diff --git "a/deduped/dedup_0990.jsonl" "b/deduped/dedup_0990.jsonl"
new file mode 100644--- /dev/null
+++ "b/deduped/dedup_0990.jsonl"
@@ -0,0 +1,41 @@
+{"text": "Caenorhabditis elegans retroviruses, are class II viral fusion proteins. Comparisons of divergent viral fusion proteins can reveal features essential for virion:cell fusion, and suggest drug and vaccine strategies.The Bunyaviridae family of enveloped RNA viruses includes five genuses, orthobunyaviruses, hantaviruses, phleboviruses, nairoviruses and tospoviruses. It has not been determined which Bunyavirus protein mediates virion:cell membrane fusion. Class II viral fusion proteins (beta-penetrenes), encoded by members of the Alphaviridae and Flaviviridae, are comprised of three antiparallel beta sheet domains with an internal fusion peptide located at the end of domain II. Proteomics computational analyses indicate that the carboxyl terminal glycoprotein (Gc) encoded by Sandfly fever virus (SAN), a phlebovirus, has a significant amino acid sequence similarity with envelope protein 1 (E1), the class II fusion protein of Sindbis virus (SIN), an Alphavirus. Similar sequences and common structural/functional motifs, including domains with a high propensity to interface with bilayer membranes, are located collinearly in SAN Gc and SIN E1. Gc encoded by members of each Bunyavirus genus share several sequence and structural motifs. These results suggest that Gc of Bunyaviridae, and similar proteins of Tenuiviruses and a group of  Two classes of viral envelope proteins that mediate virion:cell fusion have been described. Class I and II fusion proteins (aka \u03b1-and \u03b2-penetrenes) are distinguished, in part, by the location of the \"fusion peptide,\" a cluster of hydrophobic and aromatic amino acids that appears critical for fusing viral and cell membranes. The fusion peptides of class I fusion proteins are located at or near the amino terminus, whereas fusion peptides of class II fusion proteins are internal. The overall structures of these two classes of viral fusions proteins are also distinct. Class I fusion proteins have a pair of extended \u03b1 helices that are separated by sequences variable in length, but usually containing one or more dicysteine linkages. Several otherwise disparate viruses, including orthomyxoviruses, paramyxoviruses, retroviruses, arenaviruses, filoviruses and coronaviruses encode class I fusion proteins -4. ClassCaenorhabditis elegans retroviruses, are class II viral fusion proteins (\u03b2-penetrenes).The Bunyaviridae family of enveloped RNA viruses includes five disparate genuses. Orthobunyaviruses, phleboviruses, nairoviruses and tospoviruses are spread by insect vectors, whereas hantaviruses are spread by rodent vectors . MembersCaenorhabditis elegans, including Cer13 . We also compared Bunyavirus M sequences to structural proteins of Flaviviruses, including members of the flavivirus genus tick-borne encephalitis virus, strain Neudoerfl ; Japanese encephalitis virus, strain JaOARS982 , yellow fever virus, strain 17D-204 , dengue virus type 2, strain PR-159/S1 , and West Nile virus, strain NY 2000-crow3356 . The prototype hepaciviruses, strain H (subtype 1a) of hepatitis C virus , and several pestiviruses, including the Alfort 187 strain of classical swine fever virus, aka hog cholera virus , bovine viral diarrhea virus genotype 1 aka pestivirus type 1, stain NADL  and border disease virus, strain BD31 , were used in other comparisons.For sequence and structural comparisons of Bunyavirus M encoded proteins representatives of the five genuses were used, including pleboviruses Sandfly fever virus, Sicilian strain  and Rift Valley fever virus , orthobunyavirus Bunyamwera virus , hantavirus Hantaan virus, strain 76\u2013118 , nairovirus Crimean-Congo hemorrhagic fever virus, strain IbAr , and tospovirus tomato spotted wilt virus, ordinary strain . Additional phlebovirus M sequences compared included those of Uukuniemi virus  and Punta Toro virus . Bunyavirus M sequences were compared to sequences encoded in Alphavirus subgenomic RNA, including structural proteins of Sindbis virus , Semliki Forest virus , Venezuelian equine encephalitis virus, strain TC-83 , Western equine encephalitis virus, strain McMillan , O'nyong-nyong virus, strain GULU , Mayaro virus, strain TRVL4675 , Barmah Forest virus strain BH2193  and Ross River virus, strain NB5092 . Comparisons were also made with proteins encoded by RNA2 of the HZ isolate of Rice stripe virus, a Tenuivirus , and with certain retroviruses of ) was the preferred method of secondary structure prediction [). TMpred is based on a statistical analysis of TMbase, a database of naturally occurring transmembrane glycoproteins [Xplorer version 2.2a from the Stephen White laboratory using default settings [ was used to predict mucin type GalNAc O-glycosylation sites. RasMac , developed by Roger Sayle, was used to render a 3D model of SFV E1, which was extrapolated to SIN E1 and SAN GC.Methods to derive general models of surface glycoproteins have been described previously . PRSS3, ediction . PHDsec proteins . Sequencsettings . The NetSimilar sequences or common structural/functional motifs are located collinearly in the carboxyl terminal glycoprotein of Sandfly fever virus and Sindbis virus envelope glycoprotein E1.Previously, Gallaher and coworkers modeled the structure of the retroviral transmembrane glycoprotein (TM)  onto thePrior X-ray crystallographic studies have demonstrated that SFV E1 is a class II viral fusion protein (\u03b2-penetrene) . BecauseTo provide support for the proposed alignment of SAN Gc and SIN E1, another proteomics computational tool was used to compare potential membrane interactive domains in the glycoproteins. Besides fusion peptides, a motif that can be important in virus:cell fusion and is present in many class I and class II viral fusion proteins is an aromatic aa rich domain proximal to the transmembrane anchor . The preRecently, Gibbons and coworkers determined the structure of a fragment of the SFV E1 ectodomain  after exposure to low pH and liposomes . Under tThere are many possible alternatives to the cysteine linkages and secondary structures of SAN Gc drawn in Figure -18). As noted previously [-8). As with phlebovirus Gc, the prototype of the hantavirus genus, Hantaan virus (HAN), showed a modest sequence alignment (p < 0.05) with SIN E1, further supporting the proposed similarities between Bunyavirus Gc and Alphavirus E1. Significant alignments were not detected between Bunyavirus Gc or Alphavirus E1 and TBEV E or other flavivirus class II viral fusion proteins. Limited local similarities were observed between some Bunyavirus Gc and pestivirus E2. It is noteworthy that the significance of the overall sequence similarities between certain phlebovirus Gc and Alphavirus E1 is higher than some similarities among Gc of some prototypic members of the Bunyaviridae . These results further validate the use of the PRSS3 algorithm to identify limited similarities amongst viral proteins. Alignment of the carboxyl terminal portion of the pvc2 protein of rice stripe virus (RiSV), a Tenuivirus, and the envelope protein encoded by Cer13 retrovirus with two phlebovirus Gc reveals a collinear arrangement of fusion peptide consensus sequences . HAN Gn also showed a significant alignment with Gn of RVF, a phlebovirus. Both HAN Gn and Gn of TSWV, a tospovirus, also showed significant alignments with envelope protein 2 (E2) of SIN. SIN E2 has been implicated as the virion protein responsible for binding to the cell surface receptor [The longest open reading frames of M segments of all members of the Bunyaviridae are antisense to the virion RNA. mRNAs transcribed from Bunyavirus M segments are translated into large polyproteins that are subsequently cleaved by into functional proteins ,43. Gc oreceptor . These rThe simplest M polyprotein, encoding only Gn and Gc, is that of hantaviruses Fig. . In addiC. elegans retroviruses previously shown to have remarkable sequence similarities to phlebovirus Gc. These results also indicate that Gallaher's \"Rosetta Stone\" strategy can be used to identify potential class II viral fusion proteins, as demonstrated previously for class I fusion proteins [Proteomics computational analyses suggest that Bunyavirus Gc proteins are class II viral fusion proteins (\u03b2-penetrenes), with a structure similar to the fusion proteins of Alphaviruses and Flaviviruses. Similar sequences or common structural/functional motifs are collinearly located in Bunyavirus Gc and Alphavirus E1. Features common to other class II fusion proteins, including an internal fusion peptide, a carboxyl terminal transmembrane domain and regions with a high propensity to interface with bilayer membranes, are conserved and in similar locations in Gc of viruses in each genus of the Bunyaviridae. These features are also present in glycoproteins encoded by nonenveloped Tenuiviruses of plants, and a group of proteins ,49. The Many viral fusion proteins fit neither class I or II and it is likely that other classes of viral fusion protein also exist. However, among major classes of enveloped RNA viruses, there are at least six, myxoviruses, retroviruses, paramyxoviruses, filoviruses, arenaviruses and coronaviruses, that encode class I viral fusion proteins -4. AlphaAlphaviruses appear to use separate envelope proteins for fusion (E1) and attachment (E2) . BecauseThe remarkable similarities in both the pre- and post-fusion forms of the fusion proteins of SFV E1, an Alphavirus, and DEN and TBEV, members of the flavivirus genus of the Flaviviruses, in the absence of detectable sequence similarities, suggest that Alphavirus and Flavivirus class II fusion proteins may have diverged from a common progenitor. Alternatively, there may have been convergent evolution towards the common structure. Likewise, the sequence similarities detected between phlebovirus Gc and SIN E1 are consistent with divergent evolution from a common progenitor, but are insufficient to directly establish a phylogenic relationship. The results presented here suggest that Gc of members of the Bunyaviridae may have a common ancestor. Gn and Gc are in analogous locations in the polyproteins encoded by the five genuses of the Bunyaviridae. The simplest Bunyavirus M polyprotein, that of hantavirus members, encodes only Gn and Gc, whereas M of members of other Bunyavirus genuses encode several additional proteins. Therefore, divergence of Bunyavirus M segments may have occurred either through acquisition of sequences and/or lose of sequences in a cassette manner constrained in part by the locations of the major glycoproteins.Comparisons of divergent viral fusion proteins with internal fusion peptides can reveal features essential for virion:cell fusion. Regions of high membrane interfacial propensity including the fusion peptide and the transmembrane anchor, appear in similar locations in Bunyaviruses, Alphaviruses and Flaviviruses. The presence of several additional sequences with the propensity to interact with bilayer membranes in class II viral fusion proteins has not been considered in previous virion:cell fusion models ,11,54. CCurrent fusion models do not consider that the transmembrane domain and fusion peptide, while anchored into the viral and cellular membranes, would still be free to move laterally without distorting the membranes. More importantly, the virion is quite small compared to the cell, and would be freely mobile. Rearrangement of the fusion proteins may simply draw the virus closer to the cell without distorting either the viral or cellular membranes. An alternative to the models involving apposing membrane nipple formation is suggested by the observation that sequences of class II viral fusion proteins, including the fusion peptide, the transmembrane anchor and other sequences with high WWIHS scores, potentially form a nearly continuous track of membrane interactive regions that could channel the movement of lipids during virion:cell fusion Fig. , black. In the absence of structural determinations by X-ray crystallography, models such as proposed here can provide useful hypotheses to guide experimental strategies for development of vaccines or drugs to prevent or treat infection by viruses with class II fusion proteins. Prior to the availability of X-ray structural data, several potent HIV-1 TM inhibitors were developed ,57 basedThe authors declare that they have no competing interests.CEG performed the sequence alignments and assisted in the preparation of figures. RFG supervised the work and wrote the manuscript."}
+{"text": "Viral fusion proteins mediate cell entry by undergoing a series of conformational changes that result in virion-target cell membrane fusion. Class I viral fusion proteins, such as those encoded by influenza virus and human immunodeficiency virus (HIV), contain two prominent alpha helices. Peptides that mimic portions of these alpha helices inhibit structural rearrangements of the fusion proteins and prevent viral infection. The envelope glycoprotein (E) of flaviviruses, such as West Nile virus (WNV) and dengue virus (DENV), are class II viral fusion proteins comprised predominantly of beta sheets. We used a physio-chemical algorithm, the Wimley-White interfacial hydrophobicity scale (WWIHS)  in combi Enveloped viruses utilize membrane-bound fusion proteins to mediate attachment and entry into specific target host cells. During the virion assembly process, newly synthesized envelope proteins are targeted to the endoplasmic reticulum and golgi apparatus where initial folding and post-transcriptional processing occurs, including multimerization, glycosylation, and proteolysis. This initial folding and processing is required to achieve a conformation where the proteins are held in a metastable state prior to virion release. Post virion release, the multimeric envelope proteins are poised to undergo structural rearrangement leading to fusion of the virion and the new target cell lipid bilayer membranes. Depending on the virus system, the rearrangement trigger can take the form of specific receptor binding, multiple receptor binding, decreased pH following receptor mediated endocytosis, or a combination of triggers.The prototypic viral envelope fusion protein, the hemagglutinin of influenza virus, contains short alpha helical domains in the trimeric virion configuration. In response to receptor binding and decreased pH, the short helices rearrange with adjoining sequences to produce a longer helix, thus exposing an N-terminal fusion peptide that is believed to interact directly with the target cell membrane. This is followed by a hinge-like bending of the entire complex to adjoin and fuse the two lipid membranes ,3. The sQureshi et al. 1990) demonstrated that a peptide from one of the two extended helical domains of the HIV-1 transmembrane protein can block virion infectivity. Subsequently, the FDA approved anti-HIV-1 drug Fuzeon\u2122  and other N- and C-helix inhibitory peptides were developed ,7. These90 demonsThe envelope fusion proteins of several virus types, including the flaviviruses and alphaviruses, have a structure distinct from class I viral fusion proteins. The envelope glycoprotein (E) of the flavivirus tick-borne encephalitis virus (TBEV) consists of three domains: a structurally central amino terminal domain (domain I), a dimerization domain (domain II) and a carboxyl terminal Ig-like domain (domain III), all containing predominantly beta sheet folds . The priThe flaviviruses, which include DENV, West Nile virus (WNV), yellow fever virus, Japanese encephalitis virus (JEV), and TBEV, among others, are transmitted between vertebrate hosts by insect vectors. The most serious manifestations of DENV infection are dengue hemorrhagic fever (DHF) and dengue shock syndrome (DSS). There are four serotypes of DENV (1\u20134), which together cause an estimated 50 million human infections per year , and eacAlthough there are many differences between the structures of class I and class II viral fusion proteins, we hypothesized that they function through a similar membrane fusion mechanism involving rearrangements of domains, and that peptides mimicking portions of class II viral fusion proteins would inhibit virion fusion and entry steps thereby serving as lead compounds for the development of antivirals. We used a physio-chemical algorithm, the Wimley-White interfacial hydrophobicity scale  in combiThe domains that precede the transmembrane anchors of most class I fusion proteins are not highly hydrophobic, however, they usually contain a cluster of aromatic amino acids and display a tendency to partition into bilayer membranes, as revealed by analyses using the experimentally-determined Wimley-White interfacial hydrophobicity scale (WWIHS) . Fuzeon'To test this hypothesis, an initial set of synthetic peptides representing sequences of DENV E and WNV E with significant WWIHS scores was synthesized and screened for the ability to inhibit plaque formation by these flaviviruses Table . PeptideDose-response curves were determined for the most potent of the peptides WN53 and WN83 against WNV and also for peptide DN59 against DENV . Cross-inhibition of WNV fusion/infectivity (>99% inhibition at <25 \u03bcM) was also reproducibly demonstrated with DN59 Fig. . HoweverTo determine if these peptides specifically inhibit infectivity of the viruses for which they were designed, the WN53, WN83 and DN59 peptides were tested for inhibitory effects against Sindbis virus (SINV), an alphavirus that encodes a class II fusion protein. None of the peptides showed a statistically significant effect against SINV infectivity Fig. . PeptideIt is possible that inhibitory peptides induce cellular alterations or toxicity that can block flavivirus entry or other steps in the replication cycle. To address this possibility, LLCMK-2 monkey kidney epithelial cell monolayers were exposed to 100 mg/ml concentrations of WN53, WN83 and DN59 peptides for 24 hrs, and cell viability was assayed with an MTT assay. No statistical difference was observed between the viability of control cells versus cells exposed to the peptides or DMSO Fig. . This reWhen added in combination, peptides that block entry at different steps or that target different domains may produce greater inhibition of DENV-2 infectivity than either peptide alone. Synergistic or antagonistic effects are also possible, if a peptide that alters protein-protein interactions allows greater or lesser access to E domains targeted by another peptide. Since the WN53, WN83 and DN59 peptides all inhibited WNV entry, the possibility of antagonistic or synergistic function was examined by testing WN53 and DN59 alone or in combination at three concentrations . At all three concentrations, the peptide combination was more effective than WN53 alone, but less effective than DN59 alone. This indicates that the activity of the WN53 peptide has an antagonistic effect on the function of the DN59 peptide Fig. .in vitro cellular toxicity. These results indicate that these inhibitory peptides function through a sequence-specific mechanism and are not merely cytotoxic.Synthetic peptides corresponding to sequences in DENV and WNV E proteins were identified that inhibited infectivity of these viral pathogens of major public health importance. The inhibitory effects of these peptides were dose dependent with IC50s in the range of 10 \u03bcM. Several of the most potent of these peptides showed no inhibitory activity against SINV, an alphavirus that possesses a class II viral fusion protein with a similar overall structure as flavivirus E. Scrambled peptides with the same amino acid composition as the inhibitory peptides, but with a different primary sequence, failed to inhibit DENV and WNV infection. None of the DENV or WNV inhibitory peptides induced gross cytopathic effects, killing of cultured cells or showed evidence of Membrane fusion by both class I and II viral fusion proteins is initiated by interaction of the fusion peptide with the target cell membrane. In class I viral fusion proteins, a subsequent rearrangement of a trimer of the proteins, each with two \u03b1 helices, to form a six-helix bundle brings the viral and cell membranes into closer proximity. Inhibitors of viruses with class I fusion proteins, such as Fuzeon\u2122 that mimic a portion of one or the other of the two \u03b1 helices, interfere with a step proximal to six-helix bundle formation possibly by forming an inactive aggregate with the opposite helix. Recent studies indicate that after insertion of the fusion peptide, class II viral fusion proteins likewise undergo rearrangements. In this case, intraprotein interactions may occur between the stem domain and domains I, II and/or III -28,46. ATwo of the inhibitory peptides (WN53 and WN83) are designed from overlapping regions of the E protein domain I/II junction and are specifically inhibitory against WNV. Recently, other investigators have hypothesized that small molecule inhibitors to this domain I/II junction region might be developed. Modis et al  predicted that interactions near this region (the k-l loop) that are involved in the rotational changes between these domains might be blocked by small molecule inhibitors. However, our similar peptides designed from the analogous region of the DENV E protein (D57 and D81) failed to inhibit DENV infectivity.The possibility that WN53, WN83 and DN59 interact with some target cell surface component to exert their inhibitory effects cannot be ruled out. However, the majority of flavivirus neutralizing antibodies that appear to be involved in receptor blocking bind to domain III, and soluble domain III itself can block flavivirus entry, apparently through competition for cellular receptors -51. In cThe DN59 peptide is inhibitory against DENV as well as WNV. The corresponding pre-anchor region is highly conserved between DENV and WNV as well as among other flaviviruses Table  and probIC50s in the \u03bcM range have been considered promising for class I viral fusion protein inhibitor development ,55. ThusIt is worth noting that the HIV inhibitor Fuzeon\u2122, was initially identified using a predictive strategy without the availability of structural data ,7,57. Th20, and concentrations determined by absorbance of aromatic side chains at 280 nm. Scrambled peptides sequences were obtained by drawing from a hat.Sequences of DENV and WNV E with positive Wimley-White interfacial hydrophobicity scale scores were determined using the program Membrane Protein eXplorer . After c2.DENV strain New Guinea-2 and WNV strain Egypt 101 were obtained from R. Tesh at the World Health Organization Arbovirus Reference Laboratory at the University of Texas at Galveston. DENV and WNV were propagated in the African green monkey kidney epithelial cell line, LLCKM-2, a gift of K. Olsen at Colorado State University. Sindbis virus (SINV) containing the enhanced green fluorescent protein (EGFP) protein expression cassette was obtained from K. Ryman at Louisiana State University at Shreveport and was propagated in baby hamster kidney cells. All cells were grown in Dulbecco's modified eagle medium (DMEM) with 10% (v/v) fetal bovine serum (FBS), 100 U/ml penicillin G and 100 mg/ml streptomycin, at 37\u00b0C with 5% (v/v) CO5 cells in each well of a 6-well plate 48 h prior to infection. Approximately 200-focus forming units (FFU) of DENV, WNV, or SINV/EGFP were incubated with or without peptides in serum-free DMEM for 1 h at rt. Virus/peptide or virus/control mixtures were allowed to infect confluent LLCKM-2 monolayers for 1 h at 37\u00b0C, after which time the medium was removed and the cells were washed once with phosphate buffered saline (PBS) and overlaid with fresh DMEM/10% (v/v) FBS containing 0.85% (w/v) SeaPlaque Agarose . Cells were then incubated at 37\u00b0C with 5% CO2 for 1 day (Sindbis virus), 3 days (WNV) or 6 days (DNV). Sindbis virus infections were quantified by directly counting green fluorescing foci. Cultures infected with DENV were fixed with 10% formalin overnight at 4\u00b0C and permeablized with 70% (v/v) ethanol prior to immunostaining and visualization using a human polyclonal anti-flavivirus antibody  followed by horseradish peroxidase (HRP) conjugated goat anti-human immunoglobulin  and AEC chromogen substrate . WNV plaques were similarly visualized using a mouse anti-WNV antibody  and an HRP conjugated goat anti-mouse antibody .LLCKM-2 target cells were seeded at a density of 3 \u00d7 10Peptide cytotoxicity was measured using the TACS\u2122 MTT cell proliferation assay  according to the manufacturer's instructions."}
+{"text": "Infants with intestinal malrotation present with bilious emesis and the diagnosis is generally obtained by an upper gastrointestinal barium study. Malrotation is suspected if the ligament of Treitz is not positioned to the left of the vertebral body. Three patients were admitted to our department from March 2006 to May 2007, aged three weeks, one month and eight months, weighing 3,3.200 and 8 kg respectively to whom laparoscopic Ladd's procedure was done successfully. Infants with intestinal malrotation present with bilious emesis and the diagnosis is generally obtained by an upper gastrointestinal barium study. Malrotation is suspected if the ligament of Treitz is not positioned to the left of the vertebral body. Barium enema may also be used to detect malrotation by noting the abnormal position of the cecum from its usual placement in the right lower quadrant, but this study is not as reliable due to the mobility of the cecum. Some infants may not have classic radiographic findings for malrotation, yet the contrast studies are not entirely normal.Three patients were admitted to our department from March 2006 to May 2007, aged three weeks, one month and eight months, weighing 3,3.200 and 8 kg respectively.All patients had symptoms of intermittent upper intestinal obstruction, and malrotation was documented by an upper gastrointestinal contrast study. None of the patients had acute volvulus. The procedure was done in all the cases under general anaesthesia, using 5 mm diameter telescope and 3 mm instruments. Port of telescope was placed in the infraumbilical ring, and the instruments right and left mid to lower quadrants without ports. A standard Ladd's procedure with division of the Ladd's bands, incision of the common mesentery and appendectomy. The jejunum and ileum were positioned on the right and the colon on the left in the abdominal cavity.Laparoscopic Ladd's procedure was done successfully in the three cases. Operative times averaged 80 min . Feedings were started on the first postoperative day in two cases and on the second postoperative day in two cases. Hospital stay ranged from two to four days . There were no complications. All patients had resolution of their symptoms.Neonates with a short history of bilious vomiting are most likely to have MGV-complicating malrotation, but older children who have chronic intermittent symptoms are also at risk. Since there is no way to predict which patients will develop catastrophic bowel necrosis, early diagnosis and operation are necessary to prevent mortality and short-gut syndrome.Children with malrotation who are older than two years old have a significant risk of volvulus that is difficult to predict radiologically. They require surgical attention even if asymptomatic. Laparoscopy allows evaluation of the base of the mesentery and completion of the Ladd's procedure.The treatment of the intestinal malrotation with or without midgut volvulus with the Ladd procedure for laparoscopic way has been proposed by several authors since 1995.Laparoscopic Ladd's procedure is a safe and effective technique. It can be performed in neonates in times equivalent to standard open techniques, and it appears to allow for earlier feeds and decreased hospital stays allows a good visualisation of this congenital abnormality, and it is easy to perform with a significantly reduced operative trauma.5Laparoscopic Ladd's procedure is a safe and effective technique for children and infants."}
+{"text": "Haileyesus Getahun and colleagues report the development of a simple, standardized tuberculosis (TB) screening rule for resource-constrained settings, to identify people living with HIV who need further investigation for TB disease. The World Health Organization recommends the screening of all people living with HIV for tuberculosis (TB) disease, followed by TB treatment, or isoniazid preventive therapy (IPT) when TB is excluded. However, the difficulty of reliably excluding TB disease has severely limited TB screening and IPT uptake in resource-limited settings. We conducted an individual participant data meta-analysis of primary studies, aiming to identify a sensitive TB screening rule.We identified 12 studies that had systematically collected sputum specimens regardless of signs or symptoms, at least one mycobacterial culture, clinical symptoms, and HIV and TB disease status. Bivariate random-effects meta-analysis and the hierarchical summary relative operating characteristic curves were used to evaluate the screening performance of all combinations of variables of interest. TB disease was diagnosed in 557 (5.8%) of 9,626 people living with HIV. The primary analysis included 8,148 people living with HIV who could be evaluated on five symptoms from nine of the 12 studies. The median age was 34 years. The best performing rule was the presence of any one of: current cough (any duration), fever, night sweats, or weight loss. The overall sensitivity of this rule was 78.9%  and specificity was 49.6% (95% CI 29.2%\u201370.1%). Its sensitivity increased to 90.1% (95% CI 76.3%\u201396.2%) among participants selected from clinical settings and to 88.0% (95% CI 76.1%\u201394.4%) among those who were not previously screened for TB. Negative predictive value was 97.7% (95% CI 97.4%\u201398.0%) and 90.0% (95% CI 88.6%\u201391.3%) at 5% and 20% prevalence of TB among people living with HIV, respectively. Abnormal chest radiographic findings increased the sensitivity of the rule by 11.7% (90.6% versus 78.9%) with a reduction of specificity by 10.7% (49.6% versus 38.9%).Absence of all of current cough, fever, night sweats, and weight loss can identify a subset of people living with HIV who have a very low probability of having TB disease. A simplified screening rule using any one of these symptoms can be used in resource-constrained settings to identify people living with HIV in need of further diagnostic assessment for TB. Use of this algorithm should result in earlier TB diagnosis and treatment, and should allow for substantial scale-up of IPT.Please see later in the article for the Editors' Summary In 2009, 1.7 million people died from tuberculosis (TB)\u2014equating to 4,700 deaths a day\u2014including 380,000 people living with HIV. TB remains the most common cause of death in people living with HIV and compared to people without HIV, people living with HIV are more than 20 times more likely to develop TB. Furthermore, TB infection may occur at any stage of HIV disease and is often the initial presentation of underlying HIV infection. Without antiretroviral treatment, up to 50% of people living with HIV who are diagnosed with TB die during the 6\u20138 months of TB treatment.Although antiretroviral treatment can reduce the incidence of TB both at the individual and population level, people living with HIV on antiretroviral treatment still have higher TB incidence rates and a higher risk of dying from TB. Therefore, the World Health Organization recommends regular screening for active TB disease in all people living with HIV, so those identified as having active TB disease can be provided with appropriate treatment, and isoniazid preventive therapy  can be given to vulnerable individuals who do not yet have active TB.There is currently no internationally accepted evidence-based tool to screen for TB in people living with HIV\u2014a serious gap given that the presenting signs and symptoms of TB in people living with HIV are different from those in people without HIV. Therefore, the researchers aimed to develop a simple, standardized TB screening rule for resource-constrained settings, on the basis of the best available evidence that would adequately distinguish between people living with HIV who are very unlikely to have TB from those who require further investigation for TB disease.The researchers selected 12 studies that met their strict criteria, then asked the authors of these studies for primary data so that they could map individual-level data to identify five symptoms common to most studies. Using a statistical model, the researchers devised 23 screening rules derived from these five symptoms and used meta-analysis methods  and the association of study-level and individual-level correlates  to evaluate the sensitivity and specificity of each tool used in each individual study.The authors of the selected studies were able to provide data for 29,523 participants, of whom 10,057 were people living with HIV. The dataset included 9,626 people living with HIV who had TB screening and sputum culture performed, of which 8,148 individuals could be evaluated on the five symptoms of interest from nine of 12 studies. TB disease was diagnosed in 5.8% of people living with HIV and the best performing rule was the presence of any one of the following: current cough (any duration), fever, night sweats, or weight loss. The overall sensitivity of the rule was 78.9% and the specificity was 49.6%. However, the sensitivity of the rule increased to 90.1% among participants selected from clinical settings and to 88.0% among those who were not previously screened for TB.The results of this study suggest that in resource-constrained settings, the absence of current cough, fever, night sweats, and weight loss  can identify those people living with HIV who have a low probability of having TB disease. Furthermore, any one of these symptoms can be used in resource-constrained settings to identify people living with HIV who are in need of further diagnostic assessment for TB.Despite the limitations of the methodology used in this study, until there are evidence-based and internationally recommended guidelines for the diagnosis and treatment of TB in people living with HIV, use of the algorithm developed and presented in this study could result in earlier TB diagnosis and treatment for people living with HIV and could help to substantially scale-up isoniazid preventive therapy.http://dx.doi.org/10.1371/journal.pmed.1000391.Please access these websites via the online version of this summary at TB in people living with HIVThe World Health Organization has information about TB and HIV coinfectionThe US Centers for Disease Control and Prevention also provide information about isoniazid preventative therapyThe World Health Organization also has information about TB and HIV co-infectionThe Stop TB Partnership's TB/HIV Working Group provide information about  By the end of 2009, an estimated 33 million people were living with HIV, the vast majority in sub-Saharan Africa and Asia. Tuberculosis (TB) remains the most common cause of death in people living with HIV. Compared to people without HIV, people living with HIV have a more than 20-fold increased risk of developing TB For these reasons, the World Health Organization (WHO) recommends regular screening for active TB disease of all people living with HIV and providing either treatment for active disease or isoniazid preventive therapy (IPT) to mitigate TB morbidity, mortality, and transmission We conducted an individual participant data meta-analysis of published and unpublished studies to develop a simple, standardized TB screening rule for resource-constrained settings that will adequately separate patients into two groups: (1) those for whom TB is reliably excluded, and IPT and ART, if indicated, can be initiated; and (2) those who require further investigation for TB disease. We describe the results of this meta-analysis and propose an algorithm for TB screening among people living with HIV in resource-constrained settings.We proceeded through several steps. First, we prospectively enumerated criteria for studies to be included in our meta-analysis. Second, we searched for and selected studies that met these criteria. Third, we sought primary data from investigators and mapped individual-level data to common symptoms. Fourth, we identified five symptoms available in most studies and, within each study, computed the sensitivity and specificity of 23 screening rules derived from these five symptoms. Finally, we used meta-analysis methods to estimate the performance of all 23 rules, as well as the association of study-level and individual-level correlates with performance.We defined studies as being eligible for inclusion in this analysis if they met the following criteria: (1) collected sputum specimens from people living with HIV regardless of signs or symptoms; (2) used mycobacterial culture of at least one specimen to diagnose TB; and (3) collected data about signs and symptoms.To identify studies eligible for the meta-analysis, we conducted a systematic literature review of studies related to TB screening among people living with HIV in June 2008 using PubMed and various combinations of the following keywords: \u201cHIV,\u201d \u201cTuberculosis,\u201d \u201cTB screening,\u201d \u201cSmear-negative TB,\u201d \u201cSputum negative TB,\u201d \u201cTB case finding,\u201d \u201cIntensified TB case finding,\u201d \u201cIsoniazid prevention treatment, trial or therapy.\u201d We also searched for abstracts presented at conferences organized by the International Union Against TB and Lung Diseases and the International AIDS Society between 2000\u20132008. No language restriction was placed on the search. We reviewed all retrieved titles and abstracts for relevance to the topic. The reference lists of retrieved studies were also reviewed to identify further studies that meet the eligibility criteria. In addition, recognized experts in the field were contacted to identify studies that were not available  in the initial electronic search. Studies that involve concomitant HIV testing and mycobacterial culture on all patients are resource intensive and challenging to implement in countries with a high burden of TB and HIV. Therefore, we believe it is unlikely that eligible studies would have been completed but missed by our search strategy.We found 2,119 publications and reviewed all their abstracts. Using the criteria above, we selected 53 for review of the full text. Twenty-one articles included information on signs and symptoms for TB screening in people living with HIV. A total of 14 studies (six published and eight unpublished at the time of the search) met the inclusion criteria of our meta-analysis . The corInvestigators for all included studies signed a data sharing and confidentiality agreement, and agreed to a data management, analysis, and publication plan. During design and analysis phases of the meta-analysis, the investigators of the studies and data managers of the included studies held multiple discussions by email, by teleconference, and in person in Geneva, Switzerland and Atlanta, Georgia, United States.The list of variables from the most comprehensive dataset Mycobacterium tuberculosis (MTB). We defined participants as having no TB if cultures were negative for MTB and participants were judged not to have TB on the basis of the original study definition of the investigators. We excluded from the analysis: (1) patients who were receiving treatment for TB (infection or disease) at enrolment; (2) patients who were AFB smear positive, but whose culture grew non-tuberculous mycobacteria; and (3) patients who were AFB smear positive or scanty, but sputum culture negative.We defined a TB patient as any person living with HIV and at least one specimen culture positive for All studies were reviewed to identify study-level characteristics that could substantially impact the findings of the meta-analysis. Two studies were conducted exclusively among gold miners living in South Africa We compared characteristics of patients with TB to those of patients without TB to derive a standardized rule for TB screening among people living with HIV. The goal of TB screening is to divide the population of people living with HIV into two groups: (1) those who do not have TB; and (2) those who need further evaluation for the diagnosis of TB . We restricted our analysis to clinical symptoms that could be readily assessed at any level of the health system and that were asked about in all studies: current cough (C), haemoptysis (H), fever (F), night sweats (S), and weight loss (W). Using the four studies that included chest radiography data n\u201d rules as candidates for screening for TB that could best classify patients into two groups (not TB and suspected TB) with high sensitivity n\u201d represents the number of symptom(s) in a given rule. For example, a \u201c1-of-3\u201d rule could be a set of symptoms such as current cough, fever, and weight loss, abbreviated here as CFW. An individual with at least one symptom specified in this particular rule would be classified as a TB suspect; an individual without any of these symptoms would be classified as not having TB. We considered all combinations of the five candidate symptoms except for combinations that include both current cough and haemoptysis, yielding a total of 23 candidate rules: two 1-of-4 rules , seven 1-of-3 rules , nine 1-of-2 rules , and five 1-of-1 rules   and the hierarchical summary relative operating characteristic (HSROC) curve To further understand between-study heterogeneity and other factors associated with the diagnostic performance of the most sensitive rule, we analyzed several study-level predictors  and participant-level predictors . Our analytic methods produced odds ratios that reflect the magnitude of association between each factor and the probability of correctly identifying persons with TB (sensitivity) or without TB (specificity). For a range of TB prevalence values, we calculated the negative predictive values at levels of each covariate. We calculated the ratio of the number of patients that screen positive but who actually have no TB  and hence unnecessarily require additional TB diagnostic evaluation  to the number of patients that screen positive and actually have TB (true positives), which is referred to as the number needed to screen. We calculated this ratio for different rules using a theoretical population of 1,000 people living with HIV with different levels of TB prevalence. This ratio provides proxy information similar to a marginal cost-effectiveness analysis for different screening rules and it helps quantify how much a health program would need to invest  for every patient with TB identified through the screening rule Each observation with a missing covariate value was omitted from analysis of that covariate. BREMA models were fitted using SAS procedure Glimmix , and further calculations were performed in R .All data collection included in the meta-analysis was approved by institutional ethical review boards at the respective institutions during the original study; if necessary, principal investigators requested additional approval from institutional review boards for the inclusion of the primary dataset in the meta-analysis. All data for the meta-analysis were provided completely de-identified. In the meta-analysis dataset, investigators were not able to link case records to individuals.Investigators provided data about 29,523 participants, of whom 10,057 were people living with HIV. The dataset included 9,626 people living with HIV who had TB screening and sputum culture performed, of whom 8,148 could be evaluated on the five symptoms of interest from nine of 12 studies .Most patients  were from sub-Saharan Africa; the rest were from Southeast Asian countries. The median age was 34 y . Of the 9,626 patients with HIV in the 12 studies, CD4 cell count information was available for 3,489 (36%) and chest radiography information for 3,903 (41%). The median CD4 count was 248 cells/\u00b5l .The overall prevalence of TB disease was 5.8% , ranging across studies from 0.4% to 25.7% . More thWe analyzed the performance of individual and combinations of symptoms as screening rules using data from the 8,148 participants who could be evaluated based on the five candidate symptoms. p<0.001) and specificity (p<0.001) of the rule CFSW  and 67.1% (95% CI 41.7%\u201385.3%) among participants selected from clinical and community settings, respectively. Similarly the sensitivity of the rule among those who had not been previously screened for TB was higher at 88.0% (95% CI 76.1%\u201394.4%) compared to those who had been screened for TB at 40.5% (95% CI 16.6%\u201369.9%). At the 95% confidence level, the sensitivity of this rule could not be statistically distinguished from the sensitivity of the rule that substitutes haemoptysis for current cough  or the rule that drops night sweats . All other rules had lower sensitivity.Regression analysis of study-level predictors revealed that studies in which TB screening was performed in clinical settings had 4.5 times the odds for a true-positive screening result compared to studies in which TB screening was performed in a community setting (95% CI 1.0\u201319.5). Studies of participants who had not previously been screened for TB had 10.8 times the odds for a true-positive screen (95% CI 2.4\u201347.8) compared with studies in which participants had previously been screened for TB. Participants with CD4 cell count <200 cells/\u00b5l had 6.4 times the odds of a true-positive screen (95% CI 2.9\u201314.2). Statistically significant predictors of true-negative results include prescreening, geographic region, participant age \u226533 y, CD4 cell count <200 cells/ml, and abnormal result on chest radiograph .Four studies On the basis of our meta-analysis findings and incorporating current WHO recommendations on provision of IPT, we developed a simple TB screening algorithm for public health programmes to screen people living with HIV, and, depending on the outcome of screening, to either provide IPT or evaluate patients further for TB or other diseases .We found that the absence of all of current cough, fever, night sweats, and weight loss can identify a subset of people living with HIV who have low probability of having TB disease. This screening rule was superior over other candidate rules in eight of the nine studies included and had an overall favourable performance over competing rules in the hierarchical summary relative operating characteristic (HSROC) analysis. We also demonstrated that the negative predictive value of the rule was high across a range of TB disease prevalence estimates and across different population subsets, including those with low and high CD4 count, and those drawn from clinical and community settings and South African miners. We believe that these screening questions are likely to be acceptable to practitioners, because they are symptoms classically associated with TB disease.Underdiagnosis and delayed diagnosis of TB contribute to excess mortality among people living with HIV The major change to existing practice would be the replacement of chronic cough with current cough as a screening question and the addition of other symptoms to standard screening. National TB programs have traditionally defined a TB \u201csuspect\u201d as someone with cough lasting greater than 2 or 3 wk, and designed case-finding activities to investigate up to ten TB suspects for every TB case detected There has been ongoing debate about the importance of chest radiography in screening people living with HIV for IPT eligibility Our findings show that the utility of the proposed symptom-based screening rule have excellent performance in most settings with TB and HIV burden. However, the negative predictive value will fall in those settings with higher TB prevalence when symptom screening alone is used, as it depends on prevalence of disease. In particular settings , which was similar to the one we propose as the best performing one Greatly improving TB screening, diagnosis, and treatment in people living with HIV will require deployment of a rapid, accurate, point-of-care TB diagnostic test. In the absence of such a test, we believe that a standardized algorithm employing symptoms, as we propose here, can improve the diagnosis and treatment of TB for people living with HIV, and by doing so would save many lives. Reliable exclusion of TB disease will facilitate safer initiation of antiretroviral therapy and will allow for broader use of IPT, which can substantially reduce TB incidence. Earlier and accurate HIV and TB screening and treatment may also help identify infectious cases earlier, thereby reducing both HIV and TB transmission. Evidence-based and internationally recommended guidelines should be used to expedite the diagnosis and treatment of TB in people living with HIV Figure S1n rules.Hierarchical summary relative operating characteristic (HSROC) curves for the 23 candidate 1-of-(0.08 MB DOC)Click here for additional data file.Table S1Phrasing of questions that were used in all studies to ask about five common symptoms.(0.09 MB DOC)Click here for additional data file.Table S2Study-specific values and rankings of the sensitivity of each candidate screening rule in the nine studies included.(0.14 MB DOC)Click here for additional data file.Table S3Diagnostic performance of all 23 candidate rules and number needed to screen in a hypothetical population of 1,000 people living with HIV stratified by TB prevalence among people living with HIV.(0.15 MB DOC)Click here for additional data file.Table S4Diagnostic performance of 23 candidate rules that include abnormal chest radiograph and number needed to screen in a hypothetical population of 1,000 people living with HIV stratified by TB prevalence among people living with HIV.(0.15 MB DOC)Click here for additional data file."}
+{"text": "Computed Tomography (CT) is a technology that obtains the tomogram of the observed objects. In real-world applications, especially the biomedical applications, lower radiation dose have been constantly pursued. To shorten scanning time and reduce radiation dose, one can decrease X-ray exposure time at each projection view or decrease the number of projections. Until quite recently, the traditional filtered back projection (FBP) method has been commonly exploited in CT image reconstruction. Applying the FBP method requires using a large amount of projection data. Especially when the exposure speed is limited by the mechanical characteristic of the imaging facilities, using FBP method may prolong scanning time and cumulate with a high dose of radiation consequently damaging the biological specimens.1-lnorm of the sparse image as the constraint factor for the iteration procedure. With this method, we can reconstruct images from substantially reduced projection data and reduce the impact of artifacts introduced into the CT reconstructed image by insufficient projection information.In this paper, we present a compressed sensing-based (CS-based) iterative algorithm for CT reconstruction. The algorithm minimizes the To validate and evaluate the performance of this CS-base iterative algorithm, we carried out quantitative evaluation studies in imaging of both software Shepp-Logan phantom and real polystyrene sample. The former is completely absorption based and the later is imaged in phase contrast. The results show that the CS-based iterative algorithm can yield images with quality comparable to that obtained with existing FBP and traditional algebraic reconstruction technique (ART) algorithms.Compared with the common reconstruction from 180 projection images, this algorithm completes CT reconstruction from only 60 projection images, cuts the scan time, and maintains the acceptable quality of the reconstructed images. Computed Tomography (CT), which obtains a series of projection data of objects concerned from several view angles, can get the tomograms of the objects through the technology of image reconstruction. From a purely mathematical standpoint, the solution to the problem of how to reconstruct a function from its projections dated back to the paper by Radon in 1917. The current excitement in tomographic imaging originated with Hounsfield's invention of the X-ray computed tomographic scanner for which he received a Nobel Prize in 1972 . Thus, tIn real-world applications, especially the biomedical applications, higher temporal resolution and lower radiation dose have been constantly pursued. One can reduce scanning time and radiation dose by decreasing X-ray exposure time at each projection view. However, the reduction of exposure time would further lower the signal-to-noise ratio (SNR) of the projection images and consequently lower the reconstructed images' quality . The oth1l-norm of the sparse image as the constraint factor for the iteration procedure. This work focuses on reconstructing images from significantly reduced projection data, shortening scanning time, minimizing radiation dose without reducing image quality, and employing this algorithm in phase contrast imaging experiments.Compressed sensing theory, also known as compressive sampling or CS, suggested by Cand\u00e8s, Romberg, Tao and Donoho in 2006 , states The paper is organized as follows. In section 2, the experimental set-up will be introduced for our polystyrene sample imaging. In section 3, the materials and methods for data scanning and image reconstruction will be described, in section 4, numerical results under different conditions are reported and the reconstructed and reference images at the visualization-based and quantitative-metric-based evaluation levels are compared. Finally, the implication of the results will be further discussed in section 5.Phase contrast X-ray imaging -13 enabl2 per pixel. The schematic set-up of this analyzer based imaging (ABI) system is shown in Figure Our experiment was performed at the 4W1A beamline of Beijing Synchrotron Radiation Facilities (BSRF). The synchrotron X-ray beam was 20 mm in width by 10 mm in height. The X-ray beam energy was set at 15keV in this experiment. The distance between the synchrotron radiation source and the sample was approximately 43 m. The X-ray CCD was the Photonic Science X-ray FDI-18 mm camera system with 1300 \u00d7 1030 pixels, and 10.9 \u00d7 10.9 \u03bcmBoth software phantom and real sample were used to test our algorithm. The software phantom was a discrete 256 \u00d7 256 Shepp-Logan phantom  there are infinitely many x in transform domain by solving the linear program [where \u03a6 program -81 -lnorm of the vector x as x represents the gradient image vector of the desired image.Define the = \u2211i=1Nxi. In thisThe constraints where \u03b5 is a small error factor.1 -lnorm of the gradient image [To minimize the nt image ,22,23, agradient \u03b1 is constant to control the descent speed and 1 -lnorm of the gradient image which can also be thought of an image. Each pixel value of it is expressed as the following partial derivative [where rivative To avoid the condition that the denominator vanishes, a small positive number \u03b5 is added in each radical sign.In the discrete setting, the parallel-beam projection-data vector i, j \u03c6of the system matrix \u03a6 is computed by the intersection length of the ith ray through the jth pixel. Using a sketch we can understand it clearly. In Figure f0, f1, f2, and f3; g1 is a measurement; and the X-ray l1 passed pixels f0, f1, and f3; the lengths passed these three pixels are \u03c61, 0, \u03c61, 1 and \u03c61, 3 respectively. The computation of the weight \u03c6 is complex. The immediate computation of each \u03c6 will prolong the reconstruction time. Especially with iteration times' increasing, the computation of weights will repeat again and again. A solution is to save the weights in a file in advance and read the weights from this file during the iteration. Since the X-rays are parallel-beam, we can take advantage of the symmetrical characteristic of X-rays. In Figure a, b, c, and d. Actually, the measurements obtained by the integral along the X-rays 1, b1, c1 aand 1 dare detected by the same detector in different rotate angles which are \u03b1, (90- \u03b1), (90+ \u03b1) and (180- \u03b1) degrees respectively. The 1, a2a,..., m ais a set of parallel beams. These eight X-rays  in Figure y = -x is the symmetrical axis of 1 aand 1b; the x-axis is the symmetrical axis of 1 band 1c, also 1 aand 1d; and the parallel beams 1 aand m , b1 aand m , c1 band m , d1 cand m d, are symmetrical to the origin. So, if we have a weight value in X-ray 1 a(the wide segment in line 1a), we can gain the other seven weight values (the wide segment in the other seven lines) using the symmetrical characteristics.The weight component In the following, we give the steps of the reconstruction algorithm in the form of a pseudo-code and abbreviated notation.f:(1) initialization of the image (2) iterative process:k is from 1 to M. When k = M , a complete iteration period was finished. The next iteration will enforce the estimated image to the constraint where the relaxation parameter \u03bb  is a pos(3) initialization of the gradient descent image:(4) gradient descent iteration:In this iteration, the end time we selected is 5.(5) Initialize the next iterative step:(M) fand the previous (M) fis smaller than the threshold we set or the iteration number is more than 1000.then we repeat step (2) - (5) until the difference between the current \u03bb = 1.0, \u03b5 = 0.0001, and \u03b1 = 0.5 respectively. The threshold value to stop iteration was set as 0.001. These presetting parameters and coefficients only appear to alter the convergence rate.About the control parameters, we selected To demonstrate this CS-based iterative algorithm for image reconstruction from under-sampled projection data, we performed two sets of studies: the first set of studies were designed in such a way as to acquire some theoretical understanding of how the CS-based iterative algorithm performs on image reconstruction from reduced projection data with the parallel-beam configuration under ideal conditions, and the second set of numerical examples aimed to see how the CS-based iterative algorithm could be applied to phase contrast CT image reconstruction.g contain no noise and the full scan views data are used, one might expect to reconstruct images accurately. However, in the present studies, the projection data were under-sampled in view angle. We performed the FBP, traditional algebraic reconstruction technique (ART) and CS-based iterative reconstruction algorithms under the condition that the numbers of views were 60 and 30. The image-quality evaluation for each specimen was performed at two different levels, including 1) visualization-based evaluation, and 2) quantitative-metric-based evaluation. Some of the evaluation concerns make a comparison between the reconstructed and original images.Recall Eq. 3, in the situation that the measurement data Visual inspection of reconstructions in Figure In addition to visualization-based evaluation, the following three metrics were employed to quantitatively assess the similarity between reconstructed images and the original phantom image: 1) the root mean squared error (RMSE), 2) the universal quality index (UQI) , and ther fand 0 fdenote the reconstructed and original images of N pixels, andwhere vector The RMSE is widely used for measuring reconstruction accuracy, whereas the UQI and CC can be used for evaluating the pixel-to-pixel similarity between reconstructed and original images. When assessing the image's quality, we demand the RMSE index to be as small as possible, while expecting the UQI and CC to have the contrary results.In Figure From the digital Shepp-Logan phantom and reconstructed images, we computed their RMSEs, UQIs, and CCs and summarized them in Table In addition to the simulated experiments with Shepp-Logan phantom, phase contrast X-ray imaging of a real polystyrene phantom was also performed. We collected 180 radiographs at 180 views. From this full data set, we applied the conventional FBP algorithm to yield the reference CT image in the 44th slice  in the reconstructed images may be one direction of our further work.In conclusion, the paper aims to reduce the impact of artifacts introduced into the CT reconstructed image by insufficient projection information. The feasibility of this method which enforces the gradient descent for constraints in traditional iterative algorithms has been demonstrated by both the simulated phantom and the real polystyrene sample experiments. The results show that the CS-based iterative algorithm can yield images with quality comparable to that obtained with existing FBP and traditional ART algorithms. Further research will be performed to improve algorithm efficiency. Moreover, applying this algorithm to a less \"sparse\" sample such as the real biological soft tissues of small animals and studying how effective the method would be is our future concern.The authors declare that they have no competing interests.XL worked on the algorithm design and implementation, and wrote the paper; SL contributed to discussion and suggestions throughout this topic, including the manuscript writing. All authors read and approved the final manuscript."}
+{"text": "Caenorhabditis elegans causes synaptic dysfunction accompanied by impaired motor phenotypes. FET proteins are also involved in the regulation of lifespan and stress resistance, acting partially through the insulin/IGF-signalling pathway. We propose that FET proteins are involved in the maintenance of lifespan, cellular stress resistance and neuronal integrity.The FET protein family includes FUS, EWS and TAF15 proteins, all of which have been linked to amyotrophic lateral sclerosis, a fatal neurodegenerative disease affecting motor neurons. Here, we show that a reduction of FET proteins in the nematode  FUS) are one of the causes of amyotrophic lateral sclerosis (ALS)12EWSR1 gene encoding the EWS protein) and TBP associated factor 15 (TAF15). These proteins are highly similar and it is thought that they share common functions5EWSR1 and TAF15 mutations have been linked to some sporadic cases of ALS7Mutations in fused-in-sarcoma  deletion mutant in worms. C. elegans has a simple, largely non-redundant genome and many highly conserved human genes have a single orthologue in the nematode. Here, fust-1 is the orthologue of FUS, EWSR1 and TAF15. Using a loss of function mutation, we show that fust-1 is a key gene acting to regulate neuronal integrity, lifespan and cellular stress responses. Also, for some of these functions, fust-1 is an active component of the insulin/IGF-like signalling pathway (ISS).To better understand the function of FET proteins, we characterised the fust-1, which encodes the C. elegans orthologue of FUS, EWSR1, TAF15. At the protein level, FUST-1 shares 50% identity with the FUS human protein, 32% identity with EWS and 35% identity with TAF15 (http://www.cbs.dtu.dk/services/NetNES/) and Prosite (http://prosite.expasy.org/scanprosite/) confirmed the conservation of the main functional domains of FET proteins including the RNA binding domain, the zinc finger motif and the nuclear export signal  which contains a homozygous 240 base pair deletion in the N terminal part of the gene. The tm4439 allele is an in-frame deletion spanning 15\u2009bp of the second intron, and 225\u2009bp of exon 3 that is predicted to code for a protein product missing 75 amino acids compared to wild type FUST-1. While fust-1 mRNA level increases during adulthood in wild type animals, fust-1(tm4439) mutants exhibit a similar expression level throughout adulthood which is at least 50% lower than the expression level of wild-type worms at day 1 (fust-1(tm4439) is likely a hypomorphic mutation that results in decreased RNA expression and may produce a defective protein product, suggesting that these worms could be used to model a partial loss of function of FUST-1.To understand the function and role of the FET proteins, we characterised th TAF15 . Bioinfot signal . To inveat day 1 . Thus, fFUS in Drosophila, Cabeza, have suggested that a decreased expression of Cabeza in flies induces neuronal dysfunction and defects in neuromuscular junction morphology101112C. elegans, deletion mutant worms were evaluated for age-dependent paralysis, a motor phenotype that has been shown to be a good predictor of neuronal integrity1415fust-1(tm4439) mutants showed normal motor behaviour when compared to wild-type N2 worms, but as the mutants aged they showed progressive motility defects leading to paralysis, reaching 66% paralysis by day 12 of adulthood compare to the 13% observed for wild-type N2 controls  mutants exhibit an increase in the number of gaps or breaks along the ventral cord probably due to axonal fragmentation  propanal o-[(methylamino)-carbonyl] oxime), an acetylcholine esterase inhibitor that causes the build-up of acetylcholine at the neuromuscular junction leading to paralysisaldicarb . These dfust-1(tm4439) worms were due to the loss of function of fust-1, we generated a transgenic worm expressing full-length fust-1 linked to GFP under the control of its own promoter (fust-1p::fust-1::GFP). This strain displays GFP expression throughout development and adulthood with expression in the head, pharynx, intestine and tail of the adult worm  worms  worms  suggestifust-1(tm4439) deletion mutant worms.Overall, these results suggest that synaptic dysfunction precedes neuronal loss and that aging could promote the development of the motor phenotype observed in the C. elegans and central to lifespan and stress response mechanisms is the insulin /IGF-like signalling pathway (IIS)C. elegans and hypomorphic daf-2 mutants are long-lived and highly resistant to environmental stressdaf-2(e1370); fust-1(tm4439) double mutant strain and observed that the loss of fust-1 completely abolished the extended lifespan phenotype of daf-2(e1370) mutants  transcription factor encoded by daf-16. The long-lived phenotypes of daf-2 mutants is completely dependent on daf-16daf-16(mu86) mutants are short-lived but fust-1(tm4439); daf-16(mu86) double mutants have lifespan similar to daf-16(mu86) mutants alone  mutants have a normal lifespan at 20\u2009\u00b0C and 25\u2009\u00b0C , a natural product that causes the production of intracellular free radical in worms causing an acute oxidative stressfust-1 deletion mutants were more sensitive than wild-type N2 worms (fust-1p::fust-1::GFP transgene in fust-1(tm4439) mutants (daf-2(e1370); fust-1(tm4439) double mutants and observed that these animals were more sensitive to oxidative stress than daf-2(e1370) mutants, but more resistant than fust-1 mutants alone    was usedf fust-1 . To eval-type N2 . Howeverf fust-1  suggestiC. elegans31daf-16 mutants was tested on fust-1 motor phenotypes. The lack of daf-16 neither increased nor decreased the paralysis of the fust-1(tm4439) mutants . Interestingly in Drosophila, Cabeza was also shown to be involved in lifespan, neuronal integrity, and synaptic function101113C. elegans. In a recent FUS knock-out model, mice with a complete loss of expression of FUS exhibit changes in behaviour but no motor neuron lossEWSR1 and TAF15 expressionThe fust-1 deletion mutant, we have also shown that the FET protein family is involved in the IIS to maintain longevity and stress resistance. When the IIS pathway is activated, the effect of DAF-2 leads to the phosphorylation of DAF-16 that inhibits its function as a transcription factorfust-1 is downstream of daf-16 and that a reduction in the pathway causes an overexpression of fust-1. In human, IIS exerts its effect through many effectors including its many receptors, the kinases PI3K and AKT as well as FOXO transcription factors. TAF-15, EWS and FUS all contain a RNA binding domain suggestive of a role in RNA expression and metabolism. In a previous study, using UV cross-linking immunoprecipitation followed by whole transcriptome sequencing (CLIP-seq), many RNA targets of the FET protein family have been revealed. Interestingly, members of the AKT and FOXO protein family were identified as targets of wild type TAF-15, EWS and FUS proteins in human cellsC. elegans mutants, we have shown genetic interactions between the FET proteins and members of the IIS, and results from humans supports our hypothesis and suggest direct interactions with members of the IIS.Using the C. elegans deletion mutants, several functions of the FET proteins have been revealed. FUST-1 is actively participating and regulated by the IIS for the maintenance of lifespan and for proper resistance to oxidative stress. Independently of the IIS, FUST-1 is involved in neuronal integrity and the osmotic stress response suggesting its participation in other stress response pathways. It is still unclear if mutations of the FET protein family causative of ALS results in a loss of function or a gain of function. However, mutations in essential tremor, another neurodegenerative disorder, were found in FUS and are suggestive of a loss of function mechanismIn conclusion, using Escherichia coli strain at 20\u2009\u00b0C if not specified otherwise. For a list of strains used see fust-1p::fust-1::GFP fosmid was obtained by the TransgenOme projectunc-119(ed3) worms.Standard methods for culturing and handling the worms were usedhttp://blast.ncbi.nlm.nih.gov/blast/Blast.cgi?PROGRAM=blastp&PAGE_TYPE=BlastSearch&LINK_LOC=blasthome). For prediction of the functional domain of FUST-1 NetNes (http://www.cbs.dtu.dk/services/NetNES/) and Prosite (http://prosite.expasy.org/scanprosite/) were used with FUST-1 coding sequence (Wormbase). Protein alignments were done using Clustal Omega  using the coding sequence mentioned above and followed by processing with BoxShade (http://www.ch.embnet.org/software/BOX_form.html).For amino acid alignment, FUST-1 protein sequence was used as query sequence (Wormbase) and compared to FUS (CCDS58454.1), EWS isoform (CCDS54513.1) and TAF15 (CCDS59279.1) as subject sequence and align using BlastP  test. Standard error is shown on graphs.E. coli  in a flat-bottom 96-well plate. Measurement was done using Microtracker (Phylumtech), at least 3 wells were done per condition. Standard error is shown on the graph.A synchronised population was obtained using hypochlorite extraction. Worms were grown on solid media up to day 1 of adulthood. At day 1, 30 worms per well were placed in S basal with OP-50 unc-47p::mCherry marker were selected for visualisation. To evaluate synaptic integrity, transgenic worms expressing snb-1p::GFP were selected. For neurodegeneration counts during stress tests, adult day one worms were transferred to NGM\u2009+\u2009400\u2009mM NaCl at 20\u2009\u00b0C (osmotic stress) or normal NGM and put at 37\u2009\u00b0C  for six hours or for oxidative test worms were transferred on 240\u2009uM juglone for 30\u2009minutes at 20\u2009\u00b0C. For visualization, animals were immobilized in M9 with 5\u2009mM of levamisole and mounted on slides with 2% agarose pads. For all experiments, a minimum of 100 worms was scored for all conditions. The mean and SEM were calculated and two-tailed t-tests were used for statistical analysis.To score gaps along the GABAergic neurons, day one, five and nine worms expressing the transgenic daf-16 RNAi lifespan RNAi clone from the ORFeome RNAi library (Open Biosystems) was used. RNAi experiments were performed at 20\u00b0C. Worms were grown on NGM enriched with 1\u2009mM Isopropyl-b-thiogalacto-pyranoside (IPTG). Worms were counted every two days until their death. At least 100 worms were counted per strain. Survival curves and statistics were produced using Log-rank (Mantel-Cox) test. Standard error is shown on graphs.Worms were grown on NGM and transferred on NMG\u2009+\u20095\u2009\u03bcM FUDR at day 1 of adulthood. For Worms were grown on NGM until day 1 of adulthood. At day 1, worms were transferred onto 400\u2009mM NaCl plates for osmotic stress, or 240\u2009\u03bcM juglone for oxidative stress or onto NGM and put at 37\u2009\u00b0C for thermal stress. Worms were counted every two hours for up to 14\u2009hours for osmotic and thermal stress and every 30\u2009minutes for three hours for oxidative stress. Survival curves and statistics were produced using Log-rank (Mantel-Cox) test. Standard error is shown on graphs.fust-1 (probe Ce02434658_g1 Life technologies) and act-5 (probe Ce02454560_g1 Life technologies) as endogenous control were used. Expression level were calculated by converting the threshold cycle (Ct) values using the 2\u2212\u0394\u0394Ct method49Worms grown on NGM plates were collected before starvation and froze in Trizol. Total RNA was extracted according to the manufacturer protocol. 1\u2009ug of RNA was used to produce cDNA using Vilo cDNA enzyme. Taqman probes detecting How to cite this article: Therrien, M. et al. FET proteins regulate lifespan and neuronal integrity. Sci. Rep. 6, 25159; doi: 10.1038/srep25159 (2016)."}
+{"text": "Proprioceptive function can be affected after neurological injuries such as stroke. Severe and persistent proprioceptive impairments may be associated with a poor functional recovery after stroke. To better understand their role in the recovery process, and to improve diagnostics, prognostics, and the design of therapeutic interventions, it is essential to quantify proprioceptive deficits accurately and sensitively. However, current clinical assessments lack sensitivity due to ordinal scales and suffer from poor reliability and ceiling effects. Robotic technology offers new possibilities to address some of these limitations. Nevertheless, it is important to investigate the psychometric and clinimetric properties of technology-assisted assessments.We present an automated robot-assisted assessment of proprioception at the level of the metacarpophalangeal joint, and evaluate its reliability, validity, and clinical feasibility in a study with 23 participants with stroke and an age-matched group of 29 neurologically intact controls. The assessment uses a two-alternative forced choice paradigm and an adaptive sampling procedure to identify objectively the difference threshold of angular joint position.p<0.001). Furthermore, we observed larger proprioceptive deficits in participants with a right hemisphere stroke compared to a left hemisphere stroke (p=0.028), despite the exclusion of participants with neglect. No meaningful correlation could be established with clinical scales for different modalities of somatosensation. We hypothesize that this is due to their low resolution and ceiling effects.Results revealed a good reliability  = 0.73) for assessing proprioception of the impaired hand of participants with stroke. Assessments showed similar task execution characteristics  between participants with stroke and controls and a short administration time of approximately 12 min. A difference in proprioceptive function could be found between participants with a right hemisphere stroke and control subjects (This study has demonstrated the assessment\u2019s applicability in the impaired population and promising integration into clinical routine. In conclusion, the proposed assessment has the potential to become a powerful tool to investigate proprioceptive deficits in longitudinal studies as well as to inform and adjust sensorimotor rehabilitation to the patient\u2019s deficits. Proprioception is of great importance for the control of fine and coordinated movements of the upper limb \u20134, and tIn order to investigate and better understand the role of proprioception in the recovery of neurological patients, for diagnosis as well as the design of therapeutic approaches, accurate and sensitive assessments are essential. Only very few assessments for proprioception are clinically used  joint proprioception on a ratio scale  in partiTwenty-three participants with stroke were recruited and enrolled in this study. They had to be >2 weeks after their first clinical stroke (without an upper limit on post-stroke weeks). Participants with stroke were recruited on a patient-by-patient basis among the patients receiving an inpatient neurological rehabilitation at the Kliniken Schmieder Allensbach, Germany. Exclusion criteria for the participants with stroke were inability to detect any manually applied large passive finger movements. Other exclusion criteria regarding somatosensory deficits were not defined in this exploratory study to have a heterogeneous sample population with potentially a wide range of levels of proprioceptive deficits. Additional exclusion criteria were severe hand edema, high muscle tone\u2014particularly in the flexor digitorum superficialis muscle and the flexor digitorum profundus muscle\u2014evaluated with the Modified Ashworth Scale , or pain\u24c7 bands, in an attempt to maximize comfort in any pathological hand and arm posture required by the tested subject. The flexion and extension displacements are controlled by software  running on an all-in-one touchscreen computer covering the tested hand 1) to ass11A two-interval, 2AFC paradigm  in combiEach trial consisted of two consecutive passive index finger movements to different MCP joint flexion angles applied by the robotic apparatus. Each movement sequence  started at a horizontal finger position (referred to as rest position) as depicted in Fig.\u00a011x) between the two presented angles of one trial was always defined as positive and determined by the PEST algorithm . As starting parameters of the PEST algorithm, a start level x0 and a start step of 5.5\u00b0 and 2\u00b0, respectively, were chosen. The other PEST parameters W=1 and Pt=0.75 were chosen for the Wald sequential likelihood-ratio test , in order to reduce estimation bias ICC man plot . The relTo compare the outcome measures of NIC subjects to participants with stroke and to create models of neurologically intact performance, the PEST sequences of the NIC subjects were truncated to 60 trials to be of same length as for the participants with stroke. Furthermore, outliers in the NIC group were identified according to Tukey\u2019s rule and excluded from all statistical analysis.t-tests or Wilcoxon rank sum tests, respectively paired-sample t-tests or paired Wilcoxon signed rank tests, were conducted depending on whether data (or their differences for paired testing) were normally distributed or not. Normality was tested with the Shapiro\u2013Wilk or the Shapiro\u2013Francia test, depending on the kurtosis. To correct for multiple comparisons, a \u0160id\u00e1k-correction was used. To compare the effect of a LHS versus a RHS on proprioceptive function of the impaired hand (as well as unimpaired hand), their differences to NIC baseline of the corresponding hand were compared in an unpaired test. As NIC baseline the median was used, as the distributions of the left and right DL in NIC subjects were not both normally distributed. Again, the test-retest average was used for the participants with stroke.Outcome measures from the robotic assessment were compared between the left and right hand of NIC subjects (paired test), between the impaired hand of the participants with stroke and the corresponding hand in NIC subjects (two unpaired tests for LHS and RHS), and between the unimpaired hand of the participants with stroke and the corresponding hand in NIC subjects (two unpaired tests for LHS and RHS). For participants with stroke, the average of both test and retest outcomes was used. Two-sample Subjects in this study were not age-matched on an individual basis but on a group level by including subjects within the same age range. In return, the sample size of NIC subjects was chosen to be larger, which should improve the estimated distribution of DLs for the same age range. To model neurologically intact performance in elderly, log\u2013normal (semi-infinite positive support) probability density functions were fitted on the DL data of NIC subjects for the right (dominant) and left (non-dominant) hand separately. The 95th percentile was used to characterize impairment in participants with stroke. The CI for the 95th percentile cutoff were calculated by bootstrapping.t-test or paired Wilcoxon signed rank test, depending on normality of the paired differences), and between NIC subjects (mean of both hands for each subject) and the impaired, respectively unimpaired hand of participants with stroke . The \u0160id\u00e1k-correction method was used to correct for multiple comparisons.The trial duration of the robotic assessment was compared between impaired and unimpaired hands of participants with stroke  and the outcome measures of the clinical scales . As the up-down test also measures proprioception, the correlation with the robotic assessment could be regarded as a test for concurrent validity. The clinical scores for the impaired hand and the working memory test were also compared between the participants with RHS and LHS with two-sample t-test or Wilcoxon rank sum test, depending on normality of the distributions).The influence of sex on the proprioceptive outcome measures was tested by separately comparing the robotic outcome measures for the dominant as well as the non-dominant hand in male versus female NIC subjects, and for the impaired as well as the unimpaired hand in participants with stroke  was reported. All statistical analyses were performed in MATLAB R2014a .Significance levels were set to Twenty-one participants with stroke completed the two sessions of robotic assessments, and two participants with stroke dropped out of the study . As reported by the therapist conducting the robotic assessments, one of the 21 participants with stroke (P13) was not able to correctly follow the task instructions and showed severe concentration problems. Therefore, this participant was excluded from all statistical analyses. Of the 20 participants with stroke , 10 suffered from a LHS and 10 from a RHS. Participants with stroke were 43.7\u00b1118.8 weeks post lesion . For one chronic participant with stroke (P17) only the year but not the exact lesion date was known. Average number of days between the test and retest of the robotic assessment in participants with stroke was 2\u00b11 days , and between the clinical assessment and the first robotic assessment was 4\u00b14 days . The demographics of all the 23 recruited participants with stroke can be found in Table\u00a0t(27)=1.046,p=0.838). No significant effect of sex on the DL was found in NIC subjects . Participants with LHS averaged at 2.35\u00b0 \u00b1 0.94\u00b0  for the impaired (right) hand, and 2.43\u00b0 \u00b1 0.80\u00b0  for the unimpaired (left) hand. Participants with RHS averaged at 3.95\u00b0 \u00b1 2.36\u00b0  for the impaired (left) hand, and 3.31\u00b0 \u00b1 2.66\u00b0  for the unimpaired (right) hand. No significant effect of sex on the DL was found in participants with stroke . For participants with LHS, there was no significant difference between their impaired (right) hand and the right hand of NIC subjects (t(36)=1.747,p=0.373). However, there was a significant difference between their unimpaired (left) hand and the left hand of NIC subjects . For participants with RHS, proprioception of the impaired (left) hand was significantly worse than the left hand of NIC subjects (t(36)=4.656,p<0.001), whereas the unimpaired (right) hand was not significantly different . The difference from baseline for the impaired hand in participants with RHS was significantly larger compared to participants with LHS (t(18)=\u22122.384,p=0.028). There was no significant difference between the unimpaired hand in participants with RHS compared to participants with LHS . The two log\u2013normal models for neurologically intact proprioception were DL \u223cLognormal with \u03bc= 0.493 and \u03c3= 0.508 for the right, dominant hand and \u03bc= 0.381 and \u03c3= 0.455 for the left, non-dominant hand. The 95th percentile of NIC subjects was 3.78\u00b0  for the right and 3.10\u00b0  for the left hand. The DL of the left hand was higher than the 95th percentile for 2 NIC subjects. The test-retest average outcome value of the unimpaired (left) hand of participants with LHS was above the impairment cutoff value for 1 participant. Based on a single assessment, 2 (test), respectively 1 (retest), additional participants with stroke would have been considered as impaired. In 5 participants with RHS both test and retest assessments of the impaired (left) hand were above the cutoff value. For the DL of the right hand, this was the case for 1 participant with LHS (impaired hand). The average DLs of the unimpaired (right) hand were above the cutoff in 3 participants with RHS. In one of these participants only the result of one assessment (test) would be considered as impaired. Based on a single assessment, 1 (retest) additional participant with stroke would have been considered as impaired. In 2 participants with RHS both impaired and unimpaired hands were above the 95th percentile.The outcomes of the robotic assessment for all groups  are illustrated for both hands in Fig.\u00a0SEM characterizing the measurement variability, and SRD for evaluating changes are summarized in Table\u00a0The values of test-retest reliability for the impaired and unimpaired hand were 0.73 and 0.16, respectively. The detailed descriptive statistics for the DL of the test and retest, reliability, There were no systematic biases between test and retest, as can be seen by lot Fig.\u00a0.Fig. 3BZ=1.6,p=0.272), nor between assessments in NIC subjects and the impaired  or unimpaired  hand of participants with stroke, respectively. The inattention detection rate (percentage of cases) based on the psychophysical data and resulting number of excluded trials  are also summarized in Table\u00a0The average number of trials, convergence rate of the PEST algorithm, duration of the assessment, and duration per trial are reported in Table\u00a0p>0.325) nor for the working memory test (p=0.121)).All Spearman\u2019s rank-order correlations between the robotic outcome measure and the clinical scales were weak to fair and not statistically significant  of a robot-assisted assessment of MCP proprioception, using a 2AFC approach and the adaptive sampling procedure PEST providing the angular joint position DL, in a stroke population. The study demonstrated a good reliability for the contralesional hand in participants with stroke, a difference in proprioceptive function between participants with stroke and NIC subjects, and that participants with RHS may be more affected compared to participants with LHS. Only weak correlations between the robotic outcome measure and clinical scales were obtained, among others due to ceiling effects of the latter. The assessment duration of around 12 min, demonstrated high feasibility of the assessment in an impaired population.According to general reliability recommendations  , the int\u03ba from 0.26 to 0.39) for the hand : r=0.41 ).The Bland-Altman plot showed that there was no systematic bias from test to retest. However, it revealed two outlier data points for the unimpaired hand according Tukey\u2019s outlier test (difference of test-retest >4.08\u00b0 or <\u22124.41\u00b0). Visual inspection of the PEST sequences showed that for both outliers in one of their two test-retest sequences there was a period of divergence from the threshold, possibly due to inattention , which failed to be detected by the inattention detection algorithm . RemovinICC is very sensitive and directly depends on the intra- and inter-subject variability. As a matter of fact, removing participants with stroke P8 with an average DL of 9.33\u00b0  for the impaired hand, would reduce the test-retest reliability  [CI]: r=0.49 ). This shows that reporting the CI for the reliability is also important. Indeed, the reliability without P8 still remains within the CI reported in Table\u00a0It should be noted that the ICC,1 is verHypothesis-based comparisons between NIC subjects and participants with stroke, as well as between participants with RHS and LHS could give some indication of validity of the assessment . As a matter of fact, the robotic assessments of proprioception of the present study revealed worse proprioception (around 2.3 times larger DL) in the impaired (left) hand of the RHS group compared to NIC subjects. This is comparable to the results showing a fingertip position DL (flexion\u2013extension) three times larger in participants with stroke compared to the control group when using a Same-Different paradigm . The exiAnother reason for more severe proprioceptive deficits in participants with RHS could be the higher ratio of participants with RHS with a cortical stroke when compared to participants with LHS. This could potentially explain a minor neglect or somatosensory deficit in participants with RHS. It is possible that with the screening procedure for neglect some participants with stroke with minor or declining neglect might have also been included in the study. Furthermore, cortical LHS may lead more often to aphasia , which cWhile there are several studies with NIC subjects , 66, 67 Our study also showed that the unimpaired hand can be affected after stroke: The group analysis revealed a significant difference for the unimpaired (left) hand of participants with LHS, and three of the participants with RHS had DLs larger than the 95th percentiles of the corresponding hand in NIC subjects. The first could be explained by the fact that LHS subjects had similar medians for both hands, but the NIC subjects showed a trend towards better proprioception in the left hand. In contrast to the impaired hand, no significant difference was found between participants with LHS and RHS for the unimpaired hand. However, there were more participants with RHS with DLs above the 95th percentile compared to participants with LHS. This is in line with the aforementioned hemispheric dominance for proprioception and with existing evidence revealing deficits in the \u201cunimpaired\u201d ipsilesional limb after unilateral cortical lesions . Thus, iFrom all correlations with clinical scales, the best correlation was found between the proprioceptive DL provided by the robotic assessment and the clinical outcome measure of the proprioceptive up-down test. However, since a ceiling effect occurred on the up-down test for all but one participants with stroke (9/10 participants with stroke scored the maximum points), the correlation for this clinical scale should not be over-interpreted. Correlations with all other clinical assessments (not directly targeting proprioception) were also weak to fair. Thus, no concurrent validity could be established by correlating the robotic outcome measure with the clinical scales. This clearly demonstrates the limitations of clinical assessments, unable to sensitively quantify and differentiate proprioceptive deficits, and points out the need for finer-graded proprioceptive assessments as gold standards \u2014a need aSimilar as for the construct validity, the concurrent validity analysis would benefit from the inclusion of sub-acute participants with stroke with more severe proprioceptive deficits. In a future study, different sensitive outcome measures of robotic proprioception assessments using different paradigms but assessing the same proprioceptive aspects could be correlated to circumvent the common problem of coarse clinical scales and further investigate concurrent validity.The similarity of unconstrained trial duration  between participants with stroke and NIC subjects proves the feasibility of the assessment concept and response interface in participants with stroke . The convergence of PEST  shows that a maximum number of 60 trials and other termination criteria for PEST are adequately chosen for a clinical application in patients. Since the DL estimate is based on the fit of the psychometric function using data from the full sequence, it is not imperative to obtain convergence of the PEST algorithm to compute the outcome measure. Around 60 PEST trials requiring in total less than 15 min is a good compromise between precision and accuracy of the outcome measures and clinical feasibility, as assessments should be quick to administer , 98.While there exist some position matching assessments which are reported to be more rapid e.g., , 50), th, th50]),ICC [CI]: r=0.63 , for the impaired hand). Furthermore, differences between NIC subjects and participants with stroke  would increase and could lead to misleading interpretation. Thus, the results presented here  are more conservative and should more accurately represent differences in proprioception.The results with NIC subjects in Table\u00a0The lack of correlation between the robotic outcome measures and the working memory test, as well as the Bland-Altman analysis and a previously conducted mixed-effects-model on 30 elderly NIC subjects  demonstrUsing the 2AFC paradigm with passively presented proprioceptive stimuli makes the proposed method a purely proprioceptive assessment independent of motor function, in contrast to most ipsi- or contralateral matching assessments. Furthermore, it relies neither on interhemispheric transfer for the comparison of stimuli nor on the sensorimotor function of the ipsilesional \u201cunimpaired\u201d limb, which is an advantage, as the central integration of proprioceptive information across the limbs and the ipsilesional limb may also be affected by a cerebral lesion , 100, asCompared to other psychophysical paradigms , 2AFC is more robust against decision criteria  , 72, is Presenting passive movements with different amplitudes but same trajectory duration leads to varying peak velocity. Therefore, the subject may partly not only rely on the perception of angular joint position but also movement velocity. This is preferable to a time confound, as primary endings of muscle spindles respond both to the length change and rate of length change of the muscle . As a coOne limitation of the present study is the lack of a sensitive clinical scale as a reference for proprioceptive function. Therefore, some participants with stroke did not present detectable proprioceptive deficits according to the up-down test (as suggested by the high ceiling rate). On the other hand, participants with stroke with the inability to detect any large passive movement were excluded, as they would not be able to perform the robotic assessment. Both of these factors limit the severity range of deficits. As a consequence, the stroke group was more similar to the control group. These points negatively affected the concurrent validity analysis and hypothesis testing .Age-matching is important, as proprioception declines with age , 106. ByThe reliability analysis would also benefit from a larger sample size . NeverthThe evaluation of psychometric and clinimetric properties in this exploratory study including participants with stroke and a group of neurologically intact subjects demonstrated good reliability, validity, and high feasibility of the proposed robot-assisted adaptive assessment of finger proprioception. While existing clinical scales that do not require any tools may be appropriate for some fast preliminary screening of neurological patients, this robotic assessment has the potential to sensitively and accurately quantify proprioceptive deficits. Together with its good usability and short administration time, which facilitate its integration into clinical routine, it becomes a powerful tool for more standardized assessments, for understanding the role of proprioceptive deficits in the functional recovery process, as well as for improving diagnostics, prognostics, monitoring, and planning of sensorimotor rehabilitation programs in patients after neurological injuries."}
+{"text": "In this paper, we present a periodic hollowed-out pyramid microstructure with excellent superhydrophobicity. In our approach, T-topping pillars and capillary-induced self-assembly methods were combined with the photolithography process to fabricate a hollowed-out pyramid structure. First, a wideband ultraviolet source without a filter was used to fabricate the T-topping pillars during the exposure process; then, the evaporation-induced assembly collapsed the pillars and formed the hollowed-out pyramid structure. Scanning electron microscopy images showed the microstructures of the prepared surface. The contact angle of the surface was 154\u00b0. The surface showed excellent high temperature and ultraviolet irradiation tolerance, and the contact angle of the surface barely changed when the temperature dropped. This excellent environmental durability of our superhydrophobic surface has potential applications for self-cleaning and friction drag reduction under water. Friction drag is an important factor for marine vehicles. Drag reduction techniques have become a focus to increase vehicle speed and save fuel. Several techniques have been proposed to reduce the friction drag, including water repellent walls ,2, microBionics and experiments showed that superhydrophobic surfaces have an obvious drag reduction effect due to the ability to retaining microbubbles ,7,8,9. TSalvinia molesta leaf has excellent superhydrophobicity and air-retaining properties under water because of its hollowed-out pyramid-like structure [The tructure . Hence, tructure ,14,15,16tructure ,18. Capitructure . Adhesiotructure . Adhesion between the micro pillars is another important factor that determines the final assembly . A polymInclined lithography was also used to fabricate sloping micro structures ,25. SlopThese studies built a strong foundation for fabricating hollowed-out pyramid-like structures. In this paper, we fabricated a superhydrophobic surface based on the hollowed-out pyramid-like microstructure. Since the discovery of the lotus effect, the preparation of the biomimetic superhydrophobic surfaces has aroused considerable interest among researchers. From observation and preparation, wettability was found to be related to the surface free energy and structure roughness.Inspired by the plants and animals in nature, scientists fabricate numerous biomimetic superhydrophobic surfaces via various smart materials routes to construct rough surfaces and low-free-energy materials ,30,31. TUsing the periodic array microstructures, superoleophobic and superrepellent surface fabrication has been achieved ,38. A T-The durability of superhydrobic surfaces is another important aspect. Poor durability limits the practical applications. Mechanical abrasion, chemical stability, organic solvents, high temperature. and ultraviolet (UV) irradiation are harsh conditions for superhydrobic surfaces. Many durable superhydrobic surfaces have been fabricated ,43,44,45In this paper, we combined the T-topping structure and capillary-induced self-assembly in the photolithography process. Only the geometry structure of the surface was changed without addition of low surface-energy ingredients. The contact angle of the surface was 154 \u00b1 2\u00b0, the sliding angle of the surface was 10 \u00b1 1\u00b0. The sample showed excellent wettability after high temperature thermal treatment and ultraviolet irradiation. The contact angle of the surface fluctuated slightly in the cooling process. The interspace surrounded by the hollowed-out pyramid-like structures was better for air retention under water, allowing the surface to have potential for drag reduction under water.2H5OH), acetone (C3H6O), and Isopropyl Alcohol (IPA) were purchased from Sinopharm . Silicon (Si) slides with 500 nm thick silicon dioxide were used as the substrate. Ultrapure water obtained from a Millipore Milli-Q system (resistance rate >18.2 M\u03a9\u00b7cm) was used for sample preparation. The mask plate was manufactured by Shenzhen Newway Photomask making Co., Ltd. .In this study, all chemicals were used as received. The SU-8 2100 Negative Photoresist and SU-8 developer were purchased from Micro Chem . Other chemicals, including ethanol (C2. A wideband ultraviolet source without a filter was used in the exposure step to obtain T-topping pillars. (4) The sample was baked at 95 \u00b0C for 10 min on the hotplate and developed in the SU-8 developer for 6 min. Then the wafer sample was rinsed in the deionized water. Finally, the prepared sample was dried in the air naturally.Many researchers improved the fabrication technology to avoid the T-topping effect of SU-8 structure fabrication ,49,50. HThe mask graphic was an array of units composed by four adjacent circles in two dimensions. The parameters of the mask graphic were calculated and designed. As shown in All steps were identical to the T-topping pillar preparation. The only difference was the last step of structure release. The details are shown in The morphologies of the solid phase nanostructures were investigated using field emission scanning electron microscopy  at 5 kV. The static contact angles of the sample were measured by the contact angle measurement instrument. Contact angle images were collected with a high-resolution camera, and the tangent lines were drawn using Microsoft Visio 2010 . Then, the contact angles were measured using a protractor, with an accuracy of \u00b1 2\u00b0. Water droplets of about 7 \u00b5L were dropped on the sample from a distance of 0.3 cm by vibrating the pipette. The sliding angles were measured with the assistance of a rotatable platform with an angle scale, with an accuracy of \u00b1 1\u00b0.2. The sample was heated by a hotplate. First, the sample was placed on the hotplate for 1 h at 100 \u00b0C; next, the sample was removed and cooled to room temperature; third, the contact angles of the sample were measured and then the sample was placed back on the hotplate for another 1 h at 100 \u00b0C. The process was repeated 8 times. Finally the temperature of the hotplate was set to 150 \u00b0C, and the experiment above was repeated.The wettability of the sample under harsh environments was tested, including high and low temperatures. In the high temperature durability tests, the sample was 20 \u00d7 20 mm2. The relationship between the static contact angles and the temperature was investigated. The sample was cooled by a ZL-04AGT thermostat . The sample was placed on a refrigeration table, and the contact angle measurement instrument was placed in the thermostat to shoot the side view of the water droplet. The temperature fell from 10 to \u22125 \u00b0C, and the cooling rate was 3 \u00b0C/min. The humidity was 30%.In the cooling tests, the sample was 20 \u00d7 20 mm2, k = 365 nm) of the lithography machine  was used for irradiation. The distance between the UV light source and the samples was about 5 cm. The samples were placed in the UV chamber for up to 90 min and the contact angles of the sample were measured every 10 min.In the UV durability tests, the UV source . As shown in Gap and wavelength were the key factors to control the error of the SU-8 structure . The smac for a suspended droplet is described by the Cassie-Baxter [c is the apparent contact angle on the textured surface, fs is the fraction of the real liquid-solid contact area to the entire interface, and \u03b8y is the equilibrium contact angle on the smooth surface. Droplet on the T-topping pillar array surface is in Cassie state. Then the apparent contact angle \u03b8e-Baxter  model:cc is a function of fs according to Equation (1). A typical plot of \u03b8c 2 and the entire liquid-solid interface area is S = NP2. Then, the fraction of the solid contact with the liquid isFor the structure we designed, considering the water drop contact with N hollowed-out pyramid-like unit-cells, the real liquid-solid contact area is Sc is above 150\u00b0 and the surface becomes superhydrophobic. However, with decreasing fs, we wanted to determine if contact angle would increase. According to a previous study [s deceases until FC > FE during the entire self-assembly , the micropillars will be unstable. The micro pillars will randomly collapse. If D/P < 0.19, \u03b8The parameters of the micro structure influence the self-assembly process. The capillary force must be large enough to bend the pillars against each other. The height and diameter determine the stiffness of the micro pillar. Short and large diameters make the pillars hard to bend. Large and small diameters make the micro pillar easy to bend, which means it is hard for the micro pillars to resist random interference. Hence, proper ratio of height and diameter is very important. The capillary force on an individual pillar in a system of four pillars has been explored ,23, and C increases, and FE decreases. This facilitates self-assembly, and improves the stability of self-assembly.The distance of the two adjacent pillars L is important for the stability of self-assembly as it determines the displacement of the top of the pillars. According to previous studies, as the distance between two adjacent pillars decreases, FSalvinia molesta leaf. The bottom of the pyramid-like structure was square and the side length was 50 \u00b5m. Thus, we successfully performed the difficult fabrication process and created the hollowed-out pyramid-like structure. The wettability of the sample was measured. The water drop on the surface was about 7 \u03bcL, and the static contact angle was 154 \u00b1 2\u00b0. The water drop used to test the sliding angle was about 10 \u03bcL, and the sliding angle of the surface was 10 \u00b1 1\u00b0.Surface morphology is very important for the wettability of a surface. The microstructures were characterized by SEM. Adhesive force is required to bond the microstructures after collapse, which was proven again by our study. Polymer weld was examined to bond the micro pillars ,52. AlthThe rate of water evaporation is a key factor for bond formation. We placed the sample in the oven at 50 \u00b0C to accelerate the evaporation rate, no bond formed, and the collapsed pillars reverted back to their upright position after complete evaporation. Additionally, when the sample was placed in a closed glass container at 20 \u00b0C to slow the evaporation rate, the result was the same, showing that a proper evaporation rate is important for self-assembly. This area requires further research.For superhydrophobic surfaces, structure defects are unacceptable. A small defect could make the Cassie state of the droplet break down. However, obtaining a defect-free sample is difficult. Many factors affect the self-assembly process, especially the bond strength between the wafer and the micro pillars.2SO4 and H2O2, cleaning by oxygen plasma, or pre-spin coated with Polymethyl Methacrylate (PMMA). Obviously, the wet etching process can\u2019t be used for metal basement. Damp bottom are extremely harmful for the bond strength, so baking the bottom in the oven for a period of time to maintain dryness is necessary before spin coating the SU-8. The bond strength between the wafer and the micro pillars is the essential factor that can provide the force that the pillars need to stay standing. If the bond strength is rather small, the micro pillars will fall down, or even flow away during the developing process. Several approaches to achieve adhesion between the wafer and the micro pillars are possible, such as wet etching with the solution mixed by Hg) of Su-8 is greater than 200 \u00b0C, the contact angle and sliding angles will not be affected after heating at lower temperatures. This result confirms that the T-topping features were not altered and the water repellency of the structured surfaces was stable, even when subjected to very high temperatures. The sample showed a high temperature bearing capacity. The surface maintained superhydrophobicity after exposure to high temperatures, so the surface can be applied in high temperature situations.The wettability of the sample under severe environmental conditions was tested. To test the high temperature durability of the surface, the sample was placed on a hotplate at 100 \u00b0C for one hour. Then the sample was removed from the hotplate and cooled to room temperature. The contact angles were tested, and the sample was placed back on the hotplate at 100 \u00b0C for another hour. This process was repeated eight times. The temperature was then raised to 150 \u00b0C, and the experiment above was repeated. The results are shown in In the UV durability tests, the sample was irradiated with UV for up to 90 min, and the contact angles of the sample were measured every 10 min. The result is shown in The relationship between the static contact angle and low temperature was investigated. The sample was cooled on the refrigeration table, and the side view of the water droplet and the corresponding temperature were recorded. As shown in Salvinia molesta leaf, we designed and fabricated a periodic hollowed-out pyramid microstructure with excellent superhydrophobicity by combining capillary-induced self-assembly and photolithography technology. SU-8 photoresist was used as the structural material in this fabrication. To maintain the droplet on the micropillar array in Cassie state, T-topping pillars were constructed to improve the geometrical edge angle. The evaporation-induced assembly collapsed the pillar and formed the hollowed-out pyramid structure during the structure release step. The water contact angle of the surface was 154 \u00b1 2\u00b0 and the sliding angle of the surface was 10 \u00b1 1\u00b0. Additionally, the prepared surface showed excellent wettability after long exposure to high temperatures and ultraviolet irradiation, and the contact angle of the surface fluctuated slightly when the temperature dropped. Inspired by the micro structure of the For the hollowed-out pyramid-like surface, considerable space remained between the micro pillars, and the interspace surrounded by the hollowed-out pyramid-like structures was better for air retention, so the surface has potential to retain air under water. Compared with the previous durable superhydrophobic surfaces ,43,44,45"}
+{"text": "Although the consequences of food insecurity on physical health and nutritional status of youth living have been reported, its effect on their mental health remains less investigated in developing countries. The aim of this study was to examine the pathways through which food insecurity is associated with poor mental health status among youth living in Ethiopia.We used data from Jimma Longitudinal Family Survey of Youth (JLFSY) collected in 2009/10. A total of 1,521 youth were included in the analysis. We measured food insecurity using a 5-items scale and common mental disorders using the 20-item Self-Reporting Questionnaire (SRQ-20). Structural and generalized equation modeling using maximum likelihood estimation method was used to analyze the data.The prevalence of common mental disorders was 30.8% . Food insecurity was independently associated with common mental disorders . Most (91.8%) of the effect of food insecurity on common mental disorders was direct and only 8.2% of their relationship was partially mediated by physical health. In addition, poor self-rated health , high socioeconomic status , parental education , living in urban area , and female-headed household  were associated with common mental disorders.Food insecurity is directly associated with common mental disorders among youth in Ethiopia. Interventions that aim to improve mental health status of youth should consider strategies to improve access to sufficient, safe and nutritious food. Common mental disorders (CMDs) refer to mental problems that may not fall into standard diagnostic criteria. They are characterized by symptoms of sleeplessness, exhaustion, irritability, poor memory, difficulty in concentrating and somatic complaints , 2, but Previous studies have shown that the causes of CMDs are multi factorial and include, but are not limited to, biological, social and economic factors , 5\u201310. FThe biological and social consequences of food insecurity have been reported among adults, pregnant women, mothers and young children. It compromises intake of energy and nutrients, lowers physical performance, increases risk of chronic conditions and it is also associated with poor nutritional status, developmental outcomes, health and poor cognitive performance , 18\u201320.biological perspective assumes that the causality of food insecurity and poor mental health status is mediated by poor nutritional status. For instance, food insecurity affects health either directly or indirectly through poor diet and nutritional status. In turn, diet and nutritional status predict physical health, quality of life and health status [psycho-emotional perspective assumes that food insecurity leads to psychological problems such as extreme stress, psychological distress that could lead to poor self-rated health status. This poor self-rated health status in turn is associated with poor mental health such as depression. In other words, those who are food insecure could experience negative emotions which are translated inside the body and can contribute to poor mental health [A growing body of evidence demonstrates that the consequences of food insecurity extend to mental health problems , 22. Preh status , 29, 30.h status , 31\u201333. l health \u201337. As al health , 39. Othl health , 40. Forl health , 30. Thil health , 40, 41 Although associations of food insecurity and mental health have been reported by many literature, few of them have tested all the model components simultaneously. As both food insecurity and mental health are latent constructs, model that take in to account the latent structure should be used. Therefore, the aim of this study was to examine the pathways through which food insecurity is linked to youth mental health after controlling for other factors. It is expected that findings of this study will improve planning of interventions for prevention of both mental health and food insecurity status.We used third round data from the Jimma Longitudinal Family Survey of Youth (JLFSY), which is a representative cohort of adolescents living in Jimma Zone, Southwest Ethiopia. The JLFSY study began in 2005 and is designed to examine the social and economic determinants of adolescent\u2019s health and well-being. The study area encompassed rural, semi-urban, and urban communities to represent a range of agro ecological zones and development contexts. A total of six kebeles\u2019 of Jimma Town, including three kebeles of nearby semi urban towns, and 18 rural kebeles around each town, were purposively selected. A kebele is the smallest administrative unit of Ethiopia similar to a ward, a neighborhood or a localized and delimited group of people. Stratified random sampling was used to select household for inclusion in each site.A two-stage sampling plan was used to select eligible adolescents for the study. At the first stage, households were randomly sampled from each study site. The sample size in each site was determined by the relative proportion of the study population in the site and the overall target sample size. At this stage a total of 3700 households with at least one male or one female adolescent were identified. In the second stage, one adolescent aged 13 to 17 years was randomly selected from each household using a Kish Table . Data weData were collected using structured questionnaires developed in English and then translated into Amharic and Afan Oromo languages. The Amharic and Afan Oromo versions were back-translated into English to verify accuracy. Twelve interviewers and two supervisors who completed secondary level education were recruited considering their prior experiences and fluency in Amharic and Afan Oromo languages.The head of the household responded to the household questionnaire. The questionnaire for adolescents focused on issues related to personal experiences of food insecurity, education, health, nutrition and anthropometric measurements. The interview was conducted in a private place by an interviewer of the same sex as the respondent. Adolescents were interviewed after the interview with the household head was completed. The interviewers remained with the same households and adolescent respondents throughout the study period. Prior to pre-testing the forms, the interviewers and supervisors received one week of intensive training, and questionnaires were pre-tested in the study area to identify problems related to content, wording and formatting. Supervisors kept track of the field procedures and checked the completed questionnaires every day to ensure accuracy of the data collected.\u03bbi)2 is the squared sum of the unstandardized loadings called lambdas, \u03a3\u03b8ii is the sum of unstandardized error variances called thetas, the 2 \u03a3\u03b8ij is two times the sum of unstandardized covariance of the errors, if there is correlated error in the model. When there are no correlated errors the equation reduces to Both exploratory and confirmatory factor analyses were computed to identify factor variances explaining the most and to check item loadings, scale reliability and model fitness respectively. To estimate scale reliability, Cronbach's alpha was computed after confirmatory factor analysis was performed using the following formula:Food insecurity was measured using a questionnaire previously developed, adapted and tested in the same study settings , 43\u201348. Physical health status was measured using a 10 item questionnaire asking whether they had experienced health morbidities in the past two weeks prior to the data collection period . ResponsIn general, how would you rate your health today? Possible responses range from very good, good, moderate, to poor. Since responses were skewed, we used a natural logarithm transformation and treated it as continuous variable when it was included in the model , we used Self-Reporting Questionnaire (SRQ-20) . The SRQDietary diversity was assessed using a food-frequency questionnaire containing 30-food items \u201360. Parta priori. These included age, gender, female-headed household, parental education, educational status of youth, household wealth and place of residence. We computed the index of household socioeconomic status based on household ownership of 21 items. The index included items such as a functioning radio, television, cooking stove, various furniture items, and farming implements [Potential covariates were identified plements . The indThe data entered were verified for missing values, outliers, and normality prior to analysis using Stata Version 13.0 . Descriptive data were reported as percentage, means and Standard deviations (SD).For each of the exogenous and endogenous mediators and endogenous outcome variables, reliability of each item was tested in respective of its constructs. Factor and principle components analysis were used. Overall scale modification and removal of items was made based on factor scoring, error terms and factor loading criteria. For each construct, only items having greater than 0.4 factors loading were included and those items that were cross-loaded on more than two factors were omitted. Finally, confirmatory factor analysis was done for the measurement model to evaluate the relationship between each construct.2). Accordingly, CFI/NNFI value of >0.90, RMSEA< = 0.08, Pclose>0.05, and SRMR<0.08 were used as standard criterion to determine model fitness. We improved the model using modification of indices and removing non-significant paths and comparing the fit of multiple models using the Akaike Information Criteria [Both SEM and generalized structural equation modeling (GSEM) using maximum likelihood estimation method were employed based on a conceptual hierarchical modeling framework after adjusting for covariates, 61. FirCriteria .To test the effect of mediators, we followed procedures by Baron and Kenny (1986). First, we observed the significant association between food insecurity and mental health. Then we assessed whether food insecurity predicted mediating variables ; and finally we checked independent association of mediators on mental health status , 64.th subject was given by:The SEM for the mediation model for the iZi was the physical health, self-rated health and diet diversity score, xi was food insecurity status, and Yi was our outcome of interest (CMDs).Where \u03b5zi, \u03b5yi) were uncorrelated and normally distributed. The direct effect was the pathway from the food insecurity to mental health while controlling for the physical health, self-rated health and diet diversity score (i.e. \u03b3xy is the direct effect). Similarly, the indirect effect described the pathway from the food insecurity to the mental health through physical health, self-rated health and diet diversity. This path was represented by the product of \u03b2xz and \u03b3zy. Finally, the total effect was the sum of the direct and indirect effects of the exogenous variable on the outcome, \u03b3xy + \u03b2xz*\u03b3zy [We assumed that the error terms  age of the respondents was 18.75 years (\u00b11.37) for males and 18.73 years (\u00b11.35) for females. The CMDs was 30.85% . There was a statistical significance difference in CMDs by socio economic status (P = 0.014), education (P = 0.052), parental education (P<0.0001), place of residence (P<0.0001) and head of the household (P<0.0001) .In the exploratory factor analysis of food insecurity, the first factor explained 80.9% of the variation in answers to these questions. Factor loading of the items varied from 0.57 to 0.93 and its coefficient of reliability was also good . Similarly, the exploratory factor analysis for physical health measures showed that 70.4% of the proportion of variance was explained by the first factor and the reliability test of items was acceptable . Exploratory factor analysis of mental health items also showed that the first factor explained 76.9% of the total variance. After confirmatory factor analysis, the item reliability scale was also acceptable  .2 = 97.1;  = 128.686, p< 0.0001; RMSEA = 0.064; NNFI = 0.973; CFI = 0.983; Pclose = 0.014; SRMR = 0.023; CD = 0.97; R = 97.1; . MulticoThe results of the SEM are depicted in In this analysis, the pathway between food insecurity and physical health status was statistically significant  and the pathway between physical health and mental health status of youth was also significant . However, there was no significant association between food insecurity and dietary intake  or between dietary intake and mental health . Similarly, the effect of food insecurity on self-rated health status was not observed , although the pathway between self-rated health and mental health status was significant . In addition, this study also showed socioeconomic status , parental educational , living in urban areas , and living in female headed household  were associated with CMDs. As the wealth of household increased, the likelihood of common mental disorders decreased. Youths living in less educated family had a greater likelihood of having common mental disorders. Youths living in urban areas had higher chance of developing common mental disorders than their rural counterparts .The total effect of food insecurity on mental health was 0.192. The direct component of this total effect was 0.176, or in other words, 0.176 /0.192 = 0.917 or 91.8% of the effect of food insecurity on mental health is direct. By contrast, the indirect effect was 0.016, so that 8.2% of the effect of food insecurity was partially mediated by physical health .There is a growing body of evidence demonstrating an association between food insecurity and mental health among children and adults , 27, 28.In the present study, the prevalence of common mental disorders was 30.8%. This was much higher than in previous studies conducted in Ethiopia, which reported 21.6% among university students , 25.8% aFood insecurity was associated with CMDs independent of other covariates. The hypothesized mechanisms by which food insecurity is linked to mental health range from biological pathways, psycho emotional dimensions, parenting skills, and exposure to physical illness , 19, 71.In the present study, there was no observed effect of food insecurity on mental health through reduced dietary intake. However, there are studies that reported food insecurity status would result in lower intake of healthy foods and nutrients, which would ultimately result in changes in health status \u201381. ThisOther social determinants of health such as low socio economic status , are alsThe present study also reported a higher proportion of common mental disorders among youth living in urban areas compared to their rural counterparts. A similar finding was observed from studies done in Goa, India , Addis AThis study has some strengths. To the best of the authors\u2019 knowledge, this is the first report attempting to employ the use of structural equation model to understand the link between food insecurity and CMDs among youth living in Ethiopia. The study also relatively used large sample size. The findings contribute to growing scientific evidence on the impact of food insecurity on the well-being of youth by estimating direct, indirect and the total effect of food insecurity on their mental health status. Although the model does not make causal assertion, it assesses the relationships with mental health conditions. In addition, most of the previous studies that uncovered the effect of food insecurity on youth mental health were from developed countries, and the issues in low- and middle-income countries have been underrepresented. However, this study has some limitations. The first one is the inherent limitation of a cross sectional study design in drawing causal inferences and temporality. We cannot rule out reverse causality, as CMDs are known to produce food insecurity vice versa. Secondly, although we tried to control our analyses for covariates, we cannot entirely rule out the possibility of other confounders and or other explanatory models in determining the association between food insecurity and mental health status. We only assessed a limited set of variables that could explain their relationships. The hypothesized association is not the only model that could be used to examine the link between food insecurity and mental health in the youth population. Alternative models  could be used to explore other relationships.1) and mental health measures (e2). We hope that there are various variables in common that will influence both food insecurity and mental health, e.g. economic hardship, parental mental health problems, depression status of the mothers, poverty, and parenting style. One way to fit the model is to use instrumental variables that directly influence food insecurity but do not directly influence mental health and vice versa . These variables were not present in the data set. Readers should take the issues of model specification and endogeneity (omitted variable bias) into account.We have both unexplained variance in measuring both food insecurity Click here for additional data file."}
+{"text": "The sex gap  in the occurrence of a variety of mental health conditions has been well documented. Household food insecurity has also repeatedly been found to be associated with a variety of poor mental health outcomes. Although both sex and household food insecurity have received attention individually, rarely have they been examined together to explore whether or how these indicators of two social locations interact to impact common mental health outcomes. Using a pooled sample  of the Canadian Community Health Survey (2005\u20132012), we test whether sex modifies the relationship between household food insecurity assessed by the Household Food Security Survey Module and five adverse mental health outcomes, controlling for confounding covariates. Although the sex gap was observed among food secure men versus women, males and females reporting any level of food insecurity were equally likely to report adverse mental health outcomes, compared with those reporting food security. Therefore, household food insecurity seems to narrow the sex gap on five adverse mental health outcomes. The sex gap  in mental health conditions has been consistently documented and re-examined ,2,3. TheHousehold food insecurity is operationally defined as the lack of access to food because of financial constraints  and in CThere is a large and robust body of literature establishing the relationship between household food insecurity and a variety of physical health problems. Adults and children living in food insecure households report poorer physical health; increased physical limitations; and higher prevalence of diabetes mellitus, heart disease, and other chronic conditions ,12,13. FIn addition to being associated with poorer physical health, there is a growing body of evidence that household food insecurity is associated with poor mental health and an increased risk of reporting certain mental health conditions, including psychological distress , mood anHousehold food insecurity is hypothesized to be associated with poor mental health because of the unique social, physical, and psychological stresses associated with being in a food insecure household . InteresMuch of the research studying the impact of gender  on household food insecurity and mental health has been conducted on lone mothers. Researchers focusing on this topic have observed that a disproportionate number of food insecure households are led by mothers with a history of depression, psychosis spectrum disorder, or domestic violence . MothersComparatively little research has been conducted on the mental health of males reporting household food insecurity. The results from in-depth interviews indicate that food insecure men report similar precursors to mental illness as women, such as feelings of powerless, guilt, embarrassment, shame, inequity, and frustration . These eThis study\u2019s research questions are specifically as follows:1. How is household food insecurity related to the reporting of five adverse mental health outcomes  in Canadian adult men and women?2. How is the sex gap in the reporting of five adverse mental health outcomes in Canadian adults changed by concurrent consideration of household food insecurity status, controlling for common socio-demographic covariates? The study sample N = 302,683) was generated by pooling four cycles  of the Canadian Community Health Survey (CCHS). The CCHS is a nationally representative series of cross-sectional surveys structured to collect information annually on a variety of issues relating to health including health status, health care utilization, and health determinants [2,683 wasThe CCHS questions are designed for computer-assisted interviewing with pre-programmed questions, content flow, and allowable responses (ranges or answers). Half of the interviews take place by telephone, while the other half take place in person. Participation in the CCHS is voluntary and responses are kept strictly confidential . Given the difference in sample sizes between the four cycles, the existing survey weights (determined by Statistics Canada) were adjusted depending on their contribution to their total pooled sample sized. Once the individual cycles\u2019 sample weights were adjusted, the cycles were combined and the pooled dataset was treated as one sample from a single population with a sample size of N = 515,421 prior to exclusions. The population of interest in this study is working-age Canadian adults, aged 18\u201364 years, living in the ten provinces. Children aged 12\u201317 years were excluded from the dataset as mental health concerns differ in youth from adulthood, as do experiences of food insecurity in food insecure households . RespondProvincial participation in the CCHS is dependent on whether modules of the survey were considered core or optional content in each survey cycle; the measurement of household food insecurity via the Household Food Insecurity Survey Module (HFSSM) was optional in the CCHS 3.1; for that cycle, Newfoundland, Labrador, New Brunswick, Manitoba, and Saskatchewan declined participation . In the Household food insecurity in Canada is measured through the HFSSM. This 18-item questionnaire has been internationally validated and translated into many languages . The HFSFive common mental health outcomes collected in the CCHS were included in the analysis: depressive thoughts in the past month, anxiety disorders, mood disorders, mental health status, and suicidal thoughts in the past year. All five outcomes were self-reported, because of the nature of the survey, but respondents were asked to only respond affirmatively to the anxiety and mood disorder questions if they had been so diagnosed by a health professional. These mental health conditions were selected based on their high response rates and their relatively high prevalence rates in Canada. The module including some mental health variables was optional content; as a result, two of the outcomes used in this study  were not asked in all provinces. A detailed description of the five mental health outcome variables is presented in Six demographic variables  were included as covariates and were assessed for effect modification or confounding on the relationship between household food insecurity and adverse mental health outcomes. In addition, variables that measure respondents\u2019 race , immigration status , main income source , and inflation-adjusted household income  were also included in the analysis. These covariates were included because of their known association with increased levels of household food insecurity ,17,20,39Finally, a cycle variable  was included to determine whether macro-level economic events, such as the 2008\u20132009 recession in Canada, modified or confounded the relationship between household food insecurity and adverse mental health outcomes. Data analysis was conducted at the Prairie Research Data Centre (RDC) using STATA statistical software . All estimates were generated with sample weights and 500 bootstrap replicates to approximate the Canadian population, that is, 18\u201364 year old individuals living in the ten provinces.Univariate descriptive analyses of all study variables were followed by crude binary logistic regression analyses to assess the proportion of each mental health outcome by level of household food security and by sex, separately, in Canadian adults. Sex-adjusted binary logistic regression models were generated to assess the relationship between household food insecurity and the five mental health outcomes. Finally, interaction terms were created for sex and household food insecurity, and those interactions were included in the sex-adjusted binary logistic regression models to assess for effect modification with each mental health outcome. Reduced  binary logistic regression analyses were conducted on sex-stratified datasets (one dataset for each sex) to visualize the sex gap for each level of household food insecurity on the odds of reporting five adverse mental health outcomes compared with those who are food secure.In recent years, mental health researchers have recognized that separate social locations such as sex and race must be considered together, but in much of the scholarship focusing on mental health conditions, these locations are often treated as independent variables . This tyFrom a review of the literature, sex and household food insecurity are two important variables related to the reporting of adverse mental health outcomes. Empirically, this study examined how sex and household food insecurity interact and how that statistical interaction impacts the reporting of mental health outcomes. We first showed that, prior to the inclusion of household food insecurity in the analysis, females reported higher prevalence of depressive thoughts in the past month, anxiety disorders, mood disorders, and fair or poor mental health, compared with males , which ip-value of <0.1), compared with those who are food secure [This is a novel finding and indicates that the often-reported sex gap in mental health may be true among those who are food secure (who represent most Canadian adults), but among a distinctly disadvantaged population (food insecure), males and females appear to experience a similar mental health burden. Another study focused on the interactions between household food insecurity and sex and its relationship with mental health outcomes, in a high-income country. Carter and associates  examinedd secure . The preMuch of the research on the impact of gender on household food insecurity and mental health has been conducted with a study population comprised of females only ,17,19. OOur findings suggest that males and females in a food insecure household experience a similar mental health burden as a result of sharing a more similar social location compared with food secure members of their own sex. The sex gap in mental health outcomes that is often reported for the general population is largely comprised of food secure respondents and appears to have masked the food insecure sub-group\u2019s experience of mental health problems, if this important variable is not considered.The CCHS does not survey some groups that are particularly vulnerable to household food insecurity and mental health problems, specifically First Nations people living on-reserve, homeless populations, and those living in remote regions ,48. ReseWhile it would be preferable to speak only in terms of gender, the CCHS only delineates by sex and, therefore, sex is used as a variable of interest in this study. Given the self-reported nature of the CCHS, there is potential for measurement error in the mental health outcomes, particularly as a result of social desirability bias\u2014this would result in an underestimation of mental health burden.The CCHS uses two methods of data collection\u2014computer assisted telephone interviewing (CATI) and computer-assisted person interviewing (CAPI). While there is some evidence in the literature of statistically equal prevalence of self-reported mental health status using CATI and CAPI , face-toFinally, type 1 error (the probability of rejecting a null hypothesis that is in fact true ) is a thThis study employs a large and robust dataset, with enough power to examine a four-level household food insecurity variable, using the internationally validated HFSSM. This study uses a nationally representative survey that results in generalizable findings to 98% of the Canadian population aged 18\u201364 living in the ten provinces. The use of a four-level household food insecurity variable is rare in the literature, despite the predictive power of the marginal group ,19,37,38Finally, this study is novel in that it is one of only two studies to examine the interaction between sex, household food insecurity, and mental health outcomes in high-income countries , and theAlthough the sex gap in mental health outcomes has been observed and re-examined for decades, few studies have considered whether these important social determinants, sex and food insecurity, have a multiplicative effect on the odds of reporting of mental health problems. This study showed that the well-documented sex gap in mental health outcomes was reduced to non-significance when household food insecurity was reported. Therefore, household food insecurity appears to act as a chronically stressful condition that overwhelms the capacity of males to either withstand reporting mental health conditions or actually succumb to them. This study suggests that household food insecurity is a social location with public health implications. The high odds of reporting adverse mental health outcomes seen among males experiencing household food insecurity, compared with food secure males, suggest that there is a distinct mental health burden among males experiencing household food insecurity, and that this previously overlooked group is deserving of further study. Finally, household food insecurity is a modifiable stressor within the complex interplay of sex and mental health. Given the lack of a sex gap in mental health among those with household food insecurity, addressing food insecurity with progressive policy change could result in mental health gains for women, as well as men who share this vulnerability."}
+{"text": "Magnetic sensing is used to structure every-day, non-migratory behaviours in many animals. We show that crayfish exhibit robust spontaneous magnetic alignment responses. These magnetic behaviours are altered by interactions with Branchiobdellidan worms, which are obligate ectosymbionts. Branchiobdellidan worms have previously been shown to have positive effects on host growth when present at moderate densities, and negative effects at relatively high densities. Here we show that crayfish with moderate densities of symbionts aligned bimodally along the magnetic northeast-southwest axis, similar to passive magnetic alignment responses observed across a range of stationary vertebrates. In contrast, crayfish with high symbiont densities failed to exhibit consistent alignment relative to the magnetic field. Crayfish without symbionts shifted exhibited quadramodal magnetic alignment and were more active. These behavioural changes suggest a change in the organization of spatial behaviour with increasing ectosymbiont densities. We propose that the increased activity and a switch to quadramodal magnetic alignment may be associated with the use of systematic search strategies. Such a strategy could increase contact-rates with conspecifics in order to replenish the beneficial ectosymbionts that only disperse between hosts during direct contact. Our results demonstrate that crayfish perceive and respond to magnetic fields, and that symbionts influence magnetically structured spatial behaviour of their hosts. Representatives from all vertebrate classes5 and invertebrates such as molluscs and arthropods6 use the Earth\u2019s magnetic field to process directional and spatial information across multiple spatial scales. Internal and external symbionts have previously been shown to alter non-magnetic spatial behaviour of animals, either as an incidental by-product of infection7, or as a form of host manipulation that may increase symbiont fitness, often at a cost to host fitness8. Since magnetic perception appears to play an integral role in spatial behaviours, could it be possible that symbionts alter magnetic field responses in animals? Most, if not all animals host a myriad of symbionts. Without consideration of how symbiotic interactions influence magnetically structured spatial behaviour, our understanding of both host responses to magnetic cues and the effects of symbionts on these host responses might remain incomplete.The available evidence suggests that sensitivity to the geomagnetic field is widespread among motile animals and plays a fundamental role in organizing spatial behaviour1. For example, honeybees use the magnetic field vector as a directional reference when approaching a visual target from a fixed direction, which may simplify encoding of geometric patterns10. A similar strategy may be used by a wide variety of animals that have been shown to spontaneously align their bodies with Earth\u2019s magnetic field, a behaviour termed spontaneous magnetic alignment (SMA)12. As used in this paper, SMA specifically describes a consistent, non-goal oriented and untrained alignment of the animal body axis relative to a magnetic field4, and may offer fitness advantages by providing a fixed  reference for local spatial behaviour over multiple spatial scales and/or simplify encoding of spatial features of the animal\u2019s surroundings4.Use of magnetic cues is not limited to long-range movements such as migration, but has also been proposed to serve as a global reference system helping to integrate spatial information from other sensory modalities, underlying perception of both familiar and unfamiliar surroundings15, studies examining SMA do not require assays that provide conditions suitable for learning a directional response, for motivating the animal to express the learned response, or for testing conditions that do not negatively reinforce the animals attempting to orient in the learned direction. Instead, SMA appears to be a default response that many animals show reliably in the absence of reinforcement, and therefore is well suited to investigate the environmental factors that influence responses to magnetic cues and ultimately to characterize the biophysical mechanism that underlies this response.SMA offers advantages to researchers over other forms of magnetic behaviour for experimental studies of magnetic sensing. Unlike goal-oriented movements such as homing and learned magnetic compass orientation18. This example illustrates two important drivers of symbiont effects on host fitness and resultant behaviour; first, potential negative effects of ectoparasites and secondly the benefit of interacting with cleaner species that remove ectoparasites19. But changes in host behaviour may also reflect selection acting on symbionts to manipulate their hosts and increase symbiont transmission8. Examples include lancet liver flukes (Dicrocoelium dendriticum) that cause ants to climb blades of grass and thereby increase the likelihood of transmission to grazing animals; hairworms (Paragordius tricuspidatus) that alter the reaction of their insect hosts to light and water increasing the likelihood that worms will be released in the water to continue their life cycle20; and protists (Toxoplasma gondii) that cause rats to seek, rather than avoid, odours from cat predators, which are their secondary hosts21. Lastly, some effects of symbionts on host behaviour may be purely incidental with no apparent selective advantage for either host or symbiont. For instance, fleas change mammalian spatial behaviour by introducing distracting sensory stimuli that may alter movement in relation to resources or potential predators7. Regardless of causality, these examples clearly indicate that our understanding of a host\u2019s spatial behaviour is often incomplete without consideration of its symbionts. In this study, we characterize spontaneous magnetic alignment in a population of freshwater crayfish  and experimentally test for the effects of external annelid symbionts on crayfish magnetic behaviour.The effects of symbionts on host spatial behaviour are often the result of multiple interacting modes of selection that can be generally categorized into three types: selection acting on the host, selection acting on the symbiont, and bi-products of host-symbiont interactions. For example, fish plagued by ectoparasites will seek cleaning stations inhabited by mutualistic partners that remove harmful ectoparasites22. We chose this system to explore symbiont effects on magnetic behaviour for four reasons. First, branchiobdellidan presence and density on a host are easily manipulated and thus the system provides an excellent experimental model to investigate the effects of symbionts on their host23. Second, branchiobdellidans have complex fitness effects on their hosts. Moderate densities of some branchiobdellidan species may increase crayfish growth and survivorship by cleaning harmful epibiotic accumulations from their host25, whereas host growth is decreased at high density26, at least in part due to facultative parasitism. Third, sensory input from branchiobdellidans that elicits changes in host behaviour likely reflects co-evolved feedback between host and symbiont. For instance, branchiobdellidans alter host grooming behaviours27, and this host response is adjusted with changing costs and benefits of symbiosis through host ontogeny23. Lastly, alteration of crayfish spatial behaviour may affect symbiont fitness by modulating transmission, because transmission of branchiobdellidans requires contact between hosts22.Astacoidean crayfish throughout the Northern Hemisphere are hosts to a monophyletic clade of obligate ectosymbiotic worms (Annelida: Branchiobdellida)22. We then verified effects of naturally occurring symbionts on magnetic alignment by experimentally manipulating symbiont density. Our results indicate that complex host-symbiont interactions modulate magnetic behaviour and that effects of symbionts on hosts and hosts on symbionts cannot be considered independently.We used the crayfish-branchiobdellidan system to examine symbiont effects on SMA under three distinct scenarios; no symbionts, beneficial (moderate) symbiont densities, and parasitic (high) symbiont densities. We conducted a baseline study using crayfish with a range of naturally occurring symbiont densities that span beneficial effects at moderate values, and negative fitness effects at high valuesCambarus appalachiensis) were collected from Sinking Creek   one day prior to testing. They were held overnight at room temperature in plastic bags filled with water from their creek and brought to the testing facility  on the day of testing. The sampled stretch of the creek has a flow direction along the NW-SE axis (310\u00b0/130\u00b0), which results in a 40\u00b0/220\u00b0 land-water axis . The carapace length, mass and sex of all animals were determined prior to the experiments. The mean carapace length of animals used in the baseline test was 33.6 \u00b1 3.1\u2009mm and the mass was 14.2 \u00b1 4.6\u2009g. The mean carapace length for the worm manipulation experiment was 31.0 \u00b1 3.0\u2009mm and the mass 11.2 \u00b1 4.0\u2009g.For all experiments, crayfish . Crayfish were then randomly assigned to 3 treatment groups; 0, 6, and 12\u2009C. ingens. Previous experiments have shown that applying 4\u20136\u2009C. ingens per crayfish increases host growth compared to 0-worm controls, whereas applying 12 worms decreases host growth26. Worms were applied to the dorsal and lateral aspects of the carapace with fine tipped forceps. The 0-worm group was subjected to identical handling conditions without application of worms.Prior to testing in the worm manipulation experiment, we manipulated the density of the branchiobdellidan 30. The animals were transported in an opaque black container (13\u2009cm by 13\u2009cm) with a black opaque lid to prevent access to any visual cues while transporting the animal. During transport the container was rotated at least ten times to eliminate possible path integration. As described in the earlier papers 12 animals were tested in parallel. The chambers were placed in the centre of a pair of cube-surface coils31, surrounded by a Faraday cage to shield out high-frequency noise (see below for details regarding the magnetic stimulation). In case of the worm manipulation experiment, we randomized the order of worm treatments, balancing treatments for position in the coil and test day (i.e. every treatment was tested on each test day). Tests were excluded from analysis if thunderstorms/rain events occurred during testing which were audible inside the testing room. In three cases a crayfish died in the experimental chamber and these data were therefore excluded from further analysis. A chamber located outside the Faraday cage and identical to the experimental chambers was filled with water, and used as a reference to measure water temperature. During the baseline test, air temperature was 24.6 \u00b1 2.2\u2009\u00b0C, and water temperature was 21.6 \u00b1 1.9\u2009\u00b0C. During the worm manipulation experiments air temperature was 19.9 \u00b1 2.5\u2009\u00b0C and water temperature was 12.3 \u00b1 1.4\u2009\u00b0C. Temperature differences between experiments reflect to some extent outside temperatures at the time of testing. While there was considerable temperature difference between the experiments, temperatures were stable throughout each of the experiments.The animals were brought to the indoor testing set-up and were individually placed into separate radially symmetrical individual chambers Fig.\u00a0, which h31, producing a total field intensity of 50.99 \u00b1 0.37 \u00b5T and inclination angle of 64.5 \u00b1 0.7\u00b0, identical to the ambient magnetic field. The coils were used to position the earth-strength magnetic fields into one of four cardinal compass alignments . In case of the worm-density experiment animals were tested in a random sequence of all four magnetic field alignments. In the baseline experiments animals were tested in two randomly chosen perpendicular field alignments. This process allowed us to uncouple magnetic field directions from all other fixed spatial references and to separate magnetic and non-magnetic (topographic) responses . Pooling data from all four fields, or two perpendicular alignments either with respect to absolute (\u2018topographic\u2019) north, or with respect to the alignment of magnetic north in testing made it possible to isolate the component of directional behaviour that was a response to the magnetic field, from the component that was a response to non-magnetic cues . In the baseline experiment, we used 1\u2009h out of the 2\u2009h magnetic field exposure, deleting the first and last 30\u2009min, in total analysing 2\u2009h of directional responses (2\u2009\u00d7\u20091\u2009h). It is important to note that the time analysed was the same (2\u2009h) in both experiments. We excluded the beginning and end of each treatment in order to reduce potential carry-over effects from one magnetic field alignment to the next and other potential disturbances that might have arisen from the experimenter entering the outer room of the testing building and switching the magnetic field conditions.The videos were recorded in Virtual Dub, converted to one frame per second, and then were tracked and analysed using custom-programmed tracking software \u2018Alignment v4\u2019 . The tracking software initiated tracking an animal when the first movement was detected and recorded the axis of body alignment . The software also calculated an activity index, which is a measure of the movement of the animals that includes lateral movements. This index provides a comprehensive measurement of overall activity but cannot be transformed into distance travelled. To compare the effects of worm treatment on overall activity, the activity of each individual animal for all four hours of video from the worm manipulation experiment was analysed.et al., unpublished) as a reference, the expected orientation was an axial alignment response , however, the response to the worm treatments was unknown. Therefore, we also tested for quadramodal alignment . A Bonferroni correction was used to correct for multiple hypothesis testing. All circular statistics were conducted in Oriana 434. To test for quadramodal orientation, bearings were first multiplied by a factor of four (quadrupled) and then reduced to modulo 360\u00b0, and tested for unimodal orientation35. For the remaining analysis, the data were treated as \u2018axial\u2019 in Oriana. Activity between treatments was compared using an ANOVA with day as a blocking factor, and group-wise differences were assessed by post hoc Tukey\u2019s test.We calculated the mean axis of orientation of each individual crayfish relative to topographic and magnetic north by combining the axial responses of the two (baseline experiment) or four (worm-density experiment) magnetic field alignments. Based on preliminary trials , our baseline experiment did not have a 0-worm equivalent, i.e. all field-collected individuals had at least low densities of symbionts. In order to compare the two experiments we analysed the circular standard deviation in both experiments with respect to their ectosymbiont densities. Because we wanted to know how variation among indivuals would change with varying ectosymbiont densities, we calculated the circular standard deviation of the mean vectors for a moving window of 12 individuals along a gradient of ectosymbiont densities. This was done by first sorting the crayfish according to increasing ectosymbiont loads. We then calculated the circular standard deviation for the first 12 animals in the list, then shifted the frame one individual down and calculated the same statistic for the 12 consecutive animals starting from the second in the list, then the 3rd, and so on until the moving frame reached the end of the list.To compare the results of the baseline study to the worm manipulation study, the un-manipulated symbiont densities found on crayfish during the baseline experiment were classified into two groups, low density (<5 worms) and high density (\u22655 worms) based on the naturally occurring density of In our baseline study with un-manipulated symbiont densities, the overall distribution of crayfish alignments was clustered along the NNE-SSW magnetic axis Fig.\u00a0. In contThe experimental manipulation of symbiont density confirmed the findings of the baseline experiment. In the un-manipulated baseline experiment, crayfish with moderate densities of symbionts showed a strong magnetic alignment along the NE/SW axis and no significant topographic alignment, while crayfish with high symbiont densities did not exhibit consistent alignment relative to the magnetic field, but instead exhibited consistent alignment with respect to non-magnetic (topographic) cues. More specifically, alignments of crayfish with high symbiont densities were randomly distributed with respect to the magnetic field , and the distribution of magnetic alignments in the moderate symbiont density treatment Fig.\u00a0 was signIn the absence of symbiotic worms, crayfish changed their magnetic response, aligning quadramodally along the anti-cardinal magnetic directions  Fig.\u00a0. Like th2,33\u2009=\u20099.2, p\u2009<\u20090.001), day of experiment , and a significant treatment by day interaction . Post hoc analysis showed a significant increase in host activity in the no-worm treatment, but no difference between moderate and high worm treatments , and by animals approaching a goal that is within their immediate field of view . The relatively low level of activity of crayfish with moderate ectosymbionts densities that exhibited bimodal NNE-SSW magnetic orientation is consistent with spontaneous alignment being associated with proximity to (or occupation of) a fixed location ; the residual motion of crayfish could reflect the inability of the crayfish to find cover in the experimental set-up.This study is the first study to demonstrate that crayfish can detect and respond to the Earth\u2019s magnetic field. In baseline experiments with unmanipulated, natural ectosymbiotic worm densities, crayfish aligned axially along the NNE/SSW magnetic axis, closely resembling SMA responses in other animals, i.e., bimodal responses rotated slightly clockwise of the magnetic north-south axis30. This grid could help the animal to organize and structure spatial information from its surroundings  and/or magnetic input could be used to standardize visual input to the compound eye as shown in honeybees10. Standardizing the view of its surroundings by aligning itself along a fixed axis relative to the magnetic field might facilitate detection of novel targets that enter the crayfish\u2019s field of view , analogous to \u2018misplace cells\u2019 in the rodent hippocampus43.One explanation that has been proposed for this type of spontaneous magnetic alignment stems from the possibility that the pattern of input from a light-dependent (photoreceptor-based) magnetic compass forms a 3-dimensional \u2018visual\u2019 pattern surrounding the animal that functions as a simple spherical grid or coordinate system48. Interestingly, flies exhibit a form of systematic search using quadramodal movement patterns, i.e. 90\u00b0 turn algorithms, when beaconing towards a food source is not possible50. Such search patterns have been shown mathematically to optimize search in taxonomically diverse animals53.Crayfish without ectosymbionts exhibited distinctly different behaviour from those with moderate or high symbiont densities. Instead of aligning bimodally along the NNE-SSW magnetic axis, these crayfish aligned quadromodally along the anticardinal (NE-SE-SW-NW) directions relative to the magnetic field. Quadramodal  magnetic responses have been shown in a variety of both stationary and moving insects54. The increased activity of crayfish in the no-worm treatment relative to both the medium and high-density groups is consistent with this hypothesis. It is conceivable that density-dependent effects of branchiobdellidans on host and symbiont fitness may select for host behaviour that increases the likelihood of dispersal/transmission from other hosts at zero worm densities. As discussed above, crayfish fitness is maximized at moderate worm densities while high densities are associated with a decrease in host growth and survival22. However, regular moulting (ecdysis) can greatly reduce ectosymbiont abundance/prevalence on crayfish55 and symbiont populations may need to be periodically replenished via horizontal transmission from other infested crayfish. Simultaneously, strong intra-symbiont competition at high densities decreases symbiont fitness56, which may lead to changes in branchiobdellidan feeding behaviours that result in damage to host tissues26. Because transmission of branchiobdellidans occurs mostly during direct physical contact among hosts22, increased movement and altered spatial behaviour could directly influence transmission rate by increasing host contact.The role of magnetic cues in structured search behaviour of crayfish has not been investigated. Nevertheless, the increase in activity associated with the switch from bimodal to quadramodal SMA in crayfish without ectosymbionts could indicate a shift from a resting state to systematic search, perhaps using a \u2018central place foraging\u2019 strategy to systematically vary the directions of forays into the surrounding habitat50.We speculate that the increased activity of crayfish without symbionts increases the likelihood of contact with other infested hosts that are a source of beneficial symbionts. Furthermore, the quadramodal magnetic alignment of crayfish without ectosymbionts coupled with the increase in activity is consistent with temporally and spatially structured behaviour underlying systematic search, as shown in flies57, as well as to their hosts, could result from host manipulation by the symbiont leading to increased transmission rates. At moderate densities, which are beneficial for symbiont and host58, crayfish tend to remain more aligned along the NNE-SSW axis, which has been associated with resting behaviour in other animals; see above42. One could speculate that crayfish burdened with high densities of symbionts might seek out refuges, and in these scenarios, reliance on non-magnetic  may facilitate location of burrow entrances.The observed change in relative salience of magnetic and non-magnetic cues at higher worm densities, i.e., densities that might be detrimental to the ectosymbionts59, and the abundance of symbiont impacts on host behaviour, understanding how symbionts influence host responses to magnetic cues is likely to provide new insights into which factors may influence animal movements under natural conditions. It also advances our understanding of evolutionary forces that have shaped sensory systems that process spatial information, and, conversely, how symbiotic interactions influence various components of fitness in both hosts and ectosymbionts. In addition, understanding the effects of symbionts on host behaviour may help to account for some of the variability in the responses of wild caught host species to magnetic (and other) spatial cues. To the best of our knowledge, this is the first study to demonstrate that symbionts can alter their host\u2019s behavioural response to the magnetic field, an effect that could be easily overlooked in un-manipulated field studies and in laboratory studies of wild caught host species. Our findings go beyond previous work showing that symbiosis involves complex interactions between the host and symbiont with possible fitness consequences for both taxa, suggesting that these interactions involve effects on host responses to a specific type of sensory input  that play a fundamental role in organizing spatial behaviour.Symbioses are ubiquitous in nature. Given the importance of magnetic information in organizing spatial perceptionSupplementary figuresRaw Data"}
+{"text": "We demonstrate that TRIM21 promotes the activation of IRF3 in CVB3-infected cells via interacting with MAVS and catalyzing the K27-linked polyubiquitination of MAVS, thereby enhancing type I interferon signaling. The RING domain of ubiquitin ligase activity and PRY-SPRY domain of TRIM21 are critical for its anti-viral effect. In vivo overexpression of TRIM21 significantly protected mice against viral myocarditis by suppressing CVB3 replication and reducing cardiac inflammatory cytokine production. While TRIM21 deficient mice exhibited a decreased IFN-\u03b2 production, an increased cardiac and pancreatic CVB3 replication, and aggravated pancreatic injury as well as myocarditis during acute infection. Thus, our results demonstrate TRIM21 as a positive regulator of IFN-\u03b2 signaling by targeting MAVS during CVB3 infection and suggest it as a potent host defense against CVB3 infection and viral-induced injury in hearts and pancreas.Tripartite motif-containing 21 (TRIM21) is a regulator of tissue inflammation and pro-inflammatory cytokine production, and has been implicated in negative regulation of IRF3-dependent type I interferon signaling. However, the antiviral activity of TRIM21 varies among diverse viruses and its role on regulation of type I interferon remains inconsistent in different microbial infections. Here, we investigate the potential role for TRIM21 in controlling Coxsackievirus B3 (CVB3) replication and susceptible organ pathology. We found that CVB3 infection up-regulated the expression of TRIM21 in hearts of mice and cardiomyocytes at early phase of infection. Knock-down of TRIM21 resulted in increased viral replication, while overexpression led to increased phosphorylation and dimerization of IRF3, increased IFN-\u03b2 transcription and reduced viral replication  Coxsackievirus is a single-Stranded RNA non-enveloped virus of the Enterovirus genus within Picornaviridae associated with several human and mammalian diseases, of which B3 type Coxsackievirus (CVB3) is well-identified as a major causative agent of viral myocarditis (VMC) , 2. CVB3The tripartite motif (TRIM) protein family contains over 70 members of TRIM protein family in human and is structurally characterized by a RING domain, one or two B-boxes, and a coiled-coil domain . TRIM prTRIM21, initially known as an autoantigen Ro52/SS-A, is an ubiquitously expressed cytosolic E3 ubiquitin ligase and plays important roles in immune regulation and microbial restriction. TRIM21 has been well known as a regulator for type I interferon (IFN) production, however it may positively or negatively modulate the antiviral innate signaling according to the types of viruses. TRIM21 has been reported to be a positive regulator of IRF3 signaling by preventing its ubiquitination and degradation, thus enhancing IRF3 mediated antiviral responses .On the oHere, we investigate the antiviral activity of TRIM21 against CVB3 replication and its role in CVB3-induced acute vial myocarditis and pancreatic injury. Our results indicate that TRIM21 inhibits CVB3 replication via interacting with MAVS for promoting the K27 polyubiquitination of MAVS, thereby enhancing IRF3-mediated type I IFN signaling pathway and protecting mice against CVB3-induced myocarditis as well as pancreatic acinar cell necrosis.\u2212/\u2212 mice were constructed from Cyagen Biotech .CVB3 (Nancy strain) was a kind gift from Professor Yingzhen Yang .Six\u2013eight weeks old male BALB/c mice were purchased from the Shanghai Slac Animal Inc. TRIM212 incubator at 37\u00b0C.HeLa cells and HEK-293 cells were grown and maintained in DMEM medium supplemented with 10% FBS (Gibco) and 100 units/ml penicillin and streptomycin in a 5% CO50 assay on HeLa cell monolayers with standard methodology .Cell culture and tissue lysis supernatants were diluted serially using 10-fold dilutions and titered on HeLa cell monolayers by the TCID50 assay.The viral titer was determined by TCIDThe Flag-MAVs or HA-K27Ub plasmids were the gifts from Prof. Hui Zheng . Human TRIM21 cDNA was amplified from RNA of HeLa cells using primers: For: 5\u2032-GCCACCATGGATTACAAGGATGACGACCGATAAGGCTTCAGCACGC-3\u2032 and Rev: 5\u2032-AAAGCCATCAATAGTCAG-3\u2032. Mouse TRIM21 cDNA was amplified from RNA of cardiomyocytes using primers:5\u2032-ATGGATTACAAGGATGACGATAAGCACCCTCTACAACCTCAAAA-3\u2032 and 5\u2032-CCTGGCTCCTGACCATCACA-3\u2032. cDNA of truncated forms of TRIM21 lacking N-terminal RING,B-box C-terminal and PRY-SPRY domain were amplified using primers: \u0394RING-For: 5\u2032-CCGGCAGCGCTTTATGCTGCTC-3\u2032 and \u0394RING-Rev: 5\u2032-AAAGCCATCAATAGTCAG-3\u2032; \u0394B-box-For: 5\u2032-ATGCGGTGTGCAGTGCATGGA-3\u2032 and \u0394B-box-Rev: 5\u2032-AAAGCCATCAATAGTCAG-3\u2032; \u0394PRY/SPRY-For: 5\u2032-GCCACCATGGCTTCAGCAGCACGC-3\u2032 and \u0394PRY/SPRY-Rev: 5\u2032-TCACACATGGCACACACTC-3\u2032. For the transfection experiment, HeLa cells were seeded into 24-well plates and transient transfection was performed by Lipofectamine 2000 according to the manufacturer's instruction. Cells were cultured for 24 h before infection of CVB3.Total RNA was isolated from cells or tissues using RNAiso reagent , and cDNA was prepared using reverse transcriptase . Quantitative real-time RT-PCR (Q-PCR) was performed using SYBR green real-time PCR kits on a Bio-Rad iCycler using the following primers:\u2212\u0394\u0394CT method was used to normalize the transcription of the detected gene mRNA to that of the GAPDH mRNA and calculate the fold induction relative to the control.The 2in vitro siRNA transfection reagent .Human siRNA oligonucleotides targeting sequences named as TRIM21 siRNA1 (UCAUUGUCAAGCGUGCUGC) and TRIM21 siRNA2 (UGGCAUGGAGGCACCUGAAGGUGG) were ordered from GenePharma.Inc . The siRNA was transfected into HeLa cells using INTERFERin HEK293 cells were transfected with plasmids containing human or murine TRIM21 (1 \u03bcg) using the Lipofectamine Plus reagent (Invitrogen) for 24 h, and then infected by CVB3 (MOI = 5) for 18 h. Samples were resuspended in sample lysis buffer (Bio-Rad). Lysates were resolved by SDS-polyacrylamide gel electrophoresis and transferred to PVDF membranes. The blots were probed primary antibodies for Flag , IRF3 , pIRF3 , actin , GAPDH , and VP-1 . HRP-conjugated anti-rabbit  or anti-mouse IgG  was used as a secondary antibody. Proteins were detected by chemiluminescence (Pierce). The intensities of the bands in the blots were quantified by densitometry using the Image Studio Lite program according to the developer's instructions.HEK293 cells were transfected with an expression plasmid encoding full-length of Flag-tagged MAVS. Cell lysates were collected using radioimmunoprecipitation assay (RIPA) lysis buffer with protease inhibitors , followed by immunoprecipitation with anti-Flag beads. Proteins were eluted from the beads after washing six times with PBS. The protein binding to the beads was subjected to Western blot with anti-TRIM21  or anti-Flag .For analysis of ubiquitination of MAVS in HeLa cells, cells were co-transfected with TRIM21, HA-K27ub or Flag-MAVS, followed by infection with CVB3. Cell lysates were immunoprecipitated with anti-Flag and analyzed by immunoblotting with the anti-HA antibody. Native page for the detection of IRF3 dimerization was performed on acrylamide gel without SDS. Cells were lysed with ice-cold lysis buffer including 50 mM of Tris-Hcl at PH = 7.5, 150 mM of NaCl and 0.5% NP-40 containing protease inhibitor cocktail. After centrifugation at 13,000 g for 15 min, proteins in the supernatant were quantified and diluted with 5x native PAGE sample buffer . The gel was pre-run for 30 min at 40 mA on ice with 25 mM Tris-HCL (pH = 8.4), and 192 mM glycine with or without 1% of deoxycholate in the cathode chamber and anode chamber, respectively. The unboiled total protein was added into the gel for 80 min at 25 mA on ice.HEK293 cells were co-transfected with 100 ng luciferase reporter plasmid, 10 ng thymidine kinase promoter-Renilla luciferase reporter plasmid, and the TRIM21-expression or control vector plasmid using the Lipofectamine 2000 transfection reagent . 48 hrs later, cell lysates were prepared and the luciferase activities were determined by the Dual-Luciferase Reporter Assay System  according to the manufacturer's instructions.50 dose of CVB3. Body weight and mortality of mice were recorded upon the termination of experiment. Individual experiments were conducted at least three times with 7 to 10 mice per group.Mice were infected intraperitoneally (i.p.) with 100 \u03bcl PBS containing 1000 TCIDThree hearts and pancreas of each group of mice were collected 7 days post infection. The apical parts of the tissues were fixed in 10% phosphate-buffered formalin, embedded in paraffin wax, sectioned at 5 \u03bcm and stained with hematoxylin\u2013eosin (H&E). Stained sections were used for image analysis with a Nikon Eclipse TE2000-S microscope and five images were captured under high power fields randomly.Hearts were fixed with 10% formalin in 0.1 M phosphate buffer, pH 7.4. Sections were deparaffinized and irradiated at 750 W in a microwave oven in 10 mM sodium citrate buffer, pH 6.0. Sections were then treated with 3% hydrogen peroxide to inhibit endogenous peroxidases. After washing in TBS with 0.025% Triton X-100, the sections were blocked with 10% BSA. Following blocking, sections were incubated with goat polyclonal antibody against TRIM21  diluted in TBS-1% BSA overnight at 4\u00b0C. After washing, sections were incubated with a biotinylated anti-goat secondary antibody (Jackson immunoresearch) for 1 h and a peroxidase-labeled streptavidin for 5 min at room temperature. Peroxidase activity was detected with DAB , and sections were counter stained with hematoxylin. The level of protein accumulation was estimated as the percentage of the total counterstained area that was positively stained for the protein of interest, which was determined using Image Jsoftware (Nikon Eclipse TE2000-S microscope).2 at 37\u00b0C for 2 h. The unattached cardiomyocytes were seeded into fibronectin-coated 8-well Live Cell Imaging Culture Dish  and experiments were performed when the cardiomyocytes formed a confluent monolayer and beat in synchrony at 72 h.Neonatal cardiomyocytes were isolated from 1 to 3 days BALB/c mice. The ventricles obtained from 1 to 3 days BALB/c mice were removed rapidly into cold Hanks' balanced salt solution (Gibco). After washing and mincing, tissues were digested in 0.05% trypsin (Gibco) for 30 min at 4\u00b0C with rotation before transfer into DMEM (Gibco) containing 20% FBS  to terminate the digestion. After washing with HBSS, the tissues were incubated with Liberase TH  at 37\u00b0C for 5 min, and the dissociated cells were collected into 20% FBS DMEM. This procedure was repeated until most of the cells were released. The isolated cells were incubated with 5% COImmunofluorescence was performed to assess the cellular expression and location of TRIM21 and viral RNA expression according to the manufacturer's instructions. Freshly cultured cardiomyocytes were infected with CVB3 (MOI = 5) for 0, 12, and 24 hrs. Heart tissues of infected mice were embedded in OCT and made into 5 \u03bcm cryo section. Cells were fixed with 4% paraformaldehyde for 1 h before blocking (2% BSA) for 1 h. Cells were then incubated with primary antibodies against TRIM21  and anti-dsRNA  at 4\u00b0C overnight. Fluorochrome-conjugated secondary antibodies  and DAPI were used for immunofluorescent staining. Images were captured and analyzed with Nikon A1 confocal microscope.Levels of TNF-\u03b1, IL-6, IL-10, IFN-\u03b3, MCP-1 were determined using sensitive mouse, IL-6, IL-10, and IFN-\u03b3 kits according to the manufacturers' instructions .in vivo-JetPEITM\u2013Gal transfection agent according to the manufacturer's instructions . Mice received 2 doses of TRIM21 plasmids 2 days before and 1 day after CVB3 infection to sustain in vivo over-expression of TRIM21.Mice were retro-orbitally injected with 1.0 ml reagent containing 50 \u03bcg of mouse TRIM21-expression plasmid or vector plasmid using t-test. Survival curves were estimated from Kaplan-Meier procedure with the Lonrank test to compare survival among groups. P < 0.05 was considered to be statistically significant and are indicated as follows: *, 0.05 \u2265 P > 0.01; **, 0.01 \u2265 P > 0.001; ***, P \u2264 0.01.Data were presented as the mean \u00b1 SEM and statistical analysis was analyzed by GraphPadPrism 5 software. For two-group comparisons, statistical significance was determined by Student's 50 CVB3 i.p. infection, a massive inflammatory infiltration and cardiomyocye necrosis were observed in hearts at day 7 p.i.  play an important part in the resistance to viral infection. TRIM21 is reported to be involved in modulating host innate type I signaling against viral replication. Thus, we first examined the IFN-\u03b2 mRNA production in HeLa cells overexpressing TRIM21 upon CVB3 infection by real-time PCR. Cells transfected with an empty vector were used as a control. In comparison to vector-transfect cells, a moderate promotion in IFN-\u03b2 mRNA levels was observed in the TRIM21-overexpressed cells infected with CVB3. Additionally, IFN-\u03b1 mRNA level was increased significantly by TRIM21 overexpression Figure . To confin vitro. Furthermore, we observed that TRIM21 catalyzed the formation of K27-linked polyubiquitin chains on MAVS  and ~70% mice survived by day 7 p.i. , including IFN-\u03b2 and IFN-\u03b1. Type I IFNs further induce the expression of downstream proteins, which mediate innate immune responses, such as suppression of viral replication, clearance of virus-infected cells , 29. TheCVB3 has evolved many strategies to suppress host innate immunity therefore does not cause robust interferon release and ISG expression. As shown in Figure As a member of tripartite motif (TRIM) family protein, TRIM21 contains a RNIG motif in the N-terminal domain, a B-box motif, a coiled-coil domain. And TRIM21 protein also contains a carboxy-terminal B30.2 (SPRY) domain . Previouin vivo effect of TRIM21 on CVB3 replication and tissue pathology. By using in vivo-Jet PEI-transfection of TRIM21-plasmids and TRIM21 deficient mice, we demonstrated that the viral replication and CVB3-induced cardiac immune infiltration, cardiac proinflammatory cytokines production and injuries were significantly decreased upon in vivo over-expression of TRIM21 . So in further study we will focus on clarifying whether TRIM21 exerts IgA-mediated ADIN function on intestinal CVB3 replication considering CVB3 as an oral-fecal disseminating virus.Currently, there is only limited report of antiviral effect of TRIM21 in mice model. Our study demonstrate the 1 Figure . In acco1 Figure . Our dat1 Figure \u201336.So wein vivo and in vitro through interacting with MAVS thereby promoting the activation of IRF3 and Type I Interferon production. The anti-viral effect of TRIM21 is dependent on RING and PRY-SPRY domain. We also demonstrate the antiviral effect of systemic TRIM21 in vivo which leads to the increased resistance to CVB3-induced myocarditis and pancreatic injury. Our data help to clarify the biological role of TRIM21 in severe tissue pathology caused by viral infection and indicating a therapeutic target potential for TRIM21.Overall, our study identifies cytosolic TRIM21 as a positive regulator of CVB3-triggered MAVS-mediated type I Interferon signaling pathway that restricts viral infection. TRIM21 expression is up-regulated by CVB3 infection at early phase of viral infection. TRIM21 inhibits CVB3 replication All animal experiments were performed in accordance with Soochow University institutional guidelines, and the study was approved by the Ethics Committee of Soochow University in written form (SYXK2015-0036).WX conceived and supervised the project. HL and YS performed the experiments. HL and ML interpreted data and wrote the manuscript. All authors approved the final version of the paper.The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest."}
+{"text": "The results are as follows. (1) China\u2019s provinces and cities have different energy efficiency scores in energy consumption, economic growth, and CO2 emissions. The regional ranks and technology gaps of five provinces and cities in non-YREB and of four provinces and cities in YREB exhibit a decline. Overall, the ranks and technology gaps of the provinces and cities in YREB are significantly lower than those in non-YREB, meaning that there is greater room for efficiency improvement in the latter region. (2) The gross domestic product (GDP) and CO2 efficiency values of non-YREB provinces present great differences, especially the CO2 efficiency value that ranges from 0.2 to 1, while their values in YREB are more balanced with little difference between provinces and cities. Thus, YREB is more coordinated in terms of energy savings and air pollutant reduction. (3) Some cities with good economic development such as Beijing, Shanghai, and Tianjin have regional and technology gap values of one, indicating that they not only target economic growth but also address energy savings and air pollutant reduction. The regional rank and technology gap values of some underdeveloped provinces such as Neimenggu, Ningxia, and Qinghai are also one. Finally, this research proposes countermeasures and recommendations to both areas.The Yangtze River Economic Belt (YREB) is one of the most important areas for the economic growth of China, but rapid development has caused tremendous damage to the energy and ecological environments of the region. Very few studies have compared the carbon emissions of YREB with that of non-YREB and furthermore, have not considered regional differences and radial or non-radial characteristics in their analysis. This paper thus selects the energy consumption data of 19 provinces and cities in YREB and 19 provinces and cities in non-YREB from 2013 to 2016, constructs the modified meta-frontier Epsilou-based measure (EBM) data envelopment analysis (DEA) model and adds an undesirable factor, energy consumption, and CO According to People\u2019s Daily of China, the annual cargo volume of the trunk line of the Yangtze River hit 2.69 billion tons in 2018, ranking first in the world in terms of inland rivers [The Yangtze River Economic Belt (YREB) crosses east and west China and covers 11 provinces and municipalities in an area of about 2.05 million km2 emission reduction efficiency [2, and SO2 (or NO2) [There are four main directions in the field of energy consumption and low carbon economy research: (1) energy and COficiency ,4,5,6,7;ficiency ,13,14,15ficiency ,17,18; ((or NO2) ,23,24,25This present paper, therefore, has the following three major innovations and contributions. First, China\u2019s energy and environment research at the regional level mainly focuses on the division of provinces and cities, as well as the traditional three regions . In September 2014, the State Council of the People\u2019s Republic of China issued guiding opinions on promoting the development of YREB by relying on the \u201cgolden waterway\u201d and proposed the division of YREB for the first time. At present, no scholars in China have ever evaluated the energy and environmental efficiencies of YREB and non-YREB. As the middle and lower reaches of the Yangtze River are the most developed areas in China, comparing the energy efficiency of YREB with that of other regions can provide a new division basis and evaluation results for the country\u2019s regional economic development and help provinces to adjust or optimize their industrial structure.Second, YREB straddles the two major regions of east and west China, and its population density, economic density, and per capita GDP are respectively 4.5, 6.2, and 1.4 times the national average. Having the largest economic density in China, its strategic significance for China\u2019s economic development is incomparable with that of other economic belts in the world. In fact, it is the region with the largest economic growth potential in the next 15\u201320 years and should become an inland river economic belt with the largest development scale and widest influence scope globally. Therefore, the findings herein benefit not just China, but also other important river basins\u2019 economic belt research.Third, the research findings of this paper can be used to further verify whether energy conservation and emission reduction are ignored or paid greater attention to during the process of strong economic growth. Moreover, we shall see where the carbon emission efficiency of the more developed YREB is versus the less developed non-YREB.Fourth, as current research generally uses DEA, the main methods employed are radial analysis, such as CCR  and BCC , or non-radial analysis, such as SBM (slacks-based model) or DDFM . However, the radial DEA model ignores non-radial slacks, while the non-radial DEA model ignores the characteristics of the same proportion of radial DEA model. The EBM model is a combination of radial and non-radial DEA model. Thus, we select the EBM DEA model to avoid an underestimation or overestimation of efficiency values and improvement space.Our research modifies the EBM model of Tone and Tsutsui , adds unThe organization of this paper runs as follows. 2 emission reduction efficiency in recent years. Pao et al. [2 emissions, analyzing countryside energy consumption in China during 2001\u20132008 and the effects on climate change. Yao et al. [2 emission performance index (MNMCPI) to estimate carbon dioxide emission efficiency in China. The results show from 1998 to 2011 that its provincial industrial sector carbon dioxide emissions grew at an average annual rate of 5.53%, while the average carbon dioxide emissions of the industrial sectors in the eastern, central, and western regions fell. Du et al. [2 emissions in most provinces/cities in China. Decreasing inter-regional technology differences can effectively cut regional carbon dioxide emissions.Research on energy, environment, and low-carbon economy has typically focused on COo et al.  have looo et al.  considero et al.  used theu et al.  estimate2 emissions by a non-radial directional distance function meta-frontier. Pang et al. [Some scholars have employed the DEA method to evaluate energy and environmental efficiencies in different countries and industries. Blomberg et al.  evaluateg et al.  used SBMg et al.  utilizedg et al.  developeg et al.  employ Sg et al.  took theSome scholars have researched the relationship between GDP growth and energy consumption. Niu et al.  evaluate2 and SO2 (or NO2) together and regard them as undesirable outputs for energy environment efficiency assessment. Tsolas [2, NOX, and CO2 are unintended outputs. Inefficient power plants are less efficient than the initial estimation, while non-lignite plants are on average more efficient than power plants. Sueyoshi and Mika [X) by a non-radial DEA model and measure the environmental performance of plants under two alternatives (with or without CO2 emission control). Under the CAA specification, coal-fired power plants in the U.S. are efficient at controlling SO2 and NOX emissions.Some studies have considered CO. Tsolas  uses DEAand Mika  analyzed2 and SO2 emissions and calculate the ecological total-factor energy efficiency (ETFEE) of 30 regions in China from 2005 to 2009 by the SBM model. China\u2019s regional ETFEE still maintains roughly 0.6, while regional energy efficiency is estimated to exceed 0.100 regardless of the environmental impact. The regional energy efficiency in China is extremely uneven: the eastern region ranks first with ETFEE higher than 0.700, followed by the northeast and central regions, while the western region has the lowest ETFEE at below 0.500. Wang and Wei [Li and Hu  consider and Wei  used DDF and Wei  took the2, SO2, and NOX are considered as undesirable outputs. Except for Beijing and Hainan, the energy efficiencies have declined. Improving energy efficiency depends primarily on technological improvements, economies of scale, and management. Guo et al. [Qin et al.  used theo et al.  utilized2 efficiency assessment of the YREB and non-YREB regions in China. While the main methods in the literature are radial or non-radial models, they may underestimate or overestimate production efficiency values. Therefore, this paper adopts the modified meta-frontier Undesirable EBM DEA to assess energy efficiency and CO2 efficiency in 30 provinces and cities of China, in order to reflect carbon emission efficiency more objectively and accurately.According to the above literature, there is currently no specific energy and COCharnes et al.  set up tWe present now the Tone and Tsutsui  EBM DEA n, where m types of input s, where The total number of DMUs is The efficiency of the DMU unit is:Y: DMU output,X: DMU input,For DMU0, when Tone and Tsutsui  proposedTone and Tsutsui\u2019s  EBM doesN) by groups of DMUs (N = N1 + N2 +\u2026+ NG), and i  and final output r  of the DMU unit j . Under the meta-frontier, DMU k can choose the weight of the final output Due to differences in management, resources, regulations, and environments, we compose all firms :2 efficiencies using Equations (5)\u2013(7).Hu and Wang\u2019s  total-fa2 indices are efficient. If Equations (6) and (7) are less than 1, then the energy and CO2 indices are inefficient. The GDP index is the most efficient when Equation (5) equals 1. On the contrary, the GDP index is inefficient when Equation (5) is less than 1. If Equations (6) and (7) equal 1, then the energy and CO2, such as in Li et al. [2 emissions are derived from the China Energy Statistics Yearbook [2 as undesirable output : This study uses the number of employees in each region at the end of each year; unit is a person. Capital input (assets): We take capital stock according to the fixed asset investments in each city; the unit is 100 million RMB. Fixed asset investments in China Statistical Yearbook mainly refer to the total amount of construction projects, the purchase of fixed assets, and related expenses in the form of currency in each province within a certain period. Therefore, we selected this amount as an input index to reflect the cost of equipment and tools, construction and installation engineering, engineering construction and other costs invested in economic and social development.Energy consumption (com): This covers each city\u2019s total energy consumption; the unit is 100 million tons. New energy (com) includes solar energy, nuclear energy, and wind power. Consumption (com): We calculate this from each city\u2019s total energy consumption; the unit is 100 million tons.Output variable:GDP: It commonly refers to the total value of all final products and services produced within a certain period of time (a quarter or a year) in the economy of a country or region. It can reflect both a country\u2019s not only the economic performance and it is of a country but also the national strength and wealth of a country. At present, China calculates quarterly GDP data on a quarterly basis and publishes the final verified figures in the China Statistical Yearbook every September. The GDP from each province (city) is applied as the city\u2019s output; unit is 100 million RMB. Undesirable output variable:2 (carbon dioxide): It encompasses air emissions due to energy consumption.COBased on the previous research results and reasonable research assumptions, we formulated four research hypotheses that must be verified. First, we shall evaluate the energy and environmental efficiencies of YREB and non-YREB. Second, provinces (cities) have clearly not paid enough attention to energy conservation and emission reduction during economic growth, and their carbon emission efficiencies are not ideal . Third, 2 emissions. Among the three input factors, fixed assets continue to rise each year, and the maximum and the average number of employed people slightly decline since 2014. The average value of traditional energy consumption has dropped slightly, but the maximum value continues to rise.2 is not significant. It rises sharply in 2015, but declines in 2016. Most provincial municipalities and autonomous regions have begun to address CO2 emission reduction in their pursuit of GDP growth.Among outputs the average value of GDP has maintained a steady upward trend, the maximum value of GDP has increased significantly, and the minimum value has risen slowly. The increase in the average value of COFrom the provinces in YREB, Jiangsu, Hunan, Chongqing, Anhui, and Guizhou have scores and ranks that are stable. Sichuan and Yunnan show an obvious upward trend. Sichuan has increased by 7 in ranking in 2016 compared to 2013, and its overall efficiency value has gone from 0.7285 to 0.7879. Hubei and Jiangxi exhibit a significant decline.From the provinces in non-YREB, their overall efficiencies are mostly all stable. Liaoning has the largest increase, with an efficiency value of 1 in 2016, which rises 10 in ranking versus 2013. Hainan shows a significant decline, from 0.8223 in 2013 to 0.7384 in 2016, or from 9th to 14th. There are also three provinces that have remained unchanged at the end of the ranking: Xinjiang, Shanxi, and Gansu.2 efficiency scores of different provinces during 2013\u20132016. Shanghai, Sichuan, and Zhejiang in YREB and Beijing, Tianjin, Fujian, Guangxi, and Hainan in non-YREB have higher efficiency scores. In particular, Shanghai, Beijing, and Tianjin have efficiency values of 1 in each year. There are some provinces and cities with large differences in GDP, energy consumption, and CO2 efficiency scores, such as Anhui, Guizhou, and Yunnan in YREB and Ningxia, Shanxi, and Xinjiang in non-YREB. These provinces and cities have higher GDP scores, all above 0.8, but their energy consumption and CO2 efficiency scores are all very low at under 0.27. For Shanxi, the difference between GDP and CO2 efficiency scores is above 0.8, showing a huge imbalance. All these provinces are targeting GDP growth, but there is still room for improvement in energy savings and pollution reduction.2 efficiency values of YREB are more balanced, and the differences among provinces are small. However, there is a significant difference in the GDP and CO2 efficiency values of non-YREB provinces, especially as the CO2 efficiency value has a wide range from 0.2 to 1. Any improvement in the environment and efficiency of YREB will help China maintain its path of ecological priority and green development and offer a solution for environmental governance and sustainable development of the world\u2019s large river basins.From 2 emission efficiency values of YREB are relatively balanced between 0.4 and 0.8. However, the CO2 emission efficiency values of non-YREB show a large difference of between 0.1 and 1.From The regional ranks of most provinces in YREB have not changed much. Shanghai has a technology gap of 1 and ranks 1st. Jiangxi and Hubei show a slight decline. Zhejiang experienced a very significant decline from 13th in 2013 to 19th in 2016 and thus needs to strengthen carbon dioxide emission treatment.2 emission control has improved.In the non-YREB regions, two provinces stand out. First, Liaoning\u2019s technology gap values and ranks for 2013, 2014, and 2016 are all 1, but there is a fluctuation in 2015 when its technology gap value drops to 0.9594, and its rank declines to 20th. The other province is Guangxi, which jumps from 9th in 2013 to 1st in 2016. Its technology gap increases from 0.9973 to 1, indicating that its CO2 emissions and treatment. The ranks of provinces in non-YREB are highly volatile, indicating that their policies are not stable enough in terms of CO2 emissions and treatment.2 efficiency values of provinces outside YREB exhibit large differences, and the prominent polarization is basically consistent with the research results of other scholars [According to the above analysis, the COscholars ,7. Howevscholars . It show2 emission efficiency, and economic performance in 2013\u20132016. The results are as follows. This research investigates 30 provinces and cities in China from the YREB and non-YREB regions to explore the correlations among energy consumption, CO1. According to the meta-frontier, five provinces and cities in non-YREB  and four provinces and cities in YREB  decline in rank and technical gap. The proportion of provinces and cities with both a declining rank and technology gap in YREB is relatively high. The reasons are related to the prominent deterioration of water and soil environment in the Yangtze River basin, the poor water quality in some tributaries, the serious eutrophication in lakes and reservoirs, and heavy metal pollution in some areas. The upper reaches of Dongting Lake and Poyang Lake also suffer from severe soil erosion and frequent geological disasters. The ecological functions of lakes and wetlands in the middle and lower reaches of the Yangtze River have deteriorated significantly. The ranks and technology gaps of the provinces and cities in YREB are obviously behind the non-YREB provinces and cities, and with a larger gap and lower rank they former have greater room for efficiency improvement.2 efficiency values of non-YREB regions exhibit a significant difference, especially for their CO2 efficiency value as it has a wide range from 0.2 to 1. However, the YREB provinces\u2019 GDP and CO2 efficiency values are balanced, and the differences between provinces and cities within YREB are small. 2. The GDP and CO2 efficiency rank. However, YREB provinces and cities do not show a big difference in CO2 efficiency rank. Thus, the measures taken in the non-YREB region for low-carbon emission reduction are not effective enough.3. Non-YREB provinces and cities have a big difference in CO4. Beijing, Hebei, Liaoning (except for 2015), Neimenggu, Ningxia, Qinghai, Shanghai, and Tianjin have regional rank and technical gap values of 1. Except for Shanghai (in YREB), the other provinces and cities are in non-YREB. Beijing, Shanghai, Tianjin, and other cities with very developed economies show that they have been addressing energy savings and air pollutant reduction while focusing on economic growth. The economically underdeveloped provinces of Neimenggu, Ningxia, and Qinghai have rank and technical gap values that correlate with their backward economic performance.According to the efficiency values of different indicators, each province or city should adopt a strategy that is consistent with its actual situation. We now present some policy recommendations.1. China\u2019s central government should promote institutional innovation in river basin management, implement the strictest management system, and increase accountability for ecological and environmental protection. The inter-ministerial joint meeting mechanism of the Yangtze River Economic Belt that was established can also promote joint prevention and treatment of heavy chemical industry development and ecological environment. Moreover, each province should set up regional industry platforms and regional cooperation mechanisms with Shanghai, Wuhan, and Chongqing as the center. The government can integrate the industrial chain of YREB, strengthen industrial interaction among the upper, middle, and lower industry streams, and realize the coordinated development of the regional economy along the river.2. The central government should also cultivate regional characteristic industries, promote the upgrading of provinces\u2019 economic structure, and build green ecological industries, new technology industries, and intelligent manufacturing and service industries to solve the energy consumption and pollution problems caused by traditional industries. From the regional perspective, Jiangsu, Zhejiang, Shanghai and other provinces focus on the development of green intelligent manufacturing and advanced manufacturing, while Inner Neimenggu, Ningxia, and Qinghai can develop green energy such as solar photovoltaic, wind energy, and clean coal. From the perspective of industry, the regions\u2019 government can target the development of high-tech industries, intelligent manufacturing, and service industries, improve the degree of industrial concentration, promote advanced industry to solve the problems of energy consumption and pollution caused by traditional industry, and ultimately achieve green and low-carbon development of the overall industrial structure. The YREB regions can take the lead in industrial upgrading and high-end manufacturing and assist in the transformation and upgrading of non-YREB regions\u2019 industrial structure and high-quality development.3. The central authority should also promote greater energy conservation and environmental protection technology investment and further strengthen low-carbon technology, emission reduction technology, and green energy technology. Special joint actions must be taken to clean up chemical and other pollution problems within YREB and to lay out roadmaps and timetables to solve the problems of enterprises with different pollution levels. Each province should execute ecological restoration projects along the Yangtze River and prevent atmospheric, water, and soil pollution. The YREB region can also establish multiple ecological protection mechanisms such as emission rights, carbon emission rights, energy use rights, and water rights transactions. Conversely, the non-YREB region should address technological innovation, deepen supply-side reforms, and improve the overall efficiency of regional energy conservation and emission reduction.4. Finally, the China government can accelerate the construction of a national carbon emissions trading market system and promote a system for carbon rights exchange. In 2015, the government did propose to reduce carbon emissions by 40\u201345% by 2020, and thus it launched carbon rights trading in some cities. These pilot cities are Shanghai, Hubei, and Chongqing in YREB and Beijing, Tianjin, Guangdong, and Shenzhen in non-YREB. These pilot cities are going to be the model for the country\u2019s carbon trading market system.There are still some limitations to this study. For example, the factors behind the differences in carbon emissions between the two regions need to be further analyzed in greater depth. As a next step, future studies can consider the exploration and mining of impact factor analysis and spatial spillover effect analysis in order to add to the findings herein."}
+{"text": "Since the evolution of life from an aquatic to a terrestrial environment, Ca2+ signaling systems have expanded and diversified enormously. Although there are several Ca2+ sensing molecules found in a cell, EF-hand containing proteins play a principal role in calcium signaling event in plants. The major EF-hand containing proteins are calmodulins (CaMs), calmodulin like proteins (CMLs), calcineurin B-like (CBL) and calcium dependent protein kinases (CDPKs/CPKs). CaMs and CPKs contain calcium binding conserved D-x-D motifs in their EF-hands (one motif in each EF-hand) whereas CMLs contain a D-x3-D motif in the first and second EF-hands that bind the calcium ion. Calcium signaling proteins form a complex interactome network with their target proteins. The CMLs are the most primitive calcium binding proteins. During the course of evolution, CMLs are evolved into CaMs and subsequently the CaMs appear to have merged with protein kinase molecules to give rise to calcium dependent protein kinases with distinct and multiple new functions. Ca2+ signaling molecules have evolved in a lineage specific manner with several of the calcium signaling genes being lost in the monocot lineage.Ca Th. ThCaMs 2+ to the EF-hands, the globular structure of the EF-hand is modified into an open conformation that allow the protein to interact with other proteins . Th. Th2+ to EF-hand .th position is occupied by any amino acid . Th. Th2+. Thand   Physcomitrella patens (PpCBL3-3) (bryophytes) and Selaginella moellendorffii (SmCBL5) (pteridophytes) [Like r genome . The alg studied . The CBL carteri . The majtronless . The intophytes) .2+ binding D and E amino acids are conserved at the 3rd, 4th, 7th and 14th position [2-E motif at the 7th, 8th and 11th position and a E-E-x-D motif at the 19th, 20th and 22nd position [2+ ion  to 1015 amino acids (FvCBL4). The isoelectric point of CBL proteins are ranges from 3.94 (CreinCBL8) to 8.83 (MpCBL1) . Multiplposition . The E a [2+ ion . The con4-E-x6-E motif and the C-terminal region contain a conserved P-S-F-V-F-x-S-E-V-D-E motif [The positions of the conserved amino acids in CBL proteins are different from those found in CaMs and CMLs. The CBL proteins are classified into four groups namely group A, B, C and D . Group D-E motif .nd position that is a requisite for protein myristoylation  to 53 (Panicum virgatum) [CreinCPK17-5 of Chlamydomonas reinhardtii is the largest reported CPK gene containing an ORF of 5940 nucleotides whereas CpCPK2 of Carica papaya is the smallest CPK gene with an ORF of 693 nucleotides [CPK genes in Chlamydomonas reinhardtii and Physcomitrella patens and the presence of smaller CPK genes in higher eukaryotes suggests, the evolution of eukaryotic CPKs genes are associated with loss of gene size [CPK genes contain either 6, 7 or 8 introns and at least one CPK gene contains 11 introns from all of the species studied thus far, except for Carica papaya, Ostreococcus lucimarinus and Ricinus communis [CPKs that are designated as group A, B, C and D [CPK genes originated from a common ancestor and that they have evolved very recently via gene duplication in which the genes possess similar or overlapping functions [CPK genes indicates they have arisen through duplication.Calcium-dependent protein kinases are novel calcium sensors that are members of the serine/threonine protein kinase family. The number of irgatum) . CreinCPleotides . The preene size . The majcommunis . The phy C and D . Furtherunctions . The pre2+ ion  to 8.447 (SlCPK16) . Sequenc2+ ion . In addiM motifs . A conset plants . In somet plants . In addiposition . The secposition . Therefoposition . Insteadposition . The preposition .2+ binding and activation threshold of CPKs [The first EF-hand in algae, bryophyte and pteridophyte contains a E-E-I/x motif at the 1st, 2nd and 3rd position whereas the first and fourth EF-hands contain a conserved D amino acid at the 14th position . The sec of CPKs .Chlamydomonas reinhardtii, Volvox carteri, Micromonas pusilla, Ostreococcus lucimarinus and Physcomitrella patens contain M-E-L-C-x-G-G-E-L-F, H-R-D-L-K-P-E-N-F-L, D-F-G-L-S-V/x, D-I-W-S-x-G-V and P-F-W conserved amino acid motifs [2-I-A, whereas in algae, bryophyte and pteridophyte the conserved domain contain A-M-N-K-L consensus sequence [The sequence of the N-terminal region of CPKs is highly variable and dynamic while the kinase domain of CPKs contains conserved consensus sequences. The kinase domain in monocot and dicot plants contain the conserved consensus sequences C-x-G-G-E-L-x-D-R-I, H-R-D-L-K-P-E-N-F-L, D-x-V-G-S-x-Y-Y, A-P-E-V-L, D-V/I-W-S, G-V-I-x-Y-I-L-L, G-x-P-P-F-W, P-W-P-x-I-S, A-K-D-L-V and H-P-W. In contrast, the kinase domain in d motifs . The cond motifs . The autsequence .The CPKs contain putative myristoylation and palmitoylation sites ,38. Alth2+ binding proteins to avoid unwanted crosstalk of calcium signaling event. The CaM protein interacts with diverse sets of proteins involved in calmodulin-dependent protein kinase activity. They include CREB (cAMP-response-element-binding protein) phosphorylation through the activation of CaMKK, ion channel transport, opioid signaling, CaM induced events, signal transduction, signaling by GPCR , TPC1 , LAP6 , TKPR1 , NHX1 (sodium hydrogen exchanger 1), CCP3 (serine protease inhibitor 3), HSP (heat shock protein), DEK1 , PHS2 , LOS1 , WRKY (WRKY transcription factor), BAP1 (BON associated protein), SZF (zinc finger CCCH domain), RAD (UV excision repair protein), CIPK (CBL interacting protein kinase), ARP (DNA lyase) and other , Table 4movement ,53. The vacuoles . Heat shvacuoles . DEK1 isthaliana . The RADthaliana . WRKY40 thaliana ,59. BAP1thaliana . Overallthaliana ,45. Pfamthaliana ,45.+ transporter 5), TPC1 , AVP1 (pyrophosphate-energized vacuolar membrane proton pump 1)  and regulate diverse functions including abscisic acid signaling and salt tolerance and ,62. The  pump 1) , Table 4ntration . FKBP12 ntration . FKBPs antration ,69. Glutntration ,70. Vacuntration . Functiontration ,45.CPKs are involved in diverse cellular function starting from cell signaling to stress tolerance in plants. They act as a hub of plant stress signaling and development . The CPK2+ dominated as the major cation for use as a universal intracellular signaling molecule [2+ which possesses flexible coordination and rapid binding kinetics with biological molecules [2+ and other minerals. Ca2+ ion enter into cells through different pumps and ion channels present in the cell membrane [2+ are cytotoxic [2+ to maintain cellular homeostasis of calcium levels [The evolution of multi-cellular life forms from a single-celled ancestor is one of the most remarkable transitions that occurred during the evolution of life. Calcium ions may have a role as a \u201cpromoter\u201d in the evolution of early forms of life . Althougmolecule ,77. Thisolecules ,79. Addimembrane ,81,82,83ytotoxic ,85,86. Tm levels ,88,89. Im levels ,93,94,95m levels .2+ tool kit components has been reported to have emerged at bigger rate as compared to the evolution of other proteins [The major EF-hand-containing calcium sensing molecules are calcium-dependent protein kinases, calmodulins, calmodulin-like and calcineurin B-likes proteins. The intra-genomic diversity of Caproteins . TherefoA. thaliana genome were had been lost in the Oryza sativa genome  and Coccomyxa subellipsoidea , respectively, expanded up to 13 in Brassica rapa (dicot) and Mimulus guttatus (eudicot), whereas the presence of two CMLs in Coccomyxa subellipsoidea  and Ostreococcus lucimarinus  expanded up to 47 in A. thaliana (dicot)  contrasts with a total of 14 CBLs in Brassica rapa and the two CPKs in Coccomyxa subellipsoidea  and Ostreococcus lucimarinus  have expanded to 53 CPKs in Panicum virgatum (monocot). These examples reflect the evolutionary expansion and diversity of calcium-decoding molecules. Most unicellular eukaryotes, including algae, have a low calcium requirement for normal growth and development [Coccomyxa subellipsoidea. Although several other EF-hand containing proteins are exist in plant cells, CMLs, CaMs, CBLs and CPKs account for more than one-third of all the EF-hand containing proteins present in plant genomes [2+ signaling systems in plants is congruent with the increasing cellular and morphological complexity that has evolved in plants along with their ability to adapt to and live in a fluctuating and often harsh environment. The CPKs are quite abundant in algae and higher plants and they cluster with CBLs in phylogenetic trees. This suggests that CPKs and CBLs played prominent functional roles in the evolution of land plants. It seems that plants expanded the number of proteins within specific protein families during the evolution to foster functional diversification and specialization or that new functions evolved within existing protein families. The number of Ca2+-decoding protein families and the number of proteins within each family, was originally very low and subsequently expanded during evolution. The CMLs and CPKs families expanded dramatically and the increase in the number of family members is correlated with the increase in biochemical complexity that arose during plant evolution. The increase in organismal complexity was a driving force in the expansion and diversification of plant Ca2+ signaling systems where new functions had to be regulated by a limited number of sensors. This led to their expansion and functional diversification. The presence of conserved D-x-D motifs in the EF-hands of CaMs and CPKs suggest that the four primitive EF-hands of CaMs merged with protein kinase molecules to give rise to calcium-dependent protein kinases. The increase in CaM and CMLs gene numbers are correlated with the transition of plants from aquatic to terrestrial life forms [CaM and CML genes is correlated with the plant adaptation to a terrestrial environment  and the subsequent organismal complexity of gymnosperms and angiosperms.Ca (dicot) . Similarelopment . Therefo genomes . This sufe forms . The CaMfe forms . The acq2+ signaling systems in plants. A genomic analysis of Ca2+ signaling system genes in plants provides a clearer picture of the evolution of the increased number of Ca2+ signaling proteins and their diverse roles in plant metabolism, physiology and morphology. The mapping of the duplication and loss events that have occurred in Ca2+ signaling sensor molecules provides clarification of the evolution of these gene families. The interactions of CPKs with other CPKs suggests, CPKs are most possibly co-regulated together and the presence of conserved molecular feature of D-x-D, D/E-E-LD motif as well as the presence of conserved D and E amino acid at different position across the EF-hand containing protein reflect their conserved evolutionary perspectives. Differential kinetic studies of calcium signaling associated enzymes can also be very useful for understanding the functional diversification of Ca2+ signaling cascades. Additionally, more research is needed to clarify the role of the chloroplast and mitochondria in the evolution of calcium-decoding molecules, as these organelles also play a critical role in Ca2+signaling. Functional characterization of conserved calcium binding motifs and their binding kinetics will be an excellent approach to better understand calcium signaling events in detail.The genomic features of calcium binding proteins are quite conserved and interactome network reflect the involvement of CaMs, CMLs, CBLs and CPKs in diverse cellular events. More specifically CBLs are interacts with CIPKs and CPKs interacts with themselves. A complex set of evolutionary events have played an important role in shaping the Ca"}
+{"text": "Halichondria panicea and its associated bacteria in an ex situ environment. In addition, we present a method for co-cultivation of sponge explants and microbes separated by a membrane in a multi-chamber device. Tests on ex situ cultivation of H. panicea under different controlled conditions showed that only high water exchange rates in the aquarium enabled maintenance of its dominant symbiont \u201cCandidatus Halichondribacter symbioticus\u201d at a high relative abundance in the sponge body, a prerequisite for co-cultivation. The bacterial enrichment retrieved from co-cultivation contained bacteria from nine different classes in addition to sequences corresponding to \u201cCa. H. symbioticus\u201d. This represents an increase of the cultivable bacterial classes from H. panicea compared to standard isolation techniques on solid media plates. The current study provides insights into sponge-microbe maintenance under ex situ conditions and proposes a new method for the isolation of sponge-associated bacteria.Marine sponges host bacterial symbionts with biotechnological potential, yet isolation of true sponge symbionts remains difficult due to their host dependency. Moreover, attempts to grow sponges for their pharmacologically-active compounds outside of their habitat often results in a shift of their microbial community. In this study we evaluate suitable sponge cultivation methods that allow maintenance of both the marine sponge  Porifera) have been in the spotlight of marine derived natural product discovery for the past decades due to their rich inventory of pharmacologically-active compounds3. Despite this potential, sourcing sufficient quantities of a promising compound remains difficult due to the low concentrations of these chemicals in the sponge body. This issue, termed the \u201csupply problem\u201d, limits the advance of preclinical trials and hinders exploitation of sponges for other biotechnological purposes4. Apart from compounds derived from the sponge itself, it has been shown that sponge-associated microorganisms can be the source of bioactive compounds with pharmaceutically interesting properties6. Isolating these sponge-associated microbes could therefore circumvent the \u201csupply problem\u201d7. Sponges contain diverse and highly specific microbial communities which can contribute to functional attributes of the sponge holobiont8. These include obligate sponge symbionts as well as opportunistic and generalistic sponge-associated bacteria9.Marine sponge , separated by a 0.2\u2009\u00b5m membrane from bacterial inoculations generated through serial dilutions from the same sponge individual  and Clostridia  and Eyrarbakki (63\u00b051\u2032N 21\u00b009\u2032W) in South-West Iceland between April 2014 and June 2016. Samples were either cut from their substrate with a sterile scalpel or collected along with the substrate they were fastened to. Sponge individuals and samples were kept in 20\u2009l buckets filled with seawater and were transported to the laboratory or cultivation facility within 1\u2009hour after collection. Sponges were identified as H. panicea according to spicule structure and molecular markers as described in Knobloch et al.28.A total of 11\u2009H. panicea collected from the wild were cut into explants or kept on their original rock substrate. Explants were cut underwater with a sterile scalpel making sure to keep more than 50% of the explant surface covered with an intact ectosome to improve recovery. In total, five methods for cultivation of H. panicea were tested to find a suitable method for ex situ sponge maintenance . Aeration provided water movement and seawater was continuously exchanged at a rate of approximately 750 times the tank volume per day.For the sponge cultivation experiments In methods 1\u20134 the water was supplied from a coastal seawater intake of a commercial aquaculture farm and\u00a0was previously sand filtered to remove large particles from the water before entering the farm. The water used in method 5 was from a coastal seawater borehole and was also previously sand filtered before entering the public aquarium tanks. The water temperature in all system remained between 8 and 15\u2009\u00b0C degrees throughout the experiments. Attachment of sponge explants was visually observed and by gently touching or tipping the substrate to see if explants were fastened. Sponges where necrosis was detected were removed from the tanks. Sponge explants which had fallen off the substrate or were displaced by other means were also removed from the tank. Pumping activity was measured by placing food grade dye above the osculum and observing the exhalent water current. Ammonia and nitrite concentrations in the tanks were monitored using commercial aquarium test kits from Seachem. The cultivation experiments lasted between 18 and 25 weeks . A bacterial inoculum was made by rinsing 10\u2009g of the same sponge with sterile artificial seawater  to remove bacteria attached to the outer surface and grinding the sponge in sterile calcium-magnesium free seawater . The sponge suspension was centrifuged for 2\u2009minutes at 500 x g to remove the majority of sponge cells and the supernatant was subjected to serial dilutions of up to 105 in sterile artificial seawater. The bottom container of the microfiltration apparatus was filled with Marine Agar (BD Difco) under sterile conditions by inserting the medium through the effluent tube of the apparatus until the medium reached the top layer of the well separation grid. Then the effluent tube was closed and the media was left to solidify. 3\u2009\u00b5l of the 105 sponge-bacterial dilution was placed onto the solid medium of each well and covered by 0.2\u2009\u00b5m nylon membrane filters (Whatman) followed by seven layers of 25\u2009\u00b5m filter paper  to prevent the membrane from clogging. The top half of the microfiltration apparatus containing the sponge explants was briefly removed from the water and tightly screwed onto the bottom half and placed back under the water surface. This co-cultivation device was placed into a 15\u2009l tank and kept under conditions as described for method 5 above. Sponge explants displaced or showing signs of necrosis within the first week were replaced with explants kept in a reserve tank. Explants deceased or displaced after the first week were not replaced. Wells were cleaned regularly to prevent build-up of debris above the filters and membrane separating the explants and the bacterial inoculum.For the sponge-bacteria co-cultivation experiment a wild sponge was cut into ca. 0.125\u2009cmAfter ten weeks the device was removed from the tank and transported back to the laboratory on ice. The outside of the device was rinsed thoroughly with sterile water and the top half was removed, being careful not to displace or contaminate the membrane. The bottom of the membrane and surface of the solid media were searched for colony growth which was combined to a single pellet in a microcentrifuge tube and stored at \u221280\u2009\u00b0C until DNA extraction.4 and 105 were plated on Marine Agar and Starch Yeast-Extract Peptone Sea Water Agar , both being rich general purpose media. All media were additionally prepared with H. panicea sponge extract, made from a sponge suspension filtered through a 0.2\u2009\u00b5m filter and added to the media at 0.5% (v/v) after autoclaving.For bacterial isolation using the standard plating method the same sponge bacterial suspension as for the co-cultivation experiment was used. Dilutions at 10E. coli 16S rRNA gene) using the bioinformatics software Geneious, to be able to compare against 16S rRNA gene amplicons, and taxonomically classified using the SINTAX algorithm51 against the SILVA v123 LTP database52.Inoculated plates were incubated at 10 and 22\u2009\u00b0C and colonies were picked and restreaked on Marine Agar plates at least three times to assure strains were isolates. Isolated strains were analysed on a Microflex MALDI-TOF mass spectrometer (Bruker) after formic acid extraction. In short, a loopfull of an isolated colony was diluted in 300\u2009\u00b5l of ultra-pure water in a microcentrifuge tube. 900\u2009\u00b5l of pure ethanol was added and the cell suspension vortexed for 1\u2009min followed by centrifugation at 13.000 \u00d7 g for 2\u2009min. The supernatant was removed and the pellet was air dried, after which 30\u2009\u00b5l of 70% formic acid was added and mixed with the pellet by pipetting up and down. 30\u2009\u00b5l of 100% acetonitrile was added to the tube and mixed carefully followed by centrifugation at 13.000 \u00d7 g for 2\u2009min. 1\u2009\u00b5l of the supernatant was placed on a stainless steel MALDI target and allowed to air dry. Once dry, the spot was overlaid with freshly prepared HCCA (Bruker) matrix solution and run on the MALDI-TOF using default settings. A main spectra profile dendrogram was created based on m/z spectra comparison and strains clustering into same groups at low distance equivalents were considered as the same species. For each species cluster, one isolate was selected for sequencing of the partial 16S rRNA gene for which a colony of the selected strains was subjected to DNA extraction using the MasterPure DNA Purification Kit (Epicentre) according to the manufacturer\u2019s instructions. The partial 16S rRNA gene was amplified using the primer pair F27/R806 (5\u2032-AGAGTTTGATCMTGGCTCAG-3\u2032/5\u2032-GGACTACVSGGGTATCTAAT-3) and sequenced on a 3730 DNA Analyser . Sequences were trimmed to position 341 and 785 /S-D-Bact-0785-a-A-21 (5\u2032-GACTACHVGGGTATCTAATCC-3\u2032)54. Trimmed reads were merged using the fastq_mergepairs command of the USEARCH package55 and sequences smaller or larger than 30\u2009bp of the expected amplicon size were removed using the cutadapt tool56. Reads were further filtered using the -fastq_filter command with a maxee value of 1.0, dereplicated using the -fastx_uniques command and clustered into operational taxonomic units (OTUs) at 97% sequence identity using the -cluster_otus command of the UPARSE pipeline57. Singleton OTUs were removed. OTUs were taxonomically classified using the SINTAX algorithm against the SILVA v123 LTP database. The OTU and taxonomy tables were imported and subsequently analysed in the package phyloseq58 in the statistical software R59 implemented in RStudio60. For alpha and beta diversity analysis, the read number of all samples were normalised to an even depth of 15000 using the rarefy_even_depth command of the phyloseq package. Plots were created using ggplot261.Raw sequences were demultiplex and 40 and 60\u2009bps were trimmed off the forward and reverse sequences respectively using the fastx_trimmer command of the FASTX-ToolkitSupplementary Figure S1Supplementary Table S1"}
+{"text": "Parkinson\u2019s disease (PD) represents the second most common neurodegenerative disease. Currently, conventional physical therapy is complemented by additional physical interventions with recreational components, improving different motor conditions in people with PD. This review aims to evaluate the effectiveness of additional physical interventions to conventional physical therapy in Parkinson\u2019s disease. A systematic review and meta-analysis of randomized controlled trials were performed. The literature search was conducted in PubMed, Physiotherapy Evidence Database (PEDro), Scopus, SciELO and Web of Science. The PEDro scale was used to evaluate the methodological quality of the studies. A total of 11 randomized controlled trials were included in this review. Five of them contributed information to the meta-analysis. The statistical analysis showed favorable results for dance-based therapy in motor balance: (Timed Up and Go: standardized mean difference (SMD) = \u22121.16; 95% Confidence Interval (CI):(\u22122.30 to \u22120.03); Berg Balance Scale: SMD = 4.05; 95%CI:(1.34 to 6.75)). Aquatic interventions showed favorable results in balance confidence ). The results obtained in this review highlight the potential benefit of dance-based therapy in functional balance for people with Parkinson\u2019s disease, recommending its incorporation in clinical practice. Nonetheless, many aspects require clarification through further research and high-quality studies on this subject. Parkinson\u2019s disease (PD) is one of the major neurodegenerative disorders in older adults  and is tThe main symptoms of PD are: resting tremor (regular and 4\u20138 cycles/second), extrapyramidal rigidity or hypertonia, bradykinesia or akinesia, postural instability, freezing of gait, and others such as sialorrhea, amimia, depression, and cognitive impairment ,6. OtherThe main scales used to assess the stage and severity of PD are as follows: a) Hoehn and Yahr Scale , which dThis review follows the Preferred Reporting Items for Systematic Reviews and Meta-Analyses (PRISMA)  guidelinFirst, the PICO format was used to establish the selection criteria: (1) Population: adults with PD; (2) Intervention: physical interventions additional to CPT; (3) Comparison: group performing CPT according to the interventions included in the World Confederation for Physical Therapy statement , includiFirst of all, the search was carried out by combining keywords in the databases mentioned above. Subsequently, duplicated articles were excluded. Titles and abstracts were then reviewed, and articles that did not meet the proposed selection criteria were excluded. The remaining articles were evaluated in more detail, and any that did not meet the criteria were excluded. Two reviewers (R.D.H.-A. and J.A.M.-M.) participated actively and independently in the process of study selection, review and systematic data extraction. Any disagreement was resolved by an additional reviewer (D.L.-A.).The following data were extracted: (1) author and date of publication; (2) stage of the disease evaluated by the Hoehn & Yahr scale; (3) medical treatment; (4) number of participants included in the study groups; (5) characteristics of the interventions ; and (6) the results obtained in each study.The methodological quality assessment was conducted using the PEDro  scale. Tp < 0.05 was considered to be statistically significant. The standardized mean difference and the 95% confidence interval (CI) were calculated. The instructions of the Cochrane Handbook for Systematic Reviews of Interventions for obtaining standard deviation from confidence intervals and change-from-baseline standard deviation were employed when needed. A fixed-effect model was used when no heterogeneity was detected; a random model was used when homogeneity was determined. The chi-square test and the I2 statistic were used to determine the heterogeneity. Forest plots were used to represent the results of the meta-analyses. The statistical software Review Manager (RevMan) 5.3  was employed for statistical analysis. Changes in the effect size between the intervention group and the comparison group (CPT) were analyzed in the meta-analysis. The scores obtained on the PEDro scale are shown in For statistical comparison, only those RCTs that measured the same variable with the same measuring instrument and also performed the same type of intervention in comparison with CPT were taken into account. The effectiveness of different physical therapy interventions on motor function was analyzed using the UPDRS-III, as shown in Regarding the effects on walking balance and functional mobility analyzed using the TUG scale , a studyTaking into account the interventions based on AT, similar results were obtained regarding the ability to maintain standing balance measured with BBS , the oveIn this case, interventions based on AT gave favorable results after measurement with the ABC scale, the overall result of the meta-analysis being favorable, as shown in Concerning the fear of losing balance and suffering a fall, analyzed through the FES, the overall result of the meta-analysis was inconclusive, although Volpe et al.  reportedFinally, concerning improvements in quality of life, analyzed using the PDQ-39 questionnaire, AT interventions showed favorable results, but the overall result of the meta-analysis was inconclusive. Both RCTs showed favorable results. The results of the meta-analysis are shown in This paper aimed to synthesize the existing evidence on physical therapy in PD and to analyze the effect of additional therapies beyond CPT on different motor conditions. A total of 11 RCTs were reviewed, and these used different types of intervention, such as: AT, DT, physical therapy supported by the use of robotic assistance and virtual reality systems, treadmill interventions, and physical therapy supported by other disciplines such as occupational therapy or psychology. Due to the heterogeneity of parameters studied and the diversity of instruments and scales used in the assessment, only five RCTs were considered for statistical comparison through meta-analysis. The main findings of this study are discussed below.Regarding the methodological quality of the studies, it should be highlighted that nine of the RCTs had good methodological quality. Moreover, all the RCTs included in the meta-analysis had a score of 6 or higher. PD patients could have heterogeneous characteristics depending on the levels of disability, the time since onset of disease, and the medical treatment administered. These factors could affect the results obtained in response to the physical interventions. Nevertheless, in our meta-analysis, all the RCTs ,32,33,34In terms of motor function, four RCTs analyzed the effects of different interventions in people with PD. In all cases, the system selected to compare results was the scale based on UPDRS-III motor parameters. The AT interventions seemed to be no more effective than CPT. However, interventions based on specific exercise routines from dance classes, as shown in the study by Hashimoto et al. , appeareIn terms of the effects of these interventions on balance, the main scales of measurement used were the BBS scale and the TUG. Once again, DT interventions had the best effects on balance, using both scales. Nevertheless, the results obtained using the TUG scale should be interpreted with caution as only Rios Romenets et al.  showed sIn contrast, interventions based on AT did not lead to conclusive improvements in balance, fall-related self-efficacy, and quality of life, although the results suggested some improvements with respect to CPT. Moreover, they led to improvements in balance confidence. These results should be interpreted with caution; the total sample size was too low to make firm recommendations. In this context, it should be noted that fear of falling could be a predictor of recurrent falls and a possible barrier to physical land-based exercises . MethajaFinally, it is apparent that high-quality studies are needed to determine the long-term effects of additional physical interventions beyond CPT. These interventions have shown some potential benefits, although the parameters are not well defined. They also have an important characteristic that might increase adherence to the therapeutic program, the ludic component. Thus, DT could be an enjoyable social activity that produces physical, emotional, and social benefits  since itAlthough the present study presents useful information, some limitations should be addressed. First, strict exclusion criteria were established, thus leaving out all studies that were not an RCT. Second, the heterogeneity of the included studies makes comparison difficult. For this reason, out of the total of 11 RCTs included, only five contributed information to the meta-analysis. This heterogeneity was present in both the intervention and control groups (the protocols of CPT differed), so the results should be interpreted with caution. In many cases, despite evaluating the same parameter, the difference in scales or instruments used makes it impossible to compare them statistically. Another relevant aspect to mention is the sample size, which was small in most studies.There is no conclusive evidence on the effectiveness of AT interventions for improving motor function, balance, and quality of life in people with PD. However, improvements were obtained in subjective balance confidence.Moreover, physical interventions based on DT seem to be more effective than those performed as CPT, especially for improving functional balance, so they should be incorporated into clinical practice. Further research is needed to elucidate which specific factors make DT an adequate intervention for improving motor-related disorders in adults with PD. In addition, further research with larger sample sizes and greater homogeneity in terms of the type of DT used, and the frequency and the duration of the interventions, is needed, as well as research to identify which specific factors of therapy have the greatest impact in achieving positive motor outcomes in adults with PD."}
+{"text": "The Eph receptor family is implicated in both tumour promotion and suppression, depending on the tissue-specific context of available receptor interactions with ligands, adaptor proteins and triggered downstream signalling pathways. This complex interplay has not only consequences for tumorigenesis but also offers a basis from which new cancer-targeting strategies can be developed. This review comprehensively summarises the current knowledge of Eph receptor implications in oncogenesis in a tissue- and receptor-specific manner, with the aim to develop a better understanding of Eph signalling pathways for potential targeting in novel cancer therapies.The Eph receptor tyrosine kinase family, activated by binding to their cognate ephrin ligands, are important components of signalling pathways involved in animal development. More recently, they have received significant interest due to their involvement in oncogenesis. In most cases, their expression is altered, affecting the likes of cell proliferation and migration. Depending on the context, Eph receptors have the potential to act as both tumour promoters and suppressors in a number of cancers, such as breast cancer, colorectal cancer, lung cancer, prostate cancer, brain cancer and Kaposi\u2019s sarcoma (KS), the latter being intrinsically linked to EphA2 as this is the receptor used for endothelial cell entry by the Kaposi\u2019s sarcoma-associated herpesvirus (KSHV). In addition, EphA2 deregulation is associated with KS, indicating that it has a dual role in this case. Associations between EphA2 sequence variation and KSHV infection/KS progression have been detected, but further work is required to formally establish the links between EphA2 signalling and KS oncogenesis. This review consolidates the available literature of the role of the Eph receptor family, and particularly EphA2, in tumorigenesis, with the aim to develop a better understanding of Eph signalling pathways for potential targeting in novel cancer therapies. The Eph family of receptor tyrosine kinases (RTKs), involved in signalling pathways that are key to embryogenesis and tissue patterning, have been implicated in the oncogenesis of a number of cancers. Generally, this involves their aberrant expression, allowing them to act as either tumour promoters or tumour suppressors, depending on the context ,2. Here,Eph receptors are type-I transmembrane proteins with a structure that is generally conserved. The ligand-binding domain, cysteine-rich region and two fibronectin type III repeats compose the extracellular domain of the receptor, while the intracellular region is made up of a juxtamembrane domain, a protein tyrosine kinase (Pkinase-Tyr) domain, a sterile alpha motif (SAM) and a C-terminal PDZ-binding motif  2,5]. T,5. T2,5]This signalling plays a role in a number of biological processes important for both development and homeostasis. By modifying cell adhesion and the organisation of the actin cytoskeleton, Eph signalling controls cell morphology and migration. Eph signalling also affects cell proliferation and differentiation ,8. Many The best characterised Eph receptors in breast cancer are EphA2 and EphB4, but there are also others that have been found to play a role. EphA2, the main EphA receptor to have been extensively studied for its involvement in breast carcinomas, is overexpressed in 40% of breast cancers and is generally correlated with a poor prognosis ,49. ThisThe expression of EphA4 and EphA7 receptors was also found to be upregulated in breast cancer, which correlated with a worse prognosis . EphA4, Similar to EphA2, EphB4 has been implicated in breast cancer in numerous studies. Its expression has been found to be both upregulated and downregulated in breast cancer cells, suggesting it has the ability to be both pro- and antioncogenic . This acEphB6, a receptor lacking kinase activity, thereby considered \u201ckinase dead,\u201d has been shown to be downregulated in breast carcinoma cells, suggesting a role as a tumour suppressor . In invaIn slight contrast to the distinct upregulation or downregulation already mentioned in breast cancer see , the expIt has been shown that EphA7 expression is lost in colorectal cancer, also as a result of epigenetic silencing mediated by CpG methylation of the promoter . SimilarFinally, in the progeny of colorectal cancer cells subjected to radiation treatment, EphA4 activation was shown to be induced. This EphA4 overexpression caused a reduction in E-cadherin expression and, therefore, disrupted cell\u2013cell adhesion; it also activated the ERK1/2 pathway, which led to increased cell migration and invasion .As in the case of EphA1 and EphA2, initial upregulation of EphB2 and EphB3 expression appears to be followed by a loss of expression in the more advanced metastatic stages of colorectal cancer. This upregulation was found to be a result of activating Wnt pathway mutations leading to constitutive transcription from the Tcf-4 complex; EphB2 and EphB3 are Tcf-4 target genes, and their expression is thereby enhanced ,21. The Conversely, the expression of EphB4 is upregulated in colorectal cancer, suggesting that it functions as a tumour promoter . By overThe expression levels of EphA1, EphA4, EphA5 and EphA7 have been investigated in patients with nonsmall cell lung carcinoma (NSCLC), the most common type of lung cancer. Giaginis et al. suggested that the increased expression detected in non-advanced stage NSCLC was an indication that these receptors may participate in the biological mechanisms underlying carcinogenic evolution . NotablyLike EphA2, EphB3 was shown to be overexpressed in NSCLC in which it likely promotes cell growth and migration. Consequently, the loss of EphB3 lead to activation of caspase-8-mediated apoptosis and suppression of cell migration . StimulaWhile the expression levels of other EphA receptors seem to be upregulated in prostate cancer, the expression of EphA1 was shown to be downregulated, decreasing from normal prostate to primary prostate tumour cells and finally to metastatic cells, possibly due to CpG methylation of the promoter ,31. ThisSupport for EphB2 functioning as a tumour suppressor in prostate cancer comes from the identification of its mutational inactivation; when DU-145 cells were transfected with a wild-type EphB2, clonogenic growth was suppressed . ConversGlioblastoma and medulloblastoma are two of the most aggressive cancers affecting the brain. In glioblastoma, overexpression of EphA2 was shown to correlate with poor prognosis . Its tumIn contrast to EphA2, it has been shown that an overexpression of EphB1 was associated with a favourable prognosis for glioma patients. This, however, was dependent on stimulation by its ligand, ephrin-B2, with this interaction resulting in an inhibition of cell invasion and migration . ConversKaposi\u2019s sarcoma, a vascular tumour of endothelial origin, is one of the malignancies associated with the oncogenic Kaposi\u2019s sarcoma-associated herpesvirus (KSHV). KSHV infection of endothelial cells is mediated via interactions between the virus and several cell surface receptors ,76,77. SFrom this, it is evident that EphA2 plays a key role in KSHV entry, and this suggests that it may also be an important determinant for susceptibility to KS. Indeed, EphA2 is upregulated in a number of cancers see  and, likAs highlighted above, EphA2 plays an important role in a number of cancers see ; howeverThe noncanonical pathway, conversely, involves the ligand- and tyrosine kinase-independent activation and phosphorylation of EphA2. This is regulated by inflammatory cytokines and growth factors via phosphorylation of EphA2 at Ser897, with induction of this phosphorylation carried out by RSK, Akt and protein kinase A (PKA) . The effEph receptors play a complex role in oncogenesis, which is dependent on the specific interactions between the receptors, ligands, signalling pathways and adaptor proteins. Moreover, Eph receptors are implicated in tumour promotion and suppression, depending on the context\u2014their differential expression having consequences for cell proliferation and migration . It is i"}
+{"text": "The \u2018care transition\u2019 is characterised by reduced state involvement in chronic illness management in response to socio\u2010political movements aimed at meeting the challenges presented by an increased prevalence of chronic illness. Amongst these changes has been online communities\u2019 rising importance in everyday interactions and attention is being increasingly paid towards the ways online contacts might contribute to self\u2010management. Whilst research has illuminated the relevance of personal networks in long\u2010term condition management, it is relevant to extend this work to consider the place of ties mediated online in this bricolage of support, including better understanding the work drawn from them and the strategies involved in eliciting it. This study examined the work and relatedness of 30 participants, who used online communities. Participants were asked about the role of on and offline ties and ego network mapping was used to frame conversations about the nature of this support. The context of engagement followed three main themes. Participants drew from online communities in response to deficits in offline support, they used online ties to leverage support or action from offline ties and they used online ties to substitute offline support, with less intimate online ties. How care is thought about, organised and delivered has, over the last two decades changed dramatically. This has been largely driven by increased longevity, a shift from an acute to chronic disease profile and attendant social and economic pressures. In a process described as a \u2018care transition\u2019  and provided they consented, were recruited into the study.Participants had a range of LTCs, representing diverse condition experiences including Type 1 Diabetes, Parkinson's disease, Polymyalgia Rheumatica (PMR), Giant Cell Arteritis, Fibromyalgia, heart problems, Multiple Sclerosis (MS), Interstitial Lung Disease (ILD), Myalgic Encephalomyelitis (ME), chronic pain, Lupus, HIV, Stroke, Hepatitis C, Asthma, Stiff Persons Syndrome (SPS) and Epilepsy. It was common for participants to have more than one condition, including those relating to mental health.n\u00a0=\u00a07), or because they were retired (n\u00a0=\u00a013).Whilst the original focus of recruitment was on those using online communities to connect with peers in condition specific groups, most participants discussed the relevance of more general social media platforms (such as Facebook and Twitter), that facilitated access to new and existing ties; both of which were seen as relevant to self\u2010management. All participants had a formal diagnosis, but the interviews included reflections on periods prior to this, such as the conditions initial genesis. The participant's ages ranged from 25 to 74 and the mean age was 52. Participants were predominantly on lower incomes , but highly educated (56.7% having a degree) and most didn't work, either due to their condition . This allowed networks to be described according to the importance of members\u2019 contributions, allowing for a detailed visualisation of different ties contributions, in a way that negated the tendency for a positivist assignment of roles, based around relationship type, whilst also acknowledging the possibility of complimentary and overlapping roles  and participants had limited access to people offline, with the same condition (n\u00a0=\u00a05). When present in the network, partners always appeared in the inner circle (n\u00a0=\u00a021) and contributed towards everyday work (such as domestic support) but were largely excluded from conversations directly relating to management.Of the 30 participants, 24 identified an online contact or group within their personal network of support as being important to everyday management. In contrast, offline support groups were less frequently present in the participants networks  or through condition focussed groups on more general platforms (such as Facebook and Twitter). Online access to strong and weak ties already known offline, was typically through general online communities (such as Facebook), though more intimate online media, such as WhatsApp was commonly used to coordinate intimate tie involvement during crises.The results, which are presented below, indicated the use of online ties in network, and illness management strategies. The context of engagement followed three main themes. Participants drew from online communities in response to deficits in offline support, they used online ties to leverage support or action from offline ties and they used online ties to substitute offline support, with less intimate online ties.Online communities allowed participants to employ proactive strategies to shape their network with a variety of ties that they perceived to be best able to meet their needs at specific times. By using online communities, they were able to reach out and extend their network in response to perceived deficits in several lines of work which related to current, as well as forecasted needs.So then I went on the forums and um, I mean one of the forums \u2026 \u2018Limbo land\u2019 \u2026 you go to if you think you might have MS but you have not been diagnosed for definite \u2026 and then like people who have had it for a long time will go onto that forum and basically help. Scant encounters with formal, unresponsive healthcare systems presented as a feature of online engagement and were particularly visible in the conversations around the period between the initial genesis of a condition and formal diagnosis. In conditions that were difficult to diagnose, it was common for the participants to face long periods of time in which they had no access to formal health care. Often during these times, online peers were the only support they could access:I don't just mean I knew nothing about Parkinson's, I didn't know anything about medication, I didn't really know anything about symptoms, I didn't know anything about support. I knew literally nothing at all. Even at the point of diagnosis, participants often received poor or incomplete explanations of their condition and how it should be managed:I didn't know that I needed to check my blood sugar that many times a day. I was told I needed to check. But I didn't know why. I never thought to ask. I didn't really understand the numbers on the screen. So, I would check and see like 15 [mmols] and not really know that that was way too high. So, I started to think, you know. Why am I checking? Incomplete explanations and use of inaccessible medical terminology, often meant participants were unsure of what exactly they were supposed to be doing. This lack of translation resulted in participants having to speak to people online to understand what was discussed, which included understanding why certain behaviours and regimes should be followed. Eventual changes in habits were typically driven by online peers who took the time to translate abstract biomedical concepts, into understandable and relevant ones:Access to a performative online stage  first. Mainly because I can only see the consultant every few week's. Lack of timely access to formal, specialist care was also relevant. It was common for participants to face long waits to access a specialist and during this time, online communities were often the only condition specific support they were able to access. Beyond diagnosis, more formal support was rarely available when questions arose, or specific problems were encountered. Often these problems were not seen by respondents as serious enough to seek urgent care, but nonetheless required urgent solutions, especially where problems impacted upon overriding everyday concerns:They try, but as hard as they try to understand, they won't ever understand what it's like. Like even though they are amazing at it, um \u2026 they won't truly understand. I think like, I need somebody that actually gets it \u2026 you know, even just one person. Participants rarely had access to offline contacts with the same condition. Thus, whilst many felt that their offline intimate network provided emotional support, it did not come from a place of shared understanding. Online ties were often seen as better placed to offer this support, through their shared understanding of the condition and its impact on daily living:I haven't officially put people into [boxes], but I will know that they are like the tech groups and there are kind of eating disorder groups and exercise groups \u2026 I just put people into their little files and I file them away until I need them. Lack of network members with the same condition also limited the availability of offline experiential knowledge, which was relevant in helping participants overcome challenges relating to the condition and its management. Participants deliberately sought out people experiencing similar everyday challenges relating to specific symptoms, complications and activities such as work, sport, pregnancy etc. Such a strategy reflected the broader everyday needs of those managing a LTC, which were often at odds with the narrow set of self\u2010management behaviours promoted by formal care, in order to control the condition and prevent it from getting worse. The need to minimise the impact of the condition on everyday life, often resulted in the participants taking steps to ensure that they had access to people with diverse experiential knowledge to meet immediate needs. These connections were often maintained overtime through the awareness that their knowledge might become relevant in the future:et\u00a0al. et\u00a0al. et\u00a0al. et\u00a0al. et\u00a0al. And if you go to the Diabetes website, it advises you that when you get in from a night out, you have a bowl of pasta. I am not going to sit there at 3am in the morning making pasta. I am going to have cheesy chips or a kebab. In the participant's narratives, there was a visible mismatch between the self\u2010management activities that were promoted by formal care and the steps that people took to minimise the impact of their condition on daily life In adopting a range of other people's trial and error approaches to everyday management, participants gained a sense of control over the choices they made and were able to adapt practises in accordance with individual priorities. Contra the traditional sick role regimes that impact upon desired ways of living, rigid self\u2010management practices were considered in relation to their future benefits, which were by no means guaranteed. The incompatibility and overriding everyday concerns of participants made compromises necessary. These were facilitated by the activation of online ties with a set of experiences relevant to the adoption of approaches to self\u2010management that accommodated participation in, specific activities (e.g. going on holiday) and biographical events . This knowledge plugged the absence of lay and critical experiential expertise in participant's offline network, providing opportunities to compliment the prescriptively narrow, empirically focussed advice of formal care:In being more reliant on empirical truths, the advice formal care was able to offer, was often seen as being too narrow, too limited and far too risk averse to be useful on its own. The advice online ties were able to offer, often went beyond what the participants felt professionals could feasibly provide. Often this was not medical advice per se, but relevant to decisions about everyday situations that were made challenging by illness Activity with online ties was used as leverage for formal services, for example in prescribing medications and/or referrals to specialist care, and access to others online improved individual's capacity in dealing with these situations. Conversations with a pool of people online, led to a wider understanding of possible treatment options, which helped participants negotiate treatment that best reflected their needs. These conversations helped frame needs with a view towards securing certain resources. Thus, online communities were used as a backstage  to help prepare the way individuals demonstrated candidacy for certain treatments (such as a new medication or device), new equipment (such as perching stools) and financial support:Seeing what others with similar needs were offered , helped participants negotiate candidacy towards resources that they felt would be beneficial.Conversations online also helped leverage support from lay offline ties. Many were frustrated with their family and friends not understanding their condition, how it is managed or its impact on daily life. Whilst frustrations were partly addressed by talking to other people online who \u2018got it\u2019, online conversations were also useful in leveraging offline support, particularly in providing illness reification, which involved strategies that deliberately front staged their condition, including making visible conversations with online peers with the same condition. Presenting themselves in this way, particularly for those with invisible or contested illness, had relevance in legitimising their condition and its associated difficulties, in the face of both lay and medical scepticism Barker .They forget \u2026 the only time they ever really remember is when I put the pictures of me receiving the [Intravenous Immunoglobulin] (IVIG), because I do that. Because I think, actually \u2018hello\u2019, I am actually ill, I am poorly and then all of a sudden they remember \u2026 all of a sudden people will be like \u2018is there anything we can do?\u2019, \u2018do you want us to pop over \u2026 social media has helped me remind people. .Impression management saw participants revise or adjust their online presentation of self, to offline ties, with a view of signalling current and future needs Participants used sites such as Facebook to talk about their condition for the first time with less intimate offline ties, allowing them to express parts of themselves that they had previously suppressed. The greater levels of editorial control offered by online platforms allowed for a degree of impression management not available offline Indeed, being able to access offline ties through online platforms, supported the leverage of tangible support, such as lifts to hospital; emergency childcare etc. This was done in a way that matched needs with availability and a desire to help:Status updates provided a means through which needs could be signalled to a broad audience, allowing for requests to be targeted at the participants entire local network, which meant the participant did not feel like a burden, because support was both matched with availability and volunteered from a diverse range of supporters.et\u00a0al. I tend to keep the Diabetes thing away; I tend to keep it to the Twitter account, but my Facebook, that's my close friends and family \u2026 I don't really want them to have as much access to it, I don't want them to have as big an insight into this, but the online community, I don't really mind. The availability and ease of accessing online ties, led to offline ties being substituted for those online, to support identity management and reduce the burden placed on others. This was common when participants required either minimal involvement from offline ties , or when participants feared overburdening friends and family. Most participants did not want to be defined by their illness and labelling was a common concern, especially when it was felt that it might negatively influence the way others saw them; placing at risk their existing role and identity within their network  could devalue them You can speak to people who you don't know, so you don't really care so much. I know that sounds awful, but to some extent they are expendable. Whilst substitution was used to maintain the essence of existing relationships, many of the participants found moral value in being able to cope with certain aspects of their condition without implicating their friends and family In being aware of the strain the condition placed on existing relationships, participants instead drew on willing and available online ties, who provided opportunities to move aspects of support that did not require proximity, away from the offline ties that the participants were concerned of overburdening; reducing the risk of these relationship becoming too strained, and breaking down. Access to people online and the ease of which support could be negotiated, resulted in support often being sought there, especially since the contribution of online ties was accompanied by fewer obstacles associated with offline support  and how they can be enhanced in order to support approaches to management that are acceptable.et\u00a0al. Future work might consider how to best understand and make use of the hidden work that people themselves do to manage their condition, but this will require the removal of the negative and moral judgements that are placed on people who deviate from professional expectations around self\u2010management Hill . Doing set\u00a0al. et\u00a0al. et\u00a0al. The focus of recent policy suggests an accelerated push towards self\u2010management activities being realised through engagement with online resources (Hunt The responses were drawn from a mixed group of participants, who lived in the South of the UK. These participants were mostly well\u2010educated and as a result, often presented as digitally able. This was unintentional and reflected the characteristics of those who consented.Research would benefit from better understanding the sociocultural factors that underpin these practices, particularly in marginalised groups, who would benefit from being the focus of future research in this area.The inclusion of previous stages of illness, reflected the importance of considering what Morris and Sanders  describeDemographic and epidemiological transitions have created a situation in western countries, including the UK, whereby socio\u2010political movements have reduced state involvement in LTC management, whilst increasing the focus on patients self\u2010managing their own condition. To date what has largely been promoted is a set of narrow behaviours and expectations around how LTCs should be managed, that poorly align to people's own expectations around health and how they want to live. There has emerged an increasing role for the internet in supporting self\u2010management practices, particularly in plugging offline support found wanting, either through not being available, or not considering the broader everyday needs of those managing a LTC.To our knowledge, this is the first study to look at online health related work in the context of ones total configuration of condition related personal network support, including the context and circumstances of engagement with online ties. Unsurprisingly, offline support continues to be essential where physical presence is required, but the internet gave people the opportunity to realise support away from professional and lay support to manage their condition on their terms. A concern is that this transition places those lacking ability to draw on these resources appropriately, at a disadvantage. Understanding how those from more marginalised communities adapt to this changing landscape of care should be the focus of future research."}
+{"text": "People living with a tic disorder (TD)\u2014such as Tourette syndrome (TS)\u2014experience many negative psychological and social challenges arising from chronic tics, such as stigmatization from peers and poorer quality of life, and these can impact upon their families too. It can be difficult for this population to access face-to-face support for tics, and so online support communities offer one avenue for support from peers facing similar experiences. However, little is known about how online support communities may be used by people with TS and other TDs, and by others  supporting a person with TS/TD.This study aimed to explore users\u2019 experiences of participation in online support communities for TS and TDs.In total, 90 respondents  from 13 countries completed an online survey exploring their experiences of using online support communities for TS and TDs. Respondents were people living with TS/TD themselves (n=68) or supportive others of someone with TS/TD , or both (n=8). The online survey contained open-ended questions eliciting their self-reported motivations for using online communities, their benefits and drawbacks of participation, and whether online support communities affected offline management of tics. Responses were analyzed using thematic analysis.Seven overarching themes captured experiences of using online support communities for TS/TDs. The overwhelming reason for their use was to find accessible support due to a lack of offline face-to-face support. Online support communities were valued sources of informational and emotional support, and also had a positive impact upon helping users\u2019 psychological well-being. Online communities helped provide a space where people with TS/TDs could feel accepted and reduce the social isolation they felt offline. The suggestible nature of tics and being reminded of the challenging nature of TDs were main disadvantages arising from using online support communities, alongside conflict arising within online communities.The findings suggest that online support communities appear to offer valuable informational and emotional support to those living with TS/TD and their families too, especially given the lack of locally available support. This facilitates a sense of community online, which can help users in overcoming long-standing social isolation and aid self-reported improvements in psychosocial well-being. Users reported some drawbacks in engaging with online support communities, such as conflict between different types of users and triggering content, which negatively affected experiences of community participation. Tic disorders (TDs)\u2014such as Tourette syndrome (TS)\u2014are noncurable neurodevelopmental conditions characterized by sudden, persistent, purposeless motor movements, or vocalizations known as tics . TDs typThe processes involved in the assessment, diagnosis, and treatment of TDs can be tricky to navigate: delays in referral and diagnosis are common due to the fluctuating nature of tics, and how they can be indicative of other health issues  . PatientChronic tics can impair functioning across many areas of everyday life for children and adults . This inSocial support is an important resource in coping with chronic conditions , and mayactive or passive: users may actively engage in the community  or be more passive in reading others\u2019 content but not interacting with it  for Tourette\u2019s has helped so many people with accepting not only themselves but others and has made everyone a close family.P34, aged 17, has TDConnections between online support community members were depicted as akin to familial relationships, further illustrating the community atmosphere cultivated within online support communities.Several participants reported that sharing their experiences and expertise were useful to newer, struggling online support community members. Sharing experiences to engage in a process of reciprocal support was commonly discussed:If people are going through the same struggles I did when I was younger I want to offer advice.P84, aged 21, has TDgive back to communities who had helped them throughout difficult times and a sense of validation of their abilities to support others. This seemingly perpetuated a cycle of reciprocal support that enabled better adjusted participants to remain connected to the group and in continued receipt of other psychosocial benefits.Participants described a desire to Some participants reported it being more difficult to find a sense of community and community benefits  in larger online support communities:It is hard to develop strong friendships or have conversations within groups of hundreds of members.P82, aged 17, has TDFor many, the inability to engage with all online support community members was a drawback and some participants expressed concerns regarding the motivations of lesser known, often silent members. Overall, respondents typically felt more comfortable in and supported by smaller, intimate online support communities.offline world, with many reporting increased social activity and improved self-confidence in the ability to withstand public responses to tics.This theme denotes the positive impact online support communities have on participants\u2019 attitudes and behaviors toward tics. Learning of others\u2019 TD experiences resulted in a shift in beliefs about tics; several respondents expressed gratitude that their tics were less functionally impairing than many users, while some benefitted from the normalizing impact had by witnessing others live fulfilled lives despite tics. In turn this impacted participants\u2019 Comparison of oneself with other group members was found beneficial to most participants; hearing about more impairing TD experiences seemingly aided participants in reappraising their perception of their own TD, often as being minor compared with others:Some people struggle with more severe/less socially acceptable tics, such as coprolalia or complex motor tics, I feel like mine aren\u2019t such a big deal after all.P81, aged 20, has TDThis awareness appeared to help respondents accept their tics as less bothersome or apparent to other people, and reportedly helped minimize self-consciousness about their tics.Through encouraging respondents\u2019 acceptance of tics, online support communities were found to facilitate engagement in typical everyday activities :I\u2019ve learned that I shouldn't be so self-conscious when I tic, that if people ask just explain and move on.P35, aged 14, has TDReducing shame and embarrassment about tics appeared to facilitate their acceptance of them. This revised outlook seemingly bolstered participants\u2019 confidence, enabling many to embrace opportunities to socialize and address their disorder directly in their offline world. Acceptance of tics further aided participants to develop their own personal narratives to explain their tics to others:They have made me more confident to tic in public. For most of my life, I have suppressed tics in public, leading to the feeling that I am hiding a part of me that I am ashamed of, followed by tic attacks when I get home.P40, aged 23, has TDMembers with positive lived experiences were found to reassure participants that TDs do not necessarily impact upon long-term QoL:Seeing other people with TS who are happy, successful and empowered helped me to embrace my TS as it showed me that my condition should give me strength and not hinder me.P22, aged 16, has TDnormal lives was depicted as inspiring and encouraged participants to grow and learn from challenging experiences to achieve positive futures.Experienced and potentially well-adjusted online support community users were depicted as role models for younger members, capable of offering hope regarding the future by illustrating that patients with TD can achieve the same life goals as typically developing peers. Virtually meeting other people with TD living punishment. Online support communities were found to help overcome this perception: the mechanisms through which this occurred were not discussed, but other positive influences on psychosocial well-being  occurring following exposure to other individuals with TD plausibly helped facilitate this reduced self-blame:Self-blame was denoted among a handful of predominantly younger online support community members, many who once viewed tics as a I don\u2019t feel that my tics are my fault. I am trying to convince myself that I\u2019m not doing something wrong by having tics, and this community is helping.P10, aged 21, has TDBoth tic-related and internet-based problems with online support community access were described by participants. A frequently mentioned concern by respondents was the tendency for non-evidence\u2013based advice to be discussed and potentially mislead vulnerable users. Another concern centred around posts of graphic tic-related injury, with participants describing how this appeared to lead to an uncontrollable influx of tics, which often compelled temporary withdrawal from online support communities. Furthermore, reading others\u2019 negative experiences perpetuated low mood and discouraged participants\u2019 optimism for the future.triggering, meaning how reading about tics or watching videos of tics could lead to heightened tic severity, frequency, or development of new tics. Most considered this a minor disadvantage, advising that avoiding online support communities when tics are particularly bothersome is a suitable solution:Online support communities were commonly described as Sometimes you can pick up new tics, or reading about others will make your own tics increase in frequency. (...) if I am having a \u201cbad tic day\u201d I will not read the posts in the community.P14, aged 18, has TDwarnings preceding the body of particularly descriptive or visual posts.Several participants suggested using Exposure to others\u2019 daily struggles reminded participants that managing TD was a necessary part of life. Negative experiences were discussed somewhat apathetically, with a handful of participants seemingly resigned to a potentially restricted future and accepting difficulties they/the person they support may someday encounter. For some this perpetuated low mood and enhanced the perceived magnitude of TD-related problems:It can be upsetting to see and read about the negative experiences some have had and can be depressing to be part of a group when you really just wish your child didn't have this extra issue to cope with.P56, aged 52, parent of child with TDSeveral participants expressed concerns regarding the validity of advice offered in online support communities:There are many people who come looking for advice- but a lot of the advice given is misleading, inaccurate and sometimes dangerous.P58, aged 35, parent of child with TDRespondents recognized that particularly among parents of children with TD, desperation to improve their child\u2019s QoL led to them being vulnerable to accepting poor advice from unverified sources. Alternative treatment regimens were considered with skepticism, prompting multiple participants to emphasize that online support communities cannot replace medical guidance and recommend others to avoid engaging with experimental or anecdotal therapies.Perceived judgment and a lack of consideration among online support community members were found to foster conflict between users, culminating in a negative community atmosphere. Many participants discussed encounters with unfriendly individuals within online support communities, citing intolerance for personal lifestyle choices and TD management styles as common reasons for withdrawing from online support communities.Respondents felt annoyed by those who expressed entitlement to greater empathy than others; this resulted in somewhat competitive conversations, not conducive to the supportive atmosphere that most members endeavored to create. Participants felt equal respect and acceptance were not afforded to all users:Some people can be judgemental. In some groups people seem to try to compete for \u2018whose Tourette\u2019s is the worst\u2019.P39, aged 27, has TDSeveral participants additionally detailed how insensitive or provocative comments were easily misconstrued and prematurely judged some users. A small number of participants reported experiencing cyber bulling or harassment, contributing to their withdrawal from otherwise supportive networks.Many recognized that online support communities typically possess a unified and unwavering perception of different approaches for managing tics:Certain communities tend to develop a common voice. This one strongly supports CBD, that one strongly rejects it. This one loves CBIT, that one is sceptical. (...) either way one isn\u2019t getting a healthy, integrated community or understanding of TS.P18, aged 38, parent of child with TD and spouse of person with TDFor some, rigid online support community opinions were considered disadvantageous. Several respondents experienced rejection upon initiating discussions regarding topics which did not align with an online support community\u2019s outlook. Additionally, participants commented that newly diagnosed and possibly inexperienced patients with TD may only participate in one online support community, meaning they may only be exposed to certain perspectives or a few resources.Frustrations regarding the tendency for parents of younger patients with TD to monopolize groups were common and discussed somewhat evocatively. Conflict between users with a TD and users supporting a person with TD were reported:I find that parents of children with TS tend to have the loudest voices in some communities. It can focus conversations away from individuals who actually have the condition.P40, aged 23, has TDParents were depicted as insensitive and inconsiderate toward other group users; not only did people with TD feel parent users undervalued their opinions, but many also considered their domineering presence in groups prevented adults with TD from accessing comprehensive social support. Moreover, participants found parents\u2019 use of online support communities as outlets to discuss the negative impact of their child\u2019s TD on family life particularly distressing in questioning their own family\u2019s true feelings toward them.This study explored experiences of online support community users for those living with TDs and people supporting them, such as parents. Seven overarching themes were identified, many of which align with previous research into online support communities for long-term health conditions eg, ,27) and  and 27])Our findings suggest several unique benefits of online support communities for TDs. Online groups granted much-desired access to other people with TD, and allowed for diverse cross-cultural connections too. The continuous availability of online support communities allows for support regardless of time boundaries and accessibility to users whose comorbidities deterred attendance to face-to-face support groups. Given the prevalence of morbidities among people with TD , this maSupporting previous literature , many reBy contrast, 2 drawbacks of online support communities reported by some respondents were the credibility of advice provided by online support community users and rigidity of certain communities in terms of having strong opinions regarding different types of tic management. This could result in users finding it difficult to discuss evidence-based treatments that might not align with the online support community\u2019s preferences, or may be directed toward non-evidence\u2013based treatments. While the role of a moderator/administrator is generally consistent across online support communities , each community will vary in how they moderate their online space , includiEmotional support was perhaps the greatest incentive for continuing to engage in online support communities for TDs. Aligning with online support communities for other chronic conditions ,28, respThe culmination of emotional and informational resources seemingly perpetuates supportive online support communities. Many people with TS and families experience rejection in society due to tic-related stigma , and excpunishment they attributed to themselves for having tics. As well as other processes feeding into this reappraisal , another factor contributing to this could be through psychoeducational processes within online support communities, such as changing illness representations and new knowledge . Furthermore, writing about personal experiences in health-specific dedicated online support communities allows users to authentically express themselves and may contribute to sense of empowerment in living with chronic conditions [Meeting other people with TD and comparable difficulties within a group therapy setting may be sufficient enough to improve QoL , and sevnditions . The findouble-edged sword in seeking out support: respondents have described the high value they place in communicating with similar peers, but it comes with risk of experiencing changes in tics . Respondents in this study felt warnings preceding descriptions or videos of tics would be important in helping other users, and could be enforced by online support community moderators/administrators. Moreover, similar to Holbrey and Coulson [Despite the plethora of online support community benefits, participants were forthcoming about a number of limitations. Primarily, the suggestible nature of TDs perpetuated temporary onset of new tics and heightened tic severity upon exposure to graphic posts within online support communities. Similarly, vivid imagery in online support communities can be triggering for people who self-harm . For peo Coulson , a numbeAs similarly reported for other health issues ,40,46, cTo our knowledge, this is the first piece of research to examine online support community use for TS/TDs and may provide useful recommendations for practice: online support communities can be proposed as one accessible solution\u2014with cautions\u2014to people with TD and their families otherwise unable to access social support. Moreover, the study positively contributes to a growing literary body pertaining to use of online support communities among those experiencing chronic long-term conditions.There were several limitations. Although a diverse sample of 90 people of varying ages, genders, and mix of TD-related experiences from across multiple countries participated, they were mostly from Westernized countries and from participants who could respond in English. Future research may wish to explore non-English language online support communities to be more representative. Similarly, the majority of respondents being female was surprising given the higher prevalence of TDs in males , and so Overall, online support communities were illustrated as an accessible support source for people with TDs and supportive others. Provision of informational and emotional support was delineated as the foundation for building online support communities, which facilitated a much appreciated sense of inclusion among users, and perpetuated improvements in psychosocial well-being and functioning. As such, despite their drawbacks, online support communities were largely considered hugely beneficial to those experiencing TDs and could be one resource that clinicians may recommend to socially isolated patients and families."}
+{"text": "Pneumocystis jirovecii pneumonia (PJP) is one type of life-threatening pneumonia in immunocompromised patients. PJP development should be considered in not only immunocompromised individuals, but also patients undergoing intensive chemotherapies and immunotherapies, organ transplantation, or corticosteroid treatment. Past studies have described the clinical manifestation of PJP in patients during chemotherapy and reported that PJP affects cancer treatment outcomes. Therefore, PJP could be a potential problem for the management of cancer patients during chemotherapy, and PJP prophylaxis would be important during cancer treatment. This review discusses PJ colonization in outpatients during cancer chemotherapy, as well as in healthy individuals, and provides an update on PJP prophylaxis for cancer patients during chemotherapy. Pneumocystis jirovecii pneumonia (PJP) is an opportunistic infection caused by the yeast-like fungus PJ. PJP is a type of life-threatening pneumonia in immunocompromised patients including those with corticosteroid treatment, hematological and solid organ malignancies, organ transplantation, autoimmune disease, and human immunodeficiency virus. Two clinical factors need to be considered regarding the onset of this pneumonia; one is the airway environment, such as mucus damage from air pollution, chemical substances associated with cancer chemotherapy, and colonization of bacteria or fungi in the airway during cancer chemotherapy, in which PJ settles, and the other is host immunity against PJ infection after the administration of anti-tumor and immunosuppressive agents. PJ DNA is detectable in sputum or bronchoalveolar lavage specimens, not only from PJP and immunocompromised patients but also from healthy individuals, suggesting that PJ transmission may occur via an airborne route. As a result, PJ can colonize airways and pulmonary alveoli of some healthy individuals with latent infection. However, healthy individuals rarely develop PJP, even in the event of PJ colonialization. Environmental risk factors and host immunity are closely involved in PJP development.Mucosal damage and the risks of PJ colonization;Diagnosis of PJP;Host immunity-associated risks of PJP for patients during cancer chemotherapy;Chemoprophylaxis for PJP (first- and second-line) in immunocompromised patients.In this review, we discuss the following:The normal mucosa of the throat and lower respiratory tract plays an important role in protecting the host from pathogenic microorganisms. Mucosal damage is often caused by several factors, such as respiratory infections, autoimmune diseases of the respiratory tract, and chemical substances after inhalation, aspiration, or medical treatments. One of the most hazardous chemical substances for human respiratory mucosa is tobacco smoke. In contrast, mucosal damage occurs from chemical substances associated with chemotherapy, including 5-fluorocytosine, 5-fluorouracil, cyclophosphamide, cisplatin, carboplatin, docetaxel, paclitaxel, and vinorelbine , which sPJ colonization in airways and air vesicles may develop after the destruction of anatomical barriers. Our group has examined PJ colonization via the airborne route using nested PCR with specific primers targeting the PJ gene  among cancer patients during chemotherapy compared to healthy individuals. PJ DNA was detectable in 46% of sputum specimens from cancer patients during chemotherapy, which was not significantly different among cancer types and chemotherapy regimens, and the prophylactic use of trimethoprim/sulfamethoxazole (TMP/SMX) reduced the detection of PJ DNA  2]. Int. Int2]. The diagnosis of PJP requires microbiological tests and radiological findings. The following features of PJP have been reported.Microscopic examination of respiratory specimens ) using various staining methods, such as Giemsa stains or direct and indirect immunofluorescent assays, has been used to visualize and identify the morphological structures of PJ. Staining methods have now largely been supplanted by highly sensitive molecular techniques, using semi- or fully quantitative polymerase chain reaction (PCR) targeting PJ-specific genes. Quantitative PCR (qPCR), with defined upper- and lower-quantitation thresholds of the PJ copy number, can be used to distinguish true infection from colonization.In addition, serological examinations of fungal infection, such as wall polysaccharide (1-3)-beta-d-glucan (BDG) of fungi, may be helpful. However, cross-reactions with certain hemodialysis filters, beta-lactam antimicrobials, and immunoglobulins, which raise concerns about false-positives, should be considered.Chest radiographs (chest X-ray) in patients with PJP often show small pneumatoceles, subpleural blebs, and fine reticular interstitial changes that are predominantly perihilar in distribution. Pleural effusions are normally not a feature. The most frequent CT findings are bilateral, ground-glass changes with apical predominance and peripheral sparing. The range of other radiological features seen in PJP includes a combination of ground glass and consolidative opacities, cystic changes, linear-reticular opacities, solitary or multiple nodules, and parenchymal cavities. In addition, nuclear imaging modalities such as 18F-fluorodeoxyglucose-positron emission tomography (FDG-PET) have been used as an adjunct to plain X-ray or CT. FDG-PET shows bilateral uptake of FDG in the upper zones of the lungs.+ T cells/\u03bcL [Several risk factors of PJP concerning host immunity have been reported. An increased risk of developing PJP has been reported for patients with T lymphocyte-mediated immunodeficiency with fewer than 200 CD4cells/\u03bcL . Intermicells/\u03bcL .Patients with hematological malignancies and solid tumors are the most common population in need of PJP prophylaxis. In addition, several reports have shown higher risks of developing PJP in hematopoietic stem cell or organ transplant patients ,6,7,8. PPJP prophylaxis should be considered for the following upcoming molecular-targeted drugs : Bruton\u2019Chemoprophylaxis for PJP .2/dose or 2.5 mg/kg/dose (max 160 mg/dose) TMP/SMX three times a week every 12 h is recommended [TMP/SMX is the first-line drug for PJP prophylaxis, which is widely used in adults and children, and the only drug that has confirmed efficacy in prospective randomized controlled trials ,13. The ose max 10 mg/doseNo powered trials have provided sufficient evidence for PJP prophylaxis in patients during chemotherapy. However, the following drugs should be considered when TMP/SMX is not available.Dapsone is a synthetic sulfone . DDS works by inhibiting dihydrofolic acid synthesis in PJ . For aduPentamidine is an inhaled and intravenous drug. It works by inhibiting glucose metabolism, protein synthesis, and amino acid transport in PJ . For aducytochrome b in PJ mitochondria. For adults, 1500 mg atovaquone daily with a high-fat meal is recommended. For children aged 1\u20133 months, 30 mg/kg/dose atovaquone daily is recommended. For children aged 4\u201324 months, 45 mg/kg/dose (max 1500 mg) atovaquone daily is recommended. For children older than 24 months, 30 mg/kg/dose (max 1500 mg) atovaquone daily is recommended [Atovaquone is a compound belonging to the class of naphthoquinone derivatives. It works by inhibiting ubiquinone binding to ommended .PJP is a life-threatening pneumonia caused by disease- and treatment-related immunosuppression in cancer patients during chemotherapy, and appropriate prophylaxis is important for these patients. In addition to conventional circumstances such as ALL, HSCT, and corticosteroid administration, the number of conditions requiring PJP prophylaxis, such as patients treated with targeted therapies or monoclonal antibodies, is increasing. TMP/SMX is one strategy for PJP prophylaxis, and several other medications may be considered depending on the patient\u2019s condition. Air pollution may be associated with PJ colonization in the airway and air vesicles and may increase the mortality rate of PJP. All patients undergoing cancer chemotherapies should cease smoking."}
+{"text": "Gas1 and Boc/Cdon act as co-receptors in the vertebrate Hedgehog signalling pathway, but the nature of their interaction with the primary Ptch1/2 receptors remains unclear. Here we demonstrate, using primordial germ cell migration in mouse as a developmental model, that specific hetero-complexes of Ptch2/Gas1 and Ptch1/Boc mediate the process of Smo de-repression with different kinetics, through distinct modes of Hedgehog ligand reception. Moreover, Ptch2-mediated Hedgehog signalling induces the phosphorylation of Creb and Src proteins in parallel to Gli induction, identifying a previously unknown Ptch2-specific signal pathway. We propose that although Ptch1 and Ptch2 functionally overlap in the sequestration of Smo, the spatiotemporal expression of Boc and Gas1 may determine the outcome of Hedgehog signalling through compartmentalisation and modulation of Smo-downstream signalling. Our study identifies the existence of a divergent Hedgehog signal pathway mediated by Ptch2 and provides a mechanism for differential interpretation of Hedgehog signalling in the germ cell niche. How co-receptors Gas1 and Boc interact with Ptch1/2 receptors and regulate Hh signalling is unclear. Here, the authors demonstrate that the spatiotemporal expression of Gas1 and Boc determines how Hh signalling affects the dynamic migration of murine primordial germ cells. In mouse, PGCs arise from the posterior extra-embryonic mesoderm around embryonic stage (E)7.5 and migrate into the definitive endoderm, continuing through the developing hindgut (HG) until E9.5. Around E10.5, PGCs directionally migrate from the dorsal body wall, finally arriving at the bilateral genital ridges (GR) between E10.5 and 11.5, where they become immotile and differentiate into either spermatozoa or oocytes, integrating with the developing somatic gonads5. Studies in Drosophila and zebrafish suggest that Hedgehog (Hh) signalling is involved in the development of PGCs, but does not function as a fate determinant or guidance molecule8. The role of Hh signalling in mouse PGCs still remains ambiguous, although the aorta, gonad, mesonephros and GR are suggested to be the main source of chemo-attractantion10.Primordial germ cells (PGCs), the progenitors of gametes, provide a good model to study directional migration during development. The pluripotent PGCs rely upon precise communication by both secreted morphogens acting at long distance and local signalling produced by the immediate microenvironment14. Binding of Hh to the two paralogue Patched (Ptch1/2) receptors releases the Smoothened (Smo) G-protein coupled receptor, which allows its translocation to the primary cilia and the de-repression of Smo-dependent signalling. Ptch2 shares structural similarities with Ptch1, including extracellular ligand-binding loops and transmembrane domains, but has much shorter intracellular amino- and carboxy-terminals17. Like Ptch1, Ptch2 interacts with all mammalian Hh ligands  with a similar affinity and forms a complex with Smo. Contradicting reports claim that Ptch2 possesses either similar, weaker or no repressive activity on Smo during Hh signalling, compared with Ptch120. The embryonic expression pattern of Ptch2 is distinct from Ptch1, mainly in the skin and testis, and overlapping with Shh18. Ptch2-hypomorphic mice are viable and fertile, whilst Ptch1 mutants are embryonic lethal, suggesting that Ptch1 is the major regulator of Hh signalling and Ptch2 has a redundant function compensatable by Ptch123. Cells lacking Ptch1 remain sensitive to Hh in a chemotaxis assay, and Ptch2 can mediate Hh-induced motile responses in the absence of Ptch124.The role of Hh in chemotaxis has been demonstrated in different developmental contexts26, endothelial cell migration in pro-angiogenic responses27 and axon guidance through the activation of Src kinases28. A timely switch from canonical to non-canonical signalling can also occur during normal development29. Notably, Smo proteins located outside the cilia are believed to be responsible for non-canonical chemotactic responses, suggesting that Smo localisation might be the critical determinant in the selective engagement of canonical versus non-canonical pathways30. Since the majority of Smo proteins reside outside of the primary cilia, it has also been speculated that non-canonical signalling may represent a more general and robust Hh response in the normal state26.The Gli family of transcription factors mediate the canonical Hh pathway to regulate cell fate and patterning in accordance with the ligand gradient. Gli-independent non-canonical signalling also occurs, which does not require Smo localisation to the primary cilia. It is thought that non-canonical Hh signalling regulates cytoskeletal rearrangement in differentiated cells after specification31, while Gas1 is structurally distinct and localises at plasma membrane rafts via a glycosylphosphatidylinositol (GPI) anchor32. These co-receptors can bind Hh ligand independently of Ptch1 and facilitate ligand\u2013receptor interaction at the cell surface34. Boc and Cdon have partially redundant and distinct tissue-specific roles in Hh regulation during myogenic differentiation and axon guidance38. Gas1 positively regulates Shh signalling in the neural tube and forebrain40 but may exert a negative effect in the somite and mandibular arch at high concentrations43. Certainly, the developmental defects observed in Gas1 mutant mice suggest a complex relationship between Gas1 and Shh45. Since the positive effects of Gas1 are evident in areas of low Hh concentration, it has been speculated that Gas1 may extend the range of ligand gradient, translating a low peripheral chemical concentration into cellular activity46. In contrast, Boc/Cdon are implicated in areas of high Hh concentration, potentially required for the maximum canonical response47.A number of obligatory co-receptors for Hh have been identified in vertebrates, which include Boc , Cdon  and Gas1 (Growth arrest-specific gene 1). Cdon and Boc belong to a family of cell adhesion proteinsA key question is how Ptch1 and Ptch2 recognise and respond differentially to Hh ligand in the production of different cellular outcomes, particularly when considering that both canonical and non-canonical processes require Smo. Moreover, the role of co-receptor function in Ptch2-dependent signalling is completely unknown. Here we reveal that PGCs are naturally unciliated but remain sensitive to locally secreted Hh ligand through an exclusive interaction between Ptch2 and Gas1, while ciliated somatic cells immediately surrounding PGCs rely on interaction between Ptch1 and Boc. The molecular mechanisms leading to the de-repression of Smo after Hh ligand reception are different in Ptch1/Boc and Ptch2/Gas1-mediated signalling events, resulting in distinct downstream signal pathways acting in parallel to Gli-dependent transcription. Our findings provide a previously unreported mechanism for Ptch2-specific signal pathways involving the cAMP-responsive element binding protein (Creb) and Src tyrosine kinase. We propose that these distinct molecular mechanisms, mediated by different Ptch receptors and their co-receptors, may be a key determinant in the selective activation of distinct downstream signalling pathways. This may provide the required specificity and fine-tuning of Hh signalling, leading to either cell fate specification or post-specification cellular behaviour, such as motility.Ptch1, Gli1/2/3, Dhh and Shh, but not Ihh, were expressed along with a germ cell marker Stella in the HG at E9.5 and in the GR at E10.5\u201311.5, where PGCs localise  and the somatic cells (Stella-/GFP-) isolated from E10.5 StellaGFP embryos after FACS  embryos, the highly motile PGCs were stained positive for p-Src. However, Gas1 knockout (KO) mouse embryos showed a significant reduction in p-Src, even though Ptch2 and Boc expression remained similar  analyses at different time-points after Shh stimulation. We used NIH3T3 cells as a well-established model, which normally express Ptch1, Gas1, Boc and Cdon, but not Ptch2  at 24\u2009h. In contrast, in Ptch2-expressing cells, the induction of Gli1/3 remained at minimal levels even after 24\u2009h   Fig.\u00a0, agreein50. However, this compartmentalised local change of cAMP is undetectable in whole-cell extracts51. Since cAMP-PKA signalling activates Creb in NIH3T3 cells52, we assessed the level of phospho-Creb by Western blot at different time-points after Shh treatment. Ptch1-expressing cells did not show any p-Creb, agreeing with previous findings that Hh alone does not cause global p-Creb induction51. Surprisingly, Ptch2-expressing cells did show an induction of p-Creb at 40\u2009min, which further increased at 24\u2009h  activity at the cilium base regulate the coupling of Smo with inhibitory GTP-binding proteins (G\u03b1i)4\u2009h Fig.\u00a0. TherefoPtch1-expressing cells, but Ptch2-expressing cells displayed a substantial level of p-Src, which further increased upon Hh stimulation  and maintained in a C57BL/6 background. Gas1 mutant mice were originally generated by Dr Chen-Ming Fan (Carnegie Institute of Washington), maintained in a CD1/C57BL6 mixed background and genotyped as previously described46 using allele specific primers 5\u2032-TACTGCGGCAAGCTTTT CAACGG-3\u2032 and 5\u2032-AGCGCGCTGCTCGTCGTCATATTC-3\u2032 ; 5\u2032-ACTACGCGTACTGTGA GCCAGAG-3\u2032 and 5\u2032-AGTGACCAGCGAATACCTGTTCC-3\u2032 . For fertility assessment, the number of total litters and litter size of Gas1\u2212/\u2212 mice mated with and compared with paired controls were recorded for a period of nine months. All animal experiments were conducted under institutional guidelines under the Animals (Scientific Procedures) Act 1986 in the Biological Research Facilities at St. George\u2019s, University of London (PPL 70/8512) and King\u2019s College London (PPL7007441).C57BL/6 mice were purchased from Charles River . 58. Briefly, the GR of StellaGFP mouse embryos were dissected into the slice culture medium (Hepes-buffered DMEM/F-12 with 0.04% lipid-free BSA and 100\u2009U/ml penicillin/streptomycin). The transverse sections were then placed onto millicell CM organ culture inserts (Millipore) pre-coated with mouse collagen IV (50\u2009\u00b5g/ml in 0.05\u2009M HCl) (Beckton Dickson) in a 13\u2009mm glass-bottom plate  filled with pre-warmed slice culture medium containing 40\u2009\u00b5M of purmorphamine , cyclopamine (Stratech Scientific), tomatidine (Sigma-Aldrich) or dimethyl formamide (Sigma-Aldrich), which were optimised for their efficacy with minimal toxicity  interval for a minimum of 10\u201315\u2009h. Z-stack images of 11\u201313\u2009\u00b5m sections spanning 185\u2013230\u2009\u00b5m total thickness were extracted per time point and created into a movie using ImageJ. Velocity was calculated using the formula V\u2009=\u2009[sqrt (dx2\u2009+\u2009dy2)](p)/0.25h, where dx is the change in the x-axis, dy is the change in the y-axis and p is the pixel size in \u00b5m. Typically, for a 10\u00a0hour movie, 40 velocity measurements were generated per cell, which was averaged to obtain an overall velocity for that cell. Tracking was performed using ImageJ plugin Chemotaxis and Migration tool  on the GFP-positive PGCs that remained in focus and viable for the entire duration of the movie.Embryo slice culture and filming was conducted as previously reported with some modifications6 cells per 10\u2009cm dish were incubated in 0.5% NCS/DMEM for 24\u2009h and treated with 200\u2009ng/mL recombinant Shh N-terminal peptide59  for 40\u2009min or 24\u2009h. To generate the primary culture of GR cells, the dissected GR tissues were digested in 0.25% trypsin, passed through a 0.4\u2009\u03bcm cell strainer and suspended in DMEM/L-15 medium supplemented with 20% knockout serum replacement (Invitrogen), 2\u2009mM L-glutamine, 0.1\u2009mM non-essential amino acids and 0.1\u2009mM 2-mercaptoethanol (Sigma-Aldrich), before being plated onto 0.1% gelatin-coated plates. Cells were incubated in 0.5% serum-containing media before various treatments diluted in serum-free medium.NIH3T3 cells  were cultured in DMEM containing 2\u2009mM L-glutamine and 100\u2009\u00b5g/ml penicillin/streptomycin (Sigma-Aldrich), supplemented with 10% newborn calf serum (NCS). For signalling analyses, NIH3T3 plated at 2\u2009\u00d7\u200910Wdr11, which was pre-treated with Mitomycin-C (5\u2009\u03bcg/ml) for 2\u2009hours. Once the cells settled down, the two halves of coverslips were carefully rejoined in a 24 well plate containing PGC primary culture medium. After 24\u2009hours incubation, the cells were fixed with 4% paraformaldehyde and stained with anti-SSEA and DAPI. The number of cells present on each side of the coverslips was counted to obtain a percentage of migrated PGCs toward the empty vector or Shh-transfected 293 cells. The distance of PGC migration was measured from the midline.Coverslips (8\u2009mm) cut into halves using a diamond blade were coated with 0.001% poly-L-Lysine. For the source of Shh secretion, 293 cells transfected with pCS2 empty vector or encoding full-length human Shh cDNA  were plated without the feeder. For PGCs, the GR cells were plated onto NIH3T3/Cas9 feeder with the targeted knockout of 2 chamber at 37.0\u2009\u00b1\u20090.5\u2009\u00b0C. Time-lapse image sequences were analysed using the Chemotaxis and Migration Tool 2.0 plug-in software (Ibidi GmbH).Dissected GR tissues were prepared to generate single cell suspensions of GR primary culture and plated onto the NIH3T3 feeder layer pre-treated with Mitomycin-C (5\u2009\u03bcg/ml) and incubated in 0.5% serum media before treatment with Shh-N, purmorphamine, cyclopamine, tomatidine, DMF (40\u2009\u00b5M) and visomodegib (10\u2009\u00b5M), all diluted in serum-free medium. Non-directional motility of PGCs was measured by live imaging of GFP-positive cells captured every 15\u2009min for 16\u2009h using Nikon A1R laser scanning confocal microscope in a humidified COStellaGFP embryos were resuspended in the sorting buffer  and GFP+ and GFP- cell population was separated using a MoFlo XDP high-speed cell sorter (Beckman Coulter). FACS data were analysed using FlowJo software. Positive cells had an intensity of >2 on log scale of GFP detection using 488\u2009nm laser for excitation and a filter (529/28\u2009nm) for detection. Cells were selected using FSC (height) versus SSC (height) and a gate was prepared to eliminate debris or abnormally shaped cells. At least 1700 GFP+ cells representing ~0.1% of the total sorted cells collected from seven embryos were analysed per experiment. Total RNA from the sorted cells was extracted using PicoPure RNA Isolation Kit (Arcturus) and converted to cDNA using SuperScript IV reverse transcriptase (Invitrogen). Total RNA from mouse tissues was extracted using RNAeasy kit (QIAGEN) and converted to cDNA using NanoScript 2 Reverse Transcription kit (Primer Design). The cDNA obtained was analysed by either GoTaq G2 Hot Start PCR mix (Promega) or Maxima SYBR Green qPCR Master Mix (Thermo Scientific) on a Light-Cycler 2.0 (Roche) using the 2\u2212\u0394\u0394CT normalised to 18s rRNA or Gapdh. See Supplementary Table\u00a0Cells from dissected GR tissues of E10.5 Wdr11, Gas1 and Ptch1 were generated using CRISPR/Cas9 approach. Briefly, sgRNAs designed using the CRISPR Design Tool (http://crispr.mit.edu) were cloned into pSpCas9(BB)-2A-Puro (Addgene #48139) and transfected using Polyfect (Promega). After puromycin (Cambridge Bioscience) selection in 96-well plate, single-cell clones were analysed by Sanger sequencing and western blot to confirm the KO. See Supplementary Table\u00a0NIH3T3 cells with targeted KO in Total protein was extracted in a lysis buffer  containing protease/phosphatase inhibitors (Sigma-Aldrich), separated by SDS-PAGE, and transferred onto Hybond-ECL membrane (Amersham) which was probed with primary antibodies diluted in blocking buffer (5% skim milk in TBS with 0.05% Tween 20 (TBST)). After washing in TBST, the secondary antibodies conjugated with horseradish peroxidase was added before analyses by enhanced chemiluminescence . Co-IP was performed using pre-cleared lysate (1\u20132\u2009mg protein) and the immune complexes captured on protein A/G-Agarose beads (Santa Cruz Biotechnology) were analysed by Western blot. Uncropped blots are included in the source data file.For tissue staining, embryos at E9.5\u201310.5 collected after timed-mating were fixed in 4% paraformaldehyde (PFA) before paraffin embedding. Tissue sections were cut at 5\u20137\u2009\u03bcm thickness using an electric microtome (Leica RM2255), deparaffinised with Histoclear , and rehydrated in PBS. Following antigen retrieval in Sodium citrate buffer , sections were blocked with 2% goat serum, 0.2% Triton X-100 in 1xPBS for 1\u2009h at room temperature and then incubated overnight at 4\u2009\u00b0C with primary antibodies diluted in antibody dilution buffer . After washing in 1xTBST, fluorescence-labelled secondary antibodies were added with counterstaining of DAPI. For immunofluorescence analyses of cells, cultured cells on glass coverslips were fixed with 4% PFA, permeabilized with 0.2% Triton X\u2011100 in PBS, and incubated in blocking buffer  before probing with primary antibodies diluted in blocking buffer. After washing in 1xTBST, appropriate secondary antibodies were added along with DAPI, before mounting in Mowiol. Secondary antibodies  were conjugated with Alexa fluor 555 (goat anti-rabbit IgG), Alexa fluor 568 (goat anti-mouse IgG), Alexa fluor 488 (goat anti-rabbit and donkey anti-goat IgG) and used at 1:5000 dilution. For negative controls, non-specific IgG (Sigma-Aldrich) was used instead of primary antibodies. Fluorescence microscopy was performed using Zeiss Axioplan 2 Upright and analysed by using Fiji ImageJ software . For quantification, local background subtraction was performed before analysis.Antibodies were generated against Myc , Ptch1 , Ptch2 , Gas1 , Boc , Cdon , Smo , Shh , Gli3 , WDR11 , SSEA1, Stella , phospho-Src, , phospho-Creb , Arl13b , IFT88 , CEP164 , gamma\u2011tubulin , b-actin . HRP-conjugated secondary antibodies used were goat anti-mouse IgG , goat anti-rabbit IgG , donkey anti-goat IgG .t test with Welch\u2019s correction and one-way analysis of variance (ANOVA) followed by Dunnett\u2019s test.Data were analysed by the investigator blinded to the experimental condition, using GraphPad Prism 6 . Statistical significance was determined by unpaired two-tailed Student\u2019s Further information on research design is available in the\u00a0Supplementary InformationSupplementary Movie 1Supplementary Movie 2Supplementary Movie 3Supplementary Movie 4Supplementary Movie 5Supplementary Movie 6Supplementary Movie 7Supplementary Movie 8Supplementary Movie 9Supplementary Movie 10Peer Review FileReporting SummaryDescription of Additional Supplementary Files"}
+{"text": "The COVID-19 crisis and consequent confinement restrictions have caused significant psychosocial stress and reports of sleep complaints, which require early management, have increased during recent months. To help individuals concerned about their sleep, we developed a smartphone-based app called KANOPEE that allows users to interact with a virtual agent dedicated to autonomous screening and delivering digital behavioral interventions.Our objective was to assess the feasibility of this app, in terms of inclusion rate, follow-up rate, perceived trust and acceptance of the virtual agent, and effects of the intervention program, in the context of COVID-19 confinement in France.The virtual agent is an artificial intelligence program using decision tree architecture and interacting through natural body motion and natural voice. A total of 2069 users aged 18 years and above downloaded the free app during the study period . These users first completed a screening interview based on the Insomnia Severity Index (ISI) conducted by the virtual agent. If the users were positive for insomnia complaints (ISI score >14), they were eligible to join the 2-stage intervention program: (1) complete an electronic sleep diary for 1 week and (2) follow personalized sleep recommendations for 10 days. We collected and analyzed the following measures: sociodemographic information, ISI scores and sleep/wake schedules, and acceptance and trust of the agent.P<.001) and nocturnal sleep quality improved significantly after 1 week. Users who completed Step 2 also showed an improvement compared to the initial measures . Users that were most severely affected (ISI score >21) did not respond to either intervention.Approximately 76% (1574/2069) of the app users completed the screening interview with the virtual agent. The virtual agent was well accepted by 27.4% (431/1574) of the users who answered the acceptance and trust questionnaires on its usability, satisfaction, benevolence, and credibility. Of the 773 screened users who reported sleep complaints (ISI score >14), 166 (21.5%) followed Step 1 of the intervention, and only 47 of those (28.3%) followed Step 2. Users who completed Step 1 found that their insomnia complaints (baseline mean ISI score 18.56, mean ISI score after Step 1 15.99; These preliminary results suggest that the KANOPEE app is a promising solution to screen populations for sleep complaints and that it provides acceptable and practical behavioral advice for individuals reporting moderately severe insomnia. The current COVID-19 crisis has led to massive public health interventions, resulting in the confinement of almost the entire human population worldwide ,3. NotabThese findings confirm that the COVID-19 crisis has caused major psychosocial stress and that prolonged confinement is potentially an aggravating factor for sleep complaints and insomnia. Therefore, given the large number of individuals affected and the limited number of health care professionals available during the crisis, there is a need for innovative solutions to track and help individuals at risk of psychosocial stress.Digital technologies play a significant role in the context of the ongoing pandemic and overwhelmed health care services. As suggested by many researchers ,7 and goSoon after confinement measures were effective in France on March 17, 2020, we launched the first social media campaign in affiliation with our hospital and university through major national radios and newspapers. This campaign focused on the risk of insomnia and the measures to evaluate and correct inappropriate sleep hygiene practices among people during the COVID-19 confinement.\u00a0In addition to social media campaigns, we developed a free smartphone app to help individuals with sleep concerns in the context of the COVID-19 pandemic.\u00a0Named KANOPEE, the program is based on our previous research on embodied conversational agents (ECAs), also called virtual agents, which may be defined as animated characters that can engage in face-to-face dialogue through verbal and nonverbal behaviors. We previously demonstrated that ECAs can deliver a clinical interview to diagnose not only sleep complaints but also addiction and depression in an autonomous, reliable, valid, and acceptable way -19, by fWe hypothesized that a virtual agent made available via a smartphone app would be efficient and acceptable not only in providing autonomous screening for insomnia complaints but also in establishing digital behavioral interventions to help the population during the COVID-19 crisis. Therefore, to test our hypothesis, we launched a proof-of-concept study during the COVID-19 confinement.\u00a0KANOPEE was implemented using the same architecture as our previous ECAs -19, withThe app was made freely available on Google Play Store on April 22, 2020 see . After iThe interaction scenario comprises of the following steps: first, during the screening interview (Interview 1), Louise introduces herself and administers the Insomnia Severity Index (ISI)  see Fig. ThereafThroughout the process, all procedures and tools  are introduced by the virtual agent in order to facilitate understanding among the users and increase their engagement. A demo video of the user interaction by Louise has been hosted on YouTube .For the purpose of this study, users were selected for the analysis if they met the following inclusion criteria: (1) aged 18 years old and above and (2) had downloaded KANOPEE app before May 5, 2020, such that they had access to the 1-week intervention before the end of confinement period in France . Their use of the app was recorded from April 22 until May 26.After getting approval by the University and Hospital scientific committees, we obtained authorizations to be registered on the University Hospital register for General Data Protection Regulation (GDPR) approval by the French authorities\u2014Commission nationale de l'informatique et des libert\u00e9s (CNIL). Informed consent was obtained from all users downloading the app according to the GDPR and CNIL regulations.Subgroups of users were then selected for more detailed analyses see . SpecifiThe ISI  is a 7-iUsers who had an ISI score >14 were asked to complete a daily sleep diary in the app ,25 throuAddictive behaviors  of users were evaluated through a clinical interview based on the CAGE   and CDS-, perception that the agent has the ability and the expertise to conduct a medical intervention) and benevolence . Familiarity with technologies was also evaluated by a single question: \u201cAre you familiar with computer technologies?\u201d with the following 3 choices: \u201cNo,\u201d \u201cModerately,\u201d and \u201cYes,\u201d which were scored as 0, 1, and 2, respectively.After the interviews with the virtual agent, users could complete 2 assessments on the app. The first assessment was the French version of the Acceptability E-scale (AES) ,29 to met tests for continuous variables , and \u03c7\u00b2 tests for categorical variables . The data collected during the program were described using mean and SD values, and evolution of the measures over time was analyzed using repeated t tests. Acceptance  and trust  data were expressed using distributions and percentages. To investigate factors associated with acceptance and trust, we conducted univariate analyses with Pearson correlation analyses between 2 continuous variables  and performed mean comparisons  to analyze the variation in AES and ETQ scores regarding categorical variables . All analyses were performed using SPSS software .\u00a0Quantitative variables were expressed as means and SD, and qualitative variables were expressed as percentages. To compare 2 groups of users , we performed 2-tailed Student P=.016) and predominantly male users (P=.001). Other factors remained nonsignificant between the 2 groups  were divided into 2 subgroups based on their performance on the ISI: scores \u226414 considered \u201cwith subclinical insomnia\u201d and scores >14 considered \u201cwith moderate-to-severe insomnia\u201d .1576=\u22123.03; P=.002), more educated , and more likely to be female . Interestingly, more users in confinement were found in the moderate-to-severe insomnia group , but we did not find evidence of a higher prevalence of insomnia among health care professionals. Users with moderate-to-severe insomnia smoked more cigarettes  and obtained a higher score on the screening questionnaire for addiction to cigarettes  than those in the other groups.Compared to users with subclinical insomnia, users with moderate-to-severe insomnia were younger  users answered the acceptance and trust questionnaires . AcceptaP=.034), suggesting that older individuals found Louise less credible than the younger ones. Age was not correlated with other dimensions of trust and acceptance. Similarly, gender and educational level of the users were not correlated with their attitude towards Louise. Regarding insomnia severity, there was a positive relationship between the severity and credibility of Louise , indicating that users with more severe insomnia complaints found her more credible. Lastly, we found significant correlations between users\u2019 familiarity with technologies and their attitudes towards Louise: users more familiar with technologies found her more usable , more satisfactory , and more benevolent .We found a negative correlation between age and credibility subscore on the ETQ , with 36.7% (61/166) of users obtaining an ISI score below a clinically significant level  either corresponding to \u201cno insomnia\u201d  or to \u201csubthreshold insomnia\u201d . For the 47 users who completed Step 2 of the intervention, their ISI scores continued to decrease but did not reach a significant threshold . However, compared to the initial measure, a significant decrease was observed . Moreover, the proportion of users reporting low insomnia complaints increased, with a total of 48.9% (23/47) of users below a clinically significant level. Of note, 14.9% (7/47) of users still reported \u201csevere insomnia\u201d after Step 2, so they were referred to a sleep specialist.Among the 166 users who completed Step 1 of the intervention , the total ISI score  decreaseRegarding nocturnal sleep patterns, we computed the mean scores of the first 2 nights filled in the sleep diary and the last 2 nights before receiving step 2 intervention in order to evaluate the evolution of sleep indicators during completion of Step 1 of the intervention program among the 166 users who completed the Step 1 . Analyses of mean and SD values see  suggest To measure the effect of completing Step 2 on sleep indicators, we computed the mean scores of the 7 nights before the users received personalized sleep recommendations and compared it to the mean scores of the 7 nights after they started Step 2. Mean and SD analyses among the 47 users who completed Step 2 suggest that WASO, NWAK, and TWAK decreased after Step 2, whereas TIB, TST, and sleep efficiency increased see .Our results show, for the first time, the feasibility of using virtual agents in the context of a major health crisis to monitor insomnia symptoms and deliver assistance to the users through behavioral interventions. eHealth is a very rapidly growing field, and numerous solutions are particularly adapted to conditions such as confinement where human contacts must be limited. Several mobile apps use text-based chatbots for medical interviews, but the use of virtual agents  is still sparse. We believe that these new empathic human-machine interfaces can reinforce acceptance of eHealth solutions.More than 2000 people downloaded the KANOPEE app over the 11-day study period, with no technical errors reported by Google Play Store, indicating a higher inclusion rate than that reported in a previous study proposing digital cognitive behavioral therapy for insomnia . This coAcceptance of the virtual agent was a major challenge in this specific context, and we obtained very good results, similar to those reported previously with outpatients in a hospital . UsabiliIn the intervention program, 21.5% of the users reporting significant sleep complaints  completed a daily sleep diary for more than 7 days and consented to participate in Interview 2 , and 28.3% of users followed behavioral interventions and completed the sleep diary for 10 more days. Interestingly, subjects completing Step 1 significantly improved their sleep over a brief period of time . We hypothesize that filling in the sleep diary and receiving daily feedback on their sleep efficiency score helped users to adjust their sleep schedule autonomously. Another possible explanation is that their insomnia symptoms decreased naturally over time, even though a reduction of time in bed for about half an hour suggests an active change. These findings are very encouraging for the use of electronic sleep diaries to promote sleep hygiene practices, a form of low-intensity sleep health intervention that could be beneficial at the more global population level. Users who completed their personalized intervention reported an improvement in nocturnal sleep, with a reduction of nocturnal awakenings and insomnia complaints, which suggests Step 2 was beneficial for a subgroup of individuals with more significant sleep complaints. Altogether, with completion rates of 76% for the initial evaluation and 28.3% for the personalized interventions in a selected population, we believe that our results open interesting perspectives for populational interventions and mirror the proposal of Berry et al  to set uNevertheless, this study has a few limitations. First, the very peculiar period of recruitment, during the COVID-19 confinement, makes our results preliminary. Future work needs to confirm, in a more \u201cnormal period of time,\u201d the fact that KANOPEE can help individuals improve their insomnia complaints and sleep hygiene.\u00a0Second, the drop-out rate was quite high. We were unable to determine why users did not follow the program until the end, and further study is therefore needed for a precise examination of usage  and qualitative interviews with app users to unveil the reasons why they decided to drop out of KANOPEE.Another limitation of our study is related to the fact that we did not note an improvement among the most severe users, which shows the limitations of nonhuman interventions. Because we did not explore all the possible comorbidities, we might have proposed to some users a solution that may be unsuitable to their health problems. Future studies could use detailed interviews that could help precisely select the ideal population to receive the interventions and refer the other users directly to sleep centers.Considering the above limitations, we believe that KANOPEE is a new promising tool in the field of eHhealth that could limit the number of individuals asking for consultations by general practitioners for moderate sleep complaints. Indeed, we believe this app can help in both ways: identifying individuals with insomnia complaints and providing brief and practical behavioral interventions. Further research is needed to test this app apart from the COVID-19 confinement period and on more specifically selected users."}
+{"text": "Most individuals who typically receive palliative care (PC) tend to have cancer and a relatively short prognosis (<\u20096\u2009months). People with other life-limiting illnesses can also benefit from a palliative care approach. However, little is known about those who receive palliative home care in Ontario, Canada\u2019s largest province. To address this gap, the goal of this project was to understand the needs, symptoms and potential differences between those with a shorter (<\u20096\u2009months) and longer prognosis (6+ months) for individuals receiving PC in the community.n\u2009=\u200948,019 or 64.1%) were compared to those with a longer prognosis  across several clinical symptoms. The standardized difference (stdiff), between proportions, was calculated to identify statistically meaningful differences between those with a shorter and longer prognosis. Values of the stdiff of 0.2 or higher  indicated a statistically significant difference.A cross-sectional analysis was conducted using interRAI Palliative Care (interRAI PC) assessment data collected between 2011 and 2018. Individuals with a shorter prognosis . Those with a shorter prognosis were significantly more likely to experience fatigue  and shortness of breath at rest . However, the two groups were similar in terms of severe pain , depressive symptoms  and nausea .These results highlight the importance of earlier identification of individuals who could benefit from a palliative approach to their care as individuals with a longer prognosis also experience high rates of symptoms such as pain and nausea. Providing PC earlier in the illness trajectory has the potential to improve an individual\u2019s overall quality of life throughout the duration of their illness.The online version contains supplementary material available at 10.1186/s12904-021-00851-x. As the population continues to age and people continue to live longer, there is a growing number of individuals living with chronic illnesses such as Alzheimer\u2019s dementia, organ failure, stroke and chronic lung diseases. Within Canada, roughly three in ten individuals 32%) have a chronic illness, with 70% of all deaths occurring from a chronic disease . Many or% have a In 2008, it was estimated that only 16 to 30% of individuals had access to formal palliative care services , the majEven though there is strong evidence that providing a palliative approach to care that starts early in the illness trajectory is beneficial, the literature still shows that the majority of care is focused on the last weeks or days of life , 7. TherFor the most part, older adults prefer to \u201cage in place\u201d and remain in their own homes for as long as possible . This isCurrently, the interRAI Palliative Care (interRAI PC) assessment is only used in Ontario to assess individuals receiving PC in the community. The interRAI PC was developed in 2003 by interRAI, a non-profit organization of roughly 100 clinicians and researchers representing 35 countries who develop and test standardized assessments for use in various populations, including palliative care. The interRAI PC offers a wealth of data at the person-level and offers insights in the needs of individuals receiving PC in the community. The current body of literature has limited information on who is receiving PC in the community in Ontario. To address this gap using existing interRAI PC data, the current study aims to understand the needs, symptoms and potential differences in characteristics for those with both a shorter and longer prognosis for individuals receiving palliative care in the community.This cross-sectional study utilized secondary data collected using the interRAI Palliative Care (interRAI PC) assessment in Ontario. The interRAI PC is a comprehensive assessment instrument that identifies person-specific palliative care preferences, symptoms and needs to support health professionals in the care planning process , 16. Then\u2009=\u200948,019; 64% of the sample) to those with more than six months to live . Eligibility for PC has often been determined by proximity to death and tends to fall within the last weeks or months of life [All interRAI PC clients who had a completed assessment between 2011 and 2018 were included, representing the most recent information available for Ontario. For individuals with multiple assessments completed within this time frame, the most recent assessment was retained for analysis. This resulted in a total sample of 74,964 unique individuals. This sample represents a mix of individuals that have been on service for a longer period of time , as well as those that would have recently started service (75.2% of sample). We ultimately decided to utilize each individual\u2019s most recent assessment for analysis in order to take a cross section of all clients on service that is as close to the current landscape as possible. The data were de-identified before being shared with the research team. Prognosis was captured with a single item on the interRAI PC with four response options including death imminent (within days), less than six weeks, six weeks or longer, but less than six months and six months or longer to live. To differentiate those with a short versus long prognosis, we decided to collapse and dichotomize the prognosis variable comparing those with less than six months to live  is scored from zero to six and includes four items, namely, short-term memory, cognitive skills for daily decision making, expressive communication and independence in eating. A cut-point of two or higher was used to indicate at least moderate impairment in cognitive functioning. The scale has been validated against the Mini Mental State Exam (MMSE) [m (MMSE)  and is cm (MMSE) .The Pain Scale includes two items which capture both the frequency and intensity of pain. The scale is scored from zero (no pain) to three (severe/daily pain) and has been validated against the Visual Analog Scale [og Scale . A scoreog Scale .The Activities of Daily Living Self-Performance Hierarchy Scale (ADL-H) is scored from zero (independent) to six  for items including bathing and dressing. In line with previous research, a cut-point of two or higher indicated at least moderate difficulty completing ADL tasks independently [endently , 24. Theendently .The Depression Rating Scale (DRS) is scored from zero to fourteen and includes items pertaining to both mood and behavior. A score of three or higher has been found to be predictive of a clinical diagnosis of depression [pression .The Pressure Ulcer Risk Scale (PURS) is scored from zero to eight and includes items such as impaired bed mobility, bowel incontinence, weight loss and history of a resolved pressure ulcer [re ulcer . In linere ulcer .There are five health index scales embedded within the interRAI PC assessment which are automatically generated upon completion of the assessment:Several other dichotomous variables (yes/no) around physical, psychosocial and spiritual characteristics were examined including a recent fall in the last 90\u2009days, difficulty falling asleep/staying asleep, too much sleep, shortness of breath, fatigue, nausea, vomiting, fluctuating state of consciousness, acute change in mental status, hospital and emergency department visits, a wish to die now, being at peace with life, finding guidance in religion or spirituality, being accepting of their situation as well as having a sense of completion on transfer of financial, legal and other formal responsibilities.International Classification of Diseases, Tenth Revision (ICD-10) categories. Since it was common for individuals to have multiple diagnoses, the diagnostic groups are not mutually exclusive. The 11 diagnostic groups included cancer, circulatory diseases, respiratory diseases, nervous/mental disorders, digestive disorders, metabolic/endocrine diseases, musculoskeletal diseases, as well as diseases of the skin, eye, ear and congenital diseases. We also explored the number of comorbid chronic conditions present (0-2 vs. 3+). Finally, in terms of caregiver characteristics, we examined the Caregiver Risk Evaluation (CaRE) algorithm, which is a decision-support tool that is used to assess the risk of caregiver burden, ranging from low risk to very high risk [We also explored diagnosis, which is collected on the interRAI PC in a free-text format. A detailed description on how free-text entries were recoded into 11 diagnostic groups can be found elsewhere . In summigh risk .Within the interRAI PC, eight Clinical Assessment Protocols (CAPs) can be generated from data elements found in the assessment. CAPs are used to assist care coordinators who complete the interRAI PC with care planning and can also highlight areas of need that may benefit from treatment, additional assessment or referral . The eigThere was some degree of missing data in seven of the eight CAPs, however the number of missing data is due to how the assessment is completed. For example, the delirium, fatigue, sleep disturbance and mood CAPs are not calculated for individuals who are considered comatose (missing\u2009=\u2009636). For the pressure ulcer and nutrition CAP, some of the specific items required to populate the CAP were missing. Case managers in Ontario have the option of using an abbreviated version of the interRAI PC assessment, based on their clinical judgement . This shorter version does not include the comprehensive set of items, resulting in an inability to calculate some of the CAPs.Demographic and clinical characteristics between individuals with a prognosis of at least six months to live compared to those with less than six months to live were analyzed using the chi-square statistic. Given the large sample size and potential for type I error, we used an absolute standardized difference  of 0.2 or higher to identify statistically meaningful differences between those with a shorter and longer prognosis. This cut-point was used to represent at least a small effect size . The stan\u2009=\u20091839), six weeks or less to live  and longer than six weeks to live, but less than six months . The remaining group (35.9%) had a prognosis of six months or longer to live . Overall, nearly half (44.4%) of the sample were 74\u2009years or older, 49.5% were female and 62.5% were married or had a partner. There were no significant differences between those with a longer or shorter prognosis in terms of age, sex, marital status or living arrangement , however both circulatory (46.2%) and musculoskeletal (18.5%) diseases were also highly prevalent. Diseases of the eyes, ears, skin as well as congenital diseases all had a prevalence of less than 5% in the sample and are therefore not reported in Table %, howeveAlthough some key differences existed, based on prognosis, the two groups were very similar  across multiple health-related outcomes. For example, the groups experienced similar and high rates of severe/daily pain (73.4% vs. 66.5%), nausea (35.7 vs. 29.4%), hospital admissions (49.8% vs. 39.8%), emergency department visits (26.9% vs. 22.6%), and having at least three co-morbid chronic conditions (48.3% vs. 48.2%). While those with a shorter prognosis were statistically more likely to have a caregiver being at high or very high risk of caregiver burden, a large proportion of caregivers to those with a longer prognosis also fell into this group  CAPs. Both groups triggered the following CAPs at rates that were considered not statistically significant, including pain (45% vs. 34.5%), mood (42.4% vs. 32.3%), sleep disturbance (31.8% vs. 30.6%), and nutrition (27.3% vs. 20%). The exceptions to this were the fatigue CAP, delirium CAP, dyspnea CAP, and pressure ulcer CAP which were all significantly higher in the short prognosis group; Fig.\u00a0To date, there are limited studies that touch on the experiences of individual\u2019s receiving PC in their own homes in Ontario. While these studies have utilized interRAI PC data in Ontario, almost all of them were based off of early pilot data, which included a limited sample size and focused on very specific aspects of PC \u201340. TherPain is one of the most common symptoms experienced by palliative home care clients with a life-limiting illness . It is oThe majority of Canadians prefer to \u201cage in place\u201d and remain in their own homes for as long as possible . This mePalliative care is often provided to those with a cancer diagnosis compared to other chronic life-limiting illnesses due to the predictability of decline . AlthougThere is a common misconception with some patients and health care professionals that PC is synonymous with end-of-life care. This misconception can lead to individuals not having access to PC until late in their illness trajectory when symptom burden is high . HoweverA potential limitation of the current study is the decision to use everyone\u2019s most recent assessment as we may actually be capturing individuals as they are closer to death. This sample represents a mix of individuals who have been on service for a certain length of time as well as those that were recently referred. We felt it was important to get a cross section of all clients currently on service that was as close to the current situation as possible, as this study serves as a foundation in understanding who receives home PC in Ontario, Canada\u2019s largest province. The majority of individuals (73%) only had one assessment available, therefore even if we used a different assessment , we would still be capturing the majority of the same individuals as in the current study. We also completed a sensitivity analysis comparing the results using an individual\u2019s first assessment in the data and found that in the vast majority of circumstances (94%), the difference between proportions when using the first vs. most recent assessment was less than 5%.Additionally, we recognize that this paper is focused on Ontario, but from an international point of view, this is the only interRAI PC data that is available. Currently, New Zealand is in the process of rolling out the interRAI PC assessment country wide, therefore in the future, our research team plans to do multi-country analysis. Finally, we were unable to examine the person\u2019s primary diagnosis, based on how the diagnoses were captured. However, we were still able to identify the most prevalent diagnoses in the sample, including cancer, circulatory and musculoskeletal diseases. There are also a number of strengths in the study, including the large sample size, which represent all regions in Ontario as the vast majority of regions are using the interRAI PC assessment. The interRAI PC assessment has a large variety of data elements that are not often found in administrative data, which is typically what has been used to look at PC services in the past , 60. AdmThe needs of home care clients receiving palliative care in Ontario are complex and the results of this research highlight the importance of providing PC to any individual who could benefit from a palliative approach to their care, regardless of diagnosis or prognosis. This information is needed as it allows health care professionals and policy makers to better understand the care needs of individuals being treated in the community. While those with other life-limiting illnesses tend to have a longer prognosis compared to individuals with a cancer diagnosis, these individuals still experience similar issues as those with a shorter prognosis. Therefore, it is vital that anyone living with a life-limiting illness be identified as someone who could benefit from PC as it has the potential to improve their overall quality of life throughout the trajectory of their illness.Additional file 1: Table\u00a01. Description of Clinical Assessment Protocol (CAP) triggering levels. A detailed description of how each individual Clinical Assessment Protocol (CAP) triggering level is defined.Additional file 2: Table\u00a02. Clinical Assessment Protocol (CAP) triggering rates in the overall sample. The triggering rates for each Clinical Assessment Protocol (CAP) across all clients in the sample."}
+{"text": "N\u2010acyl \u03b1\u2010amino aldoximes such as N\u2010Boc\u2010l\u2010prolinal oxime catalyzed by copper(II) acetate provides access to the corresponding N\u2010acyl \u03b1\u2010amino nitriles, which are substructures of the pharmaceuticals Vildagliptin and Saxagliptin. In this work, a detailed investigation of the formation of the amide as a by\u2010product at higher substrate loadings is performed. The amide formation depends on the electronic properties of the nitrile co\u2010substrate. We could identify an acceptor nitrile which completely suppressed amide formation at high substrate loadings of 0.5\u2005m even when being used with only 2 equivalents. In detail, utilization of trichloroacetonitrile as such an acceptor nitrile enabled the synthesis of N\u2010Boc\u2010cyanopyrrolidine in a high yield of 92\u2009% and with full retention of the absolute configuration.The access towards chiral nitriles remains crucial in the synthesis of several pharmaceuticals. One approach is based on metal\u2010catalyzed dehydration of chiral aldoximes, which are generated from chiral pool\u2010derived aldehydes as substrates, and the use of a cheap and readily available nitrile as co\u2010substrate and water acceptor. Dehydration of  Unwanted amide formation in the copper(II)\u2010catalyzed dehydration of aldoxime can be reduced or completely suppressed by a high excess of acetonitrile or by choosing a more electrophilic acceptor nitrile such as trichloroacetonitrile. Carefully tuning these parameters enabled the synthesis of N\u2010Boc\u2010cyanopyrrolidine in a high yield of 92\u2009%, with full retention of the absolute configuration. One example is given by the asymmetric Strecker synthesis. Starting from prochiral aldehydes, chiral \u03b1\u2010amino nitriles can be obtained using amines, cyanides and chiral catalysts.As a result, various efforts have been made to discover new ways of synthesizing chiral nitriles and especially 2, and proceeds through the dehydration of N\u2010acyl protected l\u2010proline amide, which is easily accessible from the chiral pool reagent l\u2010proline amide by using a suitable Vilsmeier reagent.[The utilization of toxic cyanides in the synthesis of nitriles can be avoided by dehydration of amides and aldoximes. Such a process is used, for instance, in the synthesis of Vildagliptin  reagent.3, 4 TDehydration of aldoximes represents a promising alternative for synthesizing nitriles. For the dehydration of aldoximes, several stochiometric reagents have been described, such as oxalyl chloride,A recent focus has been on the development of environmentally friendly and cost\u2010effective versions of this type of reaction, leading to the use of various metal catalysts such as copper,N\u2010acyl amino nitriles, based on a copper(II) acetate\u2010catalyzed dehydration of aldoximes, was described, using acetonitrile as water acceptor \u20102\u2010cyano\u2010pyrroldine (5).[N\u2010acylated pyrrolidines, which could serve as intermediates in the synthesis of Vildagliptin.[N\u2010amino nitriles, this access however showed disadvantages in terms of applicability on technical scale. The dehydration suffered from a low substrate concentration (80\u2005mm), a low space\u2010time yield and from being a two\u2010step process.In previous studies of our group,4, 18 4 to 0.5\u2005m in the presence of acetonitrile as reagent (\u201cacceptor nitrile\u201d), the formation of N\u2010Boc\u2010proline amide 6 in significant amounts was observed, which also occurred in a developed one\u2010pot process.6 as a by\u2010product can be found when taking into account the reaction mechanism of the desired dehydration step. In particular at high substrate loading, in\u2005situ formed Boc\u2010cyanopyrrolidine 5 can also take over the function of the acceptor nitrile in the dehydration of unreacted aldoximes.[During our research on scaling up this process and improving the space\u2010time yield of the dehydration step by raising the substrate loading of Boc\u2010prolinal oxime ldoximes.20, 2124 at a substrate concentration of 0.5\u2005m, a catalyst loading of 2\u2005mol\u2009% and the use of 10 equivalents of acetonitrile in ethyl acetate for 4\u2005h at 70\u2009\u00b0C was selected . Thus, a catalyst loading of 2\u2005mol\u2009% was chosen for the subsequent study of the impact of the reaction temperature on conversion and amide formation. The temperature was varied in the range of 70\u2009\u00b0C to \u221220\u2009\u00b0C using the standard reaction conditions . At the same time, the presence of acetonitrile leads to an increased formation of amide 6 at both studied temperatures. This can be explained by the formation of the desired cyanopyrrolidine 5 in higher amount, which then acts as an intermediate in the undesired formation of the proline amide side product 6.First, the influence of the amount of copper acetate on the progress of the reaction and side product formation was studied by varying the catalyst loading between 0.5 and 5\u2005mol\u2009% (see Supporting Information). While no difference was observed between 1 and 5\u2005mol\u2009% with respect to the total conversion as well as to the amide formation, the total conversion at a catalyst loading of 0.5\u2005mol\u2009% decreased to 38\u2009% . By successively increasing the number of equivalents of acetonitrile up to 235, which corresponds to a substrate concentration of 80\u2005mm of 4 in pure acetonitrile, led to a further decrease of formation of the undesired amide 6 to only 1\u2009% at a complete conversion of the aldoxime after 4\u2005h (entry\u20051).Since an influence of the acetonitrile on conversion and side\u2010product formation could be observed, the used equivalents were subsequently varied in a standard reaction at 70\u2009\u00b0C. In detail, the number of equivalents was varied between 235 and 10, which in most cases has also been associated with a change in substrate concentration .In contrast, a reduction of the substrate concentration to 100\u2005m5 as such a co\u2010substrate in the further course of the reaction.These results also support the described mechanism of an amide formation via a nitrile intermediate. Accordingly, an increased amount of acetonitrile as acceptor nitrile and, thus, co\u2010substrate decreases the probability of a further reaction of the desired Boc\u2010protected nitrile 4 in hand, we next focused on the preparation of Boc\u20102 cyanopyrrolidine 5 within a one\u2010pot process starting from aldehyde 3 \u20102\u2010cyanopyrrolidine (5) was isolated in a yield of 85\u2009%, whereas only 5\u2009% conversion to amide 6 was observed  addition of water during the dehydration process of the aldoxime substrate. In addition, the electronic properties of the aldoxime substrate should then play a role on both conversion and side product formation. While a general influence of electron donating substituents in this type of reaction is mentioned, an influence on amide formation under the chosen conditions has not yet been described.Although using a large excess of acetonitrile enables suppression of the side product and high conversion, the resulting substrate concentrations of 80 or 100\u2005mn\u2010octanal oxime, various p\u2010substituted benzaldoximes were chosen based on their Hammett values and used as substrates in a dehydration reaction.In order to verify this hypothesis, at first the influence of the electron density at the aldoxime on amide formation in the standard reaction was investigated Figure\u2005. For thi7\u2009a\u2013e with different substitution pattern in 4\u2010position were prepared from the respective aldehydes in good to excellent yields. Similarly, amides 11\u2009a\u2010e were obtained from the corresponding aldoximes as reference compounds in low to moderate yields by a copper(II)\u2010catalyzed rearrangement in toluene. The Hammett values \u03c3p of the aromatic aldoximes ranged from 0.78 for p\u2010nitrobenzaldoxime 7\u2009a to \u22120.83 for p\u2010aminobenzaldoxime 7\u2009e, defining the electronic characteristics of the p\u2010substituents. Furthermore, n\u2010octanal oxime (8) was investigated as an aliphatic substrate. We were pleased to find that the dehydration reaction under standard conditions , only a small amount of the side product n\u2010octanamide (12) (3\u2009%) is observed at complete conversion of the aldoxime  is7\u2009a\u2013e as substrates, there is a clear dependency of the selectivity on the Hammett parameter and, thus, on the electron density at the carbon atom of the aldoxime group  and p\u2010nitrobenzonitrile 9\u2009a (\u03c3p=0.78), respectively, was observed, although only a conversion of 95\u2009% was noted in the latter case. These observations confirm that the reactivity of the aldoxime and the resulting nitrile significantly influence the progress and selectivity of the reaction. The electron\u2010withdrawing substituent in para\u2010position lowers the electron density at the cyanocarbon of the in\u2005situ formed p\u2010nitrobenzonitrile 9\u2009a, favoring a nucleophilic attack in the dehydration of unreacted aldoxime 7\u2009a compared to the higher electron density of acetonitrile, which served as the acceptor nitrile in the initial dehydration step. In the conversion of octanal oxime 8, this effect is only slightly observed, since the resulting octanenitrile 10 has a similar electron density at the reactive center as acetonitrile. Here, the 10\u2010fold excess of acetonitrile plays a more significant role, which leads to the suppression of the undesired amide formation in this case.When using the 4\u2010substituted benzaldoximes p Figure\u2005. When us2.34 (see Supporting Information). However, when using more electrophilic acceptor nitriles we found a significant increase of the reactivity with respect to water addition, as expected. In detail, we tested two different acceptor nitriles with such an expected higher reactivity, namely trichloroacetonitrile and succinonitrile  was observed in comparison with acetonitrile (35\u2009% amide). On the other hand, reduction to two molar equivalents of succinonitrile leads to a non\u2010complete conversion (96\u2009%) of 7\u2009a after 4\u2005h with a similarly high amide 11\u2009a content (33\u2009%) compared to the experiment with ten equivalents of acetonitrile. When using trichloroacetonitrile as a co\u2010substrate, we were pleased to find that this compound showed even better properties as a nitrile acceptor . Only with just an equimolar use of this acceptor nitrile, analogous to succinonitrile, an incomplete conversion and, with 35\u2009%, a high proportion of the undesired p\u2010nitrobenzamide 11\u2009a as a side product was observed.The reaction was first carried out for both acceptor nitriles under standard conditions with onitrile 5\u2009% amide4 as a next step. When utilizing either ten equivalents (data not shown) or even just two equivalents of trichloroacetonitrile, we were pleased to find a complete conversion of the aldoxime without formation of the undesired amide side\u2010product (Scheme\u2005N\u2010Boc\u2010(S)\u20102\u2010cyanopyrrolidine 5 in 92\u2009% yield. Furthermore, also in this case full retention of the absolute configuration was observed.With this improved nitrile acceptor in hand, these findings were applied to the dehydration of Boc\u2010prolinal oxime 3para\u2010substituted benzaldoximes with different electron densities at the carbon atoms of the aldoxime and cyano groups and using acetonitrile as the co\u2010substrate was analyzed. Depending on the chosen substrate, amide formation can be reduced or completely suppressed by a high excess of acetonitrile or by appropriate choice of a more electrophilic acceptor nitrile such as trichloroacetonitrile. By suppressing the undesired amide formation, the yields were significantly improved for p\u2010nitrobenzonitrile 9\u2009a and N\u2010Boc\u2010cyanopyrrolidine 5, leading to a high yield of 92\u2009% in the latter case.In this work, the relationship between the ratio of the reactivity of the acceptor and product nitrile and its influence on the formation of the undesired amide side product in a dehydration of aldoximes was investigated. Toward this end, the dehydration of The authors declare no conflict of interest.4As a service to our authors and readers, this journal provides supporting information supplied by the authors. Such materials are peer reviewed and may be re\u2010organized for online delivery, but are not copy\u2010edited or typeset. Technical support issues arising from supporting information (other than missing files) should be addressed to the authors.Supporting InformationClick here for additional data file."}
+{"text": "Background and Objectives: biomarker-based studies are the cornerstone of precision medicine, providing key data for tailored medical care. Enrollment of the planned number of patients is a critical determinant of a successful clinical trial. Moreover, for inclusive medical care, patients from different socio-demographic backgrounds must be recruited. Still, a significant number of trials fail to reach these prerequisites. Designing the informed consent forms based on the patients\u2019 feedback could optimize accrual. We aimed to explore the attitudes of patients from a Romanian tertiary cardiology center towards participation in biomarker-based clinical trials. Materials and Methods: three hundred forty inpatients were interviewed based on a semi-structured questionnaire which included four sections: demographics, personal medical history, attitudes and trust. Results: Roughly, 62.5% of the respondents were interested in enrolling, while altruistic reasons were the most frequently expressed. Clear exposure of the possible risks was most valued (37.78%), followed by the possibility of directly communicating with the research team (23.78%). The most frequently chosen answer by acutely ill patients was improvement of their health, whereas chronically ill individuals indicated the possibility of withdrawal without affecting the quality of medical care. Importantly, the participation rate could be improved if the invitation to enrollment were made by both the current physician and the study coordinator (p = 0.0001). The level of trust in researchers was high in more than 50% of the respondents, and was correlated with therapeutic compliance and with the desire to join a biomarker study. Conclusions: the information gained will facilitate a tailored approach to patient enrollment in future biomarker-based studies in our clinic.  Decoding the patient\u2019s omic data is essential to aiding the successful completion of targeted therapy in clinical practice. Participation in clinical trials is needed in order to guarantee ongoing improvements in patient-specific therapeutic interventions. The role of biomarkers is increasingly promising, considering the continuous development of new targeted therapies. It is generally accepted that well-designed studies including a large number of participants are needed for biomarker-based research validation. However, one of the challenges faced with when conducting a clinical trial is recruitment of the targeted number of participants. The informed consent form (ICF) is ethically and legally required before enrollment in a clinical trial, and it should be tailored to respond to the patients\u2019 needs and values. Full understanding of the ICF is crucial for participation in clinical studies . BesidesA questionnaire was distributed by trained research staff to evaluate patients\u2019 willingness, attitude and expectations concerning partaking in biomarker-based studies, as well as the general trust in researches, based on a review of literature. The survey methodology has been detailed elsewhere . BrieflyThe study was approved by the Ethics Committee of the Clinical Emergency Hospital of Bucharest, and was performed in compliance with the principles of the Declaration of Helsinki . Written informed consent was obtained from all subjects. The final questionnaire was distributed to 340 subjects from the department of cardiology at the Emergency Clinical Hospital. The participants were approached for enrollment during their hospitalization for cardiovascular diseases. ICFs were signed on a separate form than the questionnaire as to ensure the anonymity of the subjects. The participants\u2019 diagnoses were filled in from the electronic medical records for accuracy.The data are presented as mean \u00b1 standard deviation for continuous variables, or as number and percentage for categorical or nominal data.The following independent variables: gender, education, age, race, religion, previous hospitalizations in the last 12 months, chronic disease status, previous study enrollment and compliance to treatment, were examined for their effects on the respondents\u2019 answers with the Chi-square test. Statistical analysis was performed with SPSS version 23.The study included 340 subjects, with a mean age of 59.68 \u00b1 13.15 years, predominantly males (70.4%), from an urban area (72.7%), who had some college education or more (84.8%) . Only 37A percentage of 85.3% of the participants considered biomarker-based studies to be beneficial, and 62.5% were interested in participating.The main reason for accepting to take part in such a study was the contribution to research in general (26.1%), followed by the desire to help other subjects with the same disease (21.2%), or for oneself (16.4%), as the information could help one\u2019s own treatment, whereas 15.2% would not participate . For theThe majority of the respondents trusted medical researchers (58.4% strongly agreed), and believed that physicians involved in research only care about the best for each patient  and would disclose all the information needed to be known about the study (58.53%) . Neearlyp = 0.001) and had more frequently been involved in previous medical studies (p = 0.003). Interestingly, chronic illnesses did not significantly affect the quality of life (p = 0.636), perception about biomarker studies (p = 0.98), interest (p = 0.317) or motivation to engage in such trials (p = 0.69).Participants with chronic diseases were more likely to adhere to prescribed medical treatment than those with acute illnesses (p = 0.302), access to medical studies (p = 0.613), quality of life (p = 0.277) or the reasons to participate (p = 0.124), but instead influenced the interest to involve (p = 0.033), even if the correlation was weak (rho = 0.117) or the information considered important (p = 0.029). Those with higher educations were less interested in participating and considered essential the clear exposure of the possible risks derived from the study, but with a weak correlation (rho = 0.12). Interestingly, participants with some higher education saw the questionnaire more positively compared with those with 4-year degree (p = 0.0001).The level of education did not influence compliance to treatment (p = 0.065). Instead it was observed that subjects who presented with acute conditions  had a tendency not to be compliant to treatment (p = 0.011), unlike those with chronic conditions (chronic heart failure); the type of cardiovascular disease for which the subject was hospitalized did not influence the quality of life (p = 0.821). Instead, the information that convinced participants to enroll was different and significant (p = 0.046); for those with acute conditions , participation in the study could substantially improve their health in the future, while for those with chronic conditions , the possibility to withdraw from the study at any time without affecting the quality of the medical treatment and the assurance that their rights will be respected during the study were more valued.The heart disease for which participants were hospitalized did not influence participation in previous medical studies . Those that strongly agreed that physicians involved in research wanted only the best for each patient (p = 0.014) and that all the required information is revealed (p = 0.018) were more prone to participate. Of note, the participation rate in the study could be improved if the invitation to enroll were to be made by both the current physician and the study coordinator (p = 0.0001).The level of trust in doctors was not influenced by sex, age, religion, community size, education, ethnicity or marital status, while the interest in participating in a clinical study on biomarkers was higher in those with high levels of trust in physicians and those that had already been enrolled in another study. Trust in physicians was also correlated with compliance , the informed consent forms will be revised so as to provide the necessary information to that respective category of patients. Moreover, our results can be applied in other clinics to can refine the design of ICF according to local characteristics (such as the predominance of acute or chronic cases)."}
+{"text": "Trajectories of endosomes inside living eukaryotic cells are highly heterogeneous in space and time and diffuse anomalously due to a combination of viscoelasticity, caging, aggregation and active transport. Some of the trajectories display switching between persistent and anti-persistent motion, while others jiggle around in one position for the whole measurement time. By splitting the ensemble of endosome trajectories into slow moving subdiffusive and fast moving superdiffusive endosomes, we analyzed them separately. The mean squared displacements and velocity auto-correlation functions confirm the effectiveness of the splitting methods. Applying the local analysis, we show that both ensembles are characterized by a spectrum of local anomalous exponents and local generalized diffusion coefficients. Slow and fast endosomes have exponential distributions of local anomalous exponents and power law distributions of generalized diffusion coefficients. This suggests that heterogeneous fractional Brownian motion is an appropriate model for both fast and slow moving endosomes. This article is part of a Special Issue entitled: \u201cRecent Advances In Single-Particle Tracking: Experiment and Analysis\u201d edited by Janusz Szwabi\u0144ski and Aleksander Weron. Intracellular transport of organelles, such as endosomes, has been described by anomalous diffusion caused by different mechanisms ,2. VarioTo decipher which mechanism is at work and determine the appropriate mathematical model to describe it, a large ensemble of trajectories is necessary. Modern experimental techniques facilitate the tracking of large ensembles of intracellular objects for considerable amounts of time. Therefore, the extraction of meaningful statistical information from trajectories is becoming an important issue. The traditional statistical analysis of trajectories includes quantification of ensemble evolution in time and space using the ensemble-averaged mean squared displacements (EMSD), time-averaged MSD (TMSD), probability density functions of displacements and correlation functions. As the accessible measurement time in experiments increases with better live-cell microscopy techniques, the accurate analysis of single trajectories has become possible . New metImproved microscopy imaging, tracking and analysis methods revealed the intrinsic spatial and temporal heterogeneity within individual trajectories of numerous biological processes ,16,17,18Recently, the intracellular transport of endosomes in eukaryotic cells was shown to be described by spatiotemporal heterogeneous fractional Brownian motion (hFBM) with non-constant Hurst exponents . By analEndosome trajectories are composed of segments of active and passive motion, and therefore they could be further decomposed into directed runs and random motion. We segmented endosomal trajectories in this way in . In thishttps://zenodo.org/record/5106450#.YPBsEuhKhPY, accessed on 23 July 2021). An example of experimental trajectories is shown in T, has a good fit to a power law distribution, We studied a large ensemble of two dimensional experimental trajectories, eos  of an individual trajectory W and centered around the time t, i.e., The time-local statistical analysis was implemented as follows. We considered only the portion of a single endosomal trajectory within a window of size The time averaged auto-correlation function (TVACF) along a single trajectory is defined as:n models .T [We split the ensemble of endosomes into slow and fast moving vesicles using the two methods described above . Unlike the slow moving endosomes, the MSDs of fast vesicles  also confirm the effectiveness of this simple threshold splitting A,B. Indee values A. Such bD\u223cTo verify that heterogeneous FBM describes slow moving endosomes, we simulated an ensemble of hFBM trajectories. Individual hFBM trajectories were simulated with constant Hurst exponent evidence . The gent ( Methods). From the fit of L-TMSD to Equation (t (stationary) and are best fitted with exponential and power law functions, respectively.We next implemented the local analysis  to betteEquation , we extromes see . The oriThe PDFs of ectories . This isectories , which dFinally, we calculated propagators of experimental trajectories for slow and fast endosomes . Using td \u03b3F\u22430.5 , we fit omes see A, we als|\u03be|1.65) .In this paper, we extend our investigation of the heterogeneous intracellular transport of endosomes based on the local analysis of experimental trajectories . IndividComparing the behavior of fast endosomes  to the behavior of the entire ensemble, we find that they are most consistent with FBM models . TherefoBoth slow and fast endosomal trajectories are found to be highly heterogeneous in space and time. The spatial heterogeneity in the form of coupling between endosome diffusivity and duration of endosome trajectory explains the behavior of the MSDs. Longer trajectories have smaller generalized diffusion coefficients since in experiments slowly moving endosomes with smaller diffusion coefficients stay longer in the field of view, having longer durations. For slow and fast endosomes, we can conclude that EMSD and E-TMSD are not adequate to describe the large heterogeneity exhibited in space and time. Therefore, we applied a time local analysis of individual trajectories.From the local analysis, we found that slow and fast endosomal trajectories are both characterized by exponentially distributed anomalous exponents and power-law distributed generalized diffusion coefficients. However, the parameters of these distributions are different. Although the factors that cause the power-law distributed generalized diffusion coefficients for slow and fast endosomes could be different, some common factors can exist. One of them could be the scale free properties of endosomal networks . Hence, Our analysis of endosomal transport would be valuable for both fundamental cell biology and nanomedicine applications such as drug and gene delivery. In these applications, nanoparticles are often used as cargo-carrying vesicles, which in turn utilize the endosomal network for their intracellular transport. For example, gold nanoparticles were shown to cluster inside endosomes and move via sub- and superdiffusion . Our resIn the future, we expect microscopy techniques will improve in tandem with tracking algorithms, providing datasets with larger ranges of time scales and improved resolution. Thus, further subclassification of ensembles of endosomal tracks (beyond the binary fast and slow separation) will become possible towards the ultimate goal of single molecule specificity. Increasing the dynamic range  will allow the stepping motion of the motor proteins (kinesin and dynein) attached to microtubules to be connected with the spectra of"}
+{"text": "Significance: Imaging of the spinal cord is challenging due to the surrounding bony anatomy, physiologic motion, and the small diameter of the spinal cord. This precludes the use of non-invasive imaging techniques in assessing structural changes related to trauma and evaluating residual function.Aim: The purpose of our research was to apply endovascular technology and techniques and construct a preclinical animal model of intrathecal spinal cord imaging using optical coherence tomography (OCT).Approach: Five animals  were utilized. Intrathecal access was gained using a 16-guage Tuohy, and an OCT catheter was advanced under roadmap technique into the cervical canal. The OCT catheter has a motorized pullback, and a total length of 54\u00a0mm of the spinal canal is imaged.Results: Image acquisition was successful for all animals. There were no instances of difficult catheter navigation, enabling OCT imaging rostrally to C2. The thecal sac provided excellent thoroughfare for the OCT catheter. The clear cerebrospinal fluid also provided an excellent medium for image acquisition, with no detectable artifact from the contents of the cerebrospinal fluid. The anatomical space of the spinal canal could be readily appreciated including: dural lining of the thecal sac, epidural veins, pial lining of the spinal cord, arachnoid bands, dentate ligaments, and nerve rootlets/roots.Conclusion: Minimally invasive intrathecal imaging using endovascular OCT was feasible in this preclinical animal study. The repurposing of an endovascular device for spinal imaging comes with limitations, and a spine-specific device is necessary. The cross-sectional images generated using OCT utilize backscattered light from the tissue structure. The underlying principal is that various biological tissues in the body have varying optical indices, and therefore, different tissue layers will reflect the light at different amplitudes. A spatial resolution of 10 to In 1991, a technology called optical coherence tomography (OCT) was developed by Huang et\u00a0al.In comparison, intravascular ultrasound has a spatial resolution of The spinal cord is located in the spinal canal within the thecal sac, which is filled with clear cerebrospinal fluid. The cerebrospinal fluid could conceivably be used as a media to navigate an OCT catheter to various anatomical locations within the spinal column. The thecal sac would act as a highway, analogous to the vessel lumen in cardiac imaging. The objective of advancing spinal cord imaging is rooted in improving clinician\u2019s ability to accurately diagnose, treat injuries, and diseases and predict clinical outcomes. The aim of this research was to construct a preclinical animal model of intrathecal spinal cord imaging using OCT. The goal is to determine if OCT catheter navigation through the thecal sac is feasible, and if cross-sectional images of the spinal cord can be generated through the cerebrospinal fluid.2All experiments were conducted according to the policies and standards established by the authors\u2019 institutional animal research ethics board. Five animals total, two Yorkshire Swine weighing 40 to 45\u00a0kg and three New Zealand White Rabbits weighting 5\u00a0kg, were utilized for spinal OCT imaging. The rationale for using two different species was testing if the catheter could be navigated in animals with larger and smaller dimension spinal canals. There was no prescreening imaging for any animal. All procedures were carried out under general anesthetic with continuous hemodynamic monitoring. Imaging data in this study are available from the corresponding author upon written request.2.1A dedicated animal interventional radiology suite equipped with a single-plane C-Arm  was used for all procedures. Under fluoroscopic guidance, the midline and L2/L3 level was landmarked, and a 16-guage Tuohy needle was advanced into the spinal canal. Once in position, the inner cannula was removed to confirm cerebrospinal fluid egression. Next, Omnipaque 300  was injected via the Tuohy to further confirm the intrathecal positioning of the needle and provide a roadmap for OCT catheter navigation .2.2The Dragonfly\u2122 OCT catheter  was used for all procedures . This deecal sac . The disNormally, the OCT catheter can be navigated to the site of interest in either a monorail fashion over a 0.014-arc sec microwire or coaxially through a larger distal access catheter when in the vasculature. Given the gentle curvature of the spinal canal without any sharp turns, the catheter could be navigated without a wire or distal access catheter. First, the catheter was advanced superiorly into the cervical spine where imaging was performed, and subsequently directed inferiorly toward the sacrum for imaging, by changing the orientation of the Tuohy bevel tip .Once in position the OCT catheter is connected to the docking station, image acquisition is enabled and motorized pullback is initiated. The catheter has a motorized pullback, and a total length of 54\u00a0mm is scanned with each pullback. OCT imaging frequency is 100 frames per second, with a total of 540 cross-sectional images generated per pullback. All cross-sectional OCT images were analyzed. Given the cerebrospinal fluid is clear, no clearing of the thecal space was needed. This is contrary to intravascular imaging, where an injection of contrast or saline is needed to clear the blood in the vessel lumen during image acquisition.3A total of five animals (two swine and three rabbits) underwent intrathecal spinal cord imaging using the endovascular OCT catheter. Image acquisition was technically successful for all animals. Lumbar puncture via Tuohy needle was achieved, and the OCT catheter was passed through the needle and navigated throughout the spinal canal successfully in all cases. There were no instances of difficult catheter navigation cranially, enabling OCT imaging as rostral as C2. Caudally, the catheter could be navigated to the superior endplate of S1, at which point it would loop rostrally. The thecal sac provided excellent thoroughfare for the OCT catheter. The clear cerebrospinal fluid also provided an excellent medium for image acquisition, with no detectable artifact from the contents of the cerebrospinal fluid. There were no obvious complications such perforation of the thecal sac or obvious traumatic damage to the spinal cord in any animal.The anatomical space of the thecal sac could be readily appreciated with the OCT lens surrounded by cerebrospinal fluid. The dural lining of the thecal sac was visualized, along with epidural veins  and 5. V4in vivo. An intravascular OCT imaging catheter designed and approved for the diagnosis and treatment of cardiac patients was repurposed and navigated throughout the thecal sac for spinal imaging. We found the navigation of the OCT catheter and the acquisition of cross-sectional images to be feasible in all five animals.The authors describe to the best of their knowledge the first intrathecal imaging of the spinal canal using OCT. This imaging acquisition technique is minimally invasive and allows for the highest spatial resolution currently available. The imaging was performed in a preclinical setting in swine and rabbits \u2013The advancement of spinal cord imaging with respect to the characterization of residual function and structure after spinal cord injury is imperative moving forward.In this feasibility study, the authors sought to determine if endovascular devices and techniques could be applied in spinal cord imaging. If imaging could be performed from within the thecal sac, one could eliminate artifacts from the surrounding bony structures. Furthermore, an imaging modality such as OCT with a spatial resolution of in situ for four continuous days. However, lumbar drains are not typically advanced into the cervical spinal canal, generally only extending a few levels above the entry point in the lumbar spine at L3/L4. Conversely, intrathecal baclofen pump placement is a common surgical procedure for spasticity. The catheters are typically placed at the T10 level for diplegia, C5 for spastic tetraplegia, and C2 for generalized secondary dystonia.Although minimally invasive, as in this case with a 16-gauge Tuohy needle, thecal sac access and threading of an intrathecal catheter does not come without risk. Ahmadieh et\u00a0al. (2020)The authors did not assess neurological function postprocedure in this feasibility study, and therefore, cannot comment on the clinical safety of navigating a 0.9-mm catheter into the thoracic and cervical spine. Preclinical neurological outcome studies are required before any human investigations can be performed using OCT catheters. However, the authors hypothesize that given no neurological complications have been reported during the implantation and advancement of a 1.2-mm catheter from the lumbar to cervical spine during intrathecal baclofen pump surgery, navigation of smaller soft catheters may also be safe. Furthermore, this study was performed on anatomically normal spinal cords in swine and rabbits, and therefore imaging in pathologic states such as spinal trauma or infection may be more challenging.Using OCT, the authors observed excellent visualization of the dura, subarachnoid space, epidural vessels, dentate ligaments, and nerve roots and rootlets. This could theoretically allow for high resolution, minimally invasive imaging for pathologies such as intradural extramedullary tumors, spinal arachnoid web versus cyst, vascular malformations, and beyond. The structure of the spinal cord itself was poorly visualized. The pial lining of the spinal cord caused a significant degree of signal reflection. Similarly, nerve roots created a shadow beyond their structure.Moving forward, certainly a spinal-dedicated device is necessary. The optimal device would have a larger field-of-view and depth of tissue penetration. The catheter diameter should be a small as possible, ideally Furthermore, in patients with spinal cord tumors, structural optical imaging could provide clear definitions of tissue boundaries therefore guiding extent of resection, which is challenging in spinal surgery. We also envision that intrathecal imaging could easily identify and differentiate arachnoid webs, ventral cord herniation, and arachnoid cysts. Clinicians currently have difficulty differentiating between these pathologies and often MRI combined with CT myelography is required, which are invasive and time-consuming diagnostic tests. In this preclinical study, arachnoids bands and dentate ligaments were well visualized, and therefore, structural OCT should be able to differentiate these pathologies. Similarly, for arachnoiditis, OCT could reveal regions of thickened tissue and bands therefore confirming the inflammatory diagnosis. Finally, large arteries and draining veins of dural arteriovenous fistulas or arteriovenous malformations could be identified with both structural and hemodynamic optical imaging. Localization and characterization of the lesions is often difficult and a minimally invasive modality could provide useful for both diagnoses, possibly stratify rupture risk, and assess for post-treatment cure.The application of endovascular OCT in spinal imaging has several limitations. The repurposing of a device, from coronary to spinal imaging, will inherently come with restrictions. The first limitation is the field-of-view of the OCT device. Given that the diameters of coronary arteries are generally a few millimeters, the current device will not be able to fully image a human spinal cord with a diameter of 15\u00a0mm at the C5 level.5Intrathecal spinal canal imaging using endovascular OCT was feasible in this preclinical animal study. The repurposing of an endovascular device for spinal imaging comes with limitations including decreased field-of-view and depth of tissue penetration. A spine-specific OCT device is necessary moving forward and could propel a new field of minimally invasive spinal imaging."}
+{"text": "Cancer occurrence is rapidly increasing all over the world, including in developing countries. The current trend in cancer management requires the use of herbal remedies since the majority of anticancer drugs are known to be costly, with unwanted side effects. In the Eastern Cape province, the use of medicinal plants for cancer management has been climbing steadily over the past two decades due to their cultural belief, low cost, efficacy, and safety claims. With the aim of identifying some potential anticancer plants for probable drug development, this study was undertaken to review plants reported by ethnobotanical surveys in the Eastern Cape province of South Africa for the traditional management of cancer. Information regarding plants used for cancer management in the Eastern Cape province was obtained from multidisciplinary databases and ethnobotanical books. About 24 plant species belonging to twenty families have been reported to be used for the traditional management of cancer in the Eastern Cape province. Among the anticancer plant species, only 16 species have been explored scientifically for their anticancer activities. This review authenticated the use of anticancer plant species in the Eastern Cape province and, therefore, identified several promising unexplored species for further scientific evaluation. Cancer, a generic term for a large group of diseases, may affect any part of the body. It is one of the world\u2019s most horrifying diseases triggered by uncontrolled cellular proliferation. The development and progression of cancer are caused by an oncogene, the tumor suppressor gene (TSG), and alterations of the microRNA gene . These gCancer is increasingly a global health burden that has caused an intolerable number of deaths worldwide. It is one of the most horrific diseases of the twenty-first century, with approximately 6 million cases reported annually . The IntIn recent years, there have been several anticancer agents or drugs used for the management of cancer. These existing anticancer agents are divided into several categories, namely alkylating agents, antibiotics, antimetabolites, mitotic inhibitors, platinum compounds, biological response modifiers and hormone therapeutics. Alkylating agents are genotoxic drugs used for the treatment of cancer. They affect the nucleic acids and their function, thereby binding to the DNA, intervening with replication and transcription resulting in mutations . The priAntibiotics used for the treatment of cancer are chemicals produced by microorganisms with anticancer activity . These aAntimetabolites are also known as cytotoxic agents, have been developed for more than 60 years and are regarded as a pillar of cancer chemotherapy. They work by interfering with nucleic acid synthesis, thus acting as false metabolites, which are incorporated into DNA strands or block essential enzymes, thereby preventing DNA synthesis , and if Mitotic inhibitors are another type of anticancer drugs used to treat several cancer types including lung cancer, breast cancer and lymphomas . They inPlatinum compounds are another class of drugs used for cancer therapy. About half of the patients on chemotherapy are given platinum drugs . The repBiological response modifiers (BRMs) have been reported to enhance the body\u2019s ability to fight cancer through immune stimulation . SeveralHormone therapy is another form of cancer treatment that is mainly used to treat specific types of breast cancer and prostate cancer that depend on sexual hormones to grow. Furthermore, several other cancers have also been reported to be treated with hormone therapy . HormoneCatharanthus roseus (vinca plants) [In line with some limitations linked with the use of current synthetic anticancer agents, the use of medicinal plants for the treatment of cancer has been greatly accepted as part of medical interventions. This is mainly due to their fewer probable side effects, lesser costs and effectiveness, with several chemical compounds for the discovery of novel active substances against cancer ,41. Plan plants) . In gene plants) ,44. Thes plants) .Dicoma anomala. Another study conducted by Mfengwana [The search for medicinal plants for the treatment of cancer is still currently ongoing worldwide. Several review reports on plants with anticancer activity from different parts of the world have also been described in the literature ,47,48. Ifengwana  reportedThe Eastern Cape province is one of the poorest South African provinces, with the highest provincial unemployment rate (55%), and the majority of the population are rural dwellers, thereby they tend to rely heavily on medicinal plants for the treatment of diseases, including cancer. This is primarily because of their cultural beliefs, low cost, efficacy and safety claims of medicinal plants ,53. The From the ethnobotanical survey, twenty-four plant species belonging to twenty botanical families have been claimed as anticancer plants by the people of Eastern Cape province , though Aspalathus linearis is an erect and highly variable shrub up to 2 m in height that belongs to the family Fabaceae [A. linearis is easily dispersed in the winter rainfall area, predominantly in the Western Cape, Northern Cape and Eastern Cape provinces of South Africa [A. linearis have been reported to inhibit cell proliferation, thereby interfere with the growth of cancerous cells in the skin [A. linearis have also been reported to exhibit anticancer activity [Fabaceae . The leah Africa . In tradh Africa . In addih Africa . Literatthe skin . Furtheractivity .Agapanthus africanus belongs to the family Agapanthaceae [A. africanus is an evergreen perennial plant that produces a leaf rosette of about 1 m in height from an underground bulb [A. africanus is found in the Eastern Cape and Western Cape provinces of South Africa [nthaceae . It is ound bulb . The leah Africa . Traditih Africa . In addih Africa . The litCannabis sativa is an erect annual plant up to 4 m tall with leaves alternate and palmately compound. The plant belongs to the family Cannabaceae and is widely distributed in Southern African countries, including South Africa and Botswana [C. sativa and its compounds. Studies conducted by Bala et al. [C. sativa effectively inhibits growth and progression of breast cancer cells, with the IC50 value of 27.8 \u00b1 5.0 \u03bcg/mL. Another study reported by Tariz and Reyaz [C. sativa has also been reported to exhibit anticancer activity. CBD showed antiproliferative effects against breast cancer cells through various mechanisms, including apoptosis, autophagy and cell cycle arrest [Botswana . In SoutBotswana . Howevera et al.  revealednd Reyaz  also shoe arrest .Catharanthus roseus is a species of a flowering plant that belongs to the family Apocynaceae. It is an evergreen herbaceous or subshrub plant with a height of approximately 1 m. The leaves of the plant range from oval to oblong, 2.5\u20139-cm-long and 1\u20133.5-cm-wide [C. roseus. Harshini et al. [C. roseus exhibits significant inhibition against the growth of breast cancer cells (MCF-7 cells) at the concentrations investigated in the study. A study conducted by Pham et al. [C. roseus root and stem extracts possess significant cytotoxic activity towards some cancer cell lines. The compound catharoseumine isolated from C. roseus was found to exhibit an inhibitory effect against the human promyelocytic leukemia HL-60 cell line, with the IC50 value of 6.28 \u03bcM [C. roseus have also been reported to possess an inhibitory activity against a human breast cancer cell line (MDA-MB-231), with the IC50 value range of 0.73\u201310.67 \u03bcM [-cm-wide . The pla-cm-wide . The alk-cm-wide . The inf-cm-wide . Severali et al.  revealedm et al.  also fou 6.28 \u03bcM . In anot10.67 \u03bcM .Eucomis autumnalis is a garden plant that belongs to the family Hyacinthaceae. It is a deciduous bulb that grows in summer. The bulbs of the plant are large, ovoid in shape, and give rise to a rosette of large broad leaves about 12\u201335 cm long and 7.5 cm wide [E. autumnalis exhibited a significant cytotoxic effect against a human hepatoma cell line (Huh-7), with the IC50 value of 7.8 \u03bcg/mL, as compared to berberine , the positive control used in the study. cm wide . The pla cm wide . In trad cm wide . The dec cm wide . The in  cm wide  revealedEuphorbia ingens (family Euphorbiaceae) is an erect succulent tree that grows up to 12 m in height. The plant prefers hot areas and is able to survive in areas that experience long periods of drought [E. ingens for the treatment of cancer, there is still a dearth of scientific information on its anticancer properties. drought . It grow drought . The Xho drought . In addi drought . DespiteHypoxis argentea is one of the numerous species of the genus Hypoxis, the largest genus of the family Hypoxidaceae [H. argentea is a perennial plant that is mostly found in grassland and on rocky outcrops. It has thin ribbed leaves with silky yellowish hairs and small yellow flowers [xidaceae . H. arge flowers . The pla flowers . The fre flowers . The pla flowers . The litPittosporum viridiflorum is an evergreen tree that belongs to the family Pittosporaceae. The leaves of the plant are frequently wider above the middle and dark-green [P. viridiflorum is prepared from boiled fruit, filtered and then administered orally for the treatment of cancer [P. viridiflorum [P. viridiflorum against human cancer cells  tested, with the IC50 value ranging from 3.16 to 26.87 \u03bcg/mL. In the same study, the author also revealed that the ethanol extract of the plant exhibits a significant anticancer activity against cervix, breast and colorectal cancer cells, with the IC50 values ranging from 13.28 to 23.37 \u03bcg/mL. Another study reported by Poschner [P. viridiflorum exhibited a cytotoxic effect against HL-60 leukemia cells, with the IC50 value of 5.15 \u03bcg/mL.rk-green . The plark-green . The decf cancer . In addif cancer . Severaldiflorum . Madikizdiflorum  reportedPoschner  revealedSolanum aculeastrum is a small tree approximately 1\u20135-m-high, with lobed discolorous leaves. The plant belongs to the family Solanaceae. S. aculeastrum occurs naturally in grassland, woodland and on forest margins, but is dispersed in Eastern Cape, Mpumalanga, Limpopo, KwaZulu\u2013Natal and Western Cape [S. aculeastrum have been reported to exhibit antiproliferative activity against three human tumor cell lines , with the IC50 value ranging between 17.1 and 48.3 \u03bcg/mL [S. aculeastrum exhibit a significant cytotoxic effect against some cancerous cells, such as A2780 ovarian carcinoma, DU145 prostate carcinoma and Sk-Br3 breast adenocarcinoma. Koduro et al. [S. aculeastrum inhibit the growth of cancer cell lines  by blocking the cell cycle in the G0/G1phase after 24-h exposure to the compounds.ern Cape . The decern Cape . The met.3 \u03bcg/mL . Another.3 \u03bcg/mL  also revo et al.  also repSutherlandia frutescens is an attractive shrub of up to about 1 m in height that belongs to the family Fabaceae. The leaves of the plant are pinnately compound and grey\u2013green in color. The plant naturally occurs in Southern African countries, such as South Africa, Namibia and Botswana [S. frutescens. Research conducted by Gouws et al. [S. frutescens decreased LS180 colorectal cell growth and viability, with the IC50 value of 2.63 mg/mL, as compared to paclitaxel, the positive control used in the study. Another study by Chinkwo [S. frutescens showed significant cytotoxicity against neoplastic  cells. A separate study conducted by Motadi [S. frutescens methanol extract induced growth inhibition of human squamous carcinoma (SiHa cell line), with the IC50 value of 50 \u03bcg/mL. In the same study, the author also indicated that the extract induced cell cycle arrest at the S phase.Botswana . In SoutBotswana . In tradBotswana . In addiBotswana . The lits et al.  showed t Chinkwo  also revy Motadi  also repA comprehensive literature search was thoroughly conducted from December 2020 to May 2021. Information about the plants used for the traditional management of cancer in the Eastern Cape province of South Africa was retrieved from various online databases, including Web of Science, Medline, Google Scholar, Science Direct, Scopus, PubMed, Medline, Web of Science and Library Search. Additionally, dissertations, theses, and ethnobotanical books were also retrieved from the libraries of universities. The keywords and terms used to search for the relevant articles, included \u201cEastern Cape\u201d, \u201ctraditional medicine\u201d, \u201ccancers\u201d, \u201cethnopharmacology\u201d and \u201cmedicinal plants\u201d. The scientific and common names of the plants were validated in reference to the PlantZAfrica  and the Cancer is a genetic condition in which certain cells of the body develop uncontrollably and spread to other parts of the body. Its incidence is rapidly increasing all over the world, including in developing countries such as South Africa. The current trend in cancer management requires the use of medicinal plants since the majority of anticancer drugs are known to be costly, with unwanted side effects. In the Eastern Cape province, the number of people using medicinal plants for the management of cancer has been rising steadily over the last two decades. This is attributed to their cultural beliefs, low cost, efficacy and safety claims of these medicinal plants. In this review study, out of the twenty-four medicinal plants reportedly used in the Eastern Cape province for the management of cancer, only sixteen plants have been scientifically studied for their anticancer activity, and many of these plants exhibited their anticancer activity through inhibition of the growth of several cancer cell lines or attenuate their proliferation. It is highlighted that the anticancer activity of these plants is mainly due to their different phytochemical compounds . Hence,"}
+{"text": "Background: The coronavirus disease 2019 (COVID-19) is a novel coronavirus that causes severe infection in the respiratory system. Since the immune status plays an essential role in combating COVID-19, herbal medicines, which have an immunomodulatory effect, may help prevent and even treat COVID-19. Nigellasativa is one of the herbal medicines with antiviral and immunomodulatory activities, and its therapeutic effectiveness makes it a promising add-on therapy for COVID-19. In addition, vitamin D3 has an immunomodulatory role, but the effect of therapeutic vitamin D3 supplementation in SARS-CoV-2 infection is still not well-known.Objective: This study aims to investigate the effects of Nigella sativa and vitamin D3 as single supplemental therapies and in combination on viral clearance indicated by a negative polymerase chain reaction and the alleviation of symptoms during the study follow-up duration of 14\u00a0days.Patients and Methods: The study design was an open-label randomized controlled clinical trial conducted at the Respiratory Hospital at the Kobry El Qobba Armed Forces Medical Complex. In total, 120 COVID-19 patients with mild to moderate symptoms were randomly assigned to four groups, with thirty patients each, as follows: Group 1 received an oral dose of 900\u00a0mg Nigella sativa through 450\u00a0mg soft gelatin capsules twice daily for two weeks; Group 2 received 2,000 IU of vitamin D3 through 1000-IU tablets given as two tablets, once daily; Group 3 received 900\u00a0mg of Nigella sativa and 2,000 IU of vitamin D3 in the same manner of dosing as in the previous groups; and Group 4 was the control group. All groups received standard therapy for COVID-19 infections and clinical management of COVID-19\u2019s clinical symptoms.Results: The Nigella sativa\u2013vitamin D3 combination in addition to the standard therapy for COVID-19 infections significantly contributed to the alleviation of most COVID-19 symptoms: 50% of patients were free of cough after 7\u00a0days, 70% showed an absence of fatigue after 4\u00a0days, 80% had no headache after 5\u00a0days, 90% were free of rhinorrhea after 7\u00a0days, and 86.7% of the patients had no dyspnea after 7\u00a0days. Moreover, patients in the four studied groups showed a reduced median temperature after 3\u00a0days of treatment. Negative results of the polymerase chain reaction (PCR) test recorded on the 7th and 14th\u00a0day of therapy were superior in the Nigella sativa and vitamin D3 combination arm compared to those of the other studied arms where the value of the odds ratio (OR) on the 7th\u00a0day was 0.13 with 95% CI: 0.03\u20130.45 and that of the 14th day was 0.09 with 95% CI: 0.02\u20130.3.Conclusion: The results of this study showed a promising therapeutic benefit of the administration of Nigella sativa and vitamin D3 combination in COVID-19 patients with mild to moderate symptoms. Additionally, the remarkable viral clearance in a short time interval and reduction in the severity and progression of symptoms recommended the use of this combination as an add-on therapy for the management of COVID-19 patients.Clinical Trial Registration:ClinicalTrials.gov, Identifier: NCT04981743. Coronavirus disease 2019 (COVID-19) is caused by a novel coronavirus known as severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2), which was recognized first in Wuhan City, China, and spread rapidly worldwide. As the illness spreads to new regions of the world, human understanding of its epidemiological characteristics is constantly changing; additionally, the full clinical presentation of COVID-19 is still not completely elucidated. It is well-known that the most common symptoms associated with COVID-19 are cough, fever, dyspnea, fatigue, anosmia, and headache, while some patients may suffer from a severe viral infection and weakened immune status with severe cytokine storms, pulmonary fibrosis, and multi-organ dysfunction that leads to death. Currently, the management of COVID-19 infections is mainly symptomatic, and new agents had been approved to treat COVID-19 infections including antiviral agents, such as remdesivir, baricitinib, and molnupiravir, and monoclonal antibodies such as tocilizumab and sotrovimab. However, these agents have many adverse effects, are relatively expensive, are not readily available, and require close monitoring .On the other hand, it is important to know that immune dysregulation and other factors such as immune dysfunction, old age, obesity, diabetes, stress, and depression have been shown to be the main leading cause of exacerbation of COVID-19 symptoms and increased mortality . Since tThe use of medicinal plants and their bioactive ingredients is considered a reasonable alternative therapy for a wide range of diseases, including cardiovascular diseases such as hypertension, coronary arterial disease, peripheral arterial, and cerebrovascular diseases ; brain iRecently, there has been an interest toward the consumption of botanical medicines, which may have antiviral, anti-inflammatory, and immunomodulatory effects  as the uGlycyrrhiza, Zingiber, cassia, and Nigella sativa  into their healthcare protocols, with a significant number of individuals using CAM interventions to improve immunity and prevent acute COVID-19 infection . Accordia sativa . In addia sativa .Nigella sativa, a widely used medicinal plant of the family Ranunculaceae and commonly known as black cumin/kalonji, has been traditionally consumed for the treatment of constitutional symptoms associated with respiratory viral infections, including fever, cough, bronchitis, and shortness of breath, in addition to its role in the management of a variety of acute and chronic conditions, including skin allergy, rheumatic pain and inflammation, hypertension, diabetes, liver diseases, mental disorder, anorexia, insomnia, and dysmenorrhea  of SARS-CoV-2 .The study protocol was approved by the Ethics Committee, Faculty of Pharmacy, Ain Shams University, registered at the Egyptian Ministry of Health (MOH). Written informed consent was obtained from each patient before enrollment in the study without any obligations to complete the study if they did not want to. All aspects of this study followed the ethical standards of the Declaration of Helsinki . The stuPatient recruitment was conducted according to the inclusion and exclusion criteria set in the study design before starting. Accordingly, 120 SARS2-CoV-2 polymerase chain reaction (PCR)-positive patients who fulfilled the inclusion criteria were included in the study. The inclusion criteria were as follows: age 18\u201365\u00a0years and patients with mild to moderate COVID-19 symptoms according to the classification of Patients were excluded from the study for any of the following criteria: severe illness requiring admission to the intensive care unit; asymptomatic chronic kidney disease ; end-stage renal disease requiring dialysis; severe chronic liver disease ; and contraindications or allergy to any of the interventional drugs, pregnancy, and breastfeeding.Nigella sativa  in the form of soft gelatin capsules containing 450\u00a0mg, given as two capsules twice daily for two weeks  in the form of 1000-IU tablets given as two tablets, once daily, in addition to the standard therapy. Group (3) patients received 900\u00a0mg of Nigella sativa and 2000 IU of vitamin D3 in the same manner of dosing as in the previous groups in addition to the standard therapy. In Group 4), which is the control group, patients received the standard therapy of COVID-19  patients received a total oral dose of 900\u00a0mg wo weeks  in additCOVID-19 , which wCOVID-19 .The main outcomes and primary endpoint of this study were both the viral clearance indicated by a negative polymerase chain reaction (PCR) and the alleviation of symptoms during the study follow-up duration of 14\u00a0days.Patients\u2019 clinical symptoms were evaluated daily, and they underwent PCR on the 7th and 14th day of therapy. If any of the patients tested negative on day 7, they were considered to have been cleared of the virus, the 14th day PCR test was not performed, and further follow-up was deferred. However, if the patient tested gave a positive PCR result, follow-up was continued until the PCR test on day 14 was done, and if negative, patients were again considered to have been cleared of the virus. However, if still positive at day 14, patients continued on standard care therapy with neither further administration of the interventional therapy nor follow-up.2), hemoglobin levels, total leukocytic count, lymphocyte count, and serum ferritin, were recorded at baseline and on the 7th day of therapy. A computed tomography (CT) scan was done at baseline to assess the severity of pneumonia evidenced by ground-glass opacity.The clinical response to therapy was denoted by a significant reduction of fever on day 3, reduction of fatigue on day 4, relief from headache on day 5, absence of rhinorrhea and dyspnea on day 7, and improvement of cough from productive to dry/absent or from dry to absent on day 7. Additionally, laboratory findings, including C-reactive protein (CRP), oxygen saturation . A total of 70 patients were males (58.3%), of which four patients were diabetic, 10 patients were hypertensive, and one patient was a smoker. Patient demographics and baseline characteristics are shown in Nigella sativa alone or the Nigella sativa\u2013vitamin D3 combination showed a significantly higher ferritin level and lower lymphocyte count at baseline  had a significantly higher prevalence of headache . Regardibaseline .Regarding the improvement of the signs and symptoms at the end of the study among the studied groups, the data showed that groups 1, 2, and 3 had reduced severity of cough, diarrhea, fatigue, and pharyngitis compared to Group 4 (the control group). However, the four treatment arms showed non-significant improvement in headache, rhinorrhea, anosmia, shortness of breath (SOB), ageusia, and vomiting, while there was a significant virological response on days 7 and 14 post-treatment .Nigella sativa independently reduced the odds of worsening cough , odds of post-treatment fatigue , and anosmia . On the other hand, vitamin D3 had no significant impact on any symptom post-treatment. However, the Nigella sativa\u2013vitamin D3 combination showed a reduction in the severity of cough  similar to that of the Nigella sativa group . Moreover, It was clear from the results shown in Nigella sativa group) and Group 3 (vitamin D3 group) showed an increase in lymphocyte counts at the end of the study period. Moreover, the impact of treatments on the patient\u2019s vital signs showed a comparable reduction in body temperature approaching normal level among the four arms of the study. Interestingly, Group 4, who received Nigella sativa were evaluated daily\u2013vitamin D3 combination, showed a significant improvement in post-treatment oxygen saturation compared to the other studied groups.Considering the results presented in Nigella sativa alone and the Nigella sativa\u2013vitamin D3 combination significantly reduced the odds of positive PCR at day 7 with odds ratios (OR) = 0.15 and 0.13, with 95% confidence interval (95% CI) = 0.04\u20130.51 and 0.03\u20130.45, respectively. However, only the combination significantly reduced the odds of a positive PCR at day 14 post-treatment , and this is evident in The data presented in Nigella sativa) showed an increase in values of lymphocytes by an average of 327 \u00d7 103/\u00b5L and a decrease in the temperature by 0.53\u00b0C compared to Group 1 (controls). In addition, it was apparent that Group 3 (vitamin D3) showed an increase in the total leukocyte count (TLC) by 1.17 \u00d7 103/\u00b5L and lymphocytes by 137/\u00b5L, and the temperature reduced by only 0.44\u00b0C at the end of the study. Conversely, vitamin D3 (Group 3) was correlated with a modest decrease in oxygen saturation by 1.48%. Finally, Group 4 (Nigella sativa and vitamin D3 combination) showed a decrease in ferritin levels by 49.2\u00a0ng/ml, an increase in lymphocytes by an average of 249/\u00b5L, and a decrease in body temperature by 0.56\u00b0C.It is clear from the results presented in Nigella sativa and vitamin D3 might be a promising strategy in the management of COVID-19.Despite the development of different vaccines from Moderna and Pfizer-BioNTech and new drugs such as remdesivir and its combination with repurposed drugs such as chloroquine, hydroxychloroquine , and iveGlobally, there is increasing use of herbal medicines and natural supplements due to the belief that they are always safe and carry no risk because they are from natural sources . Herbal Nigella sativa, with or without vitamin D3, as add-on therapy in the management of COVID-19 was superior to the standard therapy alone or the standard therapy with vitamin D3 in terms of early viral clearance and alleviation of signs, symptoms, and the laboratory parameters relevant to COVID-19. It is worth mentioning that the present study is the first of its kind in terms of study design, investigational agents, and comparator groups.In the current study, it was found that the administration of Nigella sativa\u2013vitamin D3 combination group (Group 4) compared to other groups, evidenced by the significant alleviation of COVID-19 signs and symptoms as follows: 50% of patients were free of cough after 7\u00a0days, 70% of patients did not have fatigue after 4\u00a0days, 80% of patients were relieved of headache after 5\u00a0days, 90% of patients showed no rhinorrhea after 7\u00a0days, 86.7% of patients had no dyspnea after 7\u00a0days, the median temperature reduced after 3\u00a0days of treatment, and the proportion of negative results of the polymerase chain reaction test on the 7th and 14th\u00a0day of therapy compared to the other three studied groups was high. These results suggested the superiority of the combination, supported by faster viral clearance through the inhibition of TANK-binding kinase 1 (TBK1), together with the downregulation of the interferon regulatory factor 3 (IRF-3) activation, which has a critical role in viral and bacterial innate immune responses through regulation of type I interferon production  , where iIt is worth mentioning that the findings of the current study were in accordance with those presented by The current study has certain limitations, which are as follows: the evaluation of the effect of vitamin D3 through measurement of serum level of [25(OH)D] levels was not performed and was totally based on the clinical outcome of the patients. Additionally, the polymerase chain reaction test (PCR) was conducted at baseline and after 7 days of treatment only, which was not repeated on day 14 of the study except in the positive cases only in the current study.Nigella sativa and vitamin D3, and to the best of our knowledge, no study has evaluated the effect of this combination up to date. The therapeutic benefits of administration of the Nigella sativa\u2013vitamin D3 combination as an add-on therapy were superior to using each of them separately, which was evidenced by the remarkable viral clearance in a shorter time interval accompanied by a reduction in the severity and progression of patients\u2019 signs and symptoms. Thus, it is recommended to use the Nigella sativa\u2013vitamin D3 combination as add-on therapy in the management of hospitalized COVID-19 patients and in-home isolated patients.The current work confirms the clinical benefits of"}
+{"text": "Drosophila larvae become more complex when the larvae are reared on a low-yeast diet compared to a high-yeast diet. Our systematic search for key nutrients revealed that the neurons increase their dendritic terminal densities in response to a combined deficiency in vitamins, metal ions, and cholesterol. The deficiency of these nutrients upregulates Wingless in a closely located tissue, body wall muscle. Muscle-derived Wingless activates Akt in the neurons through the receptor tyrosine kinase Ror, which promotes the dendrite branching. In larval muscles, the expression of wingless is regulated not only in this key nutrient-dependent manner, but also by the JAK/STAT signaling pathway. Additionally, the low-yeast diet blunts neuronal light responsiveness and light avoidance behavior, which may help larvae optimize their survival strategies under low-nutritional conditions. Together, our studies illustrate how the availability of specific nutrients affects neuronal development through inter-organ signaling.Nutrition in early life has profound effects on an organism, altering processes such as organogenesis. However, little is known about how specific nutrients affect neuronal development. Dendrites of class IV dendritic arborization neurons in  The physiological state of an organism influences organogenesis throughout the body. Among many external factors affecting the physiological state, nutrition in early life has a profound impact . This isDietary nutrients are absorbed by the digestive tract and circulated throughout the body, and they are sensed by organs including the nervous system . Those oDrosophila class IV dendritic arborization (C4da) neuron located in the larval periphery  compared to a high-yeast diet (HYD) due to a concurrent deficiency in vitamins, metal ions, and cholesterol. We then identified an extrinsic factor and an intracellular signaling axis that jointly enable C4da neurons to respond to the LYD nutritional status. On LYD, Akt and its upstream receptor tyrosine kinase Ror in the neuron are required for the hyperarborization. In a paracrine fashion, Wingless (Wg) produced by body wall muscles activates Akt by way of Ror and contributes to the hyperarborization. In muscles of larvae on the HYD, Stat92E, a transcription factor in the JAK/STAT pathway, was more highly expressed and negatively regulated Our analysis using the software program called DeTerm established that both the number of branch terminals per neuron and the density of terminals  were higher on LYD than on HYD . In addiDrosophila laboratory foods, and it has been primarily considered as a source of amino acids. We suspected the possibility that LYD is deficient in amino acids and that is the cause of the phenotype. Therefore, we first examined whether supplementation of LYD with amino acids would ameliorate the hyperarborization. However, the addition of an essential amino acid solution, an amino acid mix, or peptone resulted in only slight or no restoration of the phenotype  of any of these factors would affect this diet-selective phenotype . To idenAkt kinase (Akt) KD in one of the RNAi lines, which impacted hyperarborization but left overall dendritic architecture relatively intact  or Ribosomal protein S6 kinase (S6k) also ameliorated the phenotype  and dendrite length/area on each diet , Wnt2, Wnt4, or Wnt5 in either of the two tissues adjacent to C4da neurons: epidermal cells and muscles. We observed that wg KD in muscles using either Mhc-GAL4 or mef2-GAL4 suppressed the hyperarborization phenotype  and C4da neurons. This showed that Ror, a seven-pass transmembrane receptor Frizzled (Fz), and downstream components including Disheveled (Dsh) and Axin (Axn) are required for dendrite regeneration , or expression of a dominant-negative form of Bsk also significantly blunted the hyperarborization  and class III da (C3da) neurons function in proprioception and gentle-touch sensation, respectively  encoding JAK in muscles promoted hyperarborization of C4da neurons in larvae reared on HYD .Given that Wg expression in muscles is higher on LYD , and thethan LYD . Also innal disc . We usednal disc  and founnal disc . We therd on HYD . In contn on LYD . These rupd2, but not upd or upd3, in the fat body and hemocytes resulted in an increased terminal density on HYD \u2013muscle inter-organ communication through a Upd2-Stat92E pathway in suppressing the hyperarborization phenotype on HYD. To address whether the key nutrients  increase Stat92E expression in muscles, we examined the reporter expression on LYD supplemented with or without VMC. However, the addition of VMC to LYD did not increase the signal intensity of the Stat92E reporter (data not shown). This result contrasts with the decreased level of Wg in response to the key nutrients  in GABAergic neurons in the adult brain, which project onto insulin producing cells (IPCs), thereby regulating systemic growth in a nutritional-status-dependent manner . It has y on HYD . This efr hop KD  and that muscles . EnhanceAi lines  . Althouutrients . The Sta and LYD . ConsideDrosophila larvae prefer dark places to avoid noxious light, and this light avoidance behavior requires the activity of C4da neurons  and inhibit the release of Dilps , glucose (Wako 049\u201331165), sucrose (Wako 196\u201300015), peptone (Fluka 82303), and agar (Matsuki Kanten). The complete compositions of these diets can be found in We cooked the high yeast diet (HYD) or low yeast diet (LYD) based on semidefined media (SDM) as described previously . The oriFor the supplementation with essential amino acid solution, we used 50 x MEM EAA solution (Wako 132\u201315641). Each fraction of holidic medium  other thImages of ddaC (C4da) or ddaF (C3da) neurons in A3\u2013A5 segments were acquired in live whole-mount larvae as described . Protocodilp8 overexpression experiment  for the secondary screening, in which we used only ppk-GAL4 because Gr28b.c-GAL4 is expressed in a small subset of neurons in the central nervous system in addition to C4da neurons in the peripheral nervous system  in PBS plus 0.05% Triton X-100 for 30 min, then washed three times in PBS plus 0.1% Triton X-100 (PBST). After blocking in PBST plus 2% bovine serum albumin for 30 min, primary antibodies listed in Key Resources Table were added, then incubated overnight at 4 \u00b0C. After three successive washes, secondary antibodies were added, then incubated for 1 hr at room temperature. Finally, samples were mounted using FluorSave Reagent . Most of the images were acquired with a Nikon C1 laser scanning confocal microscope coupled to a Nikon Eclipse E-800 microscope. The images in Dissected wandering 3wg-GAL4, the signal intensity inside nuclei that were identified by DAPI signals was measured. Then, the values from 2 to 7 nuclei in each muscle were averaged. For quantification of p-Akt levels in cell bodies of C4da ddaC, C1da ddaE or C3da ddaF neurons, we selected the single section containing the strongest signal in the neurons and measured signal intensities inside a 1.7 \u03bcm square ROI located on the abdominal side of nuclei of the neurons. However, for the quantification in ddaF neurons, the ROI was placed on the ventral side of nuclei only when we could not identify the border between ddaF and ddaC.To quantify signal levels in muscle, we made Z-stack images and chose muscle 9, one of the closest muscles to ddaC, for measuring the signal intensity. For quantification of Wg or 10 x Stat-GFP signals, we measured the signal intensity inside a 19 \u03bcm or a 27 \u03bcm square ROI, respectively. Three ROIs were drawn for each muscle, and the average value was calculated. For quantification of RedStinger driven by 2 power was projected onto larvae for 5 s. The light spot was 1.5 mm in diameter. Peristimulus time histograms were calculated at 250 ms bins. The mean spontaneous firing frequencies were quantified in the 20 s window preceding the light stimuli. The mean firing frequencies during the light stimulation were quantified in the 5 s entire window. The firing changes were calculated by subtracting the mean spontaneous firing rate from the light-evoked one (Change amount) or using a ratio of the mean spontaneous firing rate divided by the mean light-evoked one (Change rate).Extracellular single-unit recordings in wandering 3rd instar larvae were performed as previously described . We record instar larvae one day before they start wandering. We prepared 2% agar plate with a lid half of which was covered with black tape and 20 larvae were placed along the junction between light and dark sides. After the plates were illuminated for 15 min with white LED light  at 700 lux, the number of larvae in both dark and light areas were counted. In some trials, one or two larvae dug into the agar. Such larvae were excluded from calculation of dark preference index. For the assay of wandering larvae, two opposed plastic tubes were joined by transparent scotch tape and one of the vials was covered with black tape. After 16 wandering larvae reared on HYD or LYD were put near the junction of the tubes, they were illuminated by the 700 lux light for 15 min, then the number of larvae in both dark and light areas were counted. Dark preference index was calculated as follows:Light/dark choice assays were performed as previously described with modifications . For theProtocols for sample preparation and data analysis of RNA-seq were essentially as described in P<0.05 were considered statistically different. Student\u2019s t-test or the Wilcoxon-Mann-Whitney test was used for two-group comparisons, and Dunnett\u2019s test, Steel test, or Steel-Dwass tests were used for multiple comparisons. We used two-way analysis of variance (ANOVA) to analyze interactive effects between genotype and diet. On the other hand, we used the two-group comparison tests (Student\u2019s t-test or the Wilcoxon-Mann-Whitney test) when we simply focused on whether a genetic manipulation itself affected dendrite branching on the same diet. Statistical tests used, the exact sample size (n), and p values are shown in R (R Core Team) was used for stastical analysis. Values of  Nutrition profoundly affects neural development. The Uemura lab previously reported that C4da neurons elaborate complex dendrites when larvae grow on low-yeast diets, a phenomenon called neural sparing. In the current study, they define the molecular mechanism underlying the nutrition-mediated phenomenon and identify that the inter-organ Wingless/Ror/Akt pathway between the neuron and its adjacent muscles is necessary and sufficient to mediate dendrite over-branching in the low-yeast condition. public reviews designed to be posted alongside the preprint for the benefit of readers; (ii) feedback on the manuscript for the authors, including requests for revisions, shown below. We also include an acceptance summary that explains what the editors found interesting or important about the work.Our editorial process produces two outputs: (i) Decision letter after peer review:eLife. Your article has been reviewed by 3 peer reviewers, and the evaluation has been overseen by a Reviewing Editor and K VijayRaghavan as the Senior Editor. The following individuals involved in the review of your submission have agreed to reveal their identities: Fengwei Yu (Reviewer #1); Cheng-Ting Chien (Reviewer #2).Thank you for submitting your article \"Inter-organ Wingless/Ror/Akt signaling regulates nutrient-dependent hype-arborization of somatosensory neurons\" for consideration by The reviewers have discussed their reviews with one another, and the Reviewing Editor has drafted this to help you prepare a revised submission.Essential revisions:One of the reviewers has consolidated and summarized our consultations on the individual reviews. These are given below. Please attend to each concern while responding. Please all see the individual reviews below.1) Are Wg levels increased in muscles when Upd2, Dome, or stat93E KD is knocked down. Since wg transcription could be regulated in a complex way, the Dome/JAK/STAT pathway is likely insufficient to be the main or only regulator. This is also echoed by a result described in the Discussion that Stat92E was not elevated by VMC supplement in LYD. The authors should limit their description on the significance of these results such as the description in Abstract  and conclusion on lines 276-279 in Results. Also, they could include more discussion on the possibility of other pathways.2) Could authors compare the KD efficiency in two Akt RNAi lines (v2902 and BL33615) (or are they known in previous literature)? They also need to test the specificity of anti-Akt antibodies using these akt RNAi lines. Are anti-Akt signals gone when Akt is knocked down?3) Was the dendrite hyper-arborization phenotype also observed in other types of da neurons? Did you see similar pAkt upregulation in other da neurons (class I-III) under the condition of LYD diets? If the authors have the results, it should be very nice to demonstrate the general and significant effects of their findings and mechanism.4) The Akt mutant phenotype is quite different from the Ror mutant phenotype based on the images shown in Figure 2. It seems to affect more parameters of dendrite structure than Ror. The authors should elaborate on the phenotypic difference between Akt and Ror mutants, perhaps using different quantification approaches. It is therefore appears unlikely that Akt, which has a stronger and different phenotype from Ror, only mediates Ror signaling. Indeed, as the authors mentioned in the Discussion, Akt has previously been shown to regulate ddaC dendrite branching through signals from epithelial cells, and it has also been previously demonstrated, that, unlike Ror, Akt affects dendrite growth on standard diets . The only data that suggests that Ror functions upstream of Akt are the pAkt staining shown in Figure 4. The authors need to confirm the specificity of the Akt antibody. In addition, the authors should address this concern by modifying the model in the Discussion ).5) It looks like the major change for wg RNAi in muscle is a change in arbor area in LYD- indeed this often seems to drive or at least contribute to the phenotype (except in Akt loss). Is this because animals are overall larger? Since the arbors cover the body- is this increase in size related to overall size? If so, is the dendrite difference secondary to a much broader change in animal size? Are the same conclusions reached if a total number of terminals is shown?6) The issue of lengthened developmental time on LYD is problematic and not sufficiently addressed. In a previous study on this topic (Poe), the continued growth of ddaC neurons was interpreted as resilience to malnutrition and shown to be controlled by lower levels of a stress transcription factor, foxo, than in other cells. In this interpretation, the ddaC neurons just continue to grow at their normal pace while the overall development of the animal is slowed. How is this view reconciled with the current model? Which conditions change developmental timing in this study? Do any of the genetic manipulations rescue developmental speed- and if so, is dendrite architecture changing secondarily to this?7) In figure 6 \u2013 it would be helpful, if feasible speedily, to include Ror k/d in the electrophysiological assays. The behavioral assays look somewhat inconclusive in terms of whether Ror rescues the LYD phenotype.8) On page 9 the authors mentioned screening 20 RTKs. It would be helpful to include this data. Certainly, two others they include \u2013 InR and Alk \u2013 look like they have similar phenotypes to Ror and it would be helpful to know the specificity.9) There are two ways of statistics when manipulating gene activities (RNAi or OE) in HYD and LYD. Direct comparisons of two samples were used mostly in the main Figures , while \"difference in two differences\" were shown mainly for several Supplemental figures . It is not clear why the authors used two different ways. Are there specific reasons for doing so? Could not the direct comparisons of two samples (such as for main figures) could cope with descriptions in the text and easier to comprehend.Reviewer #1 (Recommendations for the authors):Nutrition profoundly affects neural development. The Uemura lab previously reported that C4da neurons elaborate complex dendrites when larvae grow on low-yeast diets, a phenomenon called neural sparing. In this current study, they elegantly show that vitamins, metal ions, and cholesterol, but not amino acids, are critical for these hyperaborization defects. They then define the molecular mechanism underlying the nutrition-mediated phenomenon. They identify that the Wingless/Ror/Akt pathway between the neuron and its adjacent muscles is necessary and sufficient to mediate dendrite over branching in the low-yeast condition. Moreover, they also identify a systematic Upd2-Stat92E pathway which is activated in muscles by the fat body. As a result, the low-yeast condition can unsensitized C4da neuron functions which may help larva to survive better under limited nutrition conditions. Overall, this is a comprehensive and important study that provides mechanistic insights into the question of how neurons over-branch in low-yeast diets. The experiments were well designed, and the results were properly interpreted. Most of the figures are well presented. Overall, this is an interesting and rigorously conducted study and the current version is ready to be published.Reviewer #2 (Recommendations for the authors):1. Akt knockdowns in two lines (v2902 and BL33615) display qualitative suppression of dendrite hyperarborization in Figure 2. In v2902 KD, while the dendritic arbor looks more normal in both HYD and LYD, the BL33615 KD showed quite a dramatic reduction even in HYD, and also in LYD, rendering both sets of data groups clustering on a distinct area , instead of in between two controls (HYD and LYD) such as in Figure 2G. While these two lines have been used before, I am wondering if the BL33615 has a stronger KD effect and if the basal Akt is necessary for a fundamental process in normal dendrite development (which is still preserved in the v2902 line), irrespective of nutrient condition. Could authors compare the KD efficiency in these two lines (or are they known in previous literature)?eLife. The experiment was performed at 29C to increase Wg expression, and the dendrite morphology was not normal. I am not asking for more experiments, but the authors could describe/explain what is the results at 25C instead of using 29C for readers not familiar with the approach? Have the authors tried using 2 copies of UAS-wg to increase wg expression at 25C?2. The wg signal derived from muscles is required for dendrite hyperarborization  is a very nice set of data, although the effect by overexpression of wg in muscle is limited in HYD . It could be due to further control such as from epidermal cells shown in Poe et al. (2020) 3. There are two ways of statistics used when manipulating gene activities (RNAi or OE) in HYD and LYD. Direct comparisons of two samples were used mostly in the main Figures , while \"difference in two differences\" were shown mainly for several Supplemental figures . It is not clear why the authors used two different ways. Are there specific reasons for doing so? I thought the direct comparisons of two samples (such as for main figures) could cope with descriptions in the text and be easier to comprehend.4. The RNAi KD effects of Dome/JAK/STAT pathway components on inducing dendrite hyperarborization in HYD are quite variable! Three Dome RNAi KDs had no effect and one stat92E KD had an effect while the other had not! What are the effects on Wg expressions in muscles with these genetic manipulations? Since wg transcription could be regulated in a complex way, the Dome/JAK/STAT pathway is likely insufficient to be the main or only regulator. This is also echoed by a result described in the Discussion that Stat92E was not elevated by VMC supplement in LYD. The authors should limit their description on the significance of these results such as the description in Abstract  and conclusion on lines 276-279 in Results. Also, they could include more discussion on the possibility of other pathways.JNK signaling tended to increase the branch density over the control genotype on HYD, which may consequently reduce the differences in densities of dendritic terminals between the diets.\" I do not quite understand the reasoning here why some increases in HYD in the KD may reduce the differences in LYD? The explanation in the Figure legend is not clear!5. (line 217-218) \"However, these results need careful interpretation \" From the legend \"However, knocking down dsh or blocking Reviewer #3 (Recommendations for the authors):The Akt phenotype is quite different from the Ror one based on the images shown in Figure 2. It looks like it causes a baseline phenotype in HYD, and overall seems to affect more parameters of dendrite structure than Ror. It is therefore unlikely that Akt, which has a stronger and different phenotype from Ror, is the downstream mediator of Ror signaling. Indeed, as the authors mention in the discussion, Akt has previously been shown to regulate ddaC dendrite branching through signals from epithelial cells, and it has also been previously demonstrated, that, unlike Ror, Akt affects dendrite growth on standard diets .In this study in the supplemental data, as well as in a previous study  (that interprets the overgrowth of ddaC neurons on LYD in a somewhat different way) InR has been shown to be important. It is not clear why it is dismissed in this study when it is much better established as a regulator of Akt than Ror.The fact that Ror and Akt are interpreted as having similar effects on dendrite growth makes me very concerned about the quantitation method used. It is somewhat opaque and also at times dismissed .The only data that suggests that Ror functions upstream of Akt are the phosphor-Akt staining shown in Figure 4. The antibody used is different from one previously used in da neurons in Parrish 2009 and looks like it is from a commercial source. With the recognition that much of the reproducibility crisis in science is due to poorly validated antibodies, it is essential to include key controls to validate this antibody- including loss of signal when Akt is knocked down. The differences in signal do not look particularly robust, for example when compared to those shown in Parrish 2009, and as the entire link between Ror and Akt rests on this data, it is imperative to be very sure that it is correct, and ideally do some additional experiments to determine whether Ror actually acts through Akt.I would also suggest considering an alternate model, which seems much more likely based on data in the supplement and previous data on Ror function in ddaC neurons. To promote branching during dendrite regeneration Ror functions through canonical Wnt signaling proteins including dsh and Axin , which these authors also show have branching phenotypes in their assay. This Ror function is part of a Wnt signaling pathway that controls microtubule nucleation and also includes arrow, fz, and fz2 . The failure to exhibit excess growth by Ror knockdown neurons in LYD seems likely to be related to the function of Ror in mediating microtubule nucleation in these cells.It looks like the major change for wg RNAi in muscle is a change in arbor area in LYD \u2013 indeed this often seems to drive or at least contribute to the phenotype (except in Akt loss). Is this because animals are overall larger? Since the arbors cover the body \u2013 is this increase in size related to overall size? If so, is the dendrite difference secondary to a much broader change in animal size? Are the same conclusions reached if the total number of terminals is shown?I do not understand why some of the results are dismissed, but others are not. For example: why do the dsh k/d and bskDN results in more careful interpretation than, say the fz2 or fz knockdown? The reason given is that there is a slight increase in branching in HYD, but it also looks like that might be the case in Ror mutants, while the opposite is seen in Ror k/d.There issue of lengthened developmental time on LYD is problematic and not sufficiently addressed. In a previous study on this topic (Poe), the continued growth of ddaC neurons was interpreted as resilience to malnutrition and shown to be controlled by lower levels of a stress transcription factor, foxo, than other cells. In this interpretation, the ddaC neurons just continue to grow at their normal pace while the overall development of the animal is slowed. How is this view reconciled with the current model? Which conditions change developmental timing in this study? Do any of the genetic manipulations rescue developmental speed- and if so, is dendrite architecture changing secondarily to this?Correct controls are needed for RNAi experiments. Control RNAis should be paired with other transgenes rather than no RNAis to control for Gal4 dilution by expression of multiple transgenes. For example, in Figure 4 myr-Akt is compared to Ror k/d + myr-Akt. Ror k/d + myr-Akt should be compared to control RNAi + myr-Akt.In Figure 4Supp1 it states in the legend that both fz and fz2 knockdown were different from control, but only fz2 is mentioned in the main text. In this figure, images are shown for an fz2 mutant, but no quantitation is shown.Figure 5 \u2013 data seems a little preliminary. It might be better to figure out the pathway in which Ror acts rather than add another piece.In figure 6 \u2013 it would be helpful to include Ror k/d in the electrophysiological assays. The behavioral assays look somewhat inconclusive in terms of whether Ror rescues the LYD phenotype. Essential revisions:One of the reviewers has consolidated and summarized our consultations on the individual reviews. These are given below. Please attend to each concern while responding. Please all see the individual reviews below.1) Are Wg levels increased in muscles when Upd2, Dome, or stat93E KD is knocked down. Since wg transcription could be regulated in a complex way, the Dome/JAK/STAT pathway is likely insufficient to be the main or only regulator. This is also echoed by a result described in the Discussion that Stat92E was not elevated by VMC supplement in LYD. The authors should limit their description on the significance of these results such as the description in Abstract  and conclusion on lines 276-279 in Results. Also, they could include more discussion on the possibility of other pathways.stat92E was knocked down in muscles, Wg increased on HYD; however, that increase was marginal  compared to the change in the amount of Wg between larvae on HYD and on LYD . Second, stat92E was not elevated by VMC supplementation on LYD (data not shown) as described in the Discussion in the original manuscript. Accordingly, we have followed the reviewers\u2019 advice, carefully limiting our interpretation of the results, and we discuss the possible contribution of the hypothetical signaling pathways in the Abstract (lines 23-27), Introduction (lines 105-108), Results (lines 338-347) and Discussion (lines 441-448), as well as our model .We agree with the reviewers that it is likely that signaling pathways other than the Dome/JAK/STAT could also contribute to downregulation of Wg on the high-yeast diet (HYD). This is because we conducted two experiments to address whether the Dome/JAK/STAT is a primary contributor to downregulating Wg on HYD, but the results were not supportive of such a possibility: First, when 2) Could authors compare the KD efficiency in two Akt RNAi lines (v2902 and BL33615) (or are they known in previous literature)? They also need to test the specificity of anti-Akt antibodies using these akt RNAi lines. Are anti-Akt signals gone when Akt is knocked down?Akt RNAi lines (v2902 and BL33615) and the specificity of the anti-phospho-Akt (Serine 473) antibody employed in our study . The KD efficiency in those RNAi lines and the specificity of the antibody have been documented in other developmental contexts in previously published literature. For example, when Akt is knocked down in the v2902 line, p-Akt signals are absent in the wing imaginal disc .The reviewers are requesting the KD efficiency in two We have performed additional experiments and evaluated the KD efficiency in the lines and the specificity of the antibody in the class IV da neuron ddaC as follows:1. p-Akt signals were significantly reduced in either the v2902 or BL33615 line .2. The KD efficiency differed between the two lines, which is consistent with the phenotypic differences. The BL33615 line, which gave more severe dendrite phenotypes , showed weaker p-Akt signals than v2902 .Science, 2002) in class IV da neurons, increased the signal level of p-Akt .3. Expression of myr-Akt, a constitutively activated membrane-anchored form of Akt .3) Was the dendrite hyper-arborization phenotype also observed in other types of da neurons? Did you see similar pAkt upregulation in other da neurons (class I-III) under the condition of LYD diets? If the authors have the results, it should be very nice to demonstrate the general and significant effects of their findings and mechanism.The reviewer is asking whether the hyperarborization phenotype and p-Akt upregulation are also observed in other classes of da neurons. We addressed this question by performing additional quantitative data analyses in class I and III da neurons:Genes to Cells, 2017). We quantified p-Akt levels in class I da neuron ddaE and found that the p-Akt level showed no significant difference between HYD and LYD .1. We previously reported that the hyperarborization phenotype is not seen in class I da neurons, ddaD and ddaE , much like class IV da neurons.eLife, 2020), which examined dendrite morphologies , raising the possibility that the Akt-driven branching mechanism in response to the low-nutrient condition in class IV da neurons is shared by other classes of da neurons, including class III. We described and discussed these results in our revised manuscript (lines 288-300 in Results).Our results are consistent with a previous study  The Akt mutant phenotype is quite different from the Ror mutant phenotype based on the images shown in Figure 2. It seems to affect more parameters of dendrite structure than Ror. The authors should elaborate on the phenotypic difference between Akt and Ror mutants, perhaps using different quantification approaches. It is therefore appears unlikely that Akt, which has a stronger and different phenotype from Ror, only mediates Ror signaling. Indeed, as the authors mentioned in the Discussion, Akt has previously been shown to regulate ddaC dendrite branching through signals from epithelial cells, and it has also been previously demonstrated, that, unlike Ror, Akt affects dendrite growth on standard diets . The only data that suggests that Ror functions upstream of Akt are the pAkt staining shown in Figure 4. The authors need to confirm the specificity of the Akt antibody. In addition, the authors should address this concern by modifying the model in the Discussion ).Akt-knocked down phenotype is quite different from the Ror-knocked down or mutant phenotype  and gave helpful suggestions. Before explaining our additional analysis on this matter, we addressed the specificity of the p-Akt antibody in class IV da neurons and the differential KD efficiency in two Akt RNAi lines in our response to Essential Revisions 2, and we have consolidated our model where Ror functions upstream of Akt .The reviewers pointed out that the Akt KD and Ror KD, we followed the reviewers\u2019 advice and introduced a different quantification approach. In addition to dendrite \u201cbranching,\u201d we evaluated \u201celongation\u201d in our revised manuscript . We measured the total length of branches per neuron (dendrite length) and also divided the total length by the arbor size (dendrite length/area). Box plots of dendrite length/area  and that of terminal number/area  showed obvious \u201chyperelongation\u201d as well as \u201chyperarborization\u201d of the control class IV da neuron on LYD compared to HYD. In addition to the box plots, we drew two-dimensional plots with the dendritic area on the X-axis and the dendrite length on the Y-axis , which showed that the numerical features of dendrite length of the control neurons on HYD and those on LYD were clearly separated .To elaborate the phenotypic difference between Akt KD in the BL33615 line severely impaired both elongation  and branching , irrespective of the diets. On the other hand, Akt KD in the v2902 line mildly affected the hyperelongation phenotype ; and it did ameliorate hyperarborization on LYD . These results indicate that the basal activity of Akt is required for both elongation and branching on HYD and LYD , which is consistent with a previous report that demonstrated the requirement of Akt for the regulation of dendritic morphology of class IV da neurons on standard laboratory food .Compared to the control neurons, strong Ror KD or a Ror mutation blunted both elongation and branching only on LYD ; and (2) the diet-dependent phenotype of the mild Akt KD by the v2902 line was partly similar to the Ror KD or mutant phenotype. Together with the evidence for the function of Ror upstream of Akt , our result reinforces the proposed role of the Ror/Akt signaling pathway in response to LYD. We have drawn diagrams of how the signaling pathway is working or defective and how it affects dendrite branching as well as elongation under individual genetic and dietary conditions . Our model underscores the notion that Akt mediates signaling from multiple upstream receptors, including Ror. We also revised the text throughout the manuscript  and Figure 7.Our critical findings are: (1) Regarding questions related to the function of Ror in mediating microtubule nucleation and the possibility of integrating InR and AlK in the pathway, please see our detailed responses to major points 2, 5, and 7 of reviewer #3.5) It looks like the major change for wg RNAi in muscle is a change in arbor area in LYD- indeed this often seems to drive or at least contribute to the phenotype (except in Akt loss). Is this because animals are overall larger? Since the arbors cover the body- is this increase in size related to overall size? If so, is the dendrite difference secondary to a much broader change in animal size? Are the same conclusions reached if a total number of terminals is shown?wg knockdown in muscle may be a secondary effect of an increase in arbor size or larval body size . We did not measure larval body size and cannot answer whether the wg knocked down larvae were bigger than control larvae on LYD. However, we believe that the suppression of hyperarborization by wg knockdown was not a secondary effect of the increased body size, for the following reasons:The reviewers are concerned about the possibility that the suppression of hyperarborization by wg was knocked down in muscles on LYD, its ellipse  shifted closer to or overlapped with ellipses of the larvae on HYD . This result suggests that wg RNAi in muscles blunted the hyperarborization phenotype despite the increase in the dendritic area.1. As mentioned in the legend for Figure 1, 2D-plots of the control larvae, such as Figure 1F, show (1) a positive correlation between the area of the dendritic field and the number of branch terminals, and (2) a clear separation of 95% confidence ellipses of the numerical values between HYD and LYD (compare the blue ellipse with the red one). Therefore, instead of simply comparing the number of branch terminals between the diets, we focused on changes in the density of terminals  and how far the pair of red and blue ellipses are separated in the 2D plot  to evaluate the hyperarborization phenotypes. When wg knockdown using another muscle GAL4 driver  and wg hypomorphic mutations . The distribution of the arbor size on LYD was not much affected, neither by the knockdown nor the mutation ; and again, the ellipse of the knockdown or the mutant larvae shifted closer to or overlapped with those of larvae on HYD . Together with the box plots of the terminal number/area , our results strongly suggest that reduced function of wg attenuates the hyperarborization phenotype without causally changing the body size.2. We also analyzed the effects of 6) The issue of lengthened developmental time on LYD is problematic and not sufficiently addressed. In a previous study on this topic (Poe), the continued growth of ddaC neurons was interpreted as resilience to malnutrition and shown to be controlled by lower levels of a stress transcription factor, foxo, than in other cells. In this interpretation, the ddaC neurons just continue to grow at their normal pace while the overall development of the animal is slowed. How is this view reconciled with the current model? Which conditions change developmental timing in this study? Do any of the genetic manipulations rescue developmental speed- and if so, is dendrite architecture changing secondarily to this?The reviewers are concerned about the effect of the lengthened developmental time on LYD on dendrite architecture. The critical question is whether the hyperaborization phenotype is a secondary consequence of the longer larval stage on LYD than that on HYD. We gathered three lines of evidence against this possibility, which consist of the data already shown in the original submission and new data from two additional experiments. We explain each in the details below and also in the revised manuscript.Ror KD , a Ror mutation , wg KD in muscles  or wg mutations  blunted the hyperarborization phenotype compared to that of the WT dendritic arbors. These results indicate that our dietary or genetic interventions ameliorated hyperarborization without changing the developmental timing on LYD.1. As stated in the original manuscript, we collected wandering 3rd instar larvae and imaged class IV da neurons as scheduled throughout our dietary or genetic interventions (6-7 days after egg laying (AEL) on HYD and 9-10 days AEL on LYD or LYD plus supplements; Figure 1\u2014figure supplement 1A). On LYD plus any combinations of nutrients, larval developmental timings were essentially the same as for LYD; nonetheless, the hyperarborization phenotype was blunted on LYD+VMC(O) . Moreover, throughout the testing of control genotypes and all genetic interventions, the timings on LYD were similarly longer than those on HYD; notwithstanding, Dis Model Mech, 2011), the latter of which delays larval development, and we reported that the hyperarborization is not observed between those diets . We have now expanded this approach and analyzed the effect of the sugar overload on the arborization in a quantitative manner . The larval stage was longer on HYD supplemented with excess sucrose (HYD + sucrose) than on HYD; however, the dendritic arbors of class IV da neurons did not become more complex . Thus, we showed that an increase in the amount of sucrose in HYD, which extended larval development, was not associated with hyperarborization.2. As briefly stated in the Introduction in the original version of the manuscript, we previously compared dendrite morphologies between a low-sugar diet and a high-sugar diet , which may complicate the matters in solving our key question. We therefore chose dlip8 expression in wing imaginal discs, which is sufficient to extend the larval stage with a minimum effect on body growth . This genetic intervention caused a mild delay in larval development, but it was not associated with hyperarborization , providing an additional piece of evidence allaying the concern about the effect of the lengthened developmental time on dendrite complexity.3. Finally, we addressed whether any of the genetic manipulations that cause larval developmental delay are associated with an increase in dendrite complexity on a standard diet or not. Many genetic manipulations are reported to cause developmental delays; however, most of those also result in large increases in the body size  In figure 6 \u2013 it would be helpful, if feasible speedily, to include Ror k/d in the electrophysiological assays. The behavioral assays look somewhat inconclusive in terms of whether Ror rescues the LYD phenotype.We appreciate the reviewer\u2019s advice. Unfortunately, it has been difficult to rapidly conduct electrophysiological assays using larvae of multiple genotypes on different diets, due to limited human resources and access to apparatuses that must be shared by many other projects in the lab. As discussed in the original submission and also in the revised version, the identification of the downstream circuits would allow further studies, including electrophysiological analysis along the circuit, but this is beyond the scope of the present study.8) On page 9 the authors mentioned screening 20 RTKs. It would be helpful to include this data. Certainly, two others they include \u2013 InR and Alk \u2013 look like they have similar phenotypes to Ror and it would be helpful to know the specificity.Gr28b.c-GAL4 and ppk-GAL4 together. We acquired images of 3-8 knocked-down neurons for each gene on each diet, and then visually judged whether hyperarborization was blunted or not. We selected nine genes  for the secondary screening, in which we used ppk-GAL4 only, because Gr28b.c-GAL4 is expressed in a small subset of neurons in the central nervous system in addition to class IV da neurons in the peripheral nervous system . Screening the 20 RTK genes is described in a new section in Materials and Methods in the revised manuscript (lines 542-550).Thank you for the suggestion. Supplementary file 2 lists the names of the 20 RTK genes, stock numbers of RNAi lines, GAL4 drivers, and effects of individual RNAi lines. We conducted two rounds of screening. In the primary screening, we intended to enhance the knockdown efficacy and used InR and Alk and data for the secondary screening of htl), and Figure 2\u2014figure supplement 6 . Regarding the KD data for InR or Alk, see our explanations and interpretations in the response to point 2 of reviewer #3.Representative images for each gene knockdown are shown in Figure 2\u2014figure supplement 4 (data for the primary screening of 18 genes), Figure 2\u2014figure supplement 5 (data for the primary and secondary screenings of 9) There are two ways of statistics when manipulating gene activities (RNAi or OE) in HYD and LYD. Direct comparisons of two samples were used mostly in the main Figures , while \"difference in two differences\" were shown mainly for several Supplemental figures . It is not clear why the authors used two different ways. Are there specific reasons for doing so? Could not the direct comparisons of two samples (such as for main figures) could cope with descriptions in the text and easier to comprehend.eLife, 2020), to test the interaction between the two variables: genotype and diet. When we first introduce 2-way ANOVA in the revised manuscript , we briefly explain why we needed to employ that particular statistical test (lines 162-168 in Results). The use of 2-way ANOVA is now also described in the Statistical Analysis section in Materials And Methods and in the figure legends.The hyperarborization phenotype is defined based on the difference in the terminal density between the two diets , we were interested in whether muscle-derived Wg promoted dendrite branching, not whether its effect varied according to the diets. We added this description to the Statistical Analysis section in Materials And Methods.On the other hand, when comparing the effects of genotypes under the same dietary conditions , we simply focused on whether a genetic manipulation itself affected dendrite branching. For example, in the Reviewer #2 (Recommendations for the authors):1. Akt knockdowns in two lines (v2902 and BL33615) display qualitative suppression of dendrite hyperarborization in Figure 2. In v2902 KD, while the dendritic arbor looks more normal in both HYD and LYD, the BL33615 KD showed quite a dramatic reduction even in HYD, and also in LYD, rendering both sets of data groups clustering on a distinct area , instead of in between two controls (HYD and LYD) such as in Figure 2G. While these two lines have been used before, I am wondering if the BL33615 has a stronger KD effect and if the basal Akt is necessary for a fundamental process in normal dendrite development (which is still preserved in the v2902 line), irrespective of nutrient condition. Could authors compare the KD efficiency in these two lines (or are they known in previous literature)?We thank for the reviewer\u2019s important suggestion and addressed this point as described in Essential revision 2\uff1aAkt RNAi lines (v2902 and BL33615) and the specificity of the anti-phospho-Akt (Serine 473) antibody employed in our study . The KD efficiency in those RNAi lines and the specificity of the antibody have been documented in other developmental contexts in previously published literature. For example, when Akt is knocked down in the v2902 line, p-Akt signals are absent in the wing imaginal disc .The reviewers are requesting the KD efficiency in two We have performed additional experiments and evaluated the KD efficiency in the lines and the specificity of the antibody in the class IV da neuron ddaC as follows:1. p-Akt signals were significantly reduced in either the v2902 or BL33615 line .2. The KD efficiency differed between the two lines, which is consistent with the phenotypic differences. The BL33615 line, which gave more severe dendrite phenotypes , showed weaker p-Akt signals than v2902 .Science, 2002) in class IV da neurons, increased the signal level of p-Akt .3. Expression of myr-Akt, a constitutively activated membrane-anchored form of Akt .2. The wg signal derived from muscles is required for dendrite hyperarborization  is a very nice set of data, although the effect by overexpression of wg in muscle is limited in HYD . It could be due to further control such as from epidermal cells shown in Poe et al. (2020) eLife. The experiment was performed at 29C to increase Wg expression, and the dendrite morphology was not normal. I am not asking for more experiments, but the authors could describe/explain what is the results at 25C instead of using 29C for readers not familiar with the approach? Have the authors tried using 2 copies of UAS-wg to increase wg expression at 25C?wg overexpression in muscles on dendrite arborization and our experimental design . In addition to the overexpression at 29\u00b0C , we did perform the same experiment at 25\u00b0C and found that the dendrite density increased on HYD , which is now stated as such in the revised version (lines 1027-1029). However, we do not discuss how this occurs, because it could be due to a number of possibilities. For example, the wg overexpression might not override the regulation by the epidermis, as the reviewer implied. While it would be quite interesting to pursue, it is also beyond the scope of this study to unravel the mechanisms underlying the limited dendrite growth due to wg overexpression.As the reviewer pointed out, the increase in the dendrite density by 3. There are two ways of statistics used when manipulating gene activities (RNAi or OE) in HYD and LYD. Direct comparisons of two samples were used mostly in the main Figures , while \"difference in two differences\" were shown mainly for several Supplemental figures . It is not clear why the authors used two different ways. Are there specific reasons for doing so? I thought the direct comparisons of two samples (such as for main figures) could cope with descriptions in the text and be easier to comprehend.We addressed this point as described in Essential revision 9:eLife, 2020), to test the interaction between the two variables: genotype and diet. When we first introduce 2-way ANOVA in the revised manuscript , we briefly explain why we needed to employ that particular statistical test (lines 162-168 in Results). The use of 2-way ANOVA is now also described in the Statistical Analysis section in Materials And Methods and in the figure legends.The hyperarborization phenotype is defined based on the difference in the terminal density between the two diets , we were interested in whether muscle-derived Wg promoted dendrite branching, not whether its effect varied according to the diets. We added this description to the Statistical Analysis section in Materials And Methods.On the other hand, when comparing the effects of genotypes under the same dietary conditions , we simply focused on whether a genetic manipulation itself affected dendrite branching. For example, in the 4. The RNAi KD effects of Dome/JAK/STAT pathway components on inducing dendrite hyperarborization in HYD are quite variable! Three Dome RNAi KDs had no effect and one stat92E KD had an effect while the other had not! What are the effects on Wg expressions in muscles with these genetic manipulations? Since wg transcription could be regulated in a complex way, the Dome/JAK/STAT pathway is likely insufficient to be the main or only regulator. This is also echoed by a result described in the Discussion that Stat92E was not elevated by VMC supplement in LYD. The authors should limit their description on the significance of these results such as the description in Abstract  and conclusion on lines 276-279 in Results. Also, they could include more discussion on the possibility of other pathways.We described our response to this point in detail in Essential revision 1 and clarified the limited contribution of the JAK/STAT pathway in the revised version as the reviewer suggested.Stat92E knockdown in muscles in both of the two RNAi lines similarly resulted in enhanced dendritic branching on HYD . These results are consistent with our hypothesis that Stat92E negatively regulates wg in muscles, and consequently, branching of class IV da neurons on HYD. This enhanced branching was also seen with the knockdown of dome in one of the three RNAi lines , knockdown of hop , and knockdown of upd2 in both of the two RNA lines . Therefore, it seems reasonable to speculate that the Upd2- Stat92E pathway functions in suppressing the hyperarborization on HYD. However, we have no data to explain why only one out of the three dome RNAi lines promoted dendritic branching on HYD; thus, it will be necessary to verify the involvement of Dome in the future (lines 334-336 of the revised version).The reviewer stated \u201cThe RNAi KD effects of Dome/JAK/STAT pathway components on inducing dendrite hyperarborization in HYD are quite variable! Three Dome RNAi KDs had no effect and one stat92E KD had an effect while the other had not.\u201d This statement may stem from an unfortunate misunderstanding of our data. 5. (line 217-218) \"However, these results need careful interpretation \" From the legend \"However, knocking down dsh or blocking JNK signaling tended to increase the branch density over the control genotype on HYD, which may consequently reduce the differences in densities of dendritic terminals between the diets.\" I do not quite understand the reasoning here why some increases in HYD in the KD may reduce the differences in LYD? The explanation in the Figure legend is not clear!We addressed this concern in the revised manuscript, and offer our explanation, referring to Figure 4\u2014figure supplement 2, as follows:Ror function attenuated dendrite branching on LYD, while there were marginal effects on HYD . On the other hand, dsh knockdown or expression of a dominant-negative form of Bsk not only reduced dendrite branching on LYD but also increased dendritic branching on HYD . Given this phenotypic difference on HYD between Ror and dsh or bsk, we speculate that Dsh and Bsk may regulate dendrite branching through a different mechanism than the low-nutrient dependent Wg-Ror pathway. We therefore did not focus on these factors further in this study.In our studies, we focused on the difference in dendrite terminal density between the two diets (HYD and LYD) and pursued dietary and genetic interventions that blunted this hyperarborization :The Akt phenotype is quite different from the Ror one based on the images shown in Figure 2. It looks like it causes a baseline phenotype in HYD, and overall seems to affect more parameters of dendrite structure than Ror. It is therefore unlikely that Akt, which has a stronger and different phenotype from Ror, is the downstream mediator of Ror signaling. Indeed, as the authors mention in the discussion, Akt has previously been shown to regulate ddaC dendrite branching through signals from epithelial cells, and it has also been previously demonstrated, that, unlike Ror, Akt affects dendrite growth on standard diets .We thank the reviewer\u2019s insightful suggestion. We addressed this point as described in Essential revision 4:Akt-knocked down phenotype is quite different from the Ror-knocked down or mutant phenotype  and gave helpful suggestions. Before explaining our additional analysis on this matter, we addressed the specificity of the p-Akt antibody in class IV da neurons and the differential KD efficiency in two Akt RNAi lines in our response to Essential Revisions 2, and we have consolidated our model where Ror functions upstream of Akt .The reviewers pointed out that the Akt KD and Ror KD, we followed the reviewers\u2019 advice and introduced a different quantification approach. In addition to dendrite \u201cbranching,\u201d we evaluated \u201celongation\u201d in our revised manuscript . We measured the total length of branches per neuron (dendrite length) and also divided the total length by the arbor size (dendrite length/area). Box plots of dendrite length/area  and that of terminal number/area  showed obvious \u201chyperelongation\u201d as well as \u201chyperarborization\u201d of the control class IV da neuron on LYD compared to HYD. In addition to the box plots, we drew two-dimensional plots with the dendritic area on the X-axis and the dendrite length on the Y-axis , which showed that the numerical features of dendrite length of the control neurons on HYD and those on LYD were clearly separated .To elaborate the phenotypic difference between Akt KD in the BL33615 line severely impaired both elongation  and branching , irrespective of the diets. On the other hand, Akt KD in the v2902 line mildly affected the hyperelongation phenotype ; and it did ameliorate hyperarborization on LYD . These results indicate that the basal activity of Akt is required for both elongation and branching on HYD and LYD , which is consistent with a previous report that demonstrated the requirement of Akt for the regulation of dendritic morphology of class IV da neurons on standard laboratory food .Compared to the control neurons, strong Ror KD or a Ror mutation blunted both elongation and branching only on LYD ; and (2) the diet-dependent phenotype of the mild Akt KD by the v2902 line was partly similar to the Ror KD or mutant phenotype. Together with the evidence for the function of Ror upstream of Akt , our result reinforces the proposed role of the Ror/Akt signaling pathway in response to LYD. We have drawn diagrams of how the signaling pathway is working or defective and how it affects dendrite branching as well as elongation under individual genetic and dietary conditions . Our model underscores the notion that Akt mediates signaling from multiple upstream receptors, including Ror. We also revised the text throughout the manuscript  and Figure 7.Our critical findings are: (1) In this study in the supplemental data, as well as in a previous study  (that interprets the overgrowth of ddaC neurons on LYD in a somewhat different way) InR has been shown to be important. It is not clear why it is dismissed in this study when it is much better established as a regulator of Akt than Ror.For the following reasons, we focused on Ror, rather than InR or Alk, in this study. We have added a new Supplementary file 2 and Figure 2\u2014figure supplement 5.InR by one RNAi line, which was used in Poe et al., attenuated the hyperarborization phenotype , another RNAi line  had no significant effect on the phenotype . Therefore, we could not convincingly conclude that InR contributes to the low-nutrient dependent hyperarborization.1) As for InR, while knockdown of Alk knockdown in the primary screening (using ppk-GAL4 + Gr28b.c-GAL4) resulted in blunted hyperarborization. However, knockdown using 2 RNAi lines in the secondary screening (using ppk-GAL4) had no significant effect .2) Ror knockdown consistently suppressed the hyperarborization phenotype in both the primary and the secondary screening . Moreover, mutant analyses recapitulated the knockdown results . We therefore decided to investigate the Ror-mediated mechanism.3) On the other hand, Future studies will explore whether other RTKs including InR and Alk indeed function upstream of Akt in the context of the Wg/Ror/Akt signaling, and if so, how these various inputs are integrated by Akt. Accordingly, we modified the Result (lines 198-201), Discussion (lines 422-425) and our model .The fact that Ror and Akt are interpreted as having similar effects on dendrite growth makes me very concerned about the quantitation method used. It is somewhat opaque and also at times dismissed .Ror KD and the Akt KD, we followed the reviewers\u2019 advice  and evaluated dendrite \u201celongation\u201d in addition to \u201cbranching\u201d. As described in detail in our reply to Essential revision 4, this quantitative analysis revealed the phenotypic similarity between the Ror KD and the Akt mild KD.To elaborate the phenotypic differences and similarities between the The only data that suggests that Ror functions upstream of Akt are the phosphor-Akt staining shown in Figure 4. The antibody used is different from one previously used in da neurons in Parrish 2009 and looks like it is from a commercial source. With the recognition that much of the reproducibility crisis in science is due to poorly validated antibodies, it is essential to include key controls to validate this antibody- including loss of signal when Akt is knocked down. The differences in signal do not look particularly robust, for example when compared to those shown in Parrish 2009, and as the entire link between Ror and Akt rests on this data, it is imperative to be very sure that it is correct, and ideally do some additional experiments to determine whether Ror actually acts through Akt.Akt was knocked down by ptc-GAL4 . As described in detail in Essential revisions 2, we validated the specificity of the Cell Signaling antibody in class IV da neuron, ddaC. We believe that our immunostaining data for Ror knocked down neurons  and wg overexpressing larvae  convincingly indicate that Wg-Ror signaling regulates Akt activity in class IV da neurons.The antibody used in Parrish et al. (2009) was no longer commercially available, and we had no choice but to use a different product. We opted to use the anti-phospho-Akt antibody  because it was used in a previous study that showed clear reduction of the signal in the wing imaginal disc when I would also suggest considering an alternate model, which seems much more likely based on data in the supplement and previous data on Ror function in ddaC neurons. To promote branching during dendrite regeneration Ror functions through canonical Wnt signaling proteins including dsh and Axin , which these authors also show have branching phenotypes in their assay. This Ror function is part of a Wnt signaling pathway that controls microtubule nucleation and also includes arrow, fz, and fz2 . The failure to exhibit excess growth by Ror knockdown neurons in LYD seems likely to be related to the function of Ror in mediating microtubule nucleation in these cells.dsh or Axin appeared to blunt hyperarborization . However, we found a phenotypic difference between Ror knockdown and the knockdown of dsh or Axin, and consider that Dsh and Axin might regulate dendrite branching through a mechanism different from the low-nutrient dependent Wg-Ror pathway (see our reply to comment 7 below). We added this point to the Discussion (lines 415-418 in DISCUSSION).The reviewer suggests that the Ror-mediated microtubule nucleation mechanism  may contribute to the hyperarborization phenotype. This is because Knockdown of It looks like the major change for wg RNAi in muscle is a change in arbor area in LYD \u2013 indeed this often seems to drive or at least contribute to the phenotype (except in Akt loss). Is this because animals are overall larger? Since the arbors cover the body \u2013 is this increase in size related to overall size? If so, is the dendrite difference secondary to a much broader change in animal size? Are the same conclusions reached if the total number of terminals is shown?We addressed this point as described in Essential revision 5:wg knockdown in muscle may be a secondary effect of an increase in arbor size or larval body size . We did not measure larval body size and cannot answer whether the wg knocked down larvae were bigger than control larvae on LYD. However, we believe that the suppression of hyperarborization by wg knockdown was not a secondary effect of the increased body size, for the following reasons:The reviewers are concerned about the possibility that the suppression of hyperarborization by wg was knocked down in muscles on LYD, its ellipse  shifted closer to or overlapped with ellipses of the larvae on HYD . This result suggests that wg RNAi in muscles blunted the hyperarborization phenotype despite the increase in the dendritic area.1. As mentioned in the legend for Figure 1, 2D-plots of the control larvae, such as Figure 1F, show (1) a positive correlation between the area of the dendritic field and the number of branch terminals, and (2) a clear separation of 95% confidence ellipses of the numerical values between HYD and LYD (compare the blue ellipse with the red one). Therefore, instead of simply comparing the number of branch terminals between the diets, we focused on changes in the density of terminals  and how far the pair of red and blue ellipses are separated in the 2D plot  to evaluate the hyperarborization phenotypes. When wg knockdown using another muscle GAL4 driver  and wg hypomorphic mutations . The distribution of the arbor size on LYD was not much affected, neither by the knockdown nor the mutation ; and again, the ellipse of the knockdown or the mutant larvae shifted closer to or overlapped with those of larvae on HYD . Together with the box plots of the terminal number/area , our results strongly suggest that reduced function of wg attenuates the hyperarborization phenotype without causally changing the body size.2. We also analyzed the effects of I do not understand why some of the results are dismissed, but others are not. For example: why do the dsh k/d and bskDN results in more careful interpretation than, say the fz2 or fz knockdown? The reason given is that there is a slight increase in branching in HYD, but it also looks like that might be the case in Ror mutants, while the opposite is seen in Ror k/d.To address this concern, we added a brief description in the Results (lines 254-260), and we provide an explanation below in the figure legend (lines 1304-1311):Ror function attenuated dendrite branching on LYD, while there were marginal effects on HYD . On the other hand, dsh knockdown or expression of a dominant-negative form of Bsk not only reduced dendrite branching on LYD but also increased dendritic branching on HYD . This also appears to be the case with the Axin knockdown, although the effect was not statistically significant . Given this phenotypic difference on HYD between Ror and dsh, bsk, or Axin, we speculate that Dsh, Bsk and Axin might regulate the dendrite branching through a mechanism different from the low-nutrient dependent Wg-Ror pathway. We therefore did not focus on these factors further in this study.In our studies, we focused on the difference in dendrite terminal density between the two diets (HYD and LYD) and pursued dietary and genetic interventions that blunted this hyperarborization , the continued growth of ddaC neurons was interpreted as resilience to malnutrition and shown to be controlled by lower levels of a stress transcription factor, foxo, than other cells. In this interpretation, the ddaC neurons just continue to grow at their normal pace while the overall development of the animal is slowed. How is this view reconciled with the current model? Which conditions change developmental timing in this study? Do any of the genetic manipulations rescue developmental speed- and if so, is dendrite architecture changing secondarily to this?We understood that this reviewer\u2019s concern is very important, performed two additional experiments, and described our response in Essential revision 6:The reviewers are concerned about the effect of the lengthened developmental time on LYD on dendrite architecture. The critical question is whether the hyperaborization phenotype is a secondary consequence of the longer larval stage on LYD than that on HYD. We gathered three lines of evidence against this possibility, which consist of the data already shown in the original submission and new data from two additional experiments. We explain each in the details below and also in the revised manuscript.Ror KD , a Ror mutation , wg KD in muscles  or wg mutations  blunted the hyperarborization phenotype compared to that of the WT dendritic arbors. These results indicate that our dietary or genetic interventions ameliorated hyperarborization without changing the developmental timing on LYD.1. As stated in the original manuscript, we collected wandering 3rd instar larvae and imaged class IV da neurons as scheduled throughout our dietary or genetic interventions (6-7 days after egg laying (AEL) on HYD and 9-10 days AEL on LYD or LYD plus supplements; Figure 1\u2014figure supplement 1A). On LYD plus any combinations of nutrients, larval developmental timings were essentially the same as for LYD; nonetheless, the hyperarborization phenotype was blunted on LYD+VMC(O) . Moreover, throughout the testing of control genotypes and all genetic interventions, the timings on LYD were similarly longer than those on HYD; notwithstanding, Dis Model Mech, 2011), the latter of which delays larval development, and we reported that the hyperarborization is not observed between those diets . We have now expanded this approach and analyzed the effect of the sugar overload on the arborization in a quantitative manner . The larval stage was longer on HYD supplemented with excess sucrose (HYD + sucrose) than on HYD; however, the dendrites of class IV da neurons did not become more complex . Thus, we showed that an increase in the amount of sucrose in HYD, which extended larval development, was not associated with hyperarborization.2. As briefly stated in the Introduction in the original version of the manuscript, we previously compared dendrite morphologies between a low-sugar diet and a high-sugar diet , which may complicate the matters in solving our key question. We therefore chose dlip8 expression in wing imaginal discs, which is sufficient to extend the larval stage with a minimum effect on body growth . This genetic intervention caused a mild delay in larval development, but it was not associated with hyperarborization , providing an additional piece of evidence allaying the concern about the effect of the lengthened developmental time on dendrite complexity.3. Finally, we addressed whether any of the genetic manipulations that cause larval developmental delay are associated with an increase in dendrite complexity on a standard diet or not. Many genetic manipulations are reported to cause developmental delays; however, most of those also result in large increases in the body size  using correct controls, and totally replaced the previous data  with the new data . Fortunately, the results in the original version were recapitulated: Expression of myr-Akt in class IV da neurons increased the terminal density, regardless of whether In Figure 4Supp1 it states in the legend that both fz and fz2 knockdown were different from control, but only fz2 is mentioned in the main text. In this figure, images are shown for an fz2 mutant, but no quantitation is shown.fz KD experiment to the legend of Figure 4\u2014figure supplement 1 as follows:We added our interpretation of the fz2 KD neurons than fz KD neurons . Therefore, we mentioned only the result of fz2 knockdown in the main text. However, we do not rule out the possibility that Fz may be involved in the hyperarborization phenotype.Both 2D-plots and boxplots of dendrite density show that the degree of attenuation of dendrite branching on LYD is much higher in fz2 mutant in Figure 4\u2014figure supplement 1O and 1P and showed that hyperarborization was strongly suppressed in the fz2 mutant neurons.We added the quantification data for the Figure 5 \u2013 data seems a little preliminary. It might be better to figure out the pathway in which Ror acts rather than add another piece.wg expression in muscles. As described in Essential revision 1, we carefully clarified the limited contribution of the Dome/JAK/STAT pathway in the revised version.We believe that the addition of the Dome/JAK/STAT pathway is informative because of its connection with In figure 6 \u2013 it would be helpful to include Ror k/d in the electrophysiological assays. The behavioral assays look somewhat inconclusive in terms of whether Ror rescues the LYD phenotype.We replied to this suggestion in Essential revision 7:We appreciate the reviewer\u2019s advice. Unfortunately, it has been difficult to rapidly conduct electrophysiological assays using larvae of multiple genotypes on different diets, due to limited human resources and access to apparatuses that must be shared by many other projects in the lab. As discussed in the original submission and also in the revised version, the identification of the downstream circuits would allow further studies, including electrophysiological analysis along the circuit, but this is beyond the scope of the present study.ReferenceDrosophila Tissue Growth with Developmental Timing. Science (1979) 336:582\u2013585. doi:10.1126/science.1216689Colombani J, Andersen DS, L\u00e9opold P. 2012. Secreted Peptide Dilp8 Coordinates Drosophila. Dev Cell 13:857\u2013871. doi:10.1016/j.devcel.2007.11.003McBrayer Z, Ono H, Shimell MJ, Parvy JP, Beckstead RB, Warren JT, Thummel CS, Dauphin-Villemant C, Gilbert LI, O\u2019Connor MB. 2007. Prothoracicotropic Hormone Regulates Developmental Timing and Body Size in Drosophila neurons. PLoS Biol 18. doi:10.1371/journal.pbio.3000657Nye DMR, Albertson RM, Weiner AT, Ian Hertzler J, Shorey M, Goberdhan DCI, Wilson C, Janes KA, Rolls MM. 2020. The receptor tyrosine kinase Ror is required for dendrite regeneration in Drosophila. Dis Model Mech 4:842\u2013849. doi:10.1242/dmm.007948Palanker Musselman L, Fink JL, Narzinski K, Ramachandran PV, Sukumar Hathiramani S, Cagan RL, Baranski TJ. 2011. A high-sugar diet produces obesity and insulin resistance in wild-type Drosophila Sensory Neurons. Neuron 63:788\u2013802. doi:10.1016/j.neuron.2009.08.006Parrish JZ, Xu P, Kim CC, Jan LY, Jan YN. 2009. The microRNA bantam Functions in Epithelial Cells to Regulate Scaling Growth of Dendrite Arbors in Drosophila somatosensory neurons protects dendrite growth under nutrient restriction. eLife 9:1\u201347. doi:10.7554/eLife.53351Poe AR, Xu Y, Zhang C, Lei J, Li K, Labib D, Han C. 2020. Low FoxO expression in Drosophila. PLoS Genet 15:e1007926. doi:10.1371/journal.pgen.1007926Santab\u00e1rbara-Ruiz P, Esteban-Collado J, P\u00e9rez L, Viola G, Abril JF, Mil\u00e1n M, Corominas M, Serras F. 2019. Ask1 and Akt act synergistically to promote ROS-dependent regeneration in Science (1979) 295:2088\u20132091. doi:10.1126/science.1068094Stocker H, Andjelkovic M, Oldham S, Laffargue M, Wymann MP, Hemmings BA, Hafen E. 2002. Living with Lethal PIP3 Levels: Viability of Flies Lacking PTEN Restored by a PH Domain Mutation in Akt/PKB. Genes to Cells 22:105\u2013114. doi:10.1111/gtc.12451Watanabe K, Furumizo Y, Usui T, Hattori Y, Uemura T. 2017. Nutrient-dependent increased dendritic arborization of somatosensory neurons. Drosophila larval body wall. Nature 468:921\u2013926. doi:10.1038/nature09576Xiang Y, Yuan Q, Vogt N, Looger LL, Jan LY, Jan YN. 2010. Light-avoidance-mediating photoreceptors tile the"}
+{"text": "Chronic kidney disease (CKD) is a highly prevalent disease worldwide. A basic pillar for the management of a patient with CKD is the safe use of drugs. Inadequate dosing of medication or contraindicated drugs in renal impairment can lead to negative outcomes. The primary objective was to analyse the drug prescriptions of patients with CKD from two primary care centres to see if they were optimally adapted to the patient's estimated glomerular filtration rate (eGFR).2 for at least three months were included. Their demographic data (age and sex) and clinical variables such as associated comorbidities, eGFR value were retrospectively registered. Finally, their medication plans were reviewed in order to detect: inappropriate prescribing (IP), defined as an incorrect dose/frequency or contraindicated drug according to the renal function of the patient; nephrotoxic drugs and drugs with a high sodium content.A retrospective observational study was conducted in two urban primary care centres. The study period was between September\u2013October 2019. Patients over 18\u00a0years of age, with established CKD and with an eGFR less than 60\u00a0mL/min/1.73mA total of 273 patients were included. The most common patient profile was an elderly woman, polymedicated, with other concomitant diseases and with mild CKD. Two hundred and one IPs were detected, 13.9% of which were contraindicated drugs. Of all patients, 49.1% had been prescribed at least one IP on their medication plan, 93.8% had some potentially nephrotoxic drug and 8.4% had drugs with a high sodium content prescribed.Patients with CKD are at increased risk of medication-related problems. It is necessary to implement measures to improve the safety in the prescription of drugs in patients with CKD. To do this, (i) the use of nephrotoxic drugs should be avoided, (ii) those drugs that can cause hyperkalaemia should be closely monitored, and (iii) the dose of drugs should be adjusted according to eGFR to guarantee their efficacy and safety . RecommeOne of the best-known nephrotoxic drug combinations in the primary care setting is a renin-angiotensin system inhibitor (RASI), a diuretic and a non-steroidal anti-inflammatory drug (NSAID), known as \u201cTriple Whammy\u201d. It has been observed that the use of the three pharmacological groups increases the risk of acute renal failure (ARF) by 31% compared to the dual therapy of an NSAID with a diuretic or a RASI , 6.All this adds up to the importance of adopting a healthy lifestyle in the management of patients with CKD. For example, a low sodium diet is generally recommended, with a daily salt intake of less than 6\u00a0g . At this last point, those drugs that may contain significant amounts of sodium in their composition should be taken into account .Thus, the control of CKD requires comprehensive and highly complex management, in which great attention must be paid to the patient\u2019s treatment plan. Previous studies carried out both in the hospital setting and in primary health level have emphasized the need for a better adjustment in the treatment of these patients , 8\u201312.Our objectives were: (I) to describe the profile of patients with CKD from two primary care centres; (II) to analyse drug prescriptions of those patients to see if they were optimally adapted to the patient\u2019s eGFR; and (III) to assess the prescription of nephrotoxic drugs, including the combination \"Triple Whammy\", and drugs with high sodium content of those patients.A retrospective observational study was conducted in two urban primary care centres with an assigned population of 60,000 patients. The care centers were located in Barcelona, in Eixample Esquerra district.2 in an analysis carried out between September and October 2019 plus another analysis performed three or more months before. The exclusion criteria were: patients with no medication prescribed in the medication plan. Using the digital records of the centers, all patients who had undergone blood tests during those two months were searched for. Then, those patients that met the inclusion criteria, and not the exclusion criteria, were selected. The current prescriptions of the patients were analysed one month after the determination of GFR less than 60\u00a0mL/min/1.73m2.The inclusion criteria were: patients over 18\u00a0years of age, with established CKD and with a GFR (estimated according to CKD-EPI) less than 60\u00a0mL/min/1.73mIn the electronic clinical record used in the health primary care centers analysed, medication plans and laboratory tests were coded. The doctor's summary of medical visits was free text. The electronic medication plan is the official document that includes both patient information , as well as the medical prescription for dispensing the medication at the pharmacy office. The dispensing of the medication is calculated based on the dosage entered into the computer system. When the patient presents kidney failure, the doctor should adjust the medication in the medication plan, if necessary.Micromedex [Uptodate [The following variables were collected from the patients' medical records of the health primary care center: demographic data (age and sex), associated comorbidities, history of vascular or thrombotic events , eGFR value, prescribed and current drugs and their dosage. To check if the medication was well adjusted for renal function and/or if there was any type of contraindication or precaution in CKD, the Summary of Product Characteristics of the drugs were consulted . The Miccromedex  and UptoUptodate  databaseDrug prescriptions at an incorrect dose/frequency and/or contraindicated according to the renal function of the patient were classified with the term inappropriate prescribing (IP). Those patients who were prescribed nephrotoxic drugs were identified, including the \u201cTriple Whammy\u201d combination. For that, drugs with a high potential for nephrotoxicity were consulted in different CKD management guidelines , 7, 16. Patients who received drugs with high sodium content were also identified. Those are the drugs with a sodium content greater than 50\u00a0mg per unit . For thiIn the present study, quantitative variables with normal distribution according to the Shapiro\u2013Wilk test were expressed as mean and standard deviation. Variables with asymmetric distribution were indicated as median and interquartile ranges. Qualitative variables were expressed as absolute value and proportion. There was no formal sample size calculation. The statistical software used was Excel\u00ae .This study has been approved by the center's research ethics committee and complies with the basic principles of the Declaration of Helsinki. It was not considered necessary to request informed consent from the patients because the study is based on retrospective data generated by clinical practice.2 were identified. Of these, 11 patients (3.9%) were excluded from the study because they had not previously presented an eGFR below the mentioned limit.In the period studied, a total of 2,103 blood tests with eGFR\u2019s determination were performed in patients from both primary care centers. Out of all of them, 284 (13.5%) patients with an eGFR\u2009<\u200960\u00a0ml/min/1.73mTable 2) and men (46.1\u2009\u00b1\u200911.2\u00a0ml/min/1.73m2). The older the patients, worst the renal function, observing the lowest eGFRs in patients older than 90\u00a0years.The eGFR\u2019s average was similar between women (43.2\u2009\u00b1\u200911.6\u00a0ml/min/1.73m2).In 59 patients (21.6%), CKD was not registered as a current clinical problem in the patient's medical history. In 76.3% of these cases (n\u2009=\u200945), it was a mild CKD grade G3A  had at least one IP on their prescription. The characteristics of these patients were quite similar to those described for all patients. Table Table Table In addition, 27 drug prescriptions whose Summary of Product Characteristics recommend caution in patients with CKD were detected Table .In our study, 49.1% of patients with IP have been detected. In similar studies, this percentage varies between 20.0\u201374.5% , 17\u201320. In absolute numbers, most of the IPs detected corresponded to paracetamol, atorvastatin, enalapril, fenofibrate and lormetazepam. However, this fact is influenced by the high frequency of prescription of these drugs in a primary care setting. Regarding drugs prescribed in the patient\u2019s study, the drugs with a higher percentage of IPs were fenofibrate, lormetazepam, atorvastatin, sitagliptin and enalapril. We have observed that drugs most frequently involved in IP vary according to the study, either at the primary care , 20, in It is concerning that most patients (93.8%) had prescribed nephrotoxic drugs. This is a known problem, worsening in patients older than 60\u201375\u00a0years , 27. On In our cohort, we observed that the most of patients as commented in the results section, were older women (75\u201390\u00a0years), with associated comorbidities, polymedicated and generally with mild CKD. These characteristics coincide with those found in other studies also carried out in primary care setting , 11. TheIn our study, only 2 cases of the \u201cTriple Whammy\u201d combination were found. In a study carried out in Catalonia, it was observed that the frequency of prescribing \u201cTriple Whammy\u201d would be 1.04 cases per 100 inhabitants , this frAn 8.4% of the patients had been prescribed a drug with a high sodium content. Although this is a small number of cases, these could have been avoided. That is because most of active ingredients have pharmaceutical presentations with lower sodium content. High sodium intake in patients with kidney disease has been associated with progression of kidney disease and increased use of antihypertensive drugs , 30.For the adjustment of many drugs commonly prescribed in primary care, physicians tend to pay more attention to clinical markers such as heart rate, blood pressure or blood glucose than to kidney function . Even soFinding solutions to improve drug adjustment in CKD patients is essential. Interventions, both computerized and manual, and education for professionals have been shown to significantly reduce IP. However, the greatest reduction is found in interventions by pharmacists or other clinical experts . It has In a non-negligible percentage of patients (21.6%), the diagnosis of CKD was not registered as an active health problem in the patient's medical history. This issue has been reported in other articles , 11, 33.In our primary care centers, there is a prescription assistance system integrated into the patient's medical history. This system shows alerts about antidiabetic drugs contraindicated in renal failure  and prescription of the \u201cTriple Whammy\u201d combination. This system has surely contributed to the reduced number of IPs of these drugs detected in this study. It should also be noted that the clinical pharmacist performs a clinical validation of all direct-acting anticoagulant prescriptions, checking if their dosage is adjusted to the weight, age and eGFR of the patient. It has probably contributed to the fact that no IP was detected in this group of drugs. To improve the safety in drug prescription in patients with CKD, it would be desirable to extend the computerized alert system to the drugs with more IP detected in this study, as well as the involvement of pharmacists in the review of drugs with higher risk.It is known that according to the equation used to calculate renal function, the prevalence of IP can vary. Although most dose adjustment guidelines were developed according to the Cockcroft-Gault (CG) equation, the CKD-EPI equation is more used by nephrologists to classify and monitor renal function in patients with CKD , 24. It Due to the retrospective nature of the study, we didn\u2019t conduct interviews with the patients. Consequently, it was not possible to detect those drugs or herbal preparations self-administered by the patient with high nephrotoxic potential , as wellAs for strengths, we provide evidence from real clinical practice on a topic not very developed in the primary care setting.We think that our results can be generalized to other primary care centers in the same health care area, since the profile of attended patients is the same, use the same electronic prescribing system, and similar consultation time per patient.For the same reasons as those just stated, we do not believe that the results we would find now post-COVID pandemic would significantly differ from those we found then. The rate of IP could even have increased slightly due to the saturation of workload that there has arisen during some periods in primary care centers.In the future, a prospective study could be carried out to see to what extent the pharmacist's recommendations on adjusting the medication plan are accepted by the prescribing physician and/or patient. Finally, since the study was conducted before COVID-19 pandemic, it would be interesting to recreate it now to see if as a result of COVID-19 the rate of IP has changed.In about half of the patients in our study, some medication was prescribed at a dose and/or frequency that were not adequate for their renal function. The consequent accumulation of the drug/metabolite can lead to negative outcomes . It is necessary to implement measures to improve the safety in the prescription of drugs in patients with CKD. The health centre pharmacist can help optimize prescribing."}
+{"text": "In vitro gametogenesis, the process of generating gametes from pluripotent cells in culture, is a powerful tool for improving our understanding of germ cell development and an alternative source of gametes. Here, we induced primordial germ cell\u2013like cells (PGCLCs) from pluripotent stem cells of the northern white rhinoceros (NWR), a species for which only two females remain, and southern white rhinoceros (SWR), the closest species to the NWR. PGCLC differentiation from SWR embryonic stem cells is highly reliant on bone morphogenetic protein and WNT signals. Genetic analysis revealed that SRY-box transcription factor 17 (SOX17) is essential for SWR-PGCLC induction. Under the defined condition, NWR induced pluripotent stem cells differentiated into PGCLCs. We also identified cell surface markers, CD9 and Integrin subunit alpha 6 (ITGA6), that enabled us to isolate PGCLCs without genetic alteration in pluripotent stem cells. This study provides a first step toward the production of NWR gametes in culture and understanding of the basic mechanism of primordial germ cell specification in a large animal. Primordial germ cell-like cells are induced from Southern and Northern White Rhinoceros as a first step toward conservation. Ceratotherium simum cottoni; hereinafter NWR) is categorized as \u201cextinct in the wild\u201d on the IUCN Red List of Threatened Species. In the 1960s, the number of NWRs was estimated at 2250 . The adapted technologies include artificial insemination (One option is to adapt advanced assisted reproductive technologies (aARTs) developed for human and livestock animal reproduction for use in NWR , has rapidly evolved over the past decade . The specific expression of these genes in pluripotent stem cells and PGCs is highly expected, as evident by the conserved expression profile of POU5F1 and PRDM1 among a broad range of mammalian species, including mice, rabbits, pigs, and primates (POU5F1/OCT3/4-EGFP (OG) and PRDM1/BLIMP1-tdTomato (BT) (OGBT) SWR-ESC lines. Inspecting one of the OGBT lines, OGBT13 bearing the reporter genes in a heterozygous fashion (fig. S1A), we found that the OG was detectable under fluorescent microscopy and by fluorescence-activated cell sorting (FACS), while no BT was detectable (To monitor the process of PGC(LC) specification, we first generated a reporter SWR-ESC line, in which tectable .Because the ability of ESCs to differentiate into PGCLCs is highly dependent on their pluripotent state . A correBoth BMP and WNT signals are required in mouse and human PGCLC specification . InductiAlthough OGBT double-positive cells were induced, the number of these cells per aggregate still averaged less than 100 , limitinNext, we attempted to determine the signals other than BMP4 and WNT that play a role in PGCLC specification in other animals. Activin A is used for preinduction in mouse and human PGCLC induction , but not SOX2  analysis . The expnot SOX2 . These rGATA3, HAND1, and TBX3, were up-regulated in the preinduced cells compared to SWR-ESCs, and many of them were down-regulated in OGBT double-positive cells. On the other hand, genes involved in PGC specification, such as SOX17, PRDM1, and NANOS3, were up-regulated in OGBT double-positive cells compared to the preinduced cells (fig. S3A). Principal components analysis (PCA) showed that the difference in gene expression profiles between SWR-ESCs and preinduced cells was projected to PC2 and that between preinduced cells and OGBT double-positive cells was projected to both PC1 and the opposite direction of PC2  analysis on SWR-ESCs, preinduced cells, and day 4 OGBT double-positive cells. Unsupervised hierarchical clustering using all the expressed genes showed that SWR-ESCs and preinduced cells were relatively close to each other and far from the OGBT double-positive cells . During n of PC2 . Genes hWe then compared the transcriptome among these SWR-ESC derivatives and related cell types in humans  and mice . PCA with PC1 and PC2 using all expressed genes showed that mouse, human, and rhinoceros profiles made clusters in each species . HoweverSOX17 would play a critical role, as it activates the gene network for PGCLC specification in humans but not in mice . From the SOX17\u2212/\u2212 OGBT13 SWR-ESCs, no OGBT double-positive cells appeared by the preinduction, followed by culture with GK15\u00a0+\u00a0BLSEYWi (SOX17 expression in SOX17\u2212/\u2212 OGBT13 SWR-ESCs with a doxycycline (Dox)\u2013inducible SOX17 expression vector . In the rescue line, a robust induction (~85%) of OGBT double-positive cells was observed in a Dox-dependent manner  was only 19 genes  (fig. S5A). In addition, PCA and unsupervised hierarchical clustering using all expressed genes showed that the manner of SWR-PGCLC induction under the aRK10\u00a0+\u00a0BLSEYF2i condition was similar to that under the GK15\u00a0+\u00a0BLSEYWi condition . Collectively, these results showed that a robust number of SWR-PGCLCs were efficiently induced from SWR-ESCs under the refined condition.To further characterize SWR-PGCLCs, we assessed whether they have the potential to undergo subsequent developmental processes after PGC specification. Having reported that mouse and human PGCLCs propagate under appropriate conditions . This syPOU5F1, SOX17, PRDM1, and NANOS3 , SWR-PGCLCs continuously proliferated while maintaining their expression of OGBT reporter genes . In addid NANOS3 . PCA andd NANOS3 . However or DAZL , suggestPOU5F1, SOX2, KLF4, and C-MYC encapsulated in the Sendai virus. During the reprogramming, fibroblasts displayed morphological changes characteristic for mesenchymal to epithelial transition within 7 days, and then individual colonies became apparent, which could be isolated from day 15 . After clearance from Sendai virus\u2013encoded RNA, expression of the pluripotency markers, such as NANOG, SOX2, OCT3/4, TRA-1-60, and SSEA3, and a diploid karyotype  expressed in PGCLCs but not in ESCs and iPSCs. By exploring the transcriptome, we identified candidate proteins that are preferentially expressed in PGCLCs or are used for isolation of PGCLCs in other species (fig. S8A) and then focused on proteins that have homologs for which antibodies are commercially available. Screening of antibodies by immunofluorescence followed by FACS analysis revealed that SWR-ESCs and SWR-PGCLCs could be separated with antibodies against CD9 and ITGA6 (fig. S8B and C). This combination of antibodies successfully isolated PGCLCs: Up to 94% of cells expressing both CD9 and ITGA6 were OGBT-positive SWR-PGCLCs . The cel+/ ITGA6+ double-positive cell population from NWR derivatives was not as clear as that from SWR-ESC derivatives, possibly due to the unexpected differentiation of BT weakly positive cells from OGBT NWR-iPSCs. The differential distribution of the derivatives after PGCLC induction could be attributed to clonal variation in the differentiation propensity of iPSCs. To test the clonal variation, we tested several nonreporter NWR-iPSCs for PGCLC differentiation, followed by cell sorting with CD9 and ITGA6 antibodies. As expected, there was variation in the differentiation of derivatives expressing these surface proteins  MEFs. Rho-associated kinase (ROCK) inhibitor  was added to medium at 10 \u03bcM, and then the cells were allowed to culture for 24\u00a0hours after the passage.SWR-ESCs (051B) and NWR-iPSCs  were maintained in DK20  except in the case of the experiments shown in et\u00a0al.  in skin medium. On the next day, medium was changed. On the day of transduction (day 0), cells of 1 \u00d7 12 wells were detached with TrypLE Select Enzyme and counted (~9.0 \u00d7 104 cells). On the basis of the obtained cell number, the amount of Sendai viruses  needed for transduction of cells in 1 \u00d7 12 wells with an multiplicity of infection of 10:10:6 (KOS:c-Myc:Klf4) was calculated. The medium of 2 \u00d7 12 wells was changed to skin medium containing polybrene . Sendai virus mixture was added to 1 \u00d7 12 wells. The other 1 \u00d7 12 wells were not transduced and served as negative control. The plate was sealed with parafilm and centrifuged at room temperature and 800g. After 20-min centrifugation, the plate was turned and centrifuged for another 10\u00a0min. Subsequently, parafilm was removed, and the plate was incubated overnight at 37\u00b0C and 5% CO2. On the next day (day 1), cells were washed once with skin medium and subsequently fed with skin medium. The skin medium was changed on days 2, 4, and 6.\u00a0On day 7, transduced cells were carefully detached by incubation with TrypLE Select Enzyme for 2 to 3\u00a0min at 37\u00b0C, and 5.0 \u00d7 103 to 20.0 \u00d7 103 cells were plated per six wells [coated with Geltrex and laid with 2.0 \u00d7 105 mitomycin C\u2013treated MEFs ] in skin medium. On the next day (day 8), the medium was changed to KB medium . From now on, KB medium was changed daily. On days 15 and 19, single colonies were transferred to individual 24 wells coated with Geltrex and laid with 5.0 \u00d7 104 MEFs. KB medium was supplemented with 10 \u03bcM ROCK inhibitor  at the day of picking and on the day after. Successfully growing clones were transferred to 12 wells coated with Geltrex and laid with 1.0 \u00d7 105 MEFs using phosphate-buffered saline (PBS) and 0.5 mM EDTA solution  for 8\u00a0min at 37\u00b0C. After split, KB medium was supplemented with 10 \u03bcM of Y-27632 for 24 hours. Clones exhibiting nice morphology were further expanded and cryopreserved in KSR, 10% dimethyl sulfoxide .Fibroblasts from the NWR female Nabire were isolated as described ]. When reaching confluency, cells were split with TrypLE Select Enzyme on Geltrex-coated wells without MEFs. Y-27632 was added at 10 \u03bcM for 24 hours. Subsequent splits were performed with PBS/EDTA (~4 min at 37\u00b0C) and without adding Y-27632.5 MEFs. Subclones of clone 6 and clone 60 were expanded, and RNA was collected at passage 11 and passage 9, respectively. Reverse transcription PCR (RT-PCR) was performed according to the manufacturer\u2019s instructions (CytoTune\u2013iPS 2.0 Sendai Reprogramming Kit) and using the primer pairs shown in table S2. NWR-iPSC lines 6A and 6B were vector-free at passage 11, and master cell banks were generated. In all subclones of clone 60, Sendai virus\u2013encoded RNA was detected. Subcloning of one subclone was not sufficient to obtain vector-free iPSC lines. Therefore, we shifted the maintenance culture of clone 60 at passage 11 to 38\u00b0C for 5 days. Cells were split, and the maintenance culture (passage 12) was incubated for additional 5 days at 39\u00b0C. After the next split (passage 13), the maintenance culture was shifted back to 37\u00b0C. After RT-PCR of clone 60 at passage 14, weak bands resulting from Sendai virus\u2013encoded RNA were detected. After another round of subcloning of clone 60, we obtained the lines 60R and 60X, which were cleared of Sendai virus RNA at passage 19.To generate vector-free NWR-iPSC lines, clones were expanded until passage 7 (clone 6) or passage 5 (clone 60) and then split with PBS/EDTA (incubation 6\u00a0min at 37\u00b0C) in 1:100 and 1:200 ratios to favor formation of individual colonies. Y-27632 was added at 5 \u03bcM for 24 hours after split. When single colonies grew to an appropriate size, they were picked into 24 wells coated with Geltrex and laid with 0.5 \u00d7 105 cells were plated in MEF-conditioned KB medium supplemented with 10 \u03bcM of Y-27632 on two Geltrex-coated T25 flasks each. The conditioned medium was generated by incubating MEFs overnight with KB medium. 2-Mercaptoethanol and FGF were added freshly before using the medium on NWR-iPSCs. MEF-conditioned KB medium supplemented with 10 \u03bcM Y-27632 was changed daily. When cells reached approximately 50% confluency, they were treated with colcemide (0.1 g/ml) for 2.5 hours at 37\u00b0C. Subsequently, cells were detached using trypsin-EDTA . Enzymatic digestion was stopped by adding medium containing 10% KSR. Cells from both T25 flasks were pooled in one 50-ml Falcon tube. After centrifugation at room temperature for 5 to 10\u00a0min at 450g, the supernatant was discarded except for ~1 ml, which was used to resuspend the cell pellet and to transfer it into a 15-ml Falcon tube. For hypotonic treatment, 10 ml of 0.075 M KCl solution  was added, and cells were incubated for 20\u00a0min at 37\u00b0C. Subsequently, ~1 ml of freshly prepared, ice-cold fixative  was added, and cells were carefully mixed by inversion. After centrifugation at room temperature for 5 to 10\u00a0min at 450g, the supernatant was discarded except for ~1 ml, which was used to resuspend the cell pellet. To wash the cells, 5 to 10 ml of fixative was added carefully in several steps including mixing, and cells were centrifuged at room temperature for 10\u00a0min at 450g. The supernatant was discarded except for ~1 ml, which was used to resuspend the cell pellet. The washing step was repeated three times. Last, the cells were resuspended in 2 ml of fixative and transferred into a 1.5-ml Eppendorf tube. The tube was sealed with parafilm and sent to the institute for human genetics in Jena, Germany. There, Giemsa-trypsin-Giemsa banding technique was used. Metaphase chromosomes were imaged with the Zeiss Axio Z2 microscope using the scanning system Metafer and the Ikaros V5.1 software (both Metasystems). The average resolution was ~200 bands per haploid chromosome set. In total, 20 metaphase spreads were analyzed per cell line.NWR-iPSCs on MEFs were split with PBS/EDTA (>6 min at 37\u00b0C), and 7.3 \u00d7 10POU5F1-p2A-EGFP or BLIMP1-p2A tdTomato knock-in SWR-ESC lines, the homology arms of POU5F1 and BLIMP1 were amplified by PCR using the primer pairs listed in table S2. Amplified PCR products were inserted using an In-Fusion system  to each vector linearized by appropriate restriction enzymes. The backbone vectors for the knock-in were provided by Saitou and co-workers (https://crispr.dbcls.jp).For construction of the donor vectors to generate 5 cells of SWR-ESCs (051B) or NWR-iPSCs (60R) with Lipofectamine 2000 . At 24\u00a0hours after the lipofection, the culture medium was exchanged with fresh medium. At 48\u00a0hours after the lipofection, puromycin (1 \u03bcg/ml) or G418 (400 \u03bcg/ml) was added to the medium. At 2 to 3 days after the drug selection, the SWR-ESCs or the NWR-iPSCs were passaged to a new culture plate coated with MEFs. The resultant SWR-ESCs and NWR-iPSCs were subjected to subsequent lipofection of Cre-EGFP vector to remove the drug resistance gene. At 24\u00a0hours after the lipofection, the medium was exchanged with fresh medium. At 48\u00a0hours after the lipofection, enhanced green fluorescent protein (EGFP)\u2013positive cells were sorted by FACSAria Fusion (BD Biosciences), and 5000 sorted cells were seeded onto a well of the six-well plate coated with MEFs. After 5 to 6 days of culture, colonies were picked up and cultured in a 96-well plate for genotyping. Cre-mediated deletion of the drug resistance gene was determined by PCR using the primer pairs shown in table S2.For generation of the OGBT reporter lines, 1.5 \u03bcg of the donor vector and 1.5 \u03bcg of the gRNA vector were introduced into the 6 \u00d7 10For the generation of SWR-ESCs constitutively expressing mCherry, 1.5 \u03bcg of CAG-mCherry-IRES-Neo flanked by PiggyBac terminal repeat sequences and 1.5 \u03bcg of PiggyBac transposase expression vector were transfected into SWR-ESCs (051B) with Lipofectamine 2000, and then the cells were cultured with G418 (400 \u03bcg/ml). At 4 days of culture, cells expressing mCherry at a similar level were sorted by FACSAria Fusion. The sorted SWR-ESCs were used as CAG-mCherry SWR-ESCs.5 SWR-ESCs were plated on a well of six-well plate coated with fibronectin  and then cultured for 24\u00a0hours in GK15  or aRK10  medium supplemented with BMP4 , 6 \u03bcM CHIR , and 10 \u03bcM of Y-27632 . Then, preinduced cells were dissociated with TrypLE for 4 min, centrifuged, and plated into a well of 96-well U-bottom ultralow attachment microplate  at a concentration of 6000 cells per well in GK15 or aRK10 supplemented with LIF , SCF , EGF , and 10 \u03bcM of Y-27632 and with or without BMP4 (200 ng/ml). The images of the aggregates were captured by a stereo microscope . The following inhibitors and cytokines were added to the culture medium on the appropriate day of culture as indicated in the description of each experiment: 2.5 \u03bcM endo-IWR1 , 10 \u03bcM forskolin , 10 \u03bcM bpV(HOpic) , 2.5 \u03bcM XAV939 , 2.5 \u03bcM IWP-2 , activin A , and 1 \u03bcM PD0325901 .For the preinduction,4.0 \u00d7 10SOX17-knockout vector, the t2A-puromycin resistance gene in pX459 was replaced with p2A-EGFP, yielding the pX459-p2A-EGFP vector. Oligos encoding gRNAs targeting SOX17 were inserted into the pX459-p2A-EGFP vector. Two gRNA vectors were constructed for a large deletion in SOX17 loci. Transfection was performed in the same way as for the generation of the OGBT reporter lines. At 48\u00a0hours after lipofection, EGFP-positive cells were sorted with a FACSAria Fusion, and 5000 sorted cells were seeded onto a well of the six-well plate coated with MEFs. After 4 to 6 days of culture, colonies were picked up and expanded for the genotyping. Genotypes were determined by PCR using the primer pairs in table S2.For construction of the SOX17, the coding sequences (CDSs) of rhinoceros SOX17 were amplified from cDNA of SWR-PGCLCs using KOD One DNA polymerase  with the primer pair listed in table S2. The Kozak sequence, GCCACC, was added within 5\u2032 of the first ATG during the PCR reaction. Rhinoceros SOX17 amplified with the Kozak sequences was inserted into the PiggyBac-based Dox-inducible expression vector using the In-Fusion system. The rhinoceros SOX17 expression vector and the rtTA vectors were transfected into cells of the SOX17-knockout line along with the PiggyBac transposase expression vector by Lipofectamine 2000. The drug selection by G418, pickup of colonies, and genotyping were performed in the same way as for the generation of OGBT reporter lines.For exogenous expression of The floating aggregates containing SWR-PGCLCs or NWR-PGCLCs were incubated in CTK solution  solution for 30 min at 37\u00b0C. After removal of CTK solution, the aggregates were dissociated by incubation in Accutase  for 10 min at 37\u00b0C. The cell suspension was filtered using a cell strainer (70 \u03bcm) to remove cell clumps. The collected cells were suspended in FACS buffer [PBS containing 0.1% bovine serum albumin (BSA)] and analyzed or sorted with a FACSAria Fusion.For the analysis/sorting of SWR-PGCLCs or NWR-PGCLCs with the cell surface markers, the floating aggregates were dissociated by incubation in CTK solution, followed by Accutase as described above, and then stained with the fluorescence-conjugated antibodies listed in table S3 for 15 min on ice. After washing the cells with FACS buffer, the cell suspension was filtered by a cell strainer and analyzed or sorted with a FACSAria Fusion.KITLG expression vector, the CDSs of rhinoceros KITLG were amplified from cDNA of SWR-ESCs using a KOD One DNA polymerase with the primer pair listed in table S2. The Kozak sequence, GCCACC, was appended to the primer and was added within 5\u2032 of the first ATG during the PCR reaction. The rhinoceros KITLG amplified with the Kozak sequence was inserted between the CAG promoter and IRES-puromycin resistance gene using the In-Fusion system. A total of 1.5 \u03bcg of the CAG-rhinoceros KITLG-IRES-puromycin resistance gene flanked by PiggyBac terminal repeat sequences and 1.5 \u03bcg of the PiggyBac transposase expression vector were transfected into Sl/Sl4 cells by Lipofectamine 2000, and then the cells were culture with puromycin (1 \u03bcg/ml) for 4 days. Then, single cells were sorted into individual wells in a 96-well plate by FACSAria Fusion. After 10 days of culture, individual cell clones were duplicated and then subjected to Mitomycin C (MMC) test following the method described in the previous report ] medium for 5 hours. MMC-treated m246 cells were stored at \u221280\u00b0C. At 6 hours before sorting of SWR-PGCLCs, MMC-treated m246 feeder cells were seeded at 1 \u00d7 105 or 2 \u00d7 105 cells per well of a 24- or 12-well plate, respectively. SWR-PGCLCs at day 6 of induction were sorted and seeded at 5 \u00d7 103 or 1 \u00d7 104 cells per well of a 24- or 12-well plate, respectively, with expansion medium  supplemented with bFGF (20 ng/ml), 6 \u03bcM CHIR, 2.5\u00a0\u03bcM endo-IWR1, and 0.5 \u03bcM SB590885 . The medium was then supplemented with 10 \u03bcM of Y-27632 for the first 48\u00a0hours of culture. The medium was changed every 2 days with the addition of 1 \u00d7 105 or 2 \u00d7 105 of MMC-treated m246 feeder cells to the well of the 24- or 12-well plate, respectively.m246 feeder cells were treated with MMC (5 \u03bcg/ml) for 2\u00a0hours, washed with PBS, and then cultured with STO . From now on, medium was changed every other day. To remove noncardiomyocytes, cells were cultivated in starvation medium  for 2 to 4 days. Beating cardiomyocytes were observed after 12 days of differentiation.To represent the mesoderm, NWR-iPSCs were differentiated into beating cardiomyoctes using two different protocols: In the first approach, feeder-free NWR-iPSCs were split with TrypLE Select Enzyme, and 1.0 \u00d7 10et\u00a0al. (l-ascorbic acid 2-phosphate (213 \u03bcg/ml)] supplemented with 5 \u03bcM CHIR (day 0). On day 2, the medium was changed to RPMI CDM3 containing 2 mM Wnt-C59 . On day 3, the medium was changed to RPMI B-27 medium, which was replaced every other day. To remove noncardiomyocytes, cells were cultivated in starvation medium for 2 to 4 days. Beating cardiomyocytes were observed after 15 days of differentiation.The second approach was modified from Burridge et\u00a0al. , medium was changed to neural induction medium . NIM was exchanged daily for five consecutive days. On day 6, cells were washed once with PBS and subsequently detached using Accutase . Enzymatic reaction was stopped after 8 min by adding neural expansion medium  supplemented with 5 \u03bcM Y-27632. Cells were passed through a 70-\u03bcm strainer  and subsequently centrifuged at 300g for 3\u00a0min at room temperature. The supernatant was discarded, cells were resuspended in NEM supplemented with 5 \u03bcM Y-27632 and counted, and 1.5 \u00d7 105 cells were plated per Geltrex-coated 24 wells. Medium was changed every day with NEM. On day 13, cells were fixed as described previously.The neural  differentiation of NWR-iPSCs was induced by a modified version of the dual SMAD inhibition protocol published by Chambers For immunofluorescence analysis, the day 4 aggregates were dissociated as described above, and then OGBT-positive cells and BT-negative cells were separately sorted by a FACSAria Fusion. The sorted OGBT-positive cells and BT-negative cells were mixed at a ratio of 1:1 and spread onto MAS-coated glass slides . The slides were fixed in 4% paraformaldehyde in PBS for 15 min at room temperature, washed three times with PBS, permeabilized with 0.5% Triton X-100 in PBS for 10 min at room temperature, and washed three times with PBS. The slides were then incubated in a blocking solution (1% BSA and 0.2% Tween 20 in PBS) overnight at 4\u00b0C. After blocking, the slides were incubated with primary antibodies in blocking solution overnight at 4\u00b0C. After washing six times with PBS, the slides were incubated with secondary antibodies in blocking solution containing 4\u2032,6-diamidino-2-phenylindole  for 1\u00a0hour at room temperature. The slides were then washed six times with PBS and mounted in PermaFluor Aqueous Mounting Medium . For the immunofluorescence analysis of 5mC and 5hmC, after fixation in 4% paraformaldehyde in PBS for 15 min at room temperature, the slides were treated with 4 and 2 N HCl, respectively, in PBS containing 0.1% triton X-100 for 10 min at room temperature. Then, the slides were incubated in 10 mM tris-HCl (pH 8) for 10 min at room temperature, washed twice with PBS, and then subjected to incubation in the blocking solution, followed by staining procedures with antibodies as described above. All antibodies used in this study are listed in table S3. Images were captured and processed by an LSM 900 confocal microscope (Zeiss).+/+  and subsequently fixed for 15\u00a0min at room temperature in BD Cytofix solution . After washing twice in PBS+/+, fixed cells were either stored at 4\u00b0C until further use or processed directly. To reduce background signal, cells were blocked for 1 hour shaking at room temperature in 1\u00d7 PBS+/+, 5% normal goat serum  for surface markers, or for intracellular and nuclear markers in blocking buffer . Afterward, primary antibodies were diluted as indicated below in 1\u00d7 PBS+/+, 1% BSA for surface markers, or blocking buffer and incubated overnight shaking at 4\u00b0C. On the next day, cells were washed three times for 15\u00a0min in PBS+/+. Secondary antibodies were diluted in PBS+/+ containing DAPI , and cells were incubated in the solution for ~2 hours, shaking at room temperature. Subsequently, cells were washed three times in PBS+/+. Images were captured and processed with a Leica DMi8 microscope and the LASX software .To stain NWR-iPSCs in pluripotent state or after differentiation into cells of the three germ layers, cells were washed twice in PBS4 cells of each cell type using the RNeasy Micro Kit , and cDNA was synthesized using the PrimeScript First-Strand cDNA Synthesis Kit . The qPCR reaction using Power SYBR Green PCR Master Mix  was performed by a CFX384 real-time qPCR system (Bio-Rad). Primers used for the qPCR reaction are listed in table S2. The gene expression levels were examined by calculating \u0394Ct  normalized to the average \u0394Ct values of ARBP and PPIA. Error bars are the means\u00a0\u00b1\u00a0SE from three independent experiments.Total RNA was extracted from 1 \u00d7 104 cells of each cell type using the RNeasy Micro Kit. Purified RNAs were subjected to library construction using a NEB Next Ultra II Directional RNA Library Prep Kit for Illumina . cDNAs were amplified by 12 cycles of PCR. Library qualities and concentrations were validated using an Agilent 2100 Bioanalyzer(Agilent) with a high-sensitivity DNA kit . Sequencing of the libraries was performed with NextSeq (Illumina).Total RNAs were isolated from 1 \u00d7 10For mapping of the sequenced fragments, the genome sequence  and the transcript annotation  were obtained from the University of California, Santa Cruz (UCSC). All reads were trimmed with Fastp, and untrimmed and trimmed reads with less than 25\u00a0base pairs were eliminated. Treated reads were mapped to the genome of each species with STAR and annotated with RNA-Seq by Expectation-Maximization (RSEM). Paired-end data (2[Transcripts Per Kilobase Million (TPM)\u00a0+\u00a01] values were\u00a0>2 in at least one sample. DEGs were extracted using edgeR version 3.32.0 from the count data of each sample. The DEGs were defined as the genes exhibiting a more than fourfold difference between samples (FDR < 0.001), and the mean of the expression level of the group was >log2CPM\u00a0=\u00a04. Unsupervised hierarchical clustering was performed using the hclust function with Pearson correlation distances and Ward\u2019s method (ward.D2). The PCA was performed using FactMineR version 2.4.Data analysis was performed using R software version 4.0.3. We defined all expressed genes as the genes whose loghttps://genome.ucsc.edu/cgi-bin/hgGateway?redirect=manual&source=genome.ucsc.edu). Then, the rhinoceros gene annotations in human coordinates were compared with cerSim1.ncbiRefSeq, followed by a search for the corresponding cerSim1.ncbiRefSeq transcripts. We performed the same procedure on hg38.ncbiRefSeq, in which transcript annotations in hg38.ncbiRefSeq were converted to rhinoceros coordinates using LiftOver, followed by a search for the corresponding rhinoceros transcripts. The two files, rhinoceros to human and human to rhinoceros, were compared, the corresponding genes were extracted, and a rhinoceros-human correspondence table was generated. We performed the same procedure between humans and mice to obtain a mouse-human correspondence table. By these procedures, the corresponding genes between rhinoceros and humans and between mice and humans were extracted, and a rhinoceros-human-mouse correspondence table was obtained  (table S4).To compare rhinoceros genes with the genes of humans and mice, we made a one-to-one correspondence table of genes by genomic coordinate comparison as described previously ("}
+{"text": "Mixed-phenotype acute leukemia (MPAL) comprises a heterogenous group of leukemias that are genetically, immunophenotypically, and clinically, diverse. Given the rarity of the disease, the diagnosis and treatment of MPAL is extremely challenging. Recent collaborative efforts have made significant progress in understanding the complex genomic landscape of MPAL. Some retrospective studies support starting ALL-type induction followed by an allogeneic stem cell transplant in the first complete remission; however, due to the inherent bias of retrospective data and small case series, a prospective validation of AML- and ALL-based regimen, and the incorporation of targeted therapies based on genetics and immunophenotype are warranted. The prognosis of adults and children with MPAL varies; this justifies modulating the intensity of therapy, including the use of allo-sct as a consolidation strategy. Acute leukemia is often myeloid or lymphoid in origin. Occasionally, leukemia blasts can express both acute lymphoblastic leukemia (ALL) and acute myeloid leukemia (AML) markers, characterized as biphenotypic or bilineal blasts. The World Health Organization WHO-2008) classification of hematopoietic and lymphoid tumors defined this type of leukemia as mixed-phenotype acute leukemia (MPAL), and it represents 1\u20133% of acute adult leukemias. Nearly 40 years ago, this entity was described as \u201cleukemia of ambiguous origin\u201d; however, over the years, several nomenclatures and algorithms have been introduced to better define leukemia .,5,6.4,5,Immunophenotype criteria for lineage classifications in MPAL according to EGIL and WHO classification systems.In 2008, the WHO classification acknowledged lineage-specific antibodies and genetic markers; this was last updated in 2016 and uses a total of 10 antibodies for diagnosis  7,8].,8.7,8].Other WHO-defined leukemias, such as AML with myelodysplasia-related changes (AML-MRC), therapy-related AML, blast-phase chronic myeloid leukemia, or AML with balanced translocations, such as core-binding leukemia  and PML-RARA t, are excluded from MPAL; this is because it has been recognized that these types of leukemia can present with an MPAL immunophenotype. The presence of three or more aberrations is considered an indication for a complex karyotype and is the most common genomic anomaly in MPAL. However, AML-MRC is often characterized by a complex karyotype including monosomy 7 and 5; these mutations are recurrently added to the MPAL series. It is controversial whether such patients should be eliminated from the MPAL category, as they fulfill criteria for an alternative WHO AML diagnosis or be retained in the classification if leukemia blasts otherwise meet the criteria for MPAL ,10,11. IThe current 2016 updated WHO classification for MPAL is subdivided into two genomic categories: BCR-ABL fusion\u2013positive and KMT2A-rearranged  cases. The remaining types of MPAL are reported based on immunophenotype B/myeloid (59%), T/myeloid (35%), or rarely, T/B (4%), T/B/myeloid (2%), or phenotype  7,8,14],8,147,8,According to the SEER database, MPAL carries the worst outcomes among adult leukemias . Due to This review will focus on innovative methods to improve current treatments using the understanding from recent developments in genetic analysis, immunophenotypic, and clinical insights. The exploration of more powerful tools as in artificial intelligence, machine learning, and improved flow cytometry (FC) generates avenues to improve survival outcomes in MPAL .Generally, immunophenotypic analysis, including FC, cytochemistry, and immunohistochemistry (IHC), is required for a precise diagnosis of MPAL. Morphologically, MPAL blasts have a hand-mirror morphology, small to intermediate size, and variable cytoplasm. Occasionally, the 2 blasts could have a distinctive phenotype, morphology, and size .The WHO does not mandate a certain percentage of lineage-specific antigens, unlike in EGIL, and depends on the intensity of antigen expression. The WHO stipulates a myeloid lineage in MPAL with the detection of MPO by cytochemistry, FC, monocytic differentiation, or IHC, and when blasts meet the criteria for B or T lineage . In addiAround 42% of B-ALL cases that express MPO show evidence of t translocation, are likely to express CD13 or CD15, and are associated with a chronic myeloid leukemia blast phase (CML-blast) rather than de novo ALL . Some BuCytoplasmic cluster of differentiation (cCD3) is essential to assign a T-cell lineage in MPAL. CD2, CD7, and CD56 are other T-cell markers that are found in many AMLs. The cCD3 fluorescence determined by fluorochrome should be comparable to that of normal T cells ,26. NatuIn the case of B lineage disease, a strong CD19 expression with another marker or weak CD19 expression with 2 other markers  is indicative; thus, this makes CD19 a mandatory marker, but not adequate for diagnosis. Of note, CD19 is expressed in 7% of all non-acute promyelocytic leukemias, including AML with t, RUNX1 mutation, and NPM1 mutation. Other B cell markers, such as CD10, CD22, CD79a, and PAX5, are expressed in AML and acknowledged in the WHO classification ,29. AlthThe understanding of lineage-specific expression in the context of varied genetic and cytogenetic abnormality continues to remain unclear. A clear distinction could improve therapeutic management and outcomes.In addition to immunophenotype, molecular analyses have become more common in the characterization of MPAL. Genetic alterations seen in AML and ALL are frequently documented in MPAL; thus, they describe its genomic integration and heterogeneity. A median of 2  mutations are seen in MPAL, which is similar to the number of mutations detected in AML or T-ALL; however, MPAL has more mutations than B-ALL. The mutational profile of B/myeloid MPAL is different from that of T/myeloid MPAL . The T/mMutations in T/myeloid MPAL frequently involve the IDH2, WT1, CEBPA DNMT3A, EZH2, PHF6, FLT3, KRAS, NRAS, CDKN2A/B, ETV6, NOTCH1, IL7R, FBXW7, and JAK/STAT signaling proteins. Early T precursor ALL (ETP-ALL) is a subgroup of T-ALL in which NOTCH1 mutations are frequently reported. ETP-ALL has poor outcomes and is considered a form in between T/myeloid MPAL and T-ALL. A notch-1 mutation is reported in 10\u201315% of T/myeloid MPAL, which is slightly less than in T-ALL and ETP-ALL ,34,35.B/myeloid MPAL has mutations in RUNX1, ASXL1, EZH2, and TET2, and deletion in IKZF1 (Ikaros) . ZNF384 The rarity of MPAL with the capability to switch lineages under pressure (treatment) defines the challenges in treating MPAL. The debate on the most appropriate induction regimen remains unresolved over the controversy whether initial therapy should be based on immunophenotype, cytogenetics, or molecular biology. MPAL has a poor prognosis and worse outcomes than standard-risk AML or ALL ; multivaHowever, despite the setbacks, there are multiple ongoing efforts to improve outcomes in MPAL. A growing preponderance of data suggests that an ALL-based induction regimen followed by allo-sct in CR1 stands the greatest chance of benefit. However, if the patient fails induction, treatment can be switched to an AML-like regimen followed by allo-sct in CR1 . RecentlIn a series of retrospective studies, the superiority of ALL-like regimens in pediatric and adult patients has been reported; however, these studies are limited by selection bias, retrospective analysis, and small patient numbers ,43,44.n = 10) that benefited from an AML-like regimen were CD19 negative with no other lymphoid features  = 0.33; 95% confidence interval, 0.18\u20130.58). However, in a multivariate analysis of detailed clinical data, including treatment type, MPAL subgroup, and patient age, there was no OS difference between ALL and AML induction regimens . MPAL patients who received hybrid regimens (combined ALL and AML therapy) had significantly worse survival  [Similar results were reported by a Children\u2019s Oncology Group (COG) study that retrospectively reviewed pediatric MPAL patients who strictly passed through the central review of WHO-defined MPAL in which the 5-year OS were not different between ALL and AML type regimens  .Recent case reports have noted efficacy and successful outcomes with a FLAG  and venetoclax-based induction regimen. In older patients who were ineligible for intensive chemotherapy or allo-sct, the use of a hypomethylating agent (HMA) with venetoclax induced CR with tolerable toxicities ,40,41. An = 27, p = 0.037). However, the composite CR rates (p = 0.58) and OS (p = 0.25) rates were similar between the matched and unmatched group [Recently, the integrated genomic analysis of 31 adult MPAL patients was compared to that of AML and ALL patients, and methylome expression analysis segregated T/myeloid MPAL and B/myeloid MPAL to T-ALL and AML-like leukemia, respectively. CR was more likely if therapy matching the methylome was administered, with remission rates of 72% for matched and 22% for unmatched therapy  treated with an ALL-like regimen, a flow-based MRD of <0.01% at the EOI was the most important predictor of EFS in multivariate analysis  [Measurable residual disease  assessment is one of the most common prognostic indicators for therapeutic decision-making in ALL. In the iBFM AMBI2012 trial of pediatric MPAL, early eradication of MPAL clones at the end of induction (EOI) had improved EFS. MPAL patients (CD19-positive) with a positive MRD (>0.01%) by the end of 12 weeks had a worse EFS of 50% \u00b1 19% compared to 83% \u00b1 5.3% for the entire CD19-positive cohort treated with an ALL-like regimen . In data 0.0036) . Moreove 0.0036) .p = 0.002) [p < 0.001) [In patients with BCR-ABL fusion positive MPAL, the addition of a tyrosine kinase inhibitor (TKI) to the chemotherapy backbone is highly recommended. Patients with Philadelphia positive (Ph+) MPAL who received TKIs had a significant reduction in the risk of death in comparison to Ph (-) MPAL patients  ,51. Howe= 0.002) ,52, wher< 0.001) ,51. Inco< 0.001) .Targeted approaches can be used in high-risk disease, especially in patients with MRD and in the relapsed refractory setting. Targetable pathways of frequently activated mutations, such as FLT3 through ITD and TKD, would benefit from a FLT3 inhibitor ,55. A reGiven the lack of prospective trials and rarity of the immunophenotypically complex MPAL, diagnosing treatment failure may be challenging from the emergence of subclones, lineage switch, clonal shift, or small immunophenotypic residual population. The most commonly used approach is changing therapy to an AML-like regimen if induction therapy used an ALL-like regimen, and vice versa. Additive toxicity is a concern, however. In a recent pediatric case series of MPAL with MRD, there were no adverse outcomes; nonetheless, this may be rather debilitating in older patients . A few cAllo-sct is usually reserved for acute leukemia patients with high-risk cytogenetics; MPAL has historically been regarded to have high disease resistance and inferior survival. In a retrospective review of 500 adult patients with MPAL, reported in the European Society of Blood and Marrow Transplant Research registry, the 3-year OS for patients that underwent allo-sct was 56%. When total body irradiation (TBI) was included in the conditioning regimen, survival was improved compared with other myeloablative regimens ,70. AccoThe assessment of MRD is challenging in MPAL due to its variable immunophenotypes and the emergence of subclones during treatment. In the largest series of 233 patients in the iBFM-AMBI2012 retrospective analysis, it was noted that patients with an MRD \u2265 5% at the EOI therapy had a 5-year EFS of <50%. Current guidelines on the treatment of MPAL mainly suggest an ALL-focused regimen unless the patient does not express CD19 and does not have expression of B-cell markers according to immunophenotyping. Hence, the COG has recommended using an MRD cutoff of <5% post-induction and <0.01% post-consolidation to carry on with any planned ALL-based regimen. Patients who do not reach these target goals would benefit from a switch in therapy to an alternative AML-type regimen, or early intensification followed by a suitable donor search for allo-sct consolidation .Redefining the classification and discovering the genomic underpinnings of MPAL are some of the significant advancements that have been made in the past decade. Contextualizing the emerging understanding of the biology of MPAL to allow homogeneity in treatment strategies would enable the risk stratification of patients and treatment approaches between MPAL subsets. This would present the opportunity to compare outcomes between ALL- and AML-based regimens and identify patient subsets that are likely to benefit from either therapy. Given the modest success with targeted molecular and immunotherapies in the salvage setting, the next step in advancing the field should include incorporating novel therapies in de novo MPAL."}
+{"text": "The nanofibers had an average diameter of (840 \u00b1 230) nm. The nanofiber implants were placed and tested at 2, 4, and 6 weeks in the subcutaneous tissue of the rats to give a chronic inflammatory infiltrate, characteristic foreign body reaction, which decreased slightly at 6 weeks with the addition of hydroxyapatite and alumina ceramic particles. The biocompatibility test showed a foreign body reaction that produces a layer of collagen and fibroblasts. Tissue loss and necrosis were not observed due to the coating of the material, but a slight decrease in the inflammatory infiltrate occurred in the last evaluation period, which is indicative of the beginning of the acceptance of the tested materials by the organism.Biodegradable polymers of natural origin are ideal for the development of processes in tissue engineering due to their immunogenic potential and ability to interact with living tissues. However, some synthetic polymers have been developed in recent years for use in tissue engineering, such as Poly-\u03b5-caprolactone. The nanotechnology and the electrospinning process are perceived to produce biomaterials in the form of nanofibers with diverse unique properties. Biocompatibility tests of poly-\u03b5-caprolactone nanofibers embedded with hydroxyapatite and alumina nanoparticles manufactured by means of the electrospinning technique were carried out in Wistar rats to be used as oral dressings. Hydroxyapatite as a material is used because of its great compatibility, bioactivity, and osteoconductive properties. The PCL, PCL-HA, PCL-\u03b1-Al Human beings have the need to repair the loss of tissues caused by trauma, diseases, or deterioration. One of the ways to correct the loss of tissue is through autologous implants. However, these types of implants have limitations in relation to their use, such as the amount of material available, the surgical procedures required to obtain the implant, complications in healing, and even infection in the donor wound sites ,2. ThereFor a material to be used in a human being, it must be biocompatible. In determining biocompatibility, different tests are required that can define whether it is suitable for use in a biological system. Among the tests used to determine the biocompatibility of a material are mechanical simulations, in vitro tests, toxicological tests, and tests on experimental animals. The most used preliminary biocompatibility tests are the MTT and proliferation tests in fibroblasts, which, in turn, provide an overview of the possible effect that the material could have on an experimental animal, which is the subsequent step to in vitro tests ,6. In te2O3) is its high hardness; resistance to abrasion; and high chemical, electrical, and mechanical resistance. Currently, alpha alumina has been recognized as a biocompatible ceramic for biomedical applications, as well as the development of both dental and prosthetic implants\u2014it has even been used as a substitute for metallic materials thanks to its hardness [Hydroxyapatite is a material with biomedical applications due to its great compatibility, bioactivity, osteoconductive properties, and great similarity to the inorganic phase of human bone . One of hardness . Finallyhardness ,14,15; thardness . Studieshardness . The pri3)2\u00b74H2O  and (NH4)2HPO4  were dissolved in deionized water separately; the phosphate solution was then added dropwise to the nitrate solution and mixed with a magnetic stirrer for 60 min. The pH of the final solution was adjusted to 11 using NH4OH  and stirred for 60 min at room temperature. The precipitate formed was separated from the liquid by centrifugation at 12,500 rpm and washed twice with deionized water and once with isopropanol, centrifuging between each washing. The precipitate was heat-treated in a high temperature oven  at 100 \u00b0C for 24 h and then calcinated at 800 \u00b0C for two hours in an oven (Thermo Scientific \u00a9 Thermoline\u2122) using a ramp of 5 \u00b0C/min. After calcination, the fragile agglomerates were grinded in an agate mortar to obtain fine powders according to a previously reported method [Hydroxyapatite powders were prepared by the chemical precipitation method. Ca(NOd method .2CH)3) was obtained using the chemical synthesis described by Reyes-L\u00f3pez et al. [2) as a catalyst to obtain the aluminum formate solution that was dried by spraying to produce a fine granulated organometallic precursor. The heat treatment was carried out by microwave combustion. Each of the emulsions was exposed to microwaves (1000 watt) for 5 min to obtain porous agglomerates. The agglomerates were calcined in a muffle furnace at a temperature of 1050 \u00b0C for one hour in an atmosphere rich in oxygen, using a ramp of 10 \u00b0C/min. After calcination, the brittle agglomerates were grinded in an agate mortar to obtain fine alpha alumina powders.The synthesis of alpha alumina nanopowders was carried out from the preparation of emulsions with a organometallic precursor of aluminum formate and urea, using absolute ethanol (\u226596%) as solvent, until a homogeneous white paste was obtained. The aluminum formate . In the electrospinning process, the distance between the needle and the collector was 10 to 14 cm, using a feed flow of 10 to 16 \u03bcL/min, and the voltage used was 8 to 11 kV. The environmental parameters during the electrospinning process were 21 \u00b0C and 35\u201342% for temperature and relative humidity, respectively; this was described by Reyes-L\u00f3pez et al. for the in vitro evaluation of poly-\u03b5-caprolactone-hydroxyapatite-\u03b1-alumina electrospun fibers on the fibroblast\u2019s proliferation [2O3, and PCL-HA-\u03b1-Al2O3. The PCL, PCL-HA, PCL-\u03b1-Al2O3, and PCL-HA-\u03b1-Al2O3 fibers obtained by the electrospinning technique were characterized by infrared spectroscopy (FTIR) using an Alpha platinum-ATR Bruker spectrometer . For scanning electron microscopy (SEM), a JEOL JSM-6400 device  operating at 20 kV and equipped with an X-ray scattering spectrometer (EDX) was used. The magnifications used were 5000\u00d7; 10,000\u00d7; and 20,000\u00d7. For each characterization technique, a sample of each fiber measuring 1 cm \u00d7 1 cm was used. The exhaustive characterization of particles and fibers was already reported in the first study of these fibers; so, in this work, only a short characterization of scaffolds is presented [The solutions were prepared from the dilution of poly-\u03b5-caprolactone (PCL)  in 10% in acetone; then, 2% HA powder and 2% \u03b1-Alferation . Four diresented .Wistar rats , weighing approximately from 150 to 300 g, were used, divided into three groups, and one rat was used as a control. Each of the rats was housed individually in conditions established by the American Veterinary Medical Association\u2019s (AVMA), NOM-062-ZOO-1999, and the Institutional Animal Care and Use Committee (IACUC), Comite Institucional de Etica y Bioetica, Universidad Autonoma de Ciudad Juarez (CIEB-UACJ). The technical specifications for the production, care, and use of laboratory animals were adhered to during the entire process of the experimental phase . It needs to be stated that the rats were fully anesthetized and the personnel who performed the procedure were fully trained. Three fractions of each of the nanofibers were taken. The implants measured approximately 8\u201310 mm in length by 1.3 mm in internal diameter. Once the implants were made, they were UV-sterilized for half an hour to avoid any type of contamination during the implantation process. For the anesthetic process, an intramuscular injection of ketamine/xylazine  was performed in one of the hind legs of the rats. After anesthetizing the rats, the dorsal area was shaved and then covered with iodine  to avoid any infection during the surgery. After applying anesthesia, the material was implanted. With the help of a previously sterilized veterinary surgical kit, 4 incisions were made in the dorsal part of the rats. Once the materials were implanted, the wounds were sutured with 2 points per incision.Euthanasia was performed at 2, 4, and 6 weeks after implantation (one rat every 2 weeks). Intravenous injection of sodium pentobarbital is the preferred method for euthanizing horses, dogs, cats, and rodents, causing a quick and painless death of the body . An overFor inclusion in paraffin, the biopsies were placed in cassettes to be subsequently dehydrated by ethanol  with a gradation increasing to 100%. After doing so, the samples were transferred to xylene , which was used as an intermediate reagent. The cassettes were taken and transferred to paraffin previously liquefied in an oven. Liquid paraffin was poured into various molds. Samples were introduced and refrigerated at 4 \u00b0C for hardening. The paraffin blocks with the tissues were cut to a thickness of 5 \u00b5m and, once the cuts were obtained, they were placed in a 37 \u00b0C water bath to warm them up. Afterwards, the cuts were placed in an oven at 60 \u00b0C for the deparaffinization process. Tissues were rehydrated with decreasing ethanol until they reached water. Tissues were dipped in hematoxylin (Sigma Aldrich) for 3 min, washed with water, then dipped in eosin red (Sigma Aldrich) for 30 s and washed with ethanol to remove traces of dyes. Tissues were dehydrated again with increasing ethanol. Once the coverslip was placed on the slide with the histopathological cut, the tissues were observed under a microscope. Finally, the plates were observed in an Oxion light microscope at 10\u00d7 and 40\u00d7 and photos were taken by a Cemex camera .2O3 powders were characterized by SEM, EDX, and dynamic light scattering (DLS). In 2O3 are appreciated and the existence of nanoparticles between 35 and 62 nanometers in diameter is observed. This can be corroborated with the dynamic light scattering analysis , (110), (113), (024), (116), (018), (214), and (300) planes, respectively (JCPDS 10-0173) [\u22121 for the PO4\u22123 group. The bands at 723 and 1020 cm\u22121 are bands belonging to the pyrophosphate groups (P2O7\u22124) and hydrogen phosphate (HPO4\u22122), respectively [2O3 nanopowders for bands corresponding to the flexural stretching of the Al\u2013O bond at 440 cm\u22121 and bands corresponding to the tension stretching of the Al group. For Al\u2013O bond, bands at 440, 570, and 640 cm\u22121 are prominent characteristics for the alpha phase of alpha alumina [2O3 and hydroxyapatite are lesser in proportion in the polymer matrix. An additional suggestion is that the ceramic particles remain embedded in the polymer, which does not allow the interaction of infrared radiation; therefore, it is not possible to observe the characteristic vibrations of ceramic particles such as \u03b1-Al2O3 and hydroxyapatite, as reported previously [\u22121 for the CH3 group and deformation stretching at 2865 cm\u22121 for the methylene group; vibrational stretching bands at 1720 cm\u22121 for C=O, bands stretching at 1365 and 1470 cm\u22121 for the COC group, and vibration bands by asymmetric stretching at 1240, 1110, 1165, 960, 732, and 450 cm\u22121 for the COC group; and vibrations at 2800 and 2650 cm\u22121 bands corresponding to the -CH2 group [In 10-0173) ,17\u2014and f10-0173) ,17,18. I (024), 1, (018),  alumina . The obteviously ,17. The H2 group ,20,21.2O3, and 2O3. The images obtained by SEM show that the nanofibers containing PCL and ceramic particles with different diameters are unidirectional. Fibers with PCL polymer  \u03bcm; in addition, some agglomerations of ceramic material can be observed. 2O3 scaffold. A contrast is observed between the HA and \u03b1-Al2O3 particles, where the HA particles present a characteristic brightness in contrast to the \u03b1-Al2O3 particles that are observed as opaque; the fibers present a random distribution with a rough surface due to the encrustation of the ceramic particles and have an approximate diameter of (1.39 \u00b1 0.64) \u03bcm. polymer a show a 2O3, and PCL-HA-\u03b1-Al2O3) for six weeks show differences when performing the evaluation of the inflammatory infiltrate in the contact area of the material every two weeks. The initial placement of the implant of the material through an incision causes injury to the animal with a natural inflammatory response by the body, due to loss in the continuity of the tissue because of the injuries caused in the vasculature found in the subcutaneous connective tissues [Preliminary in vivo biocompatibility tests in subcutaneous tissue of Wistar rats for the four different materials  are fully biocompatible with the subcutaneous tissue of Wistar rats, it can be said that at least there is no damage observed in the tissues adjacent to the implant or loss of tissue, in addition to the fact that, as previously explained, the incorporation of ceramic particles to the PCL helps to slightly decrease the degree of inflammatory infiltrate at 6 weeks, which could be an indication of acceptance by the body to the material.Once neutrophils migrate to the implant area, they try to engulf the material, an action that is not possible since the material is larger than the neutrophil, this process is known as \u201cfrustrated phagocytosis\u201d. Failure to achieve phagocytosis begins a type of chronic inflammation such as the one that can be seen in 2O3, mineralization and certain nodules that have different morphologies produced by the cells can be observed; alpha alumina allows the adhesion, proliferation, and mineralization process. The production of crystals or nodules is lower because alpha alumina does not present chemical interaction directly with the cells. PCL-HA-\u03b1-Al2O3 favors cell adhesion and proliferation, and allows mineralization, forming larger crystals in contrast to those present in the PCL-\u03b1-Al2O3 composite. A collagen fiber can be observed, entangled in the fibers of the composites according to histological studies for the start and development of mineral formation [Comparing the infrared spectrum  and SEM ormation .2O3, and PCL-HA-\u03b1-Al2O3 nanofibers were manufactured by electrospinning technique with an approximate size of (0.84 \u00b1 0.23) \u03bcm. The diameter of the nanofibers increased with the addition of the same ceramic particles that caused a roughness in the surface of the nanofibers. The characterization of the nanofibers and nanopowders of ceramic particles showed that the ceramic particles are embedded in the PCL. Additional bands for chemical bonds cannot be observed in infrared spectroscopy, showing a physical union. The subcutaneous tissues of Wistar rats were evaluated at 2, 4, and 6 weeks, observing a chronic inflammatory infiltrate\u2014a characteristic foreign body reaction\u2014which decreased slightly at 6 weeks with the addition of ceramic particles. It is said that the manufactured composites are not totally biocompatible since a foreign body reaction was presented; however, as tissue loss and necrosis were not observed and there was a slight decrease in the inflammatory infiltrate in the last evaluation period, it can be used for the beginning of an acceptance of the organism for the tested materials. This preliminary study shows adjustments for future research, such as the application of the material on a membrane and not on a roll, which would help the contact of the material with the tissue of Wistar rats.The PCL, PCL-HA, PCL-\u03b1-Al"}
+{"text": "Traumatic brain injury (TBI) is one of the leading causes of morbidity, disability and mortality across all age groups globally. Currently, only palliative treatments exist, but these are suboptimal and do little to combat the progressive damage to the brain that occurs after a TBI. However, multiple experimental treatments are currently available that target the primary and secondary biochemical and cellular changes that occur after a TBI. Some of these drugs have progressed to clinical trials and are currently being evaluated for their therapeutic benefits in TBI patients. The aim of this study was to identify which drugs are currently being evaluated in clinical trials for TBI. A search of ClinicalTrials.gov was performed on 3 December 2021 and all clinical trials that mentioned \u201cTBI\u201d OR \u201ctraumatic brain injury\u201d AND \u201cdrug\u201d were searched, revealing 362 registered trials. Of the trials, 46 were excluded due to the drug not being mentioned, leaving 138 that were completed and 116 that were withdrawn. Although the studies included 267,298 TBI patients, the average number of patients per study was 865 with a range of 5\u2013200,000. Of the completed studies, 125 different drugs were tested in TBI patients but only 7 drugs were used in more than three studies, including amantadine, botulinum toxin A and tranexamic acid (TXA). However, previous clinical studies using these seven drugs showed variable results. The current study concludes that clinical trials in TBI have to be carefully conducted so as to reduce variability across studies, since the severity of TBI and timing of therapeutic interventions were key aspects of trial success. Traumatic brain injury (TBI) is one of the leading causes of morbidity, disability and mortality across all age groups ,2. The bTBI is classified into different categories including closed head, penetrating and explosive blast TBI. TBI patients suffer a variety of symptoms including headache, nausea, seizures, amnesia, aggression and anxiety. These symptoms can appear within seconds after a TBI, and some of the effects can last months to years ,6. CloseDamage to the brain occurs both from the primary and secondary injury processes. The primary injury results from the direct mechanical forces acting on the brain during the initial insult whilst the secondary injury results from tissue and cell damages that follow the initial insult. The primary injury causes both focal and diffuse consequences which leads to tissue necrosis, hematomas and intracerebral hemorrhages, and eventually damages axons, oligodendrocytes and the vasculature, leading to oedema and ischemic brain damage ,8,9,10. Many of the treatment regimens for TBI focus on stabilization of the injured brain and prevention of secondary injury processes. Since secondary injury characteristics develop progressively, a therapeutic window of opportunity exists in order to protect further loss of neurons and glia as well as targeting excitotoxicity, inflammation, oxidative stress and apoptosis. An increased understanding of the clinical characteristics and the underlying complex pathophysiological mechanisms of TBI has led to the development of several novel and promising therapeutic approaches that have shown positive effects in preclinical studies. Many of these drugs have progressed from preclinical studies into clinical evaluation of their usefulness in treating TBI. Some of the long-term consequences of TBI include problems with balance, motricity, headaches, cognitive and behavioral problems and post-traumatic epilepsy ,13,14,15ClinicalTrials.gov on 3 December 2021 and present data on the number of trials that have been completed and the number of patients in each trial, as well as reviewing the drug treatments that are being tested. The review also aims to provide some guidelines on improving future clinical trial design, which need to be considered in this area of unmet medical need.The aim of this review is to present an overview of the clinical trials that were registered with ClinicalTrials.gov (accessed on 3 December 2021) database was searched with the terms \u201cTBI\u201d OR \u201ctraumatic brain injury\u201d AND \u201cdrug\u201d. As of 3 December 2021, there were 361 trials registered on Clinical Trials.gov that were returned after searching for \u201cTBI\u201d OR \u201ctraumatic brain injury\u201d AND \u201cdrug\u201d  and 2017 (17), with fewer studies completed since then . The totOf the completed studies, 24 were early Phase I, 8 were Phase I/II, 35 were Phase II, 5 were Phase II/III, 20 were Phase III, 22 were Phase IV and 24 were not applicable to be assigned to a phase of study . Between the completed studies, 125 different drugs for TBI were evaluated. However, only seven drugs were used in three or more studies across the different clinical phases of study, including amantadine, botulinum toxin type A, hyperbaric oxygen, methylphenidate, NNZ-2566, Rivastigmine and tranexamic acid (TXA) . There are currently 18 drugs in Phase IV clinical trials. These are drugs that have been approved previously but are being investigated in studies where the side effects caused over time are being evaluated. These include Dipeptiven, propranolol, methylphenidate, rHGF, Lisdexamfetamine, Venlafaxine, Rivastigmine, citalopram (celexa), Doxycycline, simvastatin, Enoxaparin, Levetiracetam, Androgel (testosterone), amantadine, botulinum toxin type A, intravenous acetaminophen, Nuedexta and 20% mannitol.ClinicalTrials.gov (accessed on 3 December 2021). Surprisingly, only six study results have been published . Of the 44 studies, 30 showed no statistical difference between treatment and controls, 7 studies showed better results in the treatment arm but lacked statistical data, 4 studies had only a single arm and so comparisons could not be made, 2 studies showed worse outcomes in the treatment arm, whilst only 1 study demonstrated significantly better results in the treatment arm (NCT02270736). Twenty-four studies failed to meet their recruitment targets whilst seventeen studies recruited more patients than posted on ClinicalTrials.gov (accessed on 3 December 2021).There were only 44 clinical trials in TBI that have been completed and where results are available. Amantadine is a dopaminergic agent and is an antagonist of N-methyl-D-aspartate (NMDA), approved by the FDA for use in the prevention of influenza and Parkinson\u2019s disease . AmantadBotulinum toxin type A (BoNT-A) is a potent neurotoxin produced by the Gram negative aerobic bacterium Clostridium botulinum. BoNT-A has been used as a pharmacological treatment for the management of spasticity and exerts its effects by binding pre-synaptically to high-affinity recognition sites on the cholinergic nerve terminals. This inhibits the release of acetylcholine, causing temporary neuromuscular blockade and muscle relaxation ,29. The Hyperbaric oxygen therapy (HBOT) requires the inhalation of 100% oxygen under a pressure that is greater than 1 atmosphere. Experimental studies of HBOT after TBI demonstrates inhibition of apoptosis, suppression of inflammation, protection of the blood\u2013brain barrier, and promotion of angiogenesis and neurogenesis, with a range of HBOT treatments from 1.5 atmospheres to 3 atmospheres and up to 90 min twice daily for 40 days to 45 min for two sessions . HBOT inTBI results in alterations in the chemistry and structure of brain cells and long-term changes in the levels of neurotransmitters. Reduced serotonin and catecholamine are related to TBI-associated neurological comorbidities . MethylpNNZ-2566 is an analogue of endogenous tripeptide glycine-proline-glutamate with improved stability, and after penetrating ballistic-like brain injury has been shown to be neuroprotective as well as improved motor function and reduced incidence, frequency and duration of post-injury seizures ,54,55,56Rivastigmine treatment after severe closed head injury reduced cerebral oedema and accelerated motor and cognitive function recovery, effects that were mediated by increased cholinergic activity at both muscarinic and nicotinic receptors . There wUncontrolled hemorrhage after trauma is a cause of early mortality in major trauma, accounting for 30\u201340% of all deaths. TBI is associated with intracranial bleeds in 25 to 40%, 3 to 12%, and 0.2% of severe, moderate and mild TBI patients, respectively . In addiDespite numerous studies showing some benefits of TXA in TBI, a systematic review of nine RCTs with 14,747 patients found no statistical benefits on mortality or disability after TBI . This waSeveral TBI studies are currently ongoing, with 3 studies that are active but not recruiting , 37 studOther drugs currently being tested in Phase III studies include Biperiden Lactate to reduce post-TBI epilepsy, dexamethasone to reduce pericontusional oedema, Dalteparin to prevent venous thromboembolism, NT201 to reduce lower limb spasticity after TBI, inhaled nitric oxide to reduce secondary brain damage, Nucleo CMP Forte to protect against glutamate toxicity in children, and the effect of citoflavin to improve cerebral blood flow, restore impaired consciousness and improve cognitive outcomes . ClinicalTrials.gov (accessed on 3 December 2021) include TXA, erythropoietin, phenytoin sodium, Dalteparin, propranolol, NT201 and Dexamethasone. Examples of some of the largest studies (>500 participants) that are currently registered active on Erythropoietin (EPO) is a hemopoietic growth factor with neurocytoprotective effects and is normally produced in the spleen, liver, bone marrow, lung and brain . AlthougWhat is also clear is that there were different EPO treatment doses used across the seven studies, which may account for variability. For example, EPO administration ranged from 500 IU/kg to 40,000 IU, subcutaneously or intravenously injected, some with repeated doses at days and weeks after the initial doses . The majPhenytoin is a widely used anti-epileptic drug used to control post-traumatic seizure prophylaxis. The use of anti-epileptic drugs in TBI remains a point of contention. However, it is recognized that post-TBI seizures develop in 12% of severe TBI cases and that phenytoin treatment reduces this to 3.6% . CurrentTBI patients are at high risk of venous thromboembolic events (VTE), defined as either deep vein thrombosis (DVT) or pulmonary embolism (PE). The risk of baseline VTE is approximately 5%, and this increases to 30\u201360% in patients with TBI ,83. CommIn a recent systematic review that included 21 studies, VTE prophylaxis did not lead to TBI progression and VTE prophylaxis with 24\u201372 h after TBI was safe in patients with stable injuries . There wSevere TBI causes a surge in catecholamines such as epinephrine and norepinephrine, and these remain elevated in patients with persistent coma or who are moribund . In thosThe use of \u03b2-blockade, such as the non-selective \u03b2-blocker propranolol in pre-clinical mouse studies, reduced brain oedema, improved neurological outcomes, increased cerebral perfusion and decreased cerebral hypoxia ,94,95. PNT201 is botulinum toxin type A (BoNT-A) and was mentioned earlier in this review. Initial studies in patients with brain injury or cerebral palsy offered significant reductions in spasticity in elbow, wrist, fingers and ankle muscles receiving high doses of NT201 ,32,33,34Cerebral oedema after TBI is a serious complication which corticosteroids, including glucocorticoids, can ameliorate effectively . DexametThe DEXCON-TBI study (NCT04303065) is a multicenter, randomized triple-blind placebo-controlled study that will quantify the effects of the administration of dexamethasone on the prognosis of TBI patients with brain contusions and pericontusional oedema. The primary outcome for the trial is improvements in the Glasgow scale outcome extended (GOSE) measure with a number of secondary outcomes. The study will recruit 600 participants with a short and descending course of dexamethasone. The results of this study are eagerly awaited and will determine if dexamethasone is likely to confer benefits when administered acutely.ClinicalTrials.gov (accessed on 3 December 2021) containing the search terms \u201ctraumatic brain injury\u201d OR \u201cTBI\u201d AND \u201cdrug\u201d as of 3 December 2021. Of the trials listed, 138 were completed, 116 were withdrawn, suspended or the status was unknown, 46 were still recruiting, 5 were active but not yet recruiting, 13 were not recruiting and 2 were enrolling by invitation. The average number of patients recruited per study was 865  with a median of 50 patients/study. Of the completed studies, 125 different drugs were reported to be evaluated. Only seven drugs appeared in three or more trials, which represented the most promising treatment options for TBI and included amantadine, botulinum toxin type A, hyperbaric oxygen, methylphenidate, NNZ-2566, Rivastigmine and TXA. This study reports that there were a total of 361 registered clinical trials listed on ClinicalTrials.gov (accessed on 3 December 2021) and of these, only 6 studies have been published in a peer reviewed journal. Interestingly, the published studies were only studies that were positive or contained some aspect of positive data that could be reported. All of the other studies with results were largely negative and remained unpublished in peer reviewed journals. Of the studies that posted results, 30 showed no statistical difference between the treatment arm and the placebo/control arm, 2 studies showed worse outcomes and only 1 study demonstrated statistically significant results. In addition, seven of the studies showed better results in the treatment arm but lacked statistical analysis, whilst four studies only included a single arm, presumably due to low study recruitment, and so comparisons were not possible. A significant number of studies also failed to meet their recruitment targets and so a number of studies were underpowered. Surprisingly, some studies recruited more patients than was posted on ClinicalTrials.gov (accessed on 3 December 2021).Only 44 of the 138 completed trials posted results on p = 0.005 for time effect) [Although TXA appears to be the most likely to translate to the clinic, as alluded to in  effect) . In thes effect) .Of the studies that were completed and published in peer-reviewed journals, there were other studies that failed to meet the primary outcomes but reported statistically significant data in other outcomes or subgroups. Whether this is helpful in improving the design of future clinical trials remains to be seen. However, these studies highlight several aspects of future clinical trial design that need to be taken into account. Although a variety of drugs are being analyzed in clinical trials in TBI, the variability in the reported study results warrants some discussion and refinement in the design of future clinical trials. One major issue within clinical trials of TBI is that all TBI patients, including severe, moderate and mild TBI, are often included. There are clearly significant pathological differences between severe, moderate and mild TBI and therapeutics will have different levels of benefits depending on injury severity. Even using the GCS to stratify TBI patients, heterogeneity is inevitable, since multiple causes may contribute to the same GCS score including diffuse axonal injury, diffuse swelling, contusion and hematoma.TBIs are also heterogenous , and hence the outcome of potential treatments are governed by multiple factors including injury location, physiology and whether the TBI is associated with extracranial injuries. Approximately a quarter of \u201cmild\u201d head injury patients do not return to work and >80% of patients have associated problems even after one year post-TBI, calling into question the term \u201cmild TBI\u201d. Therefore, future studies should stratify patients carefully prior to enrollment in a clinical trial and target only the same patient severities.Another key consideration in the design of clinical trials is timing of therapeutic intervention. Some treatments will need to be given as early as possible whilst other treatments can be given later. For example, treatments for oedema and to control bleeding are likely to be required immediately after injury and probably best given during the prehospital period to control these adverse events. Neuroprotective treatments may also need to be given within minutes of the injury, which is difficult, since neurons begin to die within minutes of TBI and delays may mask a real neuroprotective effect of a given drug.Most acute TBI studies are conducted in intensive care which is a safe and controlled environment. However, secondary injuries are likely to occur during the prehospital period where hypoxia, hypotension and expanding hematoma may cause the greatest amounts of neurological damage and where therapeutic interventions may have the best impact. Hence, future clinicals trials should consider studies in the prehospital environment.ClinicalTrials.gov (accessed on 3 December 2021). Interestingly, these were either studies that were positive or had some positive data that could be reported. It is therefore a concern that only studies with positive data are being published. All of these clinical trials should be written up and published in peer reviewed journals whether positive or negative. This is especially true since significant amounts of resources, manpower and time have been spent on such clinical trials. The studies themselves have value in the sense that it informs other researchers of particular treatments or the design of better studies to obtain unequivocal data regarding the efficacy of a particular compound. The issue of positive publication bias has been highlighted by many and may result in bias in meta-analyses, leading to distortion of literature and misleading researchers, doctors and even policymakers in their decision making [One significant issue is that not all clinical trials are published as manuscripts. Only 6 studies were published from amongst the 44 clinical trials that had results posted on n making ,105,106.New clinical trial designs are being recommended in TBI to enhance therapy development . These i"}
+{"text": "Pyrus pyrifolia cv. \u2019Hosui\u2019 pear fruit, as evidenced by the reduction in fruit weight loss, inhibition of firmness loss, cell wall degradation and soluble sugars, and retention of total phenols. Based on comparative transcriptomic data, a total of 3837 and 1387 differentially expressed genes (DEGs) were identified during room-temperature storage of control fruit and between SA-treated and control fruit, respectively. Further KEGG analysis revealed that the DEGs were mainly implicated in plant hormone signal transduction, starch and sugar metabolism, and cell wall modification. Moreover, exogenous SA treatment also altered the expression of many transcription factor (TF) families, including those in the ethylene-responsive factor (ERF), NAM, ATAF, CUC (NAC), basic helix-loop-helix (bHLH), basic leucine zipper (bZIP), and v-myb avian myeloblastosis viral oncogene homolog (MYB) families. Together, the results offer important insights into the role of SA-responsive genes in controlling fruit ripening in sand pears.Postharvest ripening of sand pear fruit leads to quality deterioration, including changes in texture, flavor, and fruit color. Salicylic acid (SA), an important defense-related hormone, delays fruit ripening and maintains fruit quality, but the underling mechanism remains unclear. Herein, we evaluated the efficacy of SA in delaying the ripening process of  Pyrus spp.) are an economically important fruit crop with a juicy taste and rich nutrition, and they are widely planted around the world  H2SO4 and diluted with 80% H2SO4 to 1000 mL). The mixtures were then heated in a 100 \u00b0C water bath for 10 min. After cooling to room temperature, absorbance measurements were carried out at 625 nm. The results were expressed in mg/g. Each component was replicated 3 times (n = 3).Pectin was determined by the carbazole method . First, d method . The extn = 3).Soluble sugars, including sucrose, glucose, fructose, and sorbitol, were measured as described by Miao et al. , with sl\u00ae Ultra\u2122 RNA Library Prep Kit for Illumina  and were then sequenced using the Illumina Novaseq6000 platform by Gene Denovo Biotechnology . The clean reads were obtained by removing poor-quality reads  and mapped to the Pyrus bretschneideri \u2018DangshanSuli\u2019 genome . Genes with average FPKM \u2265 1, |log2 (fold change)|\u2265 1, and p-values < 0.05 were assigned as the DEGs.The total RNA of \u2018Hosui\u2019 pear fruit obtained from each sampling point was extracted by the hexadecyl trimethyl ammonium bromide (CTAB) method as described previously . In ordeApproximately 1 \u03bcg of total RNA was reverse-transcribed into first-strand cDNA using a PrimeScript\u2122 RT reagent kit in conjunction with gDNA Eraser . Twelve significantly expressed DEGs were selected for qRT-PCR analysis, and gene-specific primers were designed using the online software Primer3 .Data analysis was performed with Microsoft Excel. The significant differences between treatments were identified using two-tailed Student\u2019s"}
+{"text": "To evaluate nutrition literacy status and its association with adherence to the Mediterranean diet (MD), anthropometric parameters and lifestyle behaviours among early adolescents.This is a cross-sectional study. Nutrition literacy was evaluated using the \u2018Adolescent Nutrition Literacy Scale\u2019. Dietary intake was assessed by 24-h food recall. The \u2018Mediterranean Diet Quality Index\u2019 was used to evaluate adolescents\u2019 adherence to the MD. Physical activity was assessed using the International Physical Activity Questionnaire (IPAQ). Body weight, height, waist, hip and neck circumference were measured.Four secondary schools in \u0130zmir, T\u00fcrkiyeThe study included 1074 secondary school students.P < 0\u00b705). According to IPAQ, active adolescents had higher nutrition literacy scores than inactive adolescents. There was no significant difference in BMI and anthropometric measurements of the adolescents according to their nutrition literacy level. Linear regression analysis showed that each unit increase in nutrition literacy increased adherence to the MD by 0\u00b7286 points (\u03b2 = 0\u00b7286) and decreased total screen time by 0\u00b7182 points (\u03b2 = \u20130\u00b7182).Adolescents\u2019 nutrition literacy was at a moderate level. Nutrition literacy scores were significantly lower in those who skip main meals. Adolescents with high nutrition literacy had higher intakes of fibre, protein, protein, Ca, K, Mg, P, vitamin C, folate and Fe intake than those with low and moderate nutrition literacy (These findings showed that nutrition literacy among early adolescents was not optimal, and a higher nutrition literacy score was significantly associated with higher MD adherence, and healthy eating habits and lifestyle behaviours. Recently, it has been reported that adolescents are gradually moving away from the Mediterranean diet (MD)  which represents a healthy and sustainable diet for all age groups and has a significant impact on the prevention of cardiovascular and metabolic disorders\u20134. Numerous studies have shown that adolescents have low adherence to the MD, but high adherence to the Western diet pattern, which is characterised by a high-energy diet style and ultra-processed foods, rich in saturated fats and low in micronutrients\u20136. In addition, it was reported that 80 % of adolescents lack physical activity, and screen-based sedentary behaviours such as watching TV and playing video games are very common among adolescents,8. Unhealthy eating habits, sedentary behaviours and physical inactivity are all recognised as risk factors for chronic diseases, including diabetes mellitus, CVD and obesity,10. Recently, it has been reported that nutrition-related problems and behaviours among children and adolescents are associated with nutrition literacy,9,11.Adolescence is considered the best period to develop throughout life positive health behaviours. Lifelong eating habits, which are a part of the lifestyle, are shaped in this period. A cross-sectional study involving 2\u00b7869 adults has shown a significant association between nutrition literacy and adherence to the MD. Tehrani et al. found that a higher nutrition knowledge score was associated with a higher MD adherence score in Iranian female adolescents. A study conducted on adolescents found that there was a relationship between nutrition literacy and BMI, daily lifestyle behaviours, and eating habits. Another study found that nutrition literacy scores were positively related to smaller fast-food portion sizes and lower frequency of intake of packaged or processed snacks among school age children and adolescents.Nutrition literacy is defined as \u2018the degree to which individuals have the ability to receive, process, and understand the nutritional knowledge and skills necessary for making appropriate nutrition decisions\u2019,16. There is limited data regarding the influence of nutrition literacy on MD and lifestyle behaviours. Moreover, to the best of our knowledge, there is no study evaluating nutrition literacy status among Turkish secondary school students and the relationship between nutrition literacy, physical activity level, total screen time, and anthropometric measurements . Therefore, the main purpose of this study was to determine the nutrition literacy status of early adolescents and its association with adherence to the MD, anthropometric measurements, and lifestyle behaviours, including eating habits, dietary intake, physical activity level and screen time.Determining nutrition literacy status and understanding the determinants of healthy eating and lifestyle behaviours can help adopt effective strategies to promote health in early adolescentsThis cross-sectional study was carried out from December 2021 to April 2022 in public secondary schools in the \u00c7i\u011fli district in \u0130zmir (a city west of T\u00fcrkiye). Schools were selected using stratified sampling. To reflect the entire \u00c7i\u011fli district, \u00c7i\u011fli was divided into four different regions: north, south, east and west. The total number of public secondary schools in this district was 38, and the number of public secondary schools in each strata was approximately similar to each other. One school from each strata was determined by randomisation. Four public secondary schools were included in this study. For secondary schools (intermediate education) in Turkiye, the duration of education is 4 years and covers grades 5\u20138. This education is mandatory for all citizens and free at public schools. Schools included in this study are half day-time schools with a canteen, an outdoor football field and an indoor sports hall. These schools do not receive school meal support from the government. Nutrition literacy education and nutrition literacy-enhancing activities are not available at these schools.After obtaining the approval of the ethics committee, necessary permission was obtained from the Provincial Directorate of National Education to conduct the study in these schools. All students from the same school and classroom were recruited if they met the inclusion criteria and provided oral consent to participate. The study sample included 1074 secondary school students of 550 boys and 524 girls (aged 10\u201313 years) . Inclusion criteria were willingness to participate and being aged between 10 and 13 years. Participants were excluded based on the following criteria: aged less than 10 or more than 13 years, and having severe acute or chronic diseases. The flow chart of participant recruitment is presented in Fig. After the necessary permissions were obtained, the researchers visited all the schools and informed the students about the study. The written informed consent forms were delivered to the parents by volunteer students. The next day, parents signed the informed written consent form and sent it back to the researchers. The data were collected in the classroom using face-to-face interview techniques after consent forms were received. To prevent mistakes and misunderstandings, the researchers read and clarified the questionnaire to the students prior to their completion. After that, completed questionnaires were collected from the students.The questionnaire was divided into five sections. The first part of the questionnaire asked for information about the students\u2019 sociodemographic data , and dietary habits  and physical activity status (duration of sleep and screen time). The second section consisted of the \u201cAdolescent Nutrition Literacy Scale\u201d to evaluate the nutritional literacy levels of adolescents. The third section incorporated Mediterranean Diet Quality Index for Children and Adolescents (KIDMED) to assess adherence to the MD. The fourth section assessed physical activity levels using the International Physical Activity Questionnaire (IPAQ). The 24-h dietary recall made up the fifth and final section., is an index consisting of a total of sixteen statements that include the characteristics of the MD. It was developed to measure dietary adequacy between the ages of 2\u201324 years. Of the expressions included in the KIDMED index, twelve are positive and four are negative expressions, and those who answer yes to positive expressions get +1 and those who answer yes to negative expressions get \u20131 points. According to the total scores of the adolescents from the index, adherence to the MD was interpreted by dividing it into three categories. These are (1) low adherence (0\u20133 points), (2) moderate adherence (4\u20137 points) and (3) high adherence (8\u201312 points).The KIDMED questionnaire was applied to measure adolescents\u2019 adherence to the MD. KIDMED, developed by Serra-Majem et al. and was adapted into Turkish by T\u00fcrkmen et al. ANLS consists of twenty-two items and each item is on a five-point scale, with scores ranging from 1 to 5 . The minimum score that can be obtained from this scale is 22, and the maximum score is 110. A score of 22\u201357\u00b72 indicates \u2018low\u2019, a score of 57\u00b72\u201374\u00b78 is considered \u2018moderate\u2019 and a score of 74\u00b78\u2013110 is classified as \u2018high nutrition literacy\u2019.\u2018Adolescent Nutrition Literacy Scale (ANLS)\u2019 was used to determine the nutrition literacy status of adolescents. This scale was developed by Bari. This brief form has seven questions and asks about time spent standing, walking, doing moderately intense activities and doing vigorous activities. According to their level of physical activity, adolescents were divided into three categories: \u2018inactive\u2019, \u2018moderately active\u2019 and \u2018active\u2019.IPAQ was used to evaluate the physical activity of participants. The validity and reliability of the questionnaire in Turkey were performed by \u00d6zt\u00fcrkDietary intake was assessed by the food consumption record . To verify that adolescents accurately indicated the amount of food they ingested, the \u2018Food and Nutrient Photo Catalogue\u2019 was used. The food consumption record was completed by contacting the parents of the students who could not remember or remember incompletely what they ate the previous day. BeBiS  was used for analysing dietary energy and nutrients.2). The adolescents were divided into four groups based on their BMI-for-age percentiles: \u2018underweight\u2019 (< 5 percentile); \u2018normal\u2019 (\u2265 5\u2013< 85 percentile); \u2018overweight\u2019 (\u2265 85\u2013< 95 percentile); and \u2018obese\u2019 (\u2265 95 percentile).Weight was measured with minimum clothing, without shoes, using a digital scale (Tanita BC-532). A handheld stadiometer with 0\u00b71 cm precision was used to measure height while standing with feet close together and the head in the Frankfort plane. Waist circumference was assessed using a non-flexible measuring tape at the end of expiration from the midpoint between the lowest rib and the crista iliac. Hip circumference was measured from the highest circumference of the hip at the back, standing on the side of the participants. Neck circumference was measured just below the larynx, with the head in the Frankford plane. BMI was calculated as weight (kg)/height (mn) and percentages (%) were used to present categorical data; normally distributed data were represented by the mean and standard deviation and non-normally distributed data by the median and interquartile range. The Student\u2019s t test and one-way ANOVA were used to compare the descriptive characteristics of participants with their mean ANLS scores. In multiple comparisons of these variables, the \u2018Tukey\u2019 test was used when the variances were equal and the \u2018Tamhane T2\u2019 test was used if not equal. \u2018Kruskal\u2013Wallis H test\u2019 was used to compare the dietary intake and anthropometric measurements data that did not fit the normal distribution according to the nutritional literacy level, and one way ANOVA was used for the normally distributed data. Multivariable linear regression analysis was carried out to determine the association between nutrition literacy and some related factors. A two-sided P value of < 0\u00b705 was considered to be statistically significant.Data were analysed using SPSS 23.0 (SPSS Inc.). The normality test was performed by the Kolmogorov\u2013Smirnov test. Numbers (P > 0\u00b705).The general characteristics of participants are presented in Table P < 0\u00b705). Adolescents who stated that they spent less than 1 h or 1\u20132 h per d in front of the screen had a higher nutrition literacy score than those who stated that they spent 3three h or more than 3 h. Besides, nutrition literacy scores were significantly lower in those who skip main meals (P < 0\u00b705). Nutrition literacy scores of adolescents who preferred milk/yogurt and fruits for snacks were higher than those who preferred sweet foods (P < 0\u00b705). Those who did not consume fast food had a higher score on nutrition literacy than those who did, both daily and 4\u20135 d a week. The mean nutrition literacy of those with high adherence to the MD was higher than those with moderate and low adherence (P < 0\u00b705). Adolescents who consumed more than 6\u20138 glasses of water per d had a higher nutrition literacy score than those who consumed 3\u20136 glasses of water daily  students (P < 0\u00b705). There was no significant difference in the energy, carbohydrate, fat intake and anthropometric measurements of the adolescents according to their nutrition literacy level.Dietary intake and anthropometric measurements according to nutrition literacy level are shown in Table P < 0\u00b705 for model 1; F = 18\u00b7700; P < 0\u00b705 for model 2) (Table \u03b2 = 0\u00b7286). In the second model, while nutrition literacy influenced 9\u00b70 % of adolescents\u2019 total screen time (adjusted R\u00b2 = 0\u00b7090), each unit increase in nutrition literacy decreased total screen time 0\u00b7182 points (\u03b2 = \u20130\u00b7182). There were no autocorrelation problem in the established models. Durbin Watson\u2019s values for each model were between 1\u00b75 and 2\u00b75.To assess the effect of nutrition literacy on KIDMED score (adherence to the MD) and total screen time by controlling for potentially confounding factors , multiple linear regression analysis was conducted. According to the results of the regression analysis, when the significance level corresponding to the F value was taken into account, model 1 and model 2 established were statistically significant  Table . In the This study\u2019s findings demonstrated that the nutrition literacy of secondary school students in Turkey was at a moderate level and higher nutrition literacy was associated with several lifestyle and dietary pattern outcomes including higher MD adherence, higher water and lower fast-food consumption, and lower total screen time. In addition, this study showed that there was no relationship between nutrition literacy and BMI and anthropometric measurements..This study revealed that the nutrition literacy of Turkish secondary school students was at a moderate level. This result is consistent with Liu et al. study and Zeng et al\u2019s study conducted with middle school children. Similarly, Turkish high school students\u2019 nutritional literacy was found to be moderate,26. The moderate nutrition literacy determined among early adolescents indicates that the nutritional literacy status of Turkish secondary school students should be improved, and this result gives key messages to educators and public healthcare planners to have more consideration for food and nutrition-related knowledge and develop new public health strategies focus on an increasing level of nutrition literacy of secondary school children.Evaluation of nutrition literacy status among secondary school children can help in improving nutritional health and implementing useful solutions,15. A recent study found that among school age children and adolescents, nutrition literacy scores were positively related to smaller fast-food portion sizes and lower frequency of intake of packaged or processed snacks. Another study demonstrated that the nutrition literacy of students who consume fast food once a week was higher than those who consume it every day. Furthermore, high nutrition literacy was found associated with frequencies of main meal consumption and increased daily water consumption. Taken together, these findings suggest that nutrition literacy may play an important role in children\u2019s eating habits and high nutrition literacy may enable adolescents to make healthy diet choices.In the present study, nutrition literacy was associated with healthy eating habits including higher water and lower fast-food consumption and consuming milk/yogurt and fruits for snacks. Moreover, nutrition literacy scores were higher in adolescents who do not skip main meals. Consistent with these results, previous studies have reported that the eating habits of adolescents change positively with the increase in their nutrition literacy. Improvement in diet quality in adolescents has positive effects such as a decrease in obesity indicators, an increase in cognitive functions and an improvement in mental health. This study showed that higher adherence to the MD  was associated with higher nutrition literacy scores among early adolescents. This finding is consistent with the results of previous studies. Taylor et al. reported that high nutrition literacy may enable individuals to adherence a high-quality prudent diet or MD in adults. In a study conducted with Iranian female adolescents, higher nutrition knowledge was significantly associated with a higher Mediterranean dietary pattern adherence score. In a study on adults in Italy, a significant association was demonstrated between nutrition knowledge and adherence to the MD. Similarly, Wall et al. revealed that higher nutrition literacy was associated with a healthier dietary eating pattern among adults. The association between MD adherence and nutrition literacy suggests that nutrition literacy is an important predictor of adherence to the MD among early adolescents.Diet quality is associated with healthy eating habits and is an important nutritional factor that improves the quality of life. Joulaei et al. reported that increased nutrition literacy was associated with lower sugar intake, improved energy balance in boys and enhanced dairy intake in girls. Another study demonstrated that high nutrition literacy predicted high consumption of low-fat dairy products, vegetables, nuts and seeds, olive oil, and soya products. It has been reported that low nutrition literacy status may be a barrier to dietary diversity and nutritional adequacy in school age children. Previous studies results have shown that high nutrition literacy is associated with increased fruit and vegetable consumption,35. These results indicate that adolescents with high nutrition literacy consume more foods that are sources of protein, fibre, Ca, A and C vitamins , in accordance with the MD. The MD is rich in vitamins and minerals and contains high levels of complex carbohydrates and fibre. In this context, these results support the link between nutrition literacy and MD adherence.This study demonstrated that adolescents with high nutrition literacy had higher intakes of fibre, protein, protein (%), Ca, K, Mg, P, vitamin C, folate and Fe intake than those with low and moderate nutrition literacy. Similarly, a significant positive relationship was found between nutrition literacy and dietary protein (%), fibre, and K intake among women,37,38. It has been reported that adolescents spend their spare time mostly in front of screens such as smartphones, tablets, game consoles and televisions. Consistent with the literature in this study, the rate of adolescents who stated that they spent 3 or more hours in front of the screen was found to be high (41\u00b77 %). Relationships between screen time and negative health effects including obesity and inactivity have been well documented. This study showed that active adolescents had higher nutrition literacy scores than inactive (sedentary) adolescents. The multiple linear regression analysis revealed that lower total screen time was associated with higher nutrition literacy scores. Supporting this study, the nutrition literacy scores of those who watched TV < 1 h/d were found to be significantly higher than those of the students who spent more time watching TV. Consistently, another study revealed that higher nutrition knowledge was significantly associated with good physical activity behaviour in students. Additionally, some authors reported that there is a relationship between health literacy, which is a concept that includes nutritional literacy and is defined as individuals\u2019 ability to make decisions that have a positive impact on their own health, and active lifestyle. Overall, these results suggest the nutrition literacy predictor of a healthy lifestyle among early adolescents.Several studies have shown that sedentary behaviours increase and the level of physical activity decreases among adolescents,11,42,43. In some studies, nutrition literacy was inversely associated with overweight/obesity among adolescents, while in others a positive relationship between nutrition literacy and BMI has been reported. This study showed no association between nutrition literacy and BMI, neck, waist, and hip circumference. In line with these results, Taleb and Itani found no association between nutrition literacy and BMI among adolescents. Regarding anthropometric measurements, to the best of our knowledge, there is no study investigating the relationship between nutrition literacy with waist, hip and neck circumference among adolescents. Although nutritional literacy was associated with healthy lifestyle behaviours, the non-significant association between nutrition literacy and BMI and anthropometric measurements can be explained by the fact that these parameters are influenced not only by the nutritional literacy level but also by other factors such as lifestyle, environmental, psychological and genetic factors. The present study did not examine the relationship between these other factors and BMI. Further research is required to understand the relationship between nutrition literacy and BMI and anthropometric measurements.There are many studies addressing nutrition literacy and weight status. However, the results of these studies were inconsistentThis study has some limitations. First, causal relationships between nutrition literacy and physical activity, diet quality, and intake could not be determined from this study due to its cross-sectional design. Second, the self-reported survey is subject to social desirability and response bias. Third, this study was conducted among secondary school students in Turkey; therefore, these results may not be generalised to other age groups. In spite of these limitations, this study is strengthened by its large sample size, use of validated instruments and robust hypotheses-driven analyses. Moreover, dietary intake was assessed with 24-h dietary recall, which allows analysis of typical dietary intake in adolescents.The findings of this study showed that nutrition literacy among early adolescents was not optimal, and a higher nutrition literacy score was significantly associated with higher MD adherence, healthy lifestyle behaviours including healthy eating habits and lower screen time. These results suggest that finding methods to improve early adolescents\u2019 nutrition literacy is crucial for promoting healthy dietary patterns and lifestyle behaviours. Adolescents\u2019 awareness should be increased to develop healthy lifestyle behaviours, and health policies should be developed in this regard by creating appropriate educational content. Future studies with long-term follow-up plans are necessary to comprehend how nutrition literacy affects the behaviours that contribute to healthy lifestyle behaviours. Moreover, future research should concentrate on concepts that can enhance adolescents\u2019 nutrition literacy to build nutritional interventions that will encourage healthy eating among secondary school students."}
+{"text": "Food literacy is capturing the attention worldwide and gaining traction in the Arab countries. Strengthening food and nutrition literacy among Arab teenagers are important promising empowering tools which can protect them from malnutrition. This study aims to assess the nutrition literacy status of adolescents with the food literacy of their parents in 10 Arab countries.This cross-sectional study involving a convenient sample of 5,401 adolescent-parent dyads  was launched between 29 April and 6 June 2022 in 10 Arab nations. The Adolescent Nutrition Literacy Scale (ANLS) and the Short Food Literacy Questionnaire (SFLQ) were used to meet the study aims.p\u2009=\u20090.001, OR\u2009=\u20091.8, CI\u2009= 1.6\u20132.1, p\u2009<\u20090.001, respectively).More than one-quarter (28%) of adolescents had poor nutrition literacy, with 60% of their parents being food illiterate. The top three countries with nutritionally\u201d less literate\u201d adolescents were Qatar (44%), Lebanon (37.4%), and Saudi Arabia (34.9%). Adolescents\u2019 age, gender, education level, primary caregivers, employment status, and the inclusion of nutrition education in the schools\u2019 curriculum predicted the nutrition literacy levels of Arab adolescents. Besides, parental weight status, health status, parent\u2019s food literacy level, and the number of children per household were significant determinants too. Adolescents studying at a university and having parents with adequate food literacy had the highest odds of being nutritionally literate (OR\u2009=\u20094.5, CI\u2009=\u20091.8\u201311.5, Nutrition literacy inadequacy among Arab adolescents is a prioritized challenge to be tackled. High le2.2.1.A cross-sectional study using the snowball sampling method was conducted in Lebanon and nine other Arab nations: Bahrain, Egypt, Jordan, Kuwait, Morocco, Palestine, Qatar, Saudi Arabia, and United Arab Emirates (UAE). A self-administered questionnaire (82 items)2.2.The explanatory variables were as the follows: (i) demographic and socio-economic status of adolescents , and whether nutrition education is a part of school\u2019s curriculum; (ii) demographic and socio-economic status of parents . The body mass index (BMI) was calculated and evaluated per WHO recommendations .2.3.2.3.1.The Adolescent Nutrition Literacy Scale (ANLS), developed by Bari , was useTotal Nutrition Literacy (TNL): the sum of FNL, INL, and CNL .FNL (questions 1\u20137): minimum-maximum score: 7\u201335 (\u2265 21 is an average score).INL (questions 8\u201313): minimum-maximum score: 6\u201330 (\u2265 18 is an average score).CNL (questions 14\u201322): minimum-maximum score: 9\u201345 (\u2265 27 is an average score).2.3.2.Parental food literacy was evaluated using the Short Food Literacy Questionnaire (SFLQ), developed by Gr\u00e9a Krause et al. . It cons2.4.The study was performed based on the ethical standards laid down in the Helsinki Declaration. We obtained written approval from the Ethics Committee of Al Zahraa University Medical Center , Beirut, Lebanon, and the universities from all participating countries. A consent form was added to the survey, informing participants about their, rights and confidentiality. The participation was entirely voluntary with no obligation to do so.2.5.\u03c72) was used to determine associations between study variables. In addition, the binary backward stepwise regression was used to examine the predictors of adolescents\u2019 nutrition literacy. A value of p of 5% was considered significant.We performed the statistical analysis using the Statistical Package of Social Sciences Software (SPSS) . A \u201cweighting\u201d variable was created to adjust the representation of the sampled population. Respondents\u2019 characteristics were presented as frequencies (percentages) for categorical variables, while means \u00b1 standard deviation (SD) for continuous variables. The adolescence stages were classified as follows: early adolescence (10\u201313\u2009years old), middle adolescence (14\u201316\u2009years old), and late adolescence (17\u201319\u2009years old). The normality of data was checked using the Shapiro\u2013Wilk test. Due to the non-normal distribution, Kruskal-Wallis test was used to determine score differences according to country. Chi-squared test  or the middle (24%) adolescence stage, rriculum . The higrriculum . Further\u2009<\u20090.001 .As for the parent participants, 67.8% were mothers with a mean age\u2009\u00b1\u2009SD of 43.0\u2009\u00b1\u20098.0. More than third of parents were overweight . where39% of parents had no job, and half of themhad health problems .3.2.In the overall adolescent population, the mean TNL score was 70.6\u2009\u00b1\u20099.5, with poor nutrition literacy was found in 28% of adolescents. The FNL, INL, and CNL scores were as follows: 22.7\u2009\u00b1\u20097, 18.5\u2009\u00b1\u20095.8, and 29.5\u2009\u00b1\u20094.6, respectively. Hence, 4 out of 10 adolescents (36%) were with poor FNL and INL, and 21% were with poor CNL .p\u2009<\u20090.001 , followed by Saudi Arabia (35%), Bahrain (29.4%), Kuwait (28%), Palestine (25%), Morocco (24%), Jordan (23%), UAE (18.2%), and Egypt (18.1%), \u2009<\u20090.001 . Half th\u2009<\u20090.001 . Adolesc\u2009<\u20090.001 . Similar\u2009<\u20090.001 . Regardi\u2009<\u20090.001 .3.3.p\u2009<\u20090.001. Similarly, FNL, INL, and CNL, were adequate among older adolescents compared to young and middle stage adolescents . In terms of adolescents\u2019 gender, poor nutrition literacy was found significantly more among males compared to females; TNL , FNL , and INL , respectively. Poor nutrition literacy was also found more among obese adolescents; TNL (35.4%), FNL (43%), and INL (41.3%), although these findings were not significant . Parents who were underweight and with obesity had more adolescents with poor TNL , compared to normal-weight and overweight parents  p\u2009<\u20090.001. Further, it was noted that nearly half the obese parents (41.2%) had adolescent with poor FNL, p\u2009<\u20090.001. On the other hand, adequate level of nutrition literacy scores was found more among adolescents studying at university, with TNL , FNL , INL , and CNL , compared to those at school level , and those not attending a school or university  (ctively) .p\u2009<\u20090.001) and CNL . Similarly, adolescents of fathers having university degree showed adequate TNL , FNL , INL , and CNL . In addition, adolescents having both parents as primary caregivers expressed adequate TNL , INL , and CNL . Moreover, working adolescents had predominately adequate TNL  and FNL , compared to non-workers. However, the school type was not a significant correlate except in the FNL, with adolescents in private schools scoring better in FNL compared to those in public schools . Adolescents receiving nutrition education showed significantly better TNL and INL in contrast to others who did not report so  and , respectively. Most married parents had adolescent with adequate TNL , INL , and CNL . Moreover, parents having 2\u20133 children had a higher proportion of adolescent with adequate TNL , INL , and CNL . Around 36% of parents with reported disease  had adolescent with poor TNL, p\u2009=\u20090.017. As well, a higher proportion of food illiterate parents (vs. food literate) had adolescent who were nutritionally illiterate too, in TNL  INL  and CNL  dimensions  more likely to be nutritionally literate. Female adolescents had a 30% more probability of having adequate nutrition literacy . Besides, adolescents who were university students  were 4.5 times more likely to be nutritionally literate. Adolescents with parents who were either overweight or obese were 1.5 times more likely to be with adequate nutrition literacy . Further, adolescents with both parents as primary caregivers  were 30, and 60%  more likely to be nutritionally literate. Furthermore, working adolescents were 1.5 times more likely to have adequate nutrition literacy . Parents with one child (vs. \u2265 3 children) were 30% more likely to be with adequate nutrition literacy . Adolescents receiving nutrition education were 30% more likely to be nutritionally literate . Parents who reported to be healthy were 20% more likely to have adolescent who are nutritionally literate . In addition, food literate parents were 2 times more likely to have nutritionally literate adolescent  (<\u20090.001) .4.This study assessed the Arab adolescents\u2019 nutrition literacy and the food literacy of their parents. About 28% of adolescents had poor nutrition literacy, with 60% of their parents being food \u201cless literate.\u201d Nutrition illiteracy was most prevalent in Qatar (44%), Lebanon (37.4%), and Saudi Arabia (34.9%). Adolescents\u2019 age, gender, education level, primary caregiving, employment status, and receiving nutrition education in schools predicted their nutrition literacy levels. Besides, parental weight status, health status, parent food literacy level, and the number of children per household were significant determinants.There is scarcity of studies evaluating nutrition literacy among the Arab population. All in all, only three studies on this topic were conducted and were chiefly in Lebanon and Palestine , 23, 24.4.1.The current study had some limitations that should be acknowledged. First, due to the unavailability of valid questionnaires regarding nutrition and food literacy in the region, the questionnaires in this study were derived from many credible, valid sources and translated to Arabic then back translated to English by experts. Second, due to its cross-sectional design, causal inferences cannot be drawn. Third, the self-administered questionnaire causes inevitable information bias. Fourth, convenience sampling could lead to skewed sample characteristics. Fifth, we collected no information on adolescents\u2019 food habits which most probably correlate with nutrition literacy. Nonetheless, this study is the first of the region\u2019s kind, with a large sample of Arab adolescents and their parents addressing the nutrition and food literacy topics.5.This study shows that nutrition literacy inadequacy among Arab adolescents is a prioritized challenge to be addressed. The \u201cmacro-curriculum\u201d concept in schools includes intervention packages to implement, leading to the best possible nutrition outcomes. The target group for interventions includes school-age children, teachers at both public and private institutions, as well as the ministries of education and health in each Arab nation. Classroom activities, such as counting with pictures of fruits and vegetables, learning about cultural food traditions, and measuring ingredients for a recipe, could be included in school interventions. Additionally, schools can send daily messages with nutrition content, such as morning announcements, to other family members. Staff meetings, parent-teacher interviews, and home cooking activities are also things to be considered.The raw data supporting the conclusions of this article will be made available by the authors, without undue reservation.The study was conducted in accordance with the Declaration of Helsinki, and approved by the Ethics Committee of Al Zahraa University Medical Center , Beirut, Lebanon, and the universities from all participating countries. Written informed consent to participate in this study was provided by the participants\u2019 legal guardian/next of kin.Bahrain: Tariq Abdulkarim Alalwan; Palestine: Malak Amro; Qatar: Aljazi AlQahtani; United Arab Emirates: Leila Cheikh Ismail.MH: conceptualization, validation, and project administration. HM, KB, FH, SA, DA, HA, HB, IK, RQ, and RT: methodology. RQ: software. HM: formal analysis. MH and HM: data curation and writing\u2014original draft preparation. All authors: writing\u2014review and editing. All authors have read and agreed to the published version of the manuscript.Open access funding provided by the Qatar National Library.The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest.All claims expressed in this article are solely those of the authors and do not necessarily represent those of their affiliated organizations, or those of the publisher, the editors and the reviewers. Any product that may be evaluated in this article, or claim that may be made by its manufacturer, is not guaranteed or endorsed by the publisher."}
+{"text": "Of these, 75% were mitral repairs and 25% were replacements. Individual cohorts included minimal access using direct, video-assisted, or totally endoscopic/robotic visualization. For all groups, the authors examined the relationship between aortic cross-clamp time (ACXT) and mortality. For all groups, the 30-day mortality was 1.6%. The median ACXT for these operations was 85\u2009min with the shortest for the direct visualization cohort (73\u2009min) and longest for the robotic group (129\u2009min). By the univariate analysis, they found that irrespective of visualization method, type of mini-access or cardioplegia regimen, mortality and morbidity  were not higher with ACXTs of 60\u2009min or somewhat longer . However, when this time was increased to 90 or 120\u2009min, mortality was significantly higher . Of all operations, 25.4% had ACXTs of >120\u2009min. Risk factors for death emerged as age, emergent surgery and low ejection fraction. Concomitant procedures did not prove to be an independent risk factor for these patients. Thus, this study suggests that there is less mortality for MIMVS when ACXTs are kept between 60 and 90\u2009min.The deleterious myocardial effects of long periods of aortic cross-clamping have been concerning since the mid-1970s. Moreover, in the presence of ventricular dysfunction, both early- and long-term recovery are in greatest jeopardy. In the present article, by Doenst et al. [et al. showed that with a sternotomy (STR) in aortic valve replacement patients that the mortality was higher if the ACXT was longer than 60\u2009min [et al. [et al. of 24 individual cohort studies compared MIMVS patients to STR ones [et al. also showed equal mortality despite significantly longer ACXTs for the MIMVS cohort [In a prospective study, Ruggieri et al.  showed iet al. . Swinkeln 60\u2009min . Lange an 60\u2009min . Pojar eSTR ones . Cross-cS cohort .et al. [Most recently, Mori et al.  reviewedet al. determined in their current study [Minimally invasive mitral surgery has challenges. As shown above often have significantly longer ACXTs than operating through an STR. Limited access requires more attention to myocardial protection. An STR avails the possibility of topical cooling as well as better ventricular decompression and deairing. Also, MIMVS operations require more operator skill, which is acquired best with larger case volumes. Conversely, most of these patients are <65\u2009years old and have preoperative normal ventricular function with less preoperative co-morbidities. Additionally, they usually are a first-time operation and are not an emergency. From these studies, the consensus seems that the safe ACXT is 60\u201390\u2009min with mortality rising significantly after 120\u2009min. This is what Doenst"}
+{"text": "The analysis of these issues such as toothaches or cavities, among others could be crucial for them. However, no studies have been conducted in Cuenca, Ecuador. Thus, this study aimed to create a model explaining how social factors and healthy habits impact oral health in Cuenca, Ecuador. (2) Methods: An observational study was performed using a questionnaire developed from scratch. Principal component factor analysis was performed to calculate the oral disease index based on the oral health issues reported by women during pregnancy. (3) Results: 1971 women participated in the research. In total, 88% reported at least one oral health problem, with cavities (34%) and bleeding gums (33%) as the most prevalent. The rate of preventive visits and frequent brushing were the two variables that most impacted the oral disease index. The consumption of sweets, age, and the belief that visiting the dentist harms their unborn child were also important factors. However, income, education, and ethnic background showed little to no effect. (4) Conclusions: The most beneficial determinants of oral health factors in pregnant women in Cuenca, Ecuador, are preventive dentist visits, frequent brushing, and a contained consumption of sweets. The main harmful factors are age and the misconception that dental visits can harm their unborn child. Surprisingly, income, education, and ethnic background have little effect. This study can be replicated in other countries and cultures. Pregnancy is usually associated with oral health problems ,2,3,4. DParticular beliefs can have an impact on one\u2019s health. For example, the idea that losing teeth during pregnancy or dental procedures can be detrimental to pregnancy is expected. Furthermore, pregnant women should indulge in their cravings, although many involve sugary foods ,18. SpecHowever, improving oral hygiene in pregnant women has an impact on their general health , on theiTo improve oral health among pregnant women, we must consider several factors. Addressing these factors comprehensively is crucial, especially in underprivileged areas, to ensure mothers-to-be and newborns receive the necessary care and support for optimal oral health. Despite the precarious state of oral health in pregnant women in Cuenca, Ecuador, no studies were conducted to investigate the factors that may contribute to this issue from the perspective of these women. This issue presents a significant opportunity for improvement. Therefore, this study aimed to create a model explaining how social factors and healthy habits impact oral health in Cuenca, Ecuador. We also sought to examine if some social aspects could also impact the oral health of these women. Habits such as oral hygiene, preventive visits, sugary food consumption, and various social, demographic, educational, socioeconomic, and psychological variables were evaluated. Additionally, we examined how ethnicity, anxiety about experiencing pain during appointments, and concerns about harm to the fetus from dental procedures can affect the situation.An observational study was performed using a questionnaire developed from scratch. The questionnaire was based on a review of the literature and the professional experience of the authors of this investigation. The questionnaire collected exploratory data on various factors, including age, self-identification as Indigenous, net monthly household income, level of education, the frequency of brushing and use of oral rinses, and the frequency of sweet consumption. Furthermore, the questionnaire investigated whether participants believed that going to the dentist could harm their fetus and the correlation between pain, fear, going to the dentist, and the number of preventive dental visits made. The N/P3 index was calculated from the last question. N represented the number of problems the participant visited the dentist during his lifetime, so they could only cite those she knew. P3 was the total number of visits to the dentist. Higher values of the ratio value indicate poorer oral health among the population.A pre-test was conducted with 30 female participants to evaluate the questionnaire\u2019s ease of completion. The questionnaire took approximately 12 min to complete. The participants found the questions easy and the survey completion time acceptable.A study conducted in Cuenca (Ecuador) involved 1971 pregnant women in 2017. Participants who attended morning or afternoon consults at gynecological care centers were invited to participate if they met the following inclusion criteria: pregnant women who understood Spanish and agreed to complete the survey. The survey was conducted face to face, using a structured, closed-ended paper questionnaire. One hundred trained medical students acted as recruiters and interviewers, helping in the process. Participants were fully informed about the study objectives and consented to participate. They also knew they could withdraw from the study at any time. No personal information was collected that could be used to directly or indirectly identify women who participated in the survey.Exploratory and confirmatory factorial analyses were performed to evaluate the validity of the construct. The adequacy of exploratory factor analysis (EFA) was determined by analyzing the Bartlett test and the Kaiser\u2013Meyer\u2013Olkin (KMO) measure. We evaluated the construct validity of the qualitative questionnaire items via exploratory factor analysis. Factor loadings and Cronbach\u2019s alpha were examined to determine if an item was redundant or did not measure the same underlying construct, including or excluding the item via an iterative process ,35. ConfThe oral disease index was calculated using a principal component factor analysis of oral health issues reported by women at various times, including throughout their lifetime, in the previous two years, and during pregnancy. This index was assessed using a statistical reliability exploratory test based on Cronbach\u2019s alpha . BeforehThe research followed the ethical guidelines outlined in the Declaration of Helsinki. The anonymity of all participants was safeguarded during the collection, storage, and analysis of the data. No personal information was collected, and confidentiality was strictly maintained. The informed consent of the participants was signed, who were informed of the objectives of this investigation. All procedures mentioned in this research received approval from two ethics committees, as it was a collaboration between universities in Ecuador and Spain: the Research and Ethics Committee of the Department of Nursing, Physiotherapy and Medicine of the University of Almeria (Spain) with the approval number EFM 278/23; and the Bioethics Committee of the University of Cuenca, Ecuador, with the code 2017 008EO.The study involved 1971 women aged 14 to 46 years, with an average age of 26.8 years and an average of 0.8 children (range 0\u20138). An amount of 1,416 participants (74.9%) had a primary or secondary education level, and 1566 women (79.5%) reported monthly net income under $1000 .Almost all participants (99%) reported experiencing oral health problems at some point. The most common problems were cavities (84%) and toothaches (74%), which were also the main reasons for visiting the dentist . On averOf all survey respondents, 66% brushed their teeth three times daily, 26% brushed twice daily, and 9% brushed once or less. Among the female participants, 31% used oral rinses once or twice a day, and 9% used them three times a day. Regarding sweet consumption, 40% of women reported eating sweets daily: 19% ate them once a day, 11% ate them twice a day, and 10% ate them three or more times a day. The N/P3 index produced a variable ranging from 0.75 to 1.0, with a mean of 0.83 and a standard deviation of 0.173. The oral disease index had a Cronbach\u2019s alpha of 0.721. The KMO test for the principal component solution scored 0.691 .As shown in After analyzing the dependent variable, oral disease, and all other variables in the questionnaire, it was found that there was no significant correlation between educational level and being Indigenous. However, there were low but statistically significant correlations between the dependent variable and the rest of the variables listed in 2 value of 0.126, indicating its explanatory capacity. The fit to the data had a chi-square value of 0.0. To explain the oral disease, a causal path analysis model was performed using significant variables. The model had an RThe data analyzed showed that the rate of preventive visits and frequent brushing were the two variables that most impacted the oral disease index. The consumption of sweets, age, and the belief that visiting the dentist harms the fetus were also important factors. However, family income had a low explanatory capacity and was almost statistically insignificant. There were no significant covariances when examining the relationships between explanatory variables, except for a few weak ones. Age was associated with income , frequency of brushing with fetal harm , and age with fetal harm due to dental visits . Most of the other associations were weak and insignificant.This research aimed to develop a model explaining the social factors and healthy habits that impact the oral health of expectant mothers in Cuenca, Ecuador. The oral health of the women studied was found inadequate during pregnancy, as well as during the last two years and over their lifetime, according to the frequency of dental visits recorded. Most dental visits (67%) were made during pregnancy due to a mandatory dental check-up program. Despite this program, participants reported a high incidence of oral health problems, contrasting with the low number of visits to the dentist. This finding is particularly concerning given the young age of the sample population.Considering several significant variables, a causal path analysis model was used to explain the oral disease index. Despite initially including all the correlated variables, we excluded the rinsing frequency variable in the solution presented in the study. Although it correlated significantly with the dependent variable in the exploratory analysis, its regression coefficient was not significant in the model. Moreover, the model improved when we removed it. Similarly, the fear of pain variable did not contribute significantly to the model\u2019s explanatory capacity, although this bivariate correlation was significant. Therefore, we did not include it in the final solution. In the model presented, all regression coefficients were statistically significant.Our findings suggest that frequent teeth brushing is associated with better oral health. On the contrary, consuming more sweets, being older, and having a higher degree of agreement that visiting the dentist during pregnancy is harmful are associated with an increased risk of oral disease. Surprisingly, family income showed a low impact on oral health. The lack of correlation between educational level and oral health was even more unexpected. These findings are striking as these two factors often contribute to social inequalities in health studies ,37,38, iOur results show that brushing frequency is quite common among the population, ranking as the second most significant factor in maintaining good oral health. However, relying solely on brushing is inadequate in preventing oral problems. In addition, consuming sweets is the third factor in the explanatory model and is a common habit in Ecuadorian society, which counteracts the positive effects of brushing. Pregnant women are often concerned about the potential harm to their fetuses during dental check-ups, particularly during X-rays. This fear is as crucial as age and often leads to postponing dental visits until after childbirth, which can worsen oral health during pregnancy.Fear of dental pain does not explain oral health status. Although this fear might prevent or postpone dentist visits, the data we collected did not strongly support this hypothesis . AlthougThe correlations between significant variables were generally low in the model obtained via causal path analysis. This finding may suggest that other variables and factors could be considered in future research. However, we found that the model fit was optimal with the data, as evidenced by a chi-square value of 0.0.This study has some limitations. First, it is important to acknowledge the presence of a potential selection bias in the study. It is due to the recruitment method that hinders the complete randomization of the sample. While the large number of participants and the detailed description of their demographic characteristics help to evaluate this bias, it is essential to consider this limitation when evaluating the external validity of the study\u2019s conclusions. In this sense, the heterogeneity of the interviewers could have also introduced some potential bias. Another factor to consider is that the participants\u2019 responses may be influenced by bias. They could have overestimated the number of times they brush their teeth and overall oral hygiene or underreported their consumption of sugary foods, as they may not want to reveal bad habits to a health interviewer. Therefore, the findings may only give a partial picture of the oral health issues of the studied population. Finally, it is important to note that the factorial analyses performed have a high sample dependence. Although our sample is large and above the recommendations of other authors ,51, thisOur study also has some strengths. The main one is its large sample size, which increases the validity of the findings and reduces the risk of selection bias. In addition, the surveys were administered by trained medical students, ensuring that the data was collected neutrally and objectively. Medical students could also assist participants with questions or concerns, ensuring a clearer understanding of the questions and more accurate responses. Finally, the study gathered responses from real women who identified a significant problem that causes a considerable health gap among women. These findings allow health practitioners, administrators, and policymakers to create interventions at various levels of healthcare care management, potentially improving these women\u2019s lives in their typical environment.The most critical determinants of oral health of pregnant women in the canton of Cuenca, Ecuador, are those related to preventive aspects: preventive dentist visits, frequent brushing, and a contained consumption of sweets. The main factors that lead to poorer oral health in pregnant women are their age and the misconception that dental visits can harm their unborn child. Interestingly, income level has a minor impact, while education level and ethnic background seem to have little to no effect. It may be because the lack of regular dental check-ups is widespread across all social groups. These findings are highly relevant, as they have practical applications in clinical and social settings. They can also assist health professionals, managers, and politicians in making informed decisions to improve the oral health of pregnant women. Additionally, this study can be replicated in other countries and cultures to compare the results."}
+{"text": "Schistosoma species. Nonetheless, re-infections have continued to be detected in endemic areas with individuals living in the same area presenting with varying infection intensities. Our objective was to characterize the transcriptome profiles in peripheral blood of children between 10\u201315 years with varying intensities of Schistosoma mansoni infection living along the Albert Nile in Uganda. RNA extracted from peripheral blood collected from 44 S. mansoni infected (34 high and 10 low by circulating anodic antigen [CAA] level) and 20 uninfected children was sequenced using Illumina NovaSeq S4 and the reads aligned to the GRCh38 human genome. Differential gene expression analysis was done using DESeq2. Principal component analysis revealed clustering of gene expression by gender when S. mansoni infected children were compared with uninfected children. In addition, we identified 14 DEGs between S. mansoni infected and uninfected individuals, 56 DEGs between children with high infection intensity and uninfected individuals, 33 DEGs between those with high infection intensity and low infection intensity and no DEGs between those with low infection and uninfected individuals. We also observed upregulation and downregulation of some DEGs that are associated with fibrosis and its regulation. These data suggest expression of fibrosis associated genes as well as genes that regulate fibrosis in S. mansoni infection. The relatively few significant DEGS observed in children with schistosomiasis suggests that chronic S. mansoni infection is a stealth infection that does not stimulate a strong immune response.Over 290 million people are infected by schistosomes worldwide. Schistosomiasis control efforts focus on mass drug treatment with praziquantel (PZQ), a drug that kills the adult worm of all  S. mansoni infection. In this study, we used RNAseq to identify differentially expressed genes associated with S. mansoni infection in children between 10\u201315 years. We conducted comparisons between phenotypes including infection intensities measured by circulating anodic antigen, wasting by body mass index and stunting by height-for-age Z-score. Our data showed very low numbers of significantly differentially expressed genes in all comparisons. Some of the few differentially expressed genes that were observed were associated with fibrosis which is the cause of pathology in humans and has been observed in late stages of S. mansoni infection in murine studies.Schistosomiasis is a neglected tropical disease transmitted via an intermediate snail host through contact with contaminated fresh water. Even with routine Mass Drug Administration for treatment of the infection, re-infections are still common and variations in infection intensity and pathology are still observed in individuals in the same location. These may be due to differences in individuals\u2019 response to  Schistosoma mansoni  A letter containing a detailed list of your responses to the review comments and a description of the changes you have made in the manuscript.\u00a0Please note while forming your response, if your article is accepted, you may have the opportunity to make the peer review history publicly available. The record will include editor decision letters (with reviews) and your responses to reviewer comments. If eligible, we will contact you to opt in or out.[2] Two versions of the revised manuscript: one with either highlights or tracked changes denoting where the text has been changed; the other a clean version (uploaded as the manuscript file). Important additional instructions are given below your reviewer comments.Please prepare and submit your revised manuscript within 60 days. If you anticipate any delay, please let us know the expected resubmission date by replying to this email. Please note that revised manuscripts received after the 60-day due date may require evaluation and peer review similar to newly submitted manuscripts.Thank you again for your submission. We hope that our editorial process has been constructive so far, and we welcome your feedback at any time. Please don't hesitate to contact us if you have any questions or comments.Sincerely,Jennifer A. Downs, M.D., Ph.D.Academic EditorPLOS Neglected Tropical DiseasesEva ClarkSection EditorPLOS Neglected Tropical Diseases***********************This is an interesting manuscript. Please consider the reviewers' thorough comments included, particularly the question about whether the pathways analysis may be revised or removed. It would also be helpful if the authors can provide further information to clarify the study design and the decisions to include or exclude some samples.Reviewer's Responses to QuestionsKey Review Criteria Required for Acceptance?As you describe the new analyses required for acceptance, please consider the following:Methods-Are the objectives of the study clearly articulated with a clear testable hypothesis stated?-Is the study design appropriate to address the stated objectives?-Is the population clearly described and appropriate for the hypothesis being tested?-Is the sample size sufficient to ensure adequate power to address the hypothesis being tested?-Were correct statistical analysis used to support conclusions?-Are there concerns about ethical or regulatory requirements being met?Reviewer #1: The authors have provided detailed description of the experiments' methodology.Reviewer #2: 1. Major: I would like more information about the study. Was screening done as part of a public health effort and then a subset were asked to participate in a research study? When did the research component start \u2013 with collection of the screening urine or the blood sample? This could be made clearer in the text and in Figure 1.Were there only 10-15 year olds in the screening? Were they only screened for schistosomiasis or for other parasites? If other parasites, these would be important to include as confounders. The ethics statement includes stool examination for eggs but I didn\u2019t see egg data included for your study participants \u2013 were children with positive POC-CCA also treated with praziquantel? If the TrypanoGEN+ study protocol has been published, please reference it as this could clear up a lot of these questions. In the results, there were 727 in \u201cfurther studies\u201d and 152 in the \u201cgene expression study based on POC-CCA scores.\u201d What was it about the POC-CCA that led those 152 participants to be recruited for this study?2. Major: CAA can be positive for Schistosoma haematobium and/or S. mansoni. If the Albert-Nile area is endemic only for S. mansoni, I would include that information. If it is endemic for both, did you confirm that eggs were mansoni rather than haematobium? Although it is rare, S. mansoni can cause urogenital schistosomiasis. Did the participants have urine and stool microscopy to assess for eggs?3. Major: Blood collected in a PAXgene tube usually has RNA extracted using the Paxgene kit, but the authors used Trizol. I am unable to find a published study validating Trizol for RNA extraction from Paxgene tubes, and the reference given (#11) does not specify the RNA extraction method for blood collected in Paxgene tubes. Can the authors elaborate on the rationale for this approach, ideally with a reference validating this method?4. Minor: Since your audience is not all Schisto experts, would describe what CAA and CCA are and why you did both and whether or not people\u2019s CAA and CCA results needed to be concordant to be included in the study.5. Minor: Give rationale for assigning someone as low vs. high CAAemia \u2013 how did you decide on the cutoff?6. Minor: Include the details of the POC-CCA used .7. Minor: Spell out what the UCP-LF of UCP-LF CAA is and include its details . 8. Typo: line 123 \u201cCAA concentrations > 30 pg/mL\u201d should be \u201c< 30 pg/mL\u201d9. Typo: line 128 clarify if it should be \u201cquantity of 1 ug\u201d or a \u201cconcentration of 1 ug\u201d per what volume. 10. Typo: line 135 For clarity, would specify 2x150 bp and 30 millionReviewer #3: -Are the objectives of the study clearly articulated with a clear testable hypothesis stated? Yes-Is the study design appropriate to address the stated objectives? Yes-Is the population clearly described and appropriate for the hypothesis being tested? Yes-Is the sample size sufficient to ensure adequate power to address the hypothesis being tested? This study is a hypothesis generating type of study. So no problem.-Were correct statistical analysis used to support conclusions? Yes-Are there concerns about ethical or regulatory requirements being met? No--------------------Results-Does the analysis presented match the analysis plan?-Are the results clearly and completely presented?-Are the figures  of sufficient quality for clarity?Reviewer #1: The results are clearly.Reviewer #2: 1. Major: 80 samples were \u201cselected for sequencing to represent the extremes of infection intensity\u201d which I assumed meant their CAA-determined infection intensity, yet \u201c11 lacked CAA results and were excluded.\u201d Could the authors elaborate on this? Additionally, only 52% of RNA passed QC, which seems very low to me, and I am assuming is because of the 1 ug cutoff. Why was the cutoff so high? The amount of input RNA for RNA-Seq is usually much lower than 1 ug. My concern would be that participants with lower WBC counts would be excluded since they wouldn\u2019t generate enough RNA to meet that cutoff which could skew your results.2. Major: While it is inconvenient when there are people who do not cluster in a PCA, I\u2019m not sure that excluding 5 people is the right approach, nor do the reasons given seem appropriate. We don\u2019t usually exclude people from analysis because of their ethnicity. Poor RNA quality should have been detected with Qubit and Agilent bioanalyzer QC before sequencing. Which schisto groups were these 5 people in?3. Major: There are so few differentially expressed genes, and so few that are included in the Reactome database, that I don\u2019t think that pathways analysis is an appropriate approach. There is only 1 gene included in each pathway of Tables 4 and S4 and 1 or 2 genes for each pathway in Table S8. Although the p-value numbers indicate statistical significance, I question if 1 differentially expressed gene is enough to invoke pathologic importance for that pathway. It may be that there really aren\u2019t that many differences in gene expression between the groups and that alone is the conclusion \u2013 adding pathways analysis seems like trying to create a difference where there might not be one.4. Major: The BMI and stunting subanalyses are only done in the schistosomiasis group \u2013 why is this? In discussion, would need to clarify that the associations are for BMI and stunting in people with schistosomiasis at the time of the study. Were these studies done for a subset of the differentially expressed genes or an analysis of all of the RNASeq data?5. Major: The inclusion of the PubMed search results as part of methods and results for specific gene products, while thorough, would seem to be more appropriate for integration into the discussion where there are relevant citations, for example the authors do this in lines 288-290 with reference 28.6. Minor: How did the authors compensate for the multiple comparisons \u2013 4 between-group comparisons  \u2013 in deciding on a cutoff for statistical significance?7. Minor: Was the regression analysis for differential gene expression only done for the subset of genes already found to be differentially expressed in the S. mansoni group?Reviewer #3: -Does the analysis presented match the analysis plan? Yes-Are the results clearly and completely presented? No-Are the figures  of sufficient quality for clarity? No--------------------Conclusions-Are the conclusions supported by the data presented?-Are the limitations of analysis clearly described?-Do the authors discuss how these data can be helpful to advance our understanding of the topic under study?-Is public health relevance addressed?Reviewer #1: This article provides sufficient information to understand the genetic changes in human children infected with Schistosoma mansoni. The results have potential implications for the diagnosis and treatment of schistosomiasis.Reviewer #2: Because of the aforementioned questions/concerns about the data analysis approach, it is difficult to assess the conclusions. The limitations noted by this reviewer were not considered in the conclusion as written. While the findings of association of some of the differentially expressed genes in the schistosomiasis group with fibrosis is interesting, there were so few differentially expressed genes (and only 4 protein-coding) that the conclusions may have been overstated.Reviewer #3: -Are the conclusions supported by the data presented? Yes-Are the limitations of analysis clearly described? Yes-Do the authors discuss how these data can be helpful to advance our understanding of the topic under study? Not much, should have mentioned about the benefit for future diagnosis and treatment.-Is public health relevance addressed? No--------------------Editorial and Data Presentation Modifications?Use this section for editorial suggestions as well as relatively minor modifications of existing data that would enhance clarity. If the only modifications needed are minor and/or editorial, you may wish to recommend \u201cMinor Revision\u201d or \u201cAccept\u201d. Reviewer #1: AcceptReviewer #2: 1. Major -- add relevant available demographic data to Table 1 \u2013 age, coinfections, BMI, stunting, what subcounty site a person was from, average CAA, % with S. mansoni eggs seen in stool, etc. Any significant differences in these variables should be addressed.2. Major \u2013 consider if the fold changes, adjusted p-values, and FDR should/need to be taken to the millionths place in Tables 3, 5, S2, S3, S4. 3. Major \u2013 Figures 3 and 4 are illegible 4. Please specify where the RNA-Seq data are deposited.5. Consider providing the code used for analysis as supplemental material or a link to a github with that information.Reviewer #3: Minor modification is enough.--------------------Summary and General CommentsUse this section to provide overall comments, discuss strengths/weaknesses of the study, novelty, significance, general execution and scholarship. You may also include additional comments for the author, including concerns about dual publication, research ethics, or publication ethics. If requesting major revision, please articulate the new experiments that are needed.Reviewer #1: In this manuscript, the authors investigated the RNA sequencing of 44 Schistosoma mansoni-infected children and 20 uninfected children, with the reads aligned to the GRCh38 human genome. The study is well-conducted, and its scientific soundness is reasonable. However, before publication, some points should be addressed, which are discussed below:1. It is recommended to reconfirm the RNA expression of significant DEGs  using qPCR, especially for CLTP1, SUZ12, and TRBC2.2. Apart from CLTP1, SUZ12, and TRBC2 genes, more detailed explanations should be provided for other significant DEGs identified in the study.Reviewer #2: In this manuscript, Namulondo and colleagues use transcriptomics to compare peripheral blood gene expression in young adolescents with or without schistosomiasis and with low vs. high schistosomal burden. I appreciate the important work to describe the human immune status during schistosomal infection using gene expression studies. The main finding may be that there aren\u2019t many alterations in gene expression in the peripheral blood \u2013 in itself, an interesting finding! Namulondo et al. do mention that it may be that the worms don\u2019t induce an immune response, but then go on to do the pathways and other analyses to try to find patterns in 14 differentially expressed genes, of which only 4 were protein encoding, with statistically significant pathways only including one of the differentially expressed genes. I would recommend focusing on the similarities between schisto/no schisto rather than the differences.Reviewer #3: This paper is designed to characterize different types of Schistosoma mansoni infected persons in highly endemic area in Uganda by RNAseq analysis using peripheral blood. Density of parasite load was evaluated by circulating antigen (CCA and CAA) levels. High, Low, and No infection groups with stunting and BMI, Blood cell types were well defined. their conclusion that high levels of active infection influenced the expression levels of limited number of genes that were mainly related to fibrotic and TGF-B1 activation. Although the results are simply descriptive, this transcriptome information will be beneficial for future development of relevant research. There are several comments to be improved.1. Fig.3 and Fig 4 needs clearer picture with high resolution. And more important is to make more easy-to-understand legends that explain the details of the methodology.2. Cell types analysis needs more explanation. How the authors identified MPP showed a significant change between the groups?3. There was no description of antibody levels of the individuals. If available, please describe it.4. Generally, fibrosis in the liver is frequently observed in the endemic area? Even younger generation?--------------------what does this mean?). If published, this will include your full peer review and any attached files.PLOS authors have the option to publish the peer review history of their article  digital diagnostic tool, Data Requirements:http://www.plosbiology.org/article/info%3Adoi%2F10.1371%2Fjournal.pbio.1001908#s5.Please note that, as a condition of publication, PLOS' data policy requires that you make available all data used to draw the conclusions outlined in your manuscript. Data must be deposited in an appropriate repository, included within the body of the manuscript, or uploaded as supporting information. This includes all numerical values that were used to generate graphs, histograms etc.. For an example see here: Reproducibility:https://plos.org/protocols?utm_medium=editorial-email&utm_source=authorletters&utm_campaign=protocolsTo enhance the reproducibility of your results, we recommend that you deposit your laboratory protocols in protocols.io, where a protocol can be assigned its own identifier (DOI) such that it can be cited independently in the future. Additionally, PLOS ONE offers an option to publish peer-reviewed clinical study protocols. Read more information on sharing protocols at  3 Oct 2023AttachmentResponse_to_reviewers.docxSubmitted filename: Click here for additional data file. 10 Oct 2023Dear Dr Mulindwa,Thank you very much for submitting your manuscript \"Transcriptome analysis of peripheral blood of Schistosoma mansoni infected children from the Albert Nile region in Uganda reveals genes implicated in fibrosis pathology.\" for consideration at PLOS Neglected Tropical Diseases. As with all papers reviewed by the journal, your manuscript was reviewed by members of the editorial board and by several independent reviewers. The reviewers appreciated the attention to an important topic. Based on the reviews, we are likely to accept this manuscript for publication, providing that you modify the manuscript according to the review recommendations. We thank the authors for their responsiveness to reviews and the major edits that they have made, which have substantially improved the manuscript. There are still some unresolved issues that need correction:The results that no other parasites were found in the stool of the children selected for RNA-Seq is not clearly presented and should be mentioned in the text.The ethics statement states that children who had eggs in stool were treated with praziquantel, but there is still no comment about those who were POC-CCA positive being treated.Reference 16 reports CAA cut-offs that are different than what was used in this manuscript. Please reconcile this. Also, in lines 148-150 there is not a clear classification for what would happen if someone\u2019s CAA result was exactly 1000 pg/mL.The EGA number does not appear to be included in the text anywhere.The discussion does not include a paragraph about limitations of this study, which were pointed out by reviewers. Please add this and be sure to include:-POC-CCA doesn\u2019t differentiate between species; urine was not filtered. -Please mention the requirement that samples had to have 1 ug of RNA, which was done to avoid amplification steps but could still introduce bias because of excluding those with lower amounts of RNA.-Statistical analysis did not correct for multiple comparisons and an additional laboratory method (e.g. qPCR or other method) to validate these findings would be useful.Please prepare and submit your revised manuscript within 30 days. If you anticipate any delay, please let us know the expected resubmission date by replying to this email. When you are ready to resubmit, please upload the following:[1] A letter containing a detailed list of your responses to all review comments, and a description of the changes you have made in the manuscript. Please note while forming your response, if your article is accepted, you may have the opportunity to make the peer review history publicly available. The record will include editor decision letters (with reviews) and your responses to reviewer comments. If eligible, we will contact you to opt in or out[2] Two versions of the revised manuscript: one with either highlights or tracked changes denoting where the text has been changed; the other a clean version (uploaded as the manuscript file).Important additional instructions are given below your reviewer comments. Thank you again for your submission to our journal. We hope that our editorial process has been constructive so far, and we welcome your feedback at any time. Please don't hesitate to contact us if you have any questions or comments.Sincerely,Jennifer A. Downs, M.D., Ph.D.Academic EditorPLOS Neglected Tropical DiseasesEva ClarkSection EditorPLOS Neglected Tropical Diseases***********************We thank the authors for their responsiveness to reviews and the major edits that they have made, which have substantially improved the manuscript. There are still some unresolved issues that need correction:The results that no other parasites were found in the stool of the children selected for RNA-Seq is not clearly presented and should be mentioned in the text.The ethics statement states that children who had eggs in stool were treated with praziquantel, but there is still no comment about those who were POC-CCA positive being treated.Reference 16 reports CAA cut-offs that are different than what was used in this manuscript. Please reconcile this. Also, in lines 148-150 there is not a clear classification for what would happen if someone\u2019s CAA result was exactly 1000 pg/mL.The EGA number does not appear to be included in the text anywhere.The discussion does not include a paragraph about limitations of this study, which were pointed out by reviewers. Please add this and be sure to include:-POC-CCA doesn\u2019t differentiate between species; urine was not filtered. -Please mention the requirement that samples had to have 1 ug of RNA, which was done to avoid amplification steps but could still introduce bias because of excluding those with lower amounts of RNA.-Statistical analysis did not correct for multiple comparisons and an additional laboratory method (e.g. qPCR or other method) to validate these findings would be useful.Figure Files:https://pacev2.apexcovantage.com. PACE helps ensure that figures meet PLOS requirements. To use PACE, you must first register as a user. Then, login and navigate to the UPLOAD tab, where you will find detailed instructions on how to use the tool. If you encounter any issues or have any questions when using PACE, please email us at figures@plos.org.While revising your submission, please upload your figure files to the Preflight Analysis and Conversion Engine (PACE) digital diagnostic tool, Data Requirements:http://www.plosbiology.org/article/info%3Adoi%2F10.1371%2Fjournal.pbio.1001908#s5.Please note that, as a condition of publication, PLOS' data policy requires that you make available all data used to draw the conclusions outlined in your manuscript. Data must be deposited in an appropriate repository, included within the body of the manuscript, or uploaded as supporting information. This includes all numerical values that were used to generate graphs, histograms etc.. For an example see here: Reproducibility:https://plos.org/protocols?utm_medium=editorial-email&utm_source=authorletters&utm_campaign=protocolsTo enhance the reproducibility of your results, we recommend that you deposit your laboratory protocols in protocols.io, where a protocol can be assigned its own identifier (DOI) such that it can be cited independently in the future. Additionally, PLOS ONE offers an option to publish peer-reviewed clinical study protocols. Read more information on sharing protocols at ReferencesPlease review your reference list to ensure that it is complete and correct. If you have cited papers that have been retracted, please include the rationale for doing so in the manuscript text, or remove these references and replace them with relevant current references. Any changes to the reference list should be mentioned in the rebuttal letter that accompanies your revised manuscript. If you need to cite a retracted article, indicate the article's retracted status in the References list and also include a citation and full reference for the retraction notice. 31 Oct 2023AttachmentResponse_to_review_comments.docxSubmitted filename: Click here for additional data file. 3 Nov 2023Dear Dr Mulindwa,We are pleased to inform you that your manuscript 'Transcriptome analysis of peripheral blood of Schistosoma mansoni infected children from the Albert Nile region in Uganda reveals genes implicated in fibrosis pathology.' has been provisionally accepted for publication in PLOS Neglected Tropical Diseases.Before your manuscript can be formally accepted you will need to complete some formatting changes, which you will receive in a follow up email. A member of our team will be in touch with a set of requests.Please note that your manuscript will not be scheduled for publication until you have made the required changes, so a swift response is appreciated.IMPORTANT: The editorial review process is now complete. PLOS will only permit corrections to spelling, formatting or significant scientific errors from this point onwards. Requests for major changes, or any which affect the scientific understanding of your work, will cause delays to the publication date of your manuscript.Should you, your institution's press office or the journal office choose to press release your paper, you will automatically be opted out of early publication. We ask that you notify us now if you or your institution is planning to press release the article. All press must be co-ordinated with PLOS.Thank you again for supporting Open Access publishing; we are looking forward to publishing your work in PLOS Neglected Tropical Diseases.Best regards,Jennifer A. Downs, M.D., Ph.D.Academic EditorPLOS Neglected Tropical DiseasesEva ClarkSection EditorPLOS Neglected Tropical Diseases*********************************************************** 9 Nov 2023Dear Dr Mulindwa,We are delighted to inform you that your manuscript, \"Transcriptome analysis of peripheral blood of Schistosoma mansoni infected children from the Albert Nile region in Uganda reveals genes implicated in fibrosis pathology.,\" has been formally accepted for publication in PLOS Neglected Tropical Diseases.We have now passed your article onto the PLOS Production Department who will complete the rest of the publication process. All authors will receive a confirmation email upon publication.The corresponding author will soon be receiving a typeset proof for review, to ensure errors have not been introduced during production. Please review the PDF proof of your manuscript carefully, as this is the last chance to correct any scientific or type-setting errors. Please note that major changes, or those which affect the scientific understanding of the work, will likely cause delays to the publication date of your manuscript. Note: Proofs for Front Matter articles  are generated on a different schedule and may not be made available as quickly.Soon after your final files are uploaded, the early version of your manuscript will be published online unless you opted out of this process. The date of the early version will be your article's publication date. The final article will be published to the same URL, and all versions of the paper will be accessible to readers.Thank you again for supporting open-access publishing; we are looking forward to publishing your work in PLOS Neglected Tropical Diseases. Best regards,Shaden Kamhawico-Editor-in-ChiefPLOS Neglected Tropical DiseasesPaul Brindleyco-Editor-in-ChiefPLOS Neglected Tropical Diseases"
\ No newline at end of file