable to other substitutes because of less antigenicity, less vascularity, and no mucous secretions or peristalsis Tracheal defects may occur after trauma or prolonged intubation. Resection of tracheal tumors also poses a major challenge for substitution. In an effort to solve this problem, different techniques have been tried with little success. The various tracheal substitutes and techniques of reconstruction were analyzed by Grillo , who claEleven healthy dogs ranging from 18 kg to 24 kg in weight were studied. All animals received care in compliance with the \"Guide for the care and use of laboratory animals\" prepared by the Institute of laboratory animal resources, National research Council, and published by the National Academy Press, revised 1996. Five centimeter of cervical trachea was resected and replaced by harvested abdominal aorta. The aortic defect was repaired with Dacron graft.General anesthesia was induced with thiopental and maintained with oxygen and 1\u20133% halothane through an endotracheal tube. All animals were perfused with a crystalloid solution. Pulse were monitored Introperatively. One gram of Cephazoline was injected after the induction of general anesthesia for wound prophylaxis.A laparatomy was performed thorough a midline abdominal incision to expose at least 5 cm of infrarenal abdominal aorta. Before aortic clamping, 100-unit/kg heparin was given intravenously and 5 cm of aorta was resected circumferentially and replaced by Dacron graft using a running 4-0 Polypropylene suture. The average time for the harvesting and anastomosis was less than 20 minutes without a need for aortic shunt. The excised aortic segment was placed in heparinized blood solution. The abdomen was then closed in two layers by 0-0, 3-0 nylon sutures. Access to the cervical trachea was gained through a longitudinal vertical neck incision by splitting the anterior neck muscles. The trachea was exposed and a 5 cm long window shape defect is made with resection of anterior tracheal rings. The posterior membranous portion of trachea left intact. A longitudinal incision was made along the whole length of harvested aorta [Fig. In post operative day one diet started for the animals and advanced. Clinical examination was performed daily for fist two week post op and then every month including overall status, weight, respiratory status and injury to the laryngeal nerve. Because none of the animals developed respiratory problems or fever and there was not stent, bronchoscopy and chest X-ray was not performed in the post operative period.Animals were sacrificed between two and six months after the procedure with intravenous injection of potassium chloride and Propofol to remove the grafts. En block resection of the trachea and the graft with surrounding tissues was performed and sent for macroscopic and microscopic examinations. Post mortem specimens were immediately placed in 10% formaldehyde solution for preservation. The specimens were evaluated for patency, microscopic evidence of inflammation and morphologic transformation of the graft.Ten animals survived the procedure. The average operative time was 105 minutes. Between 4 to 5 tracheal rings removed in each case. One dog died 4 hours after the operation secondary to heart failure. All the animals started on diet the first post operative day. All abdominal wounds healed primarily. There was one cervical wound infection, which was healed with secondary intention. There was no clinical respiratory problem, cough or pneumonia. There was no evidence of hoarseness and all of the animals start barking a few days after the operation. There was no complication related to aortic Dacron graft. None of the animals developed claudication.At necropsy, gross examination showed a patent lumen in all specimens. The external surface was smooth and had area of depression at the site of graft. There was no abscess formation or sing of infection in the neck. There was evidence of adhesion of adjacent muscles to the trachea. There was evidence of neovascularization from the adjacent muscles to the aortic graft. Microscopic examination of H&E stained sections of grafted aorta and the anastomotic site revealed well healed anastomosis in all animals. There were areas of mild chronic inflammation, fibrosis, foreign body granuloma and squamous metaplasia in the animals sacrificed within two months of operation. In the animals sacrificed longer that 2.5 months, Pathology revealed no foreign body granuloma, minimal inflammation and ciliated columnar epithelium coverage of grafted aorta and neovascularization of aortic wall Fig , Table .Studies on prosthesis for repairing the tracheal defects have a long history beginning with Daniel's experiment in 1948. Since then, a variety of prosthesis has been used, but the results have been disappointing in a significant proportion of cases. In an extensive analysis of the literature, Grillo -12, autoIn our study, the aorta as an autogenous tissue was used to replace the trachea in a dog model. Surgical techniques for aortic segment excision and Dacron replacement with aortotracheal graft are not complicated and feasible to be done in one stage. Secondly, the aorta has no autogenous immunity-related problems and its diameter in human is comparable to the trachea. Furthermore it provides a sufficient diameter for airway patency. Due to disparity between tracheal and the aortic diameter in dogs, the aorta was transplanted to the proximal and distal tracheal and posterior membranous parts, but it appears that no such disparity is anticipated in humans. The gross and microscopic study of transplanted aortic segment showed neovascularization from adjacent tissues providing a good and resistant grafted tissue without vascular pedicle. The growth of endothelial ciliated cells over the grafted aortic segment lumen without mucous secretion and luminal stenosis is another positive point for this method in comparison with other tubular grafts such as esophagus, jejunum and collagen-conjugated meshIn conclusion, this study confirms that an autogenous aortic graft is a valuable substitute for tracheal replacement because of less antigenicity, less vascularity, and no mucous secretions or peristalsis. It also shows a progressive transformation of the vascular graft into a structure resembling the tracheal tissue. We did not have any aortic surgery related complications in our study, but it may subject the patient to potential complications of aortic surgery. The use of an arterial allograft may be more practical in human, but it remains to be demonstrated that the same tracheal neogenesis and the same long-term function can be obtained in spite of the allogeneic nature of the graft.The authors declare that they have no competing interests.FA participated in design of the study, carried out the Coordination, collecting and analyzing the data, getting grant for the study, performing the operations and post operative care, writing the manuscript.HH conceived the study, participated in design of study, supervised the study and operative procedures and reviewed the manuscript.SD participated in design of the study, anesthesia in the operative room, the operative procedures and post-operative care.NT participated in coordination for operative procedures and post operative care in animal lab.PK carried out the gross and microscopic evaluation of pathology.All authors read and approved the final manuscript."}
+{"text": "Plasmodium berghei ANKA.Cerebral malaria (CM) is associated with high mortality and morbidity caused by a high rate of transient or persistent neurological sequelae. Studies on immunomodulatory and neuroprotective drugs as ancillary treatment in murine CM indicate promising potential. The current study was conducted to evaluate the efficacy of glatiramer acetate (GA), an immunomodulatory drug approved for the treatment of relapsing remitting multiple sclerosis, in preventing the death of C57Bl/6J mice infected with GA treatment led to a statistically significant lower risk for developing CM (57.7% versus 84.6%) in treated animals. The drug had no effect on the course of parasitaemia. The mechanism of action seems to be an immunomodulatory effect since lower IFN-gamma levels were observed in treated animals in the early course of the disease (day 4 post-infection) which also led to a lower number of brain sequestered leukocytes in treated animals. No direct neuro-protective effect such as an inhibition of apoptosis or reduction of micro-bleedings in the brain was found.These findings support the important role of the host immune response in the pathophysiology of murine CM and might lead to the development of new adjunctive treatment strategies. Plasmodium falciparum malaria is cerebral malaria (CM). It presents as a diffuse encephalopathy with alteration of consciousness, ranging from drowsiness to deep coma and is frequently accompanied by seizures [Plasmodium berghei infected mice, when applied in low dose [A major cause of morbidity and mortality of seizures . Mortaliseizures . The patseizures -5. Imporseizures ,7. Thereseizures ,9, cortiseizures ,11. Simiseizures -14. In rseizures ,16. Receseizures  and decrlow dose . The neulow dose ,20. TherGA, also known as copolymer 1, is a heterogeneous mix of polypeptides containing the four amino acids alanine, lysine, glutamic acid and tyrosine in definite ratios but with no uniform sequence with an average molecular weight of 5,000\u20139,000 daltons . GA was 6 parasitized red blood cells of a homologue donor, which had been infected with frozen polyclonal stocks of P. berghei ANKA. Four animals were used as non-infected control animals. The clinical severity of the disease was assessed by the SHIRPA-score primary screen on baseline, day 5 post-infection and before death [A total of 72 six to eight weeks old C57BL/6J mice  were used for this study during four subsequent experimental infections. 68 animals were infected intraperitoneally with 1 \u00d7 10re death . The prire death . HealthyFrom the day of infection, animals of the treatment group (n = 34) were injected subcutaneously daily with 100 \u03bcl Copaxone  after anesthesia with Forane  for two minutes on alternating injection sites. The control group (n = 34) was injected the same amount of saline . The course of infection was closely monitored. Core body temperature and weight were assessed daily. Parasitaemia was monitored daily by thin blood smear from tail blood. At day 4 post-infection 16 infected animals were killed to study the early course of the disease. Between day 6 and day 9 post-infection 37 of the infected mice developed signs of CM and were killed for ethical reasons as soon as their body temperature dropped to 30\u00b0C, a valid marker for imminent death . Mice wh3VO4 plus a protease inhibitor cocktail  and centrifuged at 18,500 g for 20 min at 4\u00b0C. Protein balanced samples were analysed using standard techniques. The bottom parts of the blots were probed with a monoclonal antibody directed against cleaved caspase-3  overnight at 4\u00b0C. To control and correct for equal loading, the top part of each blot was probed for alpha-tubulin  overnight at 4\u00b0C. Antibody binding was visualized using enhanced chemoluminescence reagents .Animals  were perfused with PBS for two minutes. Samples of the forebrain and brain stem with cerebellum were processed separately as described previously . The mic2O2) for 30 min and non-specific binding in blocking solution  for 1 hour at room temperature. All antibodies were diluted in blocking solution. Rabbit monoclonal antibody against activated caspase-3  was diluted 1:1,000 and permitted to bind overnight at 4\u00b0C. Biotinylated goat anti-rabbit antibody  was then applied at a dilution of 1:200 for 1 h at room temperature. Antibody binding was visualized using Vectastain ABC kit (Vector Laboratories) and diaminobenzidine as chromogen according to the manufacturer brochure and counterstained with haematoxylin. Sections without primary antibody or with primary antibody preincubated with caspase-3 blocking peptide  were equally processed to control for unspecific binding.After perfusion with 4% PFA in PBS, brains  were postfixed for six hours and cryoprotected with 30% sucrose in PBS. Frozen tissues were cut into 20 \u03bcm and 40 \u03bcm thick coronal sections on a freezing cryotome . 20 \u03bcm thick sections were mounted on Superfrost Plus slides  and air-dried. 40 \u03bcm thick sections were kept in assorter buffer and stored at 4\u00b0C. The directly mounted slides were stained with haematoxylin-eosin (H&E) according to standard protocols and used for analysis of haemorrhagic brain area. 40 \u03bcm free-floating sections were blocked for endogenous peroxidase activity  at +2, -6 \u00b1 350 \u03bcm bregma were determined as previously described . StereolMouse serum was harvested immediately before perfusion by puncture of the right cardiac ventricle. Five different cytokines  were measured simultaneously by a commercially available cytometric bead array according to the manufacturers protocol by FACS .To test for differences in survival Kaplan-Meier curves were drawn and the treatment groups were compared using Log-rank test. Parasitaemia levels and the cumulative SHIRPA score were compared between treatment groups by repeated measures ANOVA. The relative haemorrhagic brain area, brain sequestered leukocytes and caspase-3 immunopositive brain parenchymal cells were compared between treatment groups by Wilcoxon rank sum test. Cytokine levels were compared by two-way ANOVA with time point of sampling and treatment as factors. P-values were Bonferroni-corrected for multiple comparisons. The values of IFN-gamma were logarithmically transformed to get equal variances. Calculations were done using Insightful S-Plus 6.2 , graphs were drawn by GraphPad Prism version 5.00 .Of the 68 infected animals 16 were killed on day 4 post-infection in order to study alterations in the early course of the disease. The remaining 52 animals entered the survival analysis. 37 of these mice developed signs of CM and were killed between day 5 and 9 post-infection when showing clinical signs of inevitable death . The other 15 animals survived this critical period and were killed on day 11 post-infection. 15 animals (57.7%) in the treatment group developed CM compared to 22 animals (84.6%) in the control group. Kaplan Meier curves are shown in Figure In order to assess putative differences in the clinical course of the disease, the SHIRPA score was performed on baseline, day 5, in moribund CM animals and on day 11 post-infection in animals which did not develop CM (NCM group). No significant differences were found in the respective values of the SHIRPA score between GA and vehicle treated animals Figure . There wIn order to reveal putative effects of GA treatment on the neuropathology of CM, conventional H&E staining, immunohistochemistry and western blot analysis for activated caspase-3 was performed. Qualitative inspection of H&E stained sections did not reveal differences between GA and vehicle treated animals. All moribund CM animals showed the typical neuropathology of CM . In the early course of the disease (on day 4 post-infection) and in infected animals without CM  no signs of microhaemorrhages were observed.Histopathological changes were quantified by stereological methods. In moribund CM animals the relative haemorrhagic brain area was not significantly different between GA and vehicle treated animals Figure . The relThe relative number of brain sequestered leukocytes on day 4 post-infection was not significantly different between GA and vehicle-treated animals Figure . In moriThe immuno-phenotype of animals was determined on day 4, in moribund CM animals, and on day 11 post infection in NCM animals by measuring 5 different cytokines in sera. On day 4 post-infection GA treated animals showed a significantly lower level of IFN-gamma  and other myelin associated antigens such as proteolipid protein (PLP) and myelin-oligodendrocyte glycoprotein (MOG) for this binding or even displaces proteins from the binding site . This meSequestered leukocytes are recognized to be causally related to the pathogenesis of murine CM. The onset of neurological signs and symptoms is paralleled by the sequestration of CD8+ T-lymphocytes in the brain, and depletion of these cells confers protection against CM. Accumulation of activated T cells in the brains of CM mice has been shown by different experimental approaches ,35. BesiThe neuro-protective effects of GA have been demonstrated in several animal studies. In the EAE model and in an optic-nerve injury model GA protected neurons from demyelination, axonal damage and degeneration ,42. FurtP. berghei ANKA. In general, subcutaneous treatment with GA seldom causes severe side effects [It should be noted that GA did neither change the course of parasitaemia nor the clinical course of the disease. This is of importance since a new adjunctive drug for treating severe complicated malaria must not interfere with parasite clearance through schizonticidal medication . Further effects . The mos effects . No high effects .In conclusion, the present pilot study provides direct evidence that GA, a drug which has been safely administered to patients with relapsing remitting multiple sclerosis for several years, reduces the risk for experimental cerebral malaria. The mechanism of action seems not to be neuro-protection through inhibition of caspase-3 dependent apoptosis or inhibition of parasite growth but rather immuno-modulation in the early course of the disease. Further studies are currently performed to evaluate the exact mechanisms of GA mediated immuno-modulation in CM and to determine the most effective dosing and timing of treatment. The current findings support the important role of the host immune response in the pathophysiology of murine CM and might lead to the development of new adjunctive treatment strategies.The authors declare that they have no competing interests.PL, AP, CB, AD performed all experiments. PL, GB, RH, MR, RB analyzed the data. PL, ES, RB had the idea and designed the study. All authors participated in the interpretation, and writing of the paper and read and approved the final manuscript."}
+{"text": "Virus isolation and immunohistochemistry indicated that virus invaded the brains of guinea pigs within one day postexposure, regardless of viral strain or particle size distribution. Immunohistochemistry further demonstrated that neuroinvasion occurred through the olfactory system, followed by transneuronal spread to all regions of the brain. Olfactory bipolar neurons and neurons throughout the brain were the key viral targets. The main microscopic lesions in infected guinea pigs were neuronal necrosis, inflammation of the meninges and neuropil of the brain, and vasculitis in the brain. These results indicate that guinea pigs experimentally infected by aerosolized EEEV recapitulate several key features of fatal human infection and thus should serve as a suitable animal model for aerosol exposure to EEEV.Mice and guinea pigs were experimentally exposed to aerosols containing regionally-distinct strains (NJ1959 or ArgM) of eastern equine encephalitis virus (EEEV) at two exclusive particle size distributions. Mice were more susceptible to either strain of aerosolized EEEV than were guinea pigs; however, clinical signs indicating encephalitis were more readily observed in the guinea pigs. Lower lethality was observed in both species when EEEV was presented at the larger aerosol distribution (> 6 \u03bcm), although the differences in the median lethal dose (LD Alphavirus, family Togaviridae, that cause significant morbidity and death in infected animals and humans [Eastern equine encephalitis (EEE) virus (EEEV) are a group of positive-strand RNA viruses in the genus d humans -3. The rd humans  and expeNatural outbreaks of EEE have been reported primarily in North America; the South American varieties of EEEV appear to be less virulent in humans and animal models ,6. At a A variety of animal species have been investigated as possible disease models of human EEE. Limited pathogenicity studies using EEEV have been performed in pigs  and calvVaccines and therapeutics that protect against EEEV infection are needed to protect against the biowarfare threat posed by aerosolized EEEV. Demonstrating efficacy against aerosol exposure to EEEV would not be possible in a human clinical trial as inhalation is not a natural route of EEEV transmission. Licensure is only possible through the FDA's 'Animal Rule', which allows for the demonstration of efficacy in multiple well-characterized, relevant animal models . BecauseThe objective of this study was to initially assess the susceptibility of mice and guinea pigs to aerosolized EEEV and to describe the resulting pathology associated with experimental infection. Initially, to assess susceptibility and derive lethality estimates, groups (n = 8) of mice and guinea pigs were exposed by aerosol using either a North (NJ1959) or South American (ArgM) strains of EEEV presented at two distinctly different particle size distributions. We performed five target doses (x5) per viral strain (x2) per species (x2) per aerosol size distribution (x2) for a total of 40 individual experiments. Thereafter, groups of guinea pigs were exposed to either strain of EEEV (x2) at either aerosol size distribution (x2) to further distinguish pathology that may have resulted from multimodal aerosol exposure.ad libitum and maintained on a 12 hr light/dark cycle.Female BALB/c mice and Hartley guinea pigs of both sexes were obtained from Charles River Laboratories . The mice were approximately 19-22 g and 8-9 weeks old; the guinea pigs were 8-10 weeks old and approximately 250 g at the time of exposure. Animals were provided with rodent chow and water North American  and South American  strain of the EEEV were used in the experimentation. Viruses were propagated in cell culture as previously described . Viral tg) of 1.3 for the aerosols generated by the Collison nebulizer. The size distribution for the particles generated by the STAG was summed as being composed of distinctly 'larger' particles (> 6 \u03bcm) than the Collison-generated aerosols. Exposure concentration, expressed in plaque-forming units (PFU)/l, was determined by isokinetic sampling of the chamber with an all-glass impinger . EMEM medium with antifoam A 0.001% w/v  was used to collect medium in the impinger. 'Presented' dose was estimated by calculating the respiratory minute volume (Vm) using Guyton's formula , expressed as Vm = 2.10 \u00d7 Wb 0.75 where Wb = body weight (g), based upon the average of group weights the day of exposure. The presented dose was then calculated by multiplying the estimated total volume (Vt) of experimental atmosphere inhaled by each animal (Vt = Vm \u00d7 length of exposure) by the empirically determined exposure concentration (Ce) ('presented dose' = Ce \u00d7 Vt).Mice were exposed to EEEV aerosols in whole-body exposure chambers housed within Class III biological safety cabinets maintained under negative pressure (-1 WC\"), as previously described . The aniViral titers in the aerosol generator starting suspensions, AGI samples, tissues, and blood were determined by plaque assay as previously described. Tissues obtained at necropsy were ground with a sterile mortar and pestle and a 10% homogenate v/w solution was prepared before viral titration. Briefly, for plaque assay, samples of homogenized tissue or blood were diluted with a solution of EMEM with 5% fetal bovine serum (FBS) and gentamycin (without HEPES) added to 6-well plates containing a confluent monolayer of Vero-E6 cells (green monkey kidney cells) which were incubated at 37\u00b0C for 1 hr. Then, a 0.5% agarose overlay in 2\u00d7 basal medium EMEM with Earle's salts (EBME) solution  was added, and plates were incubated at 37\u00b0C at 5% CO2 for 48 hr. Thereafter, a second overlay of saline A (SA) with 5% neutral red and 5% FBS was added, and the plates were again incubated at 37\u00b0C for 4 hr. Defined plaques  were then counted.\u00ae . A complete necropsy was conducted on each guinea pig. Heart blood samples were collected aseptically into pediatric EDTA-anticogulant evacuated tubes. Samples of cerebrum, lung, and liver were then obtained aseptically, placed in sterile centrifuge tubes, and stored at -70\u00b0C until processing for virus isolation. Additionally, a full set of tissue samples were collected for histopathology. These tissues were fixed in 10% neutral buffered formalin and stored for a minimum of 21 days within biosafety (BSL)-3 containment to ensure all virus had been deactivated before histopathology processing. Bones were decalcified in formic acid, and all tissues were trimmed, routinely processed, and embedded in paraffin. Tissue blocks were sectioned at 5-6 \u03bcm on a rotary microtome and mounted on glass slides. All tissue sections were stained by hematoxylin and eosin. In addition, duplicate sections were prepared for immunohistochemistry from the lungs, submandibular lymph nodes, haired skin, salivary glands, brain, and multiple tissues of the skull. Immunohistochemistry was performed as described previously [Guinea pigs were euthanized at the prescribed time points in the second experiment by administering an overdose of Euthasoleviously , with mo50 values were determined by probit analysis using PROC PROBIT in SAS Version 9.1.3 . Times-to-death were compared by Wilcoxon rank-sum tests. Descriptive statistics (mean \u00b1 standard deviation) were used to display the results of the tissue and blood viral titers.Dose-response curves were constructed and LDTo examine the lethality of EEEV strains when aerosolized, Hartley guinea pigs and Balb/c mice were exposed to either large (> 6 \u03bcm) or small ~1 \u03bcm) particle aerosol distributions containing the ArgM or NJ1959 strains of EEEV  although this difference was also not significant (p = 0.1057). An LD50 could not be determined for the ArgM strain at a particle size > 6 \u03bcm because mortality was not \u2265 50% in any of the dose groups.Analysis of the survival data indicated that the virulence of aerosolized EEEV was greater in mice than in guinea pigs Table . Probit 50 of 1 \u03bcm aerosol particles containing NJ1959 was over 17 times higher than what was calculated for mice  (p = 0.0098). The LD50 for the > 3 \u03bcm particles containing NJ1959 was not significantly different from the LD50 for 1 \u03bcm particles of NJ1959 (p = 0.3500) which is similar to what was observed in the mouse exposures. The LD50 for ArgM at 1 \u03bcm was half that of NJ1959  but an LD50 could not be calculated for > 6 \u03bcm ArgM particles as \u2265 50% mortality was not observed in any of the dose groups.For guinea pigs, the LD6 PFU of either NJ1959 or ArgM at 1 \u03bcm or > 6 \u03bcm particle distributions. Thereafter, the guinea pigs were euthanized on days one, two, three or four postexposure and necropsied to collect tissues for histological examination and for virus isolation. Four guinea pigs were sampled at each time point for each viral strain/particle size combination. Regardless of viral strain or particle size, virus was isolated from all four tissues examined  one day after challenge  guinea pigs at day one postexposure by positive immunohistochemistry of the olfactory mucosa, the olfactory nerves, and/or the lamina propria. Both viral strains and both particle sizes resulted in infection of the olfactory tract at this time. Affected guinea pigs had one or more foci of immunolabeled olfactory mucosa scattered throughout the nasal tract, often associated with positive olfactory nerves and lamina propria. The foci that contained EEEV antigen were without apparent morphological changes in infected cells of all cases at day one. At day two postexposure, the olfactory tracts of 15/16 (94%) guinea pigs exhibited positive immunohistochemical staining for viral antigen Figure . In indiInfection of the brains of guinea pigs was first evident by the presence of limited EEEV antigen within the lamina fibrorum and lamina glomerulosa of the olfactory bulbs of 5/16 (31%) guinea pigs at day one postexposure. Histologically, the olfactory bulbs did not exhibit abnormal changes on day one. At day two postexposure, abundant viral antigen was present throughout all layers of the olfactory bulbs of all guinea pigs and the meninges of the olfactory bulbs were minimally to mildly thickened by infiltrates of macrophages, lymphocytes, and some heterophils at this time point and at later time points Figure . There wNeurons were the primary target of EEEV in the brains of infected guinea pigs. In particular, EEEV showed tropism for medium to large neurons such as pyramidal neurons in the neocortex, Purkinje neurons, and motor neurons in the brainstem. In addition, some scattered smaller cells in the brain, possibly small neurons and/or glial cells, also contained viral antigen, as did some apparent inflammatory cells and the previously mentioned periventricular cells. Neither the strain of EEEV, nor the size of aerosol particles with which guinea pigs were infected appeared to have any effect on how rapidly virus appeared in the olfactory mucosa or the brain. However, at day two, subjectively there did appear to be slightly more antigen in both the olfactory mucosa and rostral brain of guinea pigs infected with large particle aerosols than with small particle aerosols.Minimal amounts of viral antigen were present in the lungs of some guinea pigs infected with the NJ1959 strain of EEEV Figure , but virAdditional immunohistochemistry findings included rare positive cells that appeared to be osteoblasts in the skulls of four guinea pigs, small foci of positive subgingival or periodontal connective tissue in three cases and a focus of positive odontoblastic epithelium in a single case. Otherwise, the structures of the head, including the mandibular lymph nodes, the nasal-associated lymphoid tissues, and the vomeronasal organs, did not exhibit positive immunostaining for EEEV antigen, nor was there histological evidence of viral infection of other tissues. In particular, there was no evidence of viral infection of the respiratory lining cells of the nasal tract, nor the tracheas, of any guinea pigs in the study. Evidence of EEEV infection of other tissues, including the heart, liver, spleen, kidneys, adrenal glands, stomach, small and large intestines, pancreas, urinary bladder, testes, ovaries, uterus, skin, salivary glands, thymus, bone marrow, and mediastinal and mesenteric lymph nodes, was uniformly lacking. In addition to pneumoconiosis, lesions considered to be common findings in guinea pigs were seen in some cases. Changes consistent with vitamin C deficiency were evident in the tibia and femur of most guinea pigs in the study. In several guinea pigs, rhabdomyomatosis was present in the heart and/or mild changes consistent with early segmental nephrosclerosis were present in the kidneys.This study was performed to further assess the relative infectivity of EEEV as an aerosol, to assess the comparative virulence of representative North and South American strains of EEEV when aerosolized, and to initiate characterization of rodent models of aerosol disease to be used in future testing of medical countermeasures against EEEV. In the initial exposure experiments, lethality estimates were established in both animal species, although mortality in the groups did not consistently match the increase in dose received. This variation may account for the lack of fiducial limits in some of the probit analysis. In a previous pathogenesis study using juvenile albino mice inoculated intracranially or subcutaneously with EEEV strains E-1 and P-7, a sharp dose-response curve was observed, although the doses were simply reported as an inoculating volume of 20% brain suspension homogenate from experimentally infected suckling mice, which allows no basis for comparison . Other sIn this study, the guinea pigs proved to be the better model for EEEV infection than mice, in that they developed more uniform clinical signs with an easily identified onset and lethality in the lethal dose determination. Later stages in the clinical illness  illustrated what is typically observed in encephalitic syndromes caused by neutrotropic viruses. Clinical signs were difficult to assess in mice until very late in the course of the disease. Hamsters are the alternative rodent model for studying EEEV infection. At this time, we cannot distinguish whether guinea pigs or hamsters are the superior model since both develop pathologies similar to what has been reported to humans, particularly the development of vasculitis . However50 for both strains of EEEV was higher for aerosol exposures at the larger particle size and could not be determined for the ArgM strain in mice. We pursued the serial sacrifice studies in the guinea pig model to examine the pathogenesis of aerosolized EEEV infection as a result of these initial findings in the lethality estimation experiementsIt was expected that particle size distribution would alter the virulence and pathogenesis of aerosolized EEEV. The anatomical differences in the respiratory tract of a guinea pig when compared to a mouse would affect particle deposition and subsequent initiation of disease. Larger aerosol particles of EEEV with a MMAD of > 6 \u03bcm would be expected to deposit more in the upper respiratory tract, leading to infection of the olfactory neuroepithelium and the olfactory bulb and more rapid penetration into the brain of exposed animals than would be the case for aerosol exposure to EEEV in a smaller, more highly respirable particle. Exposure to a larger particle size would be expected to lower the dose required to cause disease and potentially accelerate the progression of the infection . It was 50. Given the observed infection of the olfactory neurons by EEEV, it was not unexpected that infection of the brain was first evident as viral antigen within the olfactory bulbs and other olfactory brain structures. This was followed by apparent transneuronal spread to other parts of the brain in generally a rostral to caudal fashion, reaching the caudal brainstem and cerebellum of a few guinea pigs by day four which was the last day studied. Viral infection of the brain resulted in direct damage to neurons as well as widespread meningoencephalitis. These important pathogenetic features, infection of olfactory neuroepithelium, invasion of the olfactory brain, transneuronal spread, direct neuronal cytopathicity, and inflammation of the brain, are essentially identical to the mouse model of aerosolized VEEV, to date the best characterized animal model of aerosolized alphavirus infection [Our observation of early infection of the olfactory neuroepithelium seems to represent a cardinal feature in the pathogenesis of aerosolized EEEV in guinea pigs. In particular, EEEV infection of the so-called bipolar olfactory neurons is key, because at one 'pole' these cells have ciliary processes that extend into the air passages, where they likely contact virus, and at the opposite 'pole' they extend axons that synapse directly with neurons in the olfactory bulbs. Viruses that target the olfactory neurons therefore have a direct portal to the brain. The additional finding of early infection of olfactory neurons in guinea pigs exposed to both small- and large-particle aerosols, however, fails to explain why the guinea pigs exposed to large particle aerosols had higher LDnfection ,17-19.There were some differences between the mouse model of aerosolized VEEV and the characteristics of EEEV infection seen in our current studies with guinea pigs. Exposure to aerosolized VEEV causes massive infection of the olfactory neuroepithelium in mice, ,19 whereThere were also similarities and differences between the guinea pigs in this study and other animal models of EEEV that utilized peripheral inoculation of this virus. Key among the similarities, cutaneous inoculation of young mice ,15 and gTwo other particular features of EEEV infection of the guinea pigs in this study merit discussion. First, we did not observe tropism of EEEV for lymphoid tissues and little, if any, viral antigen within macrophages in any tissues. Studies with mice and hamsters also reported limited lymphoid tropism by EEEV ,20. ThesAn additional aim of this study was to determine the virulence and pathogenesis of a South American strain of EEEV. South American strains of EEEV are antigenically distinct from North American strains and vaccines against North American strains may not be protective . South AIn summary, mice and guinea pigs are susceptible to lethal infection by North and South American strains of EEEV. The guinea pig model of aerosolized EEEV recapitulates several key features of fatal human infection by EEEV. It also shares several important pathogenic features with aerosolized VEEV infection in mice. Thus, guinea pigs should serve as a useful animal model for aerosol exposure to alphaviruses in general, and for EEEV in particular.Guide for the Care and Use of Laboratory Animals, National Research Council, 1996. The facility where this research was conducted is fully accredited by the Association for Assessment and Accreditation of Laboratory Animal Care International.Research was conducted in compliance with the Animal Welfare Act and other federal statutes and regulations relating to animals and experiments involving animals and adheres to principles stated in the The authors declare that they have no competing interests.CJR and DSR performed the experiments, JMH assisted with the engineering performance of the experiments. SN participated in the design of the study and performed the statistical analysis. CLW and KES performed pathological analysis. CJR conceived of the study, and DSR participated in its design and coordination. All authors read and approved the final manuscript."}
+{"text": "C. elegans extends lifespan in part because signals from the somatic reproductive tissues activate the nuclear hormone receptor DAF-12.Removal of the germ cells of  Caenorhabditis elegans and Drosophila melanogaster, removing the germline precursor cells increases lifespan. In worms, and possibly also in flies, this lifespan extension requires the presence of somatic reproductive tissues. How the somatic gonad signals other tissues to increase lifespan is not known. The lifespan increase triggered by loss of the germ cells is known to require sterol hormone signaling, as reducing the activity of the nuclear hormone receptor DAF-12, or genes required for synthesis of the DAF-12 ligand dafachronic acid, prevents germline loss from extending lifespan. In addition to sterol signaling, the FOXO transcription factor DAF-16 is required to extend lifespan in animals that lack germ cells. DAF-12/NHR is known to assist with the nuclear accumulation of DAF-16/FOXO in these animals, yet we find that loss of DAF-12/NHR has little or no effect on the expression of at least some DAF-16/FOXO target genes. In this study, we show that the DAF-12-sterol signaling pathway has a second function to activate a distinct set of genes and extend lifespan in response to the somatic reproductive tissues. When germline-deficient animals lacking somatic reproductive tissues are given dafachronic acid, their expression of DAF-12/NHR-dependent target genes is restored and their lifespan is increased. Together, our findings indicate that in C. elegans lacking germ cells, the somatic reproductive tissues promote longevity via steroid hormone signaling to DAF-12.In  C. elegans and other organisms have shown that the reproductive system can also affect the rate at which an animal ages. Removal of C. elegans' germ cells extends lifespan but this effect is not simply due to sterility, as removal of both the somatic reproductive tissues and the germ cells does not extend lifespan. Instead, loss of the germ cells extends lifespan by activating a pathway that requires input from the somatic gonad. In this study, we demonstrate that the somatic reproductive tissues promote longevity by controlling the activity of a steroid signaling pathway that regulates the DAF-12 nuclear hormone receptor.Reproductive tissues are known to generate important intercellular signals. For example, in mammals, the reproductive tissues produce steroid hormones such as estrogen and testosterone that have profound effects on development and physiology. Studies of the nematode  Aging and reproduction are two central aspects of an animal's life history. Although evolutionary theorists have long hypothesized that an intrinsic cost to reproduction may shorten lifespan C. elegans, the somatic reproductive tissues  can have a dramatic lifespan-extending effect. When the germ cells of the worm are removed, the resulting sterile adult animals live 60% longer than they would with an intact germline. Removal of the somatic reproductive tissues along with the germ cells suppresses this lifespan extension, suggesting that the somatic gonad dispatches lifespan-extending signals to other tissues when the germline is gone In daf-9How does the reproductive system influence other tissues? In order for animals lacking the germline to live long, they require a signaling pathway involving the nuclear hormone receptor DAF-12, as well as genes that produce DAF-12 ligands , such as the cytochrome P450 gene C. elegans, as it also performs functions characteristic of the adipose tissue, the liver, and the pancreas.] DAF-16/FOXO is completely required for loss of the germ cells to increase lifespan, and expression of daf-16/FOXO exclusively in the intestine completely rescues the longevity of daf-16(\u2212) mutants lacking a germline The analysis of this longevity pathway has been facilitated by the identification of molecular events that occur in the body when the germ cells are removed. A particularly important event caused by loss of the germ cells is the nuclear accumulation of the evolutionarily conserved lifespan-extending transcription factor DAF-16/FOXO in intestinal cells daf-12/NHR and daf-9/CYP450 are partially required for DAF-16/FOXO to accumulate in intestinal nuclei when the germ cells are removed daf-9/CYP450 mutants lacking germ cells with the DAF-12/NHR ligand \u03944-dafachronic acid rescues DAF-16/FOXO nuclear localization daf-12/NHR is still required for lifespan extension in animals carrying a mutant DAF-16/FOXO protein that localizes constitutively to nuclei daf-12/NHR has another function, apart from regulation of DAF-16/FOXO nuclear localization, in the regulation of longevity by the reproductive system.Previously, we demonstrated that daf-12/NHR might function in the signaling that takes place between the somatic reproductive tissues and the rest of the animal. Like DAF-12/NHR, the somatic gonad has a lifespan-extending function that does not involve DAF-16/FOXO nuclear localization. Germline-deficient animals that lack the somatic gonad do not live long even though DAF-16/FOXO accumulates in nuclei What is the other function of DAF-12/NHR? In this study we have asked whether germ cell (\u2212)] have an extended lifespan that requires both the DAF-12 sterol-signaling pathway and the somatic gonad Worms that lack germ cells  with \u03944-dafachronic acid, one of several isoforms of dafachronic acid hormones shown to bind DAF-12/NHR 4-dafachronic acid was able to increase the lifespan of germline-deficient animals that also lacked the somatic gonad (daf-12(rh61rh411) null mutants that lack the somatic gonad and germ cells were treated with \u03944-dafachronic acid  animals that contained the somatic reproductive tissues. In two out of three experiments, we saw no effect of \u03944-dafachronic acid supplementation (germ cell (\u2212); somatic gonad (\u2212) animals treated with dafachronic acid was as long as that of germ cell (\u2212) animals treated with dafachronic acid  mutant. We found that this construct was able to extend the lifespan of germ cell (\u2212); somatic gonad (\u2212) animals ; somatic gonad (\u2212) animals.Besides being expressed in parts of the somatic gonad,  animals . Likewise system . Thus, Ddaf-9/CYP450. We found that this was the case: expression of DAF-9/CYP450 in ciliated sensory neurons using the cilium-specific che-2 promoter also extended the lifespan of germ cell (\u2212); somatic gonad (\u2212) animals (germ cell (\u2212) animals.We also examined whether DAF-9/CYP450 could extend lifespan when expressed in cells that do not normally express  animals . This fi4-dafachronic acid, increasing dafachronic acid levels by overexpression of DAF-9/CYP450 had a greater effect on the lifespan of germ cell (\u2212); somatic gonad (\u2212) animals than it had on animals with intact gonads: germ cell (\u2212); somatic gonad (\u2212) animals lived longer than did intact animals in several strains carrying multi-copy daf-9/CYP450 transgene arrays. These findings, too, imply that dafachronic acid extends lifespan specifically in germ cell (\u2212); somatic gonad (\u2212) animals.Just as with addition of exogenous \u0394daf-9 alleles and the canonical daf-12(m20) allele both completely prevent loss of the germ cells from extending lifespan m20 allele is predicted to eliminate the function of two isoforms of DAF-12/NHR while leaving a third isoform intact daf-12/NHR mutant rh61rh411 is predicted to inactivate all DAF-12/NHR isoforms daf-12(rh61rh411) mutants and found, to our surprise, that they lived slightly longer than intact controls (daf-12(m20) animals was removed rh61rh411 allele. Together, these findings necessitate a revised model for the role of DAF-12/NHR in animals that lack germ cells . We found that expression of GFP under the control of the cdr-6 promoter (Pcdr-6::GFP) was up-regulated in the animal by germ cell ablation  mutant (daf-12/NHR dependent increase in cdr-6 expression in germ cell (\u2212) animals using quantitative RT-PCR (qPCR) (ablation . This cd) mutant . We veriR (qPCR) .cdr-6 expression upon germline removal, then (i) the presence of the somatic gonad should be required for loss of the germline to increase Pcdr-6::GFP expression and (ii) dafachronic acid should be able to substitute for the presence of the somatic gonad in the regulation of this gene. We found that both predictions were met. When we removed the somatic gonad as well as the germ cells, Pcdr-6::GFP expression was no longer elevated; instead, it was similar to the level observed in animals with an intact gonad (germ cell (\u2212); somatic-gonad (\u2212) animals were grown on plates containing \u03944-dafachronic acid, expression of Pcdr-6::GFP was restored to levels that were similar to those of Pcdr-6::GFP-transgenic animals lacking only the germline. As predicted, the increase in Pcdr-6::GFP expression caused by addition of dafachronic acid required a functional DAF-12/NHR protein. In a daf-12(rh61rh411) mutant, we observed no increase in cdr-6 expression upon \u03944-dafachronic acid treatment . The expression of a transcriptional Pdod-24::GFP gene fusion was variable; however, we found that dod-24 expression depended on the presence of the somatic gonad in a daf-12/NHR dependent fashion  mutant background, expression of a Psod-3::GFP fusion still increased upon germ cell removal. Furthermore, this increase in expression still required the somatic gonad (sod-3 by quantitative RT-PCR (qPCR) in glp-1(e2141) mutants, which lack germ cells and are long-lived daf-16/FOXO resulted in a significant drop in sod-3 expression, mutation of daf-12/NHR did not have a statistically significant effect  null mutant and observed that expression of Pcdr-6::GFP still increased relative to intact animals in response to loss of the germline (germ cell (\u2212) animals lowered the expression of Pcdr-6::GFP. Thus, the somatic gonad was still able to modulate expression of cdr-6 when DAF-16/FOXO was not functioning. Notably, the magnitude of up-regulation of Pcdr-6::GFP in the daf-16(mu86) mutant was lower than in a wild-type background. We observed similar expression patterns when we measured cdr-6 mRNA levels by qPCR in glp-1(e2141) mutants, which lack germ cells. Mutation of daf-12/NHR resulted in a significant drop in the level of cdr-6 mRNA, whereas mutation of daf-16/FOXO did not affect cdr-6 mRNA levels , background, \u03944-dafachronic acid extended the lifespan of germ-cell (\u2212); somatic gonad (\u2212) animals, in a daf-16(mu86) background, there was no change in lifespan ; somatic gonad (\u2212) animals fail to live long because they have insufficient dafachronic acid levels. We asked whether the somatic gonad might influence the level of daf-9/CYP450 gene expression, but this was not the case, as levels of DAF-9::GFP were not overtly different (unpublished data). However, the somatic gonad could potentially affect the level of dafachronic acid by alternate mechanisms; for example, by increasing the level of a biosynthetic precursor of dafachronic acid. It is also possible that the somatic gonad regulates the activity of DAF-12/NHR without affecting the total level of dafachronic acid. For example, the somatic gonad could influence the proportion of dafachronic acid in the animal that is available to bind to DAF-12/NHR. Another possibility is that the somatic gonad influences the levels or activities of DAF-12/NHR inhibitors or co-activators, though in this scenario, it is necessary to postulate that increased levels of dafachronic acid can overcome the effects of these co-regulators. It would be interesting to directly measure levels of dafachronic acids in animals that lack the germ cells or the entire reproductive system.One simple model to explain the longevity-promoting activity of the somatic gonad is that the somatic gonad stimulates dafachronic acid production when the germ cells are removed, which in turn affects DAF-12/NHR activity. Indeed, this model is not without precedent, as in humans the somatic reproductive tissues secrete steroid hormones such as androgens, which influence other tissues. In this model, daf-9/CYP450 is expressed in the somatic gonad  animals, daf-9/CYP450, dafachronic acid, and daf-12/NHR play a second role in facilitating the nuclear localization of DAF-16/FOXO germ cell (\u2212) animals Besides modulating the lifespan of daf-12/NHR-dependent up-regulation of cdr-6 and a daf-12/NHR-dependent down-regulation of dod-24 in intact animals. Since activation of DAF-12/NHR is not sufficient to extend lifespan, other lifespan-promoting factors turned on in germline-deficient animals must be necessary for an increased lifespan. Because dafachronic acid extends lifespan in the absence of the somatic gonad, the somatic gonad itself is unlikely to provide these other lifespan-promoting factors. Instead, DAF-16/FOXO is the most likely candidate for the factor activated by loss of the germ cells that is necessary, along with DAF-12/NHR and the somatic gonad, to increase lifespan. Consistent with this idea, genetic inactivation of daf-16/FOXO, like the presence of the germ cells, prevents dafachronic acid from extending lifespan.Giving dafachronic acids to animals with an intact gonad does not extend lifespan . Howeverdaf-12/NHR null mutation, lifespan is extended slightly. This daf-12-independent lifespan-extension pathway (referred to here as the \u201cunderlying pathway\u201d) does not require the somatic gonad and is not affected by dafachronic acid. When daf-12(+) activity is present but the somatic gonad is absent or daf-9/CYP450 is mutated, then germ-cell loss does not extend lifespan. This suggests that unliganded DAF-12/NHR prevents germ-cell loss from activating the underlying pathway. In contrast, liganded DAF-12/NHR extends lifespan in response to germ-cell loss, as daf-12(+) animals that have a daf-9(+) genotype plus the somatic gonad live long when the germ cells are removed. In the future, it will be interesting to explore the nature of the underlying daf-12-independent pathway and to learn how daf-12/NHR(+) can affect its activity. Finally, we note that a dual ability of DAF-12/NHR to extend and shorten lifespan is not without precedent. In intact animals, DAF-12/NHR extends lifespan in daf-9/CYP450 reduction-of-function mutants when animals are cultured at 15\u00b0C daf-9/CYP450 in the absence of thermosensory neurons An unexpected finding from this study was that DAF-12/NHR has a more complex role in this longevity pathway than previously appreciated. We found that when the germ cells are removed in animals containing a daf-12/NHR mutants, the DAF-16/FOXO target sod-3 is still up-regulated (though perhaps to a lesser extent). Likewise, Wang and Ruvkun showed that the lipase gene K04A8.5 is up-regulated by germline removal in a daf-16/FOXO-dependent but daf-12/NHR-independent fashion daf-16/FOXO is mutated, DAF-12/NHR still retains the ability to affect transcription of genes such as cdr-6 and dod-24. However, DAF-16/FOXO affects the magnitude of this regulation, suggesting that DAF-16/FOXO could have a partial effect on the activity of DAF-12/NHR. In summary, based on the several genes we examined, it appears that DAF-16/FOXO and DAF-12/NHR have distinct effects on the transcriptome of germ-cell deficient animals, although each has minor effects on the activity of the other. This interpretation is supported by a genome-wide microarray analysis of germline-defective daf-16/FOXO and daf-12/NHR mutants .Both sterol signaling and DAF-16/FOXO are required for the long lifespan of germline-deficient animals. The relationship between DAF-12/NHR and DAF-16/FOXO in animals that lack the germ cells is not well understood. Previous work has demonstrated that DAF-12/NHR is partially (but not completely) required for the nuclear accumulation of DAF-16/FOXO in animals that lack the germ cells Although dafachronic-acid signaling and DAF-16/FOXO have distinct effects on gene transcription in animals that lack germ cells, both are required to extend lifespan. Furthermore, dafachronic acid does not override the requirement for DAF-16/FOXO to extend longevity, and rendering DAF-16/FOXO constitutively nuclear does not override the requirement for DAF-12/NHR. These two pieces of data make it unlikely that DAF-12/NHR and DAF-16/FOXO operate in a simple linear pathway, where the transcriptional effects of mutation of one gene would be completely mimicked by the mutation of the other. Instead, the simplest interpretation is that DAF-12/NHR and DAF-16/FOXO function in parallel to promote longevity in animals without germ cells.Therefore, we propose the following model : germ-ceAll strains used in this study were maintained under standard conditions N2daf-12(rh61rh411)CF2479 daf-9(e1406); mgEx662[daf-9p::daf-9 genomic::GFP]daf-9(e1406); mgEx670daf-9(e1406); mgEx663daf-9(e1406); mgEx666daf-9(e1406); mgEx668dpy-5(e907); sEx15369[Pcdr-6::GFP + pCeh361]BC15369 sEx15369[Pcdr-6::GFP + pCeh361] obtained by outcrossing BC15369 3 times to the laboratory N2CF3595 daf-12(rh61rh411); sEx15369[Pcdr-6::GFP + pCeh361]CF3596 agIs6[Pdod-24::GFP]AU68 agIs6[Pdod-24::GFP] obtained by outcrossing AU86 3 times to the laboratory N2CF3556 daf-12(rh61rh411); agIs6[Pdod-24::GFP]CF3600 daf-16(mu86); agIs6[Pdod-24::GFP]CF3601 muIs84[Psod-3::GFP]CF1553 daf-12(rh61rh411); muIs84[Psod-3::GFP]CF3604 daf-16(mu86); sEx15369[Pcdr-6::GFP + pCeh361]CF3597 glp-1(e2141)CF1903 daf-16(mu86); glp-1(e2141)CF1880 glp-1(e2141); daf-12(rh61rh411)CF1658 daf-16(mu86)CF1037 Psod-3::GFP was described previously in daf-9::GFP strains were provided by the Ruvkun Lab and were described previously in Pdod-24::GFP strain was kindly provided by D. Kim. Strains containing Pcdr-6::GFP were obtained from the Genome British Columbia C. elegans Gene Expression Consortium Some nematode strains used in this study were provided by the Caenorhabditis Genetics Center, which is funded by the NIH National Center for Research Resources (NCRR). Construction of 3 agarose pads as experimental animals.Germ-cell  or somatic-gonad  precursor cells of newly hatched L1 larvae were killed by laser ablation as described previously p values were determined using the log-rank (Mantel-Cox) method.Lifespan analysis was performed at 20\u00b0C as described previously 3. Images were taken using a Retiga EXi Fast1394 CCD digital camera (QImaging) using the 10\u00d7 objective on a Zeiss Axioplan 2 compound microscope (Zeiss Corporation). Each image was taken with the intestine in focus, since expression of the various transgenes was primarily in the intestine. For each trial, exposure time was calibrated to minimize the number of saturated pixels for that set of animals. Openlab 4.0.2 software (Improvision) was used to quantify the total intensity of fluorescence per worm as measured by intensity of each pixel in the selected area of a frame (i.e. the worm). Vulval expression of Psod-3::GFP, which was very bright, was excluded from quantification, since this structure is not present in animals lacking the gonad. Fluorescence of the entire animal was measured for all other GFP constructs. No expression of any of the constructs was visible in embryos prior to egg laying. Image processing for figures was performed using Adobe Photoshop 7.0 (Adobe).On day 2 of adulthood, animals were anaesthetized on agarose pads containing 0.15 M NaNglp-1(e2141ts) and wild-type N2 animals were raised at 25\u00b0C from L1 to day 1 of adulthood, then shifted to 20\u00b0C. On day 2 of adulthood, animals were collected for RNA extraction. RNA extraction, purification, and reverse transcription were carried out as described in Sterile http://docs.appliedbiosystems.com/pebiodocs/04303859.pdf). Data were generated from at least two biological repeats. mRNA levels of ama-1, nhr-23, and Y45F10D.4 were used for normalization p values were determined using one-way ANOVA. Primer sequences are available upon request.qPCR was performed using the 7300 Real Time PCR System (Applied Biosystems) and data were analyzed using the Ct method  mutant slightly extends lifespan in a somatic gonad-independent fashion. Removal of the germ cells and the somatic gonad in animals carrying the putative null daf-12(rh61rh411) allele extends lifespan. However, daf-12(rh61rh411) germ cell (\u2212) animals do not live as long as germ cell (\u2212) animals that carry the wild-type allele of daf-12/NHR. Means and p values are listed in (0.07 MB TIF)Click here for additional data file.Figure S2The somatic gonad represses the expression of dod-24. (A) dod-24 requires the somatic gonad for proper expression. The expression of the Pdod-24::GFP transgene was variable; however, across multiple experiments, we observed a consistent trend towards decreased intestinal Pdod-24::GFP expression when the germ cells were removed.  In germ cell (\u2212); somatic gonad (\u2212) animals, Pdod-24::GFP expression levels increased relative to those of intact-gonad and germ cell (\u2212) animals.  Thus, the presence of the somatic gonad suppresses dod-24 expression. (B) GFP driven by the dod-24 promoter was observed throughout the intestine of wild-type animals. Arrowheads indicate position of the head. Original images were rotated and placed on a flat black background. (C) The increase in Pdod-24::GFP caused by removal of the somatic gonad required daf-12/NHR. Expression of Pdod-24::GFP did not increase in daf-12(rh61rh411) mutants in 4 out of 5 trials when the somatic gonad and germ cells were removed. Highly variable changes in overall expression of Pdod-24::GFP were observed when daf-12/NHR was mutated, even in intact animals. (D) daf-16/FOXO had little effect on the ability of the somatic gonad to inhibit dod-24 expression. In daf-16(mu86) mutants lacking the germ cells, removal of the somatic gonad still resulted in increased expression of Pdod-24::GFP. p values for pair-wise comparisons to intact-gonad animals are indicated by: *** p<0.0001, ** p<0.001, * p<0.05, ns p>0.05. Means and p values are listed in (0.73 MB TIF)Click here for additional data file.Table S1Dafachronic acid extends the lifespan of animals that lack both the somatic gonad and germ cells.(0.03 MB XLS)Click here for additional data file.Table S2Overexpression of DAF-9/CYP450 extends the lifespan of animals that lack both the somatic gonad and germ cells.(0.02 MB XLS)Click here for additional data file.Table S3The daf-12(rh61rh411) allele uncovers a lifespan shortening function of DAF-12/NHR in addition to its lifespan promoting activity in germ cell (\u2212) animals.(0.02 MB XLS)Click here for additional data file.Table S4Pcdr-6::GFP up-regulation in animals that lack germ cells requires the somatic gonad and daf-12/NHR.(0.03 MB XLS)Click here for additional data file.Tabe S5Pdod-24::GFP expression changes in a daf-12/NHR-dependent fashion when the germ cells and somatic gonad are removed.(0.03 MB XLS)Click here for additional data file.Table S6Psod-3::GFP up-regulation in animals that lack germ cells is largely independent of daf-12/NHR.(0.03 MB XLS)Click here for additional data file.Table S7Pcdr-6::GFP up-regulation in animals that lack germ cells is largely independent of daf-16/FOXO.(0.03 MB XLS)Click here for additional data file.Table S8Changes in Pdod-24::GFP expression in the absence of germ cells and somatic gonad do not require daf-16/FOXO.(0.03 MB XLS)Click here for additional data file.Table S9DAF-16/FOXO and DAF-12/NHR have distinct effects on gene expression in animals that lack germ cells.(0.03 MB XLS)Click here for additional data file."}
+{"text": "Present study was designed to evaluate Jigrine was evaluated in a number of pharmacological test paradigms, viz. open field arena, actophotometer, hole board, rotarod, traction test, grip strength test, spontaneous alternation behavior, passive avoidance task, and phenobarbital sleeping time.Jigrine pretreatment  did not produce any significant effect as compared to normal saline treated animals and was found to be free from any acute undesirable central effects at these two dose levels. Herbal drugs are widely used for the treatment of various diseases. Although herbal drugs often contain highly active pharmacological compounds but much importance is not given to their safety evaluation, may be due to a popular notion \u201canything herbal is safe.\u201d Lately, with recent increasing interest in traditional or herbal drugs for the prevention and treatment of various disorders, there is also increasing concern about the safety of traditional, herbal product based medicines.per se neuropharmacological effects of jigrine in mice.Jigrine is a polypharmaceutical herbal formulation containing aqueous extracts of 14 medicinal plants used for liver ailments in traditional Indian system of medicine (Unani) . Few stuad libitum. All the procedures carried out on animals were approved by institutional animal ethics committee (JHAEC).Albino mice weighing 20\u201330 g were used for the study. Animals were supplied by Central Animal House Facility of Jamia Hamdard (Hamdard University) and kept under standard laboratory conditions in 12 h light/dark cycle at 25\u00b12\u00b0C. Animals were provided with pellet diet  and water For each of the following tests, mice were divided into three groups of six animals each. Group I served as normal control and received normal saline . Groups II and III received jigrine 1 and 2 ml/kg, p.o., respectively.Mice were observed for their spontaneous motor activity by placing them individually in the actophotometer and number of beam breaks was recorded for 6 min. This apparatus consisted of a square chamber and the activity of the animals was recorded by light beams passing through the chamber and connected to photoelectric cells. The activity was recorded at 0 time and 30, 60, 90, and 120 min after their respective treatments. The actoet al.[Mice were observed for open field activity as per the method of Tricklebank et al. for 6 miMice were observed on the wooden hole board at 0 time (before treatment) and 60 and 120 min after their respective treatments.The wooden hole board apparatus consisted of 60 \u00d730 cm dimensions with 16 evenly placed holes and painted gray. The number of times the mice dipped their heads in holes during a 3-min trial was counted.Mice were trained to stay on the rotating rod of the rotarod (20 rpm) for 3 min. Trained mice were randomly divided into three groups as described above. All the animals were placed on the rotating rod  60 and 120 min after their respective treatments and the length of time they remained on the rotating rod was recorded.et al.[This test was carried out as per the procedure reported by Anca et al. Animals et al.12Grip strength of animals in all the 3 groups was measured as an indicator of neuromuscular function after 1hour of their respective treatments. The grip strength meter was positioned horizontally. Mice were held by the tail and lowered toward the apparatus. Mice were allowed to grasp smooth metal wire mesh (fore limbs only) and were then pulled backward in the horizontal plane. The force applied to the bar at the moment the grasp was released was recorded as the peak tension (kg). The test was repeated five times within the same session and the highest value from the five trials was recorded as grip strength for that animal.Spontaneous alternation behavior in mice was assessed by using a cross-maze. The maze was made up of plywood (painted gray) and consisted of symmetrical arms (23.5 cm long and 8 cm wide) with 10 cm high sidewalls. The arms extended from a central platform (8 \u00d7 8 cm) at a height of 50 cm above the floor and were labeled A, B, C, D. Mice were allowed to traverse the maze freely for 6 min after being placed on the central platform. The number and sequence of arm entries were recorded for calculation of a \u201cpercent alternation score.\u201d An alternation was defined as entry into four consecutive arms on overlapping quintuple sets. Five consecutive arm choices within the set of arm choices made up quintuple sets. A quintuple set consisting of arm choices, ABDAC, was considered an alternation. A quintuple set consisting of arm choices, ABDAB, was not considered an alternation. Using this procedure, possible alternation sequences are equal to the number of arm entries minus 4. The percent alternation score is equal to the ratio of  \u00d7 100.et al.[The method of Papazova et al. was usedet al.One hour after their respective treatments, all the animals received pentobarbitobne . Time interval between administration of pentobarbital until the loss of righting reflex was recorded as the onset of sleep while the time from the loss of righting reflex to recovery was recorded as the sleeping time.P< 0.05 was considered significant.Results are expressed as mean\u00b1SEM. Total variation present in a set of data was estimated by ANOVA followed by Dunnet\u2019s post hoc test. Jigrine was evaluated for its per se effects on locomotor activity, open field activity, hole board activity, rotarod performance, muscle relaxation, muscle grip strength, spontaneous alternation behavior, and sodium pentobarbital induced sleeping time in mice to assess its neuropharmacological safety profile. Locomotor and open"}
+{"text": "We aimed to characterize the lasting effect of moderate caloric restriction during early pregnancy on offspring energy homeostasis, by focusing on the effects on food intake and body weight as well as on the insulin and leptin systems.Male and female offspring of 20% caloric restricted dams (from 1 to 12 days of pregnancy) (CR) and from control dams were studied. These animals were fed after weaning with a normal-fat (NF) diet until the age of 4 months, and then moved to a high-fat (HF) diet. Blood parameters were measured under fed and 14-h fasting conditions at different ages . Food preferences were also assessed in adult animals.Accumulated caloric intake from weaning to the age of 5 months was higher in CR animals compared with their controls, and this resulted in higher body weight in adulthood in males, but not in females. Both male and female CR animals already showed higher insulin levels at the age of 2 months, under fed conditions, and higher HOMA-IR from the age of 4 months, compared with their controls. CR male animals, but not females, displayed higher preference for fat-rich food than their controls in adulthood and higher circulating leptin levels when they were under HF diet.It is suggested that hyperinsulinemia may play a role in the etiology of hyperphagia in the offspring of caloric restricted animals during gestation, with different outcomes on body weight depending on the gender, which could be associated with different programming effects on later leptin resistance. There is a growing body of evidence showing that the nutritional environment during early life may have later effects on the propensity to suffer from obesity and its related metabolic pathologies ,2. In thHowever, most evidence showing a direct association between gestational malnutrition and a higher propensity to obesity in later life comes from studies in rats, based on severe caloric restriction, generally between 30 to 50%, or severe protein restriction. For instance, Jones and Friedman  showed tOn another hand, little is known about the underlying mechanisms involved in the developmental programming of energy balance under conditions of undernourishment during gestation. The involvement of specific areas of the hypothalamus in the regulation of food intake and energy homeostasis has been clearly established . Hence, The purpose of the present study was to examine the lasting effects of moderate caloric restriction of 20% during the first 12 days of gestation upon offspring energy homeostasis, by focusing on the effects on food intake, body weight and fat accumulation, and on the insulin and leptin systems as possible determinants of potential disorders. In addition, the study was designed to investigate differences between male and female rats and in the effects of a dietary stressor in adult life such as high fat (HF) diet exposure.ad libitum feeding conditions. After the caloric restriction period, rats were allowed to eat ad libitum, and food intake was measured. At day 1 after delivery, excess pups in each litter were removed to keep 10 pups per dam . Weaning was conducted at 21 days of life.The study was performed in male and female rats from 12 different litters, following the protocol below. All rats were housed under controlled temperature (22\u00b0C) and a 12 h light-dark cycle (light on from 0800 to 2000), and had unlimited access to tap water and standard chow diet  unless mentioned otherwise. Briefly, virgin female Wistar rats weighing between 200 g and 225 g were mated with male rats . Day of conception (day 0 of pregnancy) was determined by examination of vaginal smears for the presence of sperm, and then female rats were single caged. Pregnant rats were divided into two groups : one with free access to standard chow diet, and the other one underwent a 20% restriction of caloric intake from day 1 to day 12 of pregnancy. Caloric restriction was performed by offering each dam a daily amount of food corresponding to 80% of the calories should be eaten according to body weight. This amount was calculated considering the calories daily consumed by their control animals under At weaning, 24 animals from control dams (controls)  and 24 from caloric restricted dams (CR)  were placed two per cage, paired with another animal of the same group, and fed with standard diet until the age of 4 months; then they were exposed to a high fat (HF) diet . HF diet contained 5.5% calories from soybean oil and 39.5% from lard.Body weight and food intake of the offspring were followed until the age of 5 months. In addition, body fat content  was measured without anesthesia at 2 different ages, when animals were 2 and 5 months old. Body length (from the tip of the nose to the anus) was also measured at the end of the follow up, when animals were 5 months old.ad libitum - animals provided with free access to chow diet - and fasting - animals deprived of food for 14 h. In both conditions, samples were obtained without anesthesia and during the first 2 h of the beginning of the light cycle. Plasma was obtained by centrifugation of blood at 700 g for 10 min, and stored at -20\u00b0C until analysis.At 3 different ages , blood samples  were collected (in heparinized containers) from the saphenous vein of control and CR animals, under different feeding conditions: The animal protocol followed in this study was reviewed and approved by the Bioethical Committee of our University and guidelines for the use and care of laboratory animals of the University were followed.Blood glucose concentration was measured by Accu-Chek Glucometer . Plasma insulin concentration was determined using a rat insulin enzyme-linked immunosorbent assay (ELISA) kit  following standard procedures. Plasma leptin concentration was measured using a mouse leptin ELISA kit . Commercial enzymatic colorimetric kits were used for the determination of plasma triglyceride (TG) levels (Triglyceride (INT) 20, Sigma Diagnostics, St Louis, MO, USA) and non-esterified fatty acid (NEFA) .The homeostatic model assessment for insulin resistance (HOMA-IR) was used to assess insulin resistance. It was calculated from fasting insulin and glucose concentration using the formula of Matthews et al : HOMA-IRFood preferences were assessed by a two-bottle preference test as previously described . BrieflyGiven that the animals studied were from six different litters in each treatment group, the effect of litter was simultaneously factored with all data by repeated measures ANOVA. No interactions between the litter and treatment were found across all the data, thus, data were expressed as mean \u00b1 S.E.M of animals from the six different litters. Multiple comparisons were assessed by repeated measures ANOVA and two-way ANOVA to determine the effects of different factors . Single comparisons between groups were assessed by Student's t test or Paired t test. The analyses were performed with SPSS for Windows . P < 0.05 was always the threshold of significance.As previously described in the same cohort of dams , 20% matAs shown in Figure The higher body weight of CR male animals compared with their controls can be explained by higher food intake Figure . Daily fUnlike males, no statistically significant differences were found in body weight of CR female animals compared with their controls at any age Figure . NeverthDifferences in body weight between control and CR adult male animals can be mainly attributed to differences in body fat content. At the age of 5 months, CR male animals presented higher percentage of body fat than controls (Student's t test) Figure . HoweverBody length of animals was not different between control and CR animals, either in males or females (data not shown).Circulating glucose, insulin, leptin, triglycerides and NEFA levels were measured in control and CR male and female animals under fed and 14 h fasting conditions at the ages of 2, 4 and 5 months  Figure .Circulating leptin levels of control and CR animals under fed and fasting conditions at the ages of 2, 4 and 5 months are also shown in Table Blood lipid profile was significantly altered in CR animals as of the early stages of life Table . In factFood preferences were measured in adult animals at the age of 3 months with the two-bottle preference test Figure . Both coIt is known that severe caloric restriction during gestation in rats increases the propensity of adverse health outcomes in adulthood, including obesity, although differences according to the magnitude of restriction has been described ,8,9. HerCentral resistance to insulin and/or leptin has been proposed as important mechanisms responsible for the dysregulation of energy homeostasis, which may lead to obesity -17. HereConcerning leptin, moderate caloric restriction led to gender related differences on later leptinemia. Adult CR male animals under NF diet showed a tendency to higher circulating leptin levels under ad libitum feeding conditions compared with their controls, in accordance with their higher body weight. This hyperleptinemia was further increased later on, when animals were 5 months old and under HF diet. In fact, it has been described an increase in leptin levels with age, which seems to be associated to the increased body weigh and fat content . This maImpaired fetal growth by 30% caloric restriction throughout gestation has also been described to be associated with hyperinsulinemia and hyperleptinemia in adult male offspring . These dCirculating lipid profile in animals that underwent caloric restriction during gestation, particularly the elevations of plasma NEFA and TG levels already occurring at the age of 2 months, could also give some clues to explain the apparent insulin resistance in both male and female CR animals. Elevated circulating NEFA levels have been described to play an important role in early molecular events involved in the development of insulin resistance . They diMetabolic programming of hyperphagia due to maternal caloric restriction during gestation could be associated with an alteration in the neuronal development of the central nervous system under these environmental conditions . In factThe reasons for the differences between males and females regarding circulating leptin levels and fat accumulation in adult life due to these particular prenatal conditions are not clearly elucidated yet. Of interest, differences between genders concerning the sensitivity to central leptin and insulin have been previously described ,29. The In addition to the amount of food intake, programming food preferences, as a part of the feeding behavior, may contribute to body weight control and to the development of obesity. This is particularly relevant in humans where obesity development is generally associated with increased appetite and preference for highly caloric food ,34. HereIn summary, it is concluded that a moderate caloric restriction of 20% during the first part of gestation has lasting, gender-dependent effects in the offspring. In particular, these animals are programmed for higher food intake, which seems to be related with central insulin resistance and with higher blood TG and NEFA levels, already present at a juvenile age, and this concludes in higher body weight in adult male rats but not in females. Why programming animals for higher food intake has different outcomes depending on the gender of animals needs further investigation; it is hypothesised that hyperleptinemia, which seems to occur, at least to some extent, in CR males but not in females under these conditions, may play a determinant role in the adult onset of obesity.The authors declare that they have no competing interests.MP participated in the experimental design of the study, carried out the animal procedure and the analysis, and participated in the discussion of the results. TP participated in the animal procedure and the discussion of the results. JS participated in the animal procedure and in the discussion of the results. AP participated in the design and coordination of the study and revised the final version of the manuscript. And CP conceived of the study, and participated in its design and coordination, carried out the discussion of the results and wrote the article. All authors read and approved the final manuscript."}
+{"text": "NFKB1 gene was identified which seems to be the first potential functional NFKB1 genetic variation. The main goal of the present investigation was to investigate the NFKB1 -94 insertion/deletion ATTG polymorphism in relation to risk of dilated cardiomyopathy (DCM).Previous studies in experimental and human heart failure showed that nuclear factor kappa B (NF-\u03baB) is chronically activated in cardiac myocytes, suggesting an important involvement of NF-\u03baB in the cardiac remodeling process. A common insertion/deletion  located between two putative key promoter regulatory elements in the NFKB1 -94 insertion/deletion ATTG polymorphism was genotyped by using PCR-PAGE.A total of 177 DCM patients and 203 control subjects were successfully investigated. The NFKB1 -94 insertion/deletion ATTG polymorphism in DCM patients was significantly different from that in control subjects (P = 0.015) and the ATTG2 carrier (ATTG1/ATTG2 + ATTG2/ATTG2) was susceptible to DCM.Genotype frequency of NFKB1 -94 insertion/deletion ATTG polymorphism is associated with DCM.Our data suggested that  Dilated cardiomyopathy (DCM), characterized by left ventricular dilation and systolic dysfunction, is the most common form of heart muscle disease, comprising 60% of the cases of identified cardiomyopathy . This diClinical observations and experimental studies have demonstrated that left ventricular (LV) remodeling and dilation occurs with the progression of end-stage LV failure. It has been reported that in experimental and human heart failure, nuclear factor kappa B (NF-\u03baB) is chronically activated in cardiac myocytes, suggesting an important involvement of NF-\u03baB in the cardiac remodeling process . NF-\u03baB iNFKB1 gene was identified which seems to be the first potential functional NFKB1 genetic variation. The presence of a 4 base pair (bp) deletion resulted in the loss of binding to nuclear proteins, leading to reduced promoter activity [NFKB1 -94 insertion/deletion ATTG polymorphism on the occurrence of DCM.A common insertion/deletion polymorphism  located between two putative key promoter regulatory elements in the activity . A reseaactivity -19. Furtactivity -23. HoweThis study was approved by the hospital ethics committee and all subjects gave written informed consent to participate. One hundred and seventy seven unrelated DCM patients between September 2002 and March 2008 were enrolled in this study. The diagnosis of DCM was made in accordance with the revised criteria established by the 1995 World Health Organization/International Society and Federation of Cardiology Task Force on the Classification of Cardiomyopathy (DCM group) [NFKB1. DNA fragments containing the polymorphism were amplified and the primer sequences were: F 5'-tggaccgcatgactctatca-3', R 5'-ggctctggcttcctagcag-3'. PCR reaction was performed in a total volume of 25 \u03bcl, including 2.5 \u03bcl 10\u00d7 PCR buffer, 1.5 mmol/L MgCl2, 0.15 mmol/L dNTPs, 0.5 \u03bcmol/L each primer, 100 ng of genomic DNA and 1 U of Tag DNA polymerase. The PCR conditions were 94\u00b0C for 4 min, followed by 32 cycles of 30 s at 94\u00b0C, 30 s at 64\u00b0C and 30 s at 72\u00b0C, with a final elongation at 72\u00b0C for 10 min. 3 \u03bcl PCR products were separated by a 6% polyacrylamide gel and staining with 1.5 g/L argent nitrate. Allele (ATTG)1 yield a 154 bp band and allele (ATTG)2 yield a 158 bp band. About 20% of the samples were randomly selected to perform the repeated assays and the results were 100% concordant.Genomic DNA of each individual was extracted from 200 \u03bcl EDTA-anticoagulated peripheral blood samples by a DNA isolation kit from Bioteke  and the procedure was performed according to instruction manual. The polymerase chain reaction (PCR)-polyacrylamide gel electrophoresis (PAGE) method was used to genotype the -94 insertion/deletion ATTG polymorphisms of NFKB1 gene -94 insertion/deletion ATTG polymorphism were obtained by directed counting and Hardy-Weinberg equilibrium were evaluated by chi-square test. Odds ratio (OR) and respective 95% confidence intervals were reported to evaluate the effects of any difference between allelic and genotypes distribution. Probability values of 0.05 or less were regarded as statistically significant in DCM patients compared to healthy controls.All data analyses were carried out using SPSS 13.0 statistical software. Allelic and genotype frequencies of NFKB1 gene -94 insertion/deletion ATTG polymorphism were tested between DCM patients and controls, and observed differences are presented in Table Genotype distributions had no deviation from Hardy-Weinberg equilibrium both in patients and controls. Differences in allelic and genotype distribution of 1/ATTG1 genotype was slightly overrepresented in controls . Furthermore, the P value and OR were 0.005 and 2.304, respectively, ATTG1/ATTG2 + ATTG2/ATTG2 vs. ATTG1/ATTG1 comparison, indicating that ATTG2 carrier (ATTG1/ATTG2 + ATTG2/ATTG2) was susceptible to DCM. The frequency of allele ATTG2 in DCM patients was higher than that in control subjects (62.7% vs. 57.1%), but is not statistically significant (P = 0.118).The overall genotype frequency of DCM patients was significantly different from that of controls. The frequency for ATTGGenetic factors are known to play an important role in the etiology of DCM. The first DCM-associated mutation, in the dystrophin gene, was described in 1993 ,25. The factor in the nucleus of B cells that binds to the enhancer of the kappa light chain of immunoglobulin [NF-\u03baB was discovered by Baltimore and coworkers in 1986 as a globulin ,26. The globulin . Inapproglobulin . NF-\u03baB iglobulin ,23,27. Hglobulin . FurtherNFKB1 promoter in 10 inflammatory bowel disease and 2 controls, and the ATTG1 allele was more frequent in ulcerative colitis than that in controls in the following study. The in vitro promoter expression studies suggest that the ATTG1 allele may result in relatively decreased NFKB1 message and hence decreased p50/p105 NF-\u03baB protein production [The -94 insertion/deletion ATTG polymorphism was identified in a study sequenced the oduction . The assoduction ,17,29.NFKB1 gene -94 insertion/deletion ATTG polymorphism in DCM patients is not significantly different from that of controls. However, the genotype frequency distribution in DCM patients was significantly different from that of controls. The frequency of the ATTG1/ATTG1 genotype of NFKB1 gene -94 insertion/deletion ATTG polymorphism in controls was significantly higher that in DCM patients. We conducted comparison between ATTG1/ATTG1 and (ATTG1/ATTG2+ATTG2/ATTG2) in DCM patients and controls, and further significant difference was observed (p = 0.005). These results indicated that ATTG2 carrier (ATTG1/ATTG2 + ATTG2/ATTG2) was susceptible to DCM. The allelic distribution between DCM patients and controls was different, although not statistically significant (p = 0.118), and the frequency for ATTG2 allele in DCM patients is higher than that in controls, although not statistically significant, also indicating that ATTG2 allele might be a risk factor for the susceptibility to DCM.Given the considerable important role of NF-\u03baB pathway involved in initiation and progression of pathogenesis in disease, we investigated the association between -94 insertion/deletion ATTG polymorphism and susceptibility to DCM. The present study shows that the allelic frequency for NFKB1 gene -94 insertion/deletion ATTG polymorphism in DCM patients is significantly different from that in control subjects, and (ATTG1/ATTG2+ATTG2/ATTG2) genotype frequency is higher in DCM patients than that in control subjects. Considering that the ATTG1 allele may result in decreased NFKB1 message and p50/p105 NF-\u03baB protein production, a detrimental role of NF-\u03baB-activation in the initiation and progression of pathogenesis in DCM can be presumed and much further work will be needed for a complete understanding of its mechanism. The main limitation of the present study is the relatively small size of the study population and the lack of replication of the significant association in a second independent cohort of DCM patients.The role of NF-\u03baB in heart has been extensively studied by many authors . Its rolNFKB1 -94 insertion/deletion ATTG polymorphism is significantly associated with DCM. The genotype frequency of (ATTG1/ATTG2+ATTG2/ATTG2) is significantly overrepresented in DCM patients, indicating that ATTG2 carriers are associated with the increased risk of DCM. However, additional studies in a larger number of DCM patients and in different populations could help to establish the true significance of this association.From this study we conclude that the The authors declare that they have no competing interests.BZ, LR and LZ conceived of the study, participated in its design, carried out most of the experiments and drafted the manuscript. YL, LG and YW participated in design of study and helped to draft the manuscript. YC, HX and YS performed sample collection and DNA extraction. YP and ML participated in genotyping. All authors have read and approved the final manuscript.The pre-publication history for this paper can be accessed here:"}
+{"text": "Detailed human studies of the mechanisms and development of shunt infection in real time are not possible, and we have developed a canine hydrocephalus model to overcome this. The intention of this pilot study was to show that the canine hydrocephalus model could be shunted using conventional \"human\" shunts, and that a shunt infection could be established so that further studies could then be planned.Canis familiaris) by fourth ventricle obstruction. Four weeks later they were shunted using a Hakim Precision valve. Four of the dogs received shunts whose ventricular catheter had been inoculated with Staphylococcus epidermidis, and three were uninoculated controls. Four weeks after shunting the dogs were sacrificed and necropsy was performed. Removed shunts and tissue samples were examined microbiologically and isolates were subjected to detailed identification and genomic comparison.Hydrocephalus was induced in seven dogs (S. epidermidis in the brain and throughout the shunt system in the four inoculated animals, but in two of these Staphylococcus intermedius was also found. S. intermedius was also isolated from all three \"negative\" controls. There were slight differences between S. intermedius strains suggesting endogenous infection rather than cross- infection from a point source.All the dogs remained well after shunting. Examination of removed shunt components revealed Shunt infection was established in the canine model, and had the experiment been extended beyond four weeks the typical microbiological, pathological and clinical features might have appeared. The occurrence of unplanned shunt infections in control animals due to canine normal skin flora reflects human clinical experience and underlines the usual source of bacteria causing shunt infection. Staphylococcus epidermidis [S. epidermidis infections is typically low-grade. A shunt-related infection of the central nervous system (CNS) is of particular concern because of the threat to cerebral functions. Treatment may be prolonged and relapses may occur, complicating control of intracranial pressure and giving rise to life-threatening risks such as cognitive and neurological deficits [The introduction of cerebrospinal fluid (CSF) shunts revolutionized the treatment of hydrocephalus and greatly decreased mortality rate. However, over subsequent decades, difficulties in shunt maintenance and problems resulting from infection or occlusion have persisted . Today, dermidis ,10. Thesdermidis . The sevdeficits ,6,12,13.Although many studies have investigated the rate, aetiology and epidemiology of shunt infections, preventive measures are difficult to study, and their pathophysiology is largely unknown due to the difficulties inherent in human studies. Animal models of infection in other implantable devices have not hitherto been suitable for these purposes. We have developed a canine model of chronic obstructive hydrocephalus  which prCanis familiaris) weighing 25\u201330 kg were used for this study. Animals were obtained from licensed suppliers and quarantined for a minimum of seven days before entering the study. They were maintained in the Cleveland Clinic's fully accredited Animal Care Facility and their maintenance and all experimental procedures were conducted in accordance with the National Institutes of Health (NIH) and The Cleveland Clinic Foundation Animal Research Committee (ARC) guidelines for the use and care of laboratory animals. Each experiment began with the induction of obstructive hydrocephalus (time zero), the details of which have been previously described [Seven young adult (8\u20139 months) male purpose \u2013 bred mongrel dogs . Prior to placement, the ventricular catheter in four of the animals was inoculated with S. epidermidis sensu stricto, F22, a clinical isolate from a proven VP shunt infection. A suspension of the bacteria was prepared in 2 mL of 0.85% saline to give an absorbance at a wavelength of 490 nm of 0.6 equivalent to a bacterial count of 1.0 \u00d7 108 colony forming units (cfu) per mL and the catheter was filled with this suspension. The remaining three animals were not inoculated. Post-operative monitoring and care was similar to that described for the post-induction recovery period except that no antibiotics were given. The animals were checked daily and data on temperature, heart rate, food and water intake, and incision site were obtained. The animals were weighed weekly, and closely monitored for clinical signs of infection for the four weeks following the shunt inoculation and implantation procedure. These signs included systemic variables such as sepsis and a persistent fever greater than 39.1\u00b0C, neurological variables such as lethargy, coma, seizures, and focal deficits, and local variables such as swelling, redness, soreness, and discharge. If no signs of infection occurred during the 4 weeks of observation, the animals were anaesthetized and a dissection was performed under aseptic conditions.Approximately four weeks after induction, the hydrocephalic animals underwent a standard shunt implantation surgery. The preoperative method of sedation and positioning with the stereotaxic head frame was the same as described previously ,17. The The distal end of the VP shunt was carefully exposed by gross dissection and ligated with silk sutures at the ventricular catheter, proximal and distal to the valve, and at the most distal end of the shunt tubing. Biopsies of the brain parenchyma and meninges adjacent to the ventricular catheter track were obtained via a 2 cm bilateral cranial burr hole. A biopsy of the peripheral tissue adjacent to the valve was obtained and the valve removed. The distal catheter tip was cut and removed along with the remaining peritoneal shunt tubing. The three tissue samples , catheter tips , ligated shunt, and the CSF samples Fig  were sen2 at 35\u00b0C, bacterial growth and identification for all samples were determined. The isolates were then sent to the University of Nottingham (R.B.) for further examination. After confirmation of identity using basic tests, each isolate was examined by APIStaph , numerical antibiogram [The tissue samples, catheter tips and lumbar CSF samples underwent routine microbiological processing. The ligated shunt tubing was sonicated for one minute, and fluid withdrawn from the lumen for culture. After incubation overnight in COibiogram  and pulsEach brain and its corresponding meninges was examined for gross signs of encephalitis, meningitis, and ventriculitis (GP). Tissue from the right cerebral hemisphere, which included the ventricular catheter track from each animal was embedded in paraffin wax, sectioned at 8 \u03bcm, and stained with haematoxylin and eosin, and the Brown-Brenn tissue Gram stain.All seven animals that underwent the induction of chronic hydrocephalus procedure recovered from surgery. One animal developed symptoms of acute hydrocephalus and required two days of observation in the Critical Care Unit and treatment of raised ICP before resolution. In the remaining animals, vital signs monitored  during the three to four-week period following the induction surgery remained in the normal range. At the time of sacrifice, Evans ratio of all animals was >0.3 confirming ventriculomegaly. There was no incidence of mortality or morbidity in any animal for either the experimental or control groups. Most hydrocephalic animals exhibited signs of lethargy, motor weakness, anorexia, and ataxia in the first seven days immediately following surgery. Vomiting often accompanied neurological signs  reflecting increased ICP. These neurological signs were observed to be transient and resolved within the first one to two days. No animal was observed to be febrile. Autopsy performed in each animal revealed no evidence of intracerebral or intraventricular bleeding, which corroborated with MRI data. In addition, the surgical incision site in all animals healed well and did not show any signs of infection.Six of the seven dogs lost weight during the first week following induction of hydrocephalus. The one animal that did not lose weight following surgery and one other animal whose weight returned to normal following recovery from induction, had shown a weight loss two weeks prior to the shunt implantation surgery. Food intake decreased by almost 50% eight days prior to the shunting procedure. In the four-week period following shunting all animals showed a steady weight gain for the remainder of the study. The animals recovered from the shunt-inoculation procedure very quickly. They had normal consumption of food and fluid the first day post-operatively. Gait and vital signs were normal for the four-week period following the inoculation-shunt procedure. None was febrile and there were no signs of infection of the abdominal or head wounds.At dissection, the animals were deeply anaesthetized, facilitating close examination of the wounds. In five of the seven animals, upon opening the healed sutured skin on the head, fluid collection was observed. In one animal this fluid was thick and slightly discoloured and followed the shunt catheter distally to the valve (neck region). On removal of the ventricular catheters, a plug appeared to block the end of the catheter in five animals. In addition, there was protein matter (non-brain) infiltrating some of the valve systems. No visual signs of infection were observed at the abdominal insertion incision. At autopsy no peritoneal cysts or other abnormalities were observed.S. epidermidis grew this organism from most of the collected samples . In two of these four \"S. epi\" animals, a second bacterium was also cultured. This was identified (APIStaph) as Staphylococcus intermedius. S. intermedius was grown in broth culture only from the brain tissue and proximal catheter samples of one animal and from the peritoneal tissue sample from the second animal. In the remaining three uninoculated control animals , all samples were positive for S. intermedius. The S. intermedius isolates were compared by APIStaph, numerical antibiogram and PFGE  was achieved and verified by gross examination and culture of hardware and tissue. In addition, the important role of skin flora in seeding of a shunt system during insertion was demonstrated fortuitously by the high rate of S. intermedius isolation, the three dogs that were not inoculated with S. epidermidis all contracting shunt infections due to S. intermedius. The evidence of infection decreased with samples taken downstream of the catheter in the peritoneal cavity, and none was found in the lumbar fluid.Using the model a 100% infection rate (four out of four animals inoculated with 8cfu/mL bacteria into the ventricular catheter in four animals, in two cases the animals' own S. intermedius was also isolated, as well as from the three uninoculated controls . S. intermedius comprises 90% of all the staphylococci isolated from canine skin [S. intermedius and S. epidermidis were found in the same shunt system the S. intermedius was found in the more proximal portion, and S. epidermidis in the more distal part. Given the flow of CSF through the shunt system this suggests the possibility of bacterial contamination from the proximal end down to the distal end. Comparison of the S. intermedius isolates by three methods (Table In spite of the inoculation of 10ine skin . In two ds Table  showed tS. intermedius has been isolated from a majority of healthy canines [S. intermedius can be confused with Staphylococcus aureus. Both are coagulase positive, and produce a heat \u2013 stable nuclease, but S. intermedius does not produce Protein A and most isolates are clumping factor negative. Some variation can occur. Our isolates were clumping factor positive but coagulase negative using human plasma, and they produced a heat \u2013 stable nuclease. Their identification was kindly confirmed by Professor Fran\u00e7ois Vandenesch of the University of Lyon, France. canines  although canines -27. S. iThis paper characterizes a canine model of chronic adult obstructive hydrocephalus. The animals survived well with no mortality and low morbidity, providing the opportunity for physiological studies, pathophysiological analyses and diagnostic studies.S. intermedius infections, which once appreciated should be avoidable in future studies, we suggest that the model described here, perhaps with extended post \u2013 infection monitoring, is particularly suitable for the study of the pathogenesis, prevention and treatment of experimental shunt infections.In spite of the fortuitous endogenous The authors declare that they have no competing interests.RB contributed to the inception and design of the study, carried out the detailed microbiological investigations, and wrote the manuscript. CB and SMD assisted in the surgery and postoperative management and drafted data. MT and GH carried out the initial laboratory examination of removed shunts and tissues. GP carried out the necropsies and the histopathological investigations. MGL contributed to the inception and design of the study, carried out the hydrocephalus induction, the shunt surgery and the clinical examinations at termination, and oversaw the project in USA. All authors have read and approved the final version of the manuscript."}
+{"text": "After 18 weeks under EOD, animals were also trained by using a treadmill for another 6 weeks and then analyzed for physical activity. Both, EOD and endurance exercise increased the resistance of animals to extenuating activity and improved motor coordination. Among the groups that showed the highest performance, AL and EOD trained animals, ALT and EODT respectively, only the EODT group was able to increase glucose and triglycerides levels in plasma after extenuating exercise. No high effects on mitochondrial respiratory chain activities or protein levels neither on coenzyme Q levels were found in gastrocnemius muscle. However, exercise and EOD did increase \u03b2-oxidation activity in this muscle accompanied by increased CD36 levels in animals fed under EOD and by changes in shape and localization of mitochondria in muscle fibers. Furthermore, EOD and training decreased muscle damage after strenuous exercise. EOD also reduced the levels of lipid peroxidation in muscle. Our results indicate that EOD improves muscle performance and resistance by increasing lipid catabolism in muscle mitochondria at the same time that prevents lipid peroxidation and muscle damage.Every other day feeding (EOD) and exercise induce changes in cell metabolism. The aim of the present work was to know if both EOD and exercise produce similar effects on physical capacity, studying their physiological, biochemical and metabolic effects on muscle. Male OF-1 mice were fed either  Every other day feeding (EOD) is a procedure that resembles many of the effects of caloric restriction (CR). EOD increases life-span, decrease cancer incidence and protects against age-associated diseases and neurodegeneration or endogenous damage of DNA Ex vivo experiments on rat gastrocnemius muscle exposed to electrical stimulation have suggested synergy between CR and aerobic exercise in muscle bioenergetics The similar effects induced by CR and exercise suggest that both interventions share some mechanisms that modify cell physiology. Both, CR and exercise modify significantly the bioenergetics of muscle. Long-term CR delays the decline of the skeletal muscle aerobic capacity that occurs during aging Most of the studies reported about dietary restriction and exercise have been performed by comparing the effect of CR versus exercise The scope of our research includes the study of different physical activities such as: spontaneous locomotion, grip strength, startle response, motor coordination and resistance to strenuous exercise in mice submitted EOD and/or endurance exercise. All these parameters might be influenced by difference in mice's weight since they were fed in different conditions. However along our experiment we did not find any difference in weight between groups under either AL or EOD . Furthervs. 66.05\u00b110.41% in AL+EOD animals, n\u200a=\u200a32, P\u200a=\u200a0.002). Further, EOD also produced significant improvement in this test . When we compared the four groups, the higher and more significant improvement was found in the EODT group (P\u200a=\u200a0.001), , .vs. 840\u00b1108 s, P\u200a=\u200a0.015) and covered more distance . Remarkably, EOD group showed almost the same capacity than trained groups . In contrast, plasma glucose levels decreased in the ALT group after exercise although showing similar performance in the extenuating test  (P\u200a=\u200a0.012).The two EOD groups were able to maintain or even increase (in the case of EODT) glucose levels after extenuating exercise . A mean ing test . In the In the case of lactate, levels of witness animals showed a tendency to decrease in trained animals  and espevs. AL animals  independently of training (P\u200a=\u200a0.001). After extenuating exercise, EOD and EODT groups were able to maintain or even increase TGs levels while they decreased in AL group . After extenuating exercise, both AL and ALT groups showed increases in plasmatic cholesterol while EOD and EODT groups did not present any changes respecting witness animals (P\u200a=\u200a0.017) when all AL fed animals  were compared with all animals fed under EOD conditions .In the case of lipids, levels of circulating triglycerides (TGs) in witness animals were significantly lower in animals fed under EOD conditions  AL group . As in t animals . This inP\u200a=\u200a0.011). The effect of exercise on initial levels of urea was higher in EOD groups being significant between EOD and EODT groups (P\u200a=\u200a0.042). Extenuating exercise did not produce any remarkable change in the levels of plasmatic urea except in the case of EODT group  respecting to sedentary animals  . On the other hand, training slightly but not significantly increased activity in AL fed animals . However, in EODT animals a decrease of activity vs. EOD animals was found being significant in the case of complex II (P\u200a=\u200a0.017) but not in the case of complex III (P\u200a=\u200a0.379) (P\u200a=\u200a0.183). Training induced a slight decreased of this activity in AL fed animals (P\u200a=\u200a0.402) being higher and significant in EOD fed animals (P\u200a=\u200a0.035). We also determined the coupled activity of complexes I+III and II+III that depend on coenzyme Q (Q) amount in mitochondrial membrane. No changes among groups were found in both activities  . No chan=\u200a0.379) . In the =\u200a0.379)  we foundtivities .9 is the predominant form in mice being around 10 times more abundant than Q10. No significant differences among the different mice groups were found , whereas EOD only induced a non-significant increase (P\u200a=\u200a0.305). However, when combined, EOD and exercise highly increased \u03b2-oxidation in comparison with the levels found in the AL group (P\u200a=\u200a0.027). Further, we determined the level of the fatty acid translocase (CD36), a protein involved in the incorporation of fatty acids from plasma to muscle and in mitochondrial fatty acid oxidation. Surprisingly, EOD significantly increased CD36 levels in comparison with AL animals (P\u200a=\u200a0.0009) whereas in EODT animals the levels of this protein decreased to the levels of AL group , which is considered to produce only a mean of 15% deficit in the calorie input due to the fact that animals eat more when they have access to food Edge exploration and elevated plus maze tests indicate that the differences in physical activity were not due to a different degree of anxiety between groups. However, an interesting finding was that, with independence of the feeding procedure, trained animals decreased their total activity in an open field after few minutes probably indicating a higher capacity to recognize new environments. Our outcomes have also shown that EOD and aerobic training increase motor coordination and resistance to exhausting exercise. In the case of running on rolling carpet, EOD slightly increased physical resistance in trained animals whereas it did significantly increase resistance in the sedentary group when compared with the AL group. Interestingly, one of the documented changes in rodents fed under CR is the increase of non-forced physical activity when compared with AL fed animals Another interesting issue was the effect of EOD on the capacity of mobilization of nutrients such as sugars and fats. Our study differs from others mainly in the fact that metabolite analysis of blood was performed in animals that were not fasted overnight. Our aim was to determine the physical capacity and associated parameters, thus, we could not submit the animals to strenuous exercise after fasting. Our data indicate that EOD improves the capacity of mobilization of glucose and lipids maintaining the levels of these metabolites during a strenuous exercise. These results suggest that animals under EOD were more efficient in mobilizing nutrients necessary for physical activity. In agreement with our results, a study made on body builders has proved that restriction in calories during a brief period of time (7 days) increases the capacity to mobilize lipids during running Induction of mitochondrial biogenesis by CR or exercise has been shown in different organisms and tissues The increase in mitochondrial content is considered a well-established adaptation of muscle to exercise, and is mainly referred as mitochondrial biogenesis. In our hands, neither EOD nor exercise induced changes in the activity and amount of proteins involved in respiratory chain. Similar results have been recently shown in other models of CR and exercise where no changes in porin, a mitochondrial mass indicator, have been reported Our results also indicate that both EOD and exercise increase \u03b2-oxidation in muscle. Electron microscopy analysis of the mitochondria in gastrocnemius muscle demonstrated that the size, localization and morphology of mitochondria were different in EOD animals. EOD and EODT animals showed more mitochondrial structures in the intermyofibrillar area and around the myofibers. Intermyofibrillar location of mitochondria has been associated with lipid droplets. Thus, these changes in the mitochondria in an intermyofibrillar location in muscle suggest a more efficient activity producing ATP near the sarcomera by using lipid catabolism 9 and Q10 in a different way. Exercise decreased the ratio whereas EOD increased it. These changes probably respond to a more bioenergetic function of Q9 whereas Q10 mainly plays an antioxidant role in mice. CR decreases the levels of reactive oxygen species (ROS) in cells 9/Q10 ratio increases In agreement with previous results, levels of Q were also slightly affected by EOD and exercise EOD protected muscle fibers against oxidative stress even in animals that suffered endurance activity. This higher protection may be related to lower muscle damage after extenuating activity in non-trained EOD animals determined by the levels of creatine kinase in plasma. Our results agree with several other reports that suggest that EOD protects muscle against oxidative stress and even avoids muscle loss during aging In summary, our work indicate that a nutritional stress induced by the EOD model of CR together with a moderate increase of energy expenditure through physical exercise produces metabolic changes that increase the efficiency of mitochondrial activity in muscle, reduces oxidative damage and improves physical performance. Subtle modifications at the cellular and biochemical levels in response to dietary stress seem to be the basis for a higher mitochondrial efficiency. Taking into consideration that the decline in physical activity during age is a common factor in many species, the results shown here suggest that the combination of the reduction of calorie intake and the practice of aerobic exercise would also increase physical performance in humans and then, improve their quality of life.A cohort of 64 non-consanguineous swiss-OF1 male mice aged 6 weeks was used . Animals were housed into enriched environmental conditions in groups of 6 animals per polycarbonate cage in a colony room under a 12 h light/dark cycle (8:00 AM\u20138:00 PM) under temperature (22\u00b13\u00b0C) and humidity controlled. Animals were maintained accordingly to a protocol approved by the Pablo de Olavide University Ethical Committee and following the international rules for animal research.ad libitum (AL) and the other half under CR using the every-other-day feeding model (EOD) ad libitum for all the groups. After four months under these conditions, each group was randomly subdivided again in a sedentary group and a trained group following a mild forced aerobic exercise protocol. During the first two weeks, a training protocol was performed by a routine increasing both speed and time on a treadmill  until reaching 20 meters/min and 20 min. This protocol consisted in the 70\u201380% of average maximum speed reached in the initial tests. After that, animals were trained at this speed for 20 min/5 days a week during the following 6 weeks similarly to already published endurance exercise protocols ad libitum and sedentary group; ALT, ad libitum and trained group; EOD, caloric restricted and sedentary group and EODT, caloric restricted and trained group. Weight was determined every 15 days.Animals were first randomly assigned to two initial groups: half of the animals were fed All physical activity analysis was carried out between 9\u201311 hours in the morning and just after a feeding day for the EOD groups. Spontaneous activity was determined by using an open field box (26\u00d739 cm)  determined by the number of broken light beams during a period of 10 min per animal. Peripheral exploration was determined directly by eye in sessions of 5 min as anxiety measure. Also, elevated plus maze test was used to quantify anxiety levels during 5 min per animal. Press force tests were performed by using a Grip Strength . For startle response, animals were placed individually inside a startle chamber . The startle response was determined by using a piezoelectric accelerometer controlled by homemade software. Startle stimulus was 100 ms at 125 db and the response is indicated as the average from 20 to 30 recordings. Motor activity and coordination tests were performed on Rotarod . After an adaptation period, a test was performed to combine coordination and resistance by using Rotarod speed acceleration up to 100 rpm and determining the maximum riding time of animals at this speed.In the case of extenuating activity, all groups of animals performed a week of habituation before test. Half of the animals from each group (n\u200a=\u200a8) were exposed to extenuating physical exercise on treadmill associated with electric stimuli, without inclination and fastening speed by 5 meters/min every 5 min. We established the end of the experiment at the moment the animal stopped for more than 5 seconds under electric stimuli without trying to move back to the treadmill. Animals were sacrificed by cervical dislocation and dissection was performed just after the test was finished. The rest of the animals of each group remained as witnesses without running and were sacrificed at the same time than the runners. These witness animals were considered as controls of the plasmatic metabolic situation of animals before exercise. To avoid any effect of nutrient uptake on extenuating activity performance, all groups received food during the day before the exercise test.g and stored in small aliquots kept at \u221280\u00b0C until the determination of different blood metabolites. Metabolites were analyzed by using commercial kits for triglycerides (Randox TR210), cholesterol (Randox CH201), urea (Randox UR457), uric acid (Randox UA233), L-lactate , glucose (Randox GL2623), total protein (Randox TP245) and albumin . Creatine kinase (CK) activity was analyzed by the CK-NAC  test. In all cases, samples were always processed in parallel with the respective quality controls provided by the supplier.Blood was collected by cardiac puncture just after cervical dislocation. Plasma was obtained by centrifugation in Vacuette Z serum Sep. Clot activator tubes for 10 min at 3000\u00d7g to eliminate debris and nuclei. Protein was determined by Stoschek-modified Bradford's method Gastrocnemius muscles were dissected immediately after sacrifice and frozen in liquid nitrogen. After thawing and clearing from connective tissue, muscle was homogenized by using lysis buffer  supplemented with 1 mM PMSF and protease inhibitor cocktail 1\u223650 (Sigma) in a 1\u22369 volume-to-weight ratio, followed by centrifugation for 10 min at 700\u00d71 as electron acceptor (\u03b5340: 6.81 mM\u22121 cm\u22121). Complex II was measured in 50 mM phosphate buffer pH 7.0 by kinetic quantification of the reduction of 0.1 mM diclorophenol-indophenol (DCPIP) at 600 nm for 2 min at 30\u00b0C after adding 32 mM succinic acid to the reaction (\u03b5600: 19 mM\u22121 cm\u22121). Complex III was determined in 50 mM phosphate buffer pH 7.5 by kinetic quantification of the reduction of the cytochrome C (0.05 mM) at 550 nm for 2 min at 30\u00b0C after adding decylubiquinol (0.05 mM) as electron supplier to the reaction (\u03b5550: 21 mM\u22121 cm\u22121). Complex IV was measured in 10 mM phosphate buffer pH 7.0 by kinetic quantification of oxidation of reduced cytochrome C as electron donor at 550 nm for 2 min at 38\u00b0C using oxygen as electron acceptor (\u03b5550: 21 mM\u22121 cm\u22121). The combined activities of complex I+III and II+III were determined in 50 mM phosphate buffer pH 7.5 by determining the kinetics of the reduction of cytochrome C for 2 min at 30\u00b0C by adding NADH (0.1 mM) (complex I+III) or succinic acid (3 mM) (complex II+III) as electrons donors (\u03b5550: 21 mM\u22121 cm\u22121). For each determination, specific inhibitors such as rotenone , actimycin A , sodium azide  and ferric cyanide , were used as previously indicated Mitochondria chain complexes activities were measured in a spectrophotometer (Thermo Spectronic Unicam UV 500). Complex I was measured in 20 mM phosphate buffer pH 8.0 by kinetic quantification of 0.2 mM NADH consumption at 340 nm for 2\u20133 min at 30\u00b0C after adding 1 mM CoQ340: 6.22 mM\u22121 cm\u22121). Inhibition with oligomycin (0.2 mg/ml) was used to specifically determine mitochondrial ATPase activity.Complex V/ATPase activity was determined by the measurement of its ATP phosphatase activity. Assay was performed in Hepes-Mg pH 8.0 (50 mM) by adding NADH (0.2 mM), phosphoenol pyruvate (2.5 mM), pyruvate kinase (10 mg/ml), lactate dehydrogenase (5 mg/ml) and antimycin A (0.2 mg/ml). After 2 min of incubation, ATP (25 mM) pH 7.0 was added (\u03b5412: 13.6 mM\u22121 cm\u22121).Citrate synthase (CS) activity was determined in 75 mM Tris-HCl buffer (pH 8.0) by quantification of ditio-bis-nitrobenzoate (0.1 mM) reduction in the presence of Triton X-100 1%, acetyl CoA (7 mg/ml) and oxalacetate (5 mM) at 412 nm for 2 min at 30\u00b0C  for 10 min followed by a vigorous shake with vortex. Q was extracted with hexane as indicated Whole muscle homogenate was obtained after disruption in lysis buffer as above indicated by using a mechanical driven homogenizer and further centrifugation at 700\u00d7g to remove debris. Supernatant was mixed with two times concentrated Laemmli Buffer  and proteins separated by SDS-PAGE. Proteins were transferred to Hybond ECL nitrocelullose membranes  and visualized by using the mouse monoclonal antibodies against the 39 kDa subunit of NADH:ubiquinone oxidoreductase , 70 kDa subunit of Succinate:ubiquinone oxidoreductase , core 2 subunit Ubiquinol:cytochrome c oxidoreductase , subunit Vb of the Cytochrome c oxidase  and \u03b1-subunit of ATP synthase   at 1\u22361000 dilution and HRP-labeled anti-mouse IgG at 1\u22361000. Blots were visualized by ECL technique and quantified by using the Quantity One 1-D analysis software (Biorad). Blots were digitalized and quantified by using Quantity One software (Biorad). Protein expression levels were corrected for whole protein loading determined by staining membrane with Red Ponceau.MDA levels were measured according to the method of G\u00e9rard-Monnier et al. with some modifications Freshly isolated muscle samples were fixed with 2.5% Glutaraldehyde in PBS and further with 1% Osmium Tetroxide, dehydrated with acetone and embedded in araldite resin. Sections (50 nm) were obtained by using an ultramicrotome (LKB 8800 Ultrotome III). After placing onto a cooper grid, slices were stained for 5 min with uranyl acetate and lead citrate followed by 2 min incubation with lead citrate. Samples were visualized by using a transmission electron microscope (Philips CM10). Ten random images  were analyzed to measure the area occupied by mitochondria, the number of mitochondrial structures per unit of area, the area per mitochondria (at least 10 mitochondria per image) and the roundness of each mitochondrial structure by using the ImageJ software version 1.42i .P<0.05.SigmaStat 3.5 program was used for the statistical analysis and figures were performed by using SigmaPlot 10.0 program (Systat Software Inc). All data are expressed as means \u00b1 S.E. For all experiments, 16 mice per group were analyzed. The information obtained from each group was statistically processed pursuant to the most suitable technique for each case. Student t-test or two ways Analysis of Variance (ANOVA) followed by Post-Hoc pairwise multiple comparison procedures (Bonferroni t-test) were performed. The critical significance level \u03b1 was \u200a=\u200a0.050 and, then, statistical significance was defined as"}
+{"text": "Mycoplasma haemofelis is the most pathogenic of the species; \u2018Candidatus Mycoplasma haemominutum\u2019 and \u2018Candidatus Mycoplasma turicensis\u2019 are less pathogenic. The natural route of transmission of feline haemoplasma infection has not been confirmed, but fleas are implicated. When disease results, common clinical signs are pallor, lethargy, anorexia, weight loss, depression, dehydration and pyrexia. Treatment with tetracyclines or fluoroquinolones is usually effective at resolving clinical disease, but clearance of infection may not result.The feline haemotropic mycoplasmas (\u2018haemoplasmas') are a group of bacteria that can induce haemolytic anaemia in cats. The feline haemoplasmas are found worldwide, although prevalence varies geographically.M haemofelis.Older male non-pedigree cats are believed to be at increased risk of haemoplasma infection, although younger cats are possibly more likely to show clinical disease associated with The significance of feline haemoplasma infection is difficult to determine due to the existence of asymptomatic carrier cats and the variable pathogenicity of the haemoplasma species. Polymerase chain reaction (PCR) results should be interpreted in the light of the patient's clinical signs and haematological findings, infecting haemoplasma species and level of haemoplasma DNA present in the blood. Trial antibiotic treatment for haemoplasmosis may be warranted in suspected cases while awaiting PCR results.Aspects of feline haemoplasmosis, particularly risk factors, pathogenesis, diagnostic methods and treatment, have been the focus of much recent research. This article draws on the current evidence base with a view to helping clinicians diagnose and manage cases more effectively."}
+{"text": "Groups of 4 guinea-pigs were immunized with acid extracts prepared from bovine myelin (EF), normal human liver tissue and malignant or benign neoplastic tissues in Freund's complete adjuvant . All the animals immunized with EF developed clinical symptoms of EAE within 21 days of the initial immunization, whilst some of the animals immunized with certain tumour extracts developed symptoms which closely resembled those of EAE. Control animals immunized with FCA only remained asymptomatic. Cellular immunity to the various extracts in immunized animals was assessed 20 days after immunization by i.d. skin testing, and upon killing at Day 21 with the direct peritoneal-exudate macrophage migration inhibition (MMI) test. Brains and spinal cords were removed at killing, fixed in formalin and processed for histological examination. I.d. skin testing was shown to be most consistent in demonstrating positive delayed hypersensitivity, whilst the MMI test frequently gave negative results in the presence of pronounced skin responses to specific extracts. Thus it was shown that 3/4 animals immunized with basic proteins extracted from an adenocarcinoma of the lung or related hepatic metastases, and 1/2 animals immunized with an extract of a carcinoma of the breast, gave intense erythema and induration responses 5 mm in diameter 24 h after i.d. challenge with EF. No such response was obtained in animals immunized with basic proteins extracted from normal human liver, any of the other neoplastic tissues, or in control animals immunized with FCA only. Examination of brains and spinal cords from animals immunized with EF revealed dense infiltration by mononuclear cells in the ependyma and choroid plexus of levels in the spinal cord. Examination of brains and spinal cords from animals immunized with the lung-tumour extract or related hepatic metastases which showed demonstrable immunological cross-reactivity with EF in immunized animals, revealed a number of inflammatory changes characterized by dense infiltrates of mononuclear cells sub-ependymally, and perivascular cuffing in the cortex. However, no significant lesions were seen in the spinal cords of these animals. Polyacrylamide-gel electrophoresis of the 2 tumour extracts exerting this apparent encephalitogenic effect did not reveal proteins within the mol. wt range of EF. Thus the observed pathological effects and cross-reactivity with EF were probably not due to contamination with nervous-tissue components. It is suggested that these tumour extracts may have contained a component or components other than EF, immunologically cross-reactive with EF, and capable of inducing the observed encephalitis."}
+{"text": "A young male patient was undergoing myringoplasty for right ear chronic suppurative otitis media. While drilling in the middle ear cavity, duramater was breached accidentally. Surgeons were, however, allowed to complete the procedure. Keeping the seriousness of such a complication in mind, an urgent neurosurgical intervention was sought and noncontrast computed tomography head scan was done to analyse the extent of the injury. Osteoplastic craniotomy had to be performed subsequently to evacuate the contusional haematoma over the right temporoparietal region. Throughout the procedure, patient's vitals were monitored vigilantly to prevent any further deterioration of his condition. All the available resources were tapped judiciously to maintain intracranial pressure within normal limits. With a quick responsiveness on the part of the anaesthesia team, an active decision making, appropriate and remarkable anaesthetic management both intra and postoperatively, and good ICU care, a young patient could be salvaged and discharged successfully within a week with no immediate or residual complications related to myringoplasty or any neurological deficit. The complication rate of myringoplasty is low in all series. Kotecha A 16-year-old, 70-kg ASA grade I male was undergoing myringoplasty for right ear CSOM in routine elective operation theatre under general anaesthesia. Unexpectedly, the duramater was breached over the aditus after 2 hours of initiating the surgery, which was recognised as a sudden give way by the otolaryngiologists. Keeping the impending cerebral compromise in mind, we sought an emergency neurosurgical consultation and decided for an urgent noncontrast computed tomography (NCCT) head scan. Meanwhile, temporalis muscle flap was placed over the breached dura by the operating surgeon. The wound was closed in two layers over gel foam and a drain. The patient was electively ventilated in ICU while awaiting NCCT head scan report with Assist Control Ventilation (volume cycled) and was maintained on continuous intravenous infusions of inj. Midazolam 0.25 mcg/kg/minute and inj. Vecuronium 1 mcg/kg/minute. Vitals were maintained within normal limits. The patient was catheterised, a nasogastric tube inserted and fundoscopy done to rule out papilloedema.NCCT head scan revealed intraparenchymal haematoma of size 4.5 \u00d7 2 \u00d7 3 cm with minimal mass effect and peri-lesional oedema with few foci of pneumocephalus in right temporal region,extra-axial bleed  in right tentorium cerebelli andbony defect in right petrous temporal bone with fluid in middle and external ear cavity.In ICU, complete haemogram, prothombin time (PT), activated partial thromboplastin time (aPTT) and international normalised ratio (INR) were done. Patient was given inj. Phenytoin 800 mg i.v. (loading dose) and inj. Vit. K one amp. i.m. along with the antibiotic cover.2O, urine output was adequate. The above regimen was implemented to maintain the vitals and cerebral haemodynamics within physiological limits. Inj. Ondansetron 6.0 mg i.v. (for postoperative nausea and vomiting) and inj. Diclofenac sodium 75 mg i.m.  were administered. Inj. Vecuronium and inj. Midazolam infusions were stopped. When patient was fully conscious with good cognition, adequate protective airway reflexes and motor power, he was extubated after giving inj. Glycopyrrolate 5 mcg/kg i.v. and inj. Neostigmine 50 mcg/kg i.v. There were no signs of any residual neurological deficit. The patient was observed in ICU. Subsequent NCCT head scan was normal. Treatment regimen consisted of inj. Amikacin, inj. Augmentin, inj. Phenytoin, inj. Mannitol and syp. Citicoline. The patient was discharged on the seventh postoperative day.An urgent right temporo-parietal osteoplastic craniotomy was planned for the drainage of contusional haematoma in 15\u00b0 head up position . High riVariations in the anatomy of the temporal bone, such as anteriorly placed lateral venous sinus, low middle cranial fossa dura or a prominent Korner's septum create additional difficulties for the inexperienced surgeon, leading to various complications. The effe2), cerebral blood flow (CBF) and ICP, since N2O is 35 times more diffusible than nitrogen, pneumocephalus and VAE (if it occurs) can expand dangerously and, therefore, was avoided. Oxygen\u2013air mixture is preferable but we used 100% oxygen along with isoflurane 0.4\u20130.6 vol.% as air was not available at our institution. Isoflurane produces a reduction in the CMRO2 which is greater than that produced by equivalent Minimum Alveolar Concentration (MAC) values of halothane, but the CBF increase with isoflurane is minimal below 1.1 MAC.[Major goals during anaesthesia include (1) maintenance of adequate perfusion and oxygenation of normal brain, (2) optimising operative conditions to facilitate resection, (3) ensuring rapid emergence of anaesthesia at the conclusion of the procedure to facilitate neurological assessment, and when appropriate, 4) accommodating intraoperative electrophysiological monitoring.[ accommod2 responsiveness is preserved.[2 and inj. Vecuronium, as such, has no cerebral and few systemic side effects.Veselis and colleagues, using PET (Positron Emission Tomography) observed a global reduction in CBF of 12% after 0.15 mg/kg of inj. Midazolam to awake healthy human volunteers and noted that the decrease occurred preferentially in brain regions associated with arousal, attention and memory. Further,reserved. Inj. FenThough we used the above technique, target controlled infusion (TCI) or total intravenous anaesthesia (TIVA) using inj. Propofol are being used at some centres, more so during awake craniotomies. At the end of surgery, a rapid recovery of consciousness is essential so that the level of response can be assessed along with Glasgow Coma Scale and to rule out any neurological deficits. Use of a good antibiotic regimen, phenytoin (antiepileptic), mannitol (osmolar diuretic), dihyropyridine calcium channel blocker like nimodipine  and a vitamin B choline like citicoline (neuroprotective agent), helps in rapid postoperative recovery.Thus, a seemingly normal procedure can pose a challenge to an anaesthesiologist's competence. When such complications occur, he should be able to take prompt decisions, act swiftly and use all the available resources optimally to affect a good patient outcome."}
+{"text": "PEA-15 is a phosphoprotein that binds and regulates ERK MAP kinase and RSK2 and is highly expressed throughout the brain. PEA-15 alters c-Fos and CREB-mediated transcription as a result of these interactions. To determine if PEA-15 contributes to the function of the nervous system we tested mice lacking PEA-15 in a series of experiments designed to measure learning, sensory/motor function, and stress reactivity.We report that PEA-15 null mice exhibited impaired learning in three distinct spatial tasks, while they exhibited normal fear conditioning, passive avoidance, egocentric navigation, and odor discrimination. PEA-15 null mice also had deficient forepaw strength and in limited instances, heightened stress reactivity and/or anxiety. However, these non-cognitive variables did not appear to account for the observed spatial learning impairments. The null mice maintained normal weight, pain sensitivity, and coordination when compared to wild type controls.We found that PEA-15 null mice have spatial learning disabilities that are similar to those of mice where ERK or RSK2 function is impaired. We suggest PEA-15 may be an essential regulator of ERK-dependent spatial learning. PEA-15 is a 15 KDa phosphoprotein that regulates both ERK MAP kinase and death receptor apoptosis pathways . PEA-15 The ERK MAP kinase pathway is involved in learning and memory. In particular, it is implicated in spatial learning and fear conditioning . Both ofBecause PEA-15 can regulate both ERK and RSK2 we assessed PEA-15 knockout (KO) mice in a series of tests that measure learning, sensory/motor function, and stress reactivity. We found that deletion of PEA-15 protein in C57BL/6J mice causes specific defects in spatial learning abilities.PEA-15 is expressed at high levels throughout the nervous system. PEA-15 null (KO) mice have been reported to have normal brain sizes and astrocyte numbers and to be born in roughly normal ratios . No diff = 4.27; p < 0.05]  = 10.79; p < 0.05]  = 6.25; p < 0.05]. There was also a trend for KOs to make a first open arm entry more quickly than WTs. Therefore KOs tended to exhibit higher levels of anxiety or fear with a concomitant increase in exploration of the maze.In elevated plus maze tests KOs (n = 13) deposited more bolli in the maze than WTs (n = 9), [F] Figure  suggesti] Figure . This di] Figure . HoweverAn alternative test of anxiety and exploration is the Open Field test. In this test KO and WT mice exhibited similar numbers of total movements in the open field Figure . However = 5.34; p < 0.05] and spent significantly less time in the white well lit side  (data not shown). This difference was not due to differences in activity between the groups, since both made a similar number of crossings between the two sides of the apparatus. This test is further evidence that KO mice suffer increased levels of anxiety or fear.In the Black/White Preference test, mice have a propensity to spend more time in the black, dimly lit half of the preference chamber presumably because they find this chamber less stressful than the well-lit white half and because animals are introduced into the apparatus on the black side. In this test, both KO and WT groups spent more of the total time during testing in the black/dim side of the chamber as is normal. However, KO mice made their initial crossing into the white side of the chamber more slowly than WT mice . Groups did not differ in their latency to explore the escape straight alley, nor did they show a preference for either end of the apparatus (start box or open end). Hence, KO mice do not appear to suffer increased fear as measured in this test. In total, the differences noted above for the elevated plus maze and the black/white preference test suggest a pattern of behavior in KO mice  that does not reflect a consistent pattern of differences in stress or anxiety related behaviors. Thus these differences may reflect other, unidentified causes.As a separate measure of fear we examined KO mouse performance in the Straight alley/Escape test. The startle stimulus (bright light combined with increased air flow) used during this test typically elicits rapid running (an \"escape\" response), which serves as an index of fear. Though the escape distance for PEA-15 null mice was only 63% of that for wildtype mice  = 18.27; p < 0.001]. This difference was not due to less running behavior during the light cycle, when all mice spent significantly less time running, but was due to KOs spending significantly less time running during the night cycle   = 3.49; p < 0.07]  mice to react slower to the painful stimulus than WT mice (n = 9) [F] Figure . Differe = 4.69; p < 0.05]  = 20.87; p < 0.001]  = 8.26; p < 0.01]  = 0.12; n.s.]  = 5.12; p < 0.01]. However, KOs (n = 13) were impaired in their mean latency to locate the reinforcer  on the first training trial (before any learning could occur)  = 4.21; p < 0.05] and committed more 'errors'  than WTs.In odor discrimination, KO mice did not differ from WTs during learning Figure . Both tycur) Fig . KOs alscur) Fig , althougcur) Fig  and 3D.  = 10.95; p < 0.01], but there was no difference between KOs and WTs in performance in this test . To control for individual basal levels of activity and exploration, step-down latencies were calculated by utilization of a ratio of post training latencies as a function of pre-training latencies. Both KO (n = 9) and WT (n = 9) mice significantly increased their latencies to step down after training . This difference was not due to reduced strength or activity of the KO mice since all mice had similar swim speeds  on the first training trial before any learning had occurred  = 3.44; p < 0.0001]. Not surprisingly, WT controls also out-performed KOs during a probe trial after training . KOs spent equivalent search time in the target quadrant as in the other three quadrants  = 4.81; p < 0.05] during the final four trials as measured by latency to navigate the maze and make an arm choice  = 2.03; ns]  mice were impaired compared to WTs (n = 9), [Fe Figure . While a] Figure . Since b = 2.03; p < 0.05], but at no point during training did the KOs differ from the WTs in errors committed . Again, however, the KO mice took significantly longer navigating the maze to make correct arm choices . Again, these results suggest that KO animals require a longer time to execute ultimately accurate decisions under the demands of spatial navigation.The PEA-15 null mice appeared to be impaired in tasks that can be solved using a spatial strategy . To further explore this observation, mice were tested in a modified version of the spatial win/stay task. This test was executed in the same manner as the earlier spatial win/stay task with the exception that animals could correct wrong choices. In the modified win/stay task, mice received an additional day of training . Under these conditions, all mice improved performance during training [FPEA-15 is a small phosphoprotein that binds to ERK and regulates ERK signaling . In partPEA-15 binds tightly to ERK and RSK2 and thereby regulates the outcome of ERK signaling . More reMutations in RSK2 cause the X-linked Coffin-Lowry syndrome . Aside fRecently, morphometric analysis by MRI of Coffin-Lowry patients showed reduced cerebellum and hippocampus volumes . HoweverIn most respects the learning disabilities of PEA-15 null mice are similar to those of mice with impaired ERK activity. However, we found no significant change in fear conditioning in the KO mice, whereas there is literature reflecting a role for ERK in this process ,32. It mWe report that PEA-15 deficient mice exhibit an impaired ability at spatial learning tasks. They also have weaker forepaws than their WT counterparts do. It is therefore possible that the reduced forepaw strength may contribute to the performance of the mice in the spatial learning tests. However, in the spatial water maze, swim speed and path length analysis suggest that the reduced forearm strength in KO mice was not responsible for their impaired performance. The fact that KO mice did not display impaired basal activity in sensory motor tests also supports the premise that the learning impairments in spatial tasks were not contingent on gross differences in sensory/motor function between PEA-15 null and WT mice. In other learning and sensory/motor tests, the PEA-15 null mice showed no deficiencies. Thus the spatial learning defect is most likely independent of the differences in forepaw strength.Our analysis was performed on adult mice in which PEA-15 had been completely deleted. The defects we observe could therefore be due to changes arising from lack of PEA-15 function in early brain development, lack of PEA-15 metabolic function in the behaving adult, or both. The current study cannot distinguish between these possibilities. However, this work provides the framework for additional studies that could address this issue. For example, we could create conditional knock-outs of PEA-15 in the brain in which PEA-15 is deactivated in the adult brain only after development is complete. These mice could then be run through a similar battery of tests to determine whether the effects are due to effects on brain development or adult brain function. These experiments are currently being planned.The ability to learn is a critical trait of many organisms  and the PEA-15 null mice KO; n = 13) and their wild-type controls  were obtained courtesy of H. Chneiweiss (College de France) and were generated by D. Kitsberg and P. Leder by homologous recombination as described [ and theiAnimals were singly housed in clear boxes with floors lined with wood shavings in a humidity- and temperature-controlled vivarium adjacent to testing rooms. A 12 hr/12 hr light/dark cycle was maintained. All behavioral training took place during the middle seven hours of the light cycle. Mice were handled in accordance with National Institutes of Health guidelines for the care and use of animals. All experiments were IACUC approved by the Institutional Review Board of Rutgers, The State University of New Jersey.ad lib food was removed from the animals' home cages at the end of the light cycle approximately 40 hours prior to the start of training (and thus encompassing the \"rest\" day between successive tasks). During the deprivation period, animals were provided with food in their home cages for 60 min/day during the last 2 hrs of the light cycle, and thus were approximately 16 hrs food-deprived at the time of training or testing. Between each successive test (of learned and unlearned behaviors), animals received a day of rest. Different experimenters (n = 3) trained or tested animals in different tasks, and no experimenter was aware of animals' performance on other tasks, or genotype, until after the completion of the entire battery of tests. In total, animals were assessed in 11 tests of unlearned behavior and fitness, and seven tests of learning. In many of these tasks, multiple measures of performance were obtained such that a total of 12 measures of learned behavior and 25 measures of unlearned performance are reported.All experiments were done blind to the genotype. For the learning tasks that required food deprivation, All animals were tested on 11 tasks that provided 25 measures of unlearned behaviors and/or fitness. A description of these tests and their implementation has been previously reported ,35.1. Body Weight and Food Consumption under Mild Deprivation. The body weights during periods of free feeding were collected every week throughout this series of tests, and the percent change in body weight was recorded after 24 hrs of food deprivation (prior to testing in the Lashley Maze).2. Running Wheel. Animals were housed for 48 hours in cages containing running wheels in the home colony room. Animals were introduced to the running cages at the start of the light cycle on Day 1, and wheel cycles were recorded for 3 hrs as an index of running during initial adaptation. Total cycles on Days 2 and 3 and the percentage of cycles during the light and dark periods were counted.3. Elevated Plus Maze. The maze was constructed of black Plexiglas in the form of a \"plus\". Each arm of the maze is 6 cm wide, and the maze is suspended 30 cm above a black surface. 8 cm high, black Plexiglas walls surrounded two opposing arms of the maze, and two of the arms were open. The maze was located in a 300 Lux environment. Animals were placed in the center of the maze facing an open arm, and their behavior in the maze was recorded in 1 min blocks for 4 min.4. Open Field Exploration. A square field (46 \u00d7 46 cm) with 13 cm high walls of white Plexiglas was utilized. The apparatus was located in a brightly lit room (400 Lux) with a background noise of 65 dB. The field was conceptually divided into a grid comprised of 6 \u00d7 6 7.65 cm quadrants, where 20 of the quadrants abutted the outer walls of the field , and 16 quadrants were displaced from the walls and comprised the interior (i.e. \"open\" quadrants) of the field. Animals were placed in the center of the field. After 20 sec had elapsed , the animals' behavior was monitored for 4-min. Throughout this time the animal's entries into wall and open quadrants were recorded. An entry was recorded whenever both front paws crossed the border of a quadrant.5. Straight Alley Exploration/Magnitude of Escape Response. A straight alley was used that was 30 cm above ground. The alley was 244 cm long and 7 cm wide with 3 cm high walls. The initial 29 cm of the alley was enclosed in 12 cm high walls and an orange acetate ceiling. This portion was designated as the \"start box\" and the exit from this box could be blocked with a sliding guillotine door made of clear Plexiglas. The interior of the start box was 4 Lux, and the alley beyond the start box was 20 Lux. A startle stimulus could be delivered in the start box. This stimulus was the compound of a bright light (400 Lux) and a high-speed (3000 RPM) fan positioned so that its airflow was directed across the animal and down the alley. The fan raised background noise 50 dB. Animals were placed in the start box with the exit blocked. After 60 sec, the door was raised and animals were allowed to explore the alley for 4 min. The latency for each animal to cross a point in the alley 213 cm from the exit of the start box was recorded as were crossings across the midline of the alley. Both served as an index of exploratory behavior. After 4 min, the animals were returned to the start box where they were again confined for 60 sec. Subsequently the door was raised. At the moment that each animal moved to within 2 cm of the exit and faced the open alley, the compound startle stimulus was initiated and presented for 800 msec. This stimulus typically elicited rapid running (an \"escape\" response). The distance that the animal ran prior to making a complete stop of forward movement for at least 500 msec was recorded.6. Pain Sensitivity. Upon being placed on a 52.6\u00b0C aluminum plate, animals' latency to raise a hind paw and to either lick or shake the paw served as the index of pain sensitivity.7. Balance Beam. Animals were placed on a 40 \u00d7 0.7 \u00d7 2 cm (l \u00d7 w \u00d7 h) beam suspended 30 cm above the ground. In a 4 min test, mice exhibited wide variability in the amount of movement along its length.8. Roto-Rod Suspension. Animals were hung by their front paws from a slowly rotating (8 RPM) rod  suspended 30 cm above ground. Latency to drop from the rod (an index of grip strength) was recorded.9. Balance platform. All four paws of animals were placed on a 3 cm round platform (60 Lux illumination) 30 cm above the ground. Latency to fall (240 sec maximum test duration) from the platform was recorded.10. Screen Climbing and Hanging. Animals were placed on the underside of a wire mesh screen tilted 45\u00b0 from vertical and suspended 24 cm from ground. The distance moved prior to dropping from the screen  and the latency to drop from the screen was computed.11. Black/White Preference. A 10 \u00d7 36 cm chamber divided along its length in two equal halves was utilized. One half was white and brightly lit (100 Lux), and the other half was black and dim (5 Lux). A center wall with a 3 cm square opening that joins the black and white sides divided the two halves. Animals were placed in the black side of the chamber and allowed to explore for 4 min. The latency to first entry into the white chamber, percent of total time in the white chamber, and number of crossings between the black and white chambers was recorded.All animals were tested on seven learning tests, three of which could be solved most efficiently using a spatial strategy. The remaining four tasks are widely asserted to represent different, distinct learning domains, as summarized in Table In a procedure based on one designed by Sara  for ratsA black Plexiglas 60 cm square field with 30 cm high walls was located in a dimly lit (40 Lux) testing room with a high ventilation rate (3 min volume exchange). Three 4 \u00d7 4 \u00d7 2.0 cm  aluminum food cups were placed in three corners of the field. A food reinforcer (30 mg portions of chocolate flavored puffed rice) was placed in a 1.6 cm deep, 1 cm diameter depression in the center of each cup. The food in two of the cups was covered (1.0 cm below the surface of the cup) with a wire mesh so that it was not accessible to the animal, while in the third cup (the \"target\" cup), the food could be retrieved and consumed.A cotton-tipped laboratory swab, located between the center and rear corner of each cup, extended vertically 3 cm from the cups' surface. Immediately prior to each trial, fresh swabs were loaded with 25 ul of lemon, almond, or mint odorants (McCormick flavor extracts). The mint odor was always associated with the target food cup. In pilot studies, the odor associated with food was counterbalanced across animals, and no discernible differences in performance was detected in response to the different odors.The Lashley III maze consisted of a start box, four interconnected alleys, and a goal box containing a food reward. Over trials, the latency of rats to locate the goal box decreases, as do their errors . Here, the Lashley III maze was scaled for mice, and parameters were developed that supported rapid acquisition. The maze was constructed of black Plexiglas. A 2 cm wide \u00d7 0.1 cm deep white cup was located in the rear portion of the goal box, and 1/2 of a 45 mg BioServe (rodent grain) pellet served as reinforcers. Illumination was 80 Lux at the floor of the maze. The maze was isolated behind a shield of white Plexiglas to prevent extra-maze landmark cues.Food-deprived animals were acclimated and trained on two successive days. On the day prior to acclimation, all animals were provided with three food pellets in their home cages to familiarize them with the novel reinforcer. On the acclimation day, each mouse was placed in the four alleys of the maze, but the openings between the alleys were blocked so that the animals could not navigate the maze. Each animal was confined to the start and subsequent two alleys for 4 min, and for 6 min in the last  alley, where three food pellets were present in the food cup. On the training day, each animal was placed in the start box and allowed to traverse the maze until it reached the goal box and consumed the single food pellet present in the cup. Upon consuming the food, the animal was returned to its home cage for a 20 min interval (ITI), after which it was returned to the start box to begin the next trial. The apparatus was cleaned during each ITI, and the sequence was repeated for five trials. Both the latency and errors  to enter the goal box were recorded on each trial.In order not to duplicate stimuli  used to support associative learning (fear conditioning), we used a variant of the step-down avoidance task that does not rely on shock to motivate behavior. Upon stepping off the platform, animals were exposed to a compound of bright light and loud oscillating noise. A chamber illuminated by dim (< 5 Lux) red light was used for training and testing. Animals were confined to circular (\"safe\") chamber . The walls and floor of this chamber were white, and the ceiling was translucent orange. The floor was comprised of plastic rods (2 mm diameter) arranged to form a pattern of 1 cm square grids. A clear exit door (3 CM square) was flush with the floor of the safe compartment, and the door could slide horizontally to open or close the compartment. The bottom of the exit door was located 4 cm above the floor of a second circular chamber . This \"unsafe\" chamber had a clear ceiling and a floor comprised of 4 mm wide aluminum planks that formed a pattern of 1.5 cm square grids that were oriented at a 45\u00b0 angle relative to the grids in the safe compartment. When an animal stepped from the safe compartment through the exit door onto the floor of the unsafe compartment, the compound aversive stimulus comprised of a bright (550 Lux) white light and oscillating (\"siren\") noise blast  was initiated.Animals were placed on the platform behind the exit blocked by the Plexiglas door. After 5 min of confinement, the door was retracted and the latency of the animal to leave the platform and make contact with the grid floor was recorded. Prior to training, step-down latencies typically range from 8-20 sec. Upon contact with the floor, the door to the platform was opened and the aversive stimulus (light+noise) was presented for 4 sec, at which time the platform door was opened to allow animals to return to the platform, where they were again confined for 5 min. At the end of this interval animals were returned to their home cages for a 1 hour retention period. Subsequently, mice were returned to the safe platform for 5 min, then the door was opened and the latency of the animal to exit the platform and step onto the grid floor (with no aversive stimulation) was recorded, completing training and testing. The ratio of post-training to pre-training step-down latencies were calculated for each animal and served to index learning.Animals were exposed to a stimulus  that terminated in the onset of a mild foot shock (i.e. a US). These tone-shock (CS-US) pairings came to elicit conditioned fear responses when animals were subsequently presented with the tone. To avoid any interaction of the training context (which itself acquires an association with shock) with the CS at the time of testing, training and testing were conducted in separate distinct contexts. Two distinct experimental chambers  were used, each of which was contained in a sound- and light-attenuating enclosure. These boxes were designated as \"training\" and \"testing\" contexts, and differ as follows: The training context was brightly illuminated (100 Lux), had clear Plexiglas walls, no lick tube, and parallel stainless-steel rods  forming the floor. The test context was dimly illuminated (6 Lux), the walls covered with an opaque pattern of alternating black and white vertical stripes (3 cm wide), and the floor was formed from stainless 1.5 mm rods arranged at right-angles to form a grid of 8 mm squares. A water-filled lick tube protruded through a small hole in one wall of the test chamber, such that the tube's tip was flush with the interior surface of the wall at a point 3 cm above the floor. Upon contacting the tube, the animal completed a circuit such that the number of licks/sec could be recorded. This circuit was designed so that if an animal made continuous contact with the tube (i.e. \"mouthed\" the tip), the circuit recorded eight licks/sec, a rate that approximates continuous licking. In the training chamber, a 0.6 mA constant-current scrambled footshock (US) could be delivered through the grid floor. In both the training and test chambers, a 40 dB above background white noise (the CS) could be presented through speakers mounted at the center of the chambers ceiling.Water-deprived animals were acclimated to the training and test chambers by placing them each in both contexts for 20 min on the day prior to training. Training occurred in the training context in a single 30 min session during which each animal was administered a noise-shock pairing 10 and 20 min after entering the chamber. Each 10 sec noise terminated with the onset of a 500 msec footshock. At the end of the training session, animals were returned to their home cages for 60 min, after which they were re-acclimated to the test context for 20 min where they were allowed free access to the lick tubes. On the subsequent day (23-25 hours post training), animals were tested. Each animal was placed in the test context whereupon after making 25 licks, the noise CS was presented continuously until the animal completed an additional 25 licks. The latency to complete the last 25 licks during the pre-tone interval and in the presence of the tone was recorded, with an 800 sec limit imposed on the second 25 licks . With these measures, the latency to complete 25 licks in the presence of the tone CS served as our index of learned fear, and the latency to complete 25 licks prior to CS onset served as an index of basal lick rates.For this task, animals were introduced into a round pool of opaque water from which they could escape onto a hidden  platform. The latency for animals to find the platform decreases across successive trials. We have developed a protocol in which mice exhibit significant reductions in their latency to locate the escape platform within six training trials ,37. FirsA round black pool  was filled to within 24 cm of the top with water made opaque by the addition of nontoxic, water soluble, black paint. A hidden 11 cm diameter perforated black platform was in a fixed location 1.5 cm below the surface of the water midway between the center and perimeter of the pool. The pool was enclosed in a ceiling-high black curtain on which five different shapes (landmark cues) were variously positioned at heights (relative to water surface) ranging from 24-150 cm. Four of these shapes were constructed of strings of white LEDs  and included an \"X\" (66 cm arms crossing at angles 40\u00b0 from the pool surface), a vertical \"spiral\" , a vertical line (31 cm) and a horizontal line (31 cm). The fifth cue was constructed of two adjacent 7 W light bulbs (each 4 cm diameter). A video camera was mounted 180 cm above the center of the water surface. These cues provided the only illumination of the maze, totaling 16 Lux at the water surface.On the day prior to training, each animal was confined to the escape platform for 300 sec. Training was conducted on the two subsequent days. On Day 1 of training, animals were started from a unique location on each of five trials. An animal was judged to have escaped from the water  at the moment at which four paws were situated on the platform, provided that the animal remained on the platform for at least 5 sec. Each animal was left on the platform for a total of 30 sec, after which the trial was terminated. Trials were spaced at 10 min intervals, during which time the animals were held in a warmed (27.5\u00b0C) opaque (5 Lux) box lined with wood shavings. On each trial, a 90 sec limit on swimming was imposed, at which time any animal that had not located the escape platform was placed by the experimenter onto the platform, where it remained for 30 sec. Animals were observed from a remote (outside of the pool's enclosure) video monitor, and the animals' performance was recorded on videotape for subsequent analysis. Day 2 of training proceeded as Day 1. However, after the last (fifth) training trial, a 2-hour retention period was begun, after which animals were tested with a \"probe\" trial. On the probe test, the escape platform was removed from the pool, and all animals were started from the sixth position for that day. A 60 sec test was conducted in which the animals' time searching in the target quadrant (that in which the escape platform was previously located) and non-target quadrants were recorded.An elevated maze in the form of a \"+\" was constructed of black Plexiglas, each of the four arms measuring with 8 \u00d7 40 cm (W \u00d7 L). A 4 mm diameter food cup was located in the center of the arm 2 cm from its end. Food (a 20 mg chocolate-flavored Noyes Rodent Pellet) was located in every cup, but was accessible to the animal on in the arm designated as \"west\". Twenty-four cm from the end of each arm and equidistant between successive arms were 18 \u00d7 18 cm visual cues, a black (240 pt) \"X\", \"O\", and \"+\".Animals were adapted to the maze on Day 1. They were placed in the north start box where they were held for 30 sec, released, and allowed to explore the unbaited maze for 3 min. This process was then repeated for the east and south arms. On Day 2, animals were trained, and a food reinforcer was present in the west arm on each trial. On the first two trials , the animal was placed in the north start box for 30 sec, and was then released and allowed to explore the maze until consuming the food in the West arm. On subsequent trials, the animal was started in the east and then south arm, followed by the reverse order of arms until a total of 12 trials  were completed. On Trials 1-12, an entry into an incorrect arm terminated the trial . If mice chose the baited arm they were allowed to consume the chocolate-flavored Noyes Rodent Pellet. An ITI of 60 sec in the home cage separated each trial. Animals' choices were recorded on each trialAn elevated maze in the form of a \"T\" was constructed of black Plexiglas. Each of the two cross- arms measured 36 cm in length, 4 cm in width, with 10 cm walls. A 4 mm diameter food cup was located in each cross-arm, 2 cm from its end. The base of the 'T' consisted of a 14 cm start box and a 16 cm central compartment from which the cross-arms connected. The portion designated as the \"start box\" could be blocked with a sliding guillotine door as can the intersection between each cross-arm and the central compartment. The maze was diffusely lit from above (80 Lux).th of a fruit loop  was available at the end of each choice arm. Over four more trials, mice were forced to alternate arm entry by closing the opposite arms' guillotine door. In the forced choice arm animals obtained a reinforcer. On the subsequent day, animals were placed in the start compartment (at the base of the T), held behind the closed guillotine door for 60 sec, and then, after the door was opened, allowed to choose one arm for entry, wherein the reward was available. On subsequent trials (30 sec ITI), the animal could choose either arm, but food was available only in the arm opposite the arm reinforced on the prior trial. Incorrect choices terminated the trial. On ensuing trials, food was available in the same arm until a correct choice was made and the food was retrieved. With our adaptation and training procedures, young adult mice often begin to perform without error after 6-10 training trials. Training proceeded for 12 trials; the number of trials required by an animal prior to its initiating three consecutive correct choices was used as an index of that animal's performance.Food deprived mice learned to alternate arm choices in a \"T-maze\" to obtain food reinforcement. The number of training trials required before an animal learns to consistently alternate is an index of rate at which they learn the correct pattern. On the first day of training, animals were adapted to the maze, in which 1/16ps < 0.05 were considered significant.Comparisons of groups were conducted with either one- or two-factor analyses of variance (ANOVA). In experiments where a single measure of a dependent variable (e.g., \"Bolli Excreted\", Fig DAT, DP, SK, KL, and GH all assisted in the design of the experiments and conducted behavioral tests. JWR and LDM conceived the study and participated in the design and coordination of the study as well as drafted the manuscript. All authors read and approved the final manuscript."}
+{"text": "Hyperplastic and neoplastic lesions of the liver occurring \u201cspontaneously\u201d in C3H \u00d7 Y male mice were transplanted autologously and isologously. Hyperplastic lesions did not survive in the same animal or in other animals of the same strain. Carcinomas grew in the host or in isologous mice and killed the animals. Most of the lesions were hyperplastic, and few were carcinomas. It is concluded that the histologic pattern of hyperplastic and neoplastic lesions can be correlated with the results obtained on transplantation."}
+{"text": "Blood glucose (glc) was thenmeasured weekly for 16 weeks. Data showed thatthe experimental group contained 70% euglycemicanimals (defined as glc <200mg/dL)  versus 10% ofthe control animals (P<.05) at 14 weeks. Meanweight in the treated group was greater than theuntreated group. Insulin mRNA was detected at theinjection site of all of the treated animals, but notcontrols. Complete destruction of islets was confirmedby histology ruling out the possibility ofspontaneous reversal of insulinitis. We concludethat IM delivery of the insulin gene in the NODmouse was able to prevent clinical DM up to 14weeks in a majority of treated animals. Our experimentaldata suggests that gene therapy may be analternative treatment for IDDM in the future.Using the Adeno-associated virus (AAV) as a genedelivery vehicle, we have constructed a recombinantvector containing the full length rat preproinsulingene (vLP-1). Utilizing the well described non-obesediabetic (NOD) mouse model, an experimentalgroup (n=10) of animals were intramuscularly (IM)injected with 10"}
+{"text": "During late summer and autumn 2000, a West Nile fever outbreak in southern France resulted in 76 equine clinical cases; 21 horses died. We report the results of a large serosurvey of all equines within a 10-km radius of laboratory-confirmed cases. Blood samples were obtained from 5,107 equines, distributed in groups of 1 to 91 animals. West Nile virus immunoglobulin (Ig) G antibodies were found in 8.5% of animals (n=432). Forty-two percent of the IgG-positive animals were also IgM positive. Horses living in small groups were more affected than those in large groups. The results suggest that West Nile virus is not endemic in the affected area, the Camargue; rather, sporadic outbreaks are separated by long silent periods. West Nile virus (WNV) is an arbovirus of the genus Flavivirus, family Flaviridae. Its natural transmission cycle involves birds and mosquitoes, mainly of the Culex genus. During late summer and autumn 2000, a WNV outbreak in southern France resulted in 76 clinical cases in equines; 21 horses died Culex species, C. pipiens and C. modestus are the most abundant.In France, the first reported outbreak occurred in humans and equines during the summer of 1962 in the south of the country ,6. EquinThe 2000 outbreak occurred west of Camargue , where tOn September 6, 2000, positive serologic results (immunoglobulin [Ig] G and IgM) were first found in two horse samples. Two days later, WNV infection was confirmed by detection of viral RNA in a brain biopsy Experimental studies and sequential samples collected from naturally infected horses have shown that IgM antibodies become detectable 8\u201310 days post-infection and persist <2\u20133 months . WNV neuAfter the first horse case was confirmed, a serosurvey was ordered by the animal health authorities on all equines located within a 10-km radius of laboratory-confirmed clinical cases Blood samples were taken from all the equines within 10 km of the laboratory-confirmed cases . The useFor each animal, a form was completed by a veterinarian. Along with other data , this form noted the species and breed of the animal, its age and sex, location, and the size of the group in which the animal was included on the day the sample was taken .The individual serologic results and the data on the forms were collected in a Microsoft Access database . The horses were grouped by sex  and age . Breeds were grouped into four classes according to their typical management conditions: the pure breeds , the Camargue breed , pony breeds (often living in riding stables and used every day for short rides) and other breeds . Four frequency categories  were defined for group sizes: 1\u20132 animals, 3\u20136 animals, 7\u201325 animals, and >25 animals.Maps were produced with MapInfo software . The geographic data describing animal locations was the name of the \u201ccommune,\u201d the smallest administrative French subdivision, which corresponds to an English parish.Statistical analyses were done with SAS software . A bivariate analysis was first performed, crossing each variable . The chi square test was calculated for the four variables. Prevalence ratios were computed for breed and group size, using the category with the lowest prevalence as a reference. For animals groups, chi square tests and prevalence ratios were computed both at the animal level  and the group level . Finally, a logistic regression was conducted. Animals for which the age, sex, breed, or group size had not been indicated were excluded from the data set. The dependent variable of the model was the serologic status of animals, and the independent variables were their age class, sex, breed, and group size.  For each variable, the reference class was the category with the lowest prevalence.2 and covered  99 communes.Fifty veterinarians took blood samples from 5,107 equines  distributed in 1,429 groups. The 14-week serosurvey began on September 16 (week 38) and ended December 15. The survey area was approximately 2,500 kmThe age of 4,749 animals ranged from birth to 40 years. Half the animals were geldings , 32% were mares , and 20% were stallions (n=951). Of 53 breeds noted for 4,867 animals, the predominant breed was the Camargue . Group sizes ranged from 1 to 91 animals, but most of the groups  were small . The mean group size was 3.6 animals.Of the 5,107 animals, 432 were IgG positive . Almost half (n=182) were also IgM positive . The group-level seroprevalence of the positive groups was higher than the animal-level seroprevalence: 19.2% (n=274) (95% CI 17.1 to 21.2).More than 50% of the samples were taken during the first 3 weeks; 90% of the samples had been taken at the end of week 6 . IgG-pos2. However, the density in some communes is >16 animals per km2.The map of the number of serum samples per commune shows that the geographic distribution of horses is not homogeneous : fewer sThe prevalence by commune  is higheNo significant difference was found in the serologic status of animals according to their distribution by age  contained 4,597 records. The reference classes were as follows: <1 year, mares, other breeds, and >25 animals. A slight effect was found for the Camargue breed . Conversely, the main effect was attributed to the group size variable, with decreasing ORs with increasing group size: 2.18 for groups of 1\u20132 animals (95% CI 1.60 to 2.96) and 1.81 for groups of 3\u20136 animals .Belonging to a small group and, to a lesser extent, being of the Camargue breed appeared to be risk factors for seropositivity. Comparison of the eight most affected communes with the rest of the survey area showed no significant differences by age, sex, breed, and group size (data not shown). Therefore, these risk factors are not explained by an overrepresentation of Camargue horses and of small groups near the epidemic hot spot.The geographic variations of the seroprevalence show that the epidemic hot spot was not located in a wet area, but several km to the north, in a rather dry area, even though the horse density was roughly the same in both areas. Moreover, antibodies were found in 8% of the captive mallards at a large pond in the south of the perimeter, and in four magpies of 18 captured a few km to the north, near the horse epidemic hot spot Data analysis showed no age effect. Several serosurveys in human populations have shown that, when WNV circulation is endemic in a given area, the seroprevalence tends to increase with age \u201313. A siA breed effect was observed in that the prevalence was higher in Camargue horses. This result reflects the usual living conditions of these rugged horses, always living outside and therefore more likely to be exposed to infectious bites.Group size had two opposite effects on seroprevalence, depending on the unit used for calculation. At the group level, the increase in seroprevalence with increasing group size is a classical finding in veterinary epidemiology: assuming all animals in a given group are exposed to the same low-level probability of infection, the more animals in the group, the higher the probability that one (or more) of them become infected. At the individual level, the decrease of the seroprevalence rate with increasing group size may be the result of two factors. First, the sizes of the groups reflect different uses and management conditions of the horses: animals kept in large groups may benefit from better management practices . However, this result could also reflect a low spatial density of infectious vectors: assuming a vector does not bite all animals of a given group but only a few of them, large groups would have a protective effect. The high density of horses in the area could also help explain the absence of reported human cases as a result of a possible zooprophylactic effect of domestic animals, as pointed out by Komar et al. The survey was intended to be comprehensive for all equines located <10 km from laboratory-confirmed clinical cases. Movements of horses in and out of the area probably occurred at the beginning of the outbreak, before the restrictive measures taken by the animal health authorities were in place. Some of the Camargue horses are half-wild and live year-round in marshes; for practical reasons, these half-wild animals were not sampled. However, even if the survey was not strictly exhaustive, the 5,107-equine sample is certainly highly representative of the domestic equines in the area.Having tested only the IgG-positive sera for IgM antibodies is an obvious bias: recently infected animals (with IgM antibodies but without IgG antibodies) that did not show clinical signs would have been missed. The seroprevalence figures obtained may be underestimated for domestic equines. Belonging to the Camargue breed was identified as a seropositivity risk factor and half-wild animals that were not sampled belong to this breed; therefore, the seroprevalence rate is probably also underestimated for the whole equine population of the area .The geographic distribution of the positive results shows that, in the east part of the survey area (and to a lesser extent the west), some positive results were still found near the area boundary: more positive results may have been included if the perimeter had been larger.The serosurvey was carried out over a 14-week period; most of the samples were taken during the first 6 weeks. Because recent WNV circulation was detected (through IgM-positive results) until week 12, some animals tested at the beginning of the study were probably infected later, and the prevalence might have been higher if the study had been conducted during winter.Few serosurveys have been conducted in equines. Survey results can be usefully compared between each other in disease-endemic areas (14); however, comparison is difficult if the survey is in epidemic areas. In such areas, the seroprevalence rate depends on the definition of the survey perimeter (which varies between studies). For example, in our study, if a radius of 15 km around cases had been used to define the survey perimeter instead of 10 km, the seroprevalence rate probably would have been lower.<2 yrs) is closer to our result: this figure better reflects the yearly infection rate and thus the infection pressure.In an endemic area, Egypt in 1959 The seroprevalence rate can also be compared with the results of two earlier serosurveys conducted in the studied area. After the 1962 epidemic , in 37 sThe results of this study, the first large-scale WNV serosurvey conducted in equines, show that seroprevalence rate does not increase with age. Assuming that, as neutralizing antibodies, IgG antibodies persist several years after infection, this result (and the WNV history in the studied area since 1962) suggest that the Camargue is an epidemic area, with outbreaks that occur periodically and are separated by long silent periods. The seroprevalence level, especially for animal groups, indicates that virus circulation was intense during the 2000 epidemic. This intense virus circulation and the location of the epidemic focus in a dry area could be explained by the amplification by synanthropic bird species in dry areas, from a primary circulation in wet areas in water birds. The survey results do not allow us to assert whether this primary circulation is permanent . However, the survey results suggest that, if the primary cycle is permanent, it is restricted to small marshy areas. Two further studies, a serologic follow-up of captive ducks and a serosurvey focused on horses living in the marshy areas, will be conducted in 2001\u20132002; these studies should allow us to refine the epidemiologic status of this primary cycle."}
+{"text": "The aim of this work was to assess the effect of chronic administration of protonated nanostructured aluminosilicate (NSAS) on the plasma cholesterol levels and development of atherosclerotic lesions in Apolipoprotein (ApoE) deficient mice fed a high cholesterol and high fat diet. Apolipoprotein E (ApoE) deficient mice were divided into the following treatment groups: protonated NSAS 1.4% (w/w), untreated control and 2% (w/w) stigmastanol mixed with high-cholesterol/high-fat diet. Animals were treated for 12 weeks, blood samples were withdrawn every 4 weeks for determination of plasma cholesterol and triglyceride levels. At the end of the study the aortic roots were harvested for assessment of atherosclerotic lesions. NSAS at 1.4% (w/w) and stigmastanol at 2% (w/w) treatment groups showed significant decreases in plasma cholesterol concentrations at all time points relative to the control animals. The lesion sum area in 1.4% (w/w) NSAS and 2% (w/w) stigmastanol groups were significantly less from the control animals. In conclusion, in this study, the effectiveness of chronic administration of protonated NSAS material in the reduction of plasma cholesterol levels and decrease in development of atherosclerotic lesions was demonstrated in Apo-E deficient mice model. Elevated plasma cholesterol levels have been associated with increased risk of atherosclerosis and coronary artery disease . AlthougMice, C57B1/6 B6.129P2-ApoE\u21221UNC, 4 week old, with homozygous deletion of the ApoE gene (apolipoprotein E knock-out) were purchased from Jackson Laboratories, USA. The Apo-E deficient mice model has been used extensively, since these mice develop severe hypercholesterolemia and atherosclerotic lesions similar to those observed in humans ,11.The protonated NSAS material was prepared as previously reported , See Add. BrieflyAll animals used in this study were cared for in accordance with the principles promulgated by the Canadian Council in Animal Care and the University of British Columbia. The research adhered to the \"Principles of Laboratory Animal Care\" .The Apo-E deficient mice  were divided into the following treatment groups: protonated NSAS 1.4% w/w, untreated control and 2% w/w stigmastanol. All animals received high-cholesterol/high-fat diet   for the duration of the study. The tested active compounds were incorporated into the diet. All animals were treated for 12 weeks. Blood samples were withdrawn from saphenous vein every 4 weeks and at the end of the study for determination of total plasma cholesterol and triglyceride levels. At the end of the study the animals were sacrificed and aortic arch was harvested for histopathology assessment of atherosclerotic lesions in control animals and in groups that showed statistically significant differences in their plasma lipid profile relatively to the control group. Tissue surrounding the aorta including all fat were trimmed, and frozen in liquid nitrogen. The aorta was cut in 3 consecutive slices (10 \u03bcmol/L) 5 mm above the aortic root. Slides were stained with Oil-Red-O, Movat's Pentachrome and Hematoxylin-eosin. An independent pathologist, blinded to the treatment groups scored the lesion formation based on cumulative atherosclerotic exposure area (sum area).Statistical analyses were performed using one-way ANOVA followed by Dunnett multiple comparisons test. Results were expressed as mean +/- SEM, p < 0.05 indicated a significant difference between groups.All animals based on physical appearance did not appear to have any deleterious effects from administration of NSAS at 1.4% w/w or stigmastanol at 2% w/w. The activity and behaviour of the animals were similar between all groups and consistent with the ApoE deficient phenotype. The baseline of the body weight was 19 g (average) and after 12 weeks was 33.2 (average). As a result of similar food and water consumption (data not shown) during all period of study, the body weight increased by the same amount over the experimental period in all groups (treatment and control)  compounds to reduce dietary cholesterol intestinal absorption in a rat model.Click here for file"}
+{"text": "Metacarpal lengthening in the hand is a new application for distraction neo-histiogenesis. Metacarpal lengthening with distraction helps in improvement in pinch function. Thumb lengthening is technically easy in comparison to other metacarpals. We present the operative treatment and post-operative outcome in nine patients with amputations and congenital anomalies.Nine patients underwent distraction osteogenesis for the treatment of amputations of the hand and other congenital anomalies. The dominant right hand was operated in eight cases and the left hand in one case. There were six males and three females. Improvement of function was always the aim of surgery. Age range was between 18 and 23 years. Thumb lengthening was performed in five patients and that of the index finger in four patients. Distraction started on the fifth post-operative day at the rate of 0.25 mm/day. Sensory function and bone consolidation was assessed before fixator removal.The mean duration of distraction was 51 days  and the distractor was removed at a mean of 150 days  and the bones were lengthened by a mean of 24 mm  There was improvement of function in all cases.The metacarpal lengthening by distraction histiogenesis in congenital and traumatic amputations is safe and simple method to improve pinch function of hand. Pioneered in Russia in the 1950s, the Ilizarov technique is used for the correction of various types of deformities and also for restoration of limb length. The use of distraction histiogenesis in metacarpals and metatarsals is a new concept.There are so many other highly skilled techniques like microvascular toe or tissue transplantation and pollicization that are possible,We have performed metacarpal lengthening by distraction histiogenesis with small external fixator in nine hands. We describe the operative procedures and our results.From 2001 to 2006, we treated nine hands in nine patients by distraction neo-histiogenesis. In five patients, the cause was traumatic amputation and in four patients it was congenital anomalies. Of the four, two had absence of fingers from the level of base of proximal phalanx and two were associated with syndactylism. There was no neurovascular deficit in any of the cases and the available muscle functions were normal. Length intended for lengthening was around 2 cm in all cases. Objective of lengthening was functional improvement. There were six males and three females. The right hand was involved in all cases but one. Only thumb metacarpal lengthening was performed in five patients and index finger lengthening was performed in four patients. Traumatic cases, thumb metacarpal lengthening was performed in three and index metacarpal in two cases. Age range was between 18 and 23 years. Clinical details of the patients are given in The planned rate of lengthening was 0.25 mm/day. The post-operative rate of bone lengthening was analyzed on the basis of anteroposterior radiographs made at the time of distractor removal. Regenerate, pinch function, and sensory function in the treated hand were evaluated.With the patient under brachial anesthesia, a straight incision was made on the dorsum of the first or second ray of hand and the metacarpal was exposed. The periosteum was dissected longitudinally and osteotomy was made horizontally toward the metaphysial area of the bone. A 1 mm K-wire was placed in the metacarpal to maintain alignment. The periosteum and the skin were sutured in layers. Two 2 mm K-wires were inserted 2 mm proximal and distal to the osteotomy site. The distractor device was then assembled to pins [Figures The mean duration of the distraction is 51 days (42\u201360 days) and of the consolidation is 90 days (70\u2013110 days). The distraction device was removed at a mean of 150 days (140\u2013160 days). The bones were lengthened by a mean of 24 mm (20\u201328 mm). On an average, a 20% increase in length was achieved. In one case there was pin loosening and in two cases non-union led to angular deformity. Hyperextension deformity of the metacarpophalangeal joint is a common complication that occurred in four of nine cases. Six months after operation, all hand movements were normal except fully active flexion of the lengthened finger. There was intact sensation of the lengthened rays. There was non-union in two cases, which were then grafted and union was achieved.The principle of distraction osteogenesis can be very effectively and rewardingly applied to the small bones of the hand. It can provide a source for enhanced prehension and gain functional length.Metacarpals were selected for lengthening due to their good vascular supply and adequate soft tissue coverage. Presence of cancellous bone and stability of the base of the metacarpal determines the level of osteotomy between base and shaft. Previous methods of lengthening by osteotomy, iliac crest grafting, and immobilization by POP cast leads to stiffness of the metacarpophalangeal joint. Distraction lengthening allows activity of the hand during lengthening as well as physiotherapy to the metacarpophalangeal joint to prevent stiffness. Bone grafting is not needed in these cases.There are few surgical options for the reconstruction of pinch function in patients with amputations of the thumb. The thumb is so small that opposition is often severely limited. Metacarpal lengthening in the thumb was adequate to allow for pinch function. The thumb metacarpal is an independent bone in comparison with other metacarpals. Hence, in our experience, thumb lengthening is easy in comparison with others.The rate of lengthening was 0.25 mm/day. On the fifth post-operative day, change of dressing was done and family members were taught pin site care as well as method of distraction. Pin site care includes once daily cleaning with hydrogen peroxide. Swabs and betadine-soaked dressings were applied. 0.25 mm distraction daily is painless and well tolerated. Patients were encouraged to use their hand during the treatment period.Consolidation was evaluated by taking antero posterior and lateral X-rays. We usually check for the formation of a minimum of three complete cortices before removal of the distractor.Pin loosening, nonunion, and metacarpophalangeal joint stiffness are some of the complications encountered. Mobilization of the metacarpophalangeal joint and active use of the hand were encouraged.Improvement of pinch and grasp functions were observed. Patients were able to write and button and unbutton dresses. Patients were operated for functional improvement. Cosmesis was never a criterion.Functional improvement by toe transfer is excellent. But, secondary operations like tenolysis, repair of ruptured tendon, tendon grafting or transfers, opponensplasty, and ligamentoplasty for joint stability were necessary in all caseset al.,Technique-wise, use of K-wire advocated by Takeshi Miyawalki et al.In children, the rate of distraction was 1 mm/dayInadequate bone formation, angular deformity, metacarpophalangeal joint stiffness, pin tract infection, and loosening are associated with this technique and care should be taken to avoid these complications.4It has been seen that inadequate bone formation is more common in the second metacarpal than the in thumb. The quality of regeneration was better in the thumb than in the second metacarpal, as seen radiologically, with no previous reports. This is probably dependant on the surrounding soft tissues. The thumb metacarpal is surrounded by muscles all around with a rich blood supply than the index finger. Careful handling of the periosteum and osteotomy in the metaphysical area prevents such complications. In this series, two cases  had poor bone formation leading to non-union and required secondary procedures in the form of antologous cancellous bone grafting. Pin tract loosening, which is a common complication, can be minimized by meticulous post-operative pin site care. We had one case of pintract loosening in index finger lengthening change pin to a more distal site (single pin only).et al.Pensler Metacarpal lengthening was found to be a simple, safe, and cost-effective method of reconstruction that provides a permanent improvement in pinch function. Holding small objects, writing, and buttoning and unbuttoning of shirts were some of the improvements in hand function post-operatively in comparison with the absence of the same functions pre-operatively."}
+{"text": "Despite the advent of highly active anti-retroviral therapy (HAART), HIV-associated neurocognitive disorders continue to be a significant problem. In efforts to understand and alleviate neurocognitive deficits associated with HIV, we used an accelerated simian immunodeficiency virus (SIV) macaque model of NeuroAIDS to test whether minocycline is neuroprotective against lentiviral-induced neuronal injury.in vivo by proton magnetic resonance spectroscopy and post-mortem by immunohistochemistry for synaptophysin (SYN), microtubule-associated protein 2 (MAP2), and neuronal counts. Astrogliosis and microglial activation were quantified by measuring glial fibrillary acidic protein (GFAP) and ionized calcium binding adaptor molecule 1 (IBA-1), respectively. SIV infection followed by CD8+ cell depletion induced a progressive decline in neuronal integrity evidenced by declining N-acetylaspartate/creatine (NAA/Cr), which was arrested with minocycline treatment. The recovery of this ratio was due to increases in NAA, indicating neuronal recovery, and decreases in Cr, likely reflecting downregulation of glial cell activation. SYN, MAP2, and neuronal counts were found to be higher in minocycline-treated animals compared to untreated animals while GFAP and IBA-1 expression were decreased compared to controls. CSF and plasma viral loads were lower in MN-treated animals.Eleven rhesus macaques were infected with SIV, depleted of CD8+ lymphocytes, and studied until eight weeks post inoculation (wpi). Seven animals received daily minocycline orally beginning at 4 wpi. Neuronal integrity was monitored In conclusion, oral minocycline alleviates neuronal damage induced by the AIDS virus. Early in the AIDS epidemic, severe neurological disorders including dementia were found to be caused by HIV The persistence of cumulative neurological disease despite antiretroviral therapy has led to a search for adjunctive therapies. Minocycline, an antibiotic with demonstrated neuroprotective properties, is being tested clinically in neuroAIDS . The benefits of using minocycline are multifaceted including effects against apoptotic cell death, inflammation, microglial activation in vivo1H magnetic resonance spectroscopy (1H MRS) to assess the effects of minocycline on the brain injury produced by lentiviral infection in an accelerated macaque model of neuroAIDS. The rapidly progressing simian immunodeficiency virus (SIV)-infected macaque model uses a monoclonal antibody to persistently deplete the animal of CD8+ lymphocytes in vivo1H MRS, particularly N-acetylaspartate/Creatine (NAA/Cr), are very similar to those found in people with HAND. We longitudinally examined a group of rhesus macaques infected with SIV and CD8+ cell depleted (n\u200a=\u200a11), a subset of which received minocycline (n\u200a=\u200a7). We demonstrate an arrest of declining NAA/Cr, indicative of restoration of neuronal metabolism, and decreases in astrogliosis, microglial activation, and neuronal loss with minocycline treatment in SIV-infected macaques.In this study, we conducted serial neuroimaging using Animals treated with anti-CD8 depleting antibody were either persistently depleted before reemergence of peripheral CD8 cells  or short-term depleted . Four MN-treated animals were persistently depleted and three were short-term depleted. Four untreated infected animals were persistently depleted. All analyses were performed on these 3 groups of animals: 1) infected, untreated, persistently CD8-depleted animals, 2) infected, MN-treated, persistently CD8-depleted animals, and 3) infected, MN-treated, short-term CD8-depleted, infected animals.7 eq/mL by 12 days post inoculation (dpi)  while no further increase in plasma viral loads was observed in the MN-treated animals after 8 dpi. The animals whose CD8 T lymphocytes rebounded before 21 dpi and that received MN treatment had 1.5\u20132 orders of magnitude lower viral loads throughout the course of infection. The three cohorts had different plasma viral loads at 55 dpi (p\u200a=\u200a0.003). Both minocycline cohorts had lower viral loads compared to untreated animals at 55 dpi .After SIV inoculation, the amount of virus in the peripheral blood plasma increased rapidly in all 3 cohorts, attaining levels greater than 10p<0.001, . The plaIn vivo1H MR spectra were acquired from the parietal cortex (PC), frontal cortex (FC), basal ganglia (BG) and white matter semiovale (WM). 1H MR spectra acquired with short echo time (TE\u200a=\u200a30 ms) are characterized by resonances primarily arising from N-acetylaspartate and N-acetylaspartylglutamate (collectively referred to as NAA), choline-containing compounds (referred to as Cho), myo-Inositol (MI), creatine-containing compounds (referred to as Cr) and the glutamate and glutamine concentrations . Consistent with previous studies myo-Inositol elevation is considered to reflect increased glial cell activity The mean percent changes in the levels of NAA/Cr as a measure of neuronal metabolism with respect to time after SIV infection in each brain region are graphically displayed in For the four SIV-infected, persistently CD8-depleted MN-treated animals (open circles), four weeks of MN treatment starting at 4 wpi resulted in a stabilization of NAA/Cr levels in all regions with partial recovery to values that were not significantly different from baseline. Treatment with MN resulted in progressive increase in NAA/Cr levels after treatment initiation in all brain regions in the three SIV-infected, short-term CD8-depleted, MN treated animals (solid triangles) .The SIV-infected untreated animals exhibited the lowest levels of NAA/Cr at the end of the study (8 wpi) in all brain regions examined . NAA/Cr The differences detected in the NAA/Cr ratio in various brain regions may be due to changes in either or both metabolites. In an attempt to identify whether changes in NAA and/or Cr are responsible for the changes observed in the ratio, NAA and Cr concentrations were estimated using tissue water as the internal standard. Due to the fact that there are over four orders of magnitude differences between the concentrations of the metabolites and water concentrations, the values have a much higher variance compared to the metabolite-metabolite ratios. Naturally, this makes obtaining statistical significance more difficult than for comparisons involving metabolite-metabolite ratios.The mean NAA concentrations in untreated SIV-infected animals declined relative to baseline measurements in each brain region analyzed, but the differences were statistically significant only in the WM . The mean Cr concentrations in these untreated SIV-infected animals were elevated in all four regions, but statistical significance was found only in the parietal cortex and white matter .The initiation of minocycline treatment four weeks after inoculation in seven animals arrested the decline in NAA and increase in Cr concentrations in the brains of these animals. The effect of minocycline treatment and the combined effects of minocycline with partial immune reconstitution of the CD8 T cell population are best appreciated when the brain concentrations of NAA and Cr at the last data point are compared in the three cohorts. As shown in Significant changes in choline (Cho) were observed in all eleven animals during the first four weeks of SIV infection (p<0.001), with an increase at 2 wpi followed by a decrease to baseline values or below, as seen in the WM. In the four SIV-infected, persistently depleted, untreated animals Cho again increased above baseline levels at 8 wpi . The increases between 4 and 8 wpi were statistically significant in the PC (p\u200a=\u200a0.003) and WM (p\u200a=\u200a0.003) (data not shown).In contrast, increases in Cho after 4 wpi were not significant in MN-treated, short-term CD8-depleted animals. In MN-treated, persistently CD8-depleted animals, increases in Cho after 4 wpi were not significant in the parietal cortex; however, Cho did increase significantly in the WM (p\u200a=\u200a0.003) and in the BG (p\u200a=\u200a0.001). Furthermore, Cho levels in the animals at their last scan before sacrifice was significantly different among the three cohorts in the PC and WM  with theMyo-Inositol (MI) levels show an increase at 2 and 4 weeks after inoculation and then normalization to baseline values (data not shown). Within the first 4 weeks of infection MI significantly increased at 2 weeks in the FC and WM  and remained elevated at 4 weeks for all eleven animals. At later time points, even without treatment, MI decreases and becomes indistinguishable from baseline levels  decreased in the parietal cortex at 2 and 4 wpi compared to baseline values (p\u200a=\u200a0.002). The same trends are observed in the other brain regions; however, changes did not reach statistical significance. After 4 weeks Glx levels did not change significantly. The Glx levels of the three cohorts at the animals' last scan before sacrifice were not significantly different from each other. Due to the large experimental error and variance in the measurements of glutamine and glutamate, larger cohort sizes may be needed to identify any statistically significant changes.post-mortem studies a control cohort of four age-matched uninfected, CD8 T-lymphocyte depleted animals was introduced to reveal changes from \u201cbaseline\u201d. The uninfected CD8-depleted cohort was chosen to detect the effect of minocycline on SIV infection and not on CD8 depletion. Using in vivo MR spectroscopy and post-mortem IHC, our group has previously shown that CD8 depletion without SIV infection does not change brain metabolism or provoke neuronal or glial degradation For all following Decreases in the expression of synaptophysin (SYN), an integral protein in presynaptic terminals, and microtubule-associated protein 2 (MAP2), a marker for neuronal cell bodies and dendrites, reflect neurodegeneration severity and have been found to correlate to the degree of neurocognitive impairment in persons with HIV There was a statistically significant difference in frontal cortex SYN levels among the four cohorts . There was, however, a statistically significant difference in parietal cortex neuronal counts among the four cohorts (ANOVA p\u200a=\u200a0.017) showing decreased numbers of neurons in untreated animals compared to both the MN-treated persistently CD8-depleted animals and short-term CD8-depleted animals.Glial fibrillary acidic protein (GFAP) is the principal intermediate filament in mature astrocytes. Astrocytes rapidly synthesize GFAP in response to a neurologic insult, and it is the most commonly used marker of astrogliosis. GFAP levels were quantified in the frontal and parietal cortex of the same four cohorts of animals used for the neuronal marker determinations described in the previous section  while there was no statistically significant difference in IBA-1 positive particles/mm2 in MN-treated animals compared to the controls. In the parietal cortex, no significant differences in IBA-1 levels among the cohorts were observed.To quantify the degree of IBA-1 upregulation induced by SIV infection in CD8-depleted animals, immunohistochemistry computer image analysis was performed on brain sections from uninfected, CD8-depleted control animals along with those from the two SIV-infected, persistently CD8-depleted cohorts, of which included one cohort that was MN-treated and one untreated cohort. We did not perform computer-aided image analyses on IBA-1 for the three MN-treated, short-term depleted animals and we recognize that this was an experimental flaw in our study. in vivo1H MR spectroscopy provides an exceptional opportunity to efficiently explore drug therapies that can control neuronal injury HIV-associated neurocognitive disorders continue to be a significant problem despite the use of highly active anti-retroviral drugs (HAART), and this has motivated a search for adjunctive therapies. The SIV-infected accelerated macaque model of neuroAIDS in combination with The SIV-infected rhesus macaque shares very similar pathology with HIV-infected human patients, including the development of AIDS, disease of the CNS, and cognitive or behavioral deficits et al. reported 10% decreases in NAA/Cr in patients with mild cognitive motor dysfunction Moreover, the neuroimaging abnormalities observed in this animal model are similar to changes in HIV-infected patients that correlate with neurocognitive impairment. Chang Declines in the neuronal marker NAA and in NAA/Cr have been found to correlate with disease severity of macaque SIV encephalitis Minocycline treatment beginning at 4 wpi was found to arrest further decrease in NAA/Cr in SIV-infected, persistently CD8 T cell depleted animals. In addition, a complete recovery of NAA/Cr was observed in MN-treated animals that had partial immune reconstitution of the CD8 T cell population. The recovery of the NAA/Cr ratio was found to be due to increases in NAA, suggesting neuronal recovery, and decreases in Cr, possibly reflecting downregulation of glial and inflammatory cell activation. These salutary effects observed by brain imaging were accompanied by clinical improvement including weight gain (data not shown).post-mortem analyses. Synaptophysin (SYN) is a membrane-bound glycoprotein of the small synaptic vesicles, consistently expressed in all pre-synaptic nerve endings of the CNS The beneficial effects of MN on neuronal health were confirmed by Minocycline has been found to be neuroprotective in models of several neurological diseases including ischemia Another possible mechanism for neuroprotection is suggested by the finding of lower viral loads in MN-treated, SIV-infected macaques. Indeed, complete recovery of NAA/Cr was observed in the animals with partial immune reconstitution of the CD8 T cell population. These animals had the lowest levels of plasma viral loads of the three SIV-infected cohorts. A similar effect by MN in a different nonhuman primate model of accelerated AIDS was reported by Zink All four untreated and four of the seven minocycline-treated animals had persistent depletion of CD8+ lymphocytes. However, three of the treated animals had partial recovery of CD8+ lymphocytes. This latter cohort was distinct from the other two with respect to viral loads, imaging, neuropathology and other measures. The better profile of this cohort demonstrates the essential role of CD8+ lymphocyte depletion in producing the neuroAIDS spectrum up to SIV encephalitis. It also demonstrates that while MN treatment alone is insufficient to fully protect the brain in this model and, presumably, the brain in HIV-infected individuals, a combination of approaches may lead to superior results. Thus, the best strategy to treat neuroAIDS may be with combination therapy of minocycline and antiretroviral therapy.Some studies have found conflicting results with respect to the neuroprotective properties of minocycline in vivo1H MR spectroscopy to noninvasively assess minocycline as a neuroprotective agent in neuroAIDS and suggests that the integration of MR spectroscopy should be considered for use in clinical trials of minocycline in patients with HAND.In conclusion, short-term administration of oral minocycline resulted in significant neuroprotection in the SIV-infected macaque accelerated model of neuroAIDS. The study also demonstrated the efficacy of All animal studies were performed in accordance with federal laws and regulations, international accreditation standards, and institutional policies, including approval by the Massachusetts General Hospital Subcommittee on Research Animal Care and the Institutional Animal Care and Use Committee of Harvard University. All animals received environmental enrichment and were monitored daily for evidence of disease and changes in attitude, appetite, or behavior suggestive of illness. Appropriate clinical support was administered under the direction of the attending veterinarian and included analgesics, antibiotics, intravenous fluids, and other supportive care. Animals were euthanized when they presented with advanced stages of AIDS; criteria for euthanasia included 15% weight loss in two weeks, unresponsive opportunistic infection, persistent anorexia, intractable diarrhea, progressive neurologic signs, significant cardiac or pulmonary signs or other serious illness.Eleven 4\u20135 years old  rhesus macaques (Macaca mulatta) were included in this study . All ani2 and respiratory rate were monitored continuously. A heated water blanket was used to prevent hypothermia. All animals were anesthetized with ketamine-HCl and euthanized by intravenous pentobarbital overdose.Animals were scanned two times before infection and biweekly until sacrifice. For MR imaging, each animal was tranquilized with 15\u201320 mg/kg intramuscular ketamine hydrochloride and intubated to ensure a patent airway during the experiment. Intravenous injection of 0.4 mg/kg atropine was administered to prevent bradycardia. Continuous infusion of approximately 0.25 mg/kg/min propofol was maintained throughout imaging via catheter in a saphenous vein. Heart rate, oxygen saturation, end-tidal COpost-mortem evaluations as control cohort.One additional cohort of four uninfected CD8-depleted macaques  were included for the 1H MRS volume of interest (VOI), sagittal and axial turbo spin echo MRI were acquired at 140\u00d7140 mm2 field of view (FOV), TE\u200a=\u200a16 ms and 512\u00d7512 matrix size. Other imaging parameters include a 2 mm slice thickness for sagittal images, a 1.2 mm slice thickness for axial images and repetition times (TR) of 4500 ms and 7430 ms for sagittal and axial images, respectively.All experiments were performed with a 3 Tesla whole-body imager  using a circularly polarized transmit-receive extremity coil. First, a three-plane localizer was performed to position the monkey in the coil. In this manner, voxel placement was highly reproducible. To image-guide the 1H MR spectroscopy was performed in the parietal cortex (PC), frontal cortex (FC), basal ganglia (BG) and white matter semiovale (WM) using a point resolved spectroscopy sequence (PRESS) with water suppression enhanced through T1 effects (WET) Single voxel All spectra were processed offline using the LCModel software package Blood and CSF were drawn before every MR scan, blood was centrifuged, and plasma and CSF were stored at \u221280\u00b0C until study endpoint. Virion-associated SIV RNA in plasma was measured by using a real-time reverse transcription-PCR assay on an Applied Biosystems  Prism 7700 sequence detection system with a threshold sensitivity of 100 copy eq/mL, as previously described CD8+ T lymphocyte depletion was monitored by flow cytometry prior to infection and CD8 depletion and weekly thereafter. Flow cytometric analyses were performed with 100-\u00b5l aliquots of blood incubated with fluorochrome-conjugated antibodies including anti\u2013CD3-APC , anti\u2013CD4-FITC , anti\u2013CD8-PE , and anti\u2013CD20\u2013PE\u2013Texas Red . Following antibody incubation for 15 minutes at room temperature, cells were washed twice with PBS containing 2% FBS; erythrocytes were lysed using ImmunoPrep Reagent System (Beckman Coulter); and samples were washed with PBS, resuspended in 2% formaldehyde in PBS and analyzed on a FACSCalibur flow cytometer (BD). The absolute number of CD8+ T lymphocytes was determined by multiplying the percentage of CD8+ CD3+ T cells by absolute lymphocyte counts obtained using a standard veterinary 3-point WBC differential, CBC Hematology Analyzer .At day of sacrifice, all animals were anesthetized with ketamine-HCl and euthanized by intravenous pentobarbital overdose. Animals were perfused with 4 liters of chilled saline, and CNS tissues were collected in 10% neutral buffered formalin, embedded in paraffin, sectioned at 6 \u00b5m and stained with hematoxylin and eosin (H&E). All H&E sections were evaluated by a neuropathologist.Microglial activation was assessed by quantifying calcium binding adaptor protein 1 (IBA-1). Frontal and parietal cortical brain sections of the four untreated animals euthanized at 8 wpi and the four persistently CD8-depleted animals were incubated with rabbit anti-IBA-1 (Wako Corp. Japan) to determine the amount of microgliosis. In addition, frontal cortex and parietal cortex from four uninfected, CD8-depleted animals served as the control cohort for the IBA-1 analyses. Images of tissue sections were captured without manipulation using an Olympus 3-CCD T60C color video camera mounted on an Olypus Vanox-SI microscope and analyzed using NIH Image J software.Quantitative immunohistochemistry for glial fibrillary acidic protein (GFAP), synaptophysin (SYN), microtubule-associated protein 2 (MAP2) and neuronal counts was performed on fifteen animals: 1) four uninfected CD8-depleted control animals, 2) the four SIV-infected, CD8-depleted untreated animals sacrificed at 8 wpi, 3) the four MN-treated, persistently CD8-depleted SIV-infected animals and 4) the three MN-treated, short-term CD8-depleted, SIV-infected animals.The degree of reactive astrogliosis was assessed with the monoclonal anti-glial fibrillary acidic protein . 5 \u00b5m-thick paraffin sections from the frontal cortex were immunolabeled overnight with these monoclonal antibodies followed by biotinylated horse anti-mouse immunoglobulin G, avidin-horseradish peroxidase , and reacted with diaminobenzidine tetrahydrochloride and peroxide (0.03%). The integrity of the synapses was evaluated with the monoclonal antibody against synaptophysin (1\u223610) . The status of neuronal dendrites was evaluated by using monoclonal antibody against microtubule-associated protein 2 (MAP2) (Boehringer Mannheim).Levels of GFAP, synaptophysin, and MAP2 were estimated by means of computer-aided image analysis, as previously described The number of cortical neurons was quantified by using stereologic evaluation. Formalin-fixed paraffin sections (7 \u00b5m thick) from the frontal and parietal cortex were stained with cresyl violet for subsequent computer-aided image analysis as previously described in vivo MR spectroscopy data and viral loads, repeated measures analysis of variance (RM-ANOVA) in combination with Holm's t-tests was employed to isolate differences between time-points within the cohorts using JMP 7.0 . For the post-mortem measures including IBA-1, SYN, MAP2, GFAP, neuronal counts and last MRS scans before sacrifice, ANOVA was performed among the cohorts and if found to be significant, Least Square Means Student's t-tests were used to isolate which cohort was significantly different. A p-value of \u2264 0.05 was considered to be significant.For the serial"}
+{"text": "Although there has been a reduction of rabies in pets and domestic animals during recent decades in the United States, rabies remains enzootic among bats and several species of terrestrial wildlife. Spillover transmission of wildlife rabies to domestic animals therefore remains a public health threatRetrospective analysis of surveillance data of reported animal incidents  from South Carolina, 1995 to 2003, was performed to assess risk factors of potential rabies exposures among human and animal victims.Dogs and cats contributed the majority  of all reported incidents, with stray dogs and cats contributing 9.0% and 15.1 respectively. Current rabies vaccination status of dogs and cats  were below World Health Organization recommended levels. Owned cats were half as likely to be vaccinated for rabies as dogs . Animal victims were primarily exposed to wildlife (83.0%), of which 27.5% were rabid. Almost 90% of confirmed rabies exposures were due to wildlife. Skunks had the highest prevalence of rabies among species of exposure animals (63.2%). Among rabid domestic animals, stray cats were the most commonly reported (47.4%).While the majority of reported potential rabies exposures are associated with dog and cat incidents, most rabies exposures derive from rabid wildlife. Stray cats were most frequently rabid among domestic animals. Our results underscore the need for improvement of wildlife rabies control and the reduction of interactions of domestic animals, including cats, with wildlife. Procyon lotor), skunks (mostly Mephitis mephitis), and foxes (mostly Vulpes vulpes) [Rabies in pets and domestic animals has been successfully reduced in the United States during recent decades with vaccination programs. Oral rabies vaccination (ORV) and other control programs in wildlife, on the other hand, have had limited success. Rabies remains enzootic among bats and several species of terrestrial wildlife ,2, inclu vulpes) . Spillov vulpes) .There is currently no national surveillance for animal exposures, including bites, scratches, or mucous membrane contact with saliva or nervous tissue ,6. SouthThis study is based on Animal Incident/Rabies Investigation Reports collected by the South Carolina Department of Health and Environmental Control (SCDHEC) between 1994 and 2004 from Appalachia I, II, and III Public Health Districts that include the seven northern counties of Anderson, Cherokee, Greenville, Oconee, Pickens, Spartanburg, and Union. Such reports relate incidents of potential rabies exposures and include all reported animal bites, scratches, or potential mucous membrane contacts. Potential rabies exposures are reported by staff of medical treatment facilities, victims or bystanders  and are investigated by environmental health specialists with SCDHEC. Animal bites to humans are included in the South Carolina List of Reportable Conditions and is therefore mandated by law and regulation. Animal bites to animals are only reported voluntarily. As we were only concerned with terrestrial rabies, we excluded incidents involving bats (N = 245). If several people receive potential rabies exposures through the same animal a separate report results for each individual. Therefore, the number of Animal Incident/Rabies Investigation Reports may be different from the number of exposure animals.Animal Incident/Rabies Investigation Reports were classified by victim type . The \"no victim\" category was assigned to reported observations of atypical, erratic, or aggressive behavior of an animal, which occurred with no physical injury or mucous membrane exposure. Exposure animals were defined as animals implicated in an Animal Incident/Rabies Investigation Report. Dogs and cats were categorized according to ownership status . Vaccination status according to SCDHEC Animal Incident/Rabies Investigation Reports was verified by SCDHEC staff for each case and post-exposure prophylaxis  was recorded. Stray animals, defined as those with no identified owner or individual harboring the animal, were considered unvaccinated. Similarly, dogs and cats with unknown immunization status were assumed to be unvaccinated. If a dog or a cat was classified as \"stray\", but was reported as having been vaccinated against rabies, it was excluded from analyses of ownership status.All counties, with the exception of Cherokee county, utilize the dBase VIPER computerized database system. A database was created for Cherokee County data for 1998 \u2013 2003 utilizing the original hard copy Animal Incident/Rabies Investigation Report forms. Use of computerized records varied by time period for some of the counties and resulted in 9 years of data from 3 counties, 5 years of data from two counties, and 3 years of data from two counties. Published SCDHEC laboratory confirmed animal rabies reports were utilized to confirm accuracy of county data. Animal rabies was diagnosed by direct fluorescent antibody testing of submitted brain tissues. Monoclonal antibody testing was used to determine the viral variant present in each positive sample.Overall, 26 records were excluded from the analysis, because of inconsistencies, such as the specification of an animal species for the victim if the victim was human (N = 12) or no victim was reported (N = 4) or when no victim species was given for animal victims (N = 10). For rate calculations, 2000 census data was used.To quantify bivariate associations between dichotomous exposure and outcome variables, we calculated odds ratios with asymptotic 95%-confidence intervals (CI) and associated p-values. For 22 contingency tables with small cell sizes we calculated exact confidence intervals for the odds ratios. For proportions, we calculated exact binomial confidence intervals. Proportions were compared using the Chi-square test for 2 \u00d7 2 contingency tables. We used an alpha level of 0.05. All statistical analyses were performed using SAS .Overall, 22,485 animal incidence reports were included in this study. The vast majority of incidents involved human victims and accounted for 95.4% of the reports. The average annual incidence rate of incidents involving people was 203.7 per 100,000.Dogs and cats most commonly caused incidents involving people  Table . Wild anAlthough dogs were overall more commonly implicated in incident reports than were cats, stray cats  were more frequently reported than stray dogs N = 2,017)  , while in owned cats, that proportion was less than a third 32.3%)  . For animals, the most common source of rabies exposure was raccoons, followed by skunks, foxes and cat Table . For peoOur results are consistent with some previous reports indicating that the majority of reported incidents in which an animal has potentially exposed a human to rabies are associated with pet dogs -10. WhilOverall, incidents in which an animal has potentially exposed another animal or human to rabies are likely to be under-reported . Patricka priori probability of being positive. This may be a result of case selection, as skunks are difficult to catch and unpleasant to handle. Skunks that are ill, possibly as a result of rabies, may be easier caught and thus submitted for testing. Skunks have been implicated as important hosts and vectors of raccoon rabies virus [The raccoon viral variant is the endemic terrestrial variant found in South Carolina and was the only rabies variant identified in this study. Raccoons were the most frequently tested exposure animals, which supports the finding by O'Bell and colleagues  for all es virus ,18. Furtes virus  and undeThe evidence of spill-over transmission of raccoon rabies to domestic animals in South Carolina is consistent with previous studies . As a reIn our study, rabies vaccination coverage for both dogs and cats was lower than the 70% recommended by the World Health Organization (WHO) to effectively create herd immunity and prevent sustained transmission of rabies . Lack of vaccination, on the other hand, will provide an opportunity for spillover transmission to domestic animals and their human companions. Veterinary rabies immunization protects and benefits both animal and human communities. The simplicity and proven efficacy of vaccination are the foundation of rabies prevention . The incWhile the majority of reported potential rabies exposures are associated with dog and cat incidents, most rabies exposures derive from rabid wildlife. Given a reported incident, domestic animal victims are much more likely to be exposed to rabies than people. Stray cats were disproportionately associated with human potential rabies exposures and were most frequently reported rabid among domestic exposure animals. Historically, rabies control has focused on vaccination and control of stray dogs. Our results underscore the need for future research to improve wildlife rabies control methods as well as the need for initiatives to reduce interactions of domestic animals, particularly cats, with wildlife.The authors declare that they have no competing interests.CR compiled the data, initiated the data analysis and manuscript preparation and wrote the first version of the manuscript; DG supervised the data compilation and helped write and edit the manuscript; IF supervised/conducted the analysis of the data and helped write and edit the manuscript and revised the manuscript according to reviewers' suggestions.The pre-publication history for this paper can be accessed here:"}
+{"text": "The concept that oxidative stress contributes to the development of human preeclampsia has never been tested in genetically-defined animal models. Homozygous deletion of catechol-O-methyl transferase (Comt-/-) in pregnant mice leads to human preeclampsia-like symptoms  resulting from extensive vasculo-endothelial pathology, primarily at the utero-fetal interface where maternal cardiac output is dramatically increased during pregnancy. Comt converts estradiol to 2-methoxyestradiol 2 (2ME2) which counters angiogenesis by depleting hypoxia inducible factor-1 alpha  at late pregnancy. We propose that in wild type (Comt++) pregnant mice, 2ME2 destabilizes HIF-1 alpha by inhibiting mitochondrial superoxide dismutase (MnSOD). Thus, 2ME2 acts as a pro-oxidant, disrupting redox-regulated signaling which blocks angiogenesis in wild type (WT) animals in physiological pregnancy. Further, we suggest that a lack of this inhibition under normoxic conditions in mutant animals (Comt-/-) stabilises HIF-1 alpha by inactivating prolyl hydroxlases (PHD). We predict that a lack of inhibition of MnSOD, leading to persistent accumulation of HIF-1 alpha, would trigger inflammatory infiltration and endothelial damage in mutant animals. Critical tests of this hypothesis would be to recreate preeclampsia symptoms by inducing oxidative stress in WT animals or to ameliorate by treating mutant mice with Mn-SOD-catalase mimetics or activators of PHD. Approximately 5\u20137% of pregnant women worldwide suffer from common hypertensive pregnancy disorders culminating in preeclampsia (PE), intrauterine growth restriction and premature child birth. PE is the major cause of maternal mortality (80%) in developing nations and in recent years, the perinatal mortality and morbidity in developed countries have increased by five-fold ,2. Moreo2O2 (nano-micromolar) are necessary for angiogenesis . Thi see Fig  and inhi animals . Such doComt-/- mice, the lack of inhibition of MnSOD under normoxic conditions (late pregnancy) would facilitate untimely accumulation of H2O2 which is essential for HIF-1\u03b1 stability [2O2 would block hydroxylation of HIF-1\u03b1 by inactivating PHD (PHD-Fe+3) [Comt-/- mice at late pregnancy [2 O2 (> 200 \u03bcM/L) under normoxic conditions together with stable HIF1-\u03b1 is sufficient to inflict vascular pathology in Comt-/- mice. Moreover, HIF-1\u03b1 is a potent mediator of myeloid cell (monocytes and macrophages) infiltration at the sites of inflammation [Comt-/- mice.In tability . H2O2 woHD-Fe+3) -29 This regnancy . Increasammation  and lipoammation . Therefoet al [1. Preeclampsia symptoms in normal pregnant mice could be created by treating the animals with 2ME2. 2ME2 which peaks at third trimester of pregnancy, is a pro-oxidant and rather than an antioxidant as proposed by Kanasaki et al . Therefo2.-, the same experiment could be repeated to ensure maximum oxidative effect. The logic behind using the combination is that rotenone at low concentration (50 nM) would direct O2.- production by diverting electron flow from complex 1 of the electron transport chain to O2, while non-toxic concentrations of 2ME2 (0.3 \u03bcM) would synergistically facilitate O2.- accumulation by inhibiting SOD [2. Since 2ME2 at low concentrations (0.3 mM) in combination with rotenone  is a potting SOD .2O2 in Comt-/- mice could be rescued by treating the animals with synthetic MnSOD/catalase mimetics. Synthetic MnSOD/catalase mimetics have been shown to exhibit both SOD and catalase activities, and some are more potent, stable and cytoprotective than the native antioxidant enzyme SOD [1. The proposed oxidative damage induced by accumulation of Hzyme SOD .2. The preeclampsia phenotype in mutant animals could be rescued by treating the animals with ascorbate or specific activators of PHD .While oxidative stress has been proposed to be central to placental pathogenesis and systemic vasculo-endothelial damage in human preeclampsia and a hypertensive mouse model , the conComt): Catechol-O-methyl transferase; (2ME2): 2-methoxyestradiol 2; (HIF-1\u03b1): Hypoxia induciblefactor-1\u03b1; : Superoxide dismutase 1\u20133; (MnSOD): Mitochondrial superoxide dismutase; (PHD): Prolylhydroxlases; (ROS): Reactive oxygen species; (WT): wild type.(ATP): Adenosine triphosphate; (GPCR): G protein-coupled receptor; (ISP3): Inositol triphosphate; (ER): Endoplasmic reticulum; (The authors declare that they have no competing interests.The authors discussed the clinical importance of different mouse models for preeclampsia and developed the hypothesis; SB wrote the manuscript. All authors read and approved the final manuscript."}
+{"text": "This report summarizes the spread of a raccoon rabies epizootic into New York in the 1990s, the species of animals affected, and human postexposure treatments (PET). A total of 57,008 specimens were submitted to the state laboratory from 1993 to 1998; 8,858 (16%) animals were confirmed rabid, with raccoons the most common species (75%). After exposure to 11,769 animals, 18,238 (45%) persons received PET, mostly because of contact with saliva or nervous tissue. We analyzed expenditure reports to estimate the cost of rabies prevention activities. An estimated $13.9 million was spent in New York State to prevent rabies from 1993 to 1998. Traditional prevention methods such as vaccinating pets, avoiding wildlife, and verifying an animal\u2019s rabies status must be continued to reduce costly PET. To reduce rabid animals, exposures, and costs, oral vaccination of wildlife should also be considered. The incidence of human rabies is high in developing countries, and most cases of the illness occur in humans with untreated dog bites ,2. In deNationwide, the number of reported rabies cases in animals increased from 6,972 in 1991 to 9,495 in 1993, but decreased to 8,224 in 1994, 8,509 in 1997, and 7,961 in 1998 . Wild an The exposure of humans and domestic animals to rabid animals has resulted in an estimated 16,000\u201339,000 persons per year receiving postexposure prophylaxis treatment (PET) in the United States New York State has passed a legislative appropriation for rabies prevention and PET. Reimbursement of PET costs not covered by third-party payers was first established more than 50 years ago in response to concerns about potential human deaths from fox rabies in those who could not afford treatment. Since the New York State Department of Health (NYSDOH) disburses these funds, this agency can provide accurate estimates of the cost of postexposure rabies treatments in the state. In addition, NYSDOH\u2019s active rabies laboratory conducts all diagnostic work in the state, excluding New York City, which has its own laboratory .Initial analyses of rabies treatments for four New York counties in 1993 and 1994 have been previously published In New York State, public health law requires health-care providers with knowledge of a person exposed to an animal suspected of having rabies infection to report the incident to the local health unit (LHU). LHUs are required to have comprehensive rabies control protocols that provide 24-hour availability of county staff to manage possible exposures, including 10-day confinement and observation of apparently healthy dogs and cats responsible for exposures; collection, preparation, and submission of animal specimens to the rabies laboratory for prompt rabies examination; authorization of human PET; and provision of pet vaccination clinics. Annually, LHUs must submit to NYSDOH a detailed expenditure report for state-reimbursed costs including PET, laboratory specimen preparation, and pet vaccination clinics. We used fiscal year data (April\u2013March) from 1993 to 1998 to estimate the overall cost of human PETs in New York.A rabies specimen history form accompanies each animal specimen submitted to the New York State Wadsworth Center rabies laboratory for testing. Using this form, we gathered information specific to the specimen regarding species, location of capture, nature of human and animal contacts, and rabies testing results. A rabies surveillance report form is completed by the LHU for each animal exposure that resulted in human postexposure treatment and for each rabid animal. These surveillance forms are forwarded to the NYSDOH Bureau of Communicable Disease Control for data entry and analysis. Data collected on these reports include animal species, location, type of exposure, and number of humans exposed to the suspected animal.We matched data from the surveillance reports with data from rabies laboratory specimen history reports. Positive test results with missing surveillance information were actively followed up with LHUs to assure the completeness of exposure and treatment data. The data from laboratory and human exposure reports have been computerized for the years 1993\u20131998 and are analyzed in this report. To map New York\u2019s counties and the year raccoon rabies was first confirmed in each county, we included data from 1991 to 1997. From 1993 to 1998, a total of 56,947 animal and 61 human specimens were submitted for rabies testing, with the highest number of tested animals in 1993  and the lowest in 1995  . The ove The geographic movement of raccoon variant of rabies is shown in  From 1993 to 1998, a total of 18,071 animal rabies surveillance reports were received from local health departments . Of thesA total of 8,858 rabies surveillance reports were received on animal specimens with laboratory-confirmed rabies , with 6,A total of 11,552 persons received PET for exposure to 8,762 animals with specimens unavailable for testing or not testable because of specimen condition . In addiAcross all categories of rabies status for the animal, most postexposure treatments were provided because of possible contact with saliva or nervous tissue (44.5%), followed by bite (34.9%) and scratch (5.8%) exposures . When th Two fatal human rabies cases related to bat exposure occurred in New York in 1993 and 1995  resulting in treatment of 55 and 48 persons, respectively, who had contact with the cases either at home or in the hospital. Although bats represented only 4.6% of the rabid animals in New York, exposure to bats accounted for 25.8% of the PETs, with a total of 4,706 persons receiving PET after exposure to bats in the state. Fifty-one percent of the bat-related PETs were classified as \u201cunknown\u201d in regard to exposure, and 28% were provided because of reported contact with saliva or nervous tissue. The total expenditure for PETs, laboratory specimen preparation, and pet vaccination clinics increased in New York from $1.8 million in the 1993\u20131994 fiscal year to $2.9 million in the 1998\u20131999 fiscal year . The est The public health impact of the reemergence of rabies in New York resulting from the spread of raccoon variant in the 1990s was profound in terms of the number of rabid animals diagnosed, humans exposed and treated, and PET costs. Despite the decreasing number of rabid animals during the study period, the increasing number of humans receiving treatment for rabies from 1993 to 1998 appeared to be a result of the high number of suspected rabid animals (untested) and the high number of reported bat exposures following publicity surrounding two bat rabies\u2013related human deaths. The high proportion of PETs associated with exposures other than bites  in our review indicates the degree of human fear about possible rabies and the difficulties in interpreting definitions of exposure ,18. This A few studies suggest that >$1 billion per year has been spent recently to prevent rabies in the United States  Seventy-five percent (24/32) of the human rabies cases in the United States since 1990 have been attributed to bat variants \u201323. The  The persistence and spread of rabies in raccoons and domestic animal exposure to this variant continue to be an important issue for public health officials. The reemergence of wildlife rabies in areas like New York (after the fox variant had moved out of the state) as a result of the unimpeded northward spread of the raccoon variant into the state and increased recognition of the importance of bat variants has led to a large number of rabies cases both in domestic and wildlife species and a corresponding number of human rabies PETs. Traditional public health methods of surveillance, public and provider education to avoid exposure to potentially rabid animals, appropriate postexposure prophylaxis, and emphasis on verifying the negative rabies status of suspect animals to avoid unnecessary treatments will remain important methods for rabies control. However, the major impact of raccoon rabies in human exposure and treatments may also need to be addressed with new wildlife rabies control methods such as oral rabies vaccine \u201329."}
+{"text": "The crystal structure consists of two crystallographically independent [TiF6]2\u2212 anions, two fluoride anions and two triply-protonated tris\u00ad(2-amino\u00adethyl)\u00adamine cations. The Ti atoms are coordinated by six F atoms within slightly distorted octa\u00adhedra. The anions and cations are connected by inter\u00admolecular N\u2014H\u22efF hydrogen bonds.The title compound, (C DOI: 10.1107/S1600536808009781/nc2095Isup2.hkl            Structure factors: contains datablocks I. DOI:  crystallographic information; 3D view; checkCIF report            Additional supplementary materials:"}
+{"text": "Ischemic brain injury due to stroke and/or cardiac arrest is a major health issue in modern society requiring urgent development of new effective therapies. The use of appropriate animal models is essential to study the mechanisms of ischemia-induced injury and neuroprotection. The goal of our study was to establish a reliable and reproducible model of brain ischemia in pigs  for further research.in vivo SDF videomicroscopy) and histological structure (light microscopy) of brain tissue in healthy control animals and after 3 hours of brain ischemia (three different models).Eighteen pigs (18 to 22 kg) were anesthetized and randomly assigned to the one of the following groups: 1 - control, 2 - unilateral carotid occlusion, 3 - bilateral carotid occlusion, 4 - bilateral carotid occlusion + hypotension (MAP 40 to 50 mmHg). In order to investigate the effects and mechanisms of cerebral ischemia, we assessed the mitochondrial respiration (high-resolution respirometry), microcirculation . Mitochondrial respiration rates after addition of atractyloside and cytochrome c were the same in all experimental groups, suggesting that intactness of mitochondrial outer membrane was not affected by cerebral ischemia. Microcirculatory and histological alterations also demonstrated increasing derangement and reversible structural changes after bilateral carotid occlusion and vascular occlusion combined with systemic hypotension.LEAK respiration  was not affected by ischemia in any model. The OXPHOS capacity with pyruvate + malate as substrates decreased by 20% and 79% compared to the control level after bilateral carotid artery occlusion and bilateral carotid occlusion + hypotension, respectively, resulting in the decrease of RCI (ADP/PM) by 14% and 73%. The OXPHOS capacity with succinate as substrate remained constant after unilateral carotid artery occlusion but decreased by 53% after bilateral carotid artery occlusion and hypotension compared to the control level ."}
+{"text": "People with higher socio-economic status (SES) are generally in better health. Less is known about when these socio-economic health differences set in during childhood and how they develop over time. The goal of this study was to prospectively study the development of socio-economic health differences in the Netherlands, and to investigate possible explanations for socio-economic variation in childhood health.Data from the Dutch Prevention and Incidence of Asthma and Mite Allergy (PIAMA) birth cohort study were used for the analyses. The PIAMA study followed 3,963 Dutch children during their first eight years of life. Common childhood health problems  were assessed annually using questionnaires. Maternal educational level was used to indicate SES. Possible explanatory lifestyle determinants  and biological determinants  were analysed using generalized estimating equations.This study shows that socio-economic differences in a broad range of health problems are already present early in life, and persist during childhood. Children from families with low socio-economic backgrounds experience more asthma symptoms (odds ratio (OR) 1.27; 95% Confidence Interval (CI) 1.08-1.49), poorer general health , more frequent respiratory infections , more overweight , and more obesity . The most important contributors to the observed childhood socio-economic health disparities are socio-economic differences in maternal age at birth, breastfeeding, and day-care centre attendance.Socio-economic health disparities already occur very early in life. Socio-economic disadvantage takes its toll on child health before birth, and continues to do so during childhood. Therefore, action to reduce health disparities needs to start very early in life, and should also address socio-economic differences in maternal age at birth, breastfeeding habits, and day-care centre attendance. Those who are socio-economically better off are generally in better health . This asThe family environment is the first and most intimate level that influences the early development and health of children . The famFamily size also seems to be relevant when it comes to the development of childhood health. Having siblings was found to protect children against hay fever, and, in several studies, against asthma and eczema as well . It has This paper describes the development of socio-economic health differences early in life in the Netherlands. We studied the impact of maternal educational level (as an indicator of the socio-economic background of the child) on the development of several health indicators among a birth cohort until the children are eight years old. The health outcomes studied are common childhood health problems: eczema, asthma symptoms, general health, frequent respiratory infections, overweight, and obesity. We explored when socio-economic differences in health occur during childhood, and whether these health disparities change as children grow older. Furthermore, we investigated explanations for socio-economic disparities in children's health during the first eight years of their lives Figure .Data were obtained from the Dutch longitudinal Prevention and Incidence of Asthma and Mite Allergy (PIAMA) study, which gathered health information on 3,963 children born in 1996 or 1997. The study collected health data during the first eight years of their lives, and is described in more detail elsewhere . The stuThe parents filled in questionnaires during pregnancy, when the child was three months old, and subsequently, every year until the child was eight years old. Questionnaires were sent to the parents once a year in the month the child celebrated his or her birthday.A child was classified as having eczema if an itchy rash had been present at one or more of the specified locations  during the previous 12 months. The question about eczema was asked every year at ages one to eight.Children were categorized as having asthma symptoms if they had one or more symptoms: a wheeze, shortness of breath (dyspnoea) or if a medical doctor had prescribed inhaled steroids for respiratory or lung problems in the preceding 12 months. Asthma symptoms were reported annually starting at three years of age.Frequent respiratory infections were measured annually from ages one to eight. Frequent respiratory infections were defined as having suffered from 3 or more of the following infections during the previous 12 months: bronchitis, pneumonia, middle ear infection, sinusitis, throat infection, or flu or a serious cold.A Dutch version of the 'RAND General Health Rating Index' for children was used to assess general health . The 'RAOverweight and obesity (severe overweight) were defined using weight and height information collected from the questionnaires at ages three to eight. Parents were asked to report their child's body weight (in kg) and height (in cm) from the last time the child was weighed and measured by a medical doctor or nurse if this had been done within the previous three months. If these measures were not available, the parents were asked to weigh and measure their child without shoes and heavy clothes. Age- and sex-specific cut-off points defined by Cole et al.  were useMaternal educational level was used to indicate the family's socio-economic status (SES). Education is considered to be a good indicator of adult SES in the Netherlands and elsewhere ,18. It iThis study examined how biological and lifestyle factors may affect the development of health inequalities early in life. Determinants present at birth and in the child's first year were chosen to examine their influence on the development of health inequalities from birth onward. The biological and lifestyle determinants used in the explanatory analyses were selected on theoretical grounds. The research group included those determinants they considered most plausible and explanatory for SES differences in childhood health. The biological determinants were the presence of older siblings (yes/no), maternal age at birth (continuous), and the child's birthweight (continuous), and were reported in the questionnaire administered at three months. Lifestyle variables were reported in the child's first year: maternal smoking (during at least the first four weeks of the pregnancy), smoking by anyone in the home (more than once a week), breastfeeding, including any form of breastfeeding, also partial , and day-care centre attendance during the first year. Day-care centre attendance was dichotomized into 'none or fewer than 4 hours per week' and '4 hours per week or more'.We used generalized estimating equations (GEE) to analyse the development of socio-economic health disparities during the first eight years of the children's lives. GEE models take into account the correlation between repeated measurements in the same individual. An autoregressive correlation was chosen to fit the data. All analyses used the most highly educated group as reference category, and were adjusted for the sex of the child.First, we estimated the association between maternal educational level and the health outcomes for the whole period by fitting a GEE model with the child's age, sex and maternal educational level. Second, to find out whether educational differences in children's health varied during the period studied, we included the interaction between the child's age and maternal educational level in the model. Third, we studied which variables longitudinally predicted childhood health by fitting GEE models containing the child's sex, age, and one potential determinant. Variables were considered predictors of the health outcome if they were significantly associated with the health outcome (p < 0.05). Next, for those determinants significantly related to one or more health conditions, we studied the distribution of the predictor according to the educational level of the mother. Finally, if the predictors are also significantly related to the educational level of the mother (p < 0.05), we added the predictor to the basic GEE model  in an attempt to explain the association between maternal educational level and childhood health. Time-dependent relationships between determinants and health outcomes were included in the model when significant, and we calculated the contribution of all significant determinants together to the educational differences in children's health. Determinants were excluded from the total model if we found no reduction in the odds ratios (ORs) and/or in the 95% confidence intervals (CIs) of the ORs of the different educational groups.) was used to perform Proc Genmod analyses and PROC MIANALYSE to pool the outcomes from the five datasets. All analyses described above were performed using both the original dataset and the imputed datasets. In this article, we report results from the analyses of the imputed datasets. The characteristics of the study population of the imputed dataset did not differ from the original dataset  of the 3,963 children included at baseline were lost to follow-up. In addition, not every parent always filled in all of the questions every year, which resulted in missing data. Particularly affected were the health outcomes, with missing data ranging from 15% for frequent respiratory infections to 35% for overweight and obesity. If data are not 'missing completely at random' (MCAR), complete case analysis may lead to biased results ,20. To o0 of the The prevalence of asthma symptoms decreases from 23% at the age of three to 13% at the age of eight. The prevalence of frequent respiratory infections decreases from 14% to 4% between the ages of three and eight. As the children grow older, more children become overweight or obese. At three years of age, 8% of the children are overweight and fewer than 1% are obese. At eight years of age, 12% are overweight and 2% are obese. The prevalence of poor general health and eczema fluctuated . The repeated data collection over a period of eight years (starting at birth) allows for longitudinal analyses to study the development of children's health. The PIAMA study contains a broad range of different health outcomes that enables a more thorough study of the relationship between a family's socio-economic background and the health development of their children.One of the study's limitations is that all of the information on health is self-reported by the parents. Self-reported information is prone to reporting bias, which could distort our findings, assuming this bias is related to SES. Another limitation is the selective availability of variables for studying explanations for educational differences in childhood health. We could only study the contribution of the available determinants to the educational health inequalities. These determinants were gathered with the intention of unravelling the aetiology of asthma and allergies . FurtherMaternal educational level is used in this study as an indicator of family socio-economic background. The educational level of the mother is a good proxy for social status in the Netherlands, and is supported by the literature ,18. It iOur study reports a consistent pattern of poorer health outcomes among children from families with low socio-economic backgrounds. Although this relationship is found in other studies, several studies have discussed a reverse SES effect . Chen etOur study shows that breastfeeding plays an important role in the development of childhood socio-economic differences for asthma symptoms and frequent respiratory infections. Mothers from lower socio-economic backgrounds are less likely to breastfeed their children , whereasIn this study, day-care centre attendance during the first year is related to socio-economic differences in children's poor general health and weight problems, but not to respiratory infections or asthma. On the one hand, day-care centre attendance is considered a threat to children's health (in particular with regard to respiratory infections) because of the close contacts between children in day-care centres ,25. RepoMaternal age at birth is an important factor for childhood socio-economic differences in asthma symptoms, poor general health, and frequent respiratory infections. Younger mothers report poorer general health, more asthma symptoms, and more respiratory infections than older mothers. The reason for this might be that younger mothers are more worried than older mothers . On the In our study, mothers from low socio-economic groups smoke more often during pregnancy, which is associated with asthma and weight problems in childhood. For asthma, similar results were found in other studies ,36. SmokThis study confirms that socio-economic health disparities already occur very early in life. Socio-economic disadvantage takes its toll before birth and continues to do so during childhood. Therefore, action to reduce health disparities needs to start very early on in life. These findings fit in with the trend of intervening in the preconception phase, for instance, with health promotion activities to reduce risky behaviour among prospective parents ,41. MoreThe authors declare that they have no competing interests.AR performed the analyses and the writing of the manuscript. MD conceived the idea for this article, supervised the analyses and preparation of the manuscript, and reviewed the drafts of the manuscript. AHW was involved in the analyses and interpretation of the findings and reviewed the drafts of the manuscript. MK, GHK and JAS participated in the realization of the PIAMA birth cohort study and reviewed the final draft of the manuscript. All authors read and approved the final manuscript.The pre-publication history for this paper can be accessed here:http://www.biomedcentral.com/1471-2458/11/225/prepub"}
+{"text": "S. pneumoniae as a major human pathogen is largely due to its remarkable genomic plasticity, allowing efficient escape from antimicrobials action and host immune response. Natural transformation, or the active uptake and chromosomal integration of exogenous DNA during the transitory differentiated state competence, is the main mechanism for horizontal gene transfer and genomic makeover in pneumococci. Although transforming DNA has been proposed to be captured by Type 4 pili (T4P) in Gram-negative bacteria, and a competence-inducible comG operon encoding proteins homologous to T4P-biogenesis components is present in transformable Gram-positive bacteria, a prevailing hypothesis has been that S. pneumoniae assembles only short pseudopili to destabilize the cell wall for DNA entry. We recently identified a micrometer-sized T4P-like pilus on competent pneumococci, which likely serves as initial DNA receptor. A subsequent study, however, visualized a different structure - short, \u2018plaited\u2019 polymers - released in the medium of competent S. pneumoniae. Biochemical observation of concurrent pilin secretion led the authors to propose that the \u2018plaited\u2019 structures correspond to transformation pili acting as peptidoglycan drills that leave DNA entry pores upon secretion. Here we show that the \u2018plaited\u2019 filaments are not related to natural transformation as they are released by non-competent pneumococci, as well as by cells with disrupted pilus biogenesis components. Combining electron microscopy visualization with structural, biochemical and proteomic analyses, we further identify the \u2018plaited\u2019 polymers as spirosomes: macromolecular assemblies of the fermentative acetaldehyde-alcohol dehydrogenase enzyme AdhE that is well conserved in a broad range of Gram-positive and Gram-negative bacteria.The success of  Streptococcus pneumoniae often escapes prevention and treatment through rapid horizontal gene transfer via natural transformation. Uptake of exogenous DNA requires expression of a transformation pilus but two markedly different models for pilus assembly and function have been proposed. We previously reported a long, Type 4 pilus-like appendage on the surface of competent pneumococci that binds extracellular DNA as initial receptor, while a separate study proposed that secreted short, \u2018plaited\u2019 transformation pili act simply as peptidoglycan drills to open DNA gateways. Here we show that the \u2018plaited\u2019 structures are not competence-specific or related to transformation. We further demonstrate that these are macromolecular assemblies of the metabolic enzyme acetaldehyde-alcohol dehydrogenase\u2014or spirosomes\u2014broadly conserved across the bacterial kingdom. Streptococcus pneumoniae remains a leading mortality cause worldwide . . 10]. AmS. pneumoniae . . 18]. Honterpart E and 2Filaments .adhE-null Streptococcus pneumoniae R6 mutant (\u0394adhE) and examined its transformation efficiency for uptake of resistance-encoding DNA cassette under challenge with the corresponding antibiotic. While the \u0394adhE mutant shows slightly decreased transformation efficiency (~ 2-fold), this change is negligible compared to typical results under comGC disruption (~ 10 000-fold) and can be due to reduced metabolic fitness under the microaerobic conditions of the experiment G.thermogirosomes ,21.S. pneumoniae, we observed spirosome release in cultures of Clostridium difficile, Streptococcus sanguinis, and E. coli . Also, although with slightly different parameters in terms of helical width and pitch, the \u2018plaited\u2019 filaments were structurally similar to both the coiled structure of a eukaryotic RecA homolog (B) [in vitro reconstituted RecAS.pneumoniae nucleofilaments (C). Nevertheless, release of the characteristic polymers persisted in a \u0394recA strain (D) and we were unable to detect the protein in the filament-enriched fractions following purification  , as wellilaments  panel C.A strain  panel D fication .E. coli spirosomes shown here underscores the fact that limited-view, low-resolution morphology imaging and bulk biochemical experiments alone are often insufficient to deduce the nature of macromolecular assemblies. Rather, a combination of orthogonal approaches that spans the different resolution levels and integrates genetic, biochemical and structural data in a meaningful way is generally warranted to avoid false-positive or otherwise erroneous results.It is therefore important to note that macromolecular organization in helical filaments is not uncommon among proteins from both the bacterial and other taxa. These include but are not limited to nucleic acid-binding proteins, cytoskeletal elements, building blocks of cell surface appendages and phage capsid subunits ,42\u201344. TV. cholerae, which shares many features with the pneumococcal transformation pilus: competence-induced expression, prerequisite for DNA uptake, and roughly a single copy per cell [Taken together, our data rule out the existence of short \u2018plaited\u2019 transformation pili in competent pneumococci and reassert the expression of a long, 5\u20136 nanometer wide appendage, structurally and compositionally similar to T4P in Gram-negative bacteria . This fiper cell .Apart from morphology alone, however, it is interesting to discuss the probable mechanism through which the transformation pili secure DNA entry into competent pneumococci. Although expression of any type of pilus would require overcoming the physical barriers of cell-wall peptidoglycan and overlaying capsule\u2014and thus possibly facilitate DNA entry\u2014the similarities among transformation pili of Gram-positive and Gram-negative bacteria suggest that naturally transformable species might have evolved a conserved and more sophisticated mechanism of pilus function than simple cell-wall destabilization.S. pneumoniae, thus opening gateways in the cell wall peptidoglycan for passive exogenous DNA entry [S. pneumoniae strains after centrifugation correlates with the peak of transformation efficiency [In agreement with a long-standing \u2018pseudo-pilus\u2019 hypothesis, Balaban and colleagues proposed a model in which the transformation pili self-secrete in the medium of competent NA entry ,9. Theirficiency . Since wficiency . Howeverficiency ,12. Suchficiency .As we have conducted only single time point visualization experiments, it is theoretically possible that the expresses transformation pili eventually detach from the cell to open entry pores for transforming DNA . HoweverS. pneumoniae and other transformable Gram-positive bacteria, pneumococci lack homologous retraction ATPase and are likely to utilize a distinct mechanism for DNA entry. In addition, transforming DNA uptake occurs at much lower speeds in Gram-positive bacteria than Gram-negative T4P retraction [While no mechanistic or quantitative data on DNA binding by the pilus are available, electron microscopy showed extensive contact interfaces between the long transformation pili and DNA chains . It is ttraction ,52.Many sequence-specific DNA binding proteins can scan DNA for their target sites at speeds several orders of magnitude higher than the upper limit for a three-dimensional diffusion-controlled process . This caStreptococcus pneumoniae spirosomes were observed in both competent and non-competent cells. For competence induction cells were grown in microaerobic conditions, without agitation, at 37\u00b0C in Casamino Acid-Tryptone (CAT) medium supplemented with 0.2% glucose, 15mM dipotassium phosphate, 3mM sodium hydroxide and 1mM calcium chloride and adjusted to pH 7.8. Competence was triggered by the addition of Competence Stimulating Peptide (CSP) at OD600 = 0.15 for 10\u201330 min. Non-competent pneumococci and Escherichia coli cells were grown similarly in LB to OD600 = 0.3 and OD600 = 0.6, respectively. Clostridium difficile cells were grown at 37\u00b0C under strict anaerobic conditions on Tryptone-Yeast extract-Glucose (TYG) plates supplemented with 0.1% thioglycolate. Streptococcus sanguinis cells were grown anaerobically, without agitation, at 37\u00b0C in CAT medium to OD600 = 0.3. For spirosome visualization cells were scraped off the plates or pelleted by centrifugation and resuspended in TBS  at ~ 5 \u03bcl TBS per milliliter of culture at OD600 = 0.3. 5 \u03bcl drops of each suspension were then placed directly on glow discharged carbon coated grids  for 1 minute. The grids were then blot-dried on filter paper, washed on a drop of ultrapure water, and negatively stained with 2% uranyl acetate in water. Specimens were examined on an FEI Tecnai T12 BioTWIN LaB6 electron microscope operating at 120 kV at nominal magnifications of 18500\u201368000 and 1\u20133 \u03bcm defocus. Images were recorded on a Gatan Ultrascan 4000 CCD camera.adhE deletion (strain AD001) was introduced in the R1501 genetic background by transformation with a DNA cassette carrying a kanamycin resistance gene inserted between two ~1000 base pair fragments corresponding to the S. pneumoniae genomic regions flanking adhE. Briefly, the genomic region upstream from the AdhE open reading frame was amplified using forward and reverse primers 5\u2019-ACA TGG CAA TCC GAT TCA TAA GGG G-3\u2019 and 5\u2019-GCC ATC TAT GTG TCG GAA CGA TAT CCT TTG TTA ATT TTT TCA CAA GTT TAT TAT AAC G-3\u2019, respectively, while the genomic region downstream of the adhE gene was amplified the following primer pair 5\u2019-AAA ATG TGT TTT TCT TTG TTT TGT TTA TCA GTC TAG AAG CAA GAC AAA AAC TCA A-3\u2019 and 5\u2019-TTG CTA TTT ATG CAT GCA GAA GAC CAA ATG-3\u2019. A third pcr reaction was used to amplify a kanamycin-resistance gene using the pR411 plasmid as template DNA [adhE-upstream and 5\u2019-end of the adhE-downstream fragments, respectively. The three pcr products were then assembled using overlap extension PCR and the purified DNA cassette was used for transformation of competence-induced S. pneumoniae R1501 cells. adhE-null mutants (strain AD001) were positively selected by growth in the presence of kanamycin (60 \u03bcg/ml) and adhE deletion was confirmed independently by DNA sequencing and western blot detection using an anti-AdhE antibody. For all transformation experiments, competence was triggered as above at OD600 = 0.15 for 10 minutes, followed by DNA addition and 20 minute incubation at 30\u00b0C. Transformants were selected on Columbia Agar supplemented with 5% horse blood and appropriate antibiotics. For the transformation efficiency assays, cells were transformed with 100 ng of a DNA cassette, amplified from S. pneumoniae R304 genomic DNA and containing the streptomycin resistance gene str41. Bacteria were plated in the presence and absence of streptomycin (100 \u03bcg/ml) and incubated at 37\u00b0C overnight before colony counting.An late DNA  and forwS. pneumoniae culture grown in LB to OD600 = 0.3 or 4L of E. coli culture grown to OD600 = 0.6 were pelleted by centrifugation (20 min at 5000 g) and resuspended in 6 ml of cold TBS, vortexed briefly and centrifuged to remove the bulk of intact cells and debris (10 min at 12000 g followed by 15 min at 50000 g). Triton x-100 was added to the supernatant at final concentration of 0.25%. Following 30 minute agitation for solubilization of remaining membrane fragments, the samples were filtered through a 0.45 \u03bcm cellulose acetate filter (Corning) and centrifuged for 1h at 125000 g for spirosome pelleting. After careful removal of the supernatant, the pellet was resuspended in 50 \u03bcl TBS, re-filtered and loaded on a Superose 6 3.2/300 size exclusion column . Spirosome enriched fractions were found to elute with the void volume. Sample preparation for electron microscopy was performed as above.All steps of the purification protocol were performed at 4\u00b0C. 8L of Streptococcus pneumoniae (strain ATCC BAA-255 / R6) (Taxonomy 171101\u20131947 proteins) or Escherichia coli (strain K12 / MC4100 / BW2952) (Taxonomy 595496\u20134043 proteins) database. A false-discovery rate of 1% was used for both peptide and protein identification. Reverse and contaminant proteins were excluded and only proteins identified with a minimum of 2 peptides were considered.Trypsin digestion was performed as described previously  and the S. pneumoniae spirosomes  and 555 particles for the E. coli spirosomes . Normalization, centering, multi-reference alignment, multi-statistical analysis, and classification (15\u201340 particles per class) were done in IMAGIC-4D . IMAGIC-4D was also used for generation of two-dimensional reprojections of the T2SS pilus and the G. thermoglucosidasius spirosome.Spirosomes and transformation pili were visualized by EM as above at nominal magnifications of 49000 and 68000, respectively. The contrast transfer function parameters were assessed using CTFFIND3 , and theS.pneumoniae was cloned in-frame in a pET21a vector for heterologous expression of C-terminally hexahistidine-tagged protein in E. coli. Briefly, the AdhES.pneumoniae open reading frame was PCR-amplified from S. pneumoniae R1501 genomic DNA using forward and reverse primers 5\u2019-CAT ATG AAA GCT ATG GAG GAA AAT ATG GCT G-3\u2019 and 5\u2019-GCG GCC GCT TTA CGG CGT CCT GGT CTT TCT TTG-3\u2019, respectively. The pET21a vector was pcr-amplified using forward and reverse primers 5\u2019-GGA CGC CGT AAA GCG GCC GCA CTC GAG CAC CAC CAC-3\u2019 and 5\u2019-CAT ATT TTC CTC CAT AGC TTT CAT ATG TAT ATC TCC TTC TTA-3\u2019, respectively. 90 ng of linearized vector DNA were incubated in 1:1 molar ratio with the AdhE pcr product in an In-Fusion cloning reaction (Clontech) and transformed into Top10 cells (Invitrogen). Plasmid DNA was purified from individual clones, verified for AdhE coding region insertion and used for transformation in BL21 (DE3) cells (Invitrogen). For expression, transformed BL21 (DE3) cells were grown under agitation at 37\u00b0C in LB to OD600 = 0.6 and expression was induced with 0.7 mM IPTG for 2h. Cells were pelleted by centrifugation (4500 g for 20 min), resuspended in TBS supplemented with cOmplete Protease Inhibitor Cocktail (Roche) and disrupted by sonication. Cellular debris were removed by centrifugation (20 000 g for 30 min) and the lysates were incubated with batch Talon metal affinity resin (Clontech) for 30 min at room temperature. The resin was extensively washed  and bound protein was eluted with TBS supplemented with 140 mM Imidazole. For EM observation eluted protein was immediately applied on glow-discharged continuous carbon grids, stained, and imaged as above.The coding sequence for AdhEadhE gene was constructed. Briefly, the adhE gene was PCR-amplified using S. pneumoniae R1501 genomic DNA as template and primer pair 5\u2019-GAG GAA GAA ACC ATG TTG AAA GCT ATG GAG GAA AAT ATG GCT GAT AAA AAA AC-3\u2019 and 5\u2019-AAA ATC AAA CGG ATC TTA CTT GTC ATC GTC ATC CTT GTA ATC TTT ACG GCG TCC TGG TCT TTC TTT G-3\u2019, the latter designed to add a C-terminal FLAG tag to the encoded protein. In parallel, pCEPx vector DNA [adhE-FLAG pcr product in an In-Fusion cloning reaction (Clontech) and transformed into Top10 E. coli cells (Invitrogen). Plasmid DNA was purified from individual clones, verified for AdhE-FLAG coding region insertion, and transformed into competence-induced R1501 cells, followed by selection with kanamycin (Kan). The resulting SO007 strain was sequence-verified for the pCEPx-derived adhE-FLAG\u2013KanR cassette recombination [600 = 0.15. CSP-induced and non-induced cells were pelleted by centrifugation and resuspended in TBS by brief vortexing in the presence of millimeter-sized glass beads for increased cell lysis. Cells were pelleted again, and the supernatants were incubated with anti-FLAG M2 affinity resin (Sigma-Aldrich A2220) for 1h at RT and under agitation. After washing with TBS, the resin-bound fraction was eluted by the addition of 100 \u03bcg/mL 3X FLAG peptide (Sigma Aldrich F4799) and mixing for additional 15 min at 4\u00b0C. The samples were then subjected to SDS-PAGE and EM analyses.For AdhE spirosome pull-down, a strain carrying an additional competence-inducible FLAG-tagged ectopic copy of the ctor DNA  was digebination  and cultS. pneumoniae was incubated with 50 mM KCl, 0.5 mM DTT, 10 mM Tris-HCl pH 7.5, 2 mM magnesium acetate, and 2 mM ATP-\u03b3-S for 15 minutes at 37\u00b0C. RecA nucleofilament formation was induced by the addition of a 54-nucleotide-long single-stranded DNA fragment or single-stranded M13mp18 DNA (New England Biolabs) at nucleotide:RecA monomer ratio of 3:1. After additional 15 minutes at 37\u00b0C, the samples were prepared for EM observation as above.2.5 \u03bcM purified RecAS1 Fig(TIF)Click here for additional data file.S2 Fig(TIF)Click here for additional data file.S3 Fig(A) Western blot detection of RecA release in the medium of competence-induced S. pneumoniae cells. (B) Representative class average of S. pneumoniae spirosomes from culture supernatant compared to the reprojected nucleofilament structure of RecA homolog hDmc1 [(C)In vitro reconstituted RecAS. pneumoniae\u2014ssDNA nucleofilament (left) compared to a spirosome from culture supernatant (right). Scale bars 10 nm. (D) Unabolished spirosome release in \u0394recA S. pneumoniae culture.og hDmc1 . (C)In (TIF)Click here for additional data file.S1 Table(DOCX)Click here for additional data file.S2 Table(DOCX)Click here for additional data file.S3 Table(DOCX)Click here for additional data file."}
+{"text": "In this work, we show that together they form a predictive model that not only improves the predictive force but also decreases bias. This resulted in a corrected classification rate of over 0.81, as well as higher sensitivity and specificity rates for the models. In addition, separation and good models were also achieved for disease categories such as antineoplastic compounds and nervous system diseases, among others. Such models can be used to guide decision on the feature landscape of compounds and their likeness to either drugs or other characteristics, such as specific or multiple disease-category(ies) or organ(s) of action of a molecule.Data mining approaches can uncover underlying patterns in chemical and pharmacological property space decisive for drug discovery and development. Two of the most common approaches are visualization and machine learning methods. Visualization methods use dimensionality reduction techniques in order to reduce multi-dimension data into 2D or 3D representations with a minimal loss of information. Machine learning attempts to find correlations between specific activities or classifications for a set of compounds and their features by means of recurring mathematical models. Both models take advantage of the different and deep relationships that can exist between features of compounds, and helpfully provide classification of compounds based on such features or in case of visualization methods uncover underlying patterns in the feature space. Drug-likeness has been studied from several viewpoints, but here we provide the first implementation in chemoinformatics of the t-Distributed Stochastic Neighbor Embedding (t-SNE) method for the visualization and the representation of chemical space, and the use of different machine learning methods separately and together to form a new ensemble learning method called AL Boost. The models obtained from AL Boost synergistically combine decision tree, random forests (RF), support vector machine (SVM), artificial neural network (ANN),  An important task in drug design is to guide the synthesis, purchase, and testing of compounds based on their predicted properties. Proper prediction of properties can save time and resources, but also generate compounds not available beforehand. There are several methods to compare a real or virtual compound to known collection of compounds, from topological similarity, fingerprints, molecular features, among others   with several targets, such as is the case seen in clinic-approved kinase inhibitors, while at the same time avoiding off- or anti-targets that may be responsible for side-effects  method for the visualization and the representation of chemical space is implemented for the first time, and the use of different machine learning methods from decision tree, random forests (RF), support vector machine (SVM), artificial neural network (ANN), k-nearest neighbors (k-NN), and logistic regression models, separately and together, to form a new ensemble learning method called AL Boost for separation of drugs and nondrugs. Good models can also be achieved for disease categories such as antineoplastic compounds, cardiovascular system drugs, and nervous system diseases.The full data set contains 762 compounds; compounds were classified into two classes: drug (366 compounds) and non-drug (396 compounds). The compounds were obtained from previous work ; Wiener index; molecular surface area (MSA); polar surface area (PSA); apolar surface area (apolarSA); hydrogen bond donor count; hydrogen bond acceptor count; rotatable bond count; atom count; hydrogen count; number of heavy atoms (NHA); molecular polarizability; aliphatic ring count; aromatic ring count; aromatic atom count; Balaban index; Harary index; bond count; hyperWiener index; Platt index; Randic index; ring count; Szeged index; Wiener polarity; and the ligand efficiencies  Data visualization using the t-SNE method; (2) Classification models, which starts by dividing the data into training and test sets, followed by model generation with seven classification methods and model validation.The t-Distributed Stochastic Neighbor Embedding (t-SNE)  divergence, i.e., how one probability distribution diverges from a second expected probability distribution) between a Gaussian distribution in the high-dimensional space and a In order to evaluate the ability of the low dimensional representation to preserve the high-dimensional data and structure, we used the trust measure , and a test set . Similar proportions (20%) of drug (73 compounds) and non-drug (79 compounds) compounds were selected for the test sets by applying independent selection procedures of a representativeness function  and logistic regression (LR), and one newly boosting method named AL Boost, were used to build the classification models. In each case, a classification model was built using the training set and subsequently used to predict the activities (drug status) of the test set compounds for validation. The six models were generated with algorithms implemented in the WEKA version 3.9.1 , support vector machine (SVM), artificial neural network (ANN), The decision tree algorithm Quinlan,  operatesRandom forests (RF) Breiman, , as deveSupport vector machine (SVM) Vapnik,  is an alArtificial neural network (ANN) Hassoun,  is a nonk-Nearest Neighbor (k-NN)   together into one predictive model in order to improve the predictive force and decrease the bias. This method takes the predictions of each classification (learners) and combines them using a weighted majority voting function to determine the prediction of each compound. Each learner is assigned a weight according to its corrected classification rate error, given that poor learners get lower weights. For each compound, two functions are calculated as follows:AL Boost: is a new chemoinformatics ensemble learning classification method which combines all the models obtained in this work  of learner i, and \u03b4i is 1 if the learner is predicted as active class , or 0 if predicted as inactive class , for Equation (2).where i is 1 if the learner is predicted as inactive class  or 0 if it is predicted as active class .For Equation (3), \u03b4The majority vote between Equations (2) and (3) determines the prediction for the compound.P) of a compound with certain features belonging to either class are computed, and that compound is assigned to the class for which the highest P is obtained.The last classification method detailed in this paper is Na\u00efve Bayesian classifiers. This method was used in a previous publication , accuracy, Matthews correlation coefficient (MCC), sensitivity, specificity, and the variance between the sensitivity and the specificity (Equations 5\u201310), where sensitivity is the percentage of truly active  compounds being predicted from the model (Equation 8), and specificity is the percentage of truly inactive  compounds being predicted from the model (Equation 9).TN and TP represent the number of true negative  and true positive  predictions, respectively. NN and NP represent the total number of the two activity classes, and FN and FP represent the number of false negative and false positive predictions, respectively. \u03bc represents the mean of the sensitivity and specificity.where vs. non-drugs, but drugs of one DC against another DC. In this work, we focus on the three largest DCs, namely cardiovascular, anti-neoplastic, and nervous systems. These three groups were evaluated against each other preforming three sub data sets Cardiovascular drugs vs. Anti-neoplastic agents, Cardiovascular drugs vs. Nervous system, and Anti-neoplastic agents vs. Nervous system. The same data mining workflow as before was applied. The number of compounds and the number of training and test sets (similar procedure and proportions as in the drug/non-drug database) for each DC are presented in Table Further in the analysis of the drug/non-drug database, the drugs in the data set were characterized into their different anatomic therapeutical classifications, also called disease or organ category (DC). Here the comparison was not drugs The properties of the compounds include widely used metrics such as size, weight, polarity, as well as topological indices, and ligand efficiencies. An important consideration for the data set construction was the curation of binding free energies of similar magnitude between drugs and non-drugs (bioactive compounds). Ligand efficiencies can normalize the binding energy of a compound according to other properties of a compound, such as size, lipophilicity, etc., and have a pragmatic use in developing series of compounds in order to improve or maintain binding strength while also improving their profile in other dimensions.The first step of the data mining workflow is data visualization; the resulting 35 dimensional data of the drug/non-drug database was reduced into a 3D representation using t-SNE. The resulting trust measure of the low dimensional embedding was found to be 63%. A comparison to the common dimension reduction technique PCA, found that for a 3D representation using PCA, a trust measure of only 42% was obtained. This result indicates a good preservation of the structure and of the local information of the high dimensional data in the low embedding for the t-SNE. The distribution and the chemical space of the drug/non-drug compounds in the resulting t-SNE 3D space are presented in Figure From Figure These results show that the separation between classes is good, and comparable to those found in other studies . These results show a low bias and a well-balanced model with a variance of 0.01%P, \u0394Gbind_MSA, and Balaban Index were found to be features that separated drug and nondrug in REF . First, we visualize the feature space using t-SNE for each sub dataset. The resulting 3D representation of Anti-Neoplastic-Nervous system, Anti-Neoplastic-Cardiovascular, and Cardiovascular-Nervous system can be seen in Figures Figure Cardiovascular drugs were also majorly separated from cancer drugs Figure , locatedThis separation between groups was not the case for the Cardiovascular vs. Nervous system drug plots, since both groups are very similar, perhaps only a cluster of cardiovascular drugs can be seen on the middle right.7, respectively.Having visualized the data, the next step is to build classification models using the six classification methods and the ensemble learning AL Boost. The results for the Anti-Neoplastic vs. Nervous system, Anti-neoplastic vs. Cardiovascular, and Cardiovascular vs. Nervous System are presented in Tables 2 and 4.73%2 on the training and test set, respectively. The accuracy for the AL Boost method was high, 0.91 for the training set, and 0.96 for the test set. These values are better when compared to those obtained previously using na\u00efve Bayesian classifiers for the same data sets, 0.88 for training set, and 0.90 for the test set  with an average CCR of 0.69 and 0.80 for the training set and test set, respectively. While the average CCR results for the four models of the AL Boost are 0.74 and 0.82 for the training set and test set, respectively. An independent sample t-test was performed among the individual CCR models results and the AL Boost CCR results which found no statically significant difference for the training set and not for the test set results. In summary, the average results for the AL Boost were found to overcome the average results for the individual classification models but weren't found to be significantly higher.Summary of the classification results for the four databases presented here : a total of 24 results obtained for the individual classification models  for prediction.To the best of our knowledge, this is the first example of the usage of t-SNE for the visualization and representation of the chemical space and the use of different machine learning methods separately and together to form a new ensemble learning method called AL Boost. Clear and good separations were obtained with the dimension reduction and machine learning approaches to distinguish drugs and non-drugs, as well as three major classes of drug compounds. The ability to use such tools for the identification of interesting trends, opens up new opportunities for understanding the factors affecting drugs performances and for designing new drugs. Considerations such as drug likeness and drug target, organ, and/or system class are thus made possible, providing another route for designing specificity into ligands and drugs. Clearly, this research should be conducted in close collaboration with experts in the medicinal/pharmaceutical chemistry field to both provide a chemistry-based explanation to the observed trends, as well as to capitalize on the results. We expect that the tools and methods implemented in this work will further be used in medicinal chemistry and drug design research.AY applied the t-SNE and models and AL Boost algorithms, analyzed results, and wrote the manuscript. RG revised the manuscript. AG-S designed the research project, collected and curated the data, analyzed the results, and wrote the manuscript.The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest."}
+{"text": "We present a novel quantitative approach to assess cardiac structure and function by extending the classical traction force microscopy technique to tissue-level preparations. Using this system, we investigated the relationship between contractile proficiency and metabolism in neonate rat ventricular myocytes (NRVM) cultured on gels with stiffness mimicking soft immature (1 kPa), normal healthy (13 kPa), and stiff diseased (90 kPa) cardiac microenvironments. We found that tissues engineered on the softest gels generated the least amount of stress and had the smallest work output. Conversely, cardiomyocytes in tissues engineered on healthy- and disease-mimicking gels generated significantly higher stresses, with the maximal contractile work measured in NRVM engineered on gels of normal stiffness. Interestingly, although tissues on soft gels exhibited poor stress generation and work production, their basal metabolic respiration rate was significantly more elevated than in other groups, suggesting a highly ineffective coupling between energy production and contractile work output. Our novel platform can thus be utilized to quantitatively assess the mechanotransduction pathways that initiate tissue-level structural and functional remodeling in response to substrate stiffness.Cardiac tissue development and pathology have been shown to depend sensitively on microenvironmental mechanical factors, such as extracellular matrix stiffness, in both  Alternatively, the spatial complexity of the heart musculature may be reconstructed in-vitro using cardiac microphysiological systems (MPS)[in-vitro remains limited.In the heart, striated cardiomyocytes seamlessly merge into two-dimensional layers that wrap around three-dimensional atria and ventricles. When single myocytes contract, the muscular layers compress and twist the heart chambers pumping blood into the body ,2. This ems (MPS),4. In thems (MPS)\u20139. Insteems (MPS)\u201314. UnfoAdditionally, the coupling of MPS-based structural-functional characterizations with metabolic assessments has remained challenging. We previously utilized traction force microscopy (TFM) to correlate contractile structure and function of isolated cardiomyocytes , as wellHere, we present a mini tissue (mTissue) TFM platform to measure tractional forces in engineered cardiac tissues and asked whether changes in substrate stiffness affect energy production and utilization in primary cardiomyocytes. To achieve this, we microcontact printed mm-scale fibronectin islands on polyacrylamide (PA) gels with embedded fluorescent beads. We prepared the gels to mimic the stiffness of fetal (~1 kPa), adult physiological (~13 kPa) and adult pathological (~90 kPa) myocardium ,8. We thin-vitro, gelatin, alginate, and PDMS have been used, but it is difficult to independently control the mechanical properties of the substrate and the geometry of cells using these materials [i) a connected grid with horizontal and vertical spacing of 1 mm and 0.5 mm, respectively; and ii) isolated diamond-shaped islands  in the gel and used a confocal microscope to image bead displacement immediately below the tissue during several consecutive contraction cycles . From thA number of important phenotypic differences occur during cardiomyocytes maturation, including the expression of different transcription factors, ion channels, and contractile proteins; the appearance of physiologically-relevant structures such as t-tubules; and the progressive assembly of the contractile cytoskeleton . SpecifiFurther, we measured bead displacement in the mini tissue TFM platform and calculated contractile stress and work output in NRVM tissues engineered on soft , panel iHeart failure with preserved ejection fraction, valve disease, diabetes, and even normal aging have all been associated with stiffer myocardium \u201324. Impo2) that can be addressed individually along the diagonal of the field of view of a typical 20x objective. A limitation worth mentioning is that, consistent with our experience with TFM in single cells and cell pairs, stamping of gels with stiffness less than five kPa remains difficult. Therefore, a better stamping technique might be needed to obtain the larger sample sizes needed to tease apart smaller contractile differences in cells seeded on substrates with stiffness values in the fetal range .We presented an alternative quantitative method to assess contractile structure and function at the tissue level in cardiac preparations. Our platform offers important advantages over existing alternatives. First, our technique makes it possible to use the same assessment technique, namely traction force microscopy, to study the contractile properties of cardiomyocytes in preparations ranging from single cells, to cell-pairs, to tissues , 7, 8. TAs a proof-of-concept study, we combined our mTissue TFM platform with an industry-standard high-throughput metabolic flux analyzers to investigate the coupling between mechanotransduction, contractility, and metabolism. We speculate  that myoIn conclusion, the tissue-level assay presented here completes a consistent suite of TFM-based assays that can enable thorough multi-scale studies of the coupling between metabolism, mechanotransduction, and contractility in primary and stem cell-derived myocytes \u20138. Two r2 in Medium 199 supplemented with 10% heat-inactivated fetal bovine serum , 10 mM HEPES, 0.1 mM MEM non-essential amino acids, 20 mM glucose, 2 mM L-glutamine, 1.5 \u03bcM vitamin B-12, and 50 U/mL penicillin for 1 day. The serum concentration was reduced to 2% after 24 hr to minimize proliferation of the small pool of fibroblast present in the culture. Cells were cultured for four days before conducting the experiments.All animal procedures conducted in this study were approved by the Harvard University Animal Care and Use Committee. Cardiac myocytes were extracted from neonatal rat ventricles using a previously described method , 8. LeftPolyacrylamide gel substrates were fabricated and characterized as previously described in details , 8. SpecPhoto- and soft-lithography were conducted as previously described in details , 8, 10. 2, 5 mM glucose, 5 mM HEPES, 1 mM MgCl2, 5.4 mM KCl, 135 mM NaCl, 0.33 mM NaH2PO4, pH 7.4) were imaged on an environmental controlled line scanning confocal microscope (Zeiss LSM510) using a 40X air objective (with a 0.5x zoom) or a 20x objective to ensure the full diamond-shaped tissue fit within the diagonal of the field of view. Movies of contracting myocytes and bead displacement were imaged at 33 Hz with both brightfield, and 488 laser excitation and recordings were performed over multiple [Traction force microscopy experiments were conducted as previously described , 8, 10. multiple \u201310 contrThe methods used to acquire displacement and traction stress vectors from images of bead displacement have been previously described , 18. BriImage analysis and processing were performed as previously described . After t2 incubator. After two hours, 500 mL of media was added to each well and media exchanges were performed as previously described above. After four days in culture, culture media was replaced with XF Assay Medium  supplemented with 20 mM glucose and plates were incubated at a 37 C for 1 h. The proprietary hydrated cartridge was loaded with 2 mM oligomycin, 1 mM carbonyl cyanide-4-(trifluoromethoxy) phenylhydrazone (FCCP), and 1 mM antimycin A and 1 mM rotenone from the XF Cell Mito Stress Test Kit . The cartridge and cell plate were then inserted into the Seahorse XFe 24 Extracellular Flux Analyzer , which made three measurements of baseline oxygen consumption rate (OCR) and three OCR measurement after injection of each of the drugs listed above. Data from multiple wells across three different neonatal rat ventricular myocyte harvest cycles were collected and used for analysis.Cellular metabolism was measured using a Seahorse Bioscience XFe 24 Extracellular Flux Analyzer . Polyacrylamide gels were pipetted into the wells (10 mL/well) of a standard XF24 microplate  and allowed to crosslink before rinsing with PBS. Plates were stored at 4 \u00b0C until cell seeding with neonatal rat ventricular myocytes (100 000 cells/100 mL/well). After seeding, plates were left in the laminar flow hood for 30 min to minimize edge effects before transfer to a 37 \u00b0C, 5% COp-value smaller than 0.05.Through the text, our results are presented as mean \u00b1 standard error of the mean (s.e.m.). After verifying that the data points were normally distributed (Shapiro-Wilkinson test), statistical comparisons were conducted among the various group using 1-way ANOVA test followed by Tukey pairwise comparisons. All analyses were conducted using SigmaPlot . The symbol * was used to denote statistically significant difference characterized by a S1 Checklist(PDF)Click here for additional data file."}
+{"text": "We prove haptic rendering plausibility on a very high number of test paths. Important errors are below just noticeable differences for the hand-arm system.This work presents an evaluation study using a force feedback evaluation framework for a novel direct needle force volume rendering concept in the context of liver puncture simulation. PTC/PTCD puncture interventions targeting the bile ducts have been selected to illustrate this concept. The haptic algorithms of the simulator system are based on (1) partially segmented patient image data and (2) a non-linear spring model effective at organ borders. The primary aim is to quantitatively evaluate force errors caused by our patient modeling approach, in comparison to haptic force output obtained from using gold-standard, completely manually-segmented data. The evaluation of the force algorithms compared to a force output from fully manually segmented gold-standard patient models, yields a low mean of 0.12\u2009N root mean squared force error and up to 1.6\u2009N for systematic maximum absolute errors. Force errors were evaluated on 31,222 preplanned test paths from 10 patients. Only twelve percent of the emitted forces along these paths were affected by errors. This is the first study evaluating haptic algorithms with deformable virtual patients  A major part of such simulation systems, namely the force feedback during needle insertion, has been surveyed6. The downside of most systems is their inability to easily simulate an intervention on new patient data (patient-specific) with little manual segmentation preparation time and effort, for which an overview was recently given by ref. 8. In addition, these simulators usually require a fully segmented 3D patient, which leads to high segmentation efforts and avoids the use of VR simulators in a clinical setting. This fact and missing patient motion dynamics are the major drawback of state of the art simulators. Our works using 3D and 4D CT image data10 remedy this situation.Virtual reality (VR) surgery simulation with needle insertion into blood vessels12. Cholestasis can be caused by i.e. gallstones or tumors in the common bile duct (CHD). To reach the target , the needle has to be inserted between the ribs  and into the liver. Modern intervention techniques use an ultrasound (US) probe with an attached needle guide , tissue deformation and non-axial forces16 are also relevant for realistic, real-time, visuo-haptic simulations. However, these topics are beyond the scope of this work.Regarding haptics, needle insertion procedure simulations must mimic stiffness, cutting and friction forces at the needle tip and shaftin vitro/vivo gold-standard force measurements, we use reference forces based on previously evaluated fully segmented patient data (in silico)13. Qualitatively, the haptic parameters determining the force output using our new system regarding liver structures, were tuned by two medical experts experienced in PTCD liver punctures9. Here, we present the quantitative haptics evaluation counterpart. We think the design of the presented evaluation experiment is a practicable way to bridge the gap between qualitative and still missing quantitative evaluations of virtual haptic simulations.Currently, haptic rendering in these visuo-haptic simulations raises the need for evaluation methods and detailed studies of the force output at the handle regarding needle insertion Fig.\u00a0. A preliThe aim of this study is to compare axial force errors of simulated needle insertion force feedback of a full patient segmentation, against a partial segmentation based force calculation algorithm. We also characterize the differences in terms of the magnitude and location of the errors found. The errors observed here are the quantitative marks of our virtual training simulator based on our virtual patient modeling approach, where only certain key structures need reviewed segmentations.The article is organized as follows: First, quantitative results using the evaluation methods on page 12 of our haptic sub-system for PTC(D) are given in section \u201cResults\u201d on the current page and discussed on the following page. The methods on page 6 start with an overview of AcusVR-4D and its hardware and software components. Then, the concept of our virtual patient modeling is summarized on page 7. Details of our method for the haptic simulation of axial forces during needle insertion, are presented in the following section dealing with haptic rendering on page 9. The evaluation methods section on page 12, shows our general framework for evaluation and interpretation of our direct needle force rendering quality.We applied our methods to 10 patient (#1-#10) clinical CT data sets and compared the new haptics method using \u201cpartial segmentation masks augmented by our patient-specific transfer functions,\u201d against the haptic algorithm based on gold-standard fully manually-segmented data.18 vs. manually driven full volume segmentation, is the significantly shorter time frame (<10x) needed to provide a virtual patient model. This is to a large extent achieved by using the threshold-based (t0 \u2026 t2) transfer functions dependent on the voxel position19. The transfer functions cover the voluminous, but less relevant and easily segmentable tissues, such as skin, fat, bone and air cavities inside the body. In this study, we introduce and report (1) segmentation errors using new local metrics, i.e. well-known measures are evaluated only on the planned puncture paths, rather than the full volume; (2) we show the axial force errors caused by these segmentation errors.The benefit of our patient modelingRegarding haptics, this is the first study in which a direct haptic volume rendering method is tested on 10 patients and 31,222 test paths (i.e. ca. 3000 paths per patient). Exemplary test path planning results can be seen in Fig.\u00a0We report the segmentation results, shown in Figs\u00a0N and MAE errors less than 1.0\u2009N, except for some displaced outliers around 1.5\u2009N. Systematic maximal force error medians of 0.7\u2009N and rare sporadic peak errors, around 1.4\u2009N occur in some patients  force threshold, elaborated on page 13, of 0.145\u2009N Fig.\u00a0.N on average, can be observed in terms of MAE. These and the outliers of ca. 1.4\u2009N prominent in some patients for the change of segmentation experiment, are clarified in the discussion. In total, we achieve on average 88% of exactly identical emitted forces  are below just noticeable thresholds, except for some (HSD) outliers of the liver. While small, almost imperceptible, RMS force errors occur, a systematic bias of about 0.7\u20099 for needle insertion simulation, has been evaluated quantitatively in terms of haptic rendering plausibility, with positive results for the influence of usual segmentation errors. The conducted \u201cchange of segmentation model\u201d experiment  in absence of in vivo and in vitro reference measurement data, which are also difficult to supply. Needle steering can not be assessed by axial forces and deformations24 alone, and non-axial needle-tissue interaction forces are found along the entire embedded needle length. However, in our situation  the forces from breathing motion are mainly directed orthogonally to the needle insertion direction, so that they do not contribute saliently during needle advance. Thus, regarding axial force we evaluate the relevant haptic aspect of the simulation compared to gold-standard virtual patients and reference force output approved by medical experts.Our qualitatively accepted VR system, AcusVR-4Dent Figs\u00a0 and 7 vaN at the skin surface is not severe in our context, as the needle enters the body through a small ski n incision made by the surgeon.With regards to skin, soft-tissue and bile segmentation, the spatial errors  are small. We often observed that the manual skin segmentation is detected slightly later on a needle path than the skin found by the threshold. The resulting systematic maximum force error of 0.7\u2009N in the MAE metric can be located, explained and well justified by the following: (1) at the skin a maximum 0.7\u2009N difference is calculated and (2) immediately above the fascial layer, a somewhat differently classified voxel (group) can cause phase 1 (Pre-X) to begin from a different force level resulting in misaligned puncture peaks (cf. Sec. on page 9). This results in ca. 1.6\u2009N maximal error. Thus, for the change of the segmentation model, errors are caused by slight differences in the manual expert segmentations and the segmentations resulting from our patient modeling approach. As long as the sequence of events is guaranteed to be the same, these outliers are haptically irrelevant. The slight spatial difference of haptic events can hardly be felt by the user comparing two independent puncture attempts along the same path. For example, the slightly displaced detection of the skin or differently detected tissues around the fascial layer, causes out of sync force emission with potentially high MAE errors (max. 1.6\u2009N) in the pre-puncture phase of the haptic algorithm near to the fascial layer (p. 10). The segmentation of the surrounding tissue of the fascial layers can be slightly different, causing misaligned force incline start levels of the pre-puncture phase on the needle trajectory. Again, more important is the correct sequence of events and accurately reaching the puncture goal. This is guaranteed by low segmentation errors and operator reviewed segmentation of the structures, i.e. especially the bile ducts. This argument is supported by currently published, experimentally determined, spatial JNDs for the hand-arm system26. The elaborated JND thresholds are undercut despite some outliers at the liver fringe in the outlier HSD metric  or in vitro (cadaver) experiments. For our haptics research, we only use already available CT images acquired from routine clinical data. We are grateful for the guiding work of other groups producing axial force measurements with real tissues28.Our algorithm for axial force rendering and the haptic parameters for deformable virtual patients, have not been published in this level of detail and in this scale of a study with a high number of test paths from 10 test patients before. In addition, our evaluation methodology has been clearly refined, e.g. using new per test path spatial error metrics and the incorporation of spatial and force JNDs. We thoroughly show in this study set-up, using 31,222 test paths, that the generated force output using the partially segmented patient image data is robust. It is shown by example that the force evaluation framework is a valid means to prove force output of haptic needle insertion simulations, without ethics approval and the experimental hassle of specimen to image registration during needle insertion. We completely circumvent 18 and better force rendering as we propose a non-linear incline at tissue borders (Pre-X). Other proxy-based methods use linear force inclines for direct haptic volume rendering31.Finally, with regards to the potential time savings in patient modeling important in clinical settings, we can fully support the use the of partially segmented data combined with the non-linear spring force output. This method offers faster patient preparation by a factor of 129. The simulation concept could easily be transfered to other liver site intervention fields in addition to PTC or PTCD, simply by replacing the target structures (with e.g. tumors).The system setup, experimental design, observed haptic errors and interpretation lines could be helpful for other haptic algorithm developersOur extended framework and study showed, that our methods, i.e. the use of partially segmented patient image data and haptic rendering techniques featuring a non-linear spring model, are usable for virtual needle insertion simulation. The evaluated system allows the user to experience and become familiar with the visual presentation and needle insertion forces during liver needle punctures.Furthermore, our evaluation of surgical needle insertion simulator haptics identifies, quantifies, and interprets errors, which is important for algorithm development.26 and very similar in force amplitude to the puncture event using gold-standard label data. The force errors are also below the force JND threshold adapted to our context27. Bone is rendered impenetrable and would cause our high force haptic device to exert 22\u2009N. The encountered MAE force outliers in this study are clearly unrelated to puncturing false-positive bone voxels, in which case we would see 22\u2009N MAE errors. Our customizable non-linear spring model gives the user a more elastic feeling of tissue borders and thus is more realistic. It can be easily adapted to in vivo/vitro measured realistic force curves6 by model fitting.In summary, the force errors of the presented force rendering algorithms using partially segmented patient data are small. In 12% of the path positions the detected errors are haptically irrelevant for the user experience. This is due to the fact that the puncture incident mismatch is mostly below JND-thresholds in terms of insertion depthFrom a developer perspective, our evaluation framework and interpretation cues help to sort out very sensitively noticeable errors, to improve virtual patient models and haptic algorithms.in vivo force measurements15. In future studies, regarding axial force curve shape, we would like to investigate refined force feedback algorithms, taking into account real force measurement curves and puncture events due to different bevel tips. This way, our first haptic rendering phase could be sub-divided in two subphases: (a) initial puncture and (b) transition from tip bevel front to shaft. In reality, there are more haptic micro-events overlayed to our 4-phase curve to be included. These effects could be modeled as superposed micro processes as well. For a more granular feeling of the tissue, the CT values could be used to infer material characteristics for micro processes. The currently constant phase 3 would be more realistically modelled by a flat, non-linear incline depending on the insertion depth.Our work on force output modeling is guided by comprehensive surveys featuring 32, work for which haptics have to be continued and evaluated accordingly. Dealing with new patient image data could be improved by researching new real-time voxel classification methods at the needle tip that for example, reliably detect the liver and its vessels. In this case, some currently necessary semi-automatic segmentation steps could become obsolete18. This could be achieved using high dimensional feature spaces and random forest classification19.Further work will be in dynamic patient effects. More complex surgical instruments and irregular respiratory motion are currently included into the haptic simulation9 . When a risk structure is struck by the needle, the user is notified by turning the simulation window background red, a successful insertion is indicated by a green background in the main viewport  can be used to assign scores to each training attempt along bookmarked reference paths defined by medical experts, so that the trainee can monitor his improvements during the experience with the virtual patient model.18.Here, we provide background and summarize the time-saving virtual patient modeling approach detailed in ref. Our start point is a fully manually-segmented and reviewed reference patient (CT and label data) to define a general virtual patient model. For fully segmented patients, we can estimate a tissue label using Alg. 1, step 1. Each new virtual patient model then consists of the same parameter attributes inherited from the reference patient model. After the automatic intensity data adaptation, only the segmentation masks for the key structures are segmented and reviewed anew specifically for the new patient model by organ-specific, known, semi-automatic segmentation methods  with cutting force threshold [N], friction force [N] and material stiffness [N/mm] for each label in a fully segmented patient  and bone are modeled. For these large volume tissue classes we determine the intersections  and bile ducts (target) located inside the liver segmentation can be masked out and are ready to be addressed. We use a vessel highlighting and selection method based on multi-scale vesselness filtering21 and auto-seeded region growing followed by morphological post-processing38.The liver and hepatic target structures are segmented by organ-specific approaches accompanied by typical segmentation errors. We use a multi-atlas and GraphCut segmentation concept to address the liverThe following patient modeling summary items consist of two paragraphs each: First, we describe the concept for the reference patient model based on a reference patient. Second, the step for its generalization to new patient models is briefly presentedFinally, during simulation we can estimate a label and hence the haptic parameters and force output for every voxel as shown in Alg. 1 (steps 1 and 2) in real time (\u22651000\u2009Hz).10.For the axial forces at the needle tool handle, we use a proxy-based computation divided into four phases: (1) pre-puncture, (2) post-puncture, (3) pass and (4) transition Fig.\u00a0. In the t16. Regarding tissue deformation by needle interaction we define a deformation (and force) vector d\u2009=\u2009|p\u2009\u2212\u2009x| between two points as follows: First, the needle tip x lies at the same tissue related position in the undeformed and deformed spaces. Second, in the deformed state we introduce a proxy position p to correspond to the needle tip 16. At the same time it is used as a force vector for a spring mounted between x and p. We determine the haptic parameters at the proxy p as we follow our assumption that the spatial relation of tip and proxy defines the deformation of the tissue9. Thus, retrieving the parameters at the proxy position in the undeformed image data (x), is equivalent to obtaining the parameters in a deformed state of the image (p). Our visual deformation algorithms are described elsewhere32. In this paper, the focus lies on the details of the axial force rendering algorithms,which work in the undeformed state of the image.The deformation of the tissue caused by instruments or breathing, is described by a smooth (inverted) deformation field d\u2009=\u2009|d| according to Hooke\u2019s law, the simplest spring model has a linear characteristic when tip and proxy diverge at a tissue border. Another variant for computation of needle forces is a non-linear spring force. Facing organ surfaces we use a second degree polynomial15:d being the displacement from the undeformed surface. With Eq.  as proposed in our previous work13. Congruent to this spring and to preserve the main haptic characteristics, the start force level a0, the pre-puncture phase design parameter a1\u2009\u2208\u2009 and consequently a2\u2009=\u2009k\u2009\u00b7\u2009(k\u2009\u2212\u2009a1)/|TN\u2009\u2212\u2009a0| yield a non-linear spring, which punctures the surface at the same displacement as the linear spring to achieve similar behavior to our evaluated reference system13. However, when the underlying gold standard and our segmentation differ only in detail, certain force errors are caused , R(p), k(p)) at every proxy position p in the deformed patient data.Using Table\u00a0Our force output algorithm  is already located in the internal organ structures behind the organ membrane.In this pre-puncture phase, by manipulation of the position of the tip behind the tissue border, 3D-forces are exerted. Simulation of the resistance of tissue surfaces to needle puncture is achieved by fixing the proxy pph1 and jumps into the inner organ structures towards x (R\u2009\u2264\u2009TN):We decided to model this phase such that after the cut instance, the proxy is released from being held back at R maintained in phase 3. This provides the user with a salient feeling of cutting the membrane of an organ.As the proxy is a virtual object only, this motivates the quick decay of the output force to the force sustain level k(p) [N/mm] and the friction force R(p) [N] (threshold) to define a maximum length for a spring moving behind the tip x that mimics advancing the needle through a viscous material:Advancing continuously inside an organ the modeling of viscosity comes into play. Here, we use the stiffness parameter In contrast to the membrane puncturing, a standard linear Hook formulation is used to render the forces of the moving spring:k as a function with additional dependence on a displacement parameter, however, this is left to a future work. The spring movement is implemented by moving the proxy pph3, if the following condition is violated: |fph3|\u2009\u2265\u2009R or rather |pph3\u2009\u2212\u2009x|\u2009\u2265\u2009lmax:max at maximum. This way when advancing or retracting the needle, the proxy moves in constant distance behind or before the tip, resulting in a ductile feeling.The force emission could be improved by modelling R from phase 3 is greater than the new structure\u2019s shell force threshold TN, the surface is cut immediately and we skip phase 1 of the new material. This results in a decline of the force as no cutting forces are due at this instant. This case is implemented as force drop to fph2 (phase 2). If the needle tip meets a harder tissue (TN\u2009>\u2009R), we start with phase 1 of the new material resulting in a force incline. The trivial but uncommon case in our scenario is exiting the body with a force decline towards 0 (piercing).This phase serves as a link between cycles or exit, depending on the haptic parameters of a newly encountered tissue. Exiting an organ means to encounter a border again. When the force R is the same as the cut force level TN (0.7\u2009N)  Table\u00a0.We establish ground truth on the 10 CT test data sets spanning the lower thorax and upper abdomen. The spacing between the voxels in the data sets is between 0.775\u20130.925\u2009mm in the x and y directions and 0.825\u20131\u2009mm in z the direction. CT images were acquired in portal venous phase. The necessary full volume manual expert segmentations used as gold-standard were carried out by a team of three experts.Trajectory (\u201creference path\u201d) planning specific to the gold-standard virtual patient. This step produces paths in proximity to the usual access area between the 6th and 7th rib on the right side of the patient,Simulated robotic needle steering to accurately follow the trajectories and 1D force signal sampling on these paths using a reference  and a new algorithm ,Structure border lag analysis, force signal comparison and statistical analysis.For axial force output assessment we measure and compare forces along preplanned test paths hitting the target. Instead of curved insertion paths, we use straight paths planned in the undeformed reference space Fig.\u00a0, left. TExtensive quantitative evaluations take place for force output of the haptic algorithm. We use many target (center line of bile ducts) hitting paths from a surgery planning step for quantitative evaluation of force feedback. Automatic needle steering along approximately 3000 paths from each of the ten test patients (\u201creference paths\u201d) yields reproducible force outputs for the algorithms to be compared in ten patients  visibility of a target structure voxel from the skin and (2) needle insertion length (9\u2009cm). Individually rated soft constraints yield a path score in a weighted averaging manner.Visibility checks serve to generate a high number of test paths. Ray casting on the GPU is used for planningC1: The visibility hard constraint dismisses all trajectories that are blocked on their way from the skin to the target through a risk structure such as bones or blood vessels. Failure is indicated by a value of infinity, success by 0.C2: Distance to target. The target must be reached in 9\u2009cm path length. Failure is indicated by a value of infinity, success by 0.C3: The minimal distance to critical structures soft constraint scores a trajectory by calculation of the smallest distance to a risk structure on the path.C4: The target hit soft criterion counts the voxels along the needle shaft. This counting is conducted inside a cut target structure (bile duct) only and tests for a certain number of voxels being visited. A higher number indicates a favorable penetration depth and insertion angle in line with a bile duct.We use the following criteria for candidate paths starting from every skin voxel:N is a normalized average of the criterion scores:The final score for a path C3,4 are normalized to 1. Weights QN\u2009=\u2009\u221e are dismissed right away. For each skin voxel we keep the best path from the candidate set as reference path.The criterion scores QN < 0.4. Also, falsely detected bone voxels from the transfer function classification could occur in very close proximity to the ribs, e.g. due to partial volume effects. These medical and technical arguments motivate the removal of these low score paths from the candidate set , where fine nerves and vessels are located causing pain if struck. Blood vessels should also not be close to the needle. Hence, nearby bone and blood vessel paths are removed from the candidate set by a quality threshold, i.e. To sum up, we test our simulator for successful trainee experience, i.e. starting from the skin paths hit the target with respect to the hard and quality soft constraints. Paths from the skin to the target (bile ducts) colliding with or aligned in close proximity to risk structures are dismissed. Soft constraints are used to score the candidate path set and to reduce it further.Finally, we test our haptics on 10 patients with a total of 31,222 test paths, i.e. ca. 3.000 paths per patient.18 using the same non-linear spring model.The selected paths from ten test patients are now used for force output evaluation. While steering the needle along the paths, two forces are calculated and compared. We compare forces based on the fully manually vs. partially segmented dataUsing about 1,000 force pair samples per planned path for insertion, the worse case for sample spacing of the currently steered path can be given as 0.09\u2009mm, which is sub-voxel resolution. Thus, generous oversampling of \u226510\u00d7 for a full length path of 90\u2009mm (worst case) is used.\u03c3, (2) account for top force outliers higher than 2.7\u2009\u00b7\u2009\u03c3 and (3) use box plots in terms of MAE to better show systematic errors. The analysis of the higher MAE outliers can be important for method investigations during haptic algorithm development. For the evaluation of the segmentation errors caused by out of sync force rendering  and \u201cmaximum absolute error\u201d (MAE) are used to assess the axial force differences from the experiment. We use (1) mean and standard deviation ing Fig.\u00a0 the meanS and a just perceivable relative stimulus change \u0394S27:26. Note, that empirically measured JNDs for distances with the finger span method26 are twice as low as for the upper limb movements25. The upper limb movement is more relevant in our context. A 2\u2009mm lower threshold corresponds to a conservative JND of 8% distance related to an average reference length of 28\u2009mm. This corresponds to the most important sub-distances for our needle to bypass, i.e. the liver to bile duct border and skin to fascia border path segments. The distance of 3\u2009mm corresponds to a JND of 11% distance. This value is justified by ref. 26. Generally, JNDs for decreasing reference measures are higher above average in small scale domains.The so-called Weber fraction given in reference force or distance magnitude % with a perceived reference stimulus 27. Regarding those human force JNDs we relate a hand-arm JND of 18.1% force magnitude  to low (0.5\u2009N) reference forcesN:To further assess the path position fraction where the segmentation errors cause force errors, we also asses the strict measure of the percentage of exactly identical emitted forces for every path In summary, in the conducted experiment the segmentation fundament is varied: For the reference forces we use the full manual expert segmentation, for the test forces the transfer functions augmented by partially segmented data are used. Using these metrics and study design, we mainly aim to evaluate the influence of the segmentation errors caused by our patient modeling strategy on the force rendering in our haptic simulation."}
+{"text": "While testing the antimicrobial activity, Ch-NPs showed the least minimum inhibitory concentration (MIC) and minimum bactericidal concentration (MBC) values exerting eightfold higher bactericidal activity than O3-oil against both Enterococcus faecalis and Streptococcus mutans as well as fourfold higher fungicidal activity against Candida albicans. Antimicrobial synergy test revealed synergism between O3-oil and Ch-NPs against the test pathogens (FIC index \u2264 0.5). Ch-NPs was superior at inhibiting immature single and mixed-species biofilm formations by 97 and 94%, respectively. Both of O3-oil and Ch-NPs had a complete anti-fibroblast adherent effect. The safety pattern results showed that O3-oil was the safest compound, followed by Ch-NPs. The double combination of Ch-NPs and O3-oil reduced the mature viable biofilm on premolars ex vivo model by 6-log reductions, with a fast kill rate, indicating potential use in treating root canals. Therefore, the double combination has the potential to eradicate mature mixed-species biofilms and hence it is potent, novel and safe.This study was conducted to investigate the antimicrobial-biofilm activity of chitosan (Ch-NPs), silver nanoparticles (Ag-NPs), ozonated olive oil (O The primary goal of endodontic therapy is to eradicate microbial infection and promote periapical tissue healing. Endodontic infections are polymicrobial and made up of various microorganisms that differ between failed endodontic cases and primary endodontic infections .Enterococcus faecalis and Streptococcus mutans, and Candida albicans are more common in failed or persistent endodontic infections  containing active oxygen in the form of peroxide ranged between 560\u2013590 mmol-equiv/kg, prepared by introducing olive oil through a device generating ozone  were prepared.Stock solutions (100 mg/ml) of Ag-NPs in sterile distilled water, Ch-NPs in 5% glacial acetic acid (HAC) and OS. mutans ATCC 2419, E. faecalis OG1RF, and C. albicans MTCC 227, were used, which were obtained from the Department of Pharmaceutical Microbiology, Faculty of Pharmacy, Tanta University, Egypt.Freeze-dried reference microorganisms, \u00ae PCS-201-012TM) were obtained from the laboratory of the Tissue Culture Department of the Holding Company for Biological Products and Vaccines (VACSERA), Cairo, Egypt.Human Gingival Fibroblast cells . MIC was defined as the lowest concentration of each medicament that inhibited the microbial growth compared to the untreated control culture. MBC was determined by performing viable count (CFU/mL) following 24 h of incubation at 37\u00b0C and was defined as the lowest medicament concentration that reduced the viable cells by more than 3 log10 steps (>99.9%) compared to the untreated control cultures. Independent assays were performed in triplicates  along the columns. The same concentrations of Ch-NPs are present in the columns which was diluted twofold (from 2.5 to 0.0391 mg/ml) along the rows. The wells were inoculated by the test pathogen at 106 CFU/ml and the plates were incubated at 37\u00b0C for 24 h. For detecting the combined synergy effect, fractional inhibitory concentration (FIC) index was calculated as follows:The antimicrobial activity of the tested root canal disinfectants was examined by determining the minimum inhibitory concentrations (MICs), minimum bactericidal concentrations (MBCs) and minimum fungicidal concentrations (MFCs) against endodontic pathogens using broth microdilution assay. The turbidity of each microbial suspension was adjusted to that of a 0.5 MacFarland standard then diluted in RPMI 1640 to give a final inoculum of 10plicates . The antWhere FIC A = MIC of drug A in the combination/MIC of drug A alone.FIC B = MIC of drug B in combination/MIC of drug B alone.3-oil/Ag-NPs was assessed by the same procedure.The results were interpreted as synergism if the FIC index \u22640.5; additive effect if the FIC index of >0.5 and \u22644; and antagonism if the FIC index >4. The procedure was replicated three times. Similarly, the antimicrobial synergy effect of Ch-NPs/Ag-NPs and O4 cell/ml) on 96-well plates. After 48 h, the cellular cytotoxic effects were quantified using the neutral red assay protocol (50) was calculated for each test medicament.The safety of the test compounds was evaluated on normal human fibroblasts. Briefly, approximately 100 \u03bcl of each of serially diluted compound was incubated with pre-cultured  were considered and inoculated medium without treatment was used as a positive control. After incubation at 37\u00b0C for 24 h, the planktonic cells were removed by aspiration of the spent media. All wells were washed twice using phosphate buffered saline solution (PBS) (pH 7.4) to remove loosely bound microbial cells and media components. Next, 125 \u03bcl of 0.1% crystal violet solution was added to each well to stain biofilm forming cells, incubated for 10 min at room temperature then rinsed three times with distilled water. For the quantitative assay, crystal violet was solubilized by adding 125 \u03bcl of 30% acetic acid to each well and incubated for 10 min at room temperature. The absorbance was measured for both the control and test groups by a plate reader at 550 nm with a reference filter of 570 nm.The effect of the test medicaments on the biofilm biomass was evaluated by crystal violet binding assay . Overnig5 cells/ml then incubated at 37\u00b0C in a 5% CO2 atmosphere until they formed semi-confluent monolayers. Twenty-four hours post-incubation, the exhausted media were replaced with fresh DMEM. Overnight cultures of the test microbes were standardized to a final inoculum of 107 CFU/ml using 0.5 MacFarland standard and confirmed by viable count. Approximately 50 \u03bcl of each standardized microbial cell cultures, pretreated with non-toxic doses of the medicaments, were incubated at 37\u00b0C for 3 h. After incubation, the medium was discarded and the wells were washed three times with PBS to remove the unbound microbial cells. One milliliter of methanol was added to each well for 1 min, then replaced with 4 ml of freshly diluted Giemsa stain (1:10) and incubated for 30 min at room temperature. The stain was discarded, and the fibroblast monolayers were washed sequentially with tap water, acidified water (1 ml concentrated H2SO4 in 1 L of tap water) and tap water again. The wells were examined at 20\u00d7 magnification under a light microscope . The microbial strains were considered adherent if they formed characteristic microcolonies on >40% of the fibroblast cell surface. The data represented at least three trials (Fibroblasts were cultured in Dulbecco\u2019s Modified Eagle\u2019s Medium (DMEM)  supplemented with 10% fetal bovine serum (FBS)  and 1% streptomycin/penicillin in 6-well plates  at approximately 1 \u00d7 10e trials .3-oil were selected due to antibiofilm activity at their IC50. The effect of the later medicaments, either separate or combined together, was evaluated on the mature multi-species biofilm ex vivo using extracted premolar teeth. The effect of DMSO or 5% HAC, as vehicles, on the microbial biofilm was also assessed.Among the tested medicaments, Ch-NPs and OA total of 168 intact single rooted human premolars with single straight root canals extracted for periodontal or orthodontic reasons were collected after obtaining the patients\u2019 written consent. This was based on the protocol approved by The Research Ethics Committee at the Faculty of Dentistry, Tanta University, Egypt. The teeth were collected in 2.5% sodium hypochlorite solution then mechanically cleaned and decoronated under water coolant using a diamond disk . The step-back technique was used to chemomechanically debride the canals using stainless steel k-files  and 2.5% sodium hypochlorite as an irrigant with a master apical file size 40.The apical 3 mm as well as crown (2\u20133 mm) of each root specimen was cut using the diamond disk to obtain 12 mm-long standardized root specimens. The canal lumen for each specimen was prepared to a standardized size by passing rotating peeso drills, sizes 1 and 2, from the coronal end until just visible at the apical end. A 2 mm-deep cavity was prepared on the apical ends of each canal using #4 slow speed round bur (Dentsply/Maillefer) and sealed with acrylic resin to prevent micro leakage. The prepared root canals were conditioned with 10 mL of 17% EDTA  for 60 s to remove the smear layer, washed with 10 mL of 5.25% NaOCl, flushed with 10 mL of saline solution and dried with paper points . Teeth were subjected to sterilization by steam autoclave for 15 m at 121\u00b0C .6 CFU/ml using the 0.5 McFarland standard. Equal portions of each microbial suspension were mixed together in a Falcon tube to be used for generating multiple species biofilm. Premolar teeth were aseptically transferred to the tube containing the mixed microbial suspension, then incubated under anaerobic conditions at 37\u00b0C for 1 week to obtain a mature multi-species biofilm. The culture broth was refreshed every 2nd day to ensure bacterial viability and remove dead cells. At the end of the incubation period, specimens were aseptically removed from the tubes and washed with sterile PBS to remove unbound microbes and culture media. Another Falcon tube contained teeth in a medium without inoculation was used as negative control  to test the three different intracanal medicaments including; O3-oil, Ch-NPs and a combination of both. The control group  was inoculated and kept untreated in the incubator for the remainder of the test. The negative control group  in which the medium was free from inoculum and treatment to exclude contamination throughout the experiment. Vehicles (DMSO or 5% HAC) were also tested to exclude their effect on mature biofilm . The positive control group (G. 8) which test calcium hydroxide suspension. Test samples were irrigated with sterile saline for 2 m and dried with paper points. The test medicaments were injected into the corresponding root using syringe and canal orifices, then aseptically sealed with modeling wax . The specimens were transferred into sterile petri dishes and covered with humid sterile gauze. The plates were incubated at 37\u00b0C for 1 week and evaluated daily for viability of microbial cells  were calculated . This procedure was repeated three times. The CFU values were converted to loglculated .50 from the plotted curves of the cytotoxicity assay.The data were analyzed using IBM SPSS statistics for Windows, version 21.0 . One-way ANOVA, and Tukey\u2019s test at \u03b1 = 0.05 were used to determine significant differences between the groups. Graph Pad Prism was used to calculate the ICTable 1. Ch-NPs exerted 4- and 8-fold increases in the microbicidal activity compared to O3-oil against C. albicans, and both of E. faecalis and S. mutans, respectively. Synergism (FIC index \u2264 0.5) was recorded for O3-oil/Ch-NPs combination when it was assessed for the antimicrobial synergy in vitro against the test endodontic pathogens. Moreover, an additive effect (FIC index of >0.5 and \u22644) was noticed when O3-oil/Ag-NPs and Ch-NPs/Ag-NPs combinations were tested as recorded in Table 2.Broth microdilution assay revealed that all of the test medicaments had high MIC and MBC values as recorded in Figure 1). The IC50 for the three test disinfectants was calculated from the plotted curves and ranged from 0.039\u201310 mg/ml. One-way ANOVA revealed a significant difference (p < 0.001) between the test groups and the untreated control group. The IC50 of O3-oil was the safest, followed by the Ch-NPs (1.25 mg/ml).The neutral red assay results for testing cytotoxicity on human fibroblasts are shown in . Ch-NPs reduced single and mixed species biofilm by 97 and 94%, respectively. Furthermore, O3-oil exerted 86 and 79% reduction in biofilm, respectively. However, Ag-NPs showed non-significant reduction. Notably, the control group was significantly different from the other groups.Effect of the test medicaments on the formation of single or mixed microbial species biofilms was evaluated by a crystal violet assay that measures only biomass by binding of positively charged CV to all negatively charged residues in the biofilm. The Ch-NP solutions had the lowest mean value of absorbance, followed by OFigure 3). It revealed that the Ch-NPs and O3-oil were the most effective at reducing the fibroblast-microbial cell adhesion by reducing the number of fibroblast-associated microbes to almost zero (p < 0.05) compared to the untreated microbial cells (control), which showed high adhesion indices. Non-significant reduction in fibroblast-bacterial cell adhesion was also noted with Ag-NPs. Moreover, it had less effect on C. albicans-fibroblast adhesion (Table 3). The time-kill kinetics for the different test treatments showed that killing was time-dependent throughout the 7-day incubation with the mature biofilm. ANOVA revealed a significant difference between groups (p < 0.05). The fastest kill rate was recorded for the double combination (O3-oil/Ch-NPs), as it significantly reduced (6-log reduction) the number of survivors by the 2nd day of treatment. The separate medicaments had slower kill rates than the combined one . There were no significant effect for DMSO or 5% HAC on the microbial biofilm as compared to the untreated control group .Antiadherent test was assessed using Giemsa staining and microscopy  secretion helps other pathogens, such as S. mutans, adhere and form microcolonies that enable growth in the presence of C. albicans. The acidity of the biofilm increases as it matures in the presence of acidogenic pathogens such as S. mutans. The coexistence of E. faecalis with these pathogens stimulates production of superoxides that trigger hyphae formation in C. albicans. This results in a more complex biofilm due to the complexity of the bacterial-fungal association  reduced the total biofilm mass compared to the control groups, specifically the Ch-NPs, which showed 97 and 94% reductions for single and mixed species biofilms, respectively. This agrees with the results of C. albicans and S. mutans up to 92.5 and 93.4%, respectively. This supports the finding that our medications acted against the biofilm. The slightly lesser effect of the treatments on the mixed species biofilm in this study can be explained by the findings of C. albicans was resistant in the presence of the encapsulated E. faecalis ATCC 29212 biofilm at the intermediate stage (24-h). E. faecalis produces peptidoglycan that induces hyphal growth in C. albicans. Consequently, this stimulatory effect at the intermediate stage of biofilm development indicates the ability of E. faecalis and C. albicans to cohabitate. Additionally, E. faecalis produces extracellular superoxides that can trigger reactive oxidative stress, inducing filamentation in C. albicans. However, this relationship can become antagonistic with unencapsulated E. faecalis isolates in mature biofilm. Similarly, S. mutans can promote C. albicans biofilm due to their mutualistic relationship . It worked faster than the other treatments and the traditional medications that need at least 1 week to provide acceptable results. Calcium hydroxide was used as a positive control in our study. It was less effective than O3-oil, Ch-NPs, and their combination. This result was supported by the findings of E. faecalis biofilm. E. faecalis cells at 200 and 400 micron depths compared to the control; however, this did not differ significantly from the triple antibiotic paste (In our study, mixed species mature biofilm was developed in premolars to simulate clinical cases. The effect of the medicaments on mature biofilm in premolars was evaluated using viable counts of CFU/ml to test their viability in biofilm within the dentinal tubules. The Oic paste .in vitro study results, further in vivo investigations are recommended to determine the best concentration, and application time for each medicament, as well as the optimum ratio of the double combination, to obtain the best antimicrobial effect with the least adverse reactions.In view of the current Based on the current study, ozonated olive oil had the least cytotoxic effects, while chitosan nanoparticles showed better antimicrobial activity against the tested endodontic pathogens when used at its MIC and MBC/MFC compared to both silver nanoparticles and ozonated olive oil. Our tested double combination has the potential to prevent microbial biofilm formation and eradicate mature mixed-species biofilms. Incorporating the tested medicaments, either separately or in the novel double combination, into intracanal treatments, root canal sealers and irrigating solutions can prevent biofilm formation and eradicate resistant endodontic pathogens from the root canal, thereby increasing the success rate of endodontic treatment. These medicines might also be valuable if added to toothpastes and/or mouth rinses to combat harmful oral microbial biofilms.LA-M and NE-D conceived the experiments. LA-M, NE-D, and WG conducted the experiments. LA-M and NE-D analyzed the results. All authors wrote and reviewed the manuscript.The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest."}
+{"text": "Recent evidences suggest the involvement of DYRK1A  in Alzheimer\u2019s disease (AD). Here we showed that DYRK1A undergoes a proteolytic processing in AD patients hippocampus without consequences on its kinase activity. Resulting truncated forms accumulate in astrocytes and exhibit increased affinity towards STAT3\u0251, a regulator of inflammatory process. These findings were confirmed in APP/PS1 mice, an amyloid model of AD, suggesting that this DYRK1A cleavage is a consequence of the amyloid pathology. We identified in vitro the Leucettine L41 as a compound able to prevent DYRK1A proteolysis in both human and mouse protein extracts. We then showed that intraperitoneal injections of L41 in aged APP/PS1 mice inhibit STAT3\u0251 phosphorylation and reduce pro-inflammatory cytokines levels  associated to an increased microglial recruitment around amyloid plaques and decreased amyloid-\u03b2 plaque burden. Importantly, L41 treatment improved synaptic plasticity and rescued memory functions in APP/PS1 mice. Collectively, our results suggest that DYRK1A may contribute to AD pathology through its proteolytic process, reducing its kinase specificity. Further evaluation of inhibitors of DYRK1A truncation promises a new therapeutic approach for AD.The online version of this article (10.1186/s40478-019-0678-6) contains supplementary material, which is available to authorized users. AD neuropathology is mostly defined by the accumulation of amyloid-beta (A\u03b2) plaques and neurofibrillary tangles (NFTs) in patient brains. Extracellular A\u03b2 plaques are mainly formed by the aggregation of amyloid peptides , encoded by a gene localized in the Down syndrome critical region of chromosome 21, is a serine/threonine protein kinase which contributes to various biological processes in the embryonic and adult central nervous systems . In AD, T) is associated with a decrease of full-length form of DYRK1A (DYRK1AFL) thus confirming previous report by Jin and colleagues [FL, DYRK1AT exhibit stronger affinity toward STAT3\u0251. We identified Leucettine L41, derived from the marine sponge alkaloid Leucettamine B [T in AD pathology and demonstrate the relevance of inhibitors of DYRK1A cleavage as a potentially relevant therapeutic strategy.Here, we show that DYRK1A is truncated in the AD context. This increase of truncated forms of DYRK1A  and 12 age-matched littermate control mice were used for behavioral (Morris Water Maze), pathology, and biochemistry studies. A second cohort composed of 14 APP/PS1 and nine littermates were used for behavioral (Y-maze) and electrophysiological analysis. APP/PS1 mice express the human APP gene carrying the Swedish double mutation (K595\u2009N/M596\u2009L). In addition, they express the human PS1\u2206E9 variant lacking exon 9 [Fourteen APPg exon 9 . Only maMice were anesthetized with ketamine/xylazine (100 and 10\u2009mg/kg respectively) and decapitated. One hemisphere was post-fixed by incubation for 72\u2009h in 4% PFA, cryoprotected in 30% sucrose in PBS, and cut into 40\u2009\u03bcm sections with a freezing microtome (Leica) for histological analyses. The contralateral hemisphere was dissected for hippocampus isolation. Samples were homogenized in a lysis buffer  containing phosphatase (Pierce) and protease (Roche) inhibitors and centrifuged for 20\u2009min at 15000 x g. The same procedure was applied to human samples.The pre-weighed compound was dissolved in DMSO/PEG300/water (5/35/60) to a final concentration of 2\u2009mg/mL for a dose of 20\u2009mg/kg. The formulation was prepared on the day of the in vivo experiment. The mice received five intraperitoneal injections per week for four weeks.2+ with or without Harmine, Leucettine LeuI or Leucettine L41 at various concentrations  for 10\u2009min at 30\u2009\u00b0C. The reactions were terminated by the addition of 4-fold concentrated SDS-PAGE sample buffer, followed by heating in boiling water for 5\u2009min. The products of proteolysis were analyzed by Western blots developed with antibody to DYRK1A.Human hippocampus tissue and 4\u2009months-aged mouse (C57Bl6) hippocampus were homogenized in 9 volumes of buffer consisting of 50\u2009mM Tris-HCl (pH\u20097.4), 8.5% sucrose, 10\u2009mM \u03b2-mercaptoethanol, 2.0\u2009mM EDTA, followed by centrifugation at 16,000\u00d7g at 4\u2009\u00b0C for 10\u2009min. The supernatants were incubated in the presence or absence of various concentrations of Ca\u03b1-DYRK1A-Nter antibody (DYRK1A D1694) overnight at 4\u2009\u00b0C. The proteins interacting with DYRK1A were revealed by Western blots developed with STAT3 , NFATc1 , APP, Tau and PS1.Homogenized total proteins from mouse hippocampus tissue were incubated with 2\u2009mM EDTA, 0 or 2\u2009mM of Ca2+ and 0 or 1\u2009\u03bcM of Leucettine L41 during 10\u2009min at 30\u2009\u00b0C. 200\u2009\u03bcg of total proteins were incubated with 2\u2009\u03bcg of Equal amounts of protein (30\u2009\u03bcg) were separated by electrophoresis in NuPAGE Bis-Tris Gels (Life Technologies) and transferred to nitrocellulose membranes. The membranes were hybridized with various primary antibodies , DYRK1A D1694 , GFAP , Vimentin , pSTAT3(Y705) , STAT3 , IBA1 , CD68 , IDE , TREM2 , GAPDH ). Various secondary antibodies were also used . Membranes were developed using enhanced chemiluminescence (Thermo Fisher Scientific). Signals were detected with Fusion FX7 (Vilber Lourmat) and analyzed and quantified using ImageJ (NIH).Inflammatory cytokines and interleukin concentrations were measured using the MSD Mouse V-PLEX Plus Proinflammatory Panel 1 kit . Extracted soluble A\u03b2 forms were quantified with the MSD Human and rodents V-Plex Plus A\u03b2 Peptide Panel 1 (4G8) . All ELISA were performed according to each kit manufacturer\u2019s instructions.2+ or 10\u2009mM EGTA to determine calcium-independent activity, thus excluding cathepsin activity.Calpain activity was measured using the fluorogenic peptide N-Succinyl-Leu-Tyr-7-Amido-4-Methylcoumarin as described by Kohli et al. . BrieflyCatalytic activity of total and endogenous DYRK1A was assessed using high-performance liquid chromatography (HPLC), based on the separation and quantification of specific fluorescent peptides (substrate and phosphorylated product), as previously described . Both ne2O2 for 5\u2009min, followed by amplification using the ABC system . Horseradish peroxidase conjugate and 3,3\u2032-diaminobenzidine were then used according to the manufacturer\u2019s manual . The sections were mounted, dehydrated by passing twice through ethanol and toluol solutions, and cover-slipped with Eukitt (O. Kindler). Images were captured with a Leica DM6000 microscope and analyzed using ImageJ software (NIH). For fluorescent immunostainings, slices were incubated with secondary Alexa Fluor conjugated antibodies (Invitrogen). Slices were stained with DAPI , mounted in Vectashield fluorescent mounting media (Vector laboratories) and conserved at 4\u2009\u00b0C. Images were captured with a Leica SP8 confocal microscope (Leica) and analyzed using ImageJ software (NIH). Laser power, numeric gain, and magnification were kept constant between animals to avoid potential technical artefacts. Images were first converted to 8-bit gray scale and binary thresholded to highlight positive staining. At least three sections per mouse  were quantified. The average value per structure was calculated for each mouse. For quantification of Iba1 and GFAP immunoreactivity around plaques, a region of interest (ROI) was drawn around the center of the plaque. The diameter of the circular ROI was set to two times the diameter of the plaque. Mean fluorescence intensity values were measured for either DYRK1A (7D10) (\u03b1-DYRK1A-Cter), DYRK1A (D1694) (\u03b1-DYRK1A-Nter) Iba1, or GFAP immunoreactivity and were processed using Icy software . Experiments and data analysis were performed blind with respect to treatments and genotypes.Cryosections were washed with 0.25% Triton in 0.1\u2009M PBS, incubated in an 88% formic acid solution for 15\u2009min , and saturated by incubation in 0.25% Triton in 0.1\u2009M PBS/5% goat serum. They were then incubated with primary antibodies , DYRK1A D1694 , GFAP , APP 4G8-Biotin, , IBA1 ). For non-fluorescent immunostaining, endogenous peroxidase was quenched with PBS containing 3% HY-maze. Experiments were performed in a maze consisting of three transparent plastic arms, 46\u2009\u00d7\u200911\u2009\u00d7\u200925\u2009cm each, set at a 120\u00b0 angle relative to each other. During the first trial, mice could freely explore two arms, called familiar arms (FA), for 3\u2009min, whereas the third arm was blocked by an opaque door. Assignment of arms was counterbalanced randomly within each experimental group to avoid any preference-related bias. Mice were then returned to their home cage for 5\u2009min. Finally, mice were returned to the maze and allowed to explore all three arms, including the novel arm (NA), for 3\u2009min. The maze was carefully cleaned with a 70% ethanol solution between each exploration phase to remove any olfactory cues. EthoVision software was used for recording and analysing each exploration trial.Experiments were performed in a tank 180\u2009cm in diameter and 50\u2009cm deep, filled with opaque water maintained at 21\u2009\u00b0C, equipped with a platform of 18\u2009cm in diameter, submerged 1\u2009cm below the surface of the water. Visual clues were positioned around the pool and luminosity was maintained at 350\u2009lx. The mice were initially exposed to a learning phase, which consisted of daily sessions  on five consecutive days. The starting position varied pseudo-randomly, between the four cardinal points. There was a mean interval of 20\u2009min between trials. The trial was considered to have ended when the animal reached the platform. Long-term spatial memory was assessed 72 and 120\u2009h after the last training trial in a probe trial in which the platform was no longer available. Animals were monitored with EthoVision software.Slice preparation. Mice were anesthetized with halothane and decapitated. The brain was rapidly removed from the skull and placed in chilled (0\u20133\u2009\u00b0C) artificial cerebrospinal fluid (ACSF) containing 124\u2009mM NaCl, 3.5\u2009mM KCl, 1.5\u2009mM MgSO4, 2.5\u2009mM CaCl2, 26.2\u2009mM NaHCO3, 1.2\u2009mM NaH2PO4, and 11\u2009mM glucose. Transverse slices (300\u2013400\u2009\u03bcm thick) were cut with a vibratome and placed in ACSF in a holding chamber, at 27\u2009\u00b0C, for at least one hour before recording. Each slice was individually transferred to a submersion-type recording chamber and submerged in ACSF continuously superfused and equilibrated with 95% O2, 5% CO2.Electrically induced long-term potentiation (LTP) was studied. Theta-burst stimulation (TBS), mimicking the natural stimulation at the theta frequency from the medial septum to the hippocampus, consisting of five trains of four 100\u2009Hz pulses each, separated by 200\u2009ms, was applied at the test intensity. The sequence was repeated three times, with an interburst interval of 10s. Testing with a single pulse was then performed for 60\u2009min (TBS) or 75\u2009min (3\u2009\u00d7\u2009100\u2009Hz), to determine the level of LTP.P-value <\u20090.05 for all tests.Data are expressed as the mean\u2009\u00b1\u2009SEM. Statistical analyses were performed with GraphPad Prism  software. One-way ANOVA followed Tukey\u2019s post-hoc tests were used to determine the significance of differences between groups. Student\u2019s t test was used when only two groups were analyzed. All values are given as mean\u2009\u00b1\u2009SEM. Statistical significance was set to a n\u2009=\u20094) and age-matched controls (n\u2009=\u20094). Using the anti-DYRK1A antibody 7D10 (named after \u03b1-DYRK1A-Cter) targeting the C-terminal region of DYRK1A, we observed decreased levels of DYRK1A in AD patients compared to controls (p\u2009<\u20090.05)    associated to an increase of the truncated form  in the hippocampus of AD patients  n\u2009=\u2009 and age-2+ dose-dependent decrease of DYRK1AFL and increase DYRK1AT were observed while the Ca2+ chelating agent EGTA was used as a control  and L41. We then performed western-blots using STAT3\u03b1 and IkB\u03b1 antibodies        Fig.\u00a0a, b. The05) Fig. c, leadinFL forms, showed only marginal co-localization between GFAP and DYRK1AFL in all mice groups, as revealed by the level of DYRK1AFL in GFAP-positive cells, which was the same for all three groups   showed lower DYRK1A staining in the hippocampi of vehicle-treated APP/PS1 mice compared to littermates for both antibodies, confirming biochemical analysis. Strikingly, treatment of APP/PS1 mice with L41 restored DYRK1A staining levels in the hippocampus to those of wild-type mice. Most pyramidal neurons in the CA1 region and interneurons in the Stratum Radiatum (StrR) exhibited DYRK1A staining in littermates and APP/PS1 mice treated or not with L41 Fig. g. This wups Fig. h. The \u03b1-th) Fig. i. These T toward STAT3\u0251  . Interestingly, L41-treated APP/PS1 exhibited lower phospho-STAT3\u03b1 levels compared to vehicle-treated APP/PS1 mice (p\u2009<\u20090.0005), thereby leading to a restored ratio pSTAT3\u0251/STAT3\u0251 similar to littermates . These levels were reversed by L41 treatment      Fig.\u00a0a-b. Westly) Fig. c-d. TREMly) Fig. e. Becausn\u2009=\u200913 slices/N\u2009=\u20095 mice) exhibited impaired LTP relative to littermates treated with the vehicle solution (n\u2009=\u200911 slices/N\u2009=\u20094 mice) (p\u2009<\u20090.0005)  relative to APP/PS1 mice that received vehicle injections. LTP generated in L41-treated APP/PS1 mice was still significantly lower compared to littermates (p\u2009<\u20090.0005), suggesting that synaptic plasticity measured by the LTP was partially rescued by the L41 treatment. To evaluate whether improved synaptic plasticity was also reflected at the behavioral level, we tested the mice by the Morris water-maze and the Y-maze tasks , whereas L41-treated APP/PS1 mice were statistically undistinguishable from littermate controls (ns)   but not different compared to littermates (ns). We also used the Y-maze paradigm to evaluate the spatial working memory which is mediated by hippocampus but also prefrontal cortex [p\u2009<\u20090.05) whereas L41-treated APP/PS1 mice tended to exhibit similar behavior (p\u2009=\u20090.06)  of synaptic transmission associated with impaired learning and memory . It has l cortex Fig. 5f)fn\u2009=\u200913 sFL) and producing truncated forms (DYRK1AT). The increase of DYRK1A kinase activity was suspected to contribute to AD. However, we demonstrate that this proteolysis is not associated with modification of the global DYRK1A kinase activity but affect its specificity. DYRK1AT forms exhibit increased affinity toward STAT3\u03b1, an activator of neuroinflammation. We then show that inhibiting DYRK1A proteolysis through the peripheral administration of Leucettine L41 in APP/PS1 mice is associated with increased number of phagocytic-microglia around amyloid-\u03b2 deposits and reduction of the plaque load. This is associated to improved synaptic plasticity and reduced cognitive and memory deficits in APP/PS1 mice. Specific inhibitors of DYRK1A proteolysis could be therapeutic interest for AD.The present study provides compelling evidence for DYRK1A involvement in AD and describes a new mechanism through which DYRK1A modulation contributes to AD pathology. We first describe a proteolytic processing of DYRK1A in the hippocampus of AD patients and APP/PS1 mice reducing level of full-length form of DYRK1A (DYRK1ADYRK1A gene is located on chromosome 21 (21q22.2), a region known as the Down- Syndrome Critical Region (DSCR) [APP gene on chromosome 21 [FL and increased DYRK1AT forms have been reported in the frontal and temporal cortex of AD patients (Braak V-VI/Tangles score\u2009=\u200914) through upregulated calpain I activity, the major calpain isoform in brain [FL forms in APP/PS1 mice, together with increased DYRK1AT forms and increased calpain activity.The n (DSCR) . People osome 21 . In addiosome 21 , 35. Howin brain . We confDYRK1A has a long kinase domain, followed by a PEST region, and histidine-repeat and serine/threonine-rich domains . PEST seSeveral molecules able to reduce DYRK1A kinase activity have been developed . One of \u03b1 and IL-12, (ii) increased microglial cells recruitment around amyloid plaques, and (iii) decrease of the amyloid-\u03b2 burden. The immune system, driven by inflammatory mediators, influences AD progression [FL levels and DYRK1AT in astrocytes or no significant decrease of pro-inflammatory cytokines were observed in LeuI treated animals  in APP/PS1 mice. STAT3\u0251 is a transcription factor and a major regulator of cytokine production . The tyrgression . In partgression  and elevgression . In addigression , 40. Emegression . Activatgression . In APP/gression . Therefogression , 48. A pgression . We showIn conclusion, we provide several evidences that DYRK1A is proteolyzed in both AD patients and APP/PS1 mice. We show that truncated forms of DYRK1A accumulate in astrocytes without consequences on its kinase activity. However, kinase specificity of truncated DYRK1A is reduced leading to increase its affinity toward STAT3\u03b1, a major regulator of inflammation We demonstrate that decreasing production of DYRK1A truncated forms by Leucettine L41 in an AD-like mouse model, reduces levels of inflammatory cytokines, improves clearance of amyloid-\u03b2 plaques through microglia recruitment and activation, and consequently improves synaptic plasticity and memory. These data confirm the interest of L41 and eventually other inhibitors of DYRK1A proteolysis for AD.Additional file 1:Supplementary data figure 1. (JPG 27 kb)Additional file 2:Supplementary data figure 2. (JPG 137 kb)Additional file 3:Supplementary data figure 3. (JPG 415 kb)Additional file 4:Supplementary data figure 4. (JPG 647 kb)Additional file 5:Supplementary data figure 5. (JPG 186 kb)Additional file 6:Supplementray Data text. (DOCX 230 kb)"}
+{"text": "Caulerpa cupressoides modified the morphology, size and surface charge of CaOx crystals. Thus, these crystals became similar to those found in healthy persons. In the presence of SPs, dihydrate CaOx crystals showed rounded or dumbbell morphology. Infrared analysis, fluorescence microscopy, flow cytometry (FITC-conjugated SPs) and atomic composition analysis (EDS) allowed us to propose the mode of action between the Caulerpa\u2019s SPs and the CaOx crystals. This study is the first step in understanding the interactions between SPs, which are promising molecules for the treatment of urolithiasis, and CaOx crystals, which are the main cause of kidney stones.Urolithiasis affects approximately 10% of the world population and is strongly associated with calcium oxalate (CaOx) crystals. Currently, there is no efficient compound that can be used to prevent this disease. However, seaweeds\u2019 sulfated polysaccharides (SPs) can change the CaOx crystals surface\u2019s charge and thus modify the crystallization dynamics, due to the interaction of the negative charges of these polymers with the crystal surface during their synthesis. We observed that the SPs of  Urinary lithiasis or urolithiasis is a pathophysiological condition resulting from the formation of kidney stones. The incidence of urinary lithiasis in the world is increasing rapidly. In the last decade, prevalence doubled from approximately 6% to 11% among men and 4% to 7% among women . This diUrolithiasis can be influenced directly by the types of formed crystals, as each crystal has its own different ability to bind to the renal epithelium and to initiate the formation of the stones. Calcium oxalate (CaOx) crystals make up about 70% of urinary stones , and theThe formation of these CaOx crystals is derived from a physicochemical process divided into three phases: nucleation, aggregation and crystal growth. The preponderant condition for crystal formation (nucleation) is urinary supersaturation due the superfluous ions that cannot be stored in the buffer system; the condensation of these salts occurs forming tiny crystals, which are called nuclei. The aggregation occurs by the union of one or more growing nuclei, which form crystals of larger dimension and mass that can precipitate in the renal epithelium, being able to adhere to or internalized by cells . The groThe changes in the CaOx crystal\u2019s face are caused by the other molecules present in the urinary tract, considering the fact that the concentration of ions in healthy persons and lithogenic patients is practically the same. These molecules, such as citrate, pyrophosphate, glycosaminoglycans and glycoproteins, present in the renal and urinary ducts, have the function of stabilizing CaOx crystals, mainly in the COD morphology ,12.Recently, seaweeds sulfated polysaccharides (SPs) have begun to be evaluated for their anti-lithic capacity. The studies are done in vitro as well as with cells under culture conditions and in vivo. The data are well reviewed in a recently published paper , which vCaulerpa cupressoides var. flabellata have been studied by our research group for almost a decade. The Brazilian coast has a wide diversity of marine seaweed, especially on the northeast coast; however, the SPs of few species are characterized and evaluated for their therapeutic potential. The SPs  from C. cupressoides exhibited several biological activities, including anticoagulant, antiproliferative and antioxidant activities  rather than growth in the direction [100]. This gave COM edges and tips with less sharp angles, as they were elliptical . Thus, the morphological characteristic assumed by COM crystals after incubation with C. cupressoides SPs is advantageous, as, by leaving the edges of their faces with a slight angle (rounded), the possible interaction of these crystals in renal epithelium could be decreased, which would consequently favor their passage in the urinary tract, thus reducing the formation of kidney stones. In agreement with our hypothesis, studies analyzing CaOx crystals in the urine of lithogenic patients verified that the COM crystals had edges and tips with sharp angles and concluded that these are important factors for the anchorage of these crystals in the renal epithelium [Regarding COM crystals, when formed after treatment with ithelium ,33.\u22121. While, in COM crystal spectra, we observed at least five prominent bands  of crystals formed in the presence of The \u03b6 mean value of untreated CaOx crystals was +8.85 \u00b1 3.30 mV. This positive profile of crystal charge surface can be mainly related with the presence of calcium ions in the crystal structure. All SPs decreased the zeta potential of CaOx crystals, ranging from \u221225.82 \u00b1 6.36 mV in the presence of CCB-F0.3 to \u221268.70 \u00b1 12.01 mV in the presence of CCB-F2.0.An interesting fact is that the increase of crystals \u03b6 did not correspond to the sulfate/sugar ratio , that isC. cupressoides, which explains part of the formation of many small crystals. The elevated negative charge on the crystal surface led to repulsion of other crystals and blocked crystal aggregation and growth. This interference in crystal aggregation/growth has also been observed by other authors while working with other seaweeds SPs [The \u03b6 increased with the presence of SPs of eeds SPs ,16. In tZeta potential analysis provides great indications that SPs interact with CaOx crystals structure. However, there are no studies that prove direct binding between SPs from seaweed and CaOx crystals. However, this connection is well described for other molecules that also have negative charges in their structure, such as polyacrylate , osteopoIn another set of experiments, the SPs were covalently conjugated to the FITC, as described in As expected, crystals formed in the presence of inflorescent SPs and FITC were not detected by flow cytometry, indicating that FITC alone did not bind to CaOx crystal. However, using this technique, we verified that, in all condition evaluated, more than 90% of crystals formed in the presence of fluorescent SPs showed positive FITC signal A.When those crystals were analyzed by fluorescence microscopy, we observed that FITC alone did not label the crystals and did not change the crystal morphology. On the other hand, we noticed that the crystals appeared marked by FITC (green) in almost totality B when foC. cupressoides induced higher amount of COD crystals in comparison to the positive control. In addition, SPs gave COD crystals\u2019 higher stability. This behavior was already observed by Escobar and colleagues [The data presented thus far show that, except for CCB-F2.0, all other SPs of lleagues , in the lleagues .C. cupressoides SPs may take different forms, which seems to indicate that SPs can stabilize COD in different ways, perhaps because they associate with crystals in different faces.However, not every sulfated polysaccharide promotes stabilization of COD crystals, as shown by Melo and colleagues  and by o42-) groups of SPs, since CaOx is composed only of calcium, carbon and oxygen, thus some considerations were made.To confirm this hypothesis, the surfaces of the COD crystals obtained after the incubation with the SPs studied here had their atomic composition characterized through the spectroscopic chemical microanalysis of X-rays by energy dispersion (EDS). The sulfur atoms were quantified at different points of the crystals: apex, face and base A. The suThe results from this analysis are summarized in the table of We found no other articles that report this type of analysis; therefore, it was not possible to compare our results with those of other authors. However, some considerations were made.Is it necessary for the SPs to be distributed differently throughout the crystal so that there is a greater stabilization of the COD crystals? It does not seem so, since CCB-F1.0 had this type of distribution, but the COD:COM ratio obtained with this sample was only 2:1 .The other SPs were more concentrated on the base. However, there is a subtle relationship between the amount of sulfur that should be at the base, apex and face. If there was a lot of sulfur in the base (about ten times more) than in the other points, as occurred with the presence of CCB-F0.5, there was stabilization of COD, but with only a COD:COM ratio of 3:1 . The ideCaulerpa cupressoides var. flabellata, was collected from N\u00edsia Floresta, on the southern coast of the state of Rio Grande do Norte, Brazil (S 6\u00b01\u2032819\u2032\u2032 and W 35\u00b06\u203233.40\u2032\u2032) and then transported to the Laboratory of Natural Polymer Biotechnology, Department of Biochemistry, Federal University of Rio Grande do Norte, UFRN. The seaweed was identified according to its morphology [The seaweed, rphology . The matC. cupressoides var. flabellata B\u00f8rgesen was cleaned with running water and oven dehydrated at 45 \u00b0C. It was sprayed and then treated four times with two volumes of ethanol for depigmentation and delipidation of the material. Two volumes of 0.25 M NaCl were added to the powder obtained, with the pH being adjusted to 8.0. The proteolytic enzyme maxatase  was added to this material. The suspension was then centrifuged at 10,000\u00d7 g for 20 min. The precipitate was discarded, and the volume of the supernatant was measured fractionated with increasing volumes of acetone, obtaining SPs according to a method established by Costa and collaborators [After collection, the green seaweed borators .2SO4 reaction, as described previously [The total sugars were determined according to Dubois and collaborators (1956) by the phenol\u2013Heviously . The suleviously . Proteineviously . C. cupressoides SPs was evaluated by gel electrophoresis in PDA buffer, according to the reported method [m/v) agarose in PDA buffer . Subsequently, aliquots of the polysaccharides (about 50 \u03bcg) were applied to the gel and subjected to electrophoresis  for 60 min. After the electrophoretic run, the polysaccharides were precipitated with 0.1% cetyltrimethylammonium bromide  for 2 h at room temperature and the gels were dried using warm air stream. To visualize the SPs, gels were stained with a solution of 0.1% toluidine blue in 1% acetic acid and 50% ethanol. The gel was then de-stained with the same solution without the dye. Three independent analyzes were performed.The electrophoretic mobility of d method . InitialThe molecular weight and homogeneity of samples were determined by gel permeation chromatography (GPC). Each sample was dissolved to a final concentration of 10 mg/mL and 200 \u00b5g were applied to a column containing Sephadex G-100 . GPC was performed using an isocratic elution mode. The molecular weight was estimated by reference to a calibration curve made by dextran sulfate standards  . Homogeneity of samples was evaluated by chromatographic profile. The total sugars were determined according to Dubois and collaborators (1956) by the phenol\u2013H2SO4 reaction, and the sulfate was determined by metachromasia, as described previously .C. cupressoides were obtained using infrared spectroscopy via Fourier transform  equipped with the IRsolution 1.20 software. SPs and crystals samples (5 mg) were completely mixed with dried potassium bromide powder (KBr) and then compressed. The sweep frequency range was 4000\u2013400 cm\u22121. Thirty-two scans at a resolution of 4 cm\u22121 were evaluated and referenced against air. The Infrared Spectroscopy Analysis was carried out at the Department of Chemistry of the Federal University of Rio Grande do Norte.The infrared spectra of the CaOx crystals controls formed after incubation with the SPs of 2+ and oxalate to a mixture of calcium chloride (8 mM/L), sodium oxalate, sodium chloride (200 mM/L) and sodium acetate (10 mM/L) as final concentrations of this solution from physiological concentrations of urine. The formation of the CaOx crystals was evaluated in the presence or absence (control) of Caulerpa\u2019s polysaccharides (0.1 mg/mL) [g and the supernatant was discarded. The precipitate was composed mainly of crystals of CaOx, and was resuspended in 0.5 mL of water, and a solution of 0.1 mL was placed on a histological slide and observed under an optical microscope (600\u00d7). Images of 10 different fields were obtained for each slide, and then the crystal diameters and sizes were analyzed using the NIS Elements AR Ver4.30.01 DU1 64-bit software, 2014 . The conclusions about the measurements of the CaOx analyzes were obtained after a trial of distinct experiments, being repeated four times.The CaOx crystals can be formed in vitro from Ca1 mg/mL) . When neC. cupressoides, scanning electron microscopy  and dispersive energy spectroscopy  images were generated with 1280 \u00d7 960 pixels resolution. The scanning electron microscopy was carried out at the Department of Materials Engineering of the Federal University of Rio Grande do Norte. The images showed in the results are representative of three independent experiments.To observe the superstructure and composition of generated crystals in the presence of the SPs of g). The crystal concentrate was then suspended in 1.5 mL of ultrapure water (pH ~7.0), and the zeta potential of the \u03b6 samples was obtained using a Zeta Plus\u00ae analyzer  . Since pH value and ionic strength are factors that affect zeta potential results, the values of these two parameters, in all solutions evaluated, were always the same.After 30 min of crystal formation in the presence and absence of the polysaccharides , the solTo better understand the morphology and arrangement of the SPs in the CaOx crystals, polysaccharide was labeled with fluorescein isothiocyanate (FITC). Five milligrams of each polysaccharide were added to 0.1 mL of phosphate buffer (PBS) at pH 7.0 containing 0.1 mg FITC. The solution was kept in an environment with reduced brightness, at room temperature for 1 h. The material was then labeled with deionized water in membranes with pores of 6 kDa, and then lyophilized. Samples without SPs as well as samples of FITC-labeled polysaccharides were not subjected to new production of CaOx crystals and slides, assembled according to n = 3). The ANOVA test was performed to check the difference between results. The Student\u2013Newman\u2013Keuls test (p < 0.05) was used to solve similarities found by ANOVA. All tests were performed in GraphPad Prism 5 .All data are presented as the mean \u00b1 standard deviation (Caulerpa cupressoides and were named CCB-F0.3; CCB-F0.5; CCB-F1.0; and CCB-F2.0. These SPs interacted in vitro with calcium oxalate crystals, making their surface more negative. They also induced a decrease in the size and an increase in the number of formed crystals. This effect did not depend on the amount of sulfate groups present in SPs. Except for CCB-F2.0, SPs induced the formation of a greater amount of COD crystals compared to the control group, with CCB-F0.3 being the most efficient. This occurred because CCB-F0.3 was distributed in the base:apex:face of the crystal in a ratio of 2:1:1. We believe that this balance/proportion between SPs at the interaction points was crucial to avoid dehydration of the COD crystal to COM, which enhanced their stability.Four sulfated polysaccharide populations were extracted from the seaweed"}
+{"text": "Ecklonia cava within alginate microparticles for the first time. Microparticles with immobilized spores were generated by printing alginate-spore suspensions into a calcium chloride solution. We demonstrate that the inkjet technique can control the number of spores in an ejected droplet in the range of 0.23 to 1.87 by varying spore densities in bioink. After the printing-based spore encapsulation, we observe initial sprouting and continuous growth of thallus until 45 days of culture. Our study suggest that inkjet printing has a great potential to immobilize algae, and that the ability to control the number of encapsulated spores and their microenvironments can facilitate research into microscopic interactions of encapsulated spores.The algal cell immobilization is a commonly used technique for treatment of waste water, production of useful metabolites and management of stock culture. However, control over the size of immobilized droplets, the population of microbes, and production rate in current techniques need to be improved. Here, we use drop-on-demand inkjet printing to immobilize spores of the alga  Entrapped algal cells can also be used to generate metabolite production4, measure toxicity6, preserve cells by freezing7, and to manage stock cultures8. The technique has also enabled improvement of metabolism, function, and growth of immobilized algal cells10. Methods to entrap microorganisms in hydrogel particles include conventional dripping of cell suspension into a receptacle that contains hardening solution11; extrusion\u00a0dripping12; gravity-driven dripping13; and suspension\u00a0spraying14. All of these methods are either slow or not allow sufficient control over the size of droplets, their content of microbes or production rate. A practical method would overcome these drawbacks.Immobilization of algal cells in polymeric hydrogels has a range of applications. Immobilized algal cells can be used for effluent treatment to remove nutrients, metals and industrial pollutantsEcklonia cava is an edible, perennial marine brown alga  that grows in the ocean around South Korea and Japan15. E. cava is a major source of alginate, which is used for foods, pharmaceuticals, therapeutics and tissue engineering17. An extract of E. cava, phlorotannin, has been evaluated for ability to suppress tumor growth18 and as an antioxidation19. Therefore, E. cava has wide applications in science and industry. However, populations of E. cava are decreasing around east Asia20.22, printed electronics25 and 3D fabrication27. The DOD piezoelectric inkjet printing uses a piezoelectric actuator in the channel of the nozzle of piezoelectric inkjet printer. A voltage pulse reduces the volume of a chamber that contains ink, so some is ejected as a droplet28. Piezoelectric inkjet printing can generate droplets of size 1\u2013100 pL at >10\u2009kHz. The size of the ejected droplet can be controlled by adjusting the input voltage pulse or by selecting an appropriate nozzle and be smaller than the diffusion limits of nutrients and metabolites in hydrogels (100\u2013200\u2009\u00b5m)12. The small size of microparticles can minimize the inhibitory effect during the growth of the entrapped algal cells29. Owing to the ability to eject small volume of ink, inkjet printing has been used to encapsulate macromolecules30, drugs17 and mammalian cells32.Drop-on-demand (DOD) inkjet printing is extensively used in various fields such as bioprinting2+) or magnesium (Mg2+) ions. Especially G blocks in alginate contributes to form strong and reversible crosslinking networks so called \u201cegg-box structure\u201d  and \u03b1-L-guluronic acid (G block). Alginate can form a hydrogel in the presence of calcium  sodium alginate solution from brown algae  was autoclaved for 20\u2009min at 120\u2009\u00b0C, cooled at room temperature and filtered using 0.45-\u00b5m syringe filter. The solution was mixed with the spore suspension to prepare a final 0.5% (w/v) sodium alginate solution with concentrations of 0.125\u2009\u00d7\u2009106, 0.500\u2009\u00d7\u2009106 or 2.00\u2009\u00d7\u2009106 cells ml\u22121.Sodium alginate was purchased from MP Biomedical LLC, USA. Reproductive thalli of \u22121 and 1,500\u2009s\u22121 were applied for 60\u2009s; the viscosities were derived by averaging data of the final 10\u2009s (n\u2009=\u20093).Shear viscosities of the suspensions were measured using a cone-plate rotational viscometer  at room temperature. The viscometer has a rotating cone with a radius of 2.4\u2009cm and a stationary plate. Sodium alginate-spore suspension (0.5\u2009ml) was placed between the plate and the cone. Shear rates between 50\u2009sA DOD inkjet printing system  was used to print the sodium alginate-spore suspensions. A piezoelectric inkjet nozzle with a diameter of 80\u2009\u00b5m was used and voltage pulse was applied at \u00b180\u2009V in bipolar mode. The wave pulse had a rise time of 6.0 \u00b5s, dwell time of 13 \u00b5s, fall time of 9.0 \u00b5s, and echo time of 22 \u00b5s. Images of jet formation were acquired every 30 \u00b5s by a stroboscopic CCD camera equipped in the printing system, and a short-duration LED light.\u22121. Printed arrays were observed under an optical microscope and the average number of spores per drop was calculated (n\u2009=\u200930).Arrays of printed sodium alginate-spore suspensions were generated on glass slides. The drop spacing\u00a0of the arrays was 400\u2009\u00b5m and stage speed was 50\u2009mm\u2009s2 in seawater. The seawater had been autoclaved for 20\u2009min at 120\u2009\u00b0C, cooled at room temperature and passed through a 0.45-\u00b5m filter. Printing was conducted at an ejection frequency of 1,000\u2009Hz for 30\u2009min. The solution was strirred using a 1-cm long magnetic stirring bar to prevent aggregation of the hydrogel particles. After printing, 70\u2009\u00b5l of generated microparticle suspension was mixed with 200\u2009\u00b5l of PESI medium37 supplemented with GeO2 and delivered into each well of 96-well plates. The samples were incubated at 15\u2009\u00b0C, light intensity of 30 \u03bcmol m\u22122 s\u22121, and diel cycle of 10\u2009h light: 14\u2009h dark. Thallus length of gametophytes of E. cava was measured under a microscope on days 3, 8, 14 and 21 of culture. The number of measured gametophytes of E. cava was different according to the used sodium alginate solutions with concentrations of 0.125\u2009\u00d7\u2009106, 0.500\u2009\u00d7\u2009106 or 2.00\u2009\u00d7\u2009106 cells ml\u22121. .Sodium alginate-spore suspensions were printed using the inkjet printing system, the the printed drops were collected in a 35-mm Petri dish containing 1% (w/v) dissolved CaClp-values\u2009<\u20090.05 were considered to be statistically significant.All quantitative data are presented as the mean\u2009\u00b1\u2009standard deviation. A one-way analysis of variance (ANOVA) with a Bonferroni post-hoc test was performed using Origin 2016 . 2 solution in a receptacle. As soon as a droplet impacts on the surface of the solution, Ca2+ enters guluronate blocks of alginate molecule, thus forming junctions with adjacent guluronate blocks38. As a result, alginate-based droplets are crosslinked and transformed into hydrogel microparticles that encapsulate spores. The solution in the receptacle was magnetically stirred to prevent aggregation of hydrogel particles\u00a0.Figure\u00a01 and 103\u2009s\u22121 to examine their printability. All of the suspensions had viscosity <20\u2009mPa\u2219s, which is suitably low for stable printing . Then, we observed their jetting behaviors for 2\u2009hours. No clogging of the nozzle was observed during the experiments. Their representative high-speed images of jet formation are shown in Fig.\u00a0E. cava spores inside the suspensions might slightly increase the elasticity of bioink.Viscosities of sodium alginate-spore suspensions was measured in the range of shear rate between 5\u2009\u00d7\u200910ing Fig.\u00a0. The spo6\u2009ml\u22121, 0.67 at 0.500\u2009\u00d7\u2009106\u2009ml\u22121, and 1.87 at 2.00\u2009\u00d7\u2009106\u2009ml\u22121 (Fig.\u00a039. This ability to control the number of encapsulated spores and their microenvironments demonstrates that the piezoelectric inkjet printing technique has possible uses as a method to study microscopic interactions of encapsulated spores.In order to quantify the controllability of delivery of spores, we investigated the number of spores in a droplet by printing dot arrays of sodium alginate-spore suspensions onto the glass substrate without crosslinking. Then, the number of spores in a drop was counted using microscope Fig.\u00a0. Examinal\u22121 Fig.\u00a0, and decl\u22121 Fig.\u00a0. However2 crosslinking solution as shown in Fig.\u00a0E. cava were immobilized inside alginate microparticles (Fig.\u00a0Microparticles were generated using inkjet printing system with a receptacle containing CaClE. cava showed a bush-like morphology. The growing E. cava showed the gametophyte phenotype because the spores had been collected from sporophytes10. The results show that inkjet printing has applications for immobilization of algal cells. Furthermore, the growth trend was not significantly affected by spore density. This result indicates that E. cava spores at low to moderate density of within hydrogel microparticles could not significantly influence each other\u2019s thallus morphology. The range of the spore density at which such influence occurs should be determined in future studies.Sprouting and growth of the entrapped spores were monitored for 45 d to prove a compatibility of the immobilization technique\u00a0of algal spores. Spores immobilized in microparticles remained dormant until day 8 Fig.\u00a0, then a E. cava in sodium alginate suspensions. Viscosities and drop-formation behaviors demonstrated that they were suitable inks for the inkjet printing. The spatial density of spores may affect the viscosity and the elasticity of sodium alginate-spore suspension, and thereby affect jetting formation and lower-than-expected average number of spores per droplet. The printing technique allowed fabrication of spore-immobilized alginate microparticles. Culture of the microparticles yielded healthy gametophytes of E. cava without significant dependence on the spore density. These results show that inkjet printing has applications for immobilization of algal cells and single cell encapsulations.In this study, piezoelectric inkjet printing technology was used to immobilize spores of Supplementary Figure 1"}
+{"text": "Differences were observed in the tumor vasculature and metabolism in tumors based on ascites volumes that provide new insights into the development of this condition.Epithelial ovarian cancer is the leading cause of death from gynecologic malignancy among women in developed countries. Epithelial ovarian cancer has a poor prognosis, due to the aggressive characteristics of the disease combined with the lack of effective therapies. Options for late-stage ovarian cancer are limited and invasive, especially once malignant ascites develops. Malignant ascites, a complication observed in terminal ovarian cancer, significantly contributes to poor quality of life and to mortality. Excess accumulation of fluid in the peritoneal cavity occurs due to a combination of impaired fluid drainage and increased net filtration, mostly due to increasing intraperitoneal vascular permeability. Here we applied non-invasive magnetic resonance imaging (MRI) and spectroscopic imaging (MRSI) of syngeneic mouse tumors  Epithelial ovarian cancer is the leading cause of death from gynecologic malignancy among women in developed countries with an estimated incidence of 205,000 cases worldwide per year resulting in ~125,000 deaths . TherapeMalignant ascites is a complication observed in terminal ovarian cancer that significantly contributes to poor quality of life and to mortality. The excess accumulation of fluid in the peritoneal cavity arises from a combination of impaired fluid drainage and increased net filtration. Malignant ascites formation is thought to occur due to increasing intraperitoneal vascular permeability . Local sin vivo MRI and 1H MRSI, and 1H MRS of tumor extracts, to better understand the relationship between tumor vasculature, metabolism, and ascites build-up in an experimental model of ovarian cancer. The ID8 cell line is an ovarian epithelial papillary serous adenocarcinoma cell line, originating from mouse ovarian surface epithelial cells transformed after multiple passages in vitro , while others had no or low-volume ascites (< 50 \u03bcl). We applied non-invasive MRI and MRSI to better characterize differences in tumor vasculature and metabolism between tumors that produced low and high-volume ascites.Non-invasive magnetic resonance imaging (MRI) and magnetic resonance spectroscopic imaging (MRSI) can be used to characterize the tumor microenvironment and understand its role in ascites formation. Here we applied in vitro . The celin vitro . These Iin vitro . When inin vitro . These ain vitro . For mosin vitro . Tumors 2. Cells were orthotopically implanted in C57BL/6J mice using a two-step process as previously described . All surgical procedures and animal handling were performed in accordance with protocols approved by the Johns Hopkins University Institutional Animal Care and Use Committee, and conformed to the Guide for the Care and Use of Laboratory Animals published by the NIH.ID8-Defb29 Vegf cells were grown in RPMI 1640 medium with 10% fetal bovine serum, and cultured under standard cell culture incubator conditions at 37\u00b0C in a humidified atmosphere containing 5% COescribed . First, 1-weighted images were acquired to localize the orthotopic tumors. To characterize tumor vascular volume and permeability, we used a previously published protocol . The albumin-GdDTPA was synthesized as previously described (1) maps were obtained by a saturation recovery method combined with fast T1 SNAPSHOT-FLASH imaging. First, an M0 map with a recovery delay of 10 s was acquired. Then, images of 4 slices (1 mm thick), acquired with an in-plane spatial resolution of 250 \u03bcm  were obtained for three relaxation delays . These T1 recovery maps were obtained before i.v. injection of albumin-GdDTPA and repeated over a 23-min period, starting 3 min after i.v. injection of the contrast agent. At the end of the imaging studies, the T1 of blood was measured. Relaxation maps were reconstructed from data sets for three different relaxation times and the M0 dataset on a pixel-by-pixel basis. Vascular volume (VV) and permeability surface area product (PSP) maps were generated from the ratio of (1/T1) values in the images to that of blood.Imaging studies were performed on a 9.4T Bruker spectrometer  using a 25 mm diameter volume coil placed around the torso of the mouse. Mice were anesthetized with a mixture of ketamine and acepromazine. Anatomic Tprotocol , 13. Briescribed . The taiMetabolic maps of tCho were obtained from a 4 mm thick slice using two dimensional-chemical shift imaging (2D-CSI)  [echo tiMice were sacrificed, and the ascitic fluid volume was measured. Lungs, liver, and lymph nodes were excised and fixed in formalin to quantify metastatic spread. Tumors were cut in half with one half freeze clamped for MR extracts and protein analysis, and the other half fixed in formalin.2O) containing 2.4 \u00d7 10\u22127 mol of 3-(trimethylsilyl)propionic 2,2,3,3-d4 acid  as an internal standard. Lipid-soluble extracts were resuspended in 0.4 mL of chloroform-D and 0.2 mL of methanol-D4 with 0.05 v/v% tetramethylsilane (TMS)  as an internal standard  using a 5-mm HX inverse probe, and the following acquisition parameters: 30\u00b0 flip angle, 6,000 Hz sweep width, 9.5 s repetition time, time-domain data points of 32K, and 128 transients  , 19. Briansients . SpectraProteins were extracted from freeze-clamped tumors using radioimmunoprecipitation lysis buffer fortified with a protease inhibitor cocktail, dithiothreitol, phenylmethylsulfonyl fluoride, sodium orthovanadate, and sodium fluoride . Protein concentration was estimated using the Bradford Bio-Rad protein assay kit . About 60 \u03bcg of total protein was resolved on 7.5% SDS-PAGE gels from Bio-Rad, transferred onto nitrocellulose membranes, and probed with antibodies directed against mouse FAS (A-5) , cPLA2 , ApoE (M-20) . GAPDH was used as a loading control and detected with a monoclonal antibody . Immunoblots were developed using SuperSignal West Pico chemiluminescent substrate kit .3. As shown in Figures ex vivo. Metastases were more frequent in mice with ascites, especially in organs in the peritoneal cavity, including the diaphragm (67 vs. 0%), liver (100 vs. 20%) and intestine (17 vs. 0%), as shown in Figures Mice were imaged when tumors were ~200\u2013300 mm1H MRSI in all the orthotopic tumors imaged  was detected with  Figures . The tChs Figure . There ws Figure  suggestiWe measured vascular volume (VV) and permeability surface area product (PSP) in the ID8-Defb29 Vegf tumors using MRI of the macromolecular contrast agent albumin-gadolinium-DTPA. Representative maps are shown in Figure 1H MRS. Analysis of the lipid phase obtained after dual phase extraction revealed higher concentrations of cholesterol, phosphatidylcholine (PtdCho), phosphatidylethanolamine (PtdE), and lower CH2/CH3 ratio in tumors from mice with high-volume ascites . No significant differences were observed in the water phase tumor extracts (data not shown).To further examine the metabolic differences between both tumor types, we extracted the tumors and performed high resolution s Figure . Figure To better understand the differences observed in tumor lipid patterns, we investigated the expression levels of some of the proteins involved in lipid and cholesterol metabolism Figure . While nin vivo between the groups do not appear to be directly related to VEGF expression in the tumors.We also performed qRT-PCR to analyze tumor Chk and VEGF mRNA expression levels and found no significant differences between the no or low-volume and high-volume ascites groups (data not shown). The differences in ascites volume, and in VV and PSP measured via the lymphatic system, resulting in a high rate of pelvic and para-aortic lymph node involvement. Hematogenous spread is less predominant but can also occur in ovarian cancer. In a retrospective clinical study, 372 ovarian cancer patients were divided into 2 groups, depending of the presence or absence of ascites  plays a critical role in ovarian tumor progression and ascites formation (2 activity is higher in epithelial ovarian cancer tissues compared to benign or normal tissues (Phospholipase Aormation . This en tissues , and hig tissues , 29. Her tissues .Higher levels of cholesterol were measured in the tumors that presented with high-volume ascites. High levels of cholesterol have been previously detected in aggressive mouse ovarian surface epithelial cells . The eleIn summary, despite similar genetic backgrounds and VEGF expression levels, the ID8-Defb29 Vegf tumors implanted orthotopically induced very different ascites volumes, highlighting the importance of tumor microenvironmental factors in the accumulation of ascites. Our data suggest that large volumes of ascites may act to occlude vessels affecting delivery of therapeutic agents. These studies provide new insights into vascular and metabolic differences in no or low-volume ascites and high-volume ascites that merit expanded future investigation.M-FP and ZB contributed to the conception and design of the study. M-FP, BK, YM, FW acquired the data. M-FP performed the data analysis and wrote the first draft of the manuscript. BK, YM, FW, TW, C-FH, and ZB revised the manuscript critically. All authors contributed to manuscript revision, read and approved the submitted version.The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest."}
+{"text": "Tertiary oral health services  represent high-cost and ineffective ways to improve a child\u2019s oral health. We measured the impact of increased Texas Medicaid reimbursements for preventive dental care on use of tertiary oral health services.We used difference-in-differences models to compare the effect of a policy change among children (\u22649 y) enrolled in Medicaid in Texas and Florida. Linear regression models estimated 4 outcomes: preventive care dental visit, dental sedation, emergency department use, and surgical event.P < .001) and decreased emergency department visits  for children aged 9 years or younger. We saw no significant change in dental surgical rates associated with increased preventive dental care reimbursements.Increased preventive care visits led to increased sedation visits (1.7 percentage points, Increased access to preventive dentistry was not associated with improved long-term oral health of Medicaid-enrolled children. Policies that aim to improve the oral health of children may increase the effectiveness of preventive dentistry by also targeting other social determinants of oral health. Increasing dental provider reimbursements for preventive care visits is an effective policy intervention to increase preventive dental visit use among Medicaid-enrolled children.Increased preventive care dental visits did not translate into significant changes in pediatric dental surgeries after a reimbursement-focused policy intervention.Interventions to reduce pediatric dental surgery should reflect the social determinants of oral health, including access to regular dental care and household oral health behaviors.Dental caries is the most common childhood chronic disease in the United States and worldwide. It disproportionately affects vulnerable children such as those who are poor, receiving Medicaid, of a racial/ethnic minority group, or residents of an underserved area ,2. The iClinical care alone does not address the multifactorial causes of caries. Oral health behaviors, caregiver psychosocial state and parenting style, dietary choices, health literacy, and fluoride exposure are only a few factors that influence a child\u2019s oral health \u201310. HoweAlthough increasing access to preventive dental care is important, preventive care alone does not reduce the likelihood of needing tertiary oral health services  . PreviouWe studied children aged 9 years or younger who were enrolled in the Texas and Florida Medicaid programs. Texas children were the treatment group, and Florida children were the control. Florida was selected as the control because its trends in reimbursement for preventive dental care were stable during the study period as a ratio of private insurance to Medicaid rates .The estimated prevalence of DGA in the Medicaid population during our study period was ~0.5% to 1% ,19. A dePatient demographics and outcomes were derived from Medicaid enrollment and claims files, which we obtained from the Centers for Medicare and Medicaid Services Research Data Assistance Center. Because of budget constraints, we limited our requests for data files for treatment and control states to the pre-reform (2007) and post-reform years 2011 and 2012). This period was selected to reflect prior work that evaluated the impact of these natural experiments on use of preventive dental care . To address this, we measured the effect of increased reimbursements for preventive dental care on appendectomies as a falsification test. If dental surgeries and appendectomies were associated with increased reimbursement for dental care in similar fashion, we would interpret this to signify confounding factors that influence both dental surgeries and preventive dental care reimbursement levels.Data management. Outcomes were identified on the basis of American Dental Association Code on Dental Procedures and Nomenclature (CDT)    or the Are (CDT)  and InteCD-9-CM) . Surgicare claim , or a coThis observational study used difference-in-differences models to establish causal inference between the intervention (policy change) and outcomes. We assumed that any changes in use of dental general anesthesia would not be immediate and theorized that the largest changes in surgery would overlap with children at risk for early childhood caries, because most dental surgeries among Medicaid enrollees occur in children aged 1 to 5 years .We used a linear regression model to estimate 4 outcomes: receipt of a preventive care dental visit, caries-related dental sedation visits, DGA, and an emergency department dental visit. State fixed effects accounted for time-invariant aspects of each state\u2019s environment related to outcomes. To control for the possibility that other changes between 2007 and 2012 in the treatment state (Texas) could confound the effect of the Medicaid reforms on use, we used Medicaid-enrolled children from Florida, where no known policy changes occurred during that same period, as a comparison group. The econometric model used for each outcome was as follows:2 represents the change in DGA in Texas after the Medicaid policy change took effect. The coefficient vector (\u03b2S) represents state fixed effects, which adjusts for varying outcome rates across states.The vector X includes control variables . Although the control variables are known to be important correlates to receipt of DGA and emergency department visits, the main variables of interest are the year by state interaction effects. For example, \u03b2A total of 7,748,850 children met study inclusion criteria. Demographic differences between Texas and Florida were primarily based on race/ethnicity, because approximately 60% of Medicaid enrollees in Texas were Latino, compared with approximately 30% Latino in Florida . Use of Reimbursements for preventive care, sedation, general anesthesia, and other caries-related treatment services increased over the study period in Texas . ReimburP < .001, standard error [SE], 0.0008) from a baseline of 50.5%. The policy-associated increase in preventive care dental visits accounted for 93% of the overall increase in such visits. Dental surgery use increased by 0.01 percentage points  in association with the policy intervention , without significance. However, surgery for a medical indication (appendicitis) increased significantly by 0.01 percentage points . Sedation visits increased by 1.7 percentage points  from a baseline of 3.2%. Emergency department visits for caries decreased in the postpolicy period by 0.3 percentage points  from a baseline of 0.41%.To isolate changes in use in the policy intervention, we employed a difference-in-differences study design. We found that use changed significantly for all difference-in-differences outcomes  when we We found that increasing provider reimbursements was an effective way to increase access to preventive care dental visits. Although tertiary services were not the intended target of our study, use of those services provides useful outcomes to assess long-term effects of increased preventive care visits. We hypothesized that increased preventive care dental visits would improve oral health to the degree that need for tertiary oral health services would be decreased. Our results partially supported this hypothesis by showing decreased dental emergency department visits. Increased reimbursements for preventive dental care were associated with increased sedation visits. Rather than an outcome for severe disease, sedation visits may indicate a population\u2019s access to dental providers who diagnose and treat caries.Although the overall frequency of emergency department visits increased over time in Texas, our model attributed a decline in these visits to a policy intervention to increase preventive care dental visits. Our findings support the idea that the use of emergency department visits is a sensitive indicator of a population\u2019s lack of access to preventive dental care. Our findings provide a counterbalance to prior work on the association between declining reimbursements and increased ED visits for caries . Such viWe were concerned about the potential for omitted variable bias, which would lead us to incorrectly attribute changes in use of dental service to a policy intervention that increased reimbursements for preventive dental care. To address this concern, we employed a difference-in-differences model with appendectomies as an outcome. We assumed that appendectomies were unlikely to be directly influenced by preventive dental care reimbursements. Although both dental and medical surgeries increased in association with increased dental reimbursements, only changes in appendectomies were found to be significant. We interpret the difference in significant change between medical versus dental surgical outcomes to further strengthen the validity of our findings that associate changes in use of dental care with increased reimbursements for preventive dental care. Had both dental and medical surgical outcomes changed in similar fashion, we would have concluded that our findings represented more general trends in health care use. Furthermore, a nonsignificant increase in dental surgeries of 0.01 percentage points with a baseline prevalence of 1.43% does not appear to be clinically meaningful at a population level. We interpret this to signify the limitations of an isolated policy intervention to increase access to preventive dental care on the oral health status of the dental surgery population.https://publichealth.nc.gov/oralhealth/partners/IMB.htm) have facilitated preventive dental care by nondental providers. However, because we defined preventive dental care as a claim for a service rather than specific to type of provider, our results reflect any preventive dental care, including that of primary care providers, reimbursed by Medicaid. Finally, we were unable to specify the mechanisms between increased provider reimbursements for prevention and use of tertiary oral health services. It has been demonstrated that reimbursement affects use of preventive services by expanding dental provider capacity, either by increasing the total number of participating providers or increasing the volume of patients seen by participating providers  with a gap in data between the prepolicy and postpolicy period 2011\u20132012). Second, the ability to detect changes in disease burden was limited by use of the CDT coding system. The CDT coding system is an accurate system to track dental procedures, but it is an inadequate measure for the extent and severity of caries. Third, other possible sources of preventive dental care extend beyond dentists. State programs, such as North Carolina\u2019s \u201cInto the Mouths of Babes\u201d (. Second,Our findings suggest that a focus on other social determinants of oral health may be particularly influential in young children. The contribution of oral health behaviors, such as regular toothbrushing, restricted sugar intake, and exposure to fluoride may have greater impact than preventive care dental visits in families with young children who require dental surgery, particularly if these families do not seek care until after caries have developed. Future interventions may build on our findings by investigating the impact of multilevel interventions that address access to dental care as well as household oral health behaviors to change a population\u2019s oral health status."}
+{"text": "The objective of the present study was to explore the long-term postpartum glucose metabolism in women with previous GDM, and study the mechanism of hyperglycemia from gestation to postpartum by investigating the postpartum insulin resistance and insulin secretion. \u03b2 were used to assess insulin resistance and insulin secretion levels with different glucose statuses.  A total of 321 females with previous GDM were followed up once during 1- to 6-years postpartum. Characteristics during pregnancy, perinatal period, and postpartum were compared between postpartum NGT and hyperglycemic women. HOMA-IR and HOMA-P=0.006). After ROC analysis, the best equilibrium between sensitivity (70.3%) and specificity (60.4%) for 2\u2009hPG was 9.03\u2009mmol/L. HOMA-IR was increased in postpartum normal glucose tolerance (NGT), prediabetes, and T2DM . After ROC analysis, the best equilibrium between sensitivity (70.3%) and specificity (60.4%) for 2\u2009hPG was 9.03\u2009mmol/L. HOMA-IR was increased in postpartum normal glucose tolerance (NGT), prediabetes, and T2DM . After ROC analysis, the best equilibrium between sensitivity (70.3%) and specificity (60.4%) for 2\u2009hPG was 9.03\u2009mmol/L. HOMA-IR was increased in postpartum normal glucose tolerance (NGT), prediabetes, and T2DM  (\u03b2-cell function contributes more to T2DM development.\u03b2 were used to assess insulin resistance and insulin secretion levels with different glucose statuses.  75\u2009g OGTT 2h\u2009PG during pregnancy higher than 9.03\u2009mmol/L is regarded as an independent risk factor of postpartum hyperglycemia. Insulin resistance with insufficient insulin secretion compensation is still common phenomenon during long-term postpartum. Women with heavier insulin resistance in the postpartum period are more likely develop prediabetes, while decreased  Maternal age, family history of DM, weight in early pregnancy, weight at delivery, weight change during pregnancy, FPG, 1\u2009h postprandial glucose (1\u2009hPG), 2\u2009hPG, and insulin use during pregnancy were collected. Neonatal birth weight and feeding patterns were recorded. During follow-up, FPG, 2\u2009hPG, fasting insulin (FINS), and 2-hour postprandial insulin (PINS) were measured. Follow-up age, weight, postpartum weight change, waist, hip, and waist hip ratio (WHR) were recorded. HOMA-IR\u2009=\u2009FPG (mmol/L) Plasma glucose levels were determined by glucose oxidase method. Insulin levels were measured by chemiluminescence.t-test, one-way ANOVA, nonparametric test, or chi-square test as appropriate. Multiple logistic regression (forward: likelihood ratio) was used to analyze the predictors of postpartum hyperglycemia. Receiver operating characteristic (ROC) analysis was used to evaluate the predictive power of identified predictors. P values\u2009<\u20090.05 were considered as statistically significant in most of the analyses. Bonferroni method was used to adjust the \u03b1 level for multiple comparisons.SPSS 21.0 was used for statistical analyses. Values were expressed as mean\u2009\u00b1\u2009standard deviation (SD) for normally distributed measurement data, median  for abnormally distributed measurement data, and number (percentage) for categorical variables. Comparisons were performed by independent-samples P=0.051, 0.283, ). Compared to the included group, the women in excluded group had lower weight  and BMI  during early pregnancy period, while the weight and BMI at delivery were similar . 75\u2009g OGTT FPG, 1\u2009hPG, and 2\u2009hPG showed no significant differences between groups , as well as the proportion of women using insulin to control blood glucose levels during pregnancy (P=0.138). As to offspring, sex and born weight of the excluded group were also similar to the included group .After followed up by telephone, 321 (28.3%) of the total population came to the hospital and underwent 75\u2009g OGTT once at different postpartum years, while the rest 813 (71.7%) women refused and were excluded from our postpartum study. Characteristics during pregnancy and perinatal period were compared between the included group and excluded group . Age at There were 54, 127, 34, 20, 41, and 45 women for 1-, 2-, 3-, 4-, 5- and 6-year postpartum study, respectively. 116 women diagnosed by NDDG criteria were followed up at 5 -year postpartum, and 205 women diagnosed by IADPSG criteria were followed up at 2 -year postpartum. During the follow-up period, 92 (28.7%) women developed hyperglycemia, which included 16 (5.0%) T2DM women and 76 (23.7%) prediabetes women. From 1- to 6-year postpartum, there were, respectively, 14 (25.9%), 24 (18.9%), 9 (26.5%), 6 (30.0%), 22 (53.7%), 17 (37.8%) women diagnosed with hyperglycemia .P=0.065, vs 15.3%, P=0.001), and demonstrated to have a significantly higher weight  and BMI during early pregnancy period . However, there were no significant differences in weight or BMI between the two groups at delivery , and similarly in the neonatal birth weight (P=0.748). In the hyperglycemic group, more women used insulin to control blood glucose levels during pregnancy , and their 75\u2009g OGTT 1\u2009hPG and 2\u2009hPG during pregnancy were significantly higher than those in the NGT group (P < 0.001), but FPG showed no significant differences (P=0.073). A greater proportion of women in the hyperglycemia group used formula to feed their offspring . At the time of follow-up, the maternal age, weight, BMI, waist, hip circumference, FPG, 2\u2009hPG, FINS, and PINS were all higher in the hyperglycemic group (P=0.06). Weight change was smaller in the hyperglycemic group both during pregnancy  and in the postpartum period . 8 (3.5%) women in the NGT group and 4 (4.3%) women in the hyperglycemic group had intervening pregnancies (P=0.748). Of all the intervening pregnancies, one woman completed delivery without GDM during the following pregnancy and developed NGT, another woman developed hyperglycemia at the time of follow-up with similar situation in the following pregnancy, and the rest of the women had abortion during early pregnancy.Compared to the NGT group, the hyperglycemic group included a slightly older women at the time of pregnancy, but the difference was not statistically significant P=0.065, . The womic group . But, WHP=0.006). ROC analysis was used to identify the optimal cut-off level of 2\u2009hPG for predicting hyperglycemia postpartum   (< 0.001) . The bes\u03b2. HOMA-IR was 1.80 , and HOMA-\u03b2 was 1.13  in the overall population. HOMA-IR in the hyperglycemic group was significantly higher than that in the NGT group  vs 1.64 , P < 0.001). HOMA-IR in the NGT, prediabetes, and T2DM groups was increased successively . The differences between NGT and prediabetes, NGT, and T2DM showed significant differences , while the difference was not statistically significant when comparing the pre-diabetes and T2DM groups after adjusting the \u03b1 level (P=0.025). HOMA-\u03b2 in the NGT group was higher than that in the hyperglycemic group  vs. 1.04 ), but the difference was not significant (P=0.115). However, when the HOMA-\u03b2 of NGT, prediabetes, and T2DM groups were calculated separately, the results were different . Both HOMA-\u03b2 of NGT and prediabetes groups were significantly higher than that of the T2DM group , while the HOMA-\u03b2 of the NGT group was not significantly higher than that of the prediabetes group (P=0.583).FPG and FINS during follow-up were used to calculate HOMA-IR and HOMA-Due to increasing prevalence and adverse outcomes, especially during the high risk of metabolic disorders postpartum, GDM caused a huge economic burden to the society, and gradually became a serious public health problem. The risk of progression from GDM to T2DM varies with ethnicity, length of follow-up period, and cohort retention. Through systematic review, Kim C et al.  found th\u03b2-cell dysfunction. When various hormones and cytokines change with increasing gestation period, insulin resistance is progressively increased to the level of T2DM [\u03b2-cell function should be increased to compensate insulin resistance [\u03b2-cell function as well as systematic insulin resistance. It is known that both increased insulin resistance and inadequate insulin secretion contribute to hyperglycemia in nonpregnant women in varying degrees, and their roles in GDM are also different. According to a study [GDM is obviously considered as a risk factor for T2DM, but this phenomenon is not fully explained. Similar to T2DM, more and more studies , 13\u201315 s of T2DM . To remasistance , 16. GDM a study , almost \u03b2 were both still higher than 100% overall after delivery. This meant that they still had insulin resistance and insulin compensatory secretion, and some of their glucose levels were even recovered to normal. Within 6-year postpartum, the women who developed hyperglycemia had significantly higher levels of HOMA-IR than those with normal glucose levels, while the difference between prediabetes and T2DM was not significant. According to the HOMA-\u03b2 levels, the normal glucose, prediabetes, and diabetes were decreased successively. In contrast to HOMA-IR, only the diabetes group demonstrated a significant decrease of HOMA-\u03b2 than normal glucose and prediabetes. These results were in accordance with the study conducted by Ekelund M et al. [\u03b2-cell function, insulin secretion ultimately decreased, with consequent development of T2DM.As insulin resistance and insulin secretion defects contribute to both GDM and T2DM, the changes after delivery in the short term and long term are necessary to explain the transition from GDM to T2DM. In short-term studies , 17, insM et al. . This stSince not all GDM women would develop hyperglycemia postpartum, the women who developed may have some characteristics during pregnancy and after delivery. In the previous studies , 20, pre\u03b2 could reflect the levels of insulin resistance and insulin secretion during the course. As serum insulin might be influenced by many factors, HOMA2-IR and HOMA2-\u03b2 [In our study, 28.3% of the total population accepted the postpartum 75\u2009g OGTT. Women who refused postpartum tests had lower weight and BMI during early pregnancy period than the included women, which could cause some selection bias. However, other characteristics during pregnancy and perinatal period showed no significant differences, indicating that the included women had representativeness to a certain extent. Our study was retrospective in nature, experiencing the change of diagnostic criteria of GDM, women were followed up only once at different postpartum years, and lack of data between perinatal and follow-up time may lead to the difficulty of acquiring the exact incidence of hyperglycemia in different postpartum years. We could only get the prevalence, but the small sample size in some postpartum years might influence the accuracy. HOMA-IR and HOMA- HOMA2-\u03b2 , 22 base\u03b2-cell function contributes more to T2DM development.In conclusion, women with previous GDM are still at a greater risk of developing prediabetes and even T2DM in long-term postpartum. 75\u2009g OGTT 2\u2009hPG during pregnancy higher than 9.03\u2009mmol/L is regarded as an independent risk factor of postpartum hyperglycemia. Entering postpartum stage, insulin resistance with insufficient insulin secretion compensation is still common phenomenon during long-term postpartum. Women with severe insulin resistance during postpartum are more likely to develop prediabetes, but decreased"}
+{"text": "The contributions of the humoral immune response to melanoma are now widely recognized, with reports of positive prognostic value ascribed to tumor-infiltrating B cells (TIL-B) and increasing evidence of B cells as key predictors of patient response to treatment. There are disparate views as to the pro- and anti-tumor roles of B cells. B cells appear to play an integral role in forming tumor-associated tertiary lymphoid structures (TLSs) which can further modulate T cell activation. Expressed antibodies may distinctly influence tumor regulation in the tumor microenvironment, with some isotypes associated with strong anti-tumor immune response and others with progressive disease. Recently, B cells have been evaluated in the context of cancer immunotherapy. Checkpoint inhibitors (CPIs), targeting T cell effector functions, have revolutionized the management of melanoma for many patients; however, there remains a need to accurately predict treatment responders. Increasing evidence suggests that B cells may not be simple bystanders to CPI immunotherapy. Mature and differentiated B cell phenotypes are key positive correlates of CPI response. Recent evidence also points to an enrichment in activatory B cell phenotypes, and the contribution of B cells to TLS formation may facilitate induction of T cell phenotypes required for response to CPI. Contrastingly, specific B cell subsets often correlate with immune-related adverse events (irAEs) in CPI. With increased appreciation of the multifaceted role of B cell immunity, novel therapeutic strategies and biomarkers can be explored and translated into the clinic to optimize CPI immunotherapy in melanoma. During early stages, primary melanoma lesions are removable through surgical intervention that is largely curative. In advanced disease however, melanoma can spread to regional lymph nodes and metastasize to distant sites. Historically, treatment options were limited in advanced disease to palliative cytotoxic chemotherapy, leading to poor 5-year survival rates. Over the last decade, immunotherapy, driven by checkpoint inhibitor antibodies, has transformed patient prognosis.via activation of different immune-inhibitory pathways, including via immune checkpoint molecules and their downstream signals. Physiologically, checkpoint pathways play a role in immune homeostasis, providing negative feedback stimuli to prevent autoimmune reactivity. The best-studied checkpoint pathways are those of negative regulatory molecules cytotoxic T lymphocyte associated protein-4 (CTLA-4) and of the Programmed Death Receptor 1 (PD-1) and its ligands PD-L1 and PD-L2.The rationale behind the use of checkpoint inhibitor therapy lies in the highly immunogenic nature of melanoma , 2. MelaCheckpoint inhibitors (CPIs) were designed to promote immune-mediated elimination of tumor cells through modulation of T cell responses. Anti-CLTA-4 (Ipilimumab approved in 2011)  or anti-Despite the undeniable clinical success of CPI therapy several challenges remain. There is currently a lack of biomarkers, limiting our ability to predict who will respond to treatment. Another important consideration is recognizing who will develop toxicities that are unfortunately common particularly with anti-CTLA-4 treatment and in the context of combination anti-CTLA-4 and anti-PD-1 therapy as compared with monotherapy. These toxicities, known as immune related adverse events (irAEs) vary in severity, can affect any organ system but most commonly target the skin, the gastrointestinal and the endocrine systems . AlthougThe role of T cells in CPI therapy has been extensively reviewed in literature. Contrastingly, B cell immunity has been less studied. B cells have a wide range of roles, including critical functions as professional antigen presenting cells (APCs), and they are capable of secreting cytokines and antibodies which enable them to conduct antibody-dependent cell-mediated cytotoxicity (ADCC), antibody-dependent cellular phagocytosis (ADCP) and complement-dependent cytotoxicity (CDC). Considering their comprehensive functions and with B cells making up one of the two arms of the adaptive immune system, it is not surprising to envisage a role within melanoma immunity and response to CPI. However, the exact role B cells play in tumor immunity is unclear with the existence of different cell subsets with juxtaposing functions, such as activatory and regulatory B cells (Bregs), and the presence of B cells in tertiary lymphoid structures (TLSs). The potential pro- and anti-tumor roles of B cells in melanoma are summarized in via an APC, but also on the presence of a costimulatory second signal, typically through binding of CD28 on the T cell to CD80/86 on the APC. CTLA-4 is a competitive CD28 homolog that has a higher affinity to CD80 (B7-1) and to a lesser degree CD86 (B7-2) than CD28 therefore inhibiting T cell co-stimulation . Like CTLA-4, PD-1 is thought to be a negative regulator of T cell function, regulating peripheral tolerance and T cell responses. PD-1 is expressed more broadly than CTLA-4 and can be found on T cells, B cells, natural killer (NK) cells, and a variety of peripheral tissues . Expressvia SHP2 and converge to inhibit downstream P13K signaling  can be thought of as a distinct complex \u201corgan\u201d which contains an array of different cells, such as immune cells, tumor-associated vasculature and lymphatics, fibroblasts and pericytes . The immLymphocyte activation typically occurs in secondary lymphoid structures which include lymph nodes, the spleen and mucosal-associated lymphoid tissue . During + stromal B cells per mm2 tumor  or may reflect the confounding presence of immunosuppressive regulatory B cells.In accordance with expectations arising from these anti-tumor properties, the percentage of tumor-infiltrating and peritumoral B cells have been found to positively correlate with more favorable patient survival in the vast majority of melanoma cohort studies , 43, 44.Several studies have demonstrated the enriched presence of various differentiated B cell phenotypes such as memory, plasmablasts (PBs) and plasma cells within melanoma tumors. Elevated percentages of PBs (short-lived cells and part of the rapid antigen response) have been reported in the circulation of patients with melanoma compared to blood from healthy individuals. PBs are short-lived cells and part of a rapid antigen response. Although PBs have a potentially positive role in melanoma, the functional plasticity of these cells may result in transient switching to a \u201cregulatory\u201d pro-tumor phenotype owing to expression of TGF\u03b2 and IL-10 by this cell subset .+ CD19++ regulatory B cell subset has been identified in mice which strongly resembles MZ cells and protects against colitis, through interactions with Tregs (via their polarized cytokine expression.IL-10-producing \u201cregulatory\u201d B (B10) cells  have beeth Tregs . These ovia TGF\u03b2 secretion (+ and IL-10+), and that tumor-derived antigens in general could induce B cell IL-10-expression  into wild-type mice significantly exacerbated B16F10 melanoma growth, illustrating that IL-10-producing B cells can directly contribute to melanoma tumor-progression . A separTumor-infiltrating regulatory B cells therefore represent a potential mechanism of tumor-mediated immune escape that in certain conditions may outweigh antigen-presentation and anti-tumor antibody-mediated effector mechanisms to skew the overall impact of B cell infiltrates towards a neutral or even a negative effect, and mandates studies into the induction of regulatory B cells in melanoma patients and correlation with overall survival.Consistent with the contributions of regulatory B cells, the microenvironments of melanoma solid tumors are characteristically considered as harboring Th2-biased cytokine expression profiles , typicalin vitro that these Th2-biased microenvironments favor alternatively activated humoral immunity which confers a shift in B cell antibody expression towards IgG4  gene was found to correlate with lack of response to anti-CTLA-4 but this was not shown in the context of anti-PD-1 therapy (versus neoadjuvant Nivolumab plus Ipilimumab (n = 12)] ]  also hign = 12)]  and foun outcome . Since mlo B cell sub-populations : particularly a significant decrease in circulating B cells in patients who underwent combination CPI as opposed to those treated with a monotherapy anti-CLTA-4 or anti-PD-1 . No signulations . Of note-4 agent . Detailein vitro (There is some evidence that plasmablasts (PB) may be directly modulated by CPI. Circulating plasmablast levels were significantly enhanced in patients undergoing treatment with anti-CTLA-4 immunotherapy . When imin vitro . In thisin vitro .versus biopsies from non-responders  have the potential to engender anti-tumor effects, mediating ADCC, ADCP, CDC or to support antigen presentation by mediating the uptake of tumor antigens by APCs such as macrophages and dendritic cells . Furtherarcinoma . IgG claarcinoma  and othearcinoma \u201387.\u03b3RIIbs) in the TME and downstream immunoreceptor tyrosine-based inhibitory motif (ITIM) domain signalling  compared to other isotypes . Furthermore B cells expressing IgG3 isotype antibodies usually undergo less antibody SHM, and therefore IgG3 antibodies may have lower affinity for the target antigen while still able to occupy FcRs . IgG2 hamelanoma , 67, 71.\u03b2 supporting IgA class switch. Melanoma-associated IgA has been found to correlate with poor clonality, suggesting that, in the tumor, class switching to IgA is a consequence of inflammation and not of an antigen-driven response, and that tumor-associated IgA could be non-tumor specific , Nivolumab plus Ipilimumab (10%), or Ipilimumab (4%). A positive correlation with progression-free survival (PFS) was found for high titers of total IgG, IgG1, IgG2, and IgG3, while a positive correlation with overall survival (OS) was found to be significant only for the IgG2 subclass . This rei.e., different patients raising antibodies against shared or similar epitopes. Moreover, when antibody lineages were analyzed and compared among patients, antibodies with high sequence similarity were found, suggesting these antibodies may have arisen from convergent selection and that the patients may be producing antibodies against shared epitopes. Of note, IgG2 was the most frequent isotype of these antibodies. Furthermore IgG2 was higher in responders compared to non-responders , the responder group had higher titers of antibodies specific for the tumor-associated antigens MDA  and the Cancer-Testis antigen NY-ESO-1 at baseline, compared to non-responders. Serum analyses showed that NY-ESO-1, TRP1/TYRP1, and TRP2/TYRP2 specific antibodies consisted of several IgG subclasses while the IgG antibodies for MelanA were mostly IgG1 and the antibodies for gp100 were of the IgG2 isotype . InteresIn patients with metastatic melanoma who were treated with anti-CTLA-4 combined with anti-angiogenic VEGF-A-targeted treatment, there was an increase of antibody titers recognizing the immunoregulatory protein Galectin-1 . Anti-Gal-1 antibody titers in turn correlated with better disease outcome. Higher frequencies of complete or partial responses and improved overall survival were seen in these individuals. Gal-1 has been reported to be up-regulated in many tumor types including melanoma and is usually associated with poorer survival, contributing to tumor growth, angiogenesis, metastasis, and immune evasion .Taken together, these results suggest that checkpoint blockade-associated restoration of T cell activity may also contribute to increasing the effectiveness of the humoral response and highlights the importance of the expressed antibodies as part of the anti-tumor activity. Furthermore, these studies suggest that melanoma-specific antibodies in pre-treatment sera may be promising indicators of CPI immunotherapy response and require further study.de novo events or whether they represent an unmasking of underlying immune mediated disease remains unclear , liver (hepatitis), lung (pneumonitis), and endocrine systems, including hypophysitis and insulin-dependent diabetes. The effects of anti-CTLA4 associated irAEs are generally more severe than those from anti PD-1 inhibition. Whether irAEs represent  unclear .lo B cell subsets in patients given combination checkpoint inhibition (Modulation of B cell phenotype has been correlated with irAE in patients undergoing CPI therapy. A recent study (described above) demonstrated an overall decline in B cell numbers but increased plasmablasts and CD21hibition Table 1 hibition . These Cvia multiple mechanisms including as antibody secreting cells, cytokine producers, APCs, and immunoregulators. Given the important role of the checkpoint pathways in regulating immune homeostasis, it is not surprising that activation of the CTLA-4 pathway has been extensively studied in the treatment of autoimmunity. Specifically Abatecept, a fusion protein of CTLA-4 and IgG1 Fc portion (CTLA-4-Ig), is approved for abrogating immune overactivity in rheumatoid arthritis ; The Guy\u2019s and St Thomas\u2019s Foundation Trust Charity Melanoma Special Fund (573); CRUK/NIHR in England/DoH for Scotland, Wales, and Northern Ireland Experimental Cancer Medicine Centre (C10355/A15587); Breast Cancer Now ;\u00a0the Medical Research Council (MR/L023091/1); Cancer Research UK .\u00a0The research was supported by the National Institute for Health Research (NIHR) Biomedical Research Centre (BRC) based at Guy\u2019s and St Thomas\u2019 NHS Foundation Trust and King\u2019s College London (IS-BRC-1215-20006).\u00a0The authors are solely responsible for study design, data collection, analysis, decision to publish, and preparation of the manuscript. The views expressed are those of the author(s) and not necessarily those of the NHS, the NIHR, or the Department of Health.SNK and JFS are founders and shareholders of Epsilogen Ltd. HJB is now employed through a fund provided by Epsilogen Ltd.The remaining authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest."}
+{"text": "Bleeding in the anterior pituitary lobe leading to tissue necrosis occurs in the acute stage of severe clinical forms of hemorrhagic fever with renal syndrome (HFRS), while atrophy of the anterior pituitary lobe with diminution of the gland function occurs after the recovery stage. The relationship between Hantaan virus infection and empty Sella syndrome (ESS) has rarely been reported.This patient was a 54-year-old previously healthy Chinese male. He presented with fever, headache, and backache with dizziness and oliguria. Physical examination was notable for hypotension and the signs of conjunctival suffusion. His platelets decreased, and his urine protein was positive. Hantaan virus IgM and virus RNA were positive.He was diagnosed as having HFRS. In his diuretic phase, his 24-hour urine volume was maintained at 10,000\u200amL, and his blood pressure was higher for a week. Then, he was diagnosed as having ESS after a series of examinations.Hormone replacement therapy was given to this patient after the diagnosis \u201cESS\u201d was made.The patient's symptoms improved, and he was discharged from the hospital soon after hormone replacement therapy.Pituitary function examination and brain magnetic resonance imaging (MRI) need to be considered to scan for ESS and panhypopituitarism in the patients with HFRS accompanied by diabetes insipidus. The most common symptom of ESS is headache. Generally, the headache is deep, dull, and centrally situated. Sometimes headache is very severe, along with giddiness and vomiting before imaging examination.The term \u201cempty sella\u201d was first used in 1951 for the neuroradiological or pathological-anatomical exposure of an apparently empty sella turcica. Empty sella syndrome (ESS) is pathophysiologically characterized by either anatomic abnormalities in the diaphragma sellae (primary ESS), damage to the pituitary by irradiation/surgery, or autoimmunity leading to the availability of \u201cempty\u201d space in the sella (secondary ESS). Empty sella is the neuroradiological or pathological finding of an apparently empty sella turcica containing no pituitary tissue. The prevalence of primary empty sella, that is, empty sella without any discernible cause, is not precisely known; estimates range from 2% to 20%. Technical advances in neuroradiology have made empty sella an increasingly incidental finding. Improvements in neuroradiological imaging techniques have resulted in an increase in the incidental finding of \u201cempty sella.\u201d According to current data from India, an empty sella turcica without any detectable cause is an incidental finding in approximately 2% of all cerebral MRI scans. In asymptomatic adult patients, the question is whether and to what extent diagnostic hormone testing should be undertaken in an incidental finding of an empty sella, particularly as this does not necessarily have pathological significance.In primary ESS, the sella tends to be symmetrically ballooned without evidence of bony lesions. The suprasellar subarachnoid space herniates through an incomplete sellar diaphragm. Cisternography, high resolution computed tomography (CT) scanning, or magnetic resonance imaging (MRI) is used for diagnosis. The signs and symptoms depend upon the size, secretion, and pressure over the pituitary gland. Before the era of CT scan, many cases of empty sella were wrongly diagnosed.The causes of most of the primary ESS are still not clear. Hemorrhagic fever with renal syndrome (HFRS) is an acute infective multisystemic disease followed by fever, hemorrhages, and acute renal insufficiency. Bleeding in the anterior pituitary lobe leading to tissue necrosis occurs in the acute stage of severe clinical forms of HFRS, while atrophy of the anterior pituitary lobe with diminution of the gland function occurs after the recovery stage. The relationship between Hantaan virus infection and ESS has rarely been reported, especially in the acute stage.Herein, we present an adult case with ESS induced by HFRS. He was cured after supportive treatment and hormone replacement therapy.2This patient was a 54-year-old, previously healthy Chinese male with no significant past medical history and surgical history. He lived in a rural area with a high incidence of HFRS. He presented with fever, headache, and backache for 5 days in winter, the epidemic season of HFRS. He suddenly experienced fever up to 40\u00b0C. He sometimes felt ocular pain without visual disturbance. He felt dizzy, but he did not have his blood pressure examined. He exhibited oliguria during the last 3 days, but his urine output was not clear. Vomiting and abdominal pain were experienced.Physical examination was notable for a blood pressure of 88/53\u200amm Hg, weight\u200a=\u200a62\u200akg, height\u200a=\u200a5\u20327\u2033, and body mass index\u200a=\u200a21.5. His body temperature recovered to the normal level of 37\u00b0C. Signs of conjunctival suffusion  were found.Laboratory test results were as follows. Routine blood examination showed WBC of 55,000\u200acells/mL, percentage of neutrophils of 61.9%, and platelets of 93,000\u200acells/mL. The urine examination showed strong positive protein. Liver enzymes were increased . Renal function was abnormal . The reverse transcriptase-polymerase chain reaction (RT-PCR) Hantaan virus test result was positive. The Hantaan virus antibody IgM result was positive, while the Hantaan virus antibody IgG was negative. However, the result of antibody IgG to Hantaan virus was positive a week later and the titer of antibody IgG increased 4 times compared with that of the first test. The C-reactive protein (CRP) level was 105\u200amg/L (0\u20133.5), and the serum procalcitonin (PCT) was 1.3\u200a\u03bcg/L (0.05\u20130.5).The urine output during the first 24-hour admission in our department was less than 200\u200amL. He was diagnosed as overlapping hypotensive phase and oliguric phase of HFRS. After supportive measures treatment, the patient progressed into the diuretic phase within a week. The regular blood cell test result was normal. His urine volume was significantly higher than normal, the 24-hour urine volume was maintained at 10,000\u200amL, and his blood pressure was obviously higher than his usual level for a week. He felt fatigued and lost his appetite. Then, the examination of pituitary function was performed. All of the results were much lower than the reference range . The brain MRI result showed that signals of cerebrospinal fluid could be observed in sella . His urine amount and the results of pituitary function tests recovered to the normal range, and the only discomfort \u2013 fatigue \u2013 disappeared 1 month later.3,6 During 1950 to 2014, the death rate of HFRS was reported as 2.89%, according to the statistical data from the National Health and Family Planning Commission of China.HFRS is a zoonotic disease caused by pathogenic hantaviruses. China is the most seriously affected country, with more than 10,000 cases reported annually, and accounts for over 90% of all cases worldwide. Serum PCT levels are much higher in bacterial, fungal, and parasitic infections than in viral infections or noninfected patients. In epidemic areas, HFRS patients with typical symptoms and routine laboratory findings could soon be diagnosed by experienced professional doctors. However, some cases need a differentiated diagnosis from severe bacterial infection, such as septicemia. The inflammatory biomarkers increased obviously in this case. Elevated levels of CRP and PCT are present in more than 90% of patients with HFRS. The elevated level of PCT in HFRS may be related to immune activation caused by hantavirus. Elevated CRP levels were observed in patients with hantavirus infection. Whether the elevated CRP and PCT are associated with the severity of HFRS remains a controversial issue.\u201312 It is well accepted that the main clinical hallmarks of HFRS are renal failure and hemorrhagic manifestations and that the disease is characterized by laboratory findings indicating renal function impairment, thrombocytopenia, and elevated ALT levels.CRP, secreted by the liver in response to bacterial infections, is a parameter used to diagnose infection. PCT, a precursor of calcitonin, is a diagnostic marker of the systemic inflammatory response, with a high sensitivity and specificity for infection. PCT and CRP have been used as new approaches to identify different types of infection. In a comparative analysis of 897 cases of HFRS, pituitary hemorrhage was revealed at autopsy in 36.8% of the patients, and pituitary necrosis in 5.2%. However, reports about pituitary involvement among survival cases with HFRS are not very common . For the most part, pituitary hemorrhage and necrosis were found in cases of death with HFRS via autopsy studies. On the contrary, treating hormonal dysregulation has a positive effect on morbidity and quality of life. In the diuretic phase of HFRS, patients need to be monitored carefully. The pituitary function and brain MRI examinations need to be considered to scan ESS and panhypopituitarism in the patients with HFRS accompanied by diabetes insipidus. Appropriate hormone replacement therapy could help the patients achieve relief quickly.It was recommended that overdiagnosis of empty sella should be avoided, as this might upset patients unnecessarily, and it also incurs substantial expense to the healthcare system.The authors thank the radiological technicians and neurosurgeons for their efforts in the clinical diagnosis and management of this patient.Conceptualization: Yang Wang.Data curation: Yuxiang Li, Yang Wang.Funding acquisition: Yang Wang.Investigation: Peng Zhang.Resources: Yuxiang Li.Software: Peng Zhang.Validation: Yang Wang.Visualization: Yang Wang.Writing \u2013 original draft: Haiying Chen, Peng Zhang.Writing \u2013 review & editing: Yang Wang."}
+{"text": "After thermocycling, Novaloc\u2019s RFs decreased by 33% (p < 0.001) while the Locators\u2019 RFs increased by 34% . In contrast to LP, the RFs of Novaloc abutments and LOs predominantly showed no clinically relevant dependence on implant angulation. Ageing processes tended to result in lower RFs at higher implant angulation. Thus, the Novaloc attachment system offers an alternative to Locator attachments. It is characterized by a comparatively continuous RF-curve over the entire wearing period. Future clinical studies have to be conducted to verify the in vitro demonstrated advantages of the Novaloc system.Removable implant-anchored dentures have become an established treatment concept especially for older, multimorbid patients. This study investigates the retention force (RF) of two different attachment systems. A total of 96 specimens (n = 8 for each condition) were fabricated and RF was measured under different conditions: fatigue , thermal undulation  and implant-angulation . The Novaloc system ((N), 0\u00b0 and 15\u00b0 abutments, yellow matrix (Y)) was compared to the Locator system ((L), pink (P) and orange (O)). Initial RFs (8.57 \u00b1 0.99 N (NY), 19.39 \u00b1 8.10 N (LP), 8.8 \u00b1 5.28 N (LO)) were reduced by ageing simulation (26% (NY), 66% (LP), 89% (LO);  In geriatric dentistry, the removable implant-anchored denture represents an established treatment concept. The insertion of two interforaminally positioned endosseous implants has become an established method for secure anchorage of a full denture ,2,3,4, yDepending on the jawbone content, deviations of the implant axes ranging from 0.5\u00b0 to 27\u00b0 in the horizontal and between 0.1\u00b0 and 12.9\u00b0 in the sagittal direction were found in everyday clinical practice ,15. MoreWear and the consequent loss of retention is basically the most frequent prosthetic complication with all individual connecting elements. Since retention and wear behavior are crucial for patient satisfaction , many stThus, the objective of the present study was to compare the Novaloc and Locator attachment systems with respect to retention behavior before, during, and after simulated ageing at different implant angulations. Matrix inserts with approximately equal retention forces according to the manufacturer\u2019s specifications were used. As a primary null hypothesis, it was assumed that for the selected matrices, the initially measured pull-off forces correspond to the manufacturer\u2019s specifications, regardless of the implant angulation, and that the retention forces among the different abutment systems are approximately the same, according to the selection. The second null hypothesis assumed that no clinically relevant retention force changes occur due to ageing simulations on the attachment systems. As the third null hypothesis, it was assumed that with the Straumann Novaloc Retentive System, there is no difference between a 15\u00b0 secondary part at an implant angulation of 15\u00b0 (20\u00b0) and a 0\u00b0 secondary part at 0\u00b0 (5\u00b0) angulation.A detailed list of the system-specific components used can be found in Sample size calculation was based on the results of Stephens et al., M\u00ednguez-Tom\u00e1s et al., and Elsyad et al. ,27,28, wA specimen basically consisted of two parts. The lower part of the specimen simulated the patient\u2019s jaw. It contained the implant analog  with the screw-retained abutments (N and L). Especially for this purpose, metal blocks of stainless steel (68 mm \u00d7 20 mm \u00d7 20 mm) were fabricated with exactly matching drill holes for all implant angulations to be tested b. The maAll retention force measurements were obtained on the universal testing machine. Part 1 of the specimen was attached to the lower traverse, and part 2 of the sample was fixed manually onto the patrix. A hook that could be screwed into the axial course of the specimen holder part 2, ; I facilAll specimens were subjected to an ageing simulation after the initial pull-off forces were determined. For this purpose, 10,000 insertions and removals of a denture were simulated in the chewing simulator. After every 100, 200, 500, 1000, 5000 and 10,000 cycles, the specimens were removed and retention force measurements were taken on the universal testing machine. The simulation was performed in a saliva bath mixture . Finally, all specimens (part 2) were artificially aged in the thermocycler with 5000 alternating cycles between a hot (55 \u00b0C) and cold (5 \u00b0C) bath of distilled water. The immersion time was 30 s, and the dripping time was 17 s.x-axis) were taken and, using the formula proposed by Petropoulus et al. [To verify a statement about the release period and possible differences in the separation of the respective attachment systems, three force-displacement diagrams of each initial specimen combination from the initial pull-off tests were evaluated, as shown in s et al. , the relApart from the material, the geometry of the abutments or matrices influences the retention force. Dimensional changes caused by wear can cause retention force changes. To verify these, all matrices were measured by light microscopy initially and after simulated ageing  in accordance with the illustrations .At all measurement time points, 20 pull-off values were created for each specimen; thus, the sample size per test series and measurement time point was n = 160. All data were listed in Excel, transferred to the SPSS program , and descriptively analyzed in terms of the following problems:In accordance with the matrix color coding, the initially measured values were averaged and compared with the manufacturer\u2019s specifications. Any deviations were stated as percentages.t-test for paired samples was used to check for significances.On the basis of the matrix color coding, the initial mean values were compared with the mean values after insertion and removal simulation and after thermal cycling. The Kolmogorov\u2013Smirnov and Shapiro\u2013Wilk tests were used to check the results of the individual test series for normal distribution. Levene\u2019s test was used to check for homogeneous variances. The t-test was applied to independent samples. For all comparisons, the effect sizes were calculated using values from the test statistics (t-tests) according to Dunlap et al. [Since, according to the manufacturer\u2019s specifications, matrices of medium retention forces were used in this study, the various test series were also compared with each other at the same measurement time points. Here, the p et al. .Influence of artificial ageing according to matrix color coding and implant angulationp-values due to an extremely large sample size, the 20 pull-off values per sample and measurement time point were averaged for statistical comparisons. After testing for normal distribution and variance homogeneity , single-factor analysis of variance (ANOVA) with repeated measurements was used to check for significances. In the absence of homogeneity of variances, Welch ANOVA with Dunett T3 post-hoc test was used.In order to avoid distorted Under the given conditions, the t-test (ANOVA) for independent samples was used to compare the mean retention force values within an attachment system at different angulations. This comparison of the retention forces was performed per angulation initially, after 10,000 insertions and removals, and after thermocycling.p \u2264 0.05), the comparison was carried out by means of the Mann\u2013Whitney U test.For the comparisons, the release periods per attachment system were summarized on average. Due to missing preconditions  of the differently coded matrices are shown in The pull-off value of the yellow Novaloc matrix is specified as medium in the product description and defined at 12.01 N. On average, the yellow Novalocs initially achieved a 28.64% lower value, independent of the angulation. In contrast, the initially measured retention value of 19.39 N of the pink Locator matrices was 45.35% higher than the specified 13.34 N. On average, only the orange Locator matrices initially reached the specified manufacturer value.p < 0.001) in the pink Locators and 89% (p < 0.001) in the orange matrices. For the Novaloc system, the retention force was reduced by an average of 26% (p < 0.001). For all three attachment systems, a strong effect is confirmed with d > 1 in the mean value comparisons.In comparison with the average initially measured retention force values , simulatp = 0.002) and orange (p = 0.148) Locators, the thermocycling process produced an average retention force increase of 34%. On the Novalocs, on the other hand, the values decreased by 33% (p < 0.001) compared to the initial values. The significances of these differences (p \u2264 0.05) were confirmed by a strong effect size (d > 0.9).Compared to the initial measurements for the pink (p = 0.824). After 10,000 cycles, there was no difference in retention force between the pink Locator system and the Novaloc system (p = 0.227). All remaining comparisons as well as the average retention forces after thermocycling showed differences with clinical relevance (p < 0.001).Mutual comparisons of the independent test series show that, on average, only the initial values of the Locator system with the orange matrix inserts did not differ significantly from the Novaloc system with yellow matrix inserts . Some of them showed slightly lower retention forces after the ageing process of 10,000 cycles in specimen combinations with higher implant angulations (p \u2265 0.05).On the straight Novaloc abutments, no significant differences were initially verified with various angulations (ulations . This cop \u2265 0.05). Only after 10,000 insertion and removal cycles, a slightly (~1.13 N) smaller average retention force (p = 0.031) was determined at an implant angulation of 20\u00b0.The orange Locator matrix inserts showed no significant differences initially and after thermocycling . The only exception was the comparison of NY-15\u00b0/IA-15\u00b0 to NY-0\u00b0/IA-0\u00b0 with 10,000 insertions and removals .Comparisons of the Novaloc combinations (NY-15\u00b0/IA-15\u00b0 to NY-0\u00b0/IA-0\u00b0 and NY-15\u00b0/IA-20\u00b0 to NY-0\u00b0/IA-5\u00b0) with theoretically identical positioning of the Novaloc abutments relative to the matrix or denture pull-off direction showed no significant differences (p < 0.001). The longest release periods were found in the Locator system with the pink matrix inserts . Between these groups, the mean value of the Locator system with the orange matrices was 0.00368 min and that of the angled Novaloc abutment was 0.00397 min. Statistically, the differences between NY-0\u00b0 and LO-0\u00b0 (p = 0.658) and between NY-15\u00b0 and LO-0\u00b0 (p = 0.065) could not be confirmed.As shown in In general, wear is characterized by mechanically and partially chemically induced surface material loss . Wear-inThe null hypothesis that the pull-off forces, according to the matrix color coding, correspond to the manufacturers\u2019 specifications had to be partially rejected. As shown in Both the average retention forces  and the retention force curves of the individual test series basically showed a continuous, statistically significant loss of retention force from 1000 insertion and removal cycles onwards. Consequently, the second null hypothesis also had to be rejected. However, in the opinion of the authors, a retention force loss of 26% is not clinically relevant, or is relevant only to a limited extent. Moreover, in the literature, the reported relative retention force losses after artificial ageing range from 21% to 78.62% for Locator attachment systems ,36,37,38Besides the angulation of implant abutments, varying designs of matrices were presented in the last years to compensate implant divergence. Thus, future studies might evaluate the retentive behavior of angulated abutments of the Novaloc system in comparison to abutments with another construction principle, for example the OT Equator system . The Equator system in combination with the smart-box abutment system allows due to a tilting mechanism with a rotation fulcrum the passive insertion up to 50\u00b0 implant angulation. Both in vitro and in vivo studies found this system to reveal acceptable results ,44.In assessments based on the mean values, thermocycling produced a significant and clinically relevant increase in retention force, specifically for the Locators, in both the initial and in the retention force values after artificial ageing. For the Novalocs, on the other hand, the initial values and the values after artificial ageing decreased . These vBy adding additives (fibers etc.), the mechanical properties, or possibly the retention force, can be improved or changed. Consequently, however, the sensitivity to hydrolysis would increase due to the formation of macroscopically or microscopically small gaps between the matrix and additive. Liquids can be absorbed into the resulting spaces by capillary action. However, the manufacturer did not provide a definitive statement regarding the composition; thus, there is no information on changes to any new batches. Clinical applications often show heavy wear of the Locators ,42, whicp \u2264 0.05), were not clinically relevant  difference after 10,000 insertions and removals was nearly 1 N, which is not clinically relevant. The retention force is ensured by the angle compensation of the Novaloc abutment, such that the same conditions exist with regard to undercuts and the pull-off direction.The third null hypothesis, that there is no difference between a 15\u00b0 secondary part at an implant angulation of 15\u00b0 (20\u00b0) and a 0\u00b0 secondary part at 0\u00b0 (5\u00b0) angulation on the Novaloc attachment system, could be confirmed. The statistically quantified , but is not reflected by a noticeably greater loss of retention force. The nonetheless higher wear verified in the marginal area of the yellow matrices may be due to the different shapes of the occlusal and lateral surfaces on the part of the manufacturer when compared to the straight Novaloc abutment. This is especially pertinent since microscopically, a tendency toward increased widening with greater implant angulation can be noticed  with currently introduced attachment systems that consist of matrices with a tilting mechanism .Within the limits of this study design, the following conclusions can be drawn:"}
+{"text": "Therapeutic lymphangiogenesis in an orthotopic lung transplant model has been shown to improve acute allograft rejection that is mediated at least in part through hyaluronan drainage. Lymphatic vessel endothelial hyaluronan receptor (LYVE-1) expressed on the surface of lymphatic endothelial cells plays important roles in hyaluronan uptake. The impact of current immunosuppressive therapies on lung lymphatic endothelial cells is largely unknown. We tested the hypothesis that FK506, the most commonly used immunosuppressant after lung transplantation, induces lung lymphatic endothelial cell dysfunction..Lung lymphatic endothelial cells were cultured in vitro and treated with FK506. Telomerase activity was measured using the TRAP assay. Protein expression of LYVE-1 and senescence markers p21 and \u03b2-galactosidase was assessed with western blotting. Matrigel tubulation assay were used to investigate the effects of FK506 on TNF-\u03b1-induced lymphangiogenesis. Dual luciferase reporter assay was used to confirm NFAT-dependent transcriptional regulation of LYVE-1. Flow cytometry was used to examine the effects of FK506 on LYVE-1 in precision-cut-lung-slices ex vivo and on hyaluronan uptake in vitro, FK506 downregulated telomerase reverse transcriptase expression, resulting in decreased telomerase activity and subsequent induction of p21 expression and cell senescence. Treatment with FK506 decreased LYVE-1 mRNA and protein levels and resulted in decreased LEC HA uptake. Similar result showing reduction of LYVE-1 expression when treated with FK506 was observed ex vivo. We identified a putative NFAT binding site on the LYVE-1 promoter and cloned this region of the promoter in a luciferase-based reporter construct. We showed that this NFAT binding site regulates LYVE-1 transcription, and mutation of this binding site blunted FK506-dependent downregulation of LYVE-1 promoter-dependent transcription. Finally, FK506-treated lymphatic endothelial cells show a blunted response to TNF-\u03b1-mediated lymphangiogenesis.In vitro. The implications of our findings on the long-term health of lung allografts merit more investigation.FK506 alters lymphatic endothelial cell molecular characteristics and causes lymphatic endothelial cell dysfunction in vitro and ex vivo. These effects of FK506 on lymphatic endothelial cell may impair the ability of the transplanted lung to drain hyaluronan macromolecules in vivo Lung transplant carries the worst outcome of any solid organ transplant with a 60% 5-year survival  is a mainstay of immune-suppression in lung   were cultured in microvascular cell culture media with supplements . All experiments were done with LEC between passages 3 to 5. FK506  and Cyclosporin A  were reconstituted with DMSO and used at indicated concentrations. At the 48\u2009h time point, FK506 did not affect LYVE-1 protein levels  assay  per manufacturer\u2019s instruction and as we have previously described -124/+\u2009124 wildtype (NFATc binding site \u2013 ttttcc) and P-124/+\u2009125 mutant (NFATc binding site \u2013 ttgtcc) constructs. Reverse transfection was carried out on a total of 20,000 HEK-293\u2009T cells using X-tremeGENE HP DNA Transfection Reagent (Sigma). Cells were transfected with 5\u2009ng of pRL_CMV vector  and 95\u2009ng of P-124/+\u2009214 (wildtype or mutant) construct or pGL3_Basic vector (negative control). Cells were treated with 15\u2009ng/mL of FK506 at 6\u2009h post-transfection, and luciferase activity was tested 24\u2009h after transfection using Dual-Glo Luciferase Assay System kit (Promega) as per manufacturer\u2019s protocol. Biotek Synergy HT microplate reader  with Biotek Gen5.1.1 microplate data collection software was used for luciferase luminescence detection. Each transfection was carried out in triplicates in 4 independent experiments.Matrigel tubulation assays were conducted as we previously described 12Nrud/J mice  were obtained as previously described , hyalurodinase , and DNase I  for an hour at 37\u2009\u00b0C. Cells were then washed twice with cold FACS buffer (PBS with 1% BSA), and incubated with purified rat anti-mouse CD16/CD32 Fc block solution  for 20\u2009min at 4\u2009\u00b0C, followed by incubation with anti-LYVE1 monoclonal antibody conjugated with PE-Cyanine7  for 30\u2009min at 4\u2009\u00b0C. Lastly, cells were washed twice with FACS buffer and subjected to flow cytometry analysis.t-tests were conducted. Telomerase activity in control and FK506 (15\u2009ng/ml)-treated cells was compared using a paired, two-tailed Student\u2019s t-test. A P value of less than 0.05 was considered significant.All experimental data are presented as the mean\u2009\u00b1\u2009SEM. For analysis of western blot and q-PCR data, one-way repeated measure ANOVAs (RM ANOVA) (within-subjects factor: treatment) were run, followed by Tukey\u2019s post-hoc test to evaluate treatment effect according to dose of FK506 (10 or 15\u2009ng/ml). To compare immunofluorescent intensity values between positive control and FK506 (15\u2009ng/ml)-treated cells, two-tailed Student\u2019s FK506 inactivates calcineurin, which blocks the dephosphorylation of NFAT, a necessary step for its nuclear translocation and subsequent transcription activation. To confirm that FK506 blocks NFAT nuclear translocation in lung LEC, we treated LEC with FK506 and showed with cell fractionation that treatment resulted, as expected, in decreased NFAT nuclear translocation  is a key enzyme involved in telomere maintenance . Treatment with FK506 resulted in a reduction in luciferase activity, which was not observed in pGL3_Basic vector with no NFAT binding sites , and a significant reduction (p\u00a0<\u20090.05) in the response to FK506 compared to the wildtype construct  compared to pGL3_Basic vector alone  decreased TERT expression and telomerase activity, which was associated with increase in LEC senescence; 2) decreased LYVE-1 expression and LEC HA-uptake and 3) inhibited TNF-\u03b1-induced lymphangiogenesis.Calcineurin inhibitors, including FK506, are currently the mainstay of immunosuppression in lung transplantation, with important effects on T-cell function and prevention of allograft rejection  for 48H. Molecular weight (kDa) for each protein is indicated on the right. Ratio of LYVE-1 to \u03b2-actin density was expressed as fold-change relative to control. Data represent mean\u2009\u00b1\u2009SEM of three independent experiments, consisting of one technical replicate each. Supplementary Figure\u00a02. FK506 prevents NFAT nuclear translocation. Lung lymphatic endothelial cells were treated as indicated. Samples of protein lysates (Entry: 27%), and nuclear (27%) fractions were separated by SDS-PAGE and transferred to nitrocellulose membranes, and reacted with antibodies against NFAT, PARP (nuclear marker) and GAPDH (cytoplasmic marker). FK506 resulted in a marked decrease in NFAT in nuclear fraction. Data represent mean\u2009\u00b1\u2009SEM of 3 independent experiments (p\u00a0<\u20090.05). Supplementary Figure\u00a03. Effect of Cyclosporin A on TERT and LYVE-1 expression. Real-time PCR analysis of TERT (A) and LYVE-1 (B) mRNA in lung lymphatic endothelial cells treated with control or Cyclosporin A (10\u2009\u03bcg/mL) for 48\u2009h. Results were expressed as the fold change compared to control. Graphs represent the mean\u2009\u00b1\u2009SE from three independent experiments. p\u00a0<\u20090.05 (*) and p\u00a0<\u20090.01 (**) by T-Test. Supplementary Figure\u00a04. Effect of FK506 on other lymphatic markers. Real-time PCR analysis of podoplanin (PDPN) (A) and PROX1 (B) mRNA in control and FK506-treated (48\u2009h) lung lymphatic endothelial cells. Results were expressed as fold change compared to control. Graphs represent the mean\u2009\u00b1\u2009SE from three independent experiments. Supplementary Figure\u00a05. Effects of LYVE-1 inhibition with function blocking antibodies on HA uptake in vitro and FK506 treatment on CD44 expression. LEC were plated in 6-well plates and treated with Isotype (control) and LYVE-1 monoclonal antibodies (10\u2009\u03bcg/mL) for 72\u2009h. Cells were then incubated in media containing 1000\u2009\u03bcg/mL of FITC-HA for 5\u2009h. Percentage of FITC-positive cells (A) were analyzed by flow cytometry. Real-time PCR analysis of CD44 (B) mRNA in control and FK506-treated (48\u2009h) lung lymphatic endothelial cells. Results were expressed as the fold change compared to control. Graphs represent the mean\u2009\u00b1\u2009SE from three independent experiments. Supplementary Figure\u00a06. Western blot full images. Supplementary Table\u00a01. Primary antibodies used in these studies. Supplementary Table\u00a02. Real-time PCR primers."}
+{"text": "Cynomolgus macaque model of TB, we revealed that transcriptional signatures of different molecular TB endotypes did not depend on TB progression post-infection. Moreover, we provide evidence that patients with molecular endotypes characterized by high levels of IFN responses (IFN-rich), suffered from more severe lung pathology than those with lower levels of IFN responses (IFN-low). Harnessing machine learning (ML) models, we derived gene signatures classifying IFN-rich and IFN-low TB endotypes and revealed that the IFN-low signature allowed slightly more reliable overall classification of TB patients from non-TB patients than the IFN-rich one. Using the paradigm of molecular endotypes and the ML-based predictions allows more precisely tailored treatment regimens, predicting treatment-outcome with higher accuracy and therefore bridging the gap between conventional treatment and precision medicine.Group-aggregated responses to tuberculosis (TB) have been well characterized on a molecular level. However, human beings differ and individual responses to infection vary. We have combined a novel approach to individual gene set analysis (GSA) with the clustering of transcriptomic profiles of TB patients from seven datasets in order to identify individual molecular endotypes of transcriptomic responses to TB. We found that TB patients differ with respect to the intensity of their hallmark interferon (IFN) responses, but they also show variability in their complement system, metabolic responses and multiple other pathways. This variability cannot be sufficiently explained with covariates such as gender or age, and the molecular endotypes are found across studies and populations. Using datasets from a  Mycobacterium tuberculosis (Mtb) fall sick with active TB (Tuberculosis (TB) remains a major threat to human health with 10 million new cases and 1.4 million deaths in 2019  samples with Mtb-specific antigens. The false negative rate of IGRA among Mtb infected individuals is in the order of 15%  expression of different genes may be highly correlated and thus, selecting one or another gene does not influence the performance of the model; (2) different molecular mechanisms dominate the response to TB in different cohorts; (3) various cohorts contain varying numbers of individuals with a certain type of dominant response which influences outcome of\u00a0comparison of \u2018all TB patients\u2019 to \u2018all healthy subjects\u2019. For\u00a0example, the study of Maertzdorf et al. identified JAK-STAT signaling and TLR signaling pathways next to IFN response as dominant in TB  which determines the release of IFN \u03b3 r of 15% . Thus, bnt in TB . In contnt in TB . Studiesnt in TB , 15. It Cynomolgus macaques  on the integrated transcriptome data with various gene set collections, including pre-defined blood transcriptional modules (BTMs) , 17 to rmacaques  and obsemacaques  and MSigmacaques  based GSmacaques , 21.The overview of the workflow of the study and the used statistical methods can be found in the via the R-package GEOquery (All utilized datasets are publicly available in Gene Expression Omnibus (GEO) data repository . Study-nGEOquery .BiomaRt R package (Included studies met the following criteria: (i) they contained WB data from untreated TB patients and healthy controls (including LTBI) each; (ii) they contained at least eight samples from TB patients and healthy controls each; (iii) they were performed using platforms which measured expression of at least 16,000 overlapping genes; (iv) they were performed using platforms with annotations available in  package , 25. Sevhttps://github.com/terkaterka/immune-response-to-TB). Datasets were analyzed with R package limma for differential expression analysis  and samples of untreated TB patients were included. MDS was created out of the training sets from each study using only common genes. Nonparametric standardization based on median and interquartile range (IQR) values (Equation 1) was used to standardize the expression values measured in each study, in order to minimize batch effects and heterogeneity between the experiments.Where:.,jIQR \u2013 IQR for expression measurement of gene i across all samples.All utilized data underwent initial quality controls which comprised outliers and artifact-detection and quality-assurance. We ascertained that case and control cohorts clustered according to TB and IFN status and not by their study of origin. Umap-algorithm  derived To perform GSA for individual patients, row-wise z-transformation of gene expression values was applied. For each gene, mean expression and standard deviation of its expression were calculated for healthy individuals from every cohort. Subsequently, the mean gene expression of healthy individuals was subtracted from the expression measurements of every individual present in the MDS and the result was divided by standard deviation of gene expression for healthy individuals. The z-score was calculated based on all samples from healthy individuals. Thus, for each patient and gene, the expression z-score is the number of standard deviations below or above the average for healthy individuals. The larger the absolute value of the z-score, the higher the deviation of the expression of that gene from the average in the healthy population.tmod .Two previously published sets of BTMs were utilized , 17. A tGSA was performed on the list of genes from every individual included in MDS sorted by increasing z-score using the three created module sets. Individuals presenting no significant enrichment in any of the IFN I modules were defined as IFN-low and are represented graphically as \u2018IFN I-\u2019. Individuals presenting enrichment in at least one IFN I module were defined as IFN-rich and are further represented graphically as \u2018IFN I+\u2019. Similarly, the \u2018IFN II-\u2019 and \u2018IFN I and II-\u2019 individuals presented no enrichment in the IFN II or IFN I and II module set, respectively. Those presenting respective enrichments were defined as \u2018IFN II+ or \u2018IFN I+ and II+\u2019. Ultimately, the overlaps between study participants classified as IFN I+, IFN II+, and IFN I+ and II+ were analyzed and their classification was compared to IFN+ and IFN- participant groups based on the original BTMs , 17.To investigate the influence of discrete features  on the IFN status the chi-square test was performed and Cram\u00e9r\u2019s V effect size was calculated. Moreover, the odds ratio (OR) was calculated with 95% CI and the test for OR was conducted (H0: OR=1). For continuous variables (age), the Mann-Whitney test was performed and rank biserial correlation was calculated as effect size.stats, pca3d and tmod  curves using R package pROC (Random Forest (RF) models were generated using R package omForest , 37 to cage pROC .We ranked the transcripts found in either model according to the amount of statistical importance in the RF model to identify a cut-off for the number of transcripts required to effectively discriminate TB patients from non-TB samples. TB IFN+ and TB IFN- signatures were defined consisting of top (i) 5, (ii) 7, (iii)\u00a010, (iv) 20, (v) 50 or (vi) 200 ranked transcripts, and new models which were trained only on the transcripts that surpassed the cut-off threshold were created. The new models were tested using 10-fold cross validation within the training MDS and their performance was evaluated using ROC plot. The optimal signature size was chosen when the increase of the number of selected transcripts ranked by highest statistical importance did not cause further significant improvement of signature\u2019s area under curve (AUC) in classification of TB patients and non-TB disease controls.For the identification of TB IFN+ and TB IFN- signatures two new class balanced RF models retaining the proportion of one TB to three non-TB cases were trained using the subsets of the complete training MDS subsets containing (i) all TB IFN+ and non-TB (Signature Model 1), (ii) all TB IFN- and non-TB (Signature Model 2). A signature consisting of the 20 top ranking transcripts from the Signature Model 1 was defined as IFN+ signature. A signature of 50 top ranking transcripts from the Signature Model 2 was defined as IFN- signature. Obtained TB IFN+ and TB IFN- signatures were tested on the test MDS and their performance was evaluated by a ROC curve analysis.The obtained TB IFN+ and TB IFN- signatures were tested on the external dataset from Cai et al.  and BlanCynomolgus macaques  for successful integration .To further benchmark the implemented division into IFN+ and IFN- groups we tested the differences between the TB patients categorized into the two groups using PCA. The results indicated that although the clusters of IFN+ and IFN- TB patient groups overlapped, the two centers of the clusters were geometrically shifted in regards to each other as best shown by PC2 and PC7 , or ISGs. To avoid using the genes on which the division into IFN+ and IFN- patient groups was based, we identified genes described in IFN signaling pathways, but not included in the original BTMs , 17, andInterestingly, despite IFN type I and type II signaling pathways being the most studied in the immune response to TB, we found that also IFN \u03bb receptor gene (IFNLR1), but not IFN \u03bb gene (IFNL) itself, which both belong to type III IFN signaling pathway was significantly overexpressed in IFN+ compared to IFN- TB patients or healthy .Based on X-Ray images of their lungs, Berry et al.  assignedGene signatures are frequently used to differentiate between TB patients and healthy individuals , 9, 46. versus healthy individuals.The IFN- signature showed a slightly better overall performance in the identification of TB patients  as surrogate marker of severity of pulmonary pathology . This suggests that the \u201cIFN-rich\u201d endotype is distinguished not only by its pronounced IFN response but also by pronounced NF-kappa B signaling and complement system signaling, while the genes belonging to T cell receptor signaling pathway and Th17 cell differentiation are strongly down-regulated in this endotype . These databases have a broader  scope than the BTMs. Next, we performed GSA using those gene set collections and tested the independence from IFN gene set enrichment in individual proportions. For several of them, the enrichment in individual patients strongly correlated (positively or negatively) with the IFN status. This was the case among others for \u201cHallmark p53 pathway\u201d module (correlation coefficient of the eigengenes r=0.98), \u201cNF-kappa B signaling pathway\u201d (r=0.96), \u201cHallmark complement\u201d (r=0.96), \u201cT cell receptor signaling pathway\u201d (r=-0.94), \u201cTh17 cell differentiation\u201d (r=-0.94). Likewise, the proportion of patients presenting enrichment in those modules significantly overlapped with the enrichment in the IFN gene set  and occurred far less commonly among TB patients from different cohorts than the enrichment in the IFN modules. To unravel these, for each given gene set, we tested the correlation of enrichments across all TB patients between the given gene set and the IFN response. This yielded 16 gene sets  which showed enrichment  in at least 10% of TB patients in the MDS and with no enrichment in the remaining TB patients and, at the same time, no significant correlation with the IFN response  the IFN I signaling pathway is thought to be mostly detrimental and (ii) the IFN II pathway is considered to play a major role in protection . Yet, ouUnsupervised analysis identified that samples collected from IFN- and IFN+ TB patient groups cluster together but are shifted with regard to each other. GSE on the weights of genes revealed contribution of T cells, which are potent producers of IFN \u03b3 and IFN \u03b1 cytokines . PCA of Our analysis demonstrates that differences in the enrichment of IFN related modules is not a consequence of varying abundances of IFN \u03b1, IFN \u03b2 or IFN \u03b3 in WB since the IFN+ and IFN- patient groups presented similar expression of IFN \u03b1, IFN \u03b2 and IFN \u03b3 genes. Rather, significant differences in the expression of IFN \u03b1 and IFN \u03b3 receptors and ISGs such as CXCL10 between the IFN+ and IFN- TB patient groups were critical. We conclude that regulation of gene expression in IFN+ and IFN- TB patient groups was not caused by differential expression of IFN \u03b1, \u03b2 or \u03b3, but by differential expression of IFNR genes and ISGs.The abundance of the transcript BATF2 contributed to the differences in enrichment observed between IFN+ and IFN- TB patient groups. The BATF2 levels were significantly higher in IFN+ than IFN- TB patient groups. This leucine zipper transcription factor has been shown to exacerbate lung pathology in an experimental mouse model  and has We defined diagnostic signatures of IFN+ and IFN- TB patient groups using ML methods. The selected IFN+ signature comprised 20 transcripts, while the optimal IFN- signature consisted of 50 transcripts. 7 transcripts were present in both IFN+ and IFN- TB signatures: GBP5, AIM2, GBP2, POLB, WARS1, LHFPL2, DUSP3. Several of these genes are related to IFN-signaling which emphasizes the important role of IFN in TB even in patients in whom IFN signaling is enriched marginally.versus sarcoidosis patients, which was only satisfactory for the IFN+ TB signature. TB and sarcoidosis have been shown to present a remarkably high overlap between biomarkers that discriminate versus healthy controls  the transcriptomes of eight out of 52 LTBI patients clustered with profiles of TB patients and four out of 21 TB patients presented transcriptional profiles resembling those of LTBI. Similar observations were reported by Blankley et al.  who deteTo this end, we next explored the possibility of further novel, molecular endotypes of TB, which are not directly linked to IFN responses. We found that TB patients differ in the activity of genes associated with calcium signaling, insulin signaling and amino acid metabolism. These findings introduce an exciting new avenue of exploring pathways linked to TB. We are aware that our results are based on lack of an observed correlation with the IFN response \u2013 and thus might indicate lack of evidence for association with IFN rather than evidence of lack. However, given the large number of patients on which we based our study, we feel reasonably confident that if such effect exists, its magnitude must be small. Clearly, as these findings are based on an exploratory analysis, a further validation targeted directly at our hypotheses will be essential. The concept of endotypes to describe subgroups of patients on the basis of distinct transcriptomic, epigenetic or metabolic features has been applied to several diseases, most recently also to TB . A combihttps://github.com/terkaterka/immune-response-to-TB).Although our study provides deeper insight into individual variability among TB patients at the level of gene expression, there are limitations: first, human cohorts are highly variable due to numerous factors including genetic variability, conditions of life and circumstances of infections . Additional confounders include varying study designs and conduct, as well as technical variation. To partly account for these confounders, we validated our results in several ways including cross-validation and leaving 20% of the acquired studies unprocessed for independent testing, acquisition of independent validation datasets and testing the gene signatures of IFN+ and IFN- TB on a different disease - sepsis. Application of our data collection, normalization and analytical methods in numerous external datasets revealed that the proposed analytical framework is robust and can be used in other multi-cohort studies. Our dataset collection selected out of published TB datasets and newly defined sets of IFN I, IFN II as well as IFN I and II inducible genes can be accessed on the website:  data repository.Publicly available datasets were analyzed in this study. This data can be found here: All of the used, publicly available datasets are referenced in the manuscript. The datasets are found in the Gene Expression Omnibus .The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest.All claims expressed in this article are solely those of the authors and do not necessarily represent those of their affiliated organizations, or those of the publisher, the editors and the reviewers. Any product that may be evaluated in this article, or claim that may be made by its manufacturer, is not guaranteed or endorsed by the publisher."}
+{"text": "We present an open and isolated palmar dislocation of the head of the fifth metacarpal bone without fracture. The diagnosis, which was initially made based on the X-rays, was confirmed during the operation. The patient was satisfactorily treated with open reduction, Kirschner wires fixation and casting followed with hand physiotherapy. The volar plate and collateral ligaments prevent MCP joints  of dislocation due to protection against hyperextension, radial and ulnar deviation. The most common dislocation of MCP joint is a dorsal dislocation  and the Therefore, the purpose of this report is to present a patient with an isolated palmar dislocation of the head of the fifth metacarpal bone without a fracture, satisfactorily treated with open reduction, Kirschner wires fixation, casting, and followed with hand physiotherapy and hand occupational therapy.A 62-year-old right-handed male presented to the Emergency Department (ED) with palmar protrusion of the head of the fifth metacarpal bone through the skin following a fall with injury to the right hand, On examination, patient had besides an open wound with palmar protrusion the fifth metacarpal bone through the skin, pain around the wound. However, capillary refill and sensation were normal, which suggested an intact neurovascular bundle of the fifth finger. Further, normal flexion of distal interphalangeal joint and the proximal interphalangeal joint was observed. Wrist and other movements were normal. The patient had no previous history of trauma to the right hand.Standard radiographs were obtained which revealed isolated palmar dislocation of the head of the fifth metacarpal bone without any other associated injury or fracture, An attempt to perform a closed reduction under local anesthesia was unsuccessful. The patient was admitted to undergo an open reduction under regional anesthesia the same day.Extending the wound, we observed a dislocation of flexor digitorum superficialis tendon (FDS) and flexor digitorum profundus tendon (FDP) to radio dorsal from the head of the fifth metacarpal bone. After replacing tendons to palmar, dislocation dissolved. Neither reconstruction of the volar plate nor exploration of the intermetacarpal ligaments were performed. After achieving hemostasis, the wound was closed with Ethilon 5-0. Internal stabilization with Kirschner- wires through MCP joint in 90 degrees of flexion was performed, see An isolated open palmar dislocation of the head of the fifth metacarpal bone without any fracture is rare. Reposition of this type of dislocations can be practically impossible due to volar plate, collateral ligament, tendinous juncture connecting the fourth and fifth extensor digitorum communis tendons, sesamoid bone, or as observed in our case luxation of FDS and FDP to dorsoradial to the head of the metacarpal bone . ConsideThe volar plate wasn\u2019t reconstructed during the surgery, because it required a total exposure of the joint capsule. During the operation, some stability of the joint was noticed due to the surrounding structures, and given the obtained results we can assume that during the healing process affected joint developed more stability due to the scar tissue and the formation of adhesions.To the best of our knowledge, this is the first published case of open isolated palmar dislocation of the head of the fifth metacarpal bone without fracture.In our opinion, a closed reduction of rare palmar MCP joint dislocations have little chance of success due to volar plate, collateral ligament, tendinous juncture connecting the fourth and fifth extensor digitorum communis tendons, sesamoid bone, or as observed in our case luxation of FDS and FDP to dorsoradial to the head of the metacarpal bone. The open reposition and fixation showed, in our case, good results after sessions of hand physiotherapy and hand occupational therapy."}
+{"text": "One way to improve the delivery of oncology palliative care in low and middle-income countries (LMICs) is to leverage mobile technology to support healthcare providers in implementing pain management guidelines (PMG). However, PMG are often developed in higher-resourced settings and may not be appropriate for the resource and cultural context of LMICs.This research represents a collaboration between the University of Virginia and the Nepalese Association of Palliative Care (NAPCare) to design a mobile health application (\u2018app\u2019) to scale-up implementation of existing locally developed PMG.We conducted a cross-sectional survey of clinicians within Nepal to inform design of the app. Questions focused on knowledge, beliefs, and confidence in managing cancer pain; barriers to cancer pain management; awareness and use of the NAPCare PMG; barriers to smart phone use and desired features of a mobile app.n\u00a0=\u200948) had training in palliative care/cancer pain management and the majority  reported high confidence levels (scores of 8 or higher/10) in managing cancer pain. Highest ranked barriers to cancer pain management included those at the country/cultural level, such as nursing and medical school curricula lacking adequate content about palliative care and pain management, and patients who live in rural areas experiencing difficulty accessing healthcare services . Most nurses and physicians use an Android Smart Phone , had heard of the NAPCare PMG , and reported frequent use of apps to provide clinical care . Key barriers to smart phone use differed by discipline, with nurses reporting greater concerns related to cost of data access  and being prohibited from using a mobile phone at work .Surveys were completed by 97 palliative care and/or oncology healthcare providers from four diverse cancer care institutions in Nepal. 49.5% (Smart phone apps can help implement PMG and support healthcare providers in managing cancer pain in Nepal and similar settings. However, such tools must be designed to be culturally and contextually congruent and address perceived barriers to pain management and app use. High quality palliative care, which emphasizes pain management, can greatly reduce global suffering from non-communicable diseases, such as cancer \u20136. This Professional oncology organizations have created pain management guidelines (PMG) to help health care providers effectively manage pain \u201329. UnfoSince its establishment in 2009, the Nepalese Association of Palliative Care   Institutional Review Board and the Nepal Health Research Council and adhered to all relevant guidelines and regulations. It is important to note that methodological decisions for this study were guided, in part, by the intent of the funding mechanism to strengthen research capacity within Nepal, and to facilitate learning and mentoring opportunities between the University of Virginia (UVA) and Nepal interdisciplinary teams.Our 36-item survey was collaboratively developed by the Nepal and UVA research teams, in consultation with the UVA Center for Survey Research. The survey took approximately 7\u2009months to design (September 2018 \u2013 April 2019) and was a highly iterative and collaborative process between the Nepal and UVA research teams, working both remotely and during in-person fieldwork visits. Survey items were informed by the study aims and the broader literature related to known barriers to cancer pain management and challenges related to opioid availability in low and middle-income countries across various levels of the Social Ecological Model   many terms did not have precise Nepali equivalents; 2) Nepali healthcare providers are trained in English and a high degree of English fluency was expected from respondents; and 3) the surveys would be administered face-to-face with a Nepali research team member available to assist with any translation needs. Particular attention was paid to be sure items were clear and contextually and culturally congruent/relevant. Questions were primarily quantitative , with a few optional write-in responses if a participant wanted to expand upon a response and organized in four sections: 1) participant demographics; 2) knowledge, beliefs and perceived barriers related to cancer pain management; 3) awareness and use of the NAPCare PMG; and 4) smart phone use, barriers, and desired features of a mobile app.We recruited a quota sample of healthcare providers over age 18 who provide direct care to patients with cancer. The target number of respondents for each site was determined by the size of the institution  and took into account what Nepal research team members felt were realistic recruitment goals. Potential respondents were identified by Nepal research team members, screened for eligibility, and offered a chance to participate in the survey. All participants provided verbal informed consent, which was approved by respective ethical committees , prior to any data collection. Participants reviewed an approved study information document and had the opportunity to discuss any questions with a trained research team member before proceeding with the survey. The sample was stratified across a public general hospital; a public cancer hospital; a private cancer hospital; and a hospice within Kathmandu Valley and Chitwan District, Nepal. The 4 study sites were selected because they see a high volume of cancer patients and represent diverse practice contexts.Pencil-and-paper surveys were administered to consented participants between May \u2013 August 2019 by trained Nepali research team members. We used paper surveys due to factors related to cost, convenience and flexibility in the field. Participants received a small cash incentive for completing the survey . Completed survey data were entered into Qualtrics for data storage and management. We elected to use Qualtrics for initial data entry due to ease of user interface and to familiarize the Nepal team with the Qualtrics platform.Qualtrics survey data were exported into SPSS v.26.1 . Data analysis was conducted both at UVA and by members of the Nepal team, with mentorship and support from researchers at UVA.During a fieldwork trip to Nepal in August 2019, the UVA and Nepal team conducted a thorough data audit, which included: 1) visual inspection of all paper surveys and cross-checking study identification numbers with the master participant log from each site; and 2) validating data entered into SPSS with paper survey responses with a random sample of at least 15% of surveys from each site. If data entry errors were discovered, we performed additional random validity checks to ensure accurate data entry of that site. Also, if two answers were marked on an item that only allowed for one response \u2013 and it was difficult/impossible to know which response the participant truly intended \u2013 then we used a coin toss to determine the response. We also reviewed all open text items and \u2018other\u2019 write-in options across the entire data set to ensure responses were correctly captured in SPSS; we made slight corrections for clarity and/or completeness.Descriptive statistics were calculated for all quantitative items. Additionally, inferential comparative analyses were run to explore how variables of interest assessed by the survey (such as confidence in pain management tasks) may vary by institution  and healthcare provider role . Specifically, Pearson chi-squared tests and independent sample t-tests were conducted to check for statistically significant relationships (\u03b1\u2009=\u20090.05). Our survey measures aimed to understand perceptions and experiences of respondents across individual survey items rather than present composite scales or indices. However, for the grouped personal, institutional, and country/cultural barriers to pain management, we did calculate Cronbach\u2019s Alpha and all had values above 0.8,  indicating strong internal reliability.Most open text responses were brief, one phrase responses  and were therefore simply counted, quantified, and presented with corresponding quantitative items. The last survey item, \u2018is there anything else you would like to share about your experience with cancer pain in Nepal?\u2019 yielded more detailed text responses which were exported into Microsoft Word, organized into groups based on similarity of key phrases, and then reviewed for patterns using a basic qualitative descriptive approach . For exan\u00a0=\u200992), as they are expected to be the primary mobile app users. Findings are presented below by survey section.With the exception of Tables\u00a0n\u00a0=\u200964; 66%), female , identified palliative care as their current practice area , and reported spending over 80% of their time caring for patients with cancer .A total of 97 healthcare providers  completed the survey across all four study sites. Overall, the majority of respondents were nurses  compared to those who did not . Overall, a higher percentage of nurses completed training  compared to physicians  and nurses rated its helpfulness  as higher than physicians . This difference was statistically significant in the overall sample and within the public general hospital.Almost equal numbers completed formal training in palliative care or cancer pain management (n\u00a0=\u200992) the average mean confidence score for managing cancer pain, in general, was 7.8. Assessing the patient\u2019s need for morphine, calculating breakthrough morphine doses, and adjusting/titrating morphine doses also all had high mean confidence scores .Participants were asked to rate their confidence  in specific cancer pain management activities. For physicians and nurses  and administering (for nurses) was also assessed per common opioid Fig.\u00a0. The mosn\u00a0=\u200992), followed by institutional . The lowest category of barriers involved personal factors .Potential barriers to cancer pain management were assessed in the categories of personal, institutional, and country/cultural factors . By overall category, the highest rated barriers were country/cultural  and by nurses  and physicians  was \u2018nursing and medical school curriculums in Nepal do not contain enough content about palliative care and pain management.\u2019 Other top ranked system-level barriers included \u2018patients in rural areas have trouble accessing healthcare services\u2019  and \u2018stigma and fear of cancer cause delayed diagnosis/treatment\u2019 . The lowest ranked country/cultural barrier overall  and by nurses  and physicians  was \u2018patient believes pain is deserved for wrongs committed in past lives.\u2019 Statistically significant differences were found between nurses and physicians overall, and within the public general hospital, related to the barriers \u2018patient or patient\u2019s family worries the patient will get addicted to pain medication\u2019 and \u2018patient believes they should bear pain without complaint,\u2019 with nurses rating these barriers with greater impact.The highest rated country/cultural barrier, overall  and by nurses  was \u2018no palliative care outpatient department.\u2019 For physicians, the highest rated institutional barrier was \u2018no separate beds or wards for palliative care\u2019 . The lowest ranked institutional barrier, overall  and by nurses  and physicians  was \u2018nurses and doctors do not communicate well;\u2019 this barrier was significantly different within the private cancer hospital, with all physician respondents ranking this factor as having no impact .The highest rated institutional barrier, overall . This barrier was statistically significant between nurses  and physicians  at the public general hospital. The lowest rated personal barriers included \u201cI worry I will get in trouble for giving patients pain medication,\u201d  and \u201cI worry patients will get addicted to pain medication,\u201d . Ratings for \u201cI am not sure of the best action to take to manage cancer pain\u201d varied significantly between nurses and physicians at both the public cancer hospital and the private cancer hospital. However, the physicians at the public cancer hospital rated it significantly higher than nurses at their institution , whereas physicians at the private cancer hospital rated the barrier significantly lower than nurses .The highest rated personal barrier was \u2018I have to care for too many patients,\u2019 , there was a statistically significant difference between nurses  and physicians . 92% of respondents also agreed or strongly agreed (8 or higher) that morphine is a beneficial and helpful medication . 82% of respondents disagreed or strongly disagreed (2 or lower) that morphine is only appropriate for dying patients . 45% of respondents also disagreed or strongly disagreed (2 or lower) that \u2018regular morphine use will cause physical dependence,\u2019 . 67% of respondents disagreed or strongly disagreed (2 or lower) that \u2018regular morphine use will cause addiction.\u2019 Lastly, 66% of respondents disagreed or strongly disagreed (2 or lower) that \u2018morphine commonly causes respiratory depression\u2019  and this difference was statistically significant between nurses and physicians at the public cancer hospital  and the private cancer hospital .On a scale of 0, strongly disagree to 10, strongly agree, 95% of respondents reported an agreement rating of 8 or higher with the statement \u2018it is my role/my job to manage cancer pain.\u2019 While this item had a high overall rating  endorsed the statement \u2018cancer pain can be difficult but usually can be controlled.\u2019 No respondents endorsed the statement \u201ccancer pain is unavoidable and cannot be controlled.\u2019The majority of respondents  is included in Table The entire sample (n\u00a0=\u200996), followed by morphine 10\u2009mg prolonged release , morphine 30\u2009mg prolonged release and morphine injectable , and then morphine 10\u2009mg immediate release . No respondent selected the option \u2018none of these morphine formulations are regularly available at my institution\u2019 or \u2018unsure.\u2019Specifically, the most frequently reported regularly available morphine formulation overall was morphine syrup, which was available at every institution  reported no morphine shortages within the past 6\u2009months at their institution; a small number of respondents indicated a morphine shortage had occurred at their institution in the past 6\u2009months  or they were unsure . Overall, respondents indicated that if morphine shortages had occurred, they generally lasted a few days  or they were unsure of duration . Shortages within the past 6\u2009months of codeine and tramadol were also infrequently reported , and if they did occur, respondents were more unsure of duration . Overall and between institutions there was the most variance regarding fentanyl, with reported shortages and duration of fentanyl shortages statistically different among the study sites  and more respondents overall reporting fentanyl shortages  or being unsure if fentanyl shortages occurred . Of note, the survey did not specify formulation of fentanyl, e.g., transdermal patch versus parenteral.The majority of respondents , paracetamol , and steroids . The most commonly reported non-pharmacological treatments for cancer pain were heat/cold packs ; massage ; and meditation/yoga .The most commonly reported non-opioid pharmacological treatments for cancer pain were non-steroidal anti-inflammatory drugs  had heard of the NAPCare PMG; of those, 97% (n\u00a0=\u200985) had read at least some, or all, of the guidelines. There were statistically significant differences between nurses and physicians related to \u2018helpfulness of the guidelines in your clinical practice\u2019  and regarding frequency of use of the NAPCare guidelines in clinical practice, with nurses more likely to use the guidelines multiple times a day  compared to physicians . 37% (n\u00a0=\u200932) of respondents indicated that they use other PMG guidelines to help manage cancer pain, usually the World Health Organization (WHO) guidelines (n\u00a0=\u200923).96% of nurses and physicians (n\u00a0=\u200990) reported having access to a smart phone; of-those, all respondents (n\u00a0=\u200989) reported having daily access to a smart phone, and most  use an Android phone. 46% of physicians (n\u00a0=\u200913) reported \u201cI encounter no barriers in using a smart phone\u201d compared to 3% (n\u00a0=\u20092) of nurses. The most frequent barriers to smart phone use reported by physicians were cost of data access  and concern about using smart phones in the presence of patients . Nurses reported more barriers to smart phone use in general, the top three being cost of data access ; not allowed to use mobile phone at work ; and concern about using smart phones in the presence of patients .All but two participants , followed by \u2018sharing information with/learning from other healthcare providers\u2019 and \u2018understanding cancer pain physiology\u2019 . Physicians most frequently selected \u2018prescribing/giving opioid medications\u2019 , followed by \u2018prescribing/giving non-opioid medications\u2019 , and \u2018sharing information with/learning from other healthcare providers\u2019 . Both nurses and physicians selected the option \u2018prescribing/giving non-pharmacological treatments\u2019 as the least important way a mobile app could help them manage cancer pain . Overall, nurses and physicians most frequently selected the option \u2018cancer pain management guidelines will be followed more consistently\u2019  and \u2018healthcare providers will feel more confident prescribing/giving pain therapies\u2019  as the top indictors to evaluate app effectiveness; \u2018morphine will be more available to patients in need\u2019 received the fewest responses as a way to evaluate the app\u2019s effectiveness .When asked how a mobile app could help healthcare providers better manage cancer pain, nurses most frequently selected \u2018educating patients and family members\u2019 , and higher for physicians  than nurses . Average mean frequency of mobile app use for personal reasons, overall, was higher than app use for clinical care , and was higher for physicians  compared to nurses .Average mean frequency  of reported mobile app use for clinical care, overall, was 6.38  answered the final survey item . Respondents shared key challenges related to managing cancer pain in Nepal, and also offered suggestions for improvement. Responses focused on four overarching themes, including: access to care; cancer pain as common and challenging; need to improve training and awareness; and concerns related to opioids. Table\u00a0In total, 90 respondents  and female, consistent with global gender demographics of nurses . StatistOur overall findings related to general opioid confidence, knowledge and beliefs are encouraging. Across all sites, providers rated average helpfulness of palliative care/cancer pain management training as high  and this rating was statistically significantly higher, overall, for nurses compared to physicians. This finding underscores the importance of ensuring interdisciplinary engagement in the creation and implementation of palliative care training content , 48\u201351.Variations in confidence levels related to specific cancer pain management tasks were seen across institutions and by roles . Reasons for variation across institutions and roles are likely related to multiple factors, including previous palliative care training , autonomy and scope of practice expectations within the specific institution , anAcross all study sites both physicians and nurses endorsed that cancer pain is difficult but can usually be controlled and strongly agreed that it is their role to manage cancer pain. Additionally, providers perceived morphine to be a beneficial and helpful medication, and not only for patients who are actively dying. Both nurses and physicians at the public general hospital most accurately agreed that regular morphine use will cause physical dependence, however other respondents largely disagreed, which could have worrying patient care implications, especially for opioid withdrawal. Most respondents disagreed that morphine use in cancer patients commonly causes respiratory depression; this knowledge could prevent concern over this side effect leading to a failure to prescribe morphine, but conversely care is also needed as respiratory depression is possible if safe prescribing practices are not followed. Collectively, these findings suggest information within pain management apps related to opioid pharmacology  is likely always important to include to support busy healthcare professionals and prevent patient harm \u2013 even for users with prior palliative care training.Lack of opioid availability is a serious concern in the delivery of palliative care and can be especially difficult in LMICs . HoweverOur results contribute to a more complete understanding of barriers to cancer pain management within LMICs, particularly between private and public sector hospitals which represent very different care contexts. Public/government sector hospitals generally provide subsidized care to a large volume of patients of lower socioeconomic status and must cope with significant resource constraints; private sector hospitals generally care for more financially secure patients who can pay out of pocket for treatment and operate with greater resources. This resource disparity is likely represented in our finding that respondents, regardless of role, at the private cancer hospital rated both institutional and personal barriers to cancer pain management very low compared to other hospitals and the overall ratings. These institutional differences are important to understand as they influence contextual barriers to cancer pain management, and thus, potential adherence or non-adherence to PMG.Key institutional barriers across all sites, and for both nurses and physicians, related to the high volume of patients they care for and lack of dedicated palliative care beds or outpatient department. Mobile app design can account for these barriers to some extent by ensuring that user interfaces are as quick and efficient as possible to accommodate brief patient care interactions and include clear, concise recommendations. It is encouraging that concerns regarding addiction and repercussions for prescribing/administering opioids were not highly rated barriers. It is especially encouraging that these barriers were the lowest rated among nurses, as they are often the ones to decide whether to administer an as-needed (PRN) pain medication. We also find this encouraging as a contrast to prior research that indicates fears related to addiction and/or regulatory surveillance can limit opioid prescribing/administration, even for patients with legitimate, severe pain, in both high and low income countries , 53. HowConsistent with prior research  our findIt is encouraging that such a large proportion of respondents had heard of the NAPCare PMG, reported using them multiple times a day, and strongly agreed that the guidelines were helpful in their day-to-day clinical practice. We are optimistic that such a degree of pre-existing awareness and receptivity to the NAPCare PMG bodes well for use of a mobile app. It is also validating that the most frequently used \u2018other\u2019 cancer pain management guideline by participants were the WHO guidelines, since they serve as the foundation for the NAPCare PMG.Our survey confirms the ubiquity of smart phones in LMICs  and the Overall, and especially for nurses, the most desired feature to better manage cancer pain was the ability of the app to educate patients and family members. While this feature is not within scope for the first iteration of our app, it is clearly a critical future component to include. Regarding evaluation of the app, key user-defined metrics include frequency of app use; confidence levels in prescribing/administering pain therapies; and adherence to the NAPCare PMG, including documenting reasons when PMG cannot be followed  to help inform future tailored interventions.The primary limitation of this study is the convenience (versus probability-based) sample of palliative care sensitized healthcare providers and the respondent quotas we established prior to survey administration. Our sample size also limited our ability to conduct more detailed multivariate analyses to more robustly explore significant differences among groups; this would be an important area of future research. However, our sampling strategy was in keeping with the pilot nature of this grant and the overall intention to mentor, and not overburden, new investigators within Nepal. In hindsight we underestimated the number of participants willing to complete our survey, and could have likely surveyed a larger, more diverse sample of clinicians, particularly at the public general and cancer hospitals. As with any survey, there is the risk of response and recall bias; we attempted to mitigate this by taking care to write our questions in neutral, clear language and by providing both remote and in-person training and support to Nepal team members who administered the survey.In this paper we describe a survey designed to identify gaps and opportunities in cancer pain management in Nepal with a focus on informing design of a tailored digital health intervention to support clinicians providing care to patients with cancer. However, it is important to note that any digital health intervention can have unintended consequences , such asOur survey of diverse cancer care institutions within Nepal emphasizes that healthcare providers view cancer pain as an important symptom management concern, use smart phones and apps frequently, and are receptive to a mobile app to provide PMG support. Mobile apps must be informed by a clear understanding of contextual barriers to both cancer pain management and smart phone usage that are influenced by institutional resource and disciplinary differences."}
+{"text": "Such significant correlationsindicate SSA to be an important source of atmospheric PFAAs to coastalareas. The correlations in the samples from And\u00f8ya were observedfor more PFAA species and were generally stronger than in the samplesfrom Birkenes, which is located further away from the coast and closerto urban areas than And\u00f8ya. Factors such as the origin of theSSA, the distance of the sampling site to open water, and the presenceof other PFAA sources  can haveinfluence on the contribution of SSA to PFAA in air at the samplingsites and therefore affect the observed correlations between PFAAsand Na+.The effective enrichmentof perfluoroalkyl acids (PFAAs) in seaspray aerosols (SSA) demonstrated in previous laboratory studies suggeststhat SSA is a potential source of PFAAs to the atmosphere. In orderto investigate the influence of SSA on atmospheric PFAAs in the field,48 h aerosol samples were collected regularly between 2018 and 2020at two Norwegian coastal locations, And\u00f8ya and Birkenes. Significantcorrelations ( The field evidencepresented in the present study showssea spray aerosols (SSA) can be an important source of atmosphericperfluoroalkyl acids (PFAAs) in coastal areas. There are threemajor sources of PFAAs to the atmosphere: (1) direct emission frommanufacturing sources such as fluoropolymer plants,12 (2) formation in the atmosphere via degradation from volatile precursorslike fluorotelomer alcohols (FTOHs),14 and (3) water-to-airtransfer via sea spray aerosol (SSA) emission.16Perfluoroalkyl acids (PFAAs), including perfluoroalkyl carboxylicacids (PFCAs) and perfluoroalkanesulfonic acids (PFSAs), are a groupof persistent organic contaminants that have been found worldwidein abiotic environments, biota, and humans.17 When air is entrained into seawater by breakingwaves, surface active substances such as PFAAs can be scavenged bythe air\u2013water interface of the bubbles and transferred to theatmosphere via SSA emission.17 LaboratorySSA simulation experiments have demonstrated that PFAA concentrationsin submicron SSA can be 4\u20135 orders of magnitude higher thanin the bulk water.18 On the basis of laboratory-derivedenrichment factors (EFs) and reported median concentrations in seawater,the estimated fluxes of perfluorooctanoic acid (PFOA) and perfluorooctanesulfonicacid (PFOS) from SSA to the atmosphere were comparable with the othertwo sources of atmospheric PFAAs ,15 suggesting the potential of SSA as an important sourceof PFAAs to the atmosphere.SSA is emitted at the sea surface by bubble bursting.r80 (radius at 80%relative humidity) = 1, 2, and 5 \u03bcm, the estimated residencetimes with respect to dry deposition are \u223c1.5 weeks, 2.3 days,and 10 h, and the transport distances are \u223c104,2000, and 330 km, respectively.19 The removalof SSA by wet deposition depends on the frequency of precipitationevents, which is usually several days to a week in a marine environment.19 The modeling results by Johansson et al. showedthat the deposition of PFOA and PFOS to terrestrial environments viaSSA transport may impact large areas of inland Europe and not onlycoastal areas.15PFAAs can travel a great distancein the atmosphere via SSA. ForSSA particles with 20 evidence fromthe field remains elusive. Long-term air monitoring between 2006 and2014 showed significantly higher PFOA concentrations at two NorwegianArctic stations, Zeppelin and And\u00f8ya, compared to the CanadianHigh Arctic station of Alert.21 It wasspeculated that the two Norwegian stations might receive additionalPFOA transported via SSA since they are closer to open water (And\u00f8ya\u223c1.3 km and Zeppelin \u223c 2km) than Alert (\u223c4 kmfrom the coast and the surrounding water was covered by sea ice formost of the year).21 However, the PFOSconcentrations were not significantly different between the threeArctic stations.21 It is hypothesized that,if SSA was an important source of PFAAs to the atmosphere, significantcorrelations between the concentrations of SSA tracer ions  and PFAAs should be observed in aerosol samples obtainedin the marine atmosphere or at coastal locations where the atmosphericburden of SSA is highest. Casas et al. collected seven aerosol samplesat a site located at South Bay, Livingston Island, Antarctica, butobserved no such correlation in the samples,9 which might be due to the small sample size collected within a relativelyshort time period (one month).Despite increasingevidence that SSA may be an important sourceto the atmosphere from these laboratory studies,n = 10) around thecoastal area of Longyearbyen, Svalbard Archipelago, Norway, in May2006 and found that the concentrations of the sea-salt component SO42\u2013 were significantly correlated with perfluorohexanesulfonicacid (PFHxS) and PFOS concentrations  but not with PFCA concentrations.22 A series of field studies have investigatedsnow pit samples or ice core samples from ice caps that representedatmospheric deposition from multiple years and found no correlationsbetween the concentrations of PFAAs and SSA tracer ions.25 The lack of correlation may be because SSA only contributed to asmall portion of the PFAA deposition on the high altitude ice caps.Ice core samples represent atmospheric deposition from multiple yearsor decades. Compared with annual PFAA and PFAA-precursor emissions,27 the annual SSA deposition is expected to be less variable over decades.So the changes in yearly PFAA deposition may be mainly driven by thechanges in historical PFAA emissions rather than SSA deposition. Inaddition, other factors such as melting events during a temporarywarm period can lead to uncertainty25 whenusing deposition samples to examine the links between PFAAs and SSAtracer ions. Therefore, direct field evidence is still needed to understandthe influence of SSA on PFAAs in the atmosphere.Atmospheric deposition samplessuch as surface snow have also beenused to examine the relationship between PFAAs and SSA. Kwok et al.collected surface snow samples . The PFCAs were perfluoropentanoicacid (PFPeA), perfluorohexanoic acid (PFHxA), perfluoroheptanoic acid(PFHpA), PFOA, perfluorononanoic acid (PFNA), perfluorodecanoic acid(PFDA), perfluoroundecanoic acid (PFUnDA), and perfluorododecanoicacid (PFDoDA) and the PFSAs were perfluorobutanesulfonic acid (PFBS),PFHxS, and PFOS. Details of the target compounds, analytical standards,and reagents used can be found in Tables S1 and S2 in the Supporting Information. Sodium (Na+) and magnesium (Mg2+) ions wereanalyzed as tracers of SSA.A total of 11 PFAAswere investigated in this study, including C5\u2013C12 PFCAs andC4, C6, and C8 PFSAs  was carried out between April2018 and July 2020 with 2\u20133 samples taken per month. The samplesfrom Birkenes (n = 58) were collected at a higherfrequency of about 5\u20138 samples per month between April andOctober in 2018 and between September and December in 2019. The sampleswere collected on prebaked (800 \u00b0C for 8 h) quartz fiber filters using a Digitel (DH77) high-volumeactive air sampler (HV-AAS) operated at a flow rate of \u223c500L min\u20131. For each sample, \u223c1500 m3 air was collected over 48 h, with a few exceptions. A complete samplelist including the start date, duration, and sample volume is providedin Table S3.Ambient aerosolsamples were collected at two Norwegian coastal sites, And\u00f8ya and Birkenes , as shown in 2.3+) and magnesium(Mg2+) analysis. The rest of the filter was used for PFAAanalysis. PFAAs were analyzed on an Acquity ultraperformance liquidchromatography system coupled to a Xevo TQ-S tandem mass spectrometer based on a previously published method.28 Na+ and Mg2+ ions wereanalyzed using an inductively coupled plasma-atomic emission spectrometer located atthe Department of Chemistry, Uppsala University, Sweden. Details regardingthe extraction of the samples and the analysis of PFAAs can be foundin the Supporting Information.Priorto extraction, a small hole (\u03c6 = 13 mm) was punched in eachQFF. The punch was stored for sodium (Na2.4n = 9) and Birkenes (n = 7) by loading the QFF on the HV-AAS and exposing themto ambient air for 1 min without turning the pump on. The field blankswere treated the same as the samples. Two blank QFFs (prebaked at800 \u00b0C for 8 h) were extracted as laboratory blanks and analyzedwith every 20 samples.Field blanks were producedroutinely at And\u00f8ya (n = 12) and analyzed for sodium and magnesium. Therelative standard deviations of triplicates were generally < 5%.Therefore, it can be assumed that SSA were evenly distributed on thefilters and the small punches were representative of the whole filters.Details regarding the blank levels, MDLs, MQLs, IS recoveries, andspike-recovery test can be found in Section S2 and Table S4.To check the distribution of SSA on thefilters, triplicate punches were randomly taken on 10% of the samples archive(https://www.ready.noaa.gov/archives.php). The HYSPLIT model was run using the ensemble method 10 days (240h) back in time. For each sample, the trajectory footprint was calculatedand used to determine the transport probability function plot , which represents the probability ofa backward trajectory passing through a certain grid cell . This was used to visualize the dominant movement pathof the air masses for any given period. The footprint analysis ofeach sample was further used to estimate the source attribution functionplot , which represents the average observed concentrationof PFAAs and Na+ if the trajectory spent time in a specificgrid cell . These source attributionfunction plots were used to identify potential source areas of PFAAs.Details regarding the trajectory analysis can be found in the Supporting Information.TheHYSPLIT4 model2.610[PFAA] and log10[Na]) before statistical analysiswas performed and values below the MDLs were not included, unlessotherwise stated. Values between the MDLs and MQLs were included withoutadjustment. Log\u2013log linear correlations were evaluated usingthe Pearson\u2019s correlation coefficient (r).To prevent a few extreme values biasing the correlations, only sampleswith PFAA and Na+ concentrations > MDLs and PFAA/Na+ ratios between the 5th and 95th percentiles at each locationwere included . Correlation analysis wasalso performed including the data with <5th percentile and >95thpercentile PFAA/Na+ values and substituting values <MDL by 1/2MDL. These different data treatments did not affect thesignificance of the correlations for PFSAs in the samples from bothsites and C7\u2013C10 PFCAs in the And\u00f8ya samples but did affectthe PFCAs in the Birkenes samples. For example, when all samples wereconsidered, none of the PFCAs (p > 0.05) werecorrelatedwith Na+ at Birkenes. Details about the results of thecorrelation analysis and orthogonal regression with different datatreatments are included in Table S5.Statisticalanalysis was conducted using RStudio (Version 1.2.5033) with R version3.6.3. Concentration data were logarithm-transformed  and Birkenes (n = 58), with detectionfrequencies > 50%. PFHxA was found in 43% of the And\u00f8ya samplesbut in only 10% of the Birkenes samples. PFPeA was not reported dueto a matrix effect which resulted in a high chromatographic baseline.The median concentrations of \u2211PFCAs were (ranges given in parentheses) 0.46 pg m\u20133 (0.045\u20133.4pg m\u20133) at And\u00f8ya and 0.22 pg m\u20133 (0.012\u20132.0 pg m\u20133) at Birkenes. The concentrationsof PFNA, PFDA, and \u2211PFCAs were significantly higher in theAnd\u00f8ya samples than in the Birkenes samples .PFAAs were detectedin all samples, and the results are shown in \u20133 (0.004\u20130.16 pg m\u20133) and0.045 pg m\u20133 (0.007\u20130.46 pg m\u20133) at And\u00f8ya and Birkenes, respectively. No significant differences(p > 0.05) were observed for PFSAs between thetwosampling sites.For PFSAs, PFOS was detected in almost all samples and PFHxSwasdetected in >70% of the samples from both locations. PFBS was excludedfrom the following analysis due to its low detection frequency (<15%at both locations). The concentrations of \u2211PFSAs  were about 1 order of magnitude lower than for \u2211PFCAs,with median concentrations (ranges in parentheses) of 0.033 pg m\u20133 and range: < 0.003\u20131.3 pg m\u20133) and PFOS(median: 0.030 pg m\u20133 and range: < 0.003\u20130.14pg m\u20133) at And\u00f8ya were comparable to previouslyreported data for samples collected between 2010\u20132014 at thissite (median: 0.24 pg m\u20133 and range: < 0.12\u20135.5pg m\u20133 for PFOA and median: 0.072 pg m\u20133 and range: < 0.043\u20130.43 pg m\u20133 for PFOS).21 The detection frequencies of PFCAs with morethan 8 carbons (C > 8) at both locations in this study were muchhigherthan reported in previous studies (<25%).31The concentrations of PFOA (median: 0.11 pgmp < 0.05) were observed betweenall possible pairs of PFCAs atboth And\u00f8ya (r = 0.68\u20130.94) and Birkenes(r = 0.47\u20130.94) as shown in Figure S2. Additionally, PFHxS and PFOS were also found tobe positively and significantly correlated with PFCAs  with only a fewexceptions. The degradation of FTOHs in the atmosphere would forma series of PFCA homologues, while both PFCAs and PFSAs can be transportedvia SSA since they are all frequently detected in seawater.32 Although perfluoroalkyl sulfonyl fluoride (PASF)-basedprecursor compounds such as x-perfluorooctanesulfonamides/sulfonamidoethanols (xFOSAs/Es) can form both PFSAs and PFCAs in the atmosphere,14xFOSAs/Es were not frequentlydetected in the long-term air monitoring program at the two samplingsites (DF < 20%) and their concentrations were orders of magnitudelower than FTOHs.31 Therefore, such a correlationpattern may suggest the combined effect of both transport via SSAand degradation from FTOHs.Significant log\u2013log linearcorrelations .The Na+ ion concentrations in the samples from And\u00f8ya(median: 0.21 \u03bcg m\u20133 and range: 0.022\u20133.2\u03bcg m\u20133) were significantly higher (p < 0.01) than in the samples from Birkenes . Significantcorrelations between Na+ and Mg2+ were observedat both locations . The Mg2+/Na+ ratiosdetermined by the slopes of the orthogonal regressions  were 0.135 and 0.141 at And\u00f8yaand Birkenes, respectively, which are close to the observed ratioof 0.119 in seawater.33 The good correlationbetween the two elements and the close Mg2+/Na+ ratio to the Mg2+/Na+ ratio of seawater suggestthat sea spray aerosol was a major source of particulate matter atthe two sampling sites.The Na3.3+ ion concentrationswere observed in air samples from both locations . PFOA showed the strongest correlations with Na+  among the PFCAs.The correlations became weaker both as the chain length decreasedand increased relative to PFOA. PFHxS  showed a better correlation with Na+ than PFOS .At Birkenes, PFOA  and PFNA  were the only PFCAs that correlated with Na+ andthe correlations were weaker than at And\u00f8ya. In the case of thetwo PFSAs, the correlations with Na+ at Birkenes  were similar to those observed at And\u00f8ya.Positive log\u2013loglinear correlations between PFAA and Naocations 2a, sugge18 Compared to PFOA and PFNA, laboratorystudies have shown that C < 8 PFCAs have \u223c3\u201320 foldlower enrichment factors18 while field measurementshave shown that C > 9 PFCAs are usually present in seawater atconcentrationsorders of magnitude lower.37 Such laboratory and field observations may explain why PFOA andPFNA exhibit the strongest correlation with Na+ among thePFCAs at And\u00f8ya  and why theywere the only two PFCAs that showed significant correlations withNa+ at Birkenes .The amount of PFAAs transportedfrom the ocean to the atmosphereis determined by both their concentrations in seawater and the enrichmentfactor in SSA.+. PFAA seawater concentrationsvary over several orders of magnitude from populated coastal areasto the open ocean.39 SSA produced from areas with different PFAA concentrations wouldalso vary in the amount of PFAA transferred to air per pg of SSA (Na+), which could weaken the correlations.Different origins of SSA could be anotherfactor influencing thecorrelation between PFAA and Na21) can also weaken the correlationsobserved between PFAAs and Na+. For example, if the fluctuationin air concentrations of precursor compounds and/or the yield of thetransformation is large in relation to the contribution from SSA,the correlation between PFAAs and Na+ might be weak oreven difficult to observe. Birkenes has a lower SSA burden than And\u00f8ya(lower Na+ concentration) and is closer to an urban areawhere consumer products containing PFCA precursor compounds were likelyused widely.40 This may explain the weakercorrelation with Na+ for PFOA and PFNA in the Birkenessamples (r < 0.5) and the lack of correlationwith Na+ for the other PFCAs. Additionally, different SSAorigin and influence of other sources can lead to variability in the[PFAA]air/[Na+]air ratio and resultin the slope of the log\u2013log linear relationship deviating from1. For example, for PFOA, the slope estimated for the Birkenes samplesis 0.419 while the slope for the And\u00f8ya samples is 1.06  and Birkenes  at the two samplingsites.31 Thus, the observed correlations for PFSAsand low PFSA precursor concentrations in air suggest that the contributionfrom SSA may be more important for PFSAs compared to PFCAs.In contrastto the PFCAs, the t test, p < 0.001, +, PFDA/Na+, and PFOS/Na+ were found to be significantly higher inthe Birkenes samples (p < 0.05). SSA originatingfrom more polluted areas  would havehigher PFAA/Na+ ratios since laboratory results show thatthe amount of PFAAs transferred via SSA emission is positively correlatedwith their seawater concentrations.18 Additionally,greater contributions from other sources such as transformation fromprecursors may also lead to a higher PFAA/Na+ ratio.Interestingly, while the overall PFNA and PFDA loadings were significantlyhigher in the And\u00f8ya samples  light intensity, and hydroxyl (OH) radical concentrations.14 These parameters all have a seasonal pattern, so the contributionof these two sources to atmospheric PFAAs may differ between seasons.To investigate whether the correlations between PFAAs and Na+ revealed seasonal differences, the samples from the two samplingsites were grouped as summer samples (collected between April firstand September 30th) and winter samples (collected between Octoberfirst and March 31st). Since the PFAA concentrations in air can besimplified as the combination of the contribution from SSA ([PFAA]SSA) and the contribution from other sources ([PFAA]other), in addition to log\u2013log linear Pearson correlation analysisbetween PFAA and Na+, the data of the two seasons werefitted to a linear function of the form:kSSA (pg\u03bcg\u20131 Na+) represents the amountof PFAA transferred to the atmosphere per \u03bcg of Na+ and [PFAA]other (pg m\u20133) representsthe average of other sources. Results of the correlation analysisand the parameters of the fitted lines are included in Table S7.SSA productioncan be affected by a number of environmental variables including windspeed and the sea surface temperature.+ (p < 0.05) in both summer and winter samplescollected at And\u00f8ya except PFDoDA, for which the log\u2013loglinear correlation was only observed in summer samples. For And\u00f8yawinter samples, the fitted lines for each PFCA have greater kSSA (0.064\u20130.345) and lower [PFAA]other (0\u20130.012) than those of the summer samples (kSSA = 0.030\u20130.198 and [PFAA]other = 0.011\u20130.031). In other words, the PFCA concentrations inair at And\u00f8ya during winter appear more sensitive to changesin Na+ concentrations, but the contribution from othersources was lower compared to summer. PFOS showed a similar patternto PFCAs, but the difference between winter  and summer  was not as largeas observed for PFCAs.Almost all PFAAs were correlated with Na43 Concentrations of PFAA precursors in air were also found to be positively correlated withair temperature,21 and the lower air concentrationof precursor compounds in winter would further limit the degradationprocess to form PFAAs.The lower contribution from other sourcesin winter may be theresult of reduced yield of the indirect photolysis of PFAA precursors.In winter, the fewer daylight hours would lead to lower concentrationsof OH radicals in the atmosphere, which would limit the reaction rate.+ wereobserved for C8\u2013C10 PFCAs (p < 0.05) inthe winter samples and for C7\u2013C9 PFCAs (p <0.05) in the summer samples. The two PFSAs were correlated with Na+ (p < 0.01) in both sample groups. Similarto the And\u00f8ya samples, [PFAA]other obtained from thefitted lines for PFOA, PFNA, and PFOS at Birkenes were lower in winterthan in summer, suggesting a lower contribution from other sourcesin winter than in summer. However, contrary to the And\u00f8ya samples, kSSA of the Birkenes samples were similar betweenthe seasons, implying little variation of the contribution from SSA.The longer distance to the coast (\u223c20 km) than And\u00f8ya(\u223c1.3 km) may have limited the size of SSA that can be transportedto Birkenes, which may be one potential cause for the observed differences.However, since the PFAA enrichment in SSA under real-world conditionsis still not very well-understood, it is difficult to conclude thecauses of the observed seasonal differences. Further laboratory studieson the enrichment mechanisms of PFAAs in SSA  and field studies with size-resolved aerosolsampling techniques will help improve the understanding of the contributionof SSA to the atmospheric transport of PFAAs.For the Birkenes samples, correlationswith Na3.5i,j], the first row in The results of the backwardair mass trajectory analysis using theHYSPLIT4 model are presented in C\u0305ij,) of PFOA and PFOSare shown in 34 emissions from these sources may also have affectedthe observed PFAA concentrations at the two sites. In order to estimatethe accumulated source contribution to observed concentrations, thetransport probability function and source attribution function canbe combined in the Arctic region and North Atlantic than other areas, especiallyfor PFOS , suggestingPFAAs originated from these areas may be partly due to SSA emission.Plots for all PFAAs can be found in Figures S4\u2013S6.Plots of correlations per grid cell  representsthe estimated amount of PFAA transferred to the atmosphere per \u03bcgof Na+. On the basis of laboratory-derived EFs and reportedPFAA seawater concentrations from the literature and assuming a constantNa+ concentration of 13.8 g L\u20131 in water, kSSA determined by the fitted lines for all samples from And\u00f8ya(Table S7) can be compared to kSSA_est estimated using 32 were used for the estimation. The average EFof individual PFAAs in particles with a dry aerodynamic diameter <10 \u03bcm from the previous laboratory study were used in the estimation.18 Details regarding the PFAA concentrations andEFs can be found in Table S8 and Table S9.In a previous laboratory study,kSSA and kSSA_est for And\u00f8ya are presented in kSSA_est followed a similar pattern to kSSA,but the differences between kSSA and kSSA_est can be 1\u20133 orders of magnitude.These estimates were greatly influenced by the PFAA seawater concentrations. The relative standard deviation ofthe laboratory-derived EFs are between 8\u201330% (Table S9), but the median PFAA seawater concentrations indifferent regions vary over orders of magnitude. For example, themedian seawater concentrations of PFOA between 2010 and 2014 are 43,103, 520, and 1090 pg m\u20133 for samples from the ArcticSea, North Atlantic, Baltic Sea, and North Sea, respectively.32 Such large differences highlight the importanceof accurate information on the geospatial variation of PFAA seawaterconcentrations when evaluating the contribution of SSA. It shouldbe noted that for PFCAs, kSSA_est is atleast 2 times lower than kSSA in mostcases, especially when the median PFAA seawater concentrations forthe time period of 2015\u20132019 were used. The causes of the underestimationare unclear since the enrichment process in the field is much morecomplicated than in controlled laboratory experiments. For example,other ions in seawater such as Mg2+ also contribute toSSA emission while only NaCl was used in the laboratory study; thepresence of organic matter in seawater may influence PFAAs emissionby SSA; wind speed at the sea surface may influence the amount andsize of SSA particles emitted; and the SSA size distribution at thesampling site can be very different from freshly emitted SSA, etc.As such, further research on the PFAAs enrichment mechanism in SSAis required to reduce the uncertainty.The comparison between kSSA determined from the fitted lines for all samples fromAnd\u00f8ya (Table S7), the global annualfluxes of PFOA and PFOS from the ocean to the atmosphere via SSA emissioncan be estimated askSSA of the And\u00f8yasamples was used since the sampling site at And\u00f8ya is \u223c1.3km to open water so the SSA size distribution may be more similarto nascent SSA above the sea surface than at Birkenes. For SSA annualproduction (fluxNa+), Textor et al. calculated 12 estimatesof SSA annual production using 12 chemical transport and general circulationmodels.44 The first and third quartileand the median values of these 12 estimates were used as the low,high, and median scenarios. These estimates of SSA annual productionhave recently been updated,45 but the valuesreported by Textor et al. were still used in the present study inorder to compare with the modeled PFOA and PFOS emission via SSA byJohansson et al.15 The estimated globalannual fluxes of PFOA and PFOS and comparison with Johansson et al.15 are shown in Table S10. Estimates of PFOA and PFOS fluxes using the updated SSA annualproduction are also included in Table S10 for reference.On the basis of modeled annual SSA production and \u20131 for the low,median, and high scenario, respectively)15 are all below the estimates based on the field measurements . Similarly, in the previous comparisonwith the laboratory result, kSSA_est ofPFCAs were also lower than kSSA in mostcases (\u20131) is close to the modelingresult of Johansson et al. (42 tonnes yr\u20131), whilethe median (96 tonnes yr\u20131) and high scenarios (149tonnes yr\u20131) are lower than the previous modelingresults .15 Asmentioned before, PFAA seawater concentrations have a large influenceon estimates of the amount of PFAA transferred to air via SSA emission(kSSA_est) based on laboratory-derivedEFs. So the PFAA seawater concentrations that are used as input inthe modeling may be one cause of the differences between the modelingresults and the estimated annual fluxes. In addition, artificial seawaterwithout organic matter was used to derive the EFs in the lab. Butthe composition of real seawater is very complex and may have influenceon the enrichment process,19 so the EFs measuredin the lab may differ from the field. It should also be noted thatthe model used the EF of three modes as input , while the estimate in the current study was based on thefield measurement of bulk aerosol samples. The EFs generally increasewith decreasing particle size.18 For example, the laboratory-derivedaverage EF of PFOS was 9.6 \u00b1 1.4 \u00d7 103 for particles< 10 \u03bcm but increased to 2.9 \u00b1 0.5 \u00d7 104 when only particles < 1.5 \u03bcm were considered (Table S8).For PFCAs, the modeling results from the threescenarios by Johanssonet al. , our results suggest that PFAAs transport via SSA may impact largeareas of inland Europe and other continents in addition to coastalareas. However, it is still challenging to evaluate the contributionfrom SSA on the global scale. Further laboratory experiments focusingon the enrichment mechanisms and more field evidence from variouscoastal locations are required before this process is well-parametrizedfor inclusion in global models.The observed significant correlationbetween PFAAs and Na"}
+{"text": "As a result, 75% of the hCG (n = 6/8) and 33% of GnRH (n = 1/3) inductions resulted in ovulation. Ovulation occurred when fecal estrogen concentration increased before and pregnane concentration after induction. Thirty-six percent of all treatments (n = 4/11) failed to induce ovulation. When ovulation induction by hCG/GnRH injection failed, estrogen and pregnane concentrations were significantly lower compared to ovulatory estrous (P < 0.001). Our results suggest that hCG and GnRH analog facilitate an easily applicable treatment to induce ovulation in females with behavioral but at times an-ovulatory estrous. Frequent use of hCG as an ovulation inducer might help to achieve pregnancies in genetically important but an-ovulatory GOH rhinoceroses.Despite a profound knowledge on reproduction biology in greater one-horned (GOH) rhinoceros, many individuals cope with sub or infertility or an-ovulatory estrous. At the same time, early and regular captive breeding is of high importance in female GOH rhinoceros due to their high prevalence to develop genital tract tumors with consequent cessation of reproduction. Thus, mature, an-ovulatory GOH rhinoceros represent a challenge for captive breeding programs and warrant for means of reliable ovulation induction. Here, we used hCG and GnRH analog histrelin to induce ovulation in an-ovulatory GOH rhinoceros. Upon ultrasound diagnosis of a preovulatory follicle hCG or GnRH were injected to induce ovulation ( Rhinoceros unicornis) is mono-ovulatory. Follicles grow in waves, from which the dominant, preovulatory follicle develops. The preovulatory, Graafian follicle measures an exceptional 10\u201312 cm in diameter, which is much larger than in other rhinoceros species. In fact, with a volume of 300\u2013500 mL, it is the largest ovulatory follicle described for any mammal species (The mean estrous cycle length of the greater one-horned (GOH) rhinoceros is 43 \u00b1 6 d , 2. LikeDespite available profound knowledge on reproduction biology in GOH rhinoceros, many individuals are affected by sub- or infertility, silent estrous, anestrous, early embryonic death, or still birth \u20135. EarlyEstrous synchronization in anestrous females to achieve ovulation and conception after natural mating or AI is an assisted reproduction tool so far described in black and white rhinoceros \u20138. For tIn GOH rhinoceros, irregular, and an-ovulatory estrous cycles with subsequent formation of hemorrhagic follicles represent a challenging problem in captive breeding programs. However, estrous synchronization has yet not been described for GOH rhinoceros. Only ovulation induction has been briefly mentioned being used during AIs , 5. HereWhile hormone activity and ovarian dynamics can be monitored closely , 2, therOvulation induction was performed in one anestrous, 12-year-old, captive female GOH rhinoceros (studbook no: 367) over a study period of 4 years. The study animal is a wild born, orphan transferred from Nepal to the Vienna Zoo at the age of 3 years. The female is housed with a fertile male in separate enclosures. Continuous hormone analysis had been conducted since this female was 4 years of age. From the age of 9 years, regular peaks of estrogen-precursors indicated follicular development, but no clear pregnane peaks were measured, suggesting that ovulation never occurred.Fecal samples were collected two times a week and analyzed using enzyme immunoassays for 20\u03b1-OH-pregnanes and 17-oxo-androstanes . Transrectal ultrasound monitored ovarian dynamics and development of preovulatory follicles. Weekly examinations were gradually increased toward daily ultrasounds when a dominant follicle emerged and grew >8 cm. Yet, without treatment pre-ovulatory follicles became atretic or hemorrhagic as previously described by Stoops et al. . A preovulatory follicle with a mean diameter of 11.9 \u00b1 0.2 cm was imaged during eight silent estrous  were preceded by a significant, preovulatory increase of fecal estrogene concentration to >75 ng/ g feces. The presence of a 11.3 \u00b1 0.9 cm corpus luteum .Successful ovulation inductions (s luteum  combinedn = 6/8). Injectable GnRH analog triggered ovulation only once (n = 1/3). Despite the rise in estrogen, the formation of a corpus luteum, and the increase in luteal activity as indicators for the induced ovulation, behavioral estrous was not observed before or after any of the hCG/GnRH treatments.HCG administered in the presence of a preovulatory follicle induced six ovulations resulting in an ovulation rate of 75%  indicate that GnRH analogs are similarly suitable to induce ovulation in an-ovulatory GOH rhinoceros than hCG.So far, GnRH has been used incidentally for ovulation induction in two GOH rhinoceros , 5. GnRHResults on the use of hCG for ovulation induction in GOH rhinoceros are consistent with results from white rhinoceros where 67% of estrous synchronizations using hCG resulted in ovulation . In whitOn one hand, hormone-induced ovulation is technically challenging for many facilities and does not appear as a comprehensive method for reproduction management of captive GOH rhinoceros. It is likely limited to facilities with an advanced animal training program and where critical hardware such as an ultrasound machine and a restraint chute is present. On the other hand, in females at advanced age, with \u201cerratic\u201d an-ovulatory estrous cycles and conception failure but yet important genetics for the captive population, the use of hCG/GnRH during behavioral estrous might present a new, practical reproductive management tool.In conclusion, our data shows that in presence of a preovulatory follicle hCG-induced ovulation in an-ovulatory GOH rhinoceros in 75% of treatments. Thus, injectable hCG represents an easy-to-apply and practical treatment to induce ovulation in GOH rhinoceros with behavioral but at times an-ovulatory estrous. As an-ovulatory GOH rhinoceros represents a challenge for captive breeding programs, frequent use of ovulation inducers, such as hCG or GnRH, might help to achieve late pregnancies in genetically important but an-ovulatory GOH rhinoceros.The original contributions presented in the study are included in the article/supplementary material, further inquiries can be directed to the corresponding author/s.The animal study was reviewed and approved by Ethics Committee of the Leibniz Institute for Zoo and Wildlife Reserach. Written informed consent was obtained from the owners for the participation of their animals in this study.RH: study design, data anaylsis, and manuscript writing and edit. FB: study design, data aquisitition, data analysis, and mansuscirpt edit. SH: Data auqiuisition. ED: data acquisition. TH: supervision and manuscript edit. FS: study design, data aquisition, data analysis, and manusciprt writing and edit. All authors contributed to the article and approved the submitted version.The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest."}
+{"text": "The essentiality of selenium (Se) and iodine (I) to human beings and the widespread areas of selenium and iodine deficiency determine the high significance of functional food production with high levels of these elements. In this respect, joint biofortification of agricultural crops with Se and I is especially attractive. Nevertheless, in practice this topic has raised many problems connected with the possible utilization of many Se and I chemical forms, different doses and biofortification methods, and the existence of wide species and varietal differences. The limited reports relevant to this subject and the multiplicity of unsolved questions urge the need for an adequate evaluation of the results obtained up-to-date, useful for developing further future investigations. The present review discusses the outcome of joint plant Se\u2013I biofortification, as well as factors affecting Se and I accumulation in plants, paying special attention to unsolved issues. A particular focus has been given to the prospects of herb sprouts production enriched with Se and I, as well as the interactions between the latter microelements and arbuscular-mycorrhizal fungi (AMF). An adequate consumption of essential elements, such as Fe, Zn, Se, and I is one of the most important factors for maintaining good human health conditions. Among the above-mentioned elements, Se and I draw special attention due to the close relationship between their metabolism in mammals, where the fundamental function of Se is its presence in the active center of triiodothyronine deiodinases, involved in the biosynthesis of thyroid hormones ,2,3, in Based on the literature reports indicating a high variability of the results and the complexity of this topic, the present review is aimed both to provide the current status and to trigger future investigations relevant to the joint Se\u2013I biofortification of agricultural crops, so as to develop and implement the technology of functional food production enabling to decrease, at least partially, the ecological risks connected with the deficiency of these two microelements. The main sources of Se and I for plants are soil and precipitation, with the latter providing a significant transfer of the two elements from the surface of sea and oceans . PhytoplIn this respect, the agrochemical biofortification of plants with Se and I is especially attractive, since it provides a chance to produce functional food products with a significant content of well-assimilated forms of trace elements and other natural antioxidants. Furthermore, most of agricultural crops belong to non-accumulators of these elements and therefore are highly sensitive to toxic Se\u2013I levels, thus providing the so-called \u2018buffer effect\u2019 preventing human toxicities in case of overdosing during biofortification . In gene\u22121 d.w. without growth inhibition, depending on the Se form and dose [In general, Se content in most agricultural crops, known to be non-accumulators of Se, may be increased up to 0.2\u20133000 mg kgand dose , as it aand dose . ConsideSe and I are not essential for plants but, thanks to their antioxidant properties, they are able to protect plants from different forms of oxidant stress and at certain concentrations may serve as growth stimulators ,13. On tIn plants, the aforementioned threshold referred to Se and I is species- and variety-dependent, which determines significant differences in the enrichment efficiency with these microelements ,25,29,30As a sulfur analog, Se has several forms with different valences: selenates (+6), selenites (+4), organic derivatives  and elemental selenium . The known chemical forms of I are iodides (\u20131), iodates (+5) and derivatives of aromatic amino acids (\u20131) . +4 and later transformed to selenocystine (SeCys)2, Se-methyl-selenocysteine (MeSeCys), and selenomethionine (SeMet) [2, CH3I, KI, KIO3), and apparently via amino acid transporters for organic I forms [The assimilation of both Se and I is achieved with the participation of appropriate protein-transporters : sulfate (SeMet) . As far  I forms . Another I forms .All these forms of Se and I are used for producing vegetables fortified either with Se or I ,31.Under joint application of the two elements, the range of their chemical forms used is limited to selenates (+6), selenites (+4), and also iodates (+5) and iodides (\u20131) .The up-to-date results relevant to the joint plant biofortification with Se and I are presented in Attempts to quickly solve the deficiency problem of a whole set of trace elements, such as Se, I, Fe, Zn, in the conditions of different countries worldwide, were achieved in cereals (10 wheat cultivars and 7 rice cultivars) in 2019 and 2020, using foliar application of elements cocktail. These works revealed the efficiency of such biofortifications, but lack of significant effect on wheat yield and just a slight increase of rice yield ,30. In tThe success of Se enrichment of various agricultural crop seedlings ,51 and t3 and KIO3 + Na2SeO4 supply, indicating the development of oxidant stress , while both joint and separate application of potassium iodide and sodium selenate resulted in growth inhibition . It is st stress .In the aforementioned conditions, the Se\u2013I interaction was also highly variable under the joint application of the two elements. Indeed, in pea and chervil seedlings there was no relationship between the two elements . Joint aHydroponics or soilless is another technological approach providing strict control of crop growing conditions and minimizing the effect of environmental factors. Four studies of joint Se\u2013I biofortification in soilless conditions ,39,40,41Arabidopsis thaliana revealed that micromolar concentrations of I are beneficial for biomass accumulation and lead to early flowering, regulating the expression of several genes mostly involved in the plant defense response, and may be incorporated into proteins both of shoot, participating in the photosynthesis, and of roots associated with some peroxidase activities [Experiments with tivities . Unfortunately, no direct data on phytohormones participation in plant I accumulation are available, except the Smolen experiments with salicylic acid ,39 Tabl. Joint b2SeO4 supply compared to KIO3 and Na2SeO3 use. Despite a significant increase in SeMet and SeCys content in lettuce leaves due to joint Se\u2013I application, the authors demonstrated a decrease in Se and I concentration in joint experiments compared to the separate application of the two elements [Great success in the utilization of Se-containing fertilizers in Finland  for optielements . Further\u22121 concentration was optimal for mature plants [\u22121 did not affect the sprout biomass.Among different methods of joint Se\u2013I biofortification, foliar application of the two elements is maybe the most interesting, although the technology of such enrichment raises some risks due to Se toxicity. As shown in e plants ,62 and t+4) accumulation and decrease of selenate (Se+6), kohlrabi demonstrated antagonism between these elements contrary to pea with typical Se\u2013I synergism. Se\u2013I synergism in Indian mustard was demonstrated only in case of separate Se and I application but not in conditions of joint Se\u2013I application [Notably, foliar application of the two elements resulted in significant Se\u2013I interaction compared to the hydroponic conditions which did not cause significant effects of the joint Se\u2013I supply, and only 50% of the investigations relevant to sprout Se\u2013I biofortification revealed the existence of Se\u2013I relationships. Foliar biofortification technology demonstrated that Se\u2013I interaction is highly species-dependent. Indeed, while Se\u2013I joint foliar biofortification of chicory resulted in the increase of selenite  [The assessment of joint Se\u2013I effect on N, P, S, Si and V relationship should be the priority , conside n = 14) . A highlAs mushrooms belong to the plant kingdom, the relationship revealed in Furthermore, the protection effect of Se against plant biotic and abiotic stress including heavy metals uptake should be highlighted. This approach might become especially interesting in contexts of Se\u2013I interaction and joint biofortification. A further focus should be given to the effect of joint Se\u2013I biofortification on plant antioxidant status, including accumulation of sugars which are known also to participate in plant antioxidant protection .The results presented in this work indicate that a restricted number of species was used for joint Se\u2013I biofortification, which entails the need for further determinations of the biofortification efficiency in widespread agricultural plants, such as tomato, onion, garlic, parsley, pepper, etc. Moreover, new discoveries relevant to organic Se forms and Se nanoparticles (NPs) efficiency in joint Se\u2013I biofortification are expected. Finally, a special interest regards the interaction between Arbuscular Mycorrhizal Fungi (AMF) inoculation and Se\u2013I biofortification in other agricultural crops. From a practical point of view the present knowledge of Se\u2013I interaction in plants indicates the actual possibility of industrial production both of sprouts and microgreens and of several agricultural crops fortified with these elements, and emphasizes the importance of wide AMF utilization capable not only to increase plant yield and quality, but also to enhance the accumulation of Se and I.Despite the attractiveness of the joint Se\u2013I biofortification of agricultural crops, unfortunately this issue has been poorly studied and further investigations are needed for identifying the mechanism of Se\u2013I interaction and evaluating the main factors affecting its intensity. From a general point of view, this topic may be considered as a new field of novel discoveries both in human nutrition and plant physiology. However, it is important to highlight that the current research state-of-art already shows the actual possibility to achieve the joint Se\u2013I biofortification of several plant species at industrial scale, targeting the human health improvement. Consumers\u2019 willingness to purchase Se\u2013I biofortified products compared to utilization of appropriate food supplements, and Se and I levels in fortified fruits and vegetables sufficient to significantly increase Se\u2013I consumption levels may be considered as a basis for active development of functional food production with enhanced Se and I levels."}
+{"text": "Foliar and soil Se application of either selenate or selenite significantly increased the Se content in different parts of wheat, while selenate had higher bioavailability than selenite in the soil. Regardless of Se application methods, the Se content of the first node was always higher than the first internode. Selenomethionine  and selenocystine  were the main Se species identified in grains of wheat. The percentage of SeMet increased by 6% in soil with applied selenite and selenate treatments at 0.5 mg kg\u20131 and decreased by 12% compared with soil applied selenite and selenate at 2 mg kg\u20131, respectively. In addition, flour processing resulted in losses of Se; the losses were 12\u201368% in white all-purpose flour compared with whole wheat flour. The Se bioaccessibility in whole wheat and white all-purpose flours for all Se treatments ranged from 6 to 38%. In summary, foliar application of 5 mg L\u20131 Se(IV) produced wheat grains that when grounds into whole wheat flour, was the most efficient strategy in producing Se-biofortified wheat. This study provides an important reference for the future development of high-quality and efficient Se-enriched wheat and wheat flour processing.A comprehensive study in selenium (Se) biofortification of staple food is vital for the prevention of Se-deficiency-related diseases in human beings. Thus, the roles of exogenous Se species, application methods and rates, and wheat growth stages were investigated on Se accumulation in different parts of wheat plant, and on Se speciation and bioaccessibility in whole wheat and white all-purpose flours. Soil Se application at 2 mg kg It was \u20131 . Conside\u20131 . Up to n\u20131 , mushroo\u20131 , maize  uaporins .\u20131, which provides insufficient daily Se for sustaining human health  and methylselenocysteine (MeSeCys) accounted for 2.6 and 0.3% of the total Se, respectively (Selenomethionine (SeMet) is the primary Se species in wheat grains . Lu et aectively . In geneectively , howeverThe production of Se-enriched wheat can be an important step in eliminating the negative impact of Se deficiencies in low Se areas. In this regard, bioaccessibility of Se from edible wheat tissues is important to understand. The bioaccessibility of Se using in vitro simulated gastrointestinal digestion test (PBET) refers to the portion of a nutrient, e.g., Se in a food product, that can be found dissolved in gastric (G) and intestinal (I) phases, and be potentially absorbed and utilized by organisms . The ordCurrently, the main methods used to explore the uptake, translocation, and transformation of Se in crops can be divided as: hydroponic experiment, pot experiment, and field experiment . The env\u20131; organic carbon, 8.53 g kg\u20131; cation exchange capacity, 23.34 cmol(+) kg\u20131; amorphous aluminum, 0.40 g kg\u20131; amorphous iron, 1.20 g kg\u20131; clay, 39.6%; and total Se, 0.139 mg kg\u20131.The pot experiment was carried out in a greenhouse at Northwest Agriculture and Forestry University in Yangling, Shaanxi from year 2018 to 2019. Tested soil was collected from the non-polluted farmland around Northwest A&F University, which has never received applied exogenous Se. After air-drying, homogenizing, and grinding, the soil was passed through 2 and 0.149 mm sieve for physical and chemical analysis determined according to Triticum aestivum L, Xiaoyan-22) were provided by a commercial seed company of Northwest Agriculture and Forestry University. Wheat seeds with full grains were selected for consistent size and no pest infestation damage, then disinfected with 5% (V/V) H2O2 for 30 min and washed thrice with deionized water.Winter wheat seeds , and Se(VI) was sodium selenate , both were analytical pure reagents. The organic Se  were all purchased from Sigma-Aldrich company and used for the determination of Se speciation in grain and leaves of wheat. Pepsin, sodium malate, sodium citrate, lactic acid, acetic acid, bile salt and trypsin, which were used for the determination of Se bioaccessibility, were all purchased from Yuanye Biological Technology Co., Ltd.Se(IV) was sodium selenite (Na\u20131) were selected in soil Se application. For foliar Se treatments, two species of exogenous Se (Se(IV) and Se(VI)), three application rates of Se  were applied at two growth stages of pre-flowering stage (F1) and pre-filling stage (F2). A total of 19 treatments were used in this experiment and each treatment was replicated three times.A complete block design was used in this study, two species of exogenous Se (Se(IV) and Se(VI)), three application rates of Se  and Se(IV) solutions were prepared according to the designed Se application rates and then evenly sprayed into the soil and mixed. The soil moisture was adjusted to 70% of the water holding capacity. After full mixing, the sprayed soil was allowed to equilibrate at 25\u00b0C for 30 days , and dei\u20131 nitrogen fertilizer was applied at regreening stage of wheat. 20 seeds were sowed into each pot. Two weeks after the emergence of seedlings, the seedlings were thinned to 10 plants per pot. The pots were weighed and watered every 4\u201314 days during the wheat growing season. For the foliar Se application, the Se solution was sprayed evenly on the plants during the pre-flowering stage (April 2019) and the pre-filling stage (May 2019) of growth. Specifically, 100 mL Se (IV) or Se (VI) solution  were mixed into water with 0.1% surfactant. Foliar Se was applied three times  in intervals of 5 days to ensure that Se was fully absorbed by wheat leaves. Each pot was sprayed with a total of 1.5, 3, and 6 mg Se(IV) and Se(VI), respectively. Moreover, during the foliar application process, the soil surface was covered with plastic film to avoid Se from dripping onto the soil.During the sowing period, 0.15 g N  and 0.033 g P  were applied to each kilogram of soil, and 0.15 g kgIn vitro simulated gastrointestinal digestion test\u201d).The height and length of rachis and the effective ear number of wheat were measured after wheat harvest (June 2019). The harvested wheat was first washed with tap water thrice to remove dust and other impurities, rinsed with deionized water thrice, and then dried with absorbent paper. Meanwhile, each wheat plant was divided into nine parts: root, stem, leaf, glume, grain, sheath, first internode, first node, and rachis . After wThe total Se content was determined via hydride atomic fluorescence spectrometry  after wet-acid digestion. The specific procedure has been described by \u20131 for 10 min at 4\u00b0C. The supernatant was collected after pouring through a 0.22 \u03bcm filter membrane, and then analyzed using the HPLC-ICP-MS system. The instrument conditions are as follows: for the HPLC; Hamilton PRP-X100 anion exchange column  was used, the column temperature was room temperature, the mobile phase was 40 mmol L\u20131 diammonium hydrogen phosphate (pH = 6.0 adjusted with 10% formic acid) at a flow rate of 1.0 mL min\u20131, and the injection volume was 100 \u03bcL. For the ICP-MS; RF power was 1,550 W, RF matching voltage was 1.8 V, sampling depth was 8 mm, atomization chamber temperature was 2\u00b0C, plasma gas flow rate was 15.0 L min\u20131, the flow rate of carrier gas was 0.65 L min\u20131, the mode was high He collision mode, the flow rate of collision gas was 4.5 mL min\u20131, peristaltic pump speed was 0.3 r s\u20131. The detection mass number m/z = 78(Se), and the integration time was 0.5 s. At the same time, Se-enriched yeast of SELM-1 was used as the quality control sample, the measured content of SeMet in the quality control sample was 3,236 \u00b1 21 mg kg\u20131, the standard value was 3,389 \u00b1 173 mg kg\u20131, the recovery rate was 95.5%.Selenium speciation was determined by HPLC-ICP-MS. First, 0.2000 g freeze-dried grains or leaves was taken into a centrifuge tube, 20 mg protease XIV and 5 mL water were added, vortexed for 30 s, ultrasonic extraction for 3 h in a 37\u00b0C water bath and shook several times during the period. Second, the sample was centrifuged at 9,000 r minAccording to the method of (1)G: 1.000 g sample was accurately weighed into 100 mL polyethylene centrifuge tube, and 50 ml fresh gastric juice (pH 2.5) were added into a constant temperature (37\u00b0C) water bath for digestion at 150 rpm for 1 h. The obtained digestive juice was centrifuged at 4,000 rpm for 10 min and 10% of the supernatant was removed and stored at 4\u00b0C for Se content determination.(2)I: the pH of the remaining digestive juice was adjusted to 7.0 by 10% (m/v) NaOH. Then 5 mL intestinal fluid were added and digested in a constant temperature water bath  for 4 h. The obtained digestive fluid was centrifugated at 4,000 rpm for 10 min, and the supernatant was stored at 4\u00b0C for further Se content determination.Moreover, the total Se content in G and I sample (2 mL of digestive fluid) were determined by the method already described in section \u201cSelenium content in various parts of wheat.\u201d The composition of gastric juice and intestinal juice was the same as Pearson correlation analysis and variance analysis were performed by SPSS 20.0 . The data in the chart are the averages of three replicates, and the data were calculated using the following Eqs.a\u2013b represents the Se translocation factor from part \u201cb\u201d to part \u201ca\u201d of wheat . \u201ca\u201d or part \u201cb\u201d refer to different parts of \u201croot,\u201d \u201cfirst node,\u201d \u201crachis,\u201d \u201cgrain,\u201d and \u201cleaves.\u201dwhere TFof wheat . Ca and \u20131. Se in sample indicates the Se content in the corresponding sample, mg kg\u20131.where BA% represents the Se bioaccessibility of whole wheat and white all-purpose flours. Selenium in G/I was the Se content in gastric or intestinal phase of the sample, mg kg\u20131) is the difference between the Se content of whole wheat and white all-purpose flours with different Se treatments.where LS% represents the Se lost proportion with different flour yield. The lost Se content (\u03bcg g\u20131 Se(VI) was soil applied, indicating that the 2 mg kg\u20131 Se treatment has little inhibition on wheat growth. However, the growth of wheat appeared to slow down due to the biological dilution effect at the later growth stage of wheat.p < 0.05) effects on the biomass and grain yield of wheat. Soil application with 2 mg kg\u20131 Se(IV) resulted in the highest grain yield of wheat, which was about 6% higher than control treatment. Compared with control, all soil Se application treatments reduced the yield of wheat (by 4\u20135% by Se(IV) treatments, except at 2 mg kg\u20131 Se(IV) (yield increased by 10% compared with 0.5 mg kg\u20131 treatments), and 4\u201362% in Se(VI) treatments). However, no significant effects (p > 0.05) were observed in the grain yield of wheat at different foliar Se application treatments, irrespective of the Se species, application rates, and application stages.p < 0.05) increased the biomass of wheat (7\u201311%), compared with control, while the application of Se(VI) increased Se application rates both significantly (p < 0.05) reduced wheat biomass (2\u201359%). Compared with 2 mg kg\u20131 Se(VI) treatment, the biomass of wheat treated with 0.5 mg kg\u20131 Se(VI) increased by 58%. No significant (p > 0.05) effects on the biomass of wheat were found among different foliar Se application treatments, irrespective of exogenous Se species, application rates, and application stages.We note that soil Se(IV) application treatments significantly (p < 0.05) increased the Se content in each part of wheat in comparison to control. The Se content increased with higher rate of Se application. A significant (p < 0.05) increase of 72 and 84% of the Se content in grains of wheat was observed at soil application 2 mg kg\u20131 Se(IV) and Se(VI) treatments, compared with 0.5 mg kg\u20131 treatment of either form. Meanwhile, the Se content in grains with foliar application rate of 20 mg L\u20131 Se(IV) and Se(VI) increased remarkably (p < 0.05) by 68\u201369% and 60\u201368% at pre-flowering and at pre-filling stages, respectively, compared with the corresponding 5 mg L\u20131 Se application treatments.The harvested wheat plants were divided into nine parts: root, stem, leave, sheath, first internode, first node, rachis, grain, and glume . We obsep < 0.05) increased the Se content in each part of the wheat (90\u201399.5%), compared with Se(IV) treatments (except foliar application of 20 mg L\u20131 Se(VI) applied at pre-filling stage). Compared with foliar Se(IV) treatment, foliar application of Se(VI) at pre-flowering stage and pre-filling stage significantly (p < 0.05) increased the Se content of wheat grains by 6\u201344% and 3\u201328%, respectively. In addition, the Se content of wheat grains from foliar Se(IV) and Se(VI) application at pre-filling stage significantly (p < 0.05) increased by 22\u201330% and 6\u201325% than that applied at pre-flowering stage, respectively.Regardless of application method of Se(IV) or Se(VI), the Se content of the first node of wheat was always higher than that of the first internode. Meanwhile, irrespective of the Se application rate and method, Se(VI) treatments significantly (p < 0.05) increased the Se content of wheat grains compared with corresponding soil application treatments, irrespective of the application stages. Specifically, the Se content of wheat grains sprayed with Se(IV) significantly (p < 0.05) increased by 45\u201354% and 61\u201368% at pre-flowering and pre-filling stages, respectively, compared with soil Se(IV) application. In contrast to foliar Se(IV) treatment, soil application of Se(VI) significantly (p < 0.05) increased the Se content of wheat grains compared with its foliar application. The Se content of wheat grains in the soil application treatments was significantly (p < 0.05) increased by 79\u201391% and 75\u201390% at the pre-flowering and pre-filling stages, compared with foliar application treatments, respectively.Foliar Se(IV) application significantly  foliar Se application: TFroot/first nodes, TFrachis/first nodes, TFgrains/rachis, and TFgrains/leaves.Translocation factor (TF) can be used to reflect the translocation capacity of plant from source to sink . Figure grain/rachis of wheat (1.2\u20132.1), while reduced the TFrachis/first nodes (0.6\u20131.1) and TFfirst nodes/root ). Moreover, when Se(IV) was soil applied, the TFgrains/rachis increased with the higher application rate of exogenous Se, and the TFgrains/rachis decreased when Se(VI) was soil applied. Although soil Se application reduced the TFfirst nodes/root, TFfirst nodes/root increased with a higher rate of exogenous soil Se applied, irrespective of the Se species. Regardless of the application stages, rates, and species of Se, foliar spraying of exogenous Se had no significant (p > 0.05) effects on TFgrains/leaves. Compared with control, foliar Se application of both forms of Se increased the TFgrains/rachis (0.1\u20130.8) in wheat. Compared with pre-filling stage, the TFgrains/rachis in wheat increased at pre-flowering stage ((Se(IV): 0.2\u20130.5; Se(VI): 0.1\u20130.9)). In addition, spraying Se(IV) at pre-filling stage significantly (p < 0.05) increased the TFrachis/first nodes (0.8\u20131.1) and the TFroot/first nodes (0.9\u20138.4), compared with control.Compared with control, soil Se application treatments significantly increased the TF2 (4\u201313%) ( (4\u201313%) , while S\u20131 increased by 6% and decreased by 12%, respectively, compared with the 2 mg kg\u20131 treatment, respectively. However, there was no significant (p > 0.05) differences among the foliar Se application rates.No significant differences were observed for the percentages of SeMet in wheat grains among soil (83\u201395%) and foliar (87\u201396%) Se application treatments, while the percentages of SeMet varied with Se application rate . The per\u20131, the percentage of SeMet in wheat grains increased by 7% in Se(VI) treatment compared with Se(IV) treatment, but decreased by 11% at 2 mg kg\u20131 Se(VI) soil treatment. However, the percentage of SeCys2 in wheat grains increased by 9% with 2 mg kg\u20131 soil Se(VI) treatment compared with 0.5 mg kg\u20131 Se(VI) soil treatment. Moreover, foliar Se(IV) application increased the percentage of SeMet in wheat grains, compared with Se(VI) application. We found that compared with Se(VI) treatments, the percentage of SeMet in wheat grains treated with Se(IV) increased by 3\u20137%. The percentage of SeMet measured in wheat grains produced from foliar Se treatment with high rate of Se(VI) at pre-flowering and pre-filling stages, increased by 9 and 5%, respectively, compared with soil Se treatments.The species of exogenous Se also affected the percentages of SeMet in grains. With soil application rate at 0.5 mg kg\u20131 Se(VI) treatment at pre-flowering stage and pre-filling stage, respectively, compared with foliar Se(IV) application.Regardless of the application methods, inorganic Se (50\u2013100%) was the major Se species in wheat leaves in all the treatments, with Se(IV) and Se(VI) accounting for 1\u201371% and 18\u201399% of total Se, respectively, while SeMet (1\u201342%) was the main organic Se species . Moreove\u20131 Se(IV) rate was the highest, which was 35\u201349% higher than other treatments. Except for soil Se(IV) application at 2 mg kg\u20131, the percentage of organic Se in wheat leaves sprayed with 20 mg L\u20131 Se(VI) increased by 8% and 11% at pre-flowering and pre-filling stages, respectively. The percentage of SeMet in wheat leaves with soil Se(IV) application at 2 mg kg\u20131 increased by 40% compared with the corresponding foliar application treatments at pre-flowering stage. The percentage of Se(VI) in wheat leaves with soil application at 20 mg L\u20131 Se(VI) increased by 8% and 9% applied at pre-flowering stage and pre-filling stages, respectively, compared with foliar application treatments.Irrespective of the application methods of Se, the percentage of organic Se in wheat leaves with soil application at 2 mg kg\u20131 Se(IV) and Se(VI) treatments, the percentages of Se lost in wheat flour were 4% and 8%, respectively, compared with the 0.5 mg kg\u20131 Se(IV) and Se(VI) treatments. The percentages of Se lost in wheat flour produced from plants sprayed with 5 mg L\u20131 Se(VI) increased by 40% (pre-flowering stage) and 23% (pre-filling stage), compared with 20 mg L\u20131 Se(VI) treatment.The whole wheat (100% wheat) and white all-purpose flour (70% wheat flour and 30% bran) were obtained by controlling different proportions of flour and bran of wheat. Selenium lost was calculated as the difference between the Se content of whole wheat and white all-purpose flour. Irrespective of the Se application methods, the percentage of Se lost in wheat flour process among the different Se treatments ranged from 12 to 68%. For soil Se application at 2 mg kgIn general, flour produced from foliar Se application had a higher percentage of Se lost in flour produced from soil Se application. The percentage of Se lost in wheat flour treated with foliar Se(IV) application was 2\u201312% (pre-flowering stage) and 43\u201351% (pre-filling stage) higher than that of the soil Se treatments (except for spraying Se(VI) at pre-filling stage). When Se(VI) was sprayed, the percentage of Se lost in wheat flour was 28% (at pre-filling stage) and 42% (at pre-filling stage) higher than the soil Se(VI) treatment.The bioaccessibility of Se in whole wheat and white all-purpose flours are shown in \u20131 increased by 6\u201313% compared with 0.5 mg kg\u20131 treatments, except for the soil application of 2 mg kg\u20131 Se(VI) treatments. Compared with the 0.5 mg kg\u20131 Se(VI) treatment, the Se bioaccessibility in whole wheat and white all-purpose flours decreased by 13% (G) and 16% (I), and 15% (G) and 17% (I) in soil at 2 mg kg\u20131 Se(VI) treatment, respectively. In addition, the Se bioaccessibility in Se(VI) treatments in both foliar and soil Se application was higher than that in Se (IV) treatment, except soil application at 2 mg kg\u20131 Se(VI). In soil Se application, the bioaccessibility of Se in wheat flour of Se(VI) treatment increased by 4% in both G and I (in whole wheat flour), compared with Se(IV) treatment. Compared with foliar Se application at pre-flowering stage, foliar Se application at pre-filling stage increased the bioaccessibility of Se in whole wheat (3\u20134%) and white all-purpose flours (2\u20138%) in G and I .Irrespective of the Se application methods and Se species, the Se bioaccessibility in wheat flour  produced from soil at 2 mg kg\u20131 Se(VI) significantly reduced plant height, effective ear number, and rachis length of wheat compared with 0.5 mg kg\u20131 Se (VI) treatment (\u20131 Se(VI) has a certain toxic effect on wheat growth. Based on this observation, it appears that 1 mg kg\u20131 can be used as the tolerance limit of Se(VI) in a wheat Se biofortification strategy. The grain yield of wheat in 0.5 mg kg\u20131 Se(VI) treatments increased by 61% compared with 2 mg kg\u20131 Se(VI) treatments. Similarly, this study also found that the highest grain yield was significantly (p < 0.05) obtained in soil applied with 2 mg kg\u20131 of Se(IV), which was about 6% higher than the control treatment  difference between foliar Se application and control treatment. p > 0.05). However, in soil Se application, compared with the selenite application (1 mg kg\u20131), the grain and the biomass yield of ZM-9023 significantly (p < 0.05) increased by about 15% for selenate application  increased the Se content in each part of wheat (90\u201399.5%), and spraying Se(VI) increased the Se content of wheat grains (3\u201344%) compared with Se(IV) treatment. This increase in Se accumulation with selenate may be attributed to the different transport mechanism of Se(VI) and Se(IV) in plants. The uptake and translocation of these two inorganic forms of Se by plants is an energy-consuming process   process . However process .Rachis is the organ connecting the stem and grain of wheat . SeleniuThis study found that irrespective of the Se application methods, the Se content in the first node was higher than that of the first internode. Except for wheat grains and leaves, the Se content in first internodes and nodes was relatively high, which was consistent with findings reported by rachis/first nodes increased when exogenous Se was applied at pre-flowering stage compared with pre-filling stage  were the main Se species in wheat grains  and MeSeCys (0.3%). More than 50% of Se was stored in edible parts such as grains, beans, and leafy vegetables as organic Se, when different species of Se(VI) or Se(IV) were applied . This st93\u2013100%; , which iSe(VI) is difficult to be converted into organic Se compared with SeIV; . TheoretIn general, most of the exogenous Se was accumulated in wheat leaves after foliar Se application . The perPleurotus ostreatus and Pleurotus florida had high Se bioaccessibility, which reached 70\u201392% , the Se bioaccessibility of Se(IV) treatment was slight higher than Se(VI) treatment (63 vs 56%), although this difference was not significant  had higher Se bioaccessibility than Se(IV) treatments. Regardless of the Se application methods, the Se bioaccessibility in intestinal phase of whole wheat and white all-purpose flour was higher than that in gastric phase. The results are consistent with the study of \u20131 Se(IV), since Se(VI) has a higher Se bioavailability than Se(IV), there was an increased translocation of Se in wheat from the rachis to the grain. Both foliar and soil Se application can effectively increase the Se contents of wheat. The Se species applied to soil or to plant, application rates and growth stages applied, all influenced the Se content of wheat. Irrespective of Se application methods, the Se content of the first node was always higher than the first internode, indicating that the first node plays an important role in Se translocation in wheat. SeMet and SeCys2 were the main Se species in grains of wheat, indicating that wheat can efficiently convert applied inorganic Se into organic Se within the plant. In addition, flour milling process will cause losses of Se in wheat. The percentages of lost Se in white all-purpose flour were 12\u201368% higher compared with whole wheat. The Se bioaccessibility of whole wheat and white all-purpose flour with different Se treatments ranged from 6 to 38%, and white all-purpose flour had higher Se bioaccessibility than whole wheat. Future studies should also focus on the speciation changes, genotypes, and influence of the nodes on the mechanisms of Se translocation within wheat.This research is the first systematic study conducted to explore Se bioassessibility in wheat Se fortified with different Se application methods. The wheat was separated into nine parts . The grain yield was the highest in plants treated with soil application at 2 mg kgThe original contributions presented in this study are included in the article/MW and DL created the hypothesis, objectives, outline the draft, and wrote the manuscript. FZ, NC, and PC performed the statistical analysis. YM, HZ, MQ, NL, YL, and LM performed the experiment. GB and DL revised the manuscript. All authors contributed to the article and approved the submitted version."}
+{"text": "Shigella vaccines is critically dependent on development of an international standard serum and harmonized ELISA, demonstration of field efficacy in young children in low- and middle-income countries, and early engagement with regulators and policy makers.Advancing new O-antigen-based  Shigella are in clinical development. Historical efficacy studies identify serum O-antigen immunoglobulin G as a correlate of protection, leading to the suggestion that accelerated licensure could be achieved using the Shigella-controlled human infection model (CHIM). We discuss the role of the Shigella CHIM alongside critical imperatives needed for accelerated licensure and uptake of Shigella vaccines: (1) development of an international standard serum and harmonized enzyme-linked immunosorbent assay; (2) demonstration of field efficacy in young children in low- and middle-income countries; and (3) early engagement with regulators and policy makers.New O-antigen-based vaccines against Shigella is a major cause of diarrhea and dysentery disproportionately affecting children in low- and middle-income countries (LMICs) and responsible for 164 300 deaths annually [Shigella vaccine preferred product characteristics concluded the following: \u201cthe primary goal is to develop a safe, effective and affordable vaccine to reduce mortality and morbidity due to dysentery and diarrhea caused by Shigella in children under 5 years of age in LMICs\u201d [Shigella species express different O-antigens. A vaccine will need to protect against Shigella sonnei and Shigella flexneri 2a, 3a, and 6 to cover the most prevalent globally circulating strains [n LMICs\u201d . A vacciS sonnei O-antigen conjugated to recombinant exotoxin of Pseudomonas aeruginosa (rEPA) conferred 74% protection against S sonnei shigellosis in Israeli military [Over 20 years ago, a National Institutes of Health (NIH) glycoconjugate vaccine of military . Loss ofmilitary .Shigella sonnei-rEPA used random coupling for conjugation resulting in a heterogenous lattice structure. Variable amounts of free polysaccharide may have interfered with the immunologic response, as seen in mice where admixing free Streptococcus pneumoniae type 4 polysaccharide with S pneumoniae type 4 polysaccharide-protein conjugate decreased polysaccharide antibody responses [esponses . Subsequesponses . Short sShigella conjugates could increase immunogenicity, overcoming lack of protection in young children. A S flexneri 2a bioconjugate developed by Limmatech (GSK), with O-antigen covalently coupled in sun-type format to rEPA, was immunogenic in US adults [Shigella-controlled human infection model (CHIM) study [Enhanced immunogenicity with reduced saccharide length and site-specific conjugation is seen with dextran conjugates . PneumocS adults , and it M) study , providiShigella outer membrane vesicle (OMV) vaccine, the vesicles serving as a delivery vehicle for O-antigen. An S sonnei OMV candidate was well tolerated and immunogenic in French, United Kingdom (UK) [S flexneri 2a synthetic O-antigen conjugated to tetanus toxoid induced significantly higher O-antigen IgG levels in Israeli adults than an NIH S flexneri 2a O-antigen-rEPA vaccine [The GSK Vaccines Institute for Global Health (GVGH) developed a dom (UK) , and Kendom (UK) , but it dom (UK) . A vacci vaccine . It is uShigella. Possible protection against shigellosis through other mechanisms including mucosal IgA and Shigella protein antibodies presents a confounder to this approach. Efforts are underway to confirm serum IgG as a correlate of protection and establish protective thresholds [By accepting serum O-antigen IgG as a correlate of protection against shigellosis , an analresholds , but theShigella vaccines [Shigella ELISA collaborative study by the National Institute of Biological Standards and Controls (NIBSC), UK, was a first step towards ELISA harmonization. In 2020, a decision was made to harmonize a Shigella ELISA protocol at the Walter Reed Army Institute for Research (WRAIR) and develop a first international standard serum at NIBSC with the goal of submitting it to the WHO Expert Committee on Biological Standardization for approval and adoption.An international standard reference serum and harmonized ELISA are required for comparability between studies. The standard serum should cover each serotype within multivalent vaccine formulations and be generated from vaccinees. Such a serum and ELISA will underpin clinical development of all O-antigen-based vaccines . In 2019Shigella CHIMs are conducted in adults in high-income countries (HICs). Therefore, such studies could potentially be used to license new-generation Shigella vaccines for travelers [ravelers . There iravelers  for travravelers . A CHIM ravelers , 23.Shigella vaccine in this population. It is not known whether serum O-antigen IgG is a correlate of protection in LMIC children, nor whether a threshold of protection determined in HICs will be applicable in these children. Therefore, efficacy needs to be demonstrated in this population and can only be achieved with a phase 3 field study. Such a study could confirm correlate of protection status and protective titers for serum O-antigen IgG in this population, enabling subsequent immunobridging and accelerating licensure for other Shigella vaccines.However, a typhoid conjugate vaccine was efficacious in young LMIC children 20 years ago . EfficacShigella vaccine. In addition, CHIM studies may identify serum IgG thresholds of protection, although the artificial nature of infection and low numbers of participants present limitations. Finally, if CHIM for S flexneri 3a and 6 become available, they may confirm that Shigella vaccines can protect against these serotypes. The low incidence of shigellosis due to these serotypes means it is difficult in a field setting to demonstrate efficacy against them. Moreover, after a successful phase 3 efficacy study in LMIC infants and children, an established correlate and threshold of protection could leverage a large phase 2 study as basis of licensure for subsequent Shigella vaccines. If this is acceptable to the regulators, the strategy could accelerate licensure, which reduces the cost of late-stage clinical development.Nevertheless, CHIM studies could assist licensure for children through licensure for travelers, by facilitating earlier use, awareness, and generation of safety data for a Shigella vaccines, allowing comparability between studies, confirming serum O-antigen IgG as a correlate of protection, and determining thresholds of protection. Currently, almost all data informing correlates and thresholds of protection are from HIC adults and older children. A field-efficacy study among LMIC infants and young children will be critical to advance a first vaccine to licensure, WHO policy recommendation, and prequalification, which are prerequisites for Gavi-supported introduction.In conclusion, an international standard serum and harmonized ELISA are needed to advance new-generation global health Shigella vaccine candidates advance to phase 3 clinical evaluation.Proactive scenario planning of regulatory strategies by vaccine developers and planning of data to be collected in late-stage product development to support future policy recommendation will help mitigate delays to postlicensure implementation. Early and parallel engagement with LMIC national regulatory authorities and policy makers, as well as global policy and financing bodies, such as WHO and GAVI, is critical before designing pivotal phase 3 efficacy studies. This is the proposed approach of the authors as"}
+{"text": "Shigella is the leading cause of global diarrheal deaths that currently lacks a licensed vaccine. Shigellosis drives antimicrobial resistance and leads to economic impact through linear growth faltering. Today, there is a robust pipeline of vaccines in clinical development which are broadly divided into parenteral glycoconjugate vaccines, consisting of O-antigen conjugated to carrier proteins, and oral live attenuated vaccines, which incorporate targeted genetic mutations seeking to optimize the balance between reactogenicity, immunogenicity and ultimately protection. Proof of efficacy has previously been shown with both approaches but for various reasons no vaccine has been licensed to date. In this report, we outline the requirements for a Shigella vaccine and describe the current pipeline in the context of the many candidates that have previously failed or been abandoned. The report refers to papers from individual vaccine developers in this special supplement of Vaccines which is focused on Shigella vaccines. Once readouts of safety and immunogenicity from current trials of lead candidate vaccines among the target population of young children in low- and middle-income countries are available, the likely time to licensure of a first Shigella vaccine will become clearer. Shigella. The pathogenesis of shigellosis involves the invasion of the colonic mucosa which results in inflammation. Clinical presentation is either with bloody diarrhea, otherwise known as dysentery, or watery diarrhea. Although dysentery is the classical presentation of shigellosis, watery diarrhea is the more common presentation. While dysentery is highly suggestive of shigellosis, presentation with watery diarrhea is clinically indistinguishable from the many other etiologies of watery diarrhea. Although human-restricted, shigellosis is highly transmissible by the fecal\u2013oral route, contaminated food and water and fomites. It is estimated that 10 s to 100 s of bacteria are sufficient to cause disease [Shigella is responsible for a large global burden of disease and is the leading bacterial cause of diarrheal deaths worldwide. Children under 5 years of age in low- and middle-income countries (LMICs) are most affected, particularly in the second year of life [Shigellosis is caused by an infection of the gastrointestinal tract with Gram-negative bacteria belonging to the genus  of life ,3,4,5. T of life . Shigell of life .Shigella, and three of these have multiple serotypes. This large number of Shigella serotypes presents a challenge for vaccine development, since immunologic protection is largely serotype-specific. Shigella flexneri is the most important species globally, particularly in low-income countries, and consists of 15 serotypes, the most common of which is S. flexneri 2a, followed by 3a and 6. Shigella sonnei has just one serotype and is the dominant species in countries that are undergoing industrial development. Shigella dysenteriae has 15 serotypes, the most significant being Shigella dysenteriae type 1, which was responsible for epidemic outbreaks with high-case fatality rates that seem to have disappeared in the 21st century. Shigella boydii, which has 19 serotypes, is responsible for a small minority of shigellosis cases and is mainly detected in South Asia [There are four species of Shigella is a major cause of linear growth faltering among young children in LMICs [Shigella. Finally, even when initiated, the use of antibiotics for the treatment of Shigellas is becoming increasingly compromised by the rise in antimicrobial resistance among circulating Shigella isolates [In addition to the direct morbidity and mortality due to diarrhea, in LMICs ,9. Currein LMICs . Otherwiisolates ,12,13.Shigella a pressing global public health need. Several approaches have been adopted by vaccine developers for the prevention of shigellosis over the years. These broadly divide between oral whole cell approaches, consisting mostly of live attenuated but also inactivated vaccines, and parenteral subunit approaches, mostly glycoconjugates, which are designed to target the immune response to key Shigella antigens. There is evidence for efficacy with both of these vaccine approaches. In the 1960s, a live attenuated vaccine developed by David Mel of the Yugoslav Army was shown to be efficacious both among military recruits [S. sonnei O-antigen glycoconjugate vaccine developed by John Robbins and colleagues at the National Institutes for Health (NIH), USA [All of these factors make the development of a vaccine against recruits  and chilrecruits  in formeIH), USA . In a suIH), USA .Shigella vaccine development and a large numbers of clinical trials  document [Shigella vaccine must be safe, immunogenic and efficacious against moderate-to-severe diarrhea (MSD) due to Shigella infection among the key target population of infants and young children under 5 years in LMICs. Efficacy should be achieved through a primary immunization schedule of one to two doses delivered during the first 12 months of life with or without an additional booster dose. The PPC document stipulates 60% or more efficacy against Shigella MSD caused by vaccine serotypes and a minimum duration of protection between 24 months and 5 years. A vaccine should be safe and not immunologically interfere when coadministered with other recommended vaccines, and should be stable for two years at 2\u20138 \u00b0C. It should be cost-effective so that price is not a barrier to access in LMICs. The PPC document includes both oral and injectable  routes of administration.Key attributes for document . A ShigeShigella [Shigella isolates from the Global Enterics Multicenter Study (GEMS) [Shigella flexneri 2a, 3a and 6, as well as Shigella sonnei O-antigens could provide direct coverage against 64% of global Shigella isolates [S. flexneri serotypes which has been observed in guinea pigs [Non-human primate studies , controlShigella  all provy (GEMS)  suggestsisolates . Coveragnea pigs .Shigella type 3 secretion system (T3SS), particular IpaB, IpaC and IpaD [Shigella into epithelial cells. A potential advantage of whole-cell approaches to vaccine development is the inclusion of Ipa proteins along with other potentially protective protein antigens.Nonetheless, there is also a body of evidence implicating surface protein antigens common to multiple serotypes in protection against shigellosis. Most prominent among these are the Ipa proteins which form the needle and extracellular complexes of the and IpaD . The T3SShigella vaccines. Both phase 3 studies with NIH S. sonnei glycoconjugate vaccines found a strong association between serum O-antigen IgG and protective efficacy [Shigella vaccines and natural infection with wild-type Shigella, fecal O-antigen IgA has been closely implicated in protection. This difference is likely indicative of parenteral vaccines inducing systemic immunity, in contrast to natural infection and oral vaccines directly inducing mucosal immunity within the gastrointestinal tract.The relevant immunological mediators and mechanisms of protection are likely multifactorial. The most recognized is serum IgG to LPS O-antigen which forms the main immunological response to parenterally administered glycoconjugate efficacy ,17. Subsefficacy . In the Shigella CHIM studies suggest that serum IgG to IpaB could also be a correlate of protection [M), and CD4+ and CD8+ T cells being proposed as having roles in protection against shigellosis [Recent data from otection . Effortsotection . As wellotection ,29. Sevegellosis ,31,32.Shigella is a human-restricted pathogen and even non-human primates require much higher bacterial inocula to induce shigellosis compared to humans, all of these models have limitations. For this reason, there has been a long-standing emphasis on assessing candidate Shigella vaccines in humans. Aligned with this, the establishment of the Shigella CHIM at three centers in the United States, has permitted the early assessment of vaccine efficacy in humans [Several animal models have been used to study shigellosis and assess the potential protective efficacy of candidate vaccines. These include the mouse pulmonary infection , guinea n humans ,37,38. Cn humans , clinican humans  and labon humans  for thesOral whole cell vaccines can be divided between whole cell killed  and liveShigella vaccine by Kiyoshi Shiga, adopted the whole-cell killed approach [The earliest vaccines, beginning with the first attempt at a approach . Key to approach .S. sonnei (SsWc) [S. flexneri 2a (Sf2aWC) [Relatively recently, formalin-inactivated i (SsWc)  and S. f(Sf2aWC)  monovale(Sf2aWC) , it has Shigella strains using media containing the antibiotic streptomycin. This resulted in the strains becoming both streptomycin dependent (SmD) and attenuated, though the exact genetic mutations leading to attenuation were unknown. Although SmD Shigella vaccines were tested in subjects over multiple studies in Yugoslavia and the US, they had a number of issues. First, the primary immunization schedule consisted of four doses. Second, protection was relatively short-lived, lasting for a year. Third, some vaccine lots lost their streptomycin dependence. Finally, there were issues with manufacturing. These vaccines were never licensed and were eventually abandoned.Studies by Mel and colleagues from the 1960s and 1970s ,15 pavedS. flexneri 2a T32 strain by multiple passages on nutrient agar [S. flexneri 2a T32 strain containing an S. sonnei plasmid. This enabled the co-expression of O-antigens of S. flexneri 2a and S. sonnei. In field studies in China, FS was reported to give 61\u201365% protection against S. flexneri 2a and 57\u201372% S. sonnei shigellosis [Around the same time, another live attenuated vaccine, the Vadizen live vaccine, was developed in Romania by Istrati from the ent agar . During ent agar . Of notegellosis . The curShigella vaccines with targeted genetic mutations. However, similar challenges are faced by all live attenuated vaccine candidates in balancing acceptable levels of reactogenicity with sufficient immunogenicity to confer protection. Below, we report on a selection of such vaccines that have been tested in clinical trials.More recently, the advent of whole genome sequencing enabled the development of well-defined live attenuated Shigella vaccines based on the well-characterized S. flexneri 2a 2457T strain. CVD 1203 contained mutations in the aroA and virG genes that encode proteins involved in amino acid biosynthesis and intra- and intercellular motility. Although immunogenic, the vaccine was excessively reactogenic, causing dysentery in 72% of recipients in a phase 1 study [guaBA, virG, set and sen genes were deleted. guaBA is required for guanine biosynthesis, while set and sen encode the ShET1 and ShET2 Shigella enterotoxins, respectively. This new approach resulted in tolerability in a phase 1 study but limited immunogenicity [The Center for Vaccine Development at the University of Maryland has developed a number of live attenuated  1 study  and was genicity .guaBA mutation but reverted to using wild-type virG, either with intact (CVD 1204) or deleted (CVD 1208) sen and set genes. The deletion of the Shigella enterotoxins was shown to be required since CVD1204 resulted in unacceptable reactogenicity [Further iterations of CVD 1207 maintained the genicity . CVD 120genicity .Shigella vaccines is the difference in reactogenicity and immunogenicity of the same vaccine among different populations. SC602 is a S. flexneri 2a candidate vaccine developed at the Pasteur Institute, Paris. It is based on the wild-type S. flexneri 2a 494 strain with deletions in virG and iuc which encodes the siderophore, aerobactin. At 104 cfu, SC602 was mildly reactogenic in US adults but immunogenic and protected against fever, dysentery and severe symptoms following challenge with S. flexneri 2a 2457T [Another challenge facing development of live attenuated 2a 2457T . When te2a 2457T .The poor immunogenicity of live attenuated vaccines has also been observed among LMIC populations with licensed vaccines against cholera, rotavirus and polio. Multiple reasons may account for this, a key one being environmental enteric dysfunction (EDD) which commonly occurs in children in LMICs . EDD is Shigella vaccine candidate based on wild-type Shigella dysenteriae type 1 strain SC595 with deleted virG, ent and fep genes, the latter two genes encoding iron chelation proteins. Although well-tolerated in phase 1 trials, the vaccine was poorly immunogenic and has not progressed [The Pasteur Institute also developed SC599, a live attenuated ogressed .Shigella vaccine candidates attenuated through the deletion of aroD which made them auxotrophic for aromatic compounds. SFL124 was based on the moderately virulent parent strain S. flexneri SFL1. The candidate was well tolerated in phase 1 studies in adults in Sweden [In the early 1990s, the National Bacteriology Laboratory in Stockholm developed live n Sweden  and Vietn Sweden , and in n Sweden , but shoaroD deleted from the more virulent S. flexneri 2a 2457T strain. When tested in a phase 1 study in Swedish adults, a narrow safety-immunogenicity profile was demonstrated [Subsequently, SLF1070 was developed with nstrated . NeitherS. sonnei vaccines based on the wild-type Moseley S. sonnei strain with virG deleted. A common problem with S. sonnei strains is loss of the virulence plasmid. However, the plasmid is relatively stable in the Moseley strain. WRSS1, the first-generation vaccine of this series, was immunogenic but resulted in diarrhea and fever among US and Israeli adult volunteers in phase 1 and phase 2 studies [WRAIR developed a series of live attenuated  studies ,62. WRSS studies .senA and senB, WRSS3 has msbB deleted from the virulence plasmid. The removal of msbB, which encodes an acyltransferase, results in the loss of an acyl chain from the lipid A of LPS with a consequent reduction in reactogenicity [Further attenuating mutations were introduced to address the reactogenicity resulting in the WRSS2 and WRSS3 candidate vaccines. While both have deleted enterotoxin genes genicity . Both vagenicity .Shigella vaccine development was the use of the licensed typhoid Ty21a live attenuated vaccine as a vector for the delivery of Shigella sonnei O-antigen. The 5076-1C vaccine was developed by Formal at the University of Maryland in the 1980s [An innovative approach to he 1980s . Though he 1980s , it suffhe 1980s ,68. FurtShigella vaccines, in a similar approach to the Ty21a Shigella candidate 5076-1C, key Shigella antigens have been expressed in E. coli. PGAI 42-1-15 was based on E. coli O8 genetically modified to express S. flexneri 2a O-antigen [S. flexneri 2a CHIM study [E. coli K12 that could express S. flexneri 2a O-antigen and also invade epithelial cells due to the inclusion of the invasion plasmid from S. flexneri 5, with aroD deleted from ECSf2a-2 to reduce reactogenicity. Unacceptable reactogenicity was a problem for ECSf2a-1 [In order to improve the tolerability of live attenuated -antigen . Though IM study . SimilarECSf2a-1 , while EECSf2a-1 . This liE. coli engineered to express Shigella antigens, is the ShigETEC live attenuated vaccine being developed by Eveliqure, Vienna [S. flexneri 2a with Shigella O-antigen and Ipa antigens, the best-characterized targets of protective immunity, removed through the deletion of rfbF and ipaBC, respectively, together with the deletion of setAB to remove enterotoxins. The vaccine was engineered to express a fusion protein of LT and ST, the labile and stable toxins of enterotoxigenic E. coli (ETEC), hence the name ShigETEC. The vaccine was well tolerated and immunogenic in a recent phase 1 trial in Hungary and is set to progress into phase 2 studies [Shigella.An intriguing and almost opposite approach to , Vienna . ShigETE studies . A key oShigella vaccine strategy at the Center for Vaccine Development is to develop a hexavalent Shigella ETEC live attenuated vaccine consisting of six Shigella strains  engineered to express ETEC antigens. This is currently in preclinical development [Similar to the ShigaETEC approach, a new ambitious elopment .Shigella vaccines builds on the successful use of this technology for vaccines against the encapsulated bacteria Haemophilus influenzae b, meningococcus, pneumococcus and, more recently, Salmonella typhi. With the exception of S. sonnei  in protection. This is the key epidemiological observation on which the Shigella glycoconjugate vaccines are based.The glycoconjugate approach to -antigen ), ShigelS. sonnei or S. flexneri 2a chemically linked to recombinant exoprotein A of Pseudomonas aeruginosa (rEPA)  . The vacgellosis . The saf placebo .S. sonnei in the arm receiving S. sonnei O-antigen/rEPA was remarkable considering this was after a single dose of vaccine with participants followed up for a duration of two years. The lack of cases of shigellosis due to S. flexneri 2a in the study prevented any conclusions being made on the efficacy of EcSf2a-2. Given that study findings were published 25 years ago, it is surprising that no glycoconjugate vaccine has yet been licensed. There are perhaps several reasons for this.The finding of 74% efficacy against shigellosis due to Shigella vaccine is young children in LMICs. Thirteen years later, in 2010, findings from a second efficacy study in Israel were published by Paswell and colleagues [S. sonnei O-antigen/rEPA or S. flexneri 2a O-antigen/rEPA. While protection was demonstrated against S. sonnei shigellosis among children aged 3\u20134 years, protection was not seen in children under three years of age. Loss of protection corresponded to a decrease in serum O-antigen IgG titer further supporting a role for this modality of immunity in protection against shigellosis. Again, insufficient cases of S. flexneri 2a shigellosis precluded any conclusions about the efficacy of S. flexneri 2a O-antigen/rEPA. Neither S. sonnei O-antigen/rEPA nor S. flexneri 2a O-antigen/rEPA were ever commercialized.While protection was demonstrated in military recruits in Israel, the key target population for a global lleagues , this tiE. coli bacteria are genetically engineered to synthesize and chemically couple glycans from exogenous bacteria to protein carriers, exploiting the oligosaccharide transferase PglB [S. dysenteriae type 1 bioconjugate, GVXN SD133-EPA was produced with O-antigen from S. dysenteriae type 1 linked to genetically detoxified exotoxin protein A of Pseudomonas aeruginosa and was found to be safe and immunogenic in a phase 1 study [Limmatech Biologics AG, based in Zurich, developed an innovative glycoconjugate technology known as bioconjugation where ase PglB . As proo 1 study .S. flexneri 2a which, following promising immunogenicity in a phase 1 study in the US, was assessed for efficacy against shigellosis in a CHIM study at Johns Hopkins University. Although the vaccine failed to meet the primary endpoint of protection against all forms of shigellosis, it did protect against more severe shigellosis in a post hoc analysis [Clinical Infectious Diseases (2019 supplement 8). As with the NIH S. sonnei vaccine, protection was closely associated with serum IgG to S. flexneri O-antigen [S. sonnei, flexneri 3a and flexneri 6, as well as S. flexneri 2a. This is currently completing an age-descending dose-finding study in Kenya [Subsequently, the technology was used to develop Flexyn2a-EPA, a vaccine against analysis . This pr-antigen ,79. On tin Kenya .Shigella conjugate vaccine constructs demonstrated that the use of O-antigens of reduced length could result in an enhanced serum IgG response to O-antigen compared with conjugates employing native length O-antigen. This observation provided supporting justification for the synthetic approach to generate Shigella O-antigens for conjugation at the Pasteur Institute. Using an elaborate process involving multiple chemical steps, a series of S. flexneri 2a synthetic O-antigens were generated and conjugated to tetanus toxoid prior to testing in mice for immunogenicity.Separate work by Pozgay and Robbins ,81 with Evaluation in animals led to the selection of a candidate vaccine, SF2a-TT15, with O-antigen consisting of three pentasaccharide repeating units . This vaccine was tested by Cohen in Israeli adults and found to be highly immunogenic, even after a single dose . As withS. sonnei and S. flexneri 2a conjugated to tetanus toxoid with adipic acid dihydrazide as linker. Following a phase 1 descending age study in China to show safety [Using more conventional glycoconjugate technology, Beijing Zhifei Lvzhu Biopharmaceuticals designed and developed a bivalent vaccine, ZF0901, using O-antigen from w safety , ZF0901 w safety .Shigella LPS and Ipa proteins. The initial iteration of Invaplex, native Invaplex or InvaplexNAT, consisted of a complex of Ipa antigens  and LPS extracted from wild-type S. flexneri 2a. Three doses delivered intranasally were well tolerated and immunogenic in phase 1 studies [An interesting alternative subunit vaccine approach to the glycoconjugates is the invasin complex or Invaplex technology developed by WRAIR . Essenti studies ,88 in th studies .AR, was produced using recombinant IpaB and IpaC generated in E. coli, and LPS from S. flexneri 2a which was safe but not consistently immunogenic when delivered intranasally to volunteers in a phase 1 study [AR-Detox) employs an LPS of low reactogenicity purified from S. flexneri 2a with deleted msbB genes. This has allowed the parenteral administration of InvaplexAR-Detox with good safety and immunogenicity results in a recent phase 1 study [Subsequently, a more defined version of Invaplex, artificial Invaplex or Invaplex 1 study . As a fu 1 study . It is sS. flexneri 2a with proteosomes (outer membrane proteins) from meningococcus to give a Proteosome-Shigella flexneri 2a lipopolysaccharide vaccine. This vaccine was only tested in phase 1 and was administered intranasally [In a similar but earlier approach to Invaplex, WRAIR complexed LPS from anasally . It was Shigella, by the deletion of tolR [tolR is a gene involved in maintaining the integrity of the connection between the inner and outer membranes in Gram-negative bacteria. In addition, htrB, which, like msbB, encodes an acyl transferase, was deleted to reduce reactogenicity, and virG to prevent epithelial invasion. This technology has the advantage of being straightforward to deploy with the potential to produce vaccine at low cost. GVGH considers the vesicles to be a vehicle for the delivery of O-antigen. Another advantage of this approach is that multiple other outer membrane components are presented to the immune system, including many outer membrane proteins [A different subunit approach which has similarities with whole cell killed vaccines is the use of bacterial native outer membrane vesicles (OMVs) as vaccines. The GSK Vaccines Institute for Global Health (GVGH) adopted this approach by increasing the spontaneous release of OMV , which are blebs of outer membrane from the surface of  of tolR . tolR isproteins , though S. sonnei 53G with the above mutations. Though well tolerated, it was poorly immunogenic compared with historic Shigella glycoconjugate vaccines whether administered intramuscularly, intradermally or intranasally in European adults [S. flexneri 1b, 2a and 3a and S. sonnei (with higher O-antigen expression than 1790GAHB) is currently being tested in a phase 1/2 clinical trial [A first OMV candidate vaccine, 1790GAHB, was generated from n adults . This isn adults , it failn adults . A quadral trial .Despite 100 years of vaccine development, there is to date no licensed vaccine to protect against shigellosis, the main cause of childhood bacterial diarrheal death globally. This is despite numerous candidate vaccines having been assessed in clinical trials and clinical efficacy proven with both the early live attenuated approaches of Mel and the Yugoslav Army in the 1960s, and the glycoconjugate approach of Robbins and the NIH in the 1990s. As indicated in this report, the large majority of vaccines tested in humans to date have been live attenuated vaccines. Their lack of success consistently comes down to the difficulty of balancing reactogenicity with sufficient immunogenicity to induce protection.Shigella vaccines [Shigella vaccine should induce protective immunity for at least two years after no more than two doses. The likely need for multivalent Shigella vaccines to provide sufficient breath of coverage against global circulating Shigella strains increases the challenge faced by live attenuated candidates. To date, it has proven exceedingly difficult to achieve an acceptable balance of reactogenicity and immunogenicity with monovalent Shigella vaccines.Where protection was demonstrated with the Mel SmD vaccines, this required multiple doses (a primary series of four doses) and duration of protection was limited to one year. However, according to the recently published WHO Preferred Product Characteristic for vaccines , a ShigeShigella vaccine. Proof of efficacy was demonstrated by Cohen with the NIH S. sonnei O-antigen-rEPA candidate 25 years ago in young Israeli adults [Shigella conjugate vaccines have entered clinical development since 1997. This is perhaps partly a result of the emphasis on pursuing the live attenuated approach by many vaccine developers during the 1990s and 2000s at a time when limited funding was available for Shigella vaccine development.Glycoconjugate technology appears more promising than live attenuated approaches for a licensed i adults  and subsi adults . It is bShigella vaccines with advancing clinical development of several promising glycoconjugate vaccines, as well as live attenuated vaccines advancing. The advent of molecular determination in recent years of pathogen etiology in diarrhea cases in place of exclusive reliance on stool culture [Shigella. Growing worldwide concern about the threat of antimicrobial resistant Shigella [Shigella is a major cause of linear growth faltering [Shigella vaccine development. These factors, together with increased funding for Shigella vaccines and the strong recommendation by the WHO\u2019s Product Development Vaccine Advisory Committee (PDVAC) of the need to develop Shigella vaccines [Following the disappointing results with so many live attenuated candidates, it is reassuring to see a balance across the global portfolio of  culture  has incrShigella  and the Shigella , as wellaltering , are provaccines , are serS. flexneri 2a synthetic O-antigen conjugate vaccine, SF2a-TT15, is completing an age descending, dose-finding study in Kenya [Although glycoconjugate candidates rarely cause issues with reactogenicity compared with live attenuated vaccines, there remains the challenge of whether current candidates will prove to be sufficiently immunogenic among young children in LMICs. The most advanced glycoconjugate vaccine is the quadrivalent bioconjugate candidate, S4V-EPA, from Limmatech. This vaccine is currently completing its phase 2 study in young children in Kenya with the expectation of a readout of interim immunogenicity this year . Meanwhiin Kenya . The GVGin Kenya .Shigella vaccine is a realistic prospect in the next few years. Should these vaccines turn out to be safe but insufficiently immunogenic, there is the possibility of enhancing immune responses using adjuvants. To date, little is known about which adjuvants may potentiate current candidate Shigella vaccines, particularly the glycoconjugates. The use of adjuvants in the clinical trials of these vaccines has so far been limited to alum and effects have been inconsistent. This represents a knowledge gap in Shigella vaccine development. The application of our understanding of new adjuvants from the COVID-19 pandemic may help address this gap but requires formulation, stability and immunogenicity studies with lead candidate vaccines to begin now.The cumulative clinical data from these trials will provide much clarity as to whether a licensed Shigella vaccines for the global pediatric market. Phase 3 studies will be lengthy and costly but ultimately, if able to demonstrate efficacy and confirm the correlate of protection status for O-antigen IgG in children, may permit the licensure of subsequent vaccines on the basis of safety and non-inferior immunogenicity. As a critical enabling activity of this, work is underway at NIBSC to develop a first Shigella International Standard Serum and harmonize Shigella ELISAs [Although there is strong evidence that serum IgG to O-antigen is a correlate of protection in adults , this isa ELISAs .Shigella vaccine for the global pediatric market is unlikely to entice one of the big five multinational vaccine companies to manufacture a Shigella vaccine. It is more likely that companies from the Developing Country Vaccine Manufacturers Network [Shigella vaccines.Studies are currently underway to facilitate and expedite the initiation of phase 3 trials for the most promising candidate vaccines when ready . Each of Network  will parShigella vaccine development has become a graveyard filled with numerous candidates that entered clinical trials and proved to be either too reactogenic, insufficiently immunogenic or both. Nevertheless, proof of efficacy has been attained on more than one occasion and there are currently multiple promising candidates in clinical development, with lead candidates due to read out shortly from studies in the target populations of young children in LMICs.Over the past 100 years,"}
+{"text": "X-ray photoelectron spectroscopy and electrochemical measurementsreveal the sp3 carbon character and advantageous electrochemicalproperties of a BDD electrode are retained during the milling process.TEM diffraction studies show a dominant (110) crystallographic orientation.Compared with conventional carbon TEM films on metal supports, theBDD-TEM electrodes offer superior thermal, mechanical and electrochemicalstability properties. For the latter, no carbon loss is observed overa wide electrochemical potential range (up to 1.80 V vs RHE) under prolonged testing times (5 h) in acid (comparable withaccelerated stress testing protocols). This result also highlightsthe use of BDD as a corrosion free electrocatalyst TEM support forfundamental studies, and in practical energy conversion applications.High magnification TEM imaging demonstrates resolution of isolated,single atoms on the BDD-TEM electrode during electrodeposition, dueto the low background electron scattering of the BDD surface. Giventhe high thermal conductivity and stability of the BDD-TEM electrodes, in situ monitoring of thermally induced morphological changesis also possible, shown here for the thermally induced crystallizationof amorphous electrodeposited manganese oxide to the electrochemicallyactive \u03b3-phase.The majority of carbon based transmission electron microscopy(TEM)platforms (grids) have a significant sp Thin films (3\u201330 nm) of carbon floatedover a support substrate are particularly popular due to carbon beinglow electron scattering and electronically conductive. Here the carbonis typically an amorphous carbon film, although graphene oxide5 and graphene6 layershave also been used.Transmission electron microscopy (TEM)is a powerful analyticaltool for characterizing nanomaterials at the atomic level.2 to sp3 bonded carbon and the levelof graphitization.7 Such carbons are useddue to their low cost, electrical conductivity and reduced electrocatalyticactivity towards the energy conversion processes of interest.8 To assess NP structure pre- and post-electrocatalysis,either the NPs or the NPs plus carbon black support, can be placedon the carbon TEM grid.10 Outside of energy applications,carbon film TEM grids have also found use in the elucidation of electrochemicallydriven NP deposition mechanisms.12In electrocatalytic energy conversion applicationscarbon is alsofrequently used as the nanostructured electrocatalyst support forelectrocatalytically active nanoparticles (NPs). The carbon, typicallya carbon black, can take a variety of structures, which range in theratio of spex situ studies, measurements are typicallyundertaken by dipping the TEM grid into an electrolyte solution, performingthe electrochemical process of interest, removing from solution andthen imaging the surface.13 This process typicallyrequires the carbon film to be supported on a metal grid so an electricalcontact can be made. Use of TEM \u201cfinder grids\u201d  makes monitoringof the same location, pre- and post-electrochemical treatment mucheasier; this process is termed identical-location (IL-)TEM.16 However, interpretation of the current passed is challenging dueto both the metal support and carbon film acting as an electrode.A few studies have overcome this issue by using bespoke holders whichprevent electrolyte accessing the metal grid.18For 20 Here the SECCM tip was used to both electrodeposit NPs locally19 and measure the local electrocatalytic activityof pre-formed NPs.20 SECCM has also beenused as a method for placing pre-formed NPs onto the working electrodefor in situ electrochemical TEM observation.21More recently, scanning electrochemicalcell microscopy (SECCM),where an electrolyte filled nanopipette is used to create a miniatureelectrochemical cell, has been employed with carbon film TEM grids.22 The mostnotable one is the fact carbon can undergo oxidation and corrosionat potentials which are important for energy conversion reactions.These include, for example, during the start\u2013stop cycle ofa proton exchange oxygen reduction reaction (ORR) membrane fuel cell24 and at the potentials required for the oxygen evolution reaction.25 Corrosion of the carbon TEM film also complicatesstudies aimed at investigating electrocatalytically induced changes in NPs. Furthermore, forthermal studies, interactions between the TEM grid metal support andthe nanostructure/carbon film should also be considered. For example,at elevated temperatures, certain metals e.g. nickel,can graphitize the carbon film,27 and metal atoms fromthe underlying support, can evaporate and redeposit, causing contamination.28Whilst carbon is useful as an electrocatalystsupport and TEM filmit does have some drawbacks.2 carbon, as the sp3 carbon bonding results in anincreased mechanical strength and corrosion resistance, both chemicaland electrochemical. BDD is also an excellent conductor of heat.29 When used as an electrode material, in the morecommon oxygen terminated form, the surface properties are such thatthe double layer capacitance is low (<10 \u03bcF cm\u20132) and electrocatalytic processes such as ORR and water electrolysisare significantly kinetically retarded.29 Many of these properties make BDD an ideal NP electrocatalyst support.31 However, BDD has yet to be used routinely as a TEM electrode, dueto the lack of methodologies available to fabricate BDD which is notonly thin enough to be electron beam transparent (\u223c10 to 100nm thick) but is also handleable. In this paper we describe a procedureto produce free standing (unsupported) BDD-TEM electrodes, and highlighttheir useful properties as corrosion free, temperature stable, TEMsupports for applications of importance in the electrodeposition andenergy conversion fields.Given the above, it is interesting toconsider the suitabilityof boron doped diamond (BDD) for correlative TEM-electrochemical  measurements. BDD is an interesting alternative to sp2SO4 95\u201397%, Scientific and Chemical Supplies Ltd.) andpotassium nitrate  were used. (b) For metal electrodeposition, manganeseoxide was deposited from a solution containing manganese chloride and potassium chloride  acidified with hydrochloric acid . (c) For electrochemical characterization,hexaamineruthenium(III) chloride  was employed as a redox couple andpotassium nitrate  as supportingelectrolyte. (d) Sulfuric acid  was used for long term electrochemicalstability testing. Where commercial TEM grids were used for comparison,carbon films on a 300 mesh copper or gold support  were employed.All solutions were preparedusing Milli-Q ultrapure water with a resistivity of 18 M\u03a9 cm(Millipore). (a) For acid cleaning, sulfuric acid  such that the material was above the metallic threshold.32 Both surfaces were mechanically (resin bonded) polished, to thinthe material to \u223c50\u201380 \u03bcm and produce surfacesof \u223cnm surface roughness.33 Lasermicromachining of the BDD was carried out using a 355 nm Nd:YAG 34ns laser (Oxford Lasers) to cut out disks of 3 mm diameter. To removemachining debris the electrodes were acid cleaned by immersing inconcentrated H2SO4 (saturated with KNO3) at \u223c200 \u00b0C, for 30 min, followed by rinsing with ultrapurewater before cleaning for 30 min in concentrated H2SO4 only, at \u223c200 \u00b0C.34All BDD was provided by Element SixLtd., Oxford, UK, and was grown using microwave chemical vapor deposition(CVD) to a suitable thickness so that it could be removed from thenon-diamond growth support.i.e. ahole had formed. To reduce surface roughness the disk was mountedin a clamp support for a final low energy polish of both sides ofthe disk simultaneously. This was achieved using a modulated ion beamat a lower accelerating voltage and angle of incidence, for 30 min.To increase the robustness of the Ohmic contact to BDD, a small segmentof the upper portion of the disc was laser roughened (532 nm Nd:YAG15 ns laser).34 The disk was again acidcleaned (vide supra) and electrical contact madeto this lasered region by either sputtering a Ti (10 nm)/Au (400 nm)contact (Moorfield MiniLab 060 Platform), followed by annealing for5 h at 400 \u00b0C,32 or by applicationof a conductive carbon ink . Note, as a resultof laser roughening and acid cleaning, the small region of the BDDonto which the contacts are placed, contains a very thin surface layerof non-diamond carbon.34 This is especiallyuseful when making an Ohmic contact using the carbon ink.Argon ion milling and polishing of the BDD disk was carriedoutusing a GATAN precision ion polishing system (PIPS). The BDD was mountedon a post support using glycol-phthalate bonding wax (Agar Scientific),allowing continuous milling as the sample rotated. First one sidewas milled for 2.5 h, then the disk was turned over and the otherside milled for 2 h and then in 15 min intervals until light transmissionthrough the center of the grid was visible 33 After any electrochemical process and before imaging, theBDD-TEM electrode was rinsed by gently dipping in ultrapure waterand then left to dry in a desiccator, held under vacuum.Cyclic voltammetry (CV)was carried out using a three-electrode setup controlled by a potentiostat with a saturated calomel electrode  or an Ag|AgCl electrode  used as the reference and a Pt coil as the counter. Electricalcontact to the BDD-TEM electrode was made using a metal clamp. Forelectrochemical measurements the BDD-TEM electrode was dipped intothe electrolyte, ensuring that the central hole was fully immersedin solution and the electrical contact remained dry.35 with a 1 mm diameter disk onthe BDD-TEM electrode exposed using Kapton tape. A 200 \u03bcL dropletof electrolyte solution was placed on the electrode surface for eachmeasurement. Solvent window and capacitance measurements were runin 0.1 M KNO3 at a scan rate of 0.1 V s\u20131. The electrode response for the redox couple Ru(NH3)63+/2+ was investigated by recording CVs of 1 mMRu(NH3)6Cl3 in 0.1 M KNO3 at a scan rate of 0.1 V s\u20131 with a step size of1 mV. Solvent windows were defined for a geometric current densityof \u00b10.4 mA cm\u20132.32Forelectrochemical characterization, a three-electrode droplet cell set-upwas used36 Contactangle measurements were recorded using a drop shape analyzer  with a water droplet of volume 50\u03bcL. Measurements were recorded in triplicate, with the surfacedried carefully in between using a lint free tissue.Surface roughness measurements were made using both an atomicforcemicroscope  and a white light interferometer. Image analysis wasperformed using Gwyddion 2.5.2.6) TEM at 200 kV. In situ TEM heating wasalso achieved in this TEM with a double tilt heating holder . Atom resolution annular dark field (ADF) imageswere recorded in a double aberration-corrected JEOL JEM-ARM200F operatedat 200 kV.Field emissionscanning EM (FE-SEM) was used to image the BDD-TEMelectrode. Images were recorded using the in-lens, secondary electron(SE2), and scanning TEM (STEM) detectors on a Zeiss Gemini FE-SEM500 operating at 20 kV. TEM imaging and electron diffraction on theBDD-TEM electrodes were carried out using a JEOL JEM 2100 . Data from the BDD-TEM electrodes were collectedusing an analysis area of 55 \u03bcm diameter, to probe as closeto the hole edge as possible. For the control sample  the data were acquired using a spot size of 110 \u03bcmin order to increase the overall count rate. C 1s spectra were obtainedusing take-off angles of 90 and 30\u00b0 with respect to the surfaceplane. To investigate the different carbon chemical environments atthe electrode surface, all data collected were fitted in CasaXPS usingLorentzian\u2013Gaussian lineshapes and Shirley backgrounds, withasymmetry included for the sp2 bonded carbon C\u2013Cpeak.X-ray photoelectron spectroscopy (XPS) was conducted using a KratosAnalytical Axis Ultra DLD spectrometer with a monochromated Al K\u03b1X-ray source (1486.69 eV) in a chamber with a base pressure below1 \u00d7 10Compared to non-diamondcarbons, achieving electron beam transparent diamond electrodes ischallenging, due to the limited number of growth methods. Here, atop down approach was employed where the starting point was the productionof freestanding and double-sided polished polycrystalline BDD electrodes,as thin as possible, but still able to be handled easily. For thisreason 50\u201380 \u03bcm thick BDD electrodes were produced byCVD growth with subsequent mechanical polishing, and then cut intodisks of 3 mm diameter to make them suitable for insertion into theTEM holder. To achieve electron beam transparency the electrode wasfirst argon ion milled, on each face, and then the energy of millinglowered to ion \u201cpolish\u201d both surfaces simultaneouslyas depicted schematically in ca. 30\u2013150\u03bcm in diameter) formed in the center of the BDD disk. The observationof a hole indicates the presence of a region of BDD that is thin enoughto be electron beam transparent around the hole edge. Typically, ifthe hole is increased in size smaller areas of electron beam transparencyresult. For nine BDD-TEM electrodes examined we found an approximatelylinear relationship (R2 = 0.98) betweenthe diameter of the hole and the width of the electron beam transparentarea. As milling results in ripples (vide infra)on the BDD surface, a final lower energy ion polish (1\u20132 keV)was required .Initially the highest accelerating voltage wasused for the fastestmilling rate to remove the bulk of the BDD. An angle of incidencein the middle of the accessible range was employed. If the angle wasset too high, material was removed more quickly, and a smaller regionof electron beam transparent material resulted. A middle value wasfound to be a time efficient compromise. The exact milling time wasdependent on the starting material thickness. As required 1 at a sl37 anda conductive carbon ink contact and the distance between the BDD-TEM electrode and reference electrodewas kept constant.38 For both electrodes,similar Ru values of 229 \u00b1 1 \u03a9(Ti/Au contact) and 346 \u00b1 4 \u03a9 (carbon ink contact) wereobtained (see Supporting Information 2),indicating both approaches were valid. Whilst Ti/Au is commonly usedto make an Ohmic electrical contact to BDD,32 it does require access to a sputter system and care is requiredduring sputtering to prevent Au spill over onto the BDD-TEM electrodedue to its concave profile. In contrast, the carbon ink can be paintedonto the laser roughened (and non-diamond carbon containing) areaof the BDD surface by hand. This method thus represents a cheaper,quicker, metal contamination free option, particularly useful forlong-term electrochemical experiments.To apply an electrical contact to the BDD-TEM electrode,two approacheswere investigated: a Ti/Au contact,tact see . To assevia the methodoutlined are shown in ca. 50 \u03bcm in width (at 20 kV). 39FE-SEM and STEM images ofa typical BDD-TEM electrode fabricated Supporting Information 3, Figure S3). The AFM measurements  shows a WLI imageof the central region of the BDD-TEM electrode covering a 1.2 mm diameterregion. Figure S3a(ii) shows the corresponding x, y topography profile from the hole edgeto 0.6 mm away [red line in Figure S3a(i)] highlighting the increasing non-linear thickness of the BDD movingaway from the hole. The ripples in the surface topography are evidentin the AFM images of topography ]. Such ripples have alsobeen seen when diamond surfaces have undergone ion bombardment.40 The mechanism of ripple formation is still disputeddespite being first observed over twenty years ago.41 The RMS roughness was calculated to be 48.3 nm across the wholearea in Supporting Information 3, Figure S4 for FE-SEM and AFM characterization.The topography of the BDD-TEM electrode was investigatedusingAFM, 3 C\u2013C/C\u2013Hcontribution of approximately 72%, with a sp2 C\u2013Ccharacter of 21% . The C\u2013O contribution is approximately 7%.39 Higher order oxides (e.g. O=C\u2013O)which occur at >288 eV, make a minimal contribution (<1% ofthefitted peak). In order to provide greater surface sensitivity, theXPS take-off angle was decreased to 30\u00b0, to reduce the samplingdepth by a factor of two.43 Using the inelasticmean free path calculator (IMFP-TPP2M)44 the penetration depth (for C 1s) reduces from 9.9 to 4.5 nm. Underthe more surface-sensitive conditions at 30\u00b0, the main differenceis a reduction in the sp2 carbon component to 9% of thefitted envelope. This result indicates that a significant componentof the sp2 carbon signal in 45 There is also an increase inthe C\u2013O contribution from \u223c7% at 90\u00b0 to \u223c13%at 30\u00b0, as a result of the lower collection angle being moresurface sensitive; the O termination is only found at the surfaceof the BDD. Adventitious carbon signals are minimal.To assess theimpact of ion milling on the surface chemistry ofthe BDD-TEM electrodes, XPS was employed, 2 carbon character from 21 to 10% for the BDD-TEMelectrode. The value is now close to that seen for the 30\u00b0 take-offangle BDD control data. This relative reduction in the sp2 carbon content in the more surface-specific geometry confirms thepresence of sub-surface damage from the initial mechanical polish,which is removed during the ion milling and ion polishing process.The data also indicates no subsequent ion milling induced sub-surfacesp2 carbon creation. Table S3, Supporting Information 4, gives fittings of the C 1s data for both electrodesexpressed as percentages of the total fitted envelope. There is ashift of approximately 0.9 eV in the absolute binding energy of theC 1s peak, and thus of the binding energies of each assigned peakin the fitting, for the BDD TEM electrode when compared to the BDDcontrol electrode. The reason for this shift is unknown. To accountfor this, binding energies have been considered relative to the assignedsp3 carbon peak for each electrode .When the 90\u00b0 take-off angle BDD control data3a is comSupporting Information 4, Figure S5 and Table S4) at room temperatureand at a take-off angle of 90\u00b0. The sp2 and sp3 carbon content was found to be 62 and 27% respectively, insimilar proportions to fittings reported in the literature.20 As expected with an increased sp2 carbon content, more significant contributions from C=O,O=C\u2013O and \u03c0\u2013\u03c0* (2% of the envelopeeach) were observed. Contact angle measurements were recorded to comparethe hydrophobicity and wetting of a BDD-TEM electrode versus a commercial amorphous carbon coated TEM grid . For the BDD-TEM electrode,the disk was only ion milled on one side to prevent formation of thehole which would adversely affect the observed wetting. Contact anglesof 62.2 \u00b1 0.5\u00b0 (BDD-TEM) and 83.6 \u00b1 1.1\u00b0 (amorphousC film) were measured showing that the BDD-TEM electrode is more hydrophilicthan the carbon film. This is also advantageous for TEM electrodeaqueous based applications, where uniform wetting of the TEM electrodeis preferred. The value recorded for the BDD-TEM electrode is at theupper end of those recorded on other oxygenated BDD surfaces.29Comparison XPSmeasurements were also obtained on a commercialthin film carbon Au backed (C/Au) TEM grid (Ep) forthe redox couple Ru(NH3)63+/2+ areshown in Supporting Information 6, Figure S7. Wide and featureless solvent windows with values of 3.2 and 3.5V, capacitance values of 5.3 and 4.3 \u03bcF cm\u20132, and \u0394Ep values of 70 and 68 mVwere obtained for the ion milled/polished BDD-TEM and BDD control electrodes, respectively. The responses forall three parameters for the two differently prepared electrode surfacesare similar with the ion milled/polished surface showing only a smalldecrease in solvent window, and a very slight increase in both capacitanceand \u0394Ep compared to the controlmaterial.To further investigatethe properties of the ion milled/polished surface compared with amechanically polished control electrode, electrochemical characterizationof the solvent window and electrical double layer capacitance wascarried out. Solvent window, double layer capacitance and CV peakto peak separation data (\u0394242SO4) for 1000 CV cycles at 0.1 V s\u20131  over the potential range 0.80 to 1.60 V versus Ag|AgCl .24 These conditions reflect the extreme positivepotentials a proton exchange membrane fuel cell experiences24 and the typical operational voltages of acidbased electrolyzers.46 Here the experimentwas carried out with both a BDD-TEM electrode and C/Au TEM grid dippedinto solution. A similar immersion depth was used for both (\u223c2mm). For the former, a carbon conducting ink was used to create theelectrical contact. This avoids Au dissolution from a Ti/Au contactand potential re-deposition (contamination) on other areas of theelectrode, as the sulfuric acid will evaporate during the long timescaleof this experiment.To assess thesusceptibility of the BDD-TEM electrode to electrochemical corrosionthat is carbon dissolution, the electrode was subjected to acceleratedstress testing (AST),Supporting Information 7). EELSspectra (pixel size = 3 nm) were acquired across all areas of theBDD electrode BDD area shown in Supporting Information 7, Figure S8.For each pixel within the EELS spectrum image the BDD thickness, t, was measured using the absolute log ratio method,47 (48), I0 is the area under thezero loss peak and It is the total area under the whole spectrum. Across the lines shownin t of 20.4 nm beforecycling and 21.7 nm after . The difference in thesevalues is within the experimental error of the calculation, whichis estimated to be ca. 5%,47 and indicates the BDD is not electrochemically corroding duringAST. This is also in agreement with no observed change in the shapeof the coastline.To verify the absence of dissolution(corrosion) of the BDD electrodeIL-STEM EELS measurements were carried out around the hole edge. IL-EELScan quantify thickness changes in the same area of the electron beamtransparent BDD in response to the AST cycling treatment. ethod,47 11\u03bb is thversus Ag|AgCl,24 although in practice it is kinetically limited, occurringat much higher potentials.25 With increasingscan number, growth of the reductive peak at 0.90 V versus Ag|AgCl is also observed. This peak is attributed to cathodic strippingof Au surface oxides (AuOx),49 formed during the oxidative part of the scan.The Au support, also exposed to solution, is converted to AuOx at electrode potentials >\u223c1.2V versus Ag|AgCl. The increasing AuOx response with increasing number of cycles also indicatescorrosionof the thin C film coating the top surface of the Au grid, which resultsin more Au being exposed to solution with time. Unlike BDD, the C/AuTEM grid CV response is still changing after 100 cycles albeit lesssignificantly than during the initial 10 cycles, and by the 1000thcycle a response close to bulk gold is observed.49 This indicates that a significant amount of carbon hasbeen removed or damaged. The extent of corrosion damage to the carbonfilm was confirmed by TEM imaging. 4]\u2212 in 0.1 M HClO4. Ahigh driving potential of \u22120.5 V versus SCEwas employed for a very short period of time, 10 ms, to minimize thesize of the nanostructures electrodeposited. As can be seen underthese conditions observation of both crystalline Au NPs and isolatedsingle Au atoms is possible, 50 Given the mechanical and chemical robustness of the BDD-TEM supports,repeated imaging in the same location is also possible (IL-TEM),33 as shown in To highlight the capability of the BDD-TEM electrode as a combinedelectrodeposition and TEM imaging platform, Au nanostructures wereelectrodeposited on the electrode from a solution containing 1 mM[AuClca. 1500 \u00b0C in vacuum and 950 \u00b0Cin air51 and is an excellent conductorof heat52 (\u223c700 W m\u20131 K\u20131 at 300K). These properties not only enable BDD-TEM substrates to be usedin high temperature electrochemical applications,53 they also ensure that the temperature the BDD-TEM electrodeexperiences during in-situ TEM heating, matchesthat of the TEM heater. Here, BDD-TEM electrodes were employed toinvestigate the temperature-induced crystallization of electrodepositedamorphous manganese oxide (MnO2). MnO2 is usedcommercially in alkaline batteries due to the low cost and naturalabundance of Mn.54 The electrochemicallyactive \u03b3-phase is favored due to its ability to facilitate protonintercalation.56Diamond also has the advantage it is thermallystable up to 2 on the BDD electrode.The interface between light and dark regions in the image indicatesthe BDD-TEM hole edge. Deposition was achieved by applying a potentialof 1.50 V versus SCE for 50 s in 0.1 M MnCl2 with 0.1 M KCl as a supporting electrolyte, acidified with HCl (0.01M).57 The electrode was then dipped indistilled water to remove any salt residues and left to air dry. Atthis potential and pH, Mn2+ is first oxidized to Mn3+, followed by acid-catalyzed hydrolysis to MnO2. Note, electrodeposition on the BDD-TEM electrode was carried out ex situ prior to placement in the TEM for the subsequentimaging/heating experiments. SAED data of the MnO2, recordedin the region of the red circle in 2 is amorphous due to the diffuse ring in 2-BDD-TEM electrode was heated in situ in the TEMand under vacuum. The electrode was heated first to 50 \u00b0C, thenallowed to cool to ambient temperature (in the TEM) and an image/diffractionpattern taken. This process was repeated, with the heating temperatureincreased in 50 \u00b0C increments , until crystallization was observeddue to the emergence of a diffraction pattern. Upon reaching 400 \u00b0C,TEM [Supporting Information 8, Figure S10). Latticespacingd* values were measured from the SAED pattern [2 ,56 the preferred phase of MnO2 for battery applications.Supporting Information 9, Figure S11. In particular, holes were seen forming due tothermal oxidation of the carbon film,58 which increased in severity with time, in addition to bending ofthe grid. This further emphasizes the wider range of operating/experimentalconditions accessible when using a BDD-TEM electrode.For some studies, it may be of interestfor the nanostructuredmaterial to undergo heating in air, with TEM imaging taking placebefore and after. To assess the suitability of BDD-TEM electrodesunder these conditions, experiments were conducted where both BDD-TEMand commercial C/Cu grids were heated to 200 \u00b0C and then 400\u00b0C in air for 4 h each. Visual inspection of the grids usingan optical microscope was carried out. For the BDD-TEM electrode novisual changes were observed. In contrast, for C/Cu the same gridcould not be used throughout due to visible damage to the grid afterthe first heating experiment, A top down facile fabrication method forthe production of re-useable,electron beam transparent and electrically conductive BDD-TEM electrodes,using argon ion milling and polishing of thin (<100 \u03bcm) BDDhas been demonstrated. In contrast with conventional C TEM grids,which typically require a metal support for handling, the resultingBDD-TEM electrodes self-support. This was due to the non-uniform natureof the milling process where the central region was thinned the most,resulting in a concave profile to both sides of the BDD-TEM grid anda very small hole  in the center.For combined electrochemical-TEM measurements this also meant theelectrochemical response was only due to the BDD and not a combinationof BDD and metal support. The electron beam transparent regions ofthe BDD-TEM electrode were shown to be thin enough to facilitate resolutionof electrochemically deposited and isolated single atoms (of Au).The central hole was also extremely helpful for IL-(S)TEM experiments,where the distinct shape of the hole edge was used to locate specificareas for repeat imaging.3 carbon character with minimal surface damage after ion milling.TEM diffraction studies showed a dominant (110) crystallography ofthe surface. Useful electrochemical properties in terms of large aqueoussolvent window and low double layer capacitance, were also retained.Moreover, the BDD-TEM grid was shown to be chemically and electrochemicallyresistant to carbon corrosion when subject to AST in acid, unlikecommercial C/metal TEM grids. Such properties are extremely usefulwhen developing NP catalyst supports, and are particularly suitablefor correlative electrochemical-TEM experiments, under corrosion freesupport conditions. Thermal stability in air was evaluated  by heating up to 400 \u00b0C. TheBDD-TEM electrodes remained intact unlike the C/metal grids. The advantageof having a thermally stable and electrically conductive TEM gridwas highlighted by using the BDD-TEM electrodes in combination with in situ TEM heating to investigate the temperature of crystallizationfor electrodeposited amorphous MnO2. Transition to theelectrochemically-active \u03b3-MnO2 phase was shown at400 \u00b0C.A combination of techniques: SEM,TEM (including EELS), WLI, AFMand XPS, contact angle and electrochemical were employed to characterizethe surface and investigate the impact of ion milling on the BDD surfaceand electrochemistry. XPS determined the BDD kept its spFinally, with the current design of BDD-TEM electrode,the centerof the disk contains a very small hole. The mass transport profileat the very edge of the hole will be different to that further away.Future work is focused on the development of BDD-TEM electrodes whichare hole free and where the whole surface is electron beam transparent.Such electrodes should also find promise for combined optical detection-electrochemicalmeasurements."}
+{"text": "We will place a particular emphasis on changing ethical considerations over time and the evolution of the model of care from gatekeeping to informed consent. To this end, we did an extensive review of the literature. We identified a trend across successive iterations of the guidelines in both reducing stigma against TGD individuals and shift in ethical considerations from \u201cdo no harm\u201d to the core principle of patient autonomy. This has helped reduce barriers to care and connect more people who desire it to gender affirming care (GAC), but in these authors\u2019 opinions does not go far enough in reducing barriers.Transgender and gender diverse (TGD) are terms that refer to individuals whose gender identity differs from sex assigned at birth. TGD individuals may choose any variety of modifications to their gender expression including, but not limited to changing their name, clothing, or hairstyle, starting hormones, or undergoing surgery. Starting in the 1950s, surgeons and endocrinologists began treating what was then known as transsexualism with cross sex hormones and a variety of surgical procedures collectively known as sex reassignment surgery (SRS). Soon after, Harry Benjamin began work to develop standards of care that could be applied to these patients with some uniformity. These guidelines, published by the World Professional Association for Transgender Health (WPATH), are in their 8th iteration. Through each iteration there has been a requirement that patients requesting gender-affirming hormones (GAH) or gender-affirming surgery (GAS) undergo one or more detailed evaluations by a mental health provider through which they must obtain a \u201cletter of readiness,\u201d placing mental health providers in the role of gatekeeper. WPATH specifies eligibility criteria for gender-affirming treatments and general guidelines for the content of letters, but does not include specific details about what must be included, leading to a lack of uniformity in how mental health providers approach performing evaluations and writing letters. This manuscript aims to review practices related to evaluations and letters of readiness for GAS in adults over time as the standards of care have evolved  Gender identity can be expressed through any combination of name, pronouns, hairstyle, clothing, and social role. Some TGD individuals wish to transition medically by taking gender-affirming hormones (GAH) and/or pursuing gender-affirming surgery (GAS) .1 The meHistorically physicians have placed significant barriers in the way of TGD people accessing the care that we now know to be lifesaving. Even today, patients wishing to receive GAC must navigate a system that sometimes requires multiple mental health evaluations for procedures, that is not required of cisgender individuals.The medical and psychiatric communities have used a variety of terms over time to refer to TGD individuals. The first and second editions of DSM described TGD individuals using terms such as transvestism (TV) and transsexualism (TS), and often conflated gender identity with sexuality, by including them alongside diagnoses such as homosexuality and paraphilias. Both the DSM and the International Classification of Diseases (ICD) have continuously changed diagnostic terminology and criteria involving TGD individuals over time, from Gender Identity Disorder in DSM-IV to Gender Dysphoria in DSM-5 to Gender Incongruence in ICD-11.3, renamed the World Profession Association for Transgender Health (WPATH) in 2006, was the first to publish international guidelines for providing GAC to TGD individuals. The WPATH Standards of Care (SOC) are used by many insurance companies and surgeons to determine an individual\u2019s eligibility for GAC. Throughout each iteration, mental health providers are placed in the role of gatekeeper and tasked with conducting mental health evaluations and providing required letters of readiness for TGD individuals who request GAC  according to PRISMA guidelines. The search was comprised of database-specific controlled vocabulary and keyword terms for (1) mental health and (2) TGD-related surgeries. Searches were conducted on December 2, 2020 in MEDLINE (PubMed), the Cochrane Library Databases (Wiley), PsychINFO (EBSCOhost), CINAHL (EBSCOhost), Scopus (Elsevier), and Dissertations and Theses Global (ProQuest). All databases were searched from inception to present without the use of limits or filters. In total, 8,197 results underwent multi-pass deduplication in a citation management system (EndNote), and 4,411 unique entries were uploaded to an online screening software (Rayyan) for title/abstract screening by two independent reviewers. In total, 303 articles were included for full text screening , howeverIn total, 86 articles were included for review. Eleven articles were focused on ethical considerations while the remaining 75 articles focused on the mental health evaluation and process of writing letters of readiness for GAS. Version 8 of the SOC was published in September of 2022 during the review process of this manuscript and is also included as a reference and point of discussion.Fourteen articles were identified in the literature search as published prior to the development of the WPATH SOC version 1 in 1979. Prominent themes included classification, categorization, and diagnosis of TS. Few publications described the components of a mental health evaluation, and inclusion and exclusion criteria, for GAS. Many publications focused exclusively on transgender females, with a paucity of literature examining the experiences of transgender males during this timeframe.Authors emphasized accurate diagnosis of TS, highlighting elements of the psychosocial history including early life cross-dressing, preference for play with the opposite gender toys and friends, and social estrangement around puberty . One autMoney argued that the selection criteria for patients requesting GAS include a psychiatric evaluation to obtain collateral information to confirm the accuracy of the interview, work with the family to foster support of the individual, and proper management of any psychiatric comorbidities . AuthorsOthers focused the role of the psychiatric evaluation on the social lives and roles of the patient. They believed the evaluation should include exploring the patient\u2019s motivation for change for at least 6\u201312 months , facilitEll recommended evaluation to ensure the patient has \u201cadequate intelligence\u201d to understand realistic expectations of surgery and attempted to highlight the patient\u2019s autonomy in the decision to undergo GAS. He wrote, \u201cThat is your decision [to undergo surgery]. It\u2019s up to you to prove that you are a suitable candidate for surgery. It\u2019s not for me to offer it to you. If you decide to go ahead with your plans to pass in the opposite gender role, you do it on your own responsibility\u201d . NotablyIn these earliest publications, one can start to see the beginning framework of modern-day requirements for accessing GAS, including ensuring an accurate diagnosis of gender incongruence; ruling out other possible causes of presentation such as psychosis; ensuring general mental stability; making sure that the patient has undergone at least some time of living in their affirmed gender; and that they are able to understand the consequences of the procedure.The first two versions of the WPATH SOC were written in 1979 and 1980, respectively and are substantially similar to one another. SOC version three was the first to be published in an academic journal in 1985 and changes from the first two versions were documented within this publication. The first two versions required that all recommendations for GAC be completed by licensed psychologists or psychiatrists. The first version recommended that patients requesting GAH and non-genital GAS, spend 3 and 6 months, respectively, living full time in their affirmed gender. These recommendations were rescinded in subsequent versions . Figure Five articles published between 1979 and 1980 were included in this review. Again, emphasis was placed on proper diagnosis, classification and consistency of gender identity over time , 18.Wise and Meyer explored the concept of a continuum between TV and TS, describing that those who experienced gender dysphoria often requested GAS, displayed evidence of strong cross-dressing desires with arousal, history of cross-gender roles, and absence of manic-depressive or psychotic illnesses . RequireVersion 3 broadened the definition of the clinician thereby broadening the scope of providers who could write recommendation letters for GAC. Whereas prior SOC required letters from licensed psychologists or psychiatrists, version 3 allowed initial evaluations from providers with at least a Master\u2019s degree in behavioral science, and when required, a second evaluation from any licensed provider with at least a doctoral degree. Version 3 recommended that all evaluators demonstrate competence in \u201cgender identity matters\u201d and must know the patient, \u201cin a psychotherapeutic relationship,\u201d for at least 6 months . VersionNine articles were published during the timeframe that the SOC version 3 were active (1981\u20131990). Themes in these publications included increasing focus on selection criteria for GAS and emphasis on the RLT, which was used to ensure proper diagnosis of gender dysphoria. Recommendations for the duration of the RLT ranged anywhere between 1 and 3 years , 23.Proposed components of the mental health evaluation for GAS included a detailed assessment of the duration, intensity, and stability of the gender dysphoria, identification of underlying psychiatric diagnoses and suicidal ideation, a mental status examination to rule out psychosis, and an assessment of intelligence  to comment on the individual\u2019s \u201ccapacity and competence\u201d to consent to GAC. The Minnesota Multiphasic Personality Inventory (MMPI), Weschler Adult Intelligence Scale (WAIS), and Lindgren-Pauly Body Image Scale were also used during assessments .Authors developed more specific inclusion and exclusion criteria for undergoing GAS with inclusion criteria including age 21 or older, not legally married, no pending litigation, evidence of gender dysphoria, completion of 1 year of psychotherapy, between 1 and 2 years RLT with ability to \u201cpass convincingly\u201d and \u201cperform successfully\u201d in the opposite gender role, at least 6 months on GAH , reasonably stable mental health , good financial standing with psychotherapy fees , and a pWorld Professional Association for Transgender Health SOC version four was published in 1990. Between version three and version four, DSM-III-R was published in 1987. Version four relied on the DSM-III-R diagnostic criteria for TS as opposed to the DSM-III criteria in version three. The DSM-III-R criteria for TS included a \u201cpersistent discomfort and sense of inappropriateness about one\u2019s assigned sex,\u201d \u201cpersistent preoccupation for at least 2 years with getting rid of one\u2019s primary and secondary sex characteristics and acquiring the sex characteristics of the other sex,\u201d and that the individual had reached puberty . NotableSix articles were published between 1990 and 1998 while version four was active. Earlier trends continued including emphasizing proper diagnosis of gender dysphoria , 32, howBockting and Coleman, in a move representative of other publications of this era, advocated for a more comprehensive approach to the mental health evaluation and treatment of gender dysphoria. Their treatment model was comprised of five main components: a mental health assessment consisting of psychological testing and clinical interviews with the individual, couple, and/or family; a physical examination; management of comorbid disorders with pharmacotherapy and/or psychotherapy; facilitation of identity formation and sexual identity management through individual and group therapy; and aftercare consisting of individual, couple, and/or family therapy with the option of a gender identity consolidation support group. Psychoeducation was a main thread throughout the treatment model and a variety of treatment \u201csubtasks\u201d such as understanding decision making, sexual functioning and sexual identity exploration, social support, and family of origin intimacy were identified as important. The authors advocated for \u201ca clear separation of gender identity, social sex role, and sexual orientation which allows a wide spectrum of sexual identities and prevents limiting access to GAS to those who conform to a heterosexist paradigm of mental health\u201d .This process can be compared with the Italian SOC for GAS which recommend a multidisciplinary assessment consisting of a psychosocial evaluation and informed consent discussion around treatment options, procedures, and risks. Requirements included 6 months of psychotherapy prior to initiating GAH, 1 year of a RLT prior to GAS, and provision of a court order approving GAS, which could not be granted any sooner than 2 years after starting the process of gender transition. Follow-up was recommended at 6, 12, and 24 months post-GAS to ensure psychosocial adjustment to the affirmed gender role .Other authors continued to refine inclusion and exclusion criteria for GAS by surveying the actual practices of health centers. Inclusion criteria included those who had life-long cross gender identification with inability to live in their sex assigned at birth; a 1\u20132 years RLT ; and ability to pass \u201ceffortlessly and convincingly in society\u201d; completed 1 year of GAH; maintained a stable job; were unmarried or divorced; demonstrated good coping skills and social-emotional stability; had a good support system; and were able to maintain a relationship with a psychotherapist. Exclusion criteria included age under 21 years old, recent death of a parent , unstablThe survey indicated some programs were more lenient around considering individuals with bipolar affective disorder, the ability to pass successfully, and issues around family support. Only three clinics used sexual orientation as a factor in decision for GAS, marking a significant change in the literature from prior decades. Overall, the authors found that 74% of the clinics surveyed did not adhere to WPATH SOC, instead adopting more conservative policies .Published in 1998, version five defined the responsibilities of the mental health professional which included diagnosing the gender disorder, diagnosing and treating co-morbid psychiatric conditions, counseling around GAC, providing psychotherapy, evaluating eligibility and readiness criteria for GAC, and collaborating with medical and surgical colleagues by writing letters of recommendation for GAC . EligibiFive articles were published between 1998 and 2001 while version five was active. Two of these articles were summaries of the SOC , 38. TheMa reviewed the role of the social worker in a multidisciplinary gender clinic in Hong Kong. Psychosocial assessment for GAS included evaluation of performance in affirmed social roles, adaptation to the affirmed gender role during the 1-year RLT and understanding the patient\u2019s identified gender role and the response to the new gender role culturally and interpersonally within the individual\u2019s support network and family unit. She noted five contraindications to GAS: a history of psychosis, sociopathy, severe depression, organic brain dysfunction or \u201cdefective intelligence,\u201d success in parental or marital roles, \u201csuccessful functioning in heterosexual intercourse,\u201d ability to function in the pretransition gender role, and homosexual or TV history with genital pleasure. She proposed a social work practice model for patients who apply for GAS with categorization of TGD individuals into \u201cbetter-adjusted\u201d and \u201cpoorly-adjusted\u201d with different intervention goals and methods for each. For those who were \u201cbetter-adjusted,\u201d treatment focused on psychoeducation, building coping tools, and mobilization into a peer counselor role, while treatment goals for those who were \u201cpoorly-adjusted\u201d focused on building support and resources .Damodaran and Kennedy reviewed the assessment and treatment model used by the Monash gender dysphoria clinic in Melbourne, Australia for patients requesting GAS. All referrals for GAS were assessed independently by two psychiatrists to determine proper diagnosis of gender dysphoria, followed by endocrinology and psychology consultation to develop a comprehensive treatment plan. Requirements included RLT of minimum 18 months and GAH .Miach reviewed the utility of using the Minnesota Multiphasic Personality Inventory-2 (MMPI-2), a revision of the MMPI which was standardized using a more heterogeneous population, in a gender clinic to assess stability of psychopathology prior to GAS, which was only performed on patients aged 21\u201355 years old. The authors concluded that while the TGD group had a significantly lower level of psychopathology than the control group, they believed that the MMPI-2 was a useful test in assessing readiness for GAC .Published in 2001, version six of the WPATH SOC did not include significant changes to the 10 tasks of the mental health professional  or in thThirteen articles were published between 2001 and 2012. One is a systematic review of evidence for factors that are associated with regret and suicide, and predictive factors of a good psychological and social functioning outcome after GAC. De Cuypere and Vercruysse note that less than one percent of patients regret having GAS or commit suicide, making detection of negative predictive factors in a study nearly impossible. They identified a wide array of positive predictive factors including age at time of request, sex of partner, premorbid social or psychiatric functioning, adequacy of social support system, level of satisfaction with secondary sexual characteristics, and surgical outcomes. Many of these predictive factors were later disproved. They also noted that there were not enough studies to determine whether following the WPATH guidelines was a positive predictive factor. In the end they noted that the evidence for all established evaluation regimens  was at best indeterminate. They recommended that changes to WPATH criteria should redirect focus from gender identity to psychopathology, differential diagnosis, and psychotherapy for severe personality disorders .The literature at this time supports two opposing approaches to requests for GAC, those advocating for a set of strictly enforced eligibility and readiness criteria associated with very thorough evaluations and those who advocate for a more flexible approach. Common approaches to the evaluation for GAC include: taking a detailed social history including current relationships, support systems, income, and social functioning; a sexual development history meant to understand when and how the patient began to identify as TGD and how their transition has affected their life; an evaluation of their coping skills, \u201cpsychic functions\u201d and general mental well-being; and a focus on assessing the \u201ccorrect diagnosis\u201d of gender identity disorder \u201356. The Those that advocated for a stricter interpretation of the eligibility and readiness criteria emphasized the importance of the RLT , 55, 56.Among groups supporting a flexible interpretation of the SOC, there was a much stronger emphasis on the supportive role of the mental health provider in the gender transition process , 52, 53.The lack of emphasis on informed consent by both groups of authors mirrors the discussion of informed consent within the SOC, which up through version six, had a relatively narrow definition and role specifically related to risks and benefits of surgery. As far back as version one, the SOC states \u201chormonal and surgical sex reassignment are procedures which must be requested by, and performed only with the agreement of, the patient having informed consent\u2026[these procedures] may be conducted or administered only after the patient applicant has received full and complete explanations, preferably in writing, in words understood by the patient applicant, of all risks inherent in the requested procedures . \u201cThis rguidelines meant to be flexible to account for different practices in different places. Compared to version six, a significantly expanded section on the \u201cTasks of the Mental Health Provider\u201d was added, offering some instructions on what to include in the assessment of the patient for GAS. For the first time the SOC expand on what it means to obtain informed consent and describe a process where the mental health provider is expected to guide a conversation around gender identity and how different treatments and procedures might affect TGD individuals psychologically, socially, and physically. Other recommendations include \u201cat a minimum, assessment of gender identity and gender dysphoria, history and development of gender dysphoric feelings, the impact of stigma attached to gender non-conformity on mental health, and the availability of support from family, friends, and peers.\u201d There is also a change to the recommended content of the letters: switching from \u201cThe initial and evolving gender, sexual, and other psychiatric diagnoses\u201d to \u201cResults of the client\u2019s psychosocial assessment, including any diagnoses\u201d, indicating a shift in the focus away from diagnosis toward the psychosocial assessment. Version 7 also adds two new tasks for the mental health provider including \u201cEducate and advocate on behalf of clients within their community  and assist clients with making changes in identity documents\u201d and \u201cProvide information and referral for peer support\u201d vs. external . For internal surgeries, criteria are the same as for top surgery with the addition of a required 12 months of GAH. For external surgeries the criteria are the same as for internal, with the addition of required 12 months of living in the patient\u2019s affirmed gender identity .Twenty-three articles were published while version 7 of the SOC have been active. Themes include identifying the role of psychometric testing in GAC evaluations, expanding the discussion around informed consent for GAC, and revising the requirements for letter writers.A systematic review evaluated the accuracy of psychometric tests in those requesting GAC, identifying only two published manuscripts that met their inclusion criteria, both of which were of poor quality; this led them to question the utility of psychometric tests in in TGD patients . Keo-MeiMany authors describe the process of informed consent for GAC , 62\u201376. Practice patterns and opinions on who should write letters of readiness and how many letters should be required vary widely. Many letters that surgeons receive are cursory, and short and non-personal letters correlate with poor surgical outcomes . SeveralThe Mount Sinai Gender Clinic describes an integrated multidisciplinary model where a patient will see a primary care doctor, endocrinologist, social worker, psychiatrist, and obtain any necessary lab work in a single visit, significantly reducing barriers to care. The criteria in this model focus on informed consent, the social determinants of health, being physically ready for surgery, and putting measurable goals on psychiatric stability, while deemphasizing the gender dysphoria diagnosis. Their study showed that people who received their evaluation over a 2-year period were more likely to meet their in-house criteria than they were to meet criteria as set forth in WPATH SOC. The Mount Sinai criteria allowed for significantly decreased barriers to care, allowing more people to progress through desired GAC in a timely fashion .Standards of care version 8, published in September 2022, includes major updates to the guidelines around GAS. This version explicitly highlights the importance of informed decision making, patient autonomy, and harm reduction models of care, as well as emphasizing the flexibility of the guidelines which the authors note can be modified by the healthcare provider in consultation with the TGD individual.Version 8 lays out the roles of the assessor which are to identify the presence of gender incongruence and any co-existing mental health concerns, provide information on GAC, support the TGD individual in their decision-making, and to assess for capacity to consent to GAC. The authors emphasize the collaborative nature of this decision-making process between the assessor and the TGD individual, as well as recommending TGD care occur in a multidisciplinary team model when possible.Version 8 recommends that providers who assess TGD individuals for GAC hold at least a Master\u2019s level degree and have sufficient knowledge in diagnosing gender incongruence and distinguishing it from other diagnoses which may present similarly. These changes allow for non-mental health providers to be the main assessors for GAC.Version 8 recommends reducing the number of evaluations prior to GAS to a single evaluation in an effort to reduce barriers to care for the TGD population. Notably, the authors have removed the recommendations around content of the letter of readiness for GAC. The guidelines note that the complexity of the assessment process may differ from patient to patient, based on the type of GAC requested and the specific characteristics of the patient. Version eight directly states that psychometric testing and psychotherapy are not requirements to pursue GAC. While evaluations should continue to identify co-existing mental health diagnoses, version 8 highlights that the presence of a mental health diagnosis should not prevent access to GAC unless the mental health symptoms directly interfere with capacity to provide informed consent for treatment or interfere with receiving treatment. Version 8 recommends that perioperative matters, such as travel requirements, presence of stable, safe housing, hygiene/healthy living, any activity restrictions, and aftercare optimization, be discussed by the surgeon prior to GAS. In terms of eligibility criteria, the authors recommend a reduced duration of GAH from 12 months (from version 7) to 6 months (in version 8) prior to pursuing GAS involving reproductive organs .A total of eleven articles explored ethical considerations of conducting mental health evaluations and writing letters of readiness for GAS, including a comparison of the ethical principles prioritized within the \u201cgatekeeping\u201d model vs. the informed consent model for GAC and the differential treatment of TGD individuals compared to cisgender individuals seeking similar surgical procedures.Many authors compare the informed consent model of care for TGD individuals to the WPATH SOC model. In the informed consent model, the role of the health practitioner is to provide TGD patients with information about risks, side effects, benefits, and possible consequences of undergoing GAC, and to obtain informed consent from the patient . Cavanauvia such systems like the WPATH SOC  to write letters for surgery . In pracThere are few published guides for writing letters of readiness for GAC. The WPATH SOC provide vague guidelines as to the information to include within the letter itself, which, in addition to a lack of consistency in implementation of the SOC, lead to a huge variety in current practices around letter writing and limit their usefulness to surgical providers . There iThe reviewed articles included opinion manuscripts, published SOC, and proposed models for how to design and operate GAC clinics, however, this narrative review is limited by a lack of peer reviewed clinical trials that assess the evidence for the GAC practices described here. As a result, it is challenging to comment on the effectiveness of various interventions over time.The WPATH SOC have evolved significantly over time with regards to their treatment of TGD individuals. Review of the literature shows a clear progression of practices from paternalistic gatekeeping toward increasing emphasis on patient autonomy and informed consent. Mental health evaluations, still required by SOC version eight are almost entirely unique as a requirement for GAS, apart from some bariatric and transplant surgeries. Individuals who wish to pursue GAC are required to get approval for treatments that their cisgender peers may pursue without such evaluations. While there may be some benefits from these evaluations in helping to optimize a patient socially, emotionally, and psychologically for GAC, the increased stigma and burden placed on patients by having a blanket requirement for such evaluations leads us to seriously question the readiness evaluation requirements in SOC version 8, despite a reduction in the requirements compared to previous SOC. This burden is made worse by limited access to providers knowledgeable and competent in conducting GAC evaluations, writing letters of readiness, and a lack of consistency in the application and interpretations of the SOC by both providers and insurance companies. Other barriers to care created by multiple letter requirements include the often-prohibitive cost of getting multiple evaluations and the delay in receiving their medical or surgical treatments due to extensive wait times to see a mental health provider. This barrier will in theory be ameliorated by updates to SOC in version 8, but multiple letters are likely to at least be required by insurance companies for some time. Overall, the shift from gate keeping to informed consent has been a net positive for patients by reducing barriers to care and improving patient autonomy, but the mental health evaluation is still an unnecessary barrier for many people. Further research is necessary to develop a standardized evaluation and letter template for providers to access, as well as further study into who can most benefit from an evaluation in the first place.The original contributions presented in this study are included in the article/TA and KK contributed to the conception and design of the study under the guidance of RL and AJ, reviewed and analyzed the literature, and wrote the manuscript. AW organized the literature search and wrote the \u201cMethods\u201d section. RL and AJ assisted in review and revision of the completed manuscript. All authors approved of the submitted version."}
+{"text": "Homocysteine and C-reactive protein (CRP) may serve as biomarkers of postoperative delirium. We set out to compare the role of blood concentration of homocysteine versus CRP in predicting postoperative delirium in patients.In this prospective observational cohort study, the plasma concentration of preoperative homocysteine and postoperative CRP was measured. Delirium incidence and severity within 3 days postoperatively were determined using the Confusion Assessment Method and Confusion Assessment Method-Severity algorithm.P = 0.026], and severity  after adjusting age, sex, preoperative Mini-Mental State Examination score and the days when postoperative CRP was measured. A statistically significant interaction (adjusted P = 0.044) was also observed, in which the association between postoperative plasma concentration of CRP and postoperative delirium incidence was stronger in the participants with lower preoperative plasma concentrations of homocysteine compared to those with higher preoperative levels.Of 143 participants  who had knee or hip surgery under general anesthesia, 44 (31%) participants developed postoperative delirium. Postoperative plasma concentration of CRP was associated with postoperative delirium incidence [adjusted odds ratio (OR) per one standard deviation change in CRP: 1.51; 95% Confidence Interval (CI): 1.05, 2.16; Pending validation studies, these data suggest that preoperative plasma concentration of homocysteine modifies the established association between postoperative plasma concentration of CRP and postoperative delirium incidence. Postoperative delirium, an acute confusion status after anesthesia and surgery, is associated with adverse effects with annual care costs of $ 32.9 billion . Populatvia increased production of pro-inflammatory cytokines in the blood and brain  is a potential predisposing factor owing to its involvement in cardiovascular disease  and AD . PreoperA recent study demonstrated the interaction between gene Apolipoprotein E (a predisposing factor) and postoperative CRP (a protein and precipitating factor) on postoperative delirium . HoweverTherefore, we set out to determine the effects of preoperative plasma concentration of homocysteine, the postoperative plasma concentration of CRP, and their interactions on the incidence and severity of postoperative delirium in patients. It was hypothesized that preoperative plasma concentrations of homocysteine would modify the established association between postoperative plasma concentration of CRP and postoperative delirium in patients.Preoperative homocysteine and postoperative CRP were evaluated in this study because postoperative CRP is an established blood biomarker of postoperative delirium . HoweverWe performed a prospective observational cohort study from June 22, 2016 to May 5, 2017, at Shanghai Tenth People\u2019s Hospital, a university-affiliated hospital in Shanghai, P. R. China. The study protocol was approved by the hospital\u2019s Human Research Ethics Committee (SHSY-IEC-3.0/15-78/01) on May 12, 2016.All participants provided written informed consent for the study before initiating any study procedures. This study is being reported following the Strengthening the Reporting of Observational Studies in Epidemiology (STROBE) criteria.We screened patients scheduled for knee/hip replacement surgeries. Participants were included if they: (1) were 60 years old or older; (2) spoke Mandarin Chinese; (3) had general anesthesia, and (4) were able to provide informed consent. Patients were excluded if they had any of the following: (1) pre-existing delirium assessed according to the Confusion Assessment Method (CAM) algorithm ; (2) priPreoperative assessments were performed one day before the scheduled surgery by well-trained researchers following a standard protocol. Participant characteristics were collected, including age, sex, education, body mass index (BMI), and Charlson Comorbidity Index (CCI) . PreoperAll participants underwent a hip or knee replacement under general anesthesia. The preoperative fasting, anesthetics used, airway management, opioid and neuromuscular blocking agent  usage, intravenous fluid administration, and mechanical ventilation were performed per the hospital policy and at the anesthesiologist\u2019s discretion. The participants generally received 1\u20132 mg midazolam preoperatively. Anesthesia was induced with propofol (2 mg/kg), sufentanil (0.5\u20131 \u03bcg/kg), and cisatracurium (0.5 mg/kg) and was maintained with anesthetic sevoflurane or propofol. We obtained information regarding the American Society of Anesthesiologists (ASA) Physical Status Classification System , surgeryWe collected 4 ml of venous blood during the insertion of intravenous catheters before the anesthesia and surgery in all participants to measure preoperative plasma concentrations of homocysteine. The blood sample was collected in anticoagulant tubes and was immediately centrifuged to collect the supernatant plasma. The plasma was stored in a \u221280\u00b0C freezer until measurement. Preoperative plasma concentration of homocysteine was determined by using the Roche Cobas 8000 system  with the enzyme cycling method.Postoperative measurement of blood CRP was part of the clinical care of the patients. Thus, we obtained the postoperative blood CRP concentrations by checking the participants\u2019 medical records. If participants had several postoperative CRP measurements, the concentration of the first postoperative measurement of plasm CRP was used for the final data analysis in the present study. Since the postoperative CRP measurement was part of the routine postoperative clinical care, the time of the postoperative blood collection  was not fixed on a particular day. Notably, in the clinical laboratory, the postoperative plasma concentrations of CRP were measured using an immunonephelometric method on a Nephelometer BNII , measuring a range from 3\u2013200 mg/L.The primary outcome was the presence of delirium at any postoperative assessments performed in the first three days postoperatively. Postoperative delirium was determined by daily interviews on postoperative days 1, 2, and 3 using the CAM . Each paThe severity of delirium was assessed as a secondary outcome. The severity of postoperative delirium was quantified using the CAM-Severity (CAM-S) long-form , comprisWe estimated that 140 participants would provide 90% power to detect the potential difference in postoperative plasma concentration of CRP between the participants with and without postoperative delirium at a 5% significance level. This estimation was based on a previous study of elderly patients aged 65 years old. The patients who developed postoperative delirium had higher postoperative CRP concentrations than those who did not: 10.26 \u00b1 5.81 mg/dL versus 6.96 \u00b1 4.89 mg/dL .According to our previous study, the estimated incidence of postoperative delirium was 25.6% , so we sThe study included the data analysis of plasma concentrations of preoperative homocysteine, postoperative CRP, and the incidence and severity of postoperative delirium. Notably, all postoperative CRP measurements were performed as part of routine clinical care, mostly occurring within 1\u20133 days after surgery. The statistical analysis plan was finalized before analyzing the data.t-test or Mann\u2013Whitney U test. Categorical variables  are presented as frequencies and proportions and assessed with chi-square or Fisher\u2019s exact test.Normally distributed continuous variables  and non-normally distributed continuous variables  are presented as the mean \u00b1 standard deviation (SD) and median , respectively. As appropriate, the differences between patients who did and did not develop delirium were assessed with an independent samples Preoperative homocysteine and postoperative CRP were scaled using z-scores in all models for analysis, which were calculated by subtracting the mean from an individual raw score and then dividing the difference by the standard deviation. The association between preoperative plasma concentration of homocysteine, the postoperative plasma concentration of CRP, and postoperative delirium incidence were assessed using logistic regression. Results are presented as odds ratio (OR) per one standard deviation change in the biomarker and their associated 95% confidence intervals (CI). The association between the biomarkers and the worst delirium severity was estimated using linear regression, with results reported as a mean difference [beta coefficient (\u03b2)] and it\u2019s associated 95% CI. Model fit assuming a Gaussian distribution was evaluated by examining the residuals and model calibration.p-values less than 0.05 were considered statistically significant for all analyses.The association between preoperative homocysteine and postoperative plasma concentration of CRP was assessed for both the primary (delirium incidence) and secondary (delirium severity) outcomes. Both predictors were evaluated in separate univariate models with each of the main effects, one model including postoperative CRP and preoperative homocysteine, and the final model including the main effects and the inclusion of an interaction term between preoperative homocysteine and postoperative CRP together. In order to visualize the interaction between postoperative CRP and preoperative homocysteine, the relationship between postoperative CRP and the predicted probability of postoperative delirium was reported for different preoperative plasma concentrations of homocysteine, namely the 10th, 25th, 50th, 75th, and 90th percentiles. Multivariable models were then created to adjust the associations between the biomarkers and outcomes for age, sex, preoperative MMSE, and day of postoperative CRP measurement for both the primary and secondary outcomes. These variables were selected for the adjustment based on previous studies as deemed clinically relevant while still considering model parsimony. Pearson Correlation was used to determine the relationship between pre-operative homocysteine and postoperative CRP. SPSS version 22.0  and R  were used to analyze the data. Two-sided N = 65), had abnormal cognitive function (N = 6), did not plan to have general anesthesia or changed anesthesia (N = 12), had prior neurologic diseases (N = 3), had an infection/fever (N = 1), and had a significant past medical history (N = 3). Thus, 168 participants were enrolled in the study. After obtaining the consent, 25 participants were excluded because they were not interested in further participation in the study (N = 18), or canceled surgery (N = 7). Participants in the present study did not include patients who took psychoactive drugs to treat mental disorders or neurological diseases. No major complications occurred during the immediate postoperative period. There were no missing data for variables of interest in the current study. The final data analysis included 143 participants  who underwent knee (88.0%) or hip (12.0%) surgery  and without (N = 99) postoperative delirium, except for the length of surgery duration, the preoperative and postoperative day 2 VAS scores  patients received all six assessments, seven (4.9%) participants received five assessments, and one (0.7%) participant received four assessments. Forty-four of the 143 participants (31%) developed postoperative delirium. There were no statistically significant differences in demographic, clinical characteristics, type of surgery, anesthesia, and other perioperative factors between participants with  mg/L versus 46.50 , mg/L, P < 0.001] than the participants without postoperative delirium  mmol/L versus 12.51  mmol/L, delirium .P = 0.026; The postoperative plasma concentration of CRP was associated with the incidence of postoperative delirium before and after adjusting for age, sex, preoperative MMSE, and day of postoperative CRP measurement .Moreover, preoperative plasma homocysteine was not associated with postoperative plasma CRP before and after adjusting for age and sex  genotype  4 genotype  and the genotype . Specifigenotype , suggest12 and folic acid could reduce cognitive impairment in aged mice by lowering homocysteine concentrations  on May 12, 2016. The patients/participants provided their written informed consent to participate in this study.YS and ZX: study concept and design. XM, XCM, TT, MW, XW, HLZ, and JC: acquisition of data. HZ, KC, EM, ZX, and YS: analysis and interpretation of data. ZX, XM, and YS: drafting of the manuscript. KC, LX, and EM: critical manuscript revision for important intellectual content. XCM, LX, and YS: obtained funding. YS and XM: administrative, technical, and material support. YS: study supervision. All authors contributed to the article and approved the submitted version."}
+{"text": "Based on the available literature, women living with HIV (WLWH) seem to show greater cognitive and emotional disadvantages than men living with HIV (MLWH). Our aim was to compare the cognitive performance of MLWH and WLWH in an Italian cohort of People Living With HIV (PLWH) and to analyse factors potentially contributing to sex differences in cognitive function. We ran a retrospective, cross-sectional analysis of a monocentric dataset of PLWH who were administered a standardized neuropsychological test battery (SNB) during routine clinical care. We enrolled 161 Italian PLWH who are on combined antiretroviral therapy (cART): 114 (70.8%) MLWH and 47 (29.2%) WLWH.z score) (GCP) was significantly higher in MLWH than WLWH . Moreover, WLWH obtained significantly higher scores on the Zung Depression Scale than MLWH . However, there was no statistically significant direct effect between male sex and better GCP (p\u2009=\u20090.692) in the context of a mediation model. On the contrary, the associations between male sex and better GCP were mediated by higher level of education  and a lower Zung depression score .Global cognitive performance (composite In conclusion, the global cognitive performance of WLWH is lower than that of MLWH. However, other demographic and clinical factors besides sex might help explain differences in their neurocognitive functions and make it possible for us to monitor them and identify those patients most in need. There are several issues relating to the HIV care that make it important to differentiate women living with HIV (WLWH) from men living with HIV (MLWH)   during routine clinical care between January 2011 and March 2019.Data concerning the following demographic, clinical, and laboratory variables were collected for each participant at the time of the neuropsychological testing: age, education, ethnicity, risk factors for HIV infection, time from HIV diagnosis, current and past antiretroviral regimen, current and nadir CD4 cell count, HIV-1 viral load, co-infection with hepatitis C virus (HCV), comorbidities, use of antidepressant and concomitant medications.learning memory: The Rey Auditory Verbal Learning Test \u2013 RAVLT;attention: WAIS Digit Span, WAIS Digit Symbol;verbal fluency: FAS Test (subtest of the Neurosensory Center Comprehensive Examination for Aphasia-NCCEA);executive functioning: Multiple features target cancellation- MFTC;fine motor skills: Grooved Pegboard Test.By means of SNB we investigated the following cognitive areas:Z scores using means and standard deviations of Italian normative data  by transforming raw scores obtained on each task into standardized Each patient was also administered the Zung Self-Rating Depression Scale Zung , 1986, aDescriptive statistics were calculated for quantitative variables  and qualitative variables (percent frequencies).T tests or the Chi-square test were performed to determine differences in cognitive performance and Zung scores among groups based on sex: WLWH\u2009=\u2009group 1 and MLWH\u2009=\u2009group 2.When appropriate, d in order to identify effect sizes and show the clinical significance of comparisons between groups 1 and 2.We also computed Cohen\u2019s We performed a mediation analysis through a bootstrapping method using SPSS Process Macro to examine the effect of mediating variables on the relationship between sex and cognitive performance .A total of 161 Italian PLWH on cART were enrolled: 114 (70.8%) MLWH and 47 (29.2%) WLWH. Their demographic and clinical characteristics are summarized in Table p\u2009=\u20090.006], with a medium effect size (d\u2009=\u20090.59), time from HIV diagnosis , with a small effect size (d\u2009=\u20090.43), and from first cART , with a small effect size (d\u2009=\u20090.38).The subjects in the two groups (MLWH vs WLWH) significantly differed in mean education  with a small effect size (d\u2009=\u20090.35). Considering each cognitive domain separately, MLWH performed better than WLWH on attention , with a medium effect size (d\u2009=\u20090.59), and executive functions , with a small effect size (d\u2009=\u20090.35). Nevertheless, the percentage of patients affected by HAND did not significantly differ between MLWH and WLWH .GCP was significantly higher in MLWH than WLWH , with a medium effect size (d\u2009=\u20090.50), indicating more symptoms of depression in the former group and a significantly higher percentage of subjects with probable depression according to the Zung Depression normative cut-off . Results of the neuropsychological performances in each cognitive domain are shown in Table Moreover, WLWH obtained significantly higher scores on the Zung Depression Scale than MLWH  and for approximately 27% of the total effect on attention skills [PM\u2009=\u2009(0.12) / (0.43)]. Moreover, the mediator, Zung depression score, accounted for approximately 32% of the total effect on GCP [PM\u2009=\u2009(0.10) / (0.32)], for approximately 23% of the total effect on attention skills [PM\u2009=\u2009(0.10) / (0.43)] and for approximately 24% of the total effect on executive skills [PM\u2009=\u2009(0.07) / (0.29)].The mediator, education, accounted for approximately 46% of the total effect on GCP [c) between sex and GCP , attention skills , and executive skills  in the context of the mediation model.On the other hand, there was no statistically significant direct effect (The aim of this study was to analyse the cognitive profile of MLWH and WLWH in an Italian cohort of PLWH and to examine the effect of mediating variables on the relationship between sex and cognitive function. Indeed, based on the available literature, WLWH seem to have cognitive and emotional disadvantages (Rubin et al.\u00a0Overall, the WLWH in our cohort of patients had a lower level of education and longer time from HIV diagnosis and from first cART compared to MWLH. In line with previous evidence (Sundermann et al. In this regard, discrepant data emerged from previous observations. For example, Sundermann et al.  found a However, we identified other demographic and clinical factors besides sex that could help explain the aforementioned difference between WLWH and MLWH. Indeed, our results showed that there was no statistically significant direct effect between sex and GCP, attention and executive skills. On the contrary, the associations between male sex and better GCP and attention skills were mediated by higher level of education and fewer depressive symptoms. Moreover, a lower Zung depression score mediated the association between male sex and better executive skills.Thus, as suggested in previous studies, we confirm that depressive symptoms seem to be more prevalent in WLWH than in MLWH (Aljassem et al. Indeed, we corroborate the finding that adjusting for critical factors such as education, clinical variables, and mental health reduces the dimension of the sex difference and elucidates factors contributing to NCI in women (Rubin et al. We acknowledge that our study has some limitations. First, our conclusions are limited by the small sample size of the study. Indeed, due to the small number of patients who were submitted to a completed SNB in the dataset used for the retrospective analysis, our study reached a low statistical power. Thus, in future studies, it will be important to extend the sample to confirm the generalizability of the results achieved.Second, this is a cross-sectional study and uncontrolled biases can occur in routine clinical practice. Thus, future longitudinal studies are needed to confirm our findings also given the fact that only one longitudinal study to date has examined the risk of neurocognitive decline in WLWH and MLWH (Heaton et al. Lastly, in future investigations, it would be useful to include a healthy control group to compare differences in cognitive functions between women and men and between PLWH and the general population. In addition, our WLWH and MLWH subgroups were not matched for education, years from HIV diagnosis and years from first ARV; future investigations that include matched groups are needed to check the probable influences of these disparities on cognitive performance.In conclusion, taken together, our findings suggest that in our sample, WLWH demonstrate lower global cognitive performance, attention, and executive skills compared to MLWH. However, other demographic and clinical factors might be able to explain these disadvantages in WLWH besides sex, in particular the lower level of education and more depressive symptoms. On these bases, in planning cognitive interventions, it seems appropriate to pay particular attention to WLWH, but it would also be helpful to monitor demographic, clinical, and mental health factors to identify the patients who are most in need and to detect cognitive impairments as soon as possible and intervene to improve the psychological wellbeing of PLWH."}
+{"text": "Studies have shown that a direct association exists between the diet and blood uric acid concentrations. However, works on the association of dietary patterns with blood uric acid concentrations and hyperuricemia remain limited.\u00a0This study aims to evaluate the association of dietary patterns with blood uric acid concentrations and hyperuricemia.n\u2009=\u20094855). Three statistical methods, including principal component analysis, reduced rank regression (RRR), and partial least squares regression, were used to extract dietary patterns. General linear regression and logistic regression analyses were utilized to explore the relationship of dietary patterns with blood uric acid concentrations and hyperuricemia.The relationship between dietary patterns and hyperuricemia was explored through a nutritional epidemiological survey in China (P\u2009<\u20090.05), whereas those in the highest quartile of animal dietary pattern scores were at a high risk of hyperuricemia . The participants in the third quartile of scores for the RRR dietary pattern, which was characterized by the relatively high intake of poultry, sugary beverages, and animal organs and the low intake of desserts and snacks, had a significantly higher risk of hyperuricemia than those in the first quartile of scores for the RRR dietary pattern .After adjusting for potential confounding factors, the score for the plant-based dietary pattern was found to be negatively correlated with blood uric acid levels (\u03b2\u2009=\u2009\u2009\u2212\u20093.225) and that for the animal dietary pattern was discovered to be directly correlated with blood uric acid levels (\u03b2\u2009=\u20093.645). The participants in the highest quartile of plant-based dietary pattern scores were at a low risk of hyperuricemia (OR\u2009=\u20090.699; 95% CI: 0.561\u20130.870, Our research indicated that plant-based dietary pattern analyzed by PCA was negatively associated with blood uric acid concentrations, while animal-based dietary pattern was directly associated with blood uric acid concentrations. The RRR dietary pattern may have the potential to induce elevations in blood uric acid concentrations.The online version contains supplementary material available at 10.1186/s12937-022-00789-7. Hyperuricemia is a chronic metabolic disease caused by blood uric acid accumulation due to purine metabolism disorders. It is the leading cause of gout and is also related to diabetes, chronic kidney disease, cardiovascular disease, and other diseases \u20134. SeverThe data used in this work were from the baseline data of the Community Cohort Study on Specialized Nervous System Diseases (No.2017YFC0907701), which is a National Key R&D Program of China Precision Medicine Project. This study was reviewed and approved by the Institutional Review Board of the National Institute for Nutrition and Health . In this project, the study population was selected in 2018 from four Chinese provinces via the segmented cluster sampling method. Information on the general demographics, disease history, diet, and other lifestyle habits of the research population were collected via face-to-face interviews. Physical examination was performed, and blood samples were collected. In this study, a total of 6720 people, of whom 5466 were adults, from Hebei Province were recruited. A total of 611 people were excluded due to incomplete data. Finally, 4855 people were included  of each food item in the reference categories within the past 12\u00a0months. Food consumption was converted into daily food intake on a uniform basis and into g/day. In accordance with the Chinese food composition table, the 65 items were classified into 17 categories: cereals and potatoes, legumes\u00a0and their products, fresh vegetables, mushrooms and algal food, preserved and processed vegetables, fruits, poultry, meat, fish and shrimp, animal organs, processed meats, eggs, snacks and desserts, dairy products, nuts, sugary beverages, and tea or coffee ; educational level . A questionnaire was used to collect the following lifestyle-related information: smoking status (yes or no) and drinking status (yes or no). Current smokers were defined as having smoked at least one cigarette per day. Recent drinking was defined as alcohol consumption at least once in the past 1\u00a0year.Hyperuricemia was defined as serum blood uric acid concentration\u2009\u2265\u2009416.5\u00a0\u03bcmol/L in men and 357\u00a0\u03bcmol/L in women . BMI wasPROC PLS statement in SAS  was utilized to conduct RRR and PLS analyses with the definitions \u201cMETHOD\u2009=\u2009PLS\u201d or \u201cMETHOD\u2009=\u2009RRR.\u201d In the analysis, the values of blood uric acid were used as response variables, the 17 food groups were considered as predictors, and one factor was extracted from each of the two methods as the dietary pattern. Food groups with absolute factor loading value\u2009>\u20090.20 were considered to be the main contributors to a dietary pattern and included in this study. A pattern score was obtained for each participant by obtaining the total consumption of each food group weighted by factor loading. A high score indicated that the intake of food groups associated with a specific pattern was high.Data reduction techniques based on PCA, PLS, and RRR were used to identify dietary patterns involving the 17 food groups. The Kaiser\u2013Meyer\u2013Olkin measure of sampling adequacy and Bartlett\u2019s test of sphericity were used to evaluate the adequacy of correlation matrixes with the data. PCA was used to derive the major dietary patterns on the basis of the frequency of the consumption of the 17 food groups in this FFQ. Varimax was applied to maintain factorial independence and increase interpretability. Factors with eigenvalue\u2009>\u20091 were extracted, and then scree plots were used to identify the major dietary patterns. The 2\u00a0test and ANOVA were used to compare categorical and continuous variables, respectively. We estimated the associations of dietary pattern factor scores with blood uric acid concentrations by using multivariate linear regression models. Hyperuricemia status was used as the dependent variable for binary logistic regression analysis, and confounders, such as age, gender, smoking, alcohol consumption, blood pressure, and blood lipids, were adjusted. RRR and PLS analyses were performed with SAS version 9.1 . All other analyses were conducted by using SPSS software package version 22.0 for Windows . A two-tailed P\u2009<\u20090.05 was considered significant.The basic characteristics of the participants were described in accordance with the quartile of the scores for each dietary pattern (ascending from Q1 to Q4). The\u00a0data of continuous variables were expressed as mean\u2009\u00b1\u2009SD and those of categorical variables were expressed as frequencies (percentage).\u00a0\u03c7A total of 4855 participants were included in the present study. The overall prevalence of hyperuricemia was 19.3%. The prevalence of hyperuricemia among males was 22.0% and that among females was 17.3%. The demographic and clinical characteristics of the participants with and without hyperuricemia are shown in Table P\u2009<\u20090.01) showed that the correlation among variables was sufficiently strong for factor analysis. Three major dietary patterns were determined by using PCA.\u00a0The first dietary pattern was characterized by the high intake of fresh vegetables, fruits, dairy products, eggs, and legumes and their products. This pattern was designated as the plant-based pattern.\u00a0The second type featured the high intake of pickled and processed vegetables, processed meat, snacks, and mushrooms and algal food and was denoted as the processed food pattern.\u00a0The third type was characterized by the high intake of poultry, livestock, fish and shrimp, processed meats and nuts and was considered as the animal dietary pattern.\u00a0The dietary pattern obtained through RRR was distinguished by the high intake of poultry meat, sugar-sweetened beverages, animal organs, and tea or coffee, and the low intake of snacks and desserts. The dietary pattern obtained from PLS was similar to that obtained from RRR but had a higher intake of fruits and beans (Table The Kaiser\u2013Meyer\u2013Olkin index 0.753) and Bartlett\u2019s test ( and BartWe identified the characteristics of the participants on the basis of the quartile of their score for each eating pattern Table . CompareP\u2009=\u20090.007). The score for the animal dietary pattern was directly correlated with blood uric acid levels . Values were adjusted for sex, age, residence, educational status, alcohol status, smoking status, BMI, hypertension, diabetes, and dyslipidemia.The linear regression relationship between the scores for different dietary patterns and blood uric acid concentrations is shown in Table  P\u2009<\u20090.05), whereas the highest quartile of animal diet pattern scores was associated with a high risk of hyperuricemia . For the RRR dietary pattern, the ratio of Q3 to Q1 was statistically significant  (Table In logistic regression analysis, the highest quartile of plant-based dietary pattern scores was associated with a low risk of hyperuricemia (OR\u2009=\u20090.699; 95% CI: 0.561\u20130.870,In the present study, the relationship between Chinese dietary patterns and serum uric acid was investigated by using three statistical methods, namely, PCA, RRR and PLS. The plant-based dietary pattern determined by PCA was negatively correlated with serum uric acid, whereas the animal-based dietary pattern was directly correlated with serum uric acid. Although no significant association was found between RRR and PLS dietary patterns and serum uric acid concentrations, the RRR dietary pattern may be a potential risk factor for hyperuricemia.6, and vitamin B12 may have important functions in reducing blood uric acid concentrations. Vitamin C may regulate blood uric acid concentration via its uricosuric effect. Increasing the concentration of vitamin C may competitively inhibit the reabsorption of uric acid given that vitamin C and uric acid are reabsorbed through anion exchange transport in proximal tubules [Similar to the Mediterranean and DASH diets, the plant food dietary pattern is characterized by the intake of large quantities of fresh vegetables, fruits, beans, dairy products, and eggs. Two studies have shown that the Mediterranean and DASH diets are associated with the low risk of hyperuricemia , 27. Veg tubules . Folate  tubules . Studies tubules . Soy bea tubules .Consistent with previous studies, this work found that the animal food dietary pattern is directly associated with uric acid concentration and hyperuricemia risk. This association can be ascribed to the following aspects: First, considering that animal foods are normally high in purine, the high intake and accumulation of purine increase uric acid . At sameThe processed food diet pattern is not mentioned in previous reports. With the development of the economy and the increase in social pressure, the number of people who may prefer the processed food dietary pattern is increasing because processed foods are convenient to eat and have long storage times. This situation may encourage the development of a new dietary pattern. In the present study, we found no significant association between the processed food diet pattern and hyperuricemia. However, previous studies have reported that the consumption of processed food is associated with the increased risk of cardiovascular disease , 34. TheThe potential interactions between different food ingredients remain worthy of in-depth study. Although our results did not reveal significant associations between serum uric acid levels and RRR dietary patterns, we speculated that the low intake of snacks and desserts in the RRR dietary pattern may offset the effect of meat on serum uric acid concentrations. After adjustment for confounding factors, we found that for the RRR dietary pattern, scores in the third quartile were directly correlated with hyperuricemia compared to scores in the first quartile. Therefore, we speculated that the RRR dietary pattern may have a potential positive correlation with blood uric acid concentration and hyperuricemia. Although the PLS and RRR dietary patterns have high intakes of animal foods, such as animal organs and poultry, vegetable and bean intake was higher in the PLS dietary pattern than in the RRR dietary pattern. The complex nature of this pattern may explain this finding to some extent. Although the high intake of animal food increases blood uric acid concentration, the intake of large quantities of vegetables and fruits accelerates the metabolism of blood uric acid. The potential interactions between different foods and nutrients have promoted these results.To summarize, we discussed the relationship between several dietary patterns and blood uric acid concentration. Although blood uric acid may induce oxidative stress, atherosclerosis, vascular inflammation, and other tissue damage, it also has protective roles by acting as an antioxidant that scavenges free radicals and reducing the permeability of the blood\u2013brain barrier \u201339. We sThe present study has some limitations. First of all, it is a cross-sectional survey. Therefore, the judgment of causality is limited. Further prospective longitudinal studies are needed to prove causality. Second, we obtained the data on dietary intakes on the basis of the memory of the participants. Such data may have some deviation from the actual intake. Finally, this study did not include the intake of dietary supplements by the participants.The plant-based dietary pattern established by PCA was negatively correlated with serum uric acid concentrations, whereas the animal dietary pattern was directly correlated with serum uric acid concentrations. Although the RRR dietary pattern did not show a linear relationship with uric acid concentrations, it does have the potential for inducing increased serum uric acid concentrations. The PLS dietary pattern was more balanced than other patterns and had no relationship with uric acid concentrations. Further longitudinal studies are needed, and dietary uric acid must be maintained within a reasonable range.Additional file 1.\u00a0Sensitivity analysis."}
+{"text": "A Pb-free PSC device (FTO/TiO2/NH3(CH2)2NH3MnCl4/spiro-OMeTAD/Au) was simulated via SCAPS-1D software. The simulated Pb-free PSCs (FTO/TiO2/NH3(CH2)2NH3MnCl4/spiro-OMeTAD/Au) showed decent power conversion efficiency (PCE) of 20.19%. Further, the impact of the thickness of absorber (NH3(CH2)2NH3MnCl4), electron transport (TiO2), and hole-transport (spiro-OMeTAD) layers were also investigated. Subsequently, various electron transport layers (ETLs) were also introduced to investigate the role of ETL. In further studies, an NH3(CH2)2NH3MnCl4-based PSC device (FTO/TiO2/NH3(CH2)2NH3MnCl4/spiro-OMeTAD/Au) was also developed (humidity = ~30\u201340%). The fabricated PSCs displayed an open circuit voltage (Voc) of 510 mV with a PCE of 0.12%.Recently, the design and fabrication of lead (Pb)-free perovskite or perovskite-like materials have received great interest for the development of perovskite solar cells (PSCs). Manganese (Mn) is a less toxic element, which may be an alternative to Pb. In this work, we explored the role of NH Mixed halide (NH4)3Sb2I3Br6 was used by Zuo et al. [3(CH2)2NH3MnCl4 as an absorber layer, which exhibited decent photovoltaic performance, as listed in 3(CH2)2NH3MnCl-based fabricated PSC device is poor (0.12%) but showed a decent Voc. The absorber layer should have a low band gap for better light absorption. Although NH3(CH2)2NH3MnCl4 has a good optical band gap, we believe that the poor PCE and Jsc of the NH3(CH2)2NH3MnCl4-based fabricated PSC device may be attributed to the poor morphological characteristics and fast crystallization process. The rapid crystallization of perovskite films has been a major concern in developing high-performance photovoltaic devices. The preparation of pin-hole-free and high-quality thin films with large grain boundaries is of great importance for the construction of highly efficient PSC devices. Previously, two-step deposition methods or anti-solvents such as chlorobenzene have been used for the preparation of high-quality thin films of perovskite materials. Some new preparation methods need to be developed to exert tight control on the crystallization process. It is also important to study the mechanism of thin film formation, charge-separation/recombination at interfaces/grain boundaries to further improve the performance of NH3(CH2)2NH3MnCl4-based PSCs. We believe that, if systematic investigations are implemented, significant improvements in the performance of the NH3(CH2)2NH3MnCl4-based PSCs can be seen in the near future. Previously, many research groups have developed Pb-free PSCs using different light absorbers. In 2015, Park et al.  developea et al.  used a cn et al. , and then et al.  reportedabsorber . Thind eabsorber  utilizedo et al. , and the2, ZnO, SnO2, TiO2, ZnSe, and WO3) were employed, and ZnSe-based PSCs showed the highest efficiency, which may be due to the high electron-hole mobility and suitable energy level values of ZnSe. Furthermore, NH3(CH2)2NH3MnCl4 was prepared, and its optical band gap was found to be 1.81 eV, which is suitable for a light absorber layer. Further, PSCs were fabricated, and the developed device exhibited a good Voc of 510 mV with a poor PCE of 0.12%. We believe this PCE may be further enhanced in the future by using/introducing some new device architectures or fabrication methods.Finally, it can be summarized that highly efficient Pb-free PSCs have been simulated via SCAPS-1D. Further, we optimized the thickness of electron, absorber, and hole transport material layers. The numerically simulated PSCs exhibited good efficiency of 20.30% via SCAPS-1D. Various electron transport layers (WS"}
+{"text": "FH cells control IgE synthesis by secreting IL-4 to allergen-specific B cells. IL-5 promotes eosinophil inflammation, while IL-13 and IL-4 are involved in goblet cell metaplasia and bronchial hyperresponsiveness. Currently, \u201cType-2 low\u201d asthma is defined as asthma with low levels of T2 biomarkers due to the lack of reliable biomarkers, which is associated with other Th cells. Th1 and Th17 are capable of producing cytokines that recruit neutrophils, such as IFN-\u03b3 and IL-17, to participate in the development of \u201cType-2-low\u201d asthma. Precision medicine targeting Th cells and related cytokines is essential in the management of asthma aiming at the more appropriate patient selection and better treatment response. In this review, we sort out the pathogenesis of Th cells in asthma and summarize the therapeutic approaches involved as well as potential research directions.Prosperous advances in understanding the cellular and molecular mechanisms of chronic inflammation and airway remodeling in asthma have been made over the past several decades. Asthma is a chronic inflammatory disease of the airways characterized by reversible airway obstruction that is self-resolving or remits with treatment. Around half of asthma patients are \u201cType-2-high\u201d asthma with overexpression of type 2 inflammatory pathways and elevated type 2 cytokines. When stimulated by allergens, airway epithelial cells secrete IL-25, IL-33, and TSLP to derive a Th2 immune response. First ILC2 followed by Th2 cells produces a series of cytokines such as IL-4, IL-5, and IL-13. T With inFH), Th17, and Th1 cells. Activation of Th2-pathways is at the core of type 2 inflammation, producing excessive amounts of the cytokines IL-4, IL-5, and IL-13. IL-5 induce eosinophil activation, maturation, and recruitment, while IL-4 and IL-13 are involved in goblet cell metaplasia, airway smooth muscle(ASM) contractility, and airway hyperresponsiveness(AHR)  . TFH celructures , 9. Accuructures . Th1 celructures . Some otructures , 13. HowCurrently, conventional asthma medications include bronchodilators and glucocorticoids. They focus on symptom control, are not curative, and are often ineffective in severe cases. Th cells remain at the forefront of asthma pathogenesis due to chronic airway inflammation and airway remodeling Figure\u00a0222.1Epithelial cytokines play a role as \u201cwhistle-blowers\u201d in developing allergic responses at barrier surfaces and are involved in the pathogenesis of type 2 inflammatory diseases, typically asthma. The release of these \u201calarmins\u201d, including IL-25, IL-33, and thymic stromal lymphopoietin (TSLP), occurs when the allergen stimulates bronchial epithelial cells . AlthougTSLP is considered to be a primary regulator of type 2 immune response to the respiratory barrier, which activates Th2 cells, innate lymphoid cells (ILCs)-2, mast cells, and other immune cells by inducing costimulatory molecules on DCs . AccumulIn addition, interactions between cytokines released by Th cells or other cells and AECs contribute to the progression of asthma. While higher levels of activin-A expressed by AECs may promote an increase in Th2 and Th9 cells , upregul2.2Th2-driven adaptive immune response and ILC2s-driven innate immune response are currently regarded as two independent but linked pathogenic mechanisms of asthma, both of which produce type 2 cytokines . ILC2s pin vitro for about 48 hours, however, IL-5 can prolong the survival time of eosinophils ) controls eosinophils\u2019 maturation, differentiation, and release . In the 2+ mobilization that was accompanied by increased mRNA expression of histamine H1 and cysteinyl leukotriene CysLT1 receptors, inducing glucocorticoid-insensitive AHR in isolated human small airways  expression on human endothelial cells and are involved in collagen production in fibroblasts . In addi airways . Further airways , 52.2.3FH cells, rather than Th2 cells, drive IgE responses in asthma. Using house dust mites (HDM) and mice, Le\u00f3n and her colleagues found that after the first sensitizing exposure, TFH cells reside in the draining mediastinal lymph nodes of the lungs and differentiate into Th2 and migrate to the lungs to exert their effects after a second attack by HDM allergens  was elevated in allergic asthma, with increased production of IL-4, and IL-21, and positively correlated with total IgE in the blood  or biomarker restrictions. In phase 2 and 3 clinical trials, including patients with severe asthma, Tezepelumab (subcutaneous injection) consistently and significantly reduced acute asthma exacerbations regardless of key biomarkers , 65. In Clinical trials with anti-IL-25 antibodies have not been conducted, but anti-IL-33 has obtained prospective results in a few trials. Itepekimab, a monoclonal antibody targeting IL-33, causes a reduction in blood eosinophils with a long-lasting effect in patients with moderate asthma . Results3.23.2.1Based on accumulating evidence implicating IL-4, IL-5, and IL-13 are responsible for the occurrence and development of asthma. Several clinical trials targeting type 2 cytokines are currently underway, and some of the relevant biologics have been approved for the treatment of severe asthma. Mepolizumab, Reslizumab (anti-IL-5 mAb), and Benralizumab (anti-IL-5R mAb) were FDA-approved to treat patients with severe eosinophilic asthma . Several3.2.21 and asthma symptom control, with greater efficacy observed in patients with elevated type 2 inflammatory biomarkers at baseline , Lavolta I enrolled 2,000 patients with severe asthma and showed that lebrikizumab significantly reduced acute asthma exacerbations and also improved lung function in patients, yet similar results were not obtained in Lavolta II . A phasebaseline . In addibaseline . The lonbaseline .3.2.3s  was effective in reducing asthma exacerbations and hospitalizations . Evidencs .3.2.4IL-9-targeted therapy may offer a new approach to treating patients with asthma, but clinical studies are not well underway. In two randomized phase 2a studies in asthmatic subjects, patients who received MEDI-528, a humanized anti-IL-9 monoclonal antibody, showed a slight improvement in symptoms without a change in lung function . Another44.1Th1 inflammation is mainly characterized by an increase in Th1 cells and infiltration of signature cytokines including IFN-\u03b3 and TNF-\u03b1. Because of the inhibition Th2 inflammatory response, Th1 is considered to have an inhibitory effect on asthmatic airway inflammation in early investigations. Several studies have shown that IFN-\u03b3 inhibits Th2 cell function to attenuate the inflammatory response in asthma . Further+CD4+ T cells were concentrated in the BALF of adult patients with severe asthma and that Th1 airway inflammation was evident in children with allergic and non-allergic severe asthma  mAb, was used in two patients with recurrent acute exacerbations of asthma, both of whom showed a good clinical response and reduced hospital admissions . ClazakiIL-23 is a pro-inflammatory cytokine regulated in Th17 and targeting IL-23 may be particularly beneficial in neutrophilic asthma. In a randomized, double-blind, placebo-controlled phase 2a study, IL-23 p19 inhibitor, Risankizumab was used in adult patients with severe asthma. However, disappointingly the study did not meet the primary endpoint. time to first asthma worsening was shorter in the risankizumab group than in the placebo group, and the annualized rate of asthma worsening was higher in the risankizumab group than in the placebo group. Lung function, ACQ-5 scores, and the incidence of severe asthma exacerbations were similar in both groups .5.31, or short-acting \u03b22-agonist (SABA) use  for the duration of the study, and inhaled glucocorticoids were available. At week 12, Brodalumab did not produce any statistically significant benefit in terms of ACQ scores, FEVABA) use . BITS720ABA) use . SecukinABA) use . Althoug5.4The current focus of asthma treatment remains on pharmacotherapy, and the main drugs can be divided into bronchodilators such as SABA which provide rapid symptomatic relief by relaxing ASM and control drugs that inhibit inflammation represented by inhaled corticosteroids (ICS) . In the AIT is the only disease-modifying and potentially preventive asthma treatment based on repeated injections or sublingual administration of specific allergens to allergic individuals to induce immune tolerance . The mec6FH cells control IgE synthesis by secreting IL-4 to allergen-specific B cells. Epithelial-derived TLPS, IL-25, and IL-33 can awaken ILC2 and Th2, while IL-4, IL-5, and IL-13 play a central role in the subsequent series of transformations. In the past few years, significant advances in Th17 and Th1 cell research have revealed new aspects of the \u201cType-2 low\u201d asthma cellular machinery. Th1 and Th17-related cytokines act as central effector mediators and continuity factors in airway inflammatory storms and airway injury.Complex interactions between cellular participants and the innate and adaptive immune systems in response to multiple allergenic stimuli coordinate the immune response in the lung. In Type-2 high asthma, TAt present, the efficacy and safety of various biologics for Th2 responses have been well evaluated. Several biologics have been approved by the FDA for the treatment of \u201cType 2 high\u201d asthma, such as benralizumab, dupilumab, and mepolizumab. They have demonstrated favorable results in clinical trials and real-world studies on reducing exacerbations, improving quality of life and lung function in patients with severe asthma, and even reducing OCS doses. However, various biologics for Th1 and Th17 are still struggling to move forward. Two biological agents (Tezepelumab and Astegolimab) have shown partial effects on \u201cType-2 low\u201d asthma by blocking epithelial cell cytokines. More in-depth study of the pathological mechanism and the selection of the appropriate patient population based on the corresponding clinical indicators may bring about a turnaround. There is no silver bullet in asthma treatment. Asthma treatment may be individualized in the future. Perhaps more in-depth research on Th cells and big data analysis to match different clinical manifestations of asthma with specific Th cells for targeted and individualized treatment will be the new direction in the future.TJ, access to literatures and writing of the manuscript. HL, revising the manuscript. Both authors contributed to the article and approved the submitted version."}
+{"text": "Asthma and chronic rhinosinusitis with nasal polyps (CRSwNP) or without (CRSsNP) are chronic respiratory diseases. These two disorders often co-exist based on common anatomical, immunological, histopathological, and pathophysiological basis. Usually, asthma with comorbid CRSwNP is driven by type 2 (T2) inflammation which predisposes to more severe, often intractable, disease.In the past two decades, innovative technologies and detection techniques in combination with newly introduced targeted therapies helped shape our understanding of the immunological pathways underlying inflammatory airway diseases and to further identify several distinct clinical and inflammatory subsets to enhance the development of more effective personalized treatments. Presently, a number of targeted biologics has shown clinical efficacy in patients with refractory T2 airway inflammation, including anti-IgE , anti-IL-5 /anti-IL5R , anti-IL-4R-\u03b1 , and anti-TSLP (tezepelumab). In non-type-2 endotypes, no targeted biologics have consistently shown clinical efficacy so far. Presently, multiple therapeutical targets are being explored including cytokines, membrane molecules and intracellular signalling pathways to further expand current treatment options for severe asthma with and without comorbid CRSwNP. In this review, we discuss existing biologics, those under development and share some views on new horizons. Asthma is a chronic respiratory disease, that is often associated with allergy and/or upper airway involvement and/or other conditions outside of the respiratory tract, such as food allergy and atopic dermatitis ,2. The hIn the past two decades, our knowledge of the multifaceted nature of asthma and the link to chronic rhinosinusitis has vastly increased ,9. So faType 2 (T2) asthma is presently the best defined endotype, which makes up approximately 50\u201360% of the asthma population ,12. WhilThe definition of non-T2 asthma seems more complex than the one of T2-asthma given the vast heterogeneity of its underlying mechanisms, varying from predominant inflammatory pathways (e.g. airway neutrophilia in the absence of respiratory infections) to the lack of eosinophilic or other inflammation (as in paucigranulocytic asthma), or predominant airway smooth muscle (ASM) dysfunction (characterised by fixed airway narrowing and severe AHR) ,25. PathIn this review, we provide an overview of existing and emerging treatment options for asthma and comorbid CRSwNP, targeting the underlying inflammatory pathways, and discuss our current knowledge and future perspectives.Asthma and chronic rhinosinusitis (CRS) represent frequently occurring, often coexisting diseases, located at the ultimate ends of the respiratory tract and interrelated through joint underlying mechanisms which respond to targeted biologics . Both coIn the late 1940s, asthma was already identified as a heterogeneous condition and since then a plethora of studies has added accumulating evidence on the stratification of asthmatic patients into different clinical phenotypes and later on, based on the predominant inflammatory sputum cell profile, into inflammatory phenotypes .In the 2000s, asthma was further subcategorised into two major endotypes: Th2 and non-Th2 asthma, based on the presence or absence of (i) CD4+ T-helper cell type 2 (Th2)-driven inflammatory responses , or Th17-driven responses , (ii) IgE, and (iii) increased levels of eosinophils, neutrophils, basophils, and mast cells in the airways . More reIn T2 asthma, the presence of copious amounts of type 2 cytokines at mucosal sites, as well as intrinsic down-regulation of the expression of claudin-18 and E-cadherins, are linked to the reduced structural integrity of the airway epithelium and the enhanced permeability and responsiveness of the epithelial barrier to exogenous triggers . ConsequIn contrast with T2 eosinophilic non-atopic asthma which usually manifests at a later age (late-onset), the allergic subset of T2 asthma usually presents at a young age (early-onset). This subtype is characterized by positive allergy skin tests, increased serum total and specific IgE and clinical symptoms upon allergen exposure. Notwithstanding, little is known about the precise roles of cells from the innate and adaptive immune compartments specifically in early-onset allergic asthma as compared with other subsets of T2 non-atopic asthma . In alleEosinophils, due to their pleiotropic effect on various cell types, are perhaps the most recognized cells in the pathophysiology of T2 asthma. Eosinophils are found at inflamed mucosal sites and upon activation they are capable of producing and releasing numerous pro-inflammatory mediators, including IL-5, IL-13, eotaxins, cysteinyl leukotrienes , major basic protein (MBP), eosinophil peroxidase (EPX), eosinophil cationic protein (ECP), and eosinophil-derived neurotoxin (EDN) . EosinopIn children, the eosinophilic phenotype is commonly present which is associated with early-onset disease with atopy, impaired lung function and increased airway hyperresponsiveness .Non-T2 asthma  is a heterogeneous condition which may comprise several underlying mechanisms including the influx of CD4+ type 1 T helper (Th1) and type 17 T helper (Th17) cells, type 1 and type 3 innate lymphoid cells (ILC1 and ILC3 respectively), neutrophils as well as increased levels of pro-inflammatory mediators in the lung tissues, among others including IL-1\u00df, IL-6, IL-8, IL-17A/F, IL-22, IFN-\u03b3, and TNF-\u03b1. Studies point out that an imbalance in Th17/Treg cells may play a role in corticosteroid-resistant neutrophilic asthma ,65. In aCRS is a common chronic inflammatory disorder of the upper airways with an estimated prevalence of approximately 10\u201315% in the general adult population ,67. CRS Based on endoscopic or imaging findings, CRS comprises two major clinical phenotypes, i.e., with (CRSwNP) or without (CRSsNP) nasal polyps (NP); the latter being approximately twice as prevalent. Although less prevalent, CRSwNP is the most cumbersome phenotype which often coexists in patients with more severe asthma ,72,73. IAn additional clinical subset of CRSwNP and late-onset T2 asthma includes aspirin-exacerbated respiratory disease (AERD) or nonsteroidal anti-inflammatory drugs (NSAIDs) exacerbated respiratory disease (NSAID-ERD). As part of the previously termed \u2018Samter's triad\u2019, patients with AERD/NSAID-ERD present with asthma and concomitant CRSwNP with often intractable disease ,74,75. TApart from the aforementioned \u2018traditional\u2019 classification, CRS phenotypes are highly heterogeneous and show a substantial geographical with racial variability across inflammatory profiles. For example, in Caucasian populations, CRSwNP most frequently presents with a type 2 inflammatory (eosinophilic) profile, while in Asian populations mixed inflammatory profiles in both CRS clinical phenotypes have been found ,77. ThisBased on increased levels of inflammatory proteins and cytokine profiles, CRS (with and without NP) comprises three different endotypes, i.e., T1 characterised by type1 cytokines IFN-\u03b3 and TGF-\u03b2, T2 by type2 proteins and cytokines IgE and IL-4, IL-5, and IL-13, and T3 by Th17 cytokine IL-17A ,80,81.In T2 CRSwNP, eosinophils usually make up the predominant inflammatory cells , while IWhile NP are commonly found in adults, they are rare in children under the age of 10 years. Furthermore, the presence of NP in children usually indicates underlying systemic diseases, such as cystic fibrosis, primary ciliary dyskinesia or immunodeficiencies. The association with asthma and other allergic/eosinophilic comorbidities is not as clearly expressed in children .Structural changes including epithelial abnormalities, subepithelial matrix deposition, ASM cell alterations and mucus hyperproduction contribute to airway remodelling in asthma resulting in small airways disease, non-specific AHR and accelerated lung function decline leading to fixed airflow obstruction . Recent Airway epithelial cells are capable of producing large amounts of cytokines, antimicrobial peptides and multiple proteases, and thus, contribute to the creation of a physical barrier restraining both pathogens and allergens ,93. AirwUnder specific conditions, such as allergen-mediated epithelial damage, airway epithelial cells lose their protective function, become highly pro-inflammatory and, by promoting airway remodelling, they become crucial players in asthma pathophysiology . EpithelFurthermore, IL-4 and IL-13 released from ILC2s and Th2 cells directly stimulate airway epithelial cells and induce mucus overproduction ,102. DynDCs act as antigen presenting cells (APCs) but their actions can vary according to their phenotype . MyeloidAnother crucial component of airway remodelling represents ASM abnormalities (hypertrophy and hyperplasia) . StructuLung function is also regulated by a network of afferent and efferent nerves . Airway Dysregulation of the DC-epithelium interactions also represents a crucial aspect in CRSwNP pathophysiology . In CRSwUntil recently, no truly disease-modifying therapies existed for asthma and/or CRSwNP. However, in terms of airway remodelling, a study including mild asthmatics receiving only SABA showed that three infusions with anti- IL-5 monoclonal antibody mepolizumab reduced the expression of extracellular matrix proteins  in the bronchial basement membrane. It also reduced TGF-\u03b21 level in BAL fluid and TGF-\u03b21 mRNA expression in eosinophils . Early iSeveral triggers and external factors  can directly or indirectly interfere with our immune system. In this complex interplay, it has become evident that the microbiome plays an important regulatory or even \u2018disease driving or modulating\u2019 role . For insn = 7115 adults; follow-up over 15 years) using metagenomic sequencing of stool samples [Escherichia, Enterococcus, Clostridium, Veillonella, and Bacteroides fragilis was found to be associated with a higher incidence of asthma over time [Staphylococcus aureus colonization may contribute to its pathogenesis [An increasing number of studies support the existence of the gut-lung axis and the role of gut microbiome alteration in the pathogenesis of chronic inflammatory diseases including asthma and COPD. Only recently, this association has been underscored by data from a large prospective population-based study  may be beneficial components of asthma management and several studies with tailored approaches are currently ongoing in different patient populations . In thisThe role of the microbiome in health and disease as well as the effects of new and existing therapeutic modalities, including the long-term application of corticosteroids and biologics, on the composition of the microbiome in the context of disease control and remission is a new area of exploration with the potential to further shape personalized medicine.Clinically applicable biomarkers help clinicians to define inflammatory asthma phenotypes and to identify responders to (biologic) treatments ,137. SimIn a cohort of patients with severe asthma, the sinonasal mucosal thickness was correlated with levels of systemic (blood eosinophils) and lower airways  type 2 biomarkers, indicative of more severe disease . There iPresently, several T2-biologic treatment options exist, blocking the following targets: IgE, IL-5 and IL-5R, IL-4R, and TSLP. A short outline per biologic is provided underneath including the mechanism of action and clinical effectiveness , Figure2Omalizumab, a recombinant humanized anti-IgE monoclonal antibody, was the first biologic drug aimed at uncontrolled severe allergic asthma, which effectively reduced severe asthma exacerbations, improved asthma symptoms and lung function, and decreased the use of inhaled glucocorticosteroids with a long established , favourable safety profile. It is approved for patients with allergic asthma older than 6 years . In addiex vivo [NCT03758716) and allergic asthma (NCT05008965) without any published data, yet.Based on the success of this approach, new monoclonal antibodies targeting different epitopes on the IgE molecule emerged. Ligelizumab, a high-affinity IgG1kappa humanized anti-IgE monoclonal antibody was shown to be very potent in IgE binding to the Fc\u03b5RI, but failed to significantly improve asthma control and exacerbation rates in severe asthma, possibly because of its faster clearance as compared to omalizumab . Quilizuex vivo . This anex vivo . A new hThe relevance of IL-4 and IL-13 in the pathophysiology of asthma has been extensively addressed throughout various studies and reports ,189. BotFollowing a positive phase IIb study , a phaseAnother therapeutic agent targeting both IL-4 and IL-13, pitrakinra, a dual IL-4/IL-13 antagonist, reduced asthma exacerbations only in a subgroup of patients with specific gene polymorphisms of IL-4 receptor .Targeted drugs aiming for selective inhibition of IL-13 include lebrikizumab, tralokinumab, anrukinzumab, decrecumab, GSK679586, and ASLAN 004. Out of these agents, only lebrikizumab and tralokinumab have reached phase 3 clinical trials so far. Lebrikizumab, a humanized monoclonal antibody targeting IL-13, was previously shown to improve asthma symptoms particularly in patients with a high serum IgE level, high blood eosinophil counts, and an increased expression of interleukin-13\u2013related genes in the lung . HoweverAmong selective IL-4 inhibitors, pascolizumab, AMG-317 and VAK694, were those to reach phase 2 of clinical development. Pascolizumab and VAK694 are monoclonal antibodies neutralizing IL-4 while AMG 317 is an IL-4 receptor antagonist . AlthougTargeting IL-5 has become a well-established therapy for patients with uncontrolled severe asthma caused predominantly by T2 inflammation with eosinophilia . MepolizNCT04719832).Similar to mepolizumab, reslizumab targets IL-5 and blocks the subsequent recruitment and activation of eosinophils. In clinical trials, reslizumab was associated with reduction in exacerbations, improvements in lung function, and quality of life ,224. TheBronchial epithelium derived cytokines, also called alarmins, include thymic stromal lymphopoietin (TSLP), IL-33, and IL-25, regulate the differentiation of ILC2 and Th2 lymphocytes  and reprNCT04410523). An alternative approach to block TSLP is targeting its receptor. A fully human monoclonal antibody against TSLP receptor (TLPR), ASP7266, is currently being evaluated in pre-clinical studies and in a monkey experimental model completely inhibited induced allergic skin reactions [Another anti-TSLP drug, CSJ117, a neutralizing antibody fragment, is currently being tested in an inhaled formulation in patients with severe uncontrolled asthma (eactions .NCT05166889). Similarly for IL-25, no data regarding blocking monoclonal antibody, ABM125, have been published, yet. No significant improvement in asthma exacerbations or in lung function were observed with humanized anti-IL-9 monoclonal antibody enokizumab [IL-33 is a member of IL-1 cytokine family potentiating both Th1 and Th2 responses . IL-33 dokizumab .Although initial studies with fevipiprant, an oral antagonist of chemoattractant receptor-homologous molecule on T-helper type-2 cells (CRTH2) serving as a receptor of prostaglandin D2, showed promising efficacy in patients with allergic asthma , the phaInhibition of CCR3 receptor for eotaxin, a chemokine attracting eosinophils, by specific inhibitor GW766994 failed to reduce blood or sputum eosinophilia and to improve lung function in patients with asthma .Nemolizumab, a humanized monoclonal antibody against IL-31 receptor markedly reduced pruritus in patients with atopic dermatitis  and down1 monoclonal antibody targeting an anti\u2013sialic acid\u2013binding immunoglobulin-like lectin 8 (Siglec-8) expressed by eosinophils and mast cells has been tested in a Phase 2 study in antihistamine-refractory patients with chronic urticaria leading to improved disease control [NCT04322708) and duodenitis (NCT04856891).Lirentelimab (AK002), a humanized, nonfucosylated IgG control . There aCompared to T2-biologic therapies, with anti-IgE and anti-IL-5 therapies globally used to treat severe allergic and eosinophilic asthma (+/- CRS), respectively, and with IL-4/13R inhibition being highly effective in atopic dermatitis, CRSwNP +/- severe asthma, targeting non-T2 mechanisms with monoclonal antibodies or inhibitors has been much less explored as well as less successful, so far.Different approaches have been tested to either down-regulate recruitment of neutrophils to the airways, or inhibit cytokines associated with Th1/Th17 inflammation. CXCR1 and CXCR2 receptors for chemokines attracting preferentially neutrophils, particularly CXCL8/IL-8, CXCL3/Gro\u03b1 or CXCL5/ENA-78, seemed to be natural targets to reduce recruitment of these cells. Treatment with AZD5069, a CXCR2 antagonist, failed to reduce exacerbation rates in patients with uncontrolled persistent asthma  despite NCT01478360) was terminated requiring changes in study design and human anti-IL-17RA antibody brodalumab failed to show clinical efficacy in severe asthma [A study with humanized anti-IL-17 monoclonal antibody, secukinumab, in asthmatics  was recently stopped by COVID-19 pandemic . Regarding other options for IL-1 blocking, a clinical study with bermekimab, an anti-IL-1\u03b1 monoclonal antibody in patients with atopic dermatitis (NCT04990440) has been terminated due to low efficacy.IL-1 is another important pro-inflammatory cytokine with a potential role in bronchial asthma . AnakinrPro-inflammatory effects of IL-6 may be inhibited by a humanized monoclonal antibody against IL-6 receptor, tocilizumab, which failed to show protection against allergen-induced bronchoconstriction in asthmatic subjects .More recently, blocking of IL-22 by the human monoclonal antibody fezakinumab affected transcription of multiple genes associated with severe neutrophilic asthma and atopic dermatitis . In a raNCT04728711). Furthermore, MTPS9579A, a monoclonal antibody inhibiting tryptase activity by its dissociation from active tetramers into inactive monomers showed a favourable safety profile [Among new drugs targeting inflammatory mediators, a clinical study with the inhibitor of reactive aldehyde species, ADX-629, is currently recruiting patients with mild asthma  which regulates their proliferation and migration, with induction of multiple asthma-associated proteins and driving of the airway hyperreactivity in a murine model of asthma .Selective inhibitor of NLRP3, OLT1177\u00ae (dapansutrile), down-regulated T2 and pro-inflammatory cytokines, caspase-1 activity, reduced lung inflammatory cells and airway hyperreactivity in a model of ovalbumin-induced asthma .Poly (ADP-ribose) polymerase (PARP) is involved in the regulation of multiple genes involved in the pathogenesis of bronchial asthma including lung expression of VCAM-1  and in aAnother approach to targeting immune cell communication is to either block or engage with their membrane molecules. CD200R engagement with CD200-Fc reduced activation, proliferation and production of type 2 cytokines in isolated lung ILC2s and downregulated airway hyperreactivity in a humanized mouse model .Dual inhibition of OX40L and CD30L reduced eosinophilic inflammation and inhibited effector memory Th2 lymphocytes expansion in house dust mite challenged mice .In addition to the already mentioned receptor for PGD2, CRTH2, there are multiple other eicosanoid receptors studied as potential targets of asthma therapy as reviewed recently ,279.Inhibition of purinergic receptors regulating the release of alarmins HMGB and IL-33 can attenuate experimental asthma onset and reduce the severity of a rhinovirus-induced asthma exacerbation .Intranasal administration of standardized bacterial lysate OM-85 protected against experimental allergic asthma by multiple mechanisms including effects on airway epithelial cells, regulation of IL-33 and type 2 responses, and by DC tolerogenic reprogramming .In experimental models, inhibitors of phosphoinositide-3-kinase (PI3K) and specifically PI3K-\u0394 were found to decrease total IgE, and T2 cytokines IL-4, IL-5, and IL-13 together with down-regulation of proinflammatory cytokines TNF-\u03b1 and IL-1\u03b2 while having no effect on IL-6 . A dual To target anaphylaxis, the fast acting IgE inhibitors based on designed ankyrin repeat protein (DARPin) scaffolds were engineered to neutralize free IgE, dissociate preformed IgE/Fc\u03b5RI complexes and actively remove prebound IgE from Fc\u03b5RI on blood basophils .In the future, using of microRNAs (miRNAs) inhibiting translation and upregulating mRNA degradation may be an alternative approach to target specific cells or cytokines involved in allergic inflammation . IntraceAsthma affects over 350 million people globally, and a substantial proportion of this population has concomitant CRS. While many patients can reach a satisfactory disease control with standard therapies , many others remain uncontrolled with an increased risk for severe exacerbations and accelerated lung function decline  or requiAn expanding number of biologics targeting T2 asthma (+/- comorbid CRSwNP) has already entered clinical practice showing clinical effectiveness in distinct (partly overlapping) inflammatory phenotypes/endotypes: anti-IgE , anti-IL5 /anti-IL5R , anti-IL4R\u03b1 , and only recently anti-alarmin TSLP (tezepelumab) . HoweverApart from offering targeted treatment options and preventing toxic effects associated with corticosteroid-overuse, these new molecules further helped to unravel underlying mechanisms and to define disease subsets. Based on their respective mechanisms of action, some biologics may achieve disease remission  and evenSo far, no biologic therapies have shown consistent clinical benefits in non-T2 asthma, although the lack of a (sputum) inflammatory signature may present a significant bias in patients well-controlled by ICS with or without targeted treatments . Hence,"}
+{"text": "The role of type 2 inflammation has been progressively associated with many diseases, including severe asthma, atopic dermatitis, nasal polyposis, eosinophilic granulomatosis with polyangiitis, and, recently, eosinophilic esophagitis. Despite this, the association between asthma and esophagitis is still poorly known, and this is probably because of the low prevalence of each disease and the even lower association between them. Nonetheless, observations in clinical trials and, subsequently, in real life, have allowed researchers to observe how drugs acting on type 2 inflammation, initially developed and marketed for severe asthma, could be effective also in treating eosinophilic esophagitis. For this reason, clinical trials specifically designed for the use of drugs targeted to type 2 inflammation were also developed for eosinophilic esophagitis. The results of clinical trials are presently promising and envisage the use of biologicals that are also likely to be employed in the field of gastroenterology in the near future. This review focuses on the use of biologicals for type 2 inflammation in cases of combined severe asthma and eosinophilic esophagitis. Type 2 (T2) inflammation was identified as a pathogenic phenomenon underlying various diseases, such as asthma, nasal polyposis, and atopic dermatitis. The eosinophilic inflammatory infiltrate, which is typical of T2 inflammation, has been demonstrated to be present in other diseases, including eosinophilic esophagitis (EoE). Asthma is a well-known disease, characterized by chronic airway inflammation and bronchial hyperresponsiveness, resulting in airflow limitation and respiratory symptoms. In the pathogenesis of asthma, interactions between genetic predisposition, environmental factors, and immune dysregulation play a role in the genesis of disease. The hallmark of asthma is chronic airway inflammation, primarily driven by type 2 (T2) immune responses. This immune activation results in the recruitment of eosinophils, mast cells, IgE, and other inflammatory cells to the airways, leading to structural changes and remodeling, increased mucus production, and bronchospasm. Several cytokines, including interleukin (IL)-4, IL-5, IL-13, IL-25, and IL-33, thymic stromal lymphopoietin (TSLP), and cells such as innate lymphoid cells type 2 (ILC2s), play crucial roles in orchestrating the inflammatory response in asthma. Among the cells responsible for inflammation that are regulated by the inflammatory pathway related to the cytokines earlier mentioned, are eosinophils. These cells are increased in both the blood and airway tissues of asthma patients and have become direct or indirect targets of many drugs developed to be controllers of asthma. With the development of knowledge regarding the pathophysiological mechanisms of T2-defined inflammation, it has been possible to associate some diseases with asthma, not only epidemiologically, but also using the inflammation pathway. These certainly include chronic rhinosinusitis with nasal polyposis (CRSwNP) and atopic dermatitis, which have a rather high incidence of coexistence with asthma. In contrast, diseases that are less frequently associated with asthma include eosinophilic esophagitis (EoE), despite it being proven that the presence of type 2 inflammatory diseases significantly increases the risk of EoE [EoE is an emerging chronic immune-mediated disorder that primarily affects the esophagus, leading to esophageal dysfunction and associated symptoms. EoE is characterized by eosinophilic infiltration and inflammation of the esophagus. Patients with EoE often present with symptoms such as dysphagia, food impaction, chest pain, and heartburn, mimicking gastroesophageal reflux disease (GERD). However, unlike GERD, EoE usually does not respond to acid-suppressive therapy. As previously described in asthma, the pathogenesis of EoE also involves a combination of genetic predisposition, environmental triggers, and dysregulated immune responses. Similar to asthma, the T2 immune response is also a key driver of the inflammatory process in EoE. Eosinophils and other inflammatory cells infiltrate the esophageal tissue, leading to mucosal damage, fibrosis, and impaired esophageal motility. Cytokines such as IL-4, IL-5, and IL-13, as well as eotaxins\u2014chemokines involved in eosinophil recruitment\u2014contribute to the pathogenesis of EoE. Although both conditions involve inflammation and share some similarities, they affect different anatomical sites and exhibit distinct clinical manifestations.asthma of the esophagus\u201d due to the similarities between diseases to emphasize the similarities of two diseases too often regarded as two entities that are distinctly separate from each other [Despite the evident common inflammatory pathway, there are not many studies linking these two diseases. About 10 years ago, Virchow defined EoE as \u201cch other . Understanding the shared and distinct mechanisms of inflammation in asthma and EoE is essential for developing targeted therapies. Current treatments for both conditions focus on controlling symptoms and reducing inflammation. In asthma, inhaled corticosteroids, long-acting beta-agonists, leukotriene modifiers, and monoclonal antibodies targeting specific cytokines have revolutionized management. Similarly, in EoE, dietary management, proton pump inhibitors, and topical corticosteroids are the mainstay of current treatments. However, there is still an unmet need for more effective and personalized therapies that can address the underlying inflammatory processes and provide long-term remission.The development of biological drugs  and several sub-analyses of clinical trials have made it possible to evaluate the effect of biologicals initially developed for asthma on eosinophilic esophagitis. The results obtained so far are encouraging and contribute to the knowledge of this type of inflammation; moreover, they provide useful suggestions when both diseases are present to orient a clinician\u2019s therapeutic choices. The research of both pathologies is crucial, both to know the real prevalence of asthma in EoE patients and vice versa and to confirm that the same drug can affect both pathologies, allowing the clinician to choose one molecule, rather than another, in the case of comorbid patients.This manuscript provides an overview of the inflammatory mechanisms underlying asthma and eosinophilic esophagitis, highlighting their etiology, pathogenesis, and potential therapeutic strategies.The type 2 immune response encompasses both the innate and adaptive arms of the immune system and represents the common inflammatory pathway within a broad range of inflammatory and infectious diseases . HistoriThe identification of the phenotype first , and theIn cases of severe asthma, the use of several biological drugs has achieved a significant reduction in exacerbations, the need for systemic corticosteroid use, and, in some cases, an improvement in respiratory function ,52,53. TSubsequently, other biological drugs targeting IL-5 were developed, namely, mepolizumab and reslizumab. Regarding the former, data from clinical and real-life trials showed its efficacy in reducing disease exacerbations in patients with an eosinophil count above 150 cells/mcl, allowing, in addition, a significant reduction in daily dosing and, in most cases, the discontinuation of systemic steroid therapy ,56. OtheReal-life data has also suggested that mepolizumab is equally effective in patients with and without certain comorbidities such as nasal polyposis ,63,64,65Again, observations in real life have shown the efficacy of the drug in other diseases such as eosinophilic esophagitis ,68,69. MAs with mepolizumab, although there is no primary indication for this condition, in real life, it has been shown to be effective on nasal polyposis, and this comorbidity has again been associated with improved therapeutic response in patients treated for asthma ,79,80,81Similarly, against IL-5, reslizumab was able to reduce asthma exacerbations and OCS intake in treated patients; unlike other drugs, it was administered intravenously, which is a method that is yet to be approved in several countries ,34,35,82Dupilumab, another drug directed on T2 inflammation mechanisms, was precisely directed to the IL-4 receptor, which is a molecule that can interact both with IL-4 and IL-13 . The administration of dupilumab has been demonstrated to be able to reduce exacerbations and systemic corticosteroid use, and, regarding nasal polyposis, it showed efficacy in reducing the polyp volume ,84,85,86Lastly, tezepelumab, an anti-TSLP antibody, is the first drug to interfere with the alarmin chain. One of the most interesting aspects of the molecule is precisely its action on a chain of inflammation beyond that of specifically type 2 cytokines , acting on what is produced as a result of epithelial damage.Current available data demonstrate a significant efficacy in patients with T2 inflammation, as well as partial efficacy in those with T2-low characteristics ,90,91,92The results about hyperactivity include differentiators from other drugs available for asthma at this time; in fact, omalizumab was able to reduce AHR only in several studies using methacholine, acetylcholine, or adenosine monophosphate; mepolizumab did not achieve this result as no results were obtained with benralizumab, lebrikizumab, tocilizumab, efalizumab, and tralokinumab. The only other drug, which is currently not marketed for asthma, that achieved the result of reducing AHR was etanercept in one study. In the end, the only two drugs that are currently available for asthma and able to reduce AHR are tezepelumab and omalizumab . Regarding efficacy on OCS-dependent patients, however, in clinical trials, tezepelumab did not meet the endpoint of the reduction in exacerbations in this category of patients. Sub-analyses of the dedicated study, however, showed that the administration of the biologic drug was able reduce exacerbations and OCS use in dependent patients, with results being proportionally related to the eosinophilic count at baseline. A new clinical trial with this aim is ongoing . The lonCurrently, a new anti IL-5 biological, depemokimab, is under investigation. Its distinguishing characteristic is its long-life capability, which allows for administration every 6 months . Two molecules targeting IL-13 have been under study for several years, with controversial results. Certainly, the addition of the effect on IL-4r and not only IL-13 demonstrates a more effective result. Lebrikizumab (anti IL-13) was demonstrated to be effective on adolescents (12\u201317 years) in reducing the exacerbation rate after 52 weeks, despite the fact that the study was prematurely terminated (sponsor\u2019s decision), potentially limiting our interpretation of the results . LebrikiOther therapeutic targets under study, at this time, are being directed toward mediators of type 2 inflammation, as well as TSLP, with CSJ117 , and IL-Eosinophilic esophagitis (EoE) is an emerging disease that is defined by symptoms of esophageal dysfunction and abnormal eosinophilic inflammation within the esophagus. The diagnosis is histological and depends on the number of eosinophils detected  ,104,105.The mechanism of inflammation is Th2-mediated, and aeroallergens/food antigens are the most important triggers. The migration to the esophageal wall and the activation of eosinophils and mast cells promote the release of proinflammatory cytokines, such as interleukin (IL)-4, IL-5, IL-13, and transforming growth factor (TGF) \u03b2, causing epithelial barrier disruption, smooth muscle impairment, and tissue remodeling ,108,109.Nowadays, several new targeted therapies that can arrest the inflammation cascade are being investigated for EoE. Some drugs are imported from bronchial asthma and atopic dermatitis since these diseases have the same mechanism of inflammation  Table 2Table 2.Dupilumab, a monoclonal antibody that inhibits the action of IL-4 and IL-13 by blocking the shared IL-4 receptor \u03b1 subunit has been approved by the FDA for moderate\u2013severe atopic dermatitis, asthma, and rhinosinusitis with nasal polyposis treatment. It suppresses most Th2 inflammatory biomarkers, representing an optimal target drug for Th2-mediated diseases; moreover, for this reason, it was also studied in the context of EoE . In May Another monoclonal antibody that acts on IL-13 is cendakimab (previously RPC4046). It inhibits binding at the IL-513 receptor and is administered weekly via subcutaneous injections. It demonstrated a histological and endoscopic improvement in a 16-week phase 2 study in adults with active EoE but not a clinical remission, although an improving trend was shown . An endoIL-5, which is produced by T helper 2 cells, is involved in the differentiation, maturation, and migration process from the bone marrow of eosinophils favoring their adhesion to the esophageal wall. Eosinophils are directly involved in tissue remodeling as shown in an experimental model . TherefoLymphocyte-trafficking modulation is currently being explored as a possible target for therapy in refractory eosinophilic gastro-intestinal disorders including EoE. Vedolizumab, a monoclonal integrin \u03b14\u03b27 antibody, mainly blocks CD4+T lymphocytes from binding to MAd CAM1 on intestinal endothelial cells, ensuring gut-selective, anti-inflammatory activity; for this reason, it has been approved to treat inflammatory bowel disease. In addition, it also blocks \u03b1E/\u03b27 integrin, which has been found in Th2 lymphocyte cells in EoE patients, and this effect could lead to hypotheses regarding its role in the context of EoE patients ,120. VedLirentelimab (or antolimab) is a monoclonal antibody to sialic acid-binding immunoglobulin-like lectin 8 (Siglec-8), a CD33 receptor located on the surface of eosinophils and mast cells. It induces eosinophilic apoptosis and inhibits mast cell activation. In a small clinical trial, histologic remission (\u22646 eos/hpf) was achieved, but there was no statistical significance for the patient-reported symptomatic coprimary endpoints; however, the results of these trials have not yet been published . The ENIGMA trial, a randomized, phase 2, placebo-controlled study aiming to assess the efficacy of the anti Siglec-8 antibody (AK002) in adult patients with eosinophilic gastritis and gastroenteritis, has recently demonstrated histologic remission in patients with concomitant EoE . For thiTezepelumab, a TSLP antagonist used for asthma and atopic dermatitis, has a mechanism of action that targets the top of the inflammatory cascade, and a recent clinical trial has started to evaluate its role in improving outcomes for EoE patients ,129. Moreover, chronic inflammation leads to progressive esophageal remodeling, and TGF-\u03b2 plays a relevant role in this process. Losartan, an antigotensin-1 receptor antagonist approved to treat high blood pressure, has been proposed due to its ability to reduce the signaling of TGF-\u03b2 as a therapy in EoE patients. An ongoing phase 2 trial with increasing doses of losartan is ongoing .Finally, the JAK\u2013STAT pathway has been identified as a potential target in the treatment of EoE. There are no studies on the JAK inhibitor tofacitinib in EoE patients, but it has been reported that it was able to reduce esophageal eosinophilic infiltration in a patient with EoE . The long-term efficacy of these drugs will be determined by further studies, but they seem to be promising in modifying the course of the disease.Although the effect of biologicals both in asthma and eosinophilic esophagitis was demonstrated, some points remain unclear and require further investigation . In the In conclusion, the effect of eosinophils and T2 inflammation has been proven to be present both in asthma and eosinophilic esophagitis. In the field of asthma, the role of monoclonal antibodies is pivotal in the treatment of the severe form of this disease, which is currently not responding adequately to traditional therapy, to reduce OCS use; the real-life analysis and sub-analysis of randomized trials of patients treated for asthma and their pathology have demonstrated the effect of antibodies also in esophagitis. The development of trials dedicated to esophagitis provides interesting results and different targets which are also directed to T2 cytokines and mediators. Further studies will be needed to evaluate the relationship between asthma and eosinophilic esophagitis, with a search for common inflammatory pathways and interactions between the diseases, as has already been evaluated in rhinosinusitis with nasal polyposis, to better understand the role of type 2 inflammation and the possible causes of the imbalance of inflammatory mechanisms.The evidence of a common inflammatory pathway in these two diseases dictates increased attention to the management of these patients. As the search for polyposis comorbidity has become more routinary over time in asthmatic patients, any pathology related to a similar mechanism, but located in a different district than the airway, must be considered. This review aimed to focus on raising awareness of one of the diseases related to T2 inflammation, that is generally seldom considered as a possible comorbidity of asthma, aiming to inform gastroenterologists and pulmonary-allergologists of the importance of the search for these two diseases."}
+{"text": "In this Review, we discuss the key features of type 2 inflammation in asthma, summarize the clinical trial evidence of monoclonal antibody asthma treatments, and explore future avenues for targeted asthma treatment. The field of asthma has undergone a dramatic change in recent years. Advances in our understanding of type 2 airway inflammation have driven the discovery of monoclonal antibodies targeting specific aspects of the immune pathway. In landmark trials, these drugs have shown efficacy in reducing asthma attacks and exposure to oral corticosteroids, important causes of morbidity in people with asthma. Our review explores the key features of type 2 inflammation in asthma and summarizes the clinical trial evidence of the novel monoclonal antibody treatments and future avenues for treatment. Asthma is characterized by variable symptoms of breathlessness, cough, chest tightness, and wheeze. Diagnosis is supported by evidence of reversible airflow obstruction on spirometry or airway hyperresponsiveness through bronchial provocation testing . Asthma For over 30 yr, the cornerstone of asthma treatment has been inhaled corticosteroids (ICSs). ICSs reduce eosinophilic airway inflammation and are proven to improve symptoms and reduce asthma attacks . HoweverOur understanding of type 2 immunity has matured from simply a tool to regulate type 1 immunity to a more complex role including host defense and tissue repair . The keyThe asthmatic airway is characterized by chronic inflammation of the airway wall due to a complex infiltration and interplay of immune cells including eosinophils, neutrophils, lymphocytes, dendritic cells (DCs), innate lymphoid cells (ILCs), and mast cells. The inflammation leads to narrowing of the airway, airway hyperresponsiveness, airway mucous plugging, and airway remodeling. This pathology underpins the typical asthma symptoms as well as the airflow obstruction seen on spirometry . See FigAirway epithelial cells are the interface between the external environment and internal structures. They act as the primary line of defense against pathogens and other inhaled insults such as allergens or chemical irritants . This deTSLP, IL-33, and IL-25 stimulate ILC2 and Th2 cells to produce type 2 cytokines . ILC2 ce+ T cells to become effector Th2 cells, which then produce type 2 cytokines  and CD18 and suppressing L-selectin . TSLP, Iytokines .Th2 cells formed in the draining lymph nodes also stimulate B cells to mature into plasma cells and produce antibodies . IL-4 anAllergic asthma is typically early onset but can persist into adulthood. DCs present inhaled aeroallergens, such as house dust mite, animal dander, or pollen, to tissue-resident memory Th2 lymphocytes, expressing antigen-specific TCRs . IgE croIL-4 and IL-13 play a powerful and intricate role in the type 2 cytokine response due to their effect on nearly every cell relevant to asthma. There are four receptor chains that compose the IL-4R complexes: IL-4R\u03b1, \u03b3 chain, IL-13R\u03b11, and IL-13R\u03b12 . On naivOn airway epithelial and smooth muscle cells, IL-4 and IL-13 bind to the heterodimer IL-4R\u03b1 and IL-13R\u03b11 , ICAM-1, and the generation of eosinophil-attracting chemokines, such as eotaxins . In thisAll the IL-4R signaling pathways operate in a JAK-STAT6-dependent manner . The rol+ stem cells. Expression of certain transcription factors induces eosinophil differentiation . IL-5, GM-CSF, and IL-3 synergistically continue this process of differentiation and maturation in the bone marrow  that bind to the CCR3 receptors on eosinophils and induce chemotaxis . PGD2 anOnce in the airway tissue, eosinophils can generate inflammation in a variety of ways. By degranulating, akin to detonating a bomb, eosinophils damage lung structural cells through the release of cytotoxic proteins including major basic protein (MBP), eosinophil peroxidase (EPO), eosinophil-derived neurotoxin (EDN), and eosinophil cationic protein ECP; . ProinflAnother cause of persistent airflow obstruction is mucous plugging. Eosinophils can form extracellular traps (EETs) made from extracellular DNA fibers . FunctioIn 1956, OCSs were shown to be effective in treating asthma attacks . Trials ICSs have a much wider therapeutic index and are an important part of modern asthma treatment. They downregulate transcription of a wide range of cytokines, resulting in a reduction in Th2 cells, mast cells, macrophages, and DCs. Eosinophils are reduced in the airway epithelium because of apoptosis and by decreased chemotactic pull by chemokines such as eotaxin, which are also downregulated by ICSs. This effect is reflected by a reduction in FeNO . HoweverBiological therapies offer a reprieve by targeting specific parts of the type 2 inflammatory pathway. They have also proved safe and effective at reducing asthma attacks and oral steroid use. For clinical relevance and brevity, we will mainly focus on the mechanisms and efficacy of treatments that are currently licensed in adults. The key classes of monoclonal antibody are anti-IgE , anti-IL5/anti-IL5R , anti-IL4R (dupilumab), and anti-TSLP  on mast cells and basophils. This reduces cellular activation and inflammatory mediator release, particularly in the context of an allergic asthmatic response . OmalizuThe efficacy of omalizumab is extensively studied in allergic asthma. A recent systematic review and meta-analysis of five adult studies found a 37% (CI 21\u201350%) absolute risk reduction in the annual exacerbation rate AER; . This waDue to the inconsistent clinical evidence and unpredictable real-world data, omalizumab is best suited to a small, specific group of young asthmatics where allergy is the primary factor in their exacerbations. IgE appears to be the product of type 2-high inflammatory activation, rather than a key mediator.9 cells per liter.IL-5 plays a more central role in the pathogenesis of type 2-high asthma. Mepolizumab and reslizumab bind to IL-5, while benralizumab binds to IL-5R\u03b1. All three treatments result in a marked reduction in blood eosinophils and are licensed for patients with severe eosinophilic asthma with a blood eosinophil count of at least 0.15 \u00d7 10The path to success for anti-IL5 biologics was not straightforward . Early cThe subsequent phase 3 trials of mepolizumab  confirme9 per liter (SIROCCO and CALIMA) decreased the annualized exacerbation rate by up to 50% and increased forced expiratory volume in 1 s (FEV1) by 110\u2013160 ml  in uncontrolled moderate to severe asthmatics demonstrated a 48% reduction in exacerbations and 130 ml improvement in FEV1 compared with a placebo . Dupilum placebo .Additionally, dupilumab is efficacious and licensed for atopic dermatitis and chronic rhinosinusitis with nasal polyposis . ClinicaThe alarmins offer the potential to have more wide-ranging effects on downstream cytokines and hematopoietic cells.9 per liter. Similarly, there was a 73% reduction in exacerbations in patients with FeNO > 50 ppb. Tezepelumab showed clinical efficacy, albeit less pronounced, in the type 2-low phenotype. There was a 41% reduction in exacerbations in patients with baseline blood eosinophils <0.3 \u00d7 109, and a 32% exacerbation reduction in patients with FeNO < 25 ppb. However, the SOURCE study did not show a significant reduction in maintenance OCS between tezepelumab and placebo  in patients aged 12\u201380 yr showed a 56% reduction in exacerbations and 130 ml improvement in FEV1 compared with a placebo . Tezepel placebo . The DES placebo . Additio placebo . An ongo placebo .There are also drugs targeting IL-33 (itepekimab) and the IL-33 ST2 receptor (astegolimab). A phase 2 comparing dupilumab, itepekimab, itepekimab/dupilumab, and placebo study showed that itepekimab prevented loss of asthma control compared with a placebo when LABA and then ICS were removed sequentially . HoweverAstegolimab was tested in a phase 2 trial with no minimum threshold for blood eosinophils. Astegolimab reduced exacerbations by 43% compared with placebo at the 490 mg dose . There w9 per liter was noted in 1.2% of dupilumab recipients, but these patients were asymptomatic  and a very low risk of hypersensitivity reaction (<0.5%). The most notable side effect of dupilumab was blood hypereosinophilia of unknown significance. This occurs because the transport of eosinophils from the bloodstream is impeded. A blood eosinophil count of 3 \u00d7 10ptomatic . There aptomatic . The mosNippostrongylus brasiliensis  and offers a potential novel treatment for asthma. OX40L is expressed on antigen-presenting cells, such as DCs, endothelial cells, macrophages, and activated B cells . OX40 isBruton\u2019s tyrosine kinase inhibitors (BTKi) are another class of small molecules already in use for B cell malignancies and are being explored in allergic asthma. BTK is an important kinase for Fc\u03b5RI signaling in mast cells and basophils, therefore mediating allergic-driven inflammation . An inhaAtuliflapon is a FLAP inhibitor that reduces 5-lipoxygenase (5-LO) pathway activity and the production of proinflammatory leukotrienes. Following an inflammatory stimulus, 5-LO interacts with 5-lipoxygenase-activating protein (FLAP) on the nuclear membrane, which mediates arachidonic acid transfer to the active site of 5-LO . AtuliflCurrently, licensed monoclonal antibodies in asthma are all injected, so there is scope to deliver treatment less invasively. Dexpramipexole is an oral medication originally developed for amyotrophic lateral sclerosis but was incidentally found to significantly reduce the blood eosinophil count. The mechanism of action is thought to be by inhibiting the maturation of promyelocytes into eosinophils in the bone marrow. In the phase 2 EXHALE study, there was an 80% reduction in asthma exacerbations and a non-significant 172-ml increase in pre-bronchodilator FEV1 by week 12 . AdditioFurthermore, combining biologics targeting different type 2 pathways is being explored by drug companies. This could offer the benefit of having a portfolio of options that could target the mechanisms driving an individual person\u2019s disease\u2014a goal of precision medicine. However, this approach could also potentiate the side effects outlined above.Haemophilus influenzae  are formed when neutrophils shape a web of DNA and protein-rich fibers to immobilize pathogens . Evidencfluenzae . Targetifluenzae .2+-triggered membrane fusion in the production of mucin are a promising opportunity to reduce mucous production and have demonstrated efficacy in mice (Mucous plugging is an important patient symptom and there is emerging longitudinal computerised tomography evidence that persistent small mucous plugs lead to an increase in air trapping and airway obstruction . Finding in mice .Finally, obesity is a major driver of asthma symptoms and healthcare utilization. Part of the symptom burden is from changes to lung physiology. But mouse models also suggest that obesity alters inflammatory mechanisms by switching type 2 T helper\u2013predominant disease to more severe, less responsive type 17 T helper\u2013predominant disease. This may be related to decreased activity of nuclear receptor peroxisome proliferator-activated receptor-\u03b3 PPAR\u03b3; . TreatmeAsthma is fraught with misdiagnosis and mistreatment by attributing non-specific symptoms to the label of asthma . Given tThere is emerging evidence that blood eosinophils and FeNO are additive prognostic markers for the risk of future exacerbations . SymptomFuture research should also delve into the causes and mechanisms of asthma attacks. We know that viral infection is often implicated, but why they do not always lead to an attack and the impact of viral infections on the lower airway immunopathology in type 2-high asthma are not well understood. The MUPPITS-1 study observed heterogeneous nasal transcription modules in viral positive and viral negative asthma attacks in children . The MUPThe field of asthma has undergone a radical transformation over the past 20 yr. Patients with significant unmet needs now have access to highly effective and safe treatments in the form of biological therapies. These treatments yielded from our heightened understanding of type 2 inflammation and its interplay with pathophysiology in asthma. But the early failures of treatments in all-comer asthma patients underscores the important narrative that asthma should be diagnosed and treated in a targeted manner. As new treatments emerge for type 2-high or type 2-low asthma, it is imperative that we persist with the principle of precision medicine."}
+{"text": "One of the main causes of proximal bowel\u00a0obstruction in neonates is congenital duodenal obstruction. It can be grouped by intrinsic and extrinsic factors and the presentation may differ\u00a0depending on whether the obstruction is complete or partial. The intrinsic\u00a0factors include\u00a0duodenal atresia, duodenal stenosis, or duodenal web. The extrinsic factors include\u00a0malrotation with Ladd\u2019s band, annular pancreas, anterior portal vein, and duodenal duplication. Malrotation may present with or without midgut volvulus.We are sharing a rare presentation of congenital duodenal obstruction with combined intrinsic and extrinsic causes, namely, duodenal stenosis with gastrointestinal malrotation\u00a0in a neonate. The patient underwent successful exploratory laparotomy, corrective Kimura\u2019s procedure (duodenostomy), Ladd's procedure, and appendicectomy.Early recognition of signs and symptoms, prompt corrective surgery, and adequate optimization of metabolic components post-operatively are important to determine the decreased morbidity and mortality of neonates. Congenital duodenal obstruction can be attributed as the main cause of intestinal obstruction in the neonatal age group . It can 9/L, haemoglobin of 5.7 g/dL, and platelet counts of 214 x 109/L. The patient developed respiratory distress syndrome and was intubated upon delivery. The initial blood gas revealed metabolic acidosis with a pH of 7.135 and a bicarbonate level of 14 mEq/litre. In view of haemodynamic instability,\u00a0feeding was not started until after seven days of life. The patient was noted to pass meconium within 24 hours after delivery and minimal yellowish stool till the day of referral. Bedside echocardiography performed on day two of life showed levocardia with small patent ductus arteriosus, intact interventricular septum, and normal four heart chambers. The patient showed improvement and responded to antibiotics therapy and other supportive measures. Once the condition stabilized, feeding was commenced after day six of life but the patient developed\u00a0feeding intolerance, where the patient started to have bilious drainage from the feeding tube and a grossly distended abdomen.A 10-day-old\u00a0premature baby girl born at 32 weeks of gestation, with a birth weight of 2.42 kg, was referred to the paediatric surgery unit for feeding intolerance, associated with bilious drainage from the feeding tube. The patient's antenatal history was uneventful up till the 32 weeks of gestation when the mother developed chorioamnionitis\u00a0and preterm premature rupture of the membrane of more than 12 hours, recording a temperature of 38.2\u00b0C prior to delivery. The mother\u00a0had one previous emergency lower segment caesarean section (EMLSCS) in 2018 for late-onset pregnancy-induced hypertension, over-diabetes (glycosylated haemoglobin of 11.1%), and neonatal abruption. There was no other family history of congenital disease in the immediate family members.\u00a0The patient was delivered\u00a0via EMLSCS after two doses of dexamethasone were given together with intravenous antibiotics\u00a0cefuroxime and metronidazole\u00a0coverage for chorioamnionitis. The baseline blood work upon delivery recorded the total white count at 27.06 x 10Upon review of the serial imaging from birth, the imaging Figures , 2 showeAn earlier referral was deferred in view of haemodynamic instability and delay in the commencement of feeding at that time. The paediatric team then referred the patient to the paediatric surgical unit for proximal duodenal obstruction. Ultrasound abdomen study performed showed normal relation of superior mesenteric artery and vein; however, intestinal malrotation cannot be excluded. The horizontal segment of the third part of the duodenum was not visualized while the liver was seen on the right side of the abdomen and the spleen on the left. With these findings, the baby was subjected to an upper GI contrast study Figure .The patient then underwent exploratory laparotomy where we found that the patient has two pathologies, duodenal stricture at D2-D3, and gastrointestinal malrotation, as shown in intraoperative pictures Figures -6. We haIntraoperatively, the liver is located to the right of the abdomen, the spleen to the left, while there are no annular pancreas and no congenital band. The gallbladder is located to the right of the abdomen behind the liver but the extrahepatic bile duct is located in front of the first part of the duodenum. The stomach is on the right side, the duodenal-jejunal flexure is located to the right of the abdomen with short mesentery, the caecum is centrally located, and the rest of the large bowel is to the left of the abdomen. We performed corrective Kimura\u2019s procedure (duodenoduodenostomy) for the duodenal stenosis and Ladd's procedure for the gastrointestinal malrotation.The patient was nursed in the neonatal intensive care unit (NICU) optimizing the patient\u2019s post-operative parameters. The NICU team managed to commence feeding the baby, approximately within a week after surgery. The patient was also diagnosed with a nosocomial\u00a0lung infection, presumed sepsis from chorioamnionitis, and hypothyroidism on top of\u00a0delays in establishing optimal feeding. Despite a turbulent four-month\u00a0stay due to prematurity and battling nosocomial infections, the patient was discharged home with bottle feeding 60cc every three hours and weighing 3.20 kg. A genetic study for this patient was not performed, as it was not routinely done in our setting in view of the high cost and limited testing capability.Congenital duodenal obstruction affects approximately one in 2,500-10,000 live births and almost half of the neonatal cases. The causes can be divided into two broad congenital factors: intrinsic and extrinsic. The intrinsic causes include duodenal atresia, duodenal stenosis, or duodenal web, whereas the extrinsic causes comprise malrotation with Ladd\u2019s band, annular pancreas, anterior portal vein, and duodenal duplication. This case presentation has the unfortunate combination of duodenal stenosis (intrinsic) and gastrointestinal malrotation (extrinsic).Due to the nature of duodenal stenosis, it poses a challenge in terms of diagnosis, as the presentation may vary depending on the degree of obstruction , compareGastrointestinal malrotation on the other hand is a result of the failure of the midgut to rotate around the axis of the superior mesenteric artery. The patient may present with intestinal obstruction due to volvulus. It is usually diagnosed early and rare in adulthood . AccordiThe imaging modality of choice for both conditions can either be a contrast study or ultrasound, either prenatal ultrasound\u00a0or postnatal ultrasound .\u00a0A gastrPlain radiographs on the other hand can give rise to suspicions based on the presence of double bubble signs or multiple dilated bowel loops with or without transition zones. The location of the feeding tube in the plain radiographs may also be suggestive of malrotation as well as defining the normal location of the heart and liver.Surgery remains the mainstay in the treatment of duodenal stenosis and malrotation, with or without volvulus. Duodenoduodenostomy or Kimura\u2019s procedure is often described as the surgery of choice for duodenal stenosis, introduced in 1977. Kimura described a method to bypass the stenosis by applying a diamond-shaped side-to-side duodenoduodenostomy  with gooOur case presentation was compounded with gastrointestinal malrotation, and more often than not, the surgical approach is Ladd\u2019s procedure . In thisThe surgical approach has to be supported with post-operative optimization of fluid and electrolytes with parenteral nutrition to have a better overall outcome. The advancement in neonatal post-operative surgical care dramatically improved the outcome in recent years . The expIt is imperative to diagnose this condition as early as possible with the help of imaging and clinical suspicion. It is important to recognize that due to the partial or complete obstruction, the presentation may not be typical. Prompt corrective surgery with good post-operative care in a controlled environment is important to achieve a good outcome in general."}
+{"text": "Understanding the correlation of work ability (WA) and anthropometric indices with cardiovascular diseases (CVDs) risk factors among public sector employees (PSE) is vital for policy direction. This study examined the correlation between work ability, anthropometric indices, and cardiovascular risk factors among PSEs.The cross\u2010sectional study had 254 (mean age\u2009=\u200937.18\u2009\u00b1\u200910.34) PSE. A self\u2010reported WA index was used to measure WA. Blood pressure (BP), body mass index (BMI), waist circumference (WC), hip circumference (HC), waist to hip ratio (WHR), and visceral fat were measured. Lifestyle CVDs risk history was also obtained.3.9% had moderate, 51.2% good, and 44.9% excellent WA. 37.4% overweight, 20.1% obese, 19.7% hypertension history, 67.7% no physical activity history. WA correlates with increased systolic BP, BMI, WC, WHR, weight to height ratio, and visceral fat significantly. Age 24\u221229 (aOR = 26.38), 30\u201039 (aOR = 7.52), and 40\u201049 (aOR = 4.94) independently predict excellent WA. Overweight (aOR\u2009=\u20090.44) independently predict decreased excellent WA.Participants were hypertension\u2010prone, had increased WC, WHR, physically inactive, overweight, and obese. WA and anthropometric indices of the participants predict CVDs risks. Workplace health care strategy should be put in place to control BP, BMI, WC, WHR, weight to height ratio, and visceral fat as CVDs risk factors. KMA is one of the 260 metropolitan, municipal, and district assemblies in Ghana. KMA is one of the 43 districts in Ashanti Region in Ghana, with Kumasi as its administrative capital. The study was conducted in line with the STrengthening the Reporting of Observational studies in Epidemiology (STROBE) for observational studies.n = (Z2\u2009x\u2009PQ)/e2, where: Z is the standard normal variate at a confidence interval of 95% = 1.96. p is the prevalence = 7% of CVD in Ghana, e is the margin of error = 0.05, and Q\u2009=\u20091\u2212p. n (minimum number of participants) =\u20091.962 x 0.07 x (1\u22120.07)/0.052\u2009=\u2009100. Hence, a minimum of 100\u00a0participants was required for the study.The study participants were recruited through a random sampling technique. The random sampling technique ensured that each participant has equal opportunity to be selected as established the literature.2.1Full time employees of public institutions within the KMA were included in the study. The study used PSE who experience high level of bureaucratic practise, tend to avoid unpaid overtime work, whose remunerations are often disbursed early and rarely delayed, more likely to be absent from work, tend to experience less stringent oversight responsibilities, and have job security when compared to private sector employees who were excluded. Employees of private and part time employees of public sectors are habitually dedicated to their job, rarely go to work late and often endure any challenge encountered for the sake of not losing one's job.2.2Demographic data on age, educational level, marital status, number of children, residence, religion, work experience (years), and working section was obtained. Lifestyle related information  was also obtained. Omron body composition analyzer and nonelastic tape measure were used to measure anthropometric indices. An Omron sphygmomanometer was used to measure blood pressure (BP) and heart rate of the study participants.The WA Index (WAI), a self\u2010assessment instrument, was administered to measure the work ability of the participants.2.32 (m). Data obtained were categorized according to standard.The height and weight were measured to the nearest 0.5\u2009cm and 0.1\u2009kg, respectively, while wearing light apparel and without shoes. The BMI formula was (weight [kg])/height2.4As CVD risk factor components, BP, heart rate, BMI, and visceral fat were measured and recorded. After each participant had sat for at least 10\u2009min, two consecutive BP readings were taken from the participant's right arm. The systolic and diastolic BPs were recorded to the closest mmHg. If the difference between the two readings is greater than 4\u2009mmHg, a third reading is taken. The subsequent analysis used the average of the two BP measurements. As the onset and disappearance of Korotkoff sounds, systolic and diastolic BP  were determined. Visceral adiposity was determined and recorded. The questionnaire on knowledge of cardiovascular risk factors (Q\u2010FARCS)Before data collection, the participants were given a thorough explanation of the study protocol and assurances of anonymity. Also, ethical approval was obtained from the Committee on Human Research, Publication, and Ethics, School of Medical Sciences, Kwame Nkrumah University of Science and Technology (Ref: CHRPE/AP/024/22). Authors declare that the work has been done in accordance with the declaration of Helsinki statement of ethical principles for medical research involving human subjects, including research on identifiable human material and data.2.4.1www.graphpad.com). Means and standard deviations served as the representations of parametric variables while medians and interquartile ranges served as those of nonparametric continuous variables. Variables of a categorical nature were represented as frequencies and percentages. Utilizing a Pearson \u03c72 test statistic and logistic regression analysis, correlation of cardiovascular risk factors as independent variables and WA as dependent were determined. A confidence interval of 95% and a p\u2010value deemed statistically significant at the 0.01 and 0.05 levels (2\u2010tailed).Microsoft Excel 2019 was used to enter, cleanse, and code the collected data. All statistical analyses were conducted using Statistical Package for the Social Sciences (SPSS) Version 26.0 and GraphPad Prism Version 8.0  significantly increased systolic BP, weight ; p\u2009=\u20090.041), and BMI ; p\u2009=\u20090.027) by 5% and 10% respectively. Also, increased WC; p\u2009=\u20090.003), and WHR ; p\u2009=\u20090.002) were significantly associated with 5%, 3%, 100% and 100% respectively of reduced WA. On the other hand, visceral fat ; p\u2009=\u20090.002) were associated with decreased excellent WA.According to Table From Table 4This study examined the correlation between WA, anthropometric indices, and cardiovascular risk factors among PSE. Findings showed that 57.5% were at least overweight, 38.6% had a history of hypertension, and 67.7% had never taken part in any physical activity, which reflects sedentary living  have been explained."}
+{"text": "The students\u2019 academic performance was also evaluated to look for quantitative differences between cohorts. We found similar overall academic scores for the Physiology course between cohorts. Interestingly, when we compared the academic scores obtained in the theoretical content from each cohort, we found a significant improvement (p < 0.05) in cohort 2 where the students achieved better results as compared to cohort 1. A subset of students was asked to fill a questionnaire assessment on their experience and found that 78.9% of them preferred integrated laboratory classes over laboratory classes alone. They consistently reported a better understanding of the theoretical content and the value they gave to ILCs for learning. In conclusion, our pilot study suggests that integrating laboratory classes into PBL-oriented clinical contexts help to retain core physiology contents and it can be considered as an engaging learning activity worth implementing in Psychology teaching.Physiology is a fundamental discipline to be studied in most Health Science studies including Psychology. Physiology content is perceived by students as rather difficult, who may lack vision on how to relate it with their professional training. Therefore, identifying novel active and more engaging pedagogical strategies for teaching physiology to psychology students may help to fill this gap. In this pilot study, we used the PBL methodology developed around a clinical case to evaluate psychology students\u2019 experience and learning in two laboratory classes modalities. The aim of this study was to compare the undergraduates\u2019 preference for laboratory classes taught either independently (cohort 1,  Physiology is considered a challenging discipline in most Health Science studies. Psychology students in particular usually consider physiology as a less relevant part of their professional training even though it provides an essential scientific understanding of the biological processes underlying human behavior and cognition . UnderstThe ability to make predictions about how external and internal changes affect the state of a biological system is central to physiology . Active All this suggest that students would be better able to handle with difficulties if they actively engage in the cognitive processes required to build connections amongst separate information pieces . This wiIn recent decades, the importance of teaching basic sciences such as Physiology in an integrated manner has been emphasized . This adUsing PBL methodologies can thus help to better engage Psychology students in learning physiology concepts, especially in relation to more real case scenarios. Integration of laboratory classes into the PBL framework has been shown to significantly improve understanding, leading to the development of critical thinking and other major competences . By provHere, we investigate the effectiveness of integrating Physiology teaching with PBL-based laboratory classes by evaluating the impact on academic performance and students\u2019 perception in the first year of the Psychology undergraduate program. Our hypothesis is that students in which the laboratory classes are contextualized into PBL develop a better knowledge as compared to those who did not have the experience. To address this hypothesis, we developed a pilot study using a PBL-oriented clinical case on Parkinson\u2019s disease using WSLA as an example. We compare a first group (academic year 2018\u20132019) in which laboratory classes were taught separately from the clinical case with an experimental group (year 2019\u20132020) for which laboratory classes were contextualized into the PBL and transformed into Integrated Laboratory Classes (ILCs) . Our stun = 87) from 2018/19, which was considered the control group, and cohort (n = 92) during 2019/2020 as the experimental group. Cohort 1 was organized in three homogeneous group of students each of 25\u201330 students. Cohort 2 was organized in four heterogeneous group of students, two of them composed by 30 students and the other two of less than 30 students. The students of both cohorts aged between 18 and 25 years. In both cohorts there were similar distribution per gender, with 69\u201377% women and 23\u201331% men.In this pilot study, we aimed to assess the impact of academic performance and student\u2019s experience of teaching laboratory classes contextualized within the PBL applied to Physiology teaching in the first-year degree of Psychology. Two cohorts from consecutive academic years were selected: cohort 1 (The methodology used to teach the subject\u2019s content consisted in lectures (theory block), laboratory classes , and problem-based learning (PBL block). The PBL block was taught through a clinical case that integrates different learning activities using WSLA. The theoretical block was delivered in the same way in both cohorts. The main difference between cohort 1 and cohort 2, was that in the first one (2018/19), the laboratory classes were conducted independently of the PBL block. As for the second cohort (2019/20), the practices were contextualized with PBL as an additional workstation and named Integrated Laboratory Classes (ILCs) in order to provide a meaningful context.Five clinical cases were completed in PBL blocks throughout the course. The cases consisted of a clinical scenario, a description of the patients, and various situations that students must solve in groups. Students had to rotate through different workstation learning activities. In each workstation, they worked with different aspects of the clinical case through learning activities such as bibliographic research, audiovisual material production, visiting external institutions, etc.To illustrate our approach, we here describe the example associated to the clinical case named \u2018Practical Case: Parkinson\u2019s disease\u2019 . After tThe clinical case considered a protagonist, Peter, who suffered uncontrollable motor symptoms, such as shaking, stiffness, and difficulty with balance and coordination. He was worried and decided to talk to his nephew who was a Ph.D. student. Peter was about to visit a Parkinson\u2019s disease association. Understanding the case required students to integrate information from different activities conducted across different workstation:Station 1: Students performed two external visits associated activities. In activity 1, they interviewed a neuropsychologist and a Parkinson\u2019s patient (PD), both from the PD Association of Madrid. Previously, the students had worked on designing the interview questions. In activity 2, students visited an animal research laboratory at the Brain Mapping Center of Universidad Complutense de Madrid (UCM) where microPET imaging is used for translational research. They also visited the \u2018Affective Neurolinguistics and Cognition Group\u2019 of the UCM working with electroencephalography on human experimental subjects. Students solved problems through neuroimaging analysis, based on the training they received during these visits.Station 2: Students were exposed to theoretical explanations relevant to the clinical case.Station 3: For evaluation, students produced audiovisual material (video recordings), integrating all the learning activities worked on in the clinical case.In cohort 1, the motor reflexes were practiced as independent laboratory classes  with 4 options each, for which correct answers to each question were maximally scored and a penalty applied for incorrect answers, giving a partial score from 0 to 8 points. Exams also included two additional short-answers questions, which were scored from o to 2 points. The final score (10 points) resulted from the summation of the two parts.For quantitative analysis, academic scores from each of the different blocks in both cohorts were compared using an inferential non-parametric statistical study. As the two independent cohorts did not follow a normal distribution, a study was conducted using the Mann-Whitney non-parametric test. Academic scores were ranked from 0 to 10.n = 19). The rationale behind this decision was to be able to inform comparisons between the two academic experiences. To this purpose, we used a survey comprised of several questions scored with a Likert scale from 1 to 5 . To know more about what aspects the students remembered the most we also asked them to associate a particular concept learnt in different activities with each clinical case (question 8). Concepts included academic contents  as well as some particular characteristics of the clinical case .Internal validation was conducted by two experts who reviewed the coherence and consistency of the questionnaire. Additional validation was certified by an expert professor external to the project . ResultsWe analyzed the academic results of the theoretical block, common to both cohorts. To compare performance in the two different academic experiences, we looked for differences in the scores of the PBL block (cohort 1) vs. the PBL block in which ILCs were added as a workstation (cohort 2), as well as in laboratory classes (cohort 1) vs. ILCs (cohort 2). We also assessed the overall score of the Physiology course for both cohorts.p < 0.05) was found in cohort 2 , where the students achieved better results as compared to Cohort 1 . This trend was also reflected in the scores obtained in PBL+ILCs by cohort 2 (median 6.5) vs. PBL in cohort 1 (median 5.2), although it did not reach significance (p = 0.18).As shown in p < 0.05, Mann-Whitney U-test), suggesting that any improvement in understanding the relevant concepts may not be resulting from a single factor but at a more integrative level. These differences cannot be explained by external variables such as the temporality of the content explained, different teachers or type of assessment. The content was taught in the same semester (S1) and by the same teacher and even the same internship support teachers in Cohort 1 and 2. Exams in both cohorts were also similar. Moreover, as detailed in methods, both cohorts had similar profile of the students, and we did not face exceptional situations that contribute external variables.Regarding academic results from ILCs , we found them significantly lower than those obtained in laboratory classes alone  , more than half did not score them highly ; 60%. ReWe next assessed what methodology the students valued the most for learning and found that 78.9% of them preferred PBL+ILC over laboratory classes alone (question 5). Actually, 94.7% rated their opinion of ILCs between 4 and 5 of the Likert scale , we found 60% rated between 4 and 5 of the Likert scale, confirming the idea that the integrated PBL block added value to learning.Finally, we evaluated whether some concepts and ideas were able to trigger recalling of aspects of interest that were learnt over the course (question 8). With this we wanted to clarify the possible strategies used by students to build connections amongst separate information pieces. Consistent with a constructive perspective of learning, we found this to be strongly dependent on the case under study. For example, for the Clinical Case Parkinson\u2019s disease, there was a notable higher percentage of students that answered appropriately to the questions related to the personal characteristics of the case protagonists, such as their names (73%) or the destination of their trip (68%). Regarding theoretical concepts, 56% of students correctly retrieved the clinical case in association with evoked potentials and only 25% with the concepts of neuroinflammation.In this work, we evaluated quantitatively if ILCs impact positively the academic performance of Physiology in first year students of psychology. Our findings show that no significant differences were obtained in the final grade for the subject. However, there was significant improvement of the score of the theoretical block of Cohort 2 students, where laboratory physiology classes were integrated and contextualized into the clinical case. Interestingly, we also found that academic results of the ILCs were significantly lower than for non-integrated laboratory classes. These results may suggest that ILCs are more challenging for students to accomplish than the non-integrated practical lesson. In spite of this difficulty, analysis of the students\u2019 perception on questionnaires confirmed the value they give to ILCs for learning and highlight their strategies for knowledge integration of theoretical concepts.Experimental psychologist Robert Bjork, advocates for the so-called \u201cdesirable difficulties\u201d as learning strategies which require learners to exert an appropriate effort when learning something new. It has been demonstrated that these activities tend to result in enhanced learning . In currStrategies to incorporate \u2018desirable difficulty\u2019 in health education include retrieval practice, spaced practice, and interleaved practice . In addiThe counterintuitive idea that more difficult learning processes can enhance learning outcomes supports our results. The ILCs is a learning activity where retrieval practice is included through questions for learners to probe their knowledge. These results suggest that students learn more significantly and are able to recall better the information they learnt through ILCs. Our results add to previous reports demonstrating that retrieval practice enhances the ability to evaluate complex physiology information .In this experience we use five clinical cases each based on a clinical scenario, a description of the patients, and various situations that students must solve in groups, working in an integrated manner through different learning activities. Health Science professionals are expected to integrate content that is traditionally taught in isolation, and this may be particularly challenging in the context of psychology. When combined, active and integrated learning approaches result in an enriched learning environment which encourages students to apply knowledge to real-world scenarios and develop critical thinking skills. By doing so, students are better equipped to understand complex problems, to analyze clinical situations, and to make informed decisions in their future practice . This isContextualization of the clinical case for Psychology students is crucial. All the clinical cases the students had to work with, were real. The protagonist of each case develops an illness related to the psychological and emotional domain, which naturally attracted the interest of psychology students. By feeling that the content they are studying comes close to their professional world, students gain motivation and engagement . ConsistAs for any pilot study, there may be some potential limitation. Our study focused on a particular cohort with a limited sample. Studies in education are usually limited by factors such as the teaching load, institutional policies and logistical constrains. Future studies would include the implementation and evaluation of integrated laboratory classes in other programs and courses with a longitudinal design. Active learning methodologies seldom reach the laboratory component of basic science courses losing an important chance to provide a better learning experience for students that may be less inclined toward laboratory work.In summary, our study supports that using active learning methodologies to teach laboratory classes within an attractive clinical context has a positive impact on learning and on the overall student\u2019s experience. Moreover, ILCs are perceived as a motivating strategy by students which facilitates the understanding of complex physiological concepts. Using real clinical scenarios make students feel the content closer to their professional future and enhances engagement in their own learning process. This pilot study suggests that the ILCs help to retain core physiology content and it can be considered as a learning activity worth implementing in the Health curricula and in particularly in Psychology teaching.The raw data supporting the conclusions of this article will be made available by the authors, without undue reservation.The studies involving human participants were reviewed and approved by the Ethics Committee from the European University of Madrid (CIPI/18/060). The studies were conducted in accordance with the local legislation and institutional requirements. The participants provided their written informed consent to participate in this study.BG: Conceptualization, Investigation, Supervision, Writing \u2013 original draft, Writing \u2013 review and editing. JS: Formal analysis, Investigation, Methodology, Writing \u2013 review and editing. BN-G: Data curation, Investigation, Writing \u2013 review and editing. ML: Investigation, Methodology, Writing \u2013 review and editing. MR: Formal analysis, Investigation, Methodology, Writing \u2013 review and editing."}
+{"text": "Acremonium terricola is used in the feed of dairy animals to promote growth and control diseases. However, the effects of dietary supplementation with A. terricola on the gut microbial structure of weaning piglets remain poorly understood. Therefore, in this study, we investigated the effects of dietary supplementation with A. terricola culture (ATC) on the growth performance, antioxidant status, immunity, and gut environment of weaning piglets. Sixty piglets were fed a basal diet supplemented with 1\u00a0g ATC/kg of basal diet . Another 60 piglets did not receive ATC (control group). The intervention lasted for 20 days.P\u2009=\u20090.0018), insulin-like growth factor (P\u2009=\u20090.0018), triiodothyronine (P\u2009=\u20090.0031), immunoglobulin A (P\u2009<\u20090.0001), immunoglobulin M (P\u2009=\u20090.001), immunoglobulin G (P\u2009=\u20090.0001), and interferon \u03b3 (P\u2009<\u20090.0001) in the experimental group compared with the levels in the control group. Furthermore, ATC supplementation significantly reduced (P\u2009<\u20090.05) the relative abundance of Shuttleworthia, Succinivibrio, Roseburia, Ruminococcus, and Paludibacter but increased that of Phascolarctobacterium, Megasphaera, Faecalibacterium, and Prevotella in the experimental group compared with that in the control group. Notably, ATC supplementation significantly increased the relative abundance of Faecalibacterium prausnitzii (P\u2009<\u20090.05), which is involved in anti-inflammatory activities, gut barrier enhancement, and butyrate production.The experimental group had higher daily weight gain and feed efficiency than did the control group. Significant increases were noted in the levels of serum insulin (Dietary supplementation with ATC may improve the growth performance, antioxidant status, immunity, and fecal microflora of weaning pigs. In pig farming, postweaning is a crucial and challenging life stage because pigs are highly susceptible to nutritional, social, and environmental stress and gastrointestinal disorders, which result in growth retardation and even death . Over thBacillus, Cordyceps, and yeast, is an effective strategy for the prevention of various diseases and the improvement of weight gain and immunity in animals  were weaned at 42 days of age . The piglets were randomly and blinded assigned to two groups ; three replicate pens (20 piglets per pen) were used per group . Piglets were assigned individually (within litters) to the treatment groups. At admission, the animals were ear tagged as they came to hand and were allocated with the use of a computer-generated randomisation list (only known to BH) to one of the two treatment groups, until the required number of piglets had been reached. Animal feeding was conducted in a commercial pig farm . During the 20-day-long experimental period, the control group was fed a basal diet, whereas the experimental group was fed the same basal diet supplemented with 1\u00a0g ATC/kg of basal diet according to a previously described method . Table\u00a02g for 10\u00a0min. The samples were prepared following a previously described method [On Day 20, blood samples were collected from the piglets after they had fasted for 12\u00a0h. For blood collection, 10 piglets were randomly selected from each group. The samples were collected in 10-mL evacuated blood collection tubes containing heparin sodium and then centrifuged at 2000 \u00d7d method . The plad method . The prod method . All assAt the end of the intervention, fecal samples were collected from four piglets selected randomly from each group. The samples were collected through rectal dilation in plastic containers . Genomic DNA was isolated from the eight fecal samples by using a DNA extraction kit  according to the manufacturer\u2019s instructions. The samples were treated with RNase to degrade RNA, and the quality and quantity (concentration) of DNA were evaluated through agarose gel electrophoresis and NanoDrop spectrophotometry. Sequencing libraries were established for the 16\u00a0S rRNA gene (V3 to V4 region) according to the relevant Illumina protocol. Paired-end shotgun sequencing was performed on the Illumina Hi-Seq 2000 platform. After the elimination of low-quality sequences, the remaining sequences were clustered into OTUs on the basis of \u2265\u200997% similarity assessed using Vsearch (version 2.3.4). Representative sequences were selected for each OTU, and taxonomic data were assigned to each representative sequence by using the Ribosomal Database Project Classifier, as described in a relevant study . OTU abuP\u2009<\u20090.05 indicated statistical significance.The pig was the statistical unit and the level of significance was set at 0.05. Sample size calculations were based on expected prevalence parameters, an expected coefficient of correlation of 0.5, \u03b1-value of 0.05, and power of 0.80. Data were analyzed using generalized linear models . A randomized complete block design was used with \u201cpen\u201d as the experimental unit for the evaluation of growth performance. Each pig was used as an experimental unit for the analysis of blood parameters and microbial counts. The significance of between-group differences was determined using Duncan\u2019s multiple range test (SAS). All data are presented as mean\u2009\u00b1\u2009standard error values."}