diff --git "a/deduped/dedup_1010.jsonl" "b/deduped/dedup_1010.jsonl"
new file mode 100644--- /dev/null
+++ "b/deduped/dedup_1010.jsonl"
@@ -0,0 +1,46 @@
+{"text": "Memento, the protagonist, Lenny, is plagued by a crippling neurological disorder that renders him incapable of storing memories for longer than fifteen minutes. He wants nothing more than to avenge the murder of his wife, but as another character in the film tells him, \u201cEven if you get revenge, you're not going to remember it. You're not even going to know it happened.\u201d Lenny has anterograde amnesia, a condition typically caused by stroke or other illness.  Most forms of amnesia\u2014including the more common retrograde amnesia, which involves the loss of long-term memory\u2014are caused by some type of brain injury\u2014 particularly to the hippocampus.In the 2002 thriller Retrograde amnesia can arise from brain damage that interferes with memory storage, retrieval, or consolidation. And it is by studying retrograde amnesia that scientists have developed theories explaining where the brain stores memory traces and how it consolidates them into long-term memories. What ultimately causes amnesia\u2014a failure to store memories or a failure to retrieve them\u2014is not clear.A major challenge in resolving this question experimentally is being able to determine whether an animal has truly recovered a lost memory or has simply re-learned the task at hand. By refining a classic behavioral neuroscience experiment to test spatial learning and memory, Livia de Hoz, Stephen Martin, and Richard Morris have developed a novel protocol that distinguishes retrieval from new learning. The experiment, developed by Morris over fifteen years ago, takes advantage of the fact that rats are good swimmers but prefer life out of water. Rats are placed in a pool and trained to remember the location of an escape platform, hidden just under the surface. (The rats can't see it because the water is cloudy.)Here, de Hoz et al. trained rats to a particular platform location\u2014their escape route\u2014then gave them hippocampal lesions. One group received \u201csham\u201d lesions, another partial lesions, and a third complete lesions. Partial lesions, the authors explain, should damage only a subset of the stored memory traces and thus weaken the rats' memory rather than completely disrupting it.The rats' postoperative memory was tested by first placing them in the pool with the platform hidden: as expected, the lesioned rats couldn't remember where it was. After a minute, the platform was raised above the water, to remind them that it existed and that they could escape by climbing onto it. The platform was revealed in the original location for half the animals and in a novel location\u2014which could be construed as misleading information if you're a rat\u2014for the other half. If raising the platform was facilitating re-learning, then animals capable of learning would look for the platform in the new location. But if raising the platform functioned as a reminder, then animals should gravitate toward the place they were trained to, regardless of whether the platform reminder was in the original location or a new one. And that's what happened to the rats with partial lesions.De Hoz et al. then repeated the experiments in a new environment. If the rats managed to escape in this situation, the authors explain, then the reminder treatment could be causing new learning rather than triggering recall of the original training experience. Not surprisingly, the rats with total lesions failed to learn in this new environment (or to be reminded in the previous experiment), while the control rats adapted to the new location. The group with partial lesions failed to learn.Since partially lesioned rats responded to the reminder treatment by recalling the original platform location, their initial memory failure couldn't have resulted from a storage failure. And since they did not realize they could escape from the new location, the reminder didn't induce new learning. Among the many questions these results raise is what role the hippocampus plays in memory storage and retrieval. It could be, as the authors propose, that essential components of spatial memory traces are either stored in the hippocampus or reactivated there, since only the partially lesioned rats responded to reminders. Whether that proves true, de Hoz et al. have contributed a much needed resource for investigating the neural basis of memory loss."}
+{"text": "Retrograde amnesia can occur after brain damage because this disrupts sites of storage, interrupts memory consolidation, or interferes with memory retrieval. While the retrieval failure account has been considered in several animal studies, recent work has focused mainly on memory consolidation, and the neural mechanisms responsible for reactivating memory from stored traces remain poorly understood. We now describe a new retrieval phenomenon in which rats' memory for a spatial location in a watermaze was first weakened by partial lesions of the hippocampus to a level at which it could not be detected. The animals were then reminded by the provision of incomplete and potentially misleading information\u2014an escape platform in a novel location. Paradoxically, both incorrect and correct place information reactivated dormant memory traces equally, such that the previously trained spatial memory was now expressed. It was also established that the reminding procedure could not itself generate new learning in either the original environment, or in a new training situation. The key finding is the development of a protocol that definitively distinguishes reminding from new place learning and thereby reveals that a failure of memory during watermaze testing can arise, at least in part, from a disruption of memory retrieval. Teasing apart memory defects in animal models is not an easy task. A new protocol reveals that failure of memory can arise, at least in part, from a disruption of memory retrieval We are not in a position to decide between these two hypotheses.\u201dFor more than a century, the phenomenon of retrograde amnesia (RA)\u2014the loss of memory for events that occur prior to a variety of precipitating brain insults\u2014has provided the foundation for theories of memory consolidation and the locus of trace storage . HoweverStudies of RA have favoured a memory-consolidation interpretation in instances in which systematic variation of the time interval between experience or training and the subsequent brain insult has revealed a temporal gradation of RA . ComputaIn studies of spatial memory using the watermaze, amnesia for the location of the escape platform in posttraining probe trials (PTs) has generally been interpreted as a failure of learning, consolidation, or storage . To inveA summary of the experimental design is provided in F = 30.4, p < 0.001). Only animals that reached the acquisition criterion received lesions (69 out of 73 rats trained). The prospective lesion groups, trained as normal animals, did not differ .During cued pretraining, the rats quickly learned to search for, and climb onto, the visually cued escape platform. In the main spatial training phase, the animals rapidly learned to locate and raise the platform in order to escape from the pool , as indiOf the 69 animals that received lesions, one died after surgery and nine were excluded based on strict histological criteria, leaving a total of 59 animals  involving two between-subject factors: lesion group and platform location during the reminder treatment , and two within-subject factors: PT (PT1 and PT2) and quadrant (training versus opposite). In both figures, the initial memory expressed during PT1 is shown in the left lane. This reveals that the partially lesioned rats were at chance, whereas the sham-lesioned rats could remember the location of the platform . The complete-lesioned animals were at chance. Analysis of percentage time in zone , but not in the two lesion groups.The key new findings are shown in  in zone  likewisePT1 ended with the animals finding the platform in the original training location, or in a novel location in the \u2018opposite' quadrant of the pool . With respect to the performance of the partial lesion group alone on this quadrant measure  and no difference between novel and original reminding locations (F < 1). The partial lesion group also showed a highly significant preference for the training quadrant versus the opposite quadrant on PT2 . The same pattern of results is apparent in the zone data  that also did not differ between \u2018novel' and \u2018original' groups (F < 1). Because a bias for the training location appeared even in the animals that were exposed to a novel platform position, memory on PT2 cannot be attributed to relearning of the platform location.The key new finding is that the partial lesion group displayed a bias for the training quadrant that was equivalent whether the animals had found the platform in the original training location or in the novel opposite location, at the end of PT1. The overall ANOVA of the PT2 quadrant data revealed a triple interaction of lesion group \u00d7 quadrant (training versus opposite) \u00d7 platform location during reminding  . Conversely, sham-lesioned animals exposed to the novel location exhibited modest reversal learning, increasing their time in the opposite quadrant . The same pattern of results was obtained from the analysis of time in the training zone .In contrast, sham-lesioned animals behaved quite differently in PT2 as a function of whether the platform was presented in the original or the novel location during the reminder treatment. Performance showed a further bias towards the training location between PT1 and PT2 following the event of climbing onto the escape platform in its original location, but exposure to the novel location resulted in a reduction in time spent in the training zone\u2014a partial reversal. Supported by significant interactions in the overall ANOVA, analysis of time spent in the training quadrant revealed that, as expected, sham-lesioned animals reexposed to the original location increased their time there between PT1 and PT2 . However, escape from the water at the end of this PT might be sufficient to support new one-trial learning. Such learning was absent in the partial hippocampal lesion group (F < 1). The sham lesion group, in contrast, did learn , performing significantly better than the lesioned groups on PTn2 . The complete lesion group again showed no evidence of learning in a new environment (F < 1).As an independent test of whether the reminder treatment of escape onto a platform could support new learning, all animals were taken to a second (\u2018downstairs') watermaze and given two PTs . This waThe key finding of this study is that rats with partial lesions of the hippocampus can be reminded of a preoperatively learned escape location in a watermaze by both correct and potentially misleading information. Whereas sham-lesioned rats showed new one-trial learning towards or away from the originally trained quadrant as a function of the type of reminder treatment to which they were exposed, partially lesioned animals were unable to learn. Instead, the first PT served only as a reminder of the original platform location irrespective of where in the pool the platform was raised at the end of this trial. Rats with complete hippocampal lesions showed neither new learning nor reminding.There is an extensive classic literature on the nature and effectiveness of reminder treatments . ExposurTwo features are distinctive about our study. First, unlike in many previous studies, the reactivated memory involves the recall and expression of highly specific information\u2014a discriminable position in space, and not just a faster escape latency, or greater freezing. Second, despite exposure to a novel platform location leading to reversal learning in the sham lesion group, the partial lesion group displayed only reminding of the original platform location. This distinction is important because, with the current revival of interest in memory retrieval, our protocol circumvents the ambiguities involved in the use of relearning as an index of retention. One example of a study that used a reacquisition rather than a true reminding protocol  revealedNonetheless, the watermaze task is deceptively complex, and successful performance depends on the operation of several distinct memory systems . AccordiOur use of partial hippocampal lesioning introduces several other issues. First, it is a technique that is arguably more relevant to human amnesia, in which damage to a structure is typically incomplete. Second, it is also relevant to the many studies in which a pharmacological intervention is applied at a single site within a brain region\u2014microinfusion into the dorsal hippocampus, for instance, is likely to have minimal effects on ventral hippocampal tissue see . Third, In raising many more questions than they answer, the present findings open a potential avenue of research into the neural dynamics of memory reactivation and retrieval. Specific interventions such as local AMPA receptor blockade cf.  might beDissociating the storage and retrieval functions of the hippocampus in memory is central to our understanding of the role of hippocampo\u2013cortical connections. Many theories of hippocampal function are based on the idea that the hippocampus acts as a mediating link between different cortical regions during the interval before systems consolidation is complete . ParadoxWe used a total of 73 male Lister Hooded rats obtained from a commercial supplier . They were pair-housed in plastic cages with sawdust bedding and ad libitum access to food and water. Their care and maintenance and all experimental procedures were carried out in accordance with United Kingdom Home Office Regulations.Behavioural testing was conducted using two separate circular pools, 2.0 m in diameter and 60 cm high, each located in well-lit rooms with numerous distal visual cues. One pool was used for training and retention (\u2018upstairs') and the other for new context learning (\u2018downstairs'). The pools were filled with water at 25 \u00b0C \u00b1 1 \u00b0C made opaque by the addition of 200 ml of latex liquid . We used the \u2018Atlantis platform' , a polysTesting was carried out according to the schedule illustrated in This phase consisted of a single day of nonspatial cued training in the \u2018upstairs' watermaze . The visible cue was suspended approximately 25 cm above the platform, which was moved every two trials to one of four possible locations, according to a pseudorandom schedule; the dwell radius was set at 20 cm, and the dwell time was 1 s.Training on a spatial reference memory task began 3 d later in the same watermaze. Rats received ten trials/day, in two sessions of five consecutive trials each , for 4 d. The dwell time was set to 0.5 s throughout training, but the dwell radius was gradually reduced over days . This schedule was intended to promote accurate and focused searching, but without generating the highly perseverative strategy that typically results from the use of long dwell times . Rats weSurgery took place 1\u20132 d after the end of training. Rats were given either partial or complete bilateral neurotoxic lesions of the hippocampal formation (DG and CA fields), or sham surgery. Complete lesions were intended to remove 85% or more of the total hippocampal volume. Partial lesions targeted the temporal two-thirds of the hippocampus, sparing the septal  third of the structure. The rats were assigned to groups of equivalent mean performance on the basis of their escape latencies during the final day of training. Lesions were made with ibotenic acid  following the protocol of This phase began 14 d after the end of training. It consisted of two PTs (PT1and PT2) spaced 1 h apart, with a reminder treatment occurring at the end of PT1.Each PT (PT1 and PT2) began with a standard 60-s swim with the platform unavailable. In each PT, the rats were placed into the pool in either the adjacent right or the adjacent left quadrants with respect to the training quadrant. Start positions were counterbalanced across PTs and across rats. At the end of the 60 s the platform was raised and the animals were allowed to find and climb onto it. The rats were allowed a further 60 s to locate the platform once risen (but still hidden just below the water surface); if unsuccessful within this period, they were guided to the platform. They then remained on the platform for 30 s.The raising of the platform at the end of PT1 constituted the reminder treatment; thus PT1 is sometimes referred to as the \u2018reminder trial.' A key variable was that the platform was raised in either the original training location  or in a novel location in the centre of the opposite quadrant of the pool . Note that reminding using the original location always occurred in the training quadrant, and reminding using the novel location always occurred in the opposite quadrant. However, whereas the terms \u2018training' and \u2018opposite' are used to refer to physical areas of the pool, \u2018novel' and \u2018original' refer also to separate groups that received each type of reminder.For analysis of the different behavioural phases, several measures of performance were assessed, including escape latency, swim speed, and time spent within defined regions of the pool. Memory retention during PTs is inferred from the time spent in each quadrant of the pool as a percentage of the 60-s duration of the PT. A more sensitive measure can be obtained by analysing percentage time spent within a specified radius (zone) centred on the platform location . When tin1 and PTn2) spaced 1 h apart.New learning was assessed the next day in a separate \u2018downstairs' watermaze that constituted a novel context. The protocol was identical to that used during \u2018upstairs' retention testing, i.e., two rewarded PTs . Their brains were removed and stored in 10% formalin for 24 h before being blocked and embedded in egg yolk. The embedding procedure is described in The relative volume of spared tissue was calculated by measuring the area of hippocampus spared in each section of a particular brain according to the following protocol: Each coronal section containing hippocampus was placed under a photomacroscope , and the image taken by a mounted video camera was imported into NIH Image 1.63 . The area of spared hippocampal tissue in each section was then outlined and automatically calculated. Surrounding fibres such as the fimbria were excluded on the grounds that they would not be considered in a section were all the hippocampal cells dead. The sections were spaced 150 \u03bcm apart, yielding up to 32 sections in a sham lesion animal, and fewer in animals with acceptable partial lesions. For each rat, the total hippocampal \u2018volume' was calculated by adding the area of hippocampal tissue spared in each successive section. The proportion of hippocampus spared for each lesioned animal was expressed as a percentage of the mean hippocampal \u2018volume' for sham-lesioned animals. Values for the left and right hippocampi were initially calculated separately and then averaged see D.Strict criteria for acceptance of a lesion were used. The lesion had to be confined to the hippocampus in all cases, and leave intact tissue volumes of 25%\u201350% in the septal hippocampus with minimal sparing (less than 10%) elsewhere in the structure in the case of partial lesions, or less than 15% total hippocampal sparing in the case of complete lesions. Animals with minimal subicular damage, typically located at medial levels of the structure, were accepted."}
+{"text": "The extent of similarity between consolidation and reconsolidation is not yet fully understood. One of the differences noted is that not every brain region involved in consolidation exhibits reconsolidation. In trace fear conditioning, the hippocampus and the medial prefrontal cortex (mPFC) are required for consolidation of long-term memory. We have previously demonstrated that trace fear memory is susceptible to infusion of the protein synthesis inhibitor anisomycin into the hippocampus following recall. In the present study, we examine whether protein synthesis inhibition in the mPFC following recall similarly results in the observation of reconsolidation of trace fear memory.Targeted intra-mPFC infusions of anisomycin or vehicle were performed immediately following recall of trace fear memory at 24 hours, or at 30 days, following training in a one-day or a two-day protocol. The present study demonstrates three key findings: 1) trace fear memory does not undergo protein synthesis dependent reconsolidation in the PFC, regardless of the intensity of the training, and 2) regardless of whether the memory is recent or remote, and 3) intra-mPFC inhibition of protein synthesis immediately following training impaired remote (30 days) memory.These results suggest that not all structures that participate in memory storage are involved in reconsolidation. Alternatively, certain types of memory-related information may reconsolidate, while other components of memory may not. Whether a reactivated memory undergoes reconsolidation appears to depend on several factors, including the age of the memory and training intensity , 5,6]. R,6. R5,6]The present study demonstrates three key findings: 1) trace fear memory does not undergo protein synthesis dependent reconsolidation in the PFC, regardless of the intensity of the training, and 2) regardless of whether the memory is recent or remote, and 3) intra-mPFC inhibition of protein synthesis immediately following training impaired remote (30 days) memory.ad libitum access to water and food. Protocols regarding the training and surgery of the animal subjects were approved by the Institutional Animal Welfare Committee and were in compliance with NIH's Guide for Care and Use of Laboratory Animals.Male Sprague Dawley rats  weighing 250 to 300 gm were pair-housed under temperature-controlled conditions with a 12 hr light/dark cycle. All rats were given 2O/O2 mixture and then maintained under 2.5% isoflurane with a 2:1 N2O/O2 mixture via a face mask. Twenty-two gauge stainless-steel guide cannulae were implanted into the mPFC  using a stereotaxic device [Animals were anesthetized under 5% isoflurane with a 2:1 Nc device . AnimalsAnisomycin  was dissolved in 1 N hydrochloric acid, neutralized with NaOH, and then diluted in artificial cerebrospinal fluid (ACSF), pH 7.4. Anisomycin was bilaterally infused into the mPFC , at a rate of 0.25 \u03bcl per minute. The dose of 250 \u03bcg/2 \u03bcl has previously been shown to be effective in blocking reconsolidation ,19. AnisHabitest Unit, Coulbourn Instruments, Allentown, PA) and given a 120 second habituation period. Conditioning trials began with a 10 second tone (CS) followed by a 20 second trace period, after which the animal received a 0.8 mA foot-shock (US) for 0.7 seconds. Each CS-US paired training trial was separated by a pseudorandom inter-trial interval (ITI) that varied between 1\u20134 minutes. A pseudorandom ITI was used so that amount of time between foot-shocks could not be used as a cue for the US. For reactivation of memory, animals were placed in a novel context, given a 120 second habituation period followed by one presentation of the CS without the presentation of the US . Immediately following the reactivation trial, animals were divided into two comparable groups based on freezing behavior during the trace period of the reactivation trial. One group was bilaterally infused with anisomycin and the other with vehicle. For retention testing, each animal was placed in a novel context and given a 120 second habituation period. In the absence of foot-shock, four presentations of the CS were given separated by a varied ITI period. During the retention and reactivation trials, freezing behavior  was measured during the CS, trace, and ITI periods. Freezing behavior was recorded every two seconds during scoring periods. Freezing behavior during the four CS presentations was averaged for each animal. Following trace CS-US retention testing; contextual retention was measured by placing the animals back into the original training context for a 90 sec period during which freezing was scored, without exposure to the CS or US.All behavioral tests were performed by an investigator who was blind to the treatment groups. Animals were placed in the training context (ANOVA was used to compare the percentage of trace period freezing during retention testing between the anisomycin- and vehicle-infused groups as well as to compare trace period freezing between reactivation and retention trials, within and between the groups. An unpaired t-test was used to compare CS as well as contextual freezing between the anisomycin- and vehicle-infused groups. A p value of \u2264 0.05 was used as the criterion for statistical significance. Raw data were used for all statistical analyses.A two-way repeated measures CS, conditioned stimulus; CTA, conditioned taste aversion; iti, intertrial interval; mPFC, medial prefrontal cortex; PL/IL, prelimbic/infralimbic; US, unconditioned stimulus.SB participated in the design of the study, carried out behavioural experiments, histological analysis, statistical analysis, and drafted the manuscript. JR participated in the design of the study, carried out behavioural experiments and statistical analysis. PD participated in the design of the study, coordinated the study, and revisions of the manuscript."}
+{"text": "A new memory is initially labile and becomes stabilized through a process of consolidation, which depends on gene expression. Stable memories, however, can again become labile if reactivated by recall and require another phase of protein synthesis in order to be maintained. This process is known as reconsolidation. The functional significance of the labile phase of reconsolidation is unknown; one hypothesis proposes that it is required to link new information with reactivated memories. Reconsolidation is distinct from the initial consolidation, and one distinction is that the requirement for specific proteins or general protein synthesis during the two processes occurs in different brain areas. Here, we identified an anatomically distinctive molecular requirement that doubly dissociates consolidation from reconsolidation of an inhibitory avoidance memory. We then used this requirement to investigate whether reconsolidation and consolidation are involved in linking new information with reactivated memories. In contrast to what the hypothesis predicted, we found that reconsolidation does not contribute to the formation of an association between new and reactivated information. Instead, it recruits mechanisms similar to those underlying consolidation of a new memory. Thus, linking new information to a reactivated memory is mediated by consolidation and not reconsolidation mechanisms. The association of new information with an established memory is mediated through a consolidation mechanism, leaving the original memory intact. ThusUsing the IA task modified to a second-order conditioning paradigm as described below, we determine (1) whether reactivation of an established memory allows the formation of a new association between the recalled memory and new information, (2) whether the formation of the new association is mediated by reconsolidation or consolidation mechanisms, and finally, (3) whether the formation of the new association interferes with the stability and the reconsolidation of the old memory.5, 66 = 11.76, p < 0.0001). As shown in p < 0.01). In contrast, independent from the second behavioral experience received in context B, all groups tested in context A had strong retention and there were no significant differences among the groups . Interestingly, the new memory for context B was as strong as the memory for context A.Rats were placed on one side of an IA apparatus (context A), and 2 s later a light was switched on . After 10 s the door opened, allowing the rats to enter the dark compartment where they received a foot shock see . Rats we5,42 = 10.50; p < 0.0001). A Newman-Keuls post hoc test showed that the significantly different latencies found 48 h after reactivation were maintained 1 wk later, indicating that the newly formed association is long-lasting .To determine whether the memory for context B is long-lasting, all groups were retested 1 wk later and similar results were found B. A one-Thus, together, these results showed that a long-lasting association is formed between new information and a reactivated IA memory. In other words, a new association is made between the new context B (S2) and the fear that was originally elicited by the light in context A (S1) paired with the shock (US).2,21 = 18.69; p < 0.0001), context of testing  and a significant interaction . A Newman-Keuls test revealed that anisomycin disrupted the memory for context B (Aniso: 72.75 \u00b1 24.84 s), compared to vehicle . As expected, the rats that did not undergo reactivation had no retention for context B (19.25 \u00b1 2.88 s).We next determined the effect of protein synthesis inhibitors injected systemically after reactivation in context B on both the new and the reactivated memory. Rats were trained in context A and reactivated in context B, as described above. Immediately after reactivation they received a systemic injection of either anisomycin or vehicle solution, and 1 wk later were tested in context B and then in context A . A two-wp < 0.01). The amnesic effect of anisomycin was contingent upon the reactivation event, as rats that did not undergo reactivation and were injected with anisomycin 48 h after training maintained their memory for context A (375.87 \u00b1 77.43 s).Moreover, in line with previous findings as well as the reconsolidation hypothesis ,19, systThus, when a memory is reactivated in the presence of new information and forms new associations, both the new and the original memory undergo a protein-synthesis-dependent phase.Because the newly formed association is composed of both new information and the reactivated memory, we investigated the mechanisms that mediate its formation. Does reconsolidation play a major role in this process, or is consolidation also involved?To address this question, we first set out to determine molecular mechanisms that are differentially engaged in distinct brain regions during either consolidation or reconsolidation of IA.In a previous study , we showIn a first set of experiments, rats were trained on IA and five hours later received bilateral injections into the amygdala of either C/EBP\u03b2 antisense oligodeoxynucleotide (\u03b2-ODN) or, as a control, scrambled oligodeoxynucleotide (SC-ODN). Retention was tested 48 hours after training. As shown in 1,46 = 4.57; p < 0.05). A Newman-Keuls post hoc test revealed that, at Test 2, the retention levels of the rats that received \u03b2-ODN-injections were significantly lower (83.77 \u00b117.34 s) than those that received SC-ODN-injections . All animals had similar latencies at Test 1  . 5 h after Test 1, half of the rats received bilateral amygdala injections of \u03b2-ODN and the other half of SC-ODN. All animals were again tested for IA memory retention 48 h after Test 1 (Test 2). A two-way ANOVA showed a significant effect of treatment (F51.77 s) B. To tes51.77 s) B. TogethHence, at 5 h post-training or post-recall, C/EBP\u03b2 is required in the hippocampus for consolidation, but not reconsolidation, and in the amygdala for the reconsolidation, but not consolidation, of IA memory. In other words, the C/EBP\u03b2 requirement in either the hippocampus or the amygdala during consolidation or reconsolidation can be used to doubly dissociate the critical contribution of the two processes.We first tested whether the formation of an association between the new information and the reactivated memory is dependent on amygdala C/EBP\u03b2 expression.1, 19 = 15.68, p < 0.001), a significant effect of the treatment , and a significant treatment \u00d7 context interaction . A Newmans-Keuls post hoc test showed that the memory of context A was significantly lower in rats that received \u03b2-ODN injection in the amygdala after reactivation (45.14 \u00b1 3.62 s), compared with that of rats that received amygdala SC-ODN-injection, and also that of non-reactivated controls injected with \u03b2-ODN . In contrast, when the rats were tested in context B, they all showed a strong memory . Together, these data indicate that reconsolidation mechanisms are not engaged in the formation of the new association that links new information with a reactivated memory.Rats were trained in context A, reactivated with the visual CS in context B, and divided in two subgroups. 5 h after reactivation, one group was injected in the amygdala with \u03b2-ODN, while the other received SC-ODN injection and served as control. Additional control groups underwent the same training and \u03b2-ODN injection procedures, but in the absence of recall. 48 h later, the rats were tested first in context B and then in context A. As shown in We then asked whether the formation of the new association depends on consolidation mechanisms; that is, we tested the requirement for C/EBP\u03b2 in the hippocampus.1, 20 = 71.28, p < 0.0001), and a significant treatment \u00d7 context interaction . A Newmans-Keuls post hoc test showed that the rats that recalled the memory in context B after receiving hippocampal injection of \u03b2-ODN had a significantly lower retention (17.5 \u00b1 2.58 s), compared with SC-ODN-injected controls . In contrast, when the groups of rats were tested in context A, they all showed a strong memory: retention of \u03b2-ODN-injected rats was similar to that of both SC-ODN and \u03b2-ODN-injected, non-reactivated controls .Rats were trained with IA in context A, and their memory was reactivated in context B as described above. They were divided in two subgroups 5 h after reactivation: one was injected into the hippocampi with \u03b2-ODN, while the other received SC-ODN. An additional control group underwent training and \u03b2-ODN injection, but in the absence of recall. The rats were tested 48 h later, first in context B and then in context A. As shown in 1, 21 = 141.4, p < 0.0001) and a significant treatment \u00d7 context interaction . A Newman-Keuls post hoc analysis revealed that the new memory for context B, induced by reactivation through the visual CS in this context, was blocked by hippocampal anisomycin injection . However, in the same rats, memory for context A remained unaffected (Aniso: 407.50 \u00b1 43.04 s), and was comparable to memory of context A of rats that received either vehicle injection (vehicle: 330.50 \u00b1 29.57 s) or anisomycin injection without reactivation (426.37 \u00b1 38.53 s). As expected, anisomycin-injected rats that did not undergo reactivation in context B showed no memory for this context (31.87 \u00b1 7.76 s).Taubenfeld et al.  also shoAnisomycin injections into the amygdala were not used to dissociate between consolidation or reconsolidation requirements because amygdala protein synthesis is required for both consolidation and reconsolidation of IA .These results reveal that consolidation, but not reconsolidation, mechanisms contribute to the formation of an association composed of new information and a reactivated memory.Together, our results indicate that when an established memory is reactivated in the presence of new information, its reconsolidation process is not essential in linking the reactivated memory with the new information. In fact, these two processes are doubly dissociable.In particular, we provide evidence that, like previously found with other second-order fear-conditioning tasks ,21\u201323, tConversely, the formation of the new association S2-fear appears to be mediated by molecular mechanisms similar to those underlying the initial consolidation of a new memory; indeed, hippocampal inhibition of protein synthesis or C/EBP\u03b2 expression selectively disrupts the new S2-fear memory, while it leaves the old memory intact. Furthermore, the amnesia of the new S2-fear association produced by hippocampal disruption of protein synthesis or C/EBP\u03b2 does not seem to be caused by a defect in the retrieval process because, during the same testing session, the old memory is normally retrieved. These data support the hypothesis that amnesia displayed after the disruption of consolidation is the result of defective stabilization and not of impaired retrieval \u201326.The amygdala requirement for C/EBP\u03b2 during IA reconsolidation, but not consolidation, is intriguing. Antisense-mediated disruption of C/EBP\u03b2 in the amygdala 5 h after IA recall impairs retention at later times, and this effect is contingent upon memory reactivation. By contrast, no memory deficit is produced by the same treatment at the same time point during the initial consolidation. Although our results do not exclude the possibility that during consolidation C/EBP\u03b2 may play a role in the amygdala at other time points, they reveal that, soon after 5 h post-training or post-recall, this molecule is differentially engaged in consolidation versus reconsolidation. Hence, this requirement at this time point selectively dissociates the contribution of IA reconsolidation. Previous results from Taubenfeld et al.  showed tOur data, together with the results obtained with cued fear conditioning \u201331, contD-aspartate receptors, play a critical role in second-order conditioning paradigms. In fact, a second-order appetitive conditioning is blocked by excitotoxic lesions of the amygdala [D-aspartate receptor antagonist DL-2-amino-5-phosphonopentanoic acid (APV) prevents the association between S2 and fear elicited by S1 in second-order fear conditioning, while it enhances the expression of the first-order conditioning [D-aspartate receptors) during acquisition, and tested memory retention within 1\u20132 h post-training. As it has been previously reported, regions involved in the acquisition of the task (whether first-order or second-order conditioning) may not participate in the memory stabilization process [Our findings seem to disagree with those indicating that the amygdala, and in particular amygdala N-methyl-amygdala . Moreoveitioning . These d process .Why does the disruption of C/EBP\u03b2 in amygdala not affect IA consolidation, but, according to previous evidence by Berman et al. , the inhConversely, the reconsolidation of IA requires protein synthesis, as anisomycin injected into the amygdala immediately after recall results in amnesia (unpublished data). Nevertheless, we chose not to use this amygdala requisite to dissect the role of reconsolidation or consolidation in our second-order IA conditioning because, as indicated by previous literature discussed above , amygdalHence, taken together, our results indicate that memory reactivation by recall can mediate two independent processes: the formation of a new association composed of new and old and reactivated information and the reconsolidation of the old memory. These processes occur in an independent fashion, as they can be doubly dissociated on the basis of their molecular requirements in distinct brain regions.Some authors have suggested that each time a memory is reactivated, a new encoding event occurs , and it In conclusion, the evidence provided in this study is in agreement with the working model described in Alberini , in whicAccording to our working model , the proLong Evans rats (200\u2013250 g) were used in all experiments. Rats were individually housed and maintained on a 12 h on/12 h off light/dark cycle, and experiments were carried out during the light hour cycle. All rats were allowed free access to food and water.The IA chamber consisted of a rectangular-shaped box, divided into a safe compartment and a shock compartment. The safe compartment was white and illuminated; the shock compartment was black and dark. Foot shocks were delivered to the grid floor of the dark chamber via a constant current scrambler circuit. The apparatus was located in a sound-attenuated, non-illuminated room. During training sessions, each rat was placed in the safe compartment with its head facing away from the door. After a period of 10 s, the door separating the compartments was automatically opened, allowing the rat access to the shock chamber. Latency to enter the shock chamber was taken as a measure of acquisition. The door closed 1 s after the rat entered the shock chamber, and a brief foot shock (0.9 mA for 2 s) was administered to the rat. The rat was then removed from the apparatus and returned to its home cage. Retention tests, which also recalled and reactivated the memory, were performed 48 h (Test 1) later by placing the rat back in the safe compartment and measuring the latency to enter the shock chamber. Foot shock was not administered on the retention test, and testing was terminated at 540 s. 48 h after Test 1, animals were retested for retention (Test 2). Latency to re-enter the dark compartment was taken as memory retention. An experimenter blind to the treatment of the groups scored latencies. Statistical analysis of the behavioral data was performed using a one- or two-way ANOVA followed by Student Newman-Keuls post hoc tests. All protocols complied with the National Institutes of Health Guide for the Care and Use of Laboratory Animals and were approved by the Mt. Sinai School of Medicine Animal Care Committees.A slightly modified protocol of IA and two different shuttle boxes (context A and context B) were used for the behavioral experiments. Each box consisted of two rectangular-shaped Perspex chambers separated by a sliding door. In context A, one chamber was white with grid floor (safe compartment) and the other dark and black (shock compartment) with grid floor. In context B, the safe compartment was very different than that of context A and had a smooth plastic floor and black-and- white striped wallpaper on the walls and roof; the black compartment was the same as in context A. Some perfume was vaporized to make the odor of the context B different. Furthermore, context B was conducted in a different experimental room. During training, rats were placed into context A. A light was switched on 2 s later , and 10 s later the door between the two chambers was opened to allow the rat to enter the dark chamber. Here, a foot shock (0.9 mA) was delivered to the grid floor via a constant current scrambler circuit. Rats were then immediately returned to their home cage. 2 d later, rats that received a reactivation trial (context B + light) were placed in context B, and 2 s later the light was switched on. The rats remained in this context for 90 s and were not allowed to enter the dark compartment. Finally, the rats were returned to their home cages. Control groups included rats that were either exposed to context B for 90 s without the light (context B), or rats that did not undergo reactivation and were left in the home cage (non-reactivated). Rats were tested 2 d later, in either context A and/or context B, as detailed in the Results section. No light was switched on during the test session. The latency to enter into the dark (shock) compartment was measured for all groups. Latency to enter the shock chamber before receiving the shock was taken as acquisition. Latency to re-enter the dark compartment was taken as memory retention. An experimenter blind to the treatment of the groups scored latencies.Intraperitoneal injections of anisomycin at 210 mg /kg were performed as previously described .Rats were anesthetized with ketamine (60 mg/kg) and xylazine (7.5 mg/kg), and stainless steel cannulas (22 gauge) were stereotactically implanted bilaterally into either their hippocampi  or basolateral amygdala nucleus . After surgery, rats were returned to their home cage for a 7-d recovery period.C/EBP\u03b2 antisense  and scrambled oligodeoxynucleotide  were bilaterally injected in the basolateral amygdala 5 h after training or reactivation .Hippocampal injections of 1 \u03bcl of 125 \u03bcg/\u03bcl of anisomycin  were performed as previously described. \u03b2-ODN or SC-ODN were bilaterally injected in the hippocampi 5 h after reactivation , as previously described .At the end of the experiments, rats were anesthetized, and their brains were removed, frozen, sectioned, and inspected for cannula placement."}
+{"text": "We have reviewed research on the effects of stress on LTP in the hippocampus, amygdala and prefrontal cortex (PFC) and present new findings which provide insight into how the attention and memory-related functions of these structures are influenced by strong emotionality. We have incorporated the stress-LTP findings into our \u201ctemporal dynamics\u201d model, which provides a framework for understanding the neurobiological basis of flashbulb and traumatic memories, as well as stress-induced amnesia. An important feature of the model is the idea that endogenous mechanisms of plasticity in the hippocampus and amygdala are rapidly activated for a relatively short period of time by a strong emotional learning experience. Following this activational period, both structures undergo a state in which the induction of new plasticity is suppressed, which facilitates the memory consolidation process. We further propose that with the onset of strong emotionality, the hippocampus rapidly shifts from a \u201cconfigural/cognitive map\u201d mode to a \u201cflashbulb memory\u201d mode, which underlies the long-lasting, but fragmented, nature of traumatic memories. Finally, we have speculated on the significance of stress-LTP interactions in the context of the Yerkes-Dodson Law, a well-cited, but misunderstood, century-old principle which states that the relationship between arousal and behavioral performance can be linear or curvilinear, depending on the difficulty of the task. Numerous reviews in recent years have advanced our understanding of the interactions among long-term potentiation and depression (LTP/LTD), stress, and memory. These reviews have focused on specific topics, such as the cognitive implications of stress-LTP-LTD interactions . The poColgrove  and thenColgrove .A decade after Colgrove's description of the influence of emotionon memory, Yerkes and Dodson  studied With rare exceptions  must come down to a low level\u201d (page 251). Similarly, Duffy [In the 1950s, major figures in the field of cognitive psychologyappear to have been unaware of, or ignored, the findings of Yerkesand Dodson when they stated that the relationship between arousaland performance was exclusively curvilinear. Thus, Schlosberg, Hebb 5, and Dufy, Duffy  stated tThe exclusion of the findings of Yerkes and Dodson in thesereviews cannot be explained by a complete loss of interest in theYerkes-Dodson law by the mid-twentieth century. At about thistime, Postman  providedIt is ironic that not only were the original findings of Yerkes and Dodson ignored in major reviews on emotion and learning in the 1950s, but Hebb's incomplete illustration of the arousal-performance relationship as exclusively curvilinear(As one of us noted recently (Diamond ), debateIn a rare example of a scholarly analysis of the Yerkes-Dodsonlaw, Hanoch and Vitouch  assessedWhereas leaders in the field of cognitive psychology have fiercelydebated the heuristic value of the Hebbian version of theYerkes-Dodson law, behavioral neuroscientists, by contrast, haveuniversally accepted and incorporated the Hebbian version of theYerkes-Dodson law into their theorizing on brain-emotioninteractions  side of the stress-performance curve always declines toproduce poor performance, as it does in the Hebbian version of theYerkes-Dodson law , then stIn summary, we have asserted that the Hebbian version of theYerkes-Dodson law  is an inunder highstress conditions improves performance. In these tasks,irrelevant cues are excluded and strong emotionality ismotivating. In other tasks, proficiency demands the use of a widerrange of cues, and strong emotionality is disorganizing.There seems to be an optimal range of cue utilization for eachtask\u201d (pages 197-198). Importantly, Easterbrook interpreted theseobservations as an indication that \u201cthe effect ofemotionality on proficiency would depend on the complexity of thetask studied\u201d (page 187). Easterbrook emphasized thatperformance on only the most demanding and complex tasks wouldsuffer a \u201cdisintegration\u201d  asa result of strong emotionality . He noted that there was an impairment in behavioralperformance in complex tasks in response to strong emotionalitybecause \u201cthe range of cue utilization is reduced in response tostrong emotion\u201d (page 197), and that \u201ctasks requiring the use ofsmaller numbers of cues were facilitated by drive increments\u201d(page 192).A problem with \u201ctask difficulty\u201d as a critical factor inunderstanding emotion-memory interactions is that it is asubjective measure. It is therefore difficult, if not impossible,to operationally define the term \u201ctask difficulty\u201d withobjective criteria. Nevertheless, investigators over the past 5decades have taken on this task. One of the earliest attempts tounderstand how task variables interact with performance wasaccomplished in a landmark paper by Easterbrook , in one Easterbrook's cue utilization hypothesis stated that withincreased emotionality, there is a reduction in the range of cuesthat an individual can process. According to Easterbrook, if atask is complex, that is, involves attention to multiple cues,then performance will deteriorate under conditions of high stress.If, on the other hand, a task is simple, that is, involves focusedattention to a single cue, as occurs, for example, with the\u201cweapon focus\u201d phenomenon  in stress and memory processing. Elsewhere,Diamond et al. , 3 and otransiently shifted into an enhanced or impaired state ofplasticity induction at different times after the onset of anemotional experience.Finally, we have arrived at the critical question that underliesthe basis of our theorizing: what does it mean, from physiologicaland cognitive perspectives, for stress to affect the induction ofLTP? Our approach to addressing this question is different fromthe conventional view that LTP can be understood exclusively as aphysiological model of memory. We suggest here, as in previoustheorizing , that tWith this diagnostic perspective on LTP induction in mind, we cannow address the functional significance of the finding that stressblocks the induction of hippocampal LTP. In 1990, our groupsuggested that the reason why stress blocks LTP was becausestress, itself, activates endogenous mechanisms of plasticity incommon with mechanisms that are also activated by exogenouslyinduced LTP . We hypIn the following sections, we have extended our earlierspeculation that stress activated endogenous mechanisms in commonwith LTP in the hippocampus with the hypothesis that thehippocampus and amygdala both undergo a stress-induced activation,followed by an inhibition, of mechanisms underlying synapticplasticity. We suggest that the rapid activation of plasticitymechanisms in these two structures underlies the well-described,arousal-induced enhancement of memory, producing flashbulb andtraumatic memories in people, and fear conditioning in rodents. Wealso hypothesize that the PFC does not undergo a stress-inducedenhancement phase followed by an inhibitory phase. We interpretthe stress-induced inhibition of LTP in the PFC as an indicationthat stress produces an immediate inhibition of the functioning ofthe PFC, which is revealed behaviorally as a narrowing ofattention and impaired multitasking, or more globally, as animpairment of complex learning. systems that are, in this state,unusually sensitive \u2026\u201d .They further proposed that \u201cstress disrupts the function of thehippocampally based locale system and its context-specificlearning capacities while potentiating taxon systems and theircontext-free associations\u201d (page 518), and that thestress-induced suppression of the hippocampus would enable phobiasthat had been formed in childhood to be expressed in adulthood.For almost four decades, Bruce McEwen's group has been studyinghow stress hormones affect the brain and behavior. He and hiscoworkers first showed that the hippocampus has the greatestdensity of glucocorticoid receptors of all brain structures blocked the induction of LTP in CA1 in vitro. They iAt about the time that Thompson's group was studying restraintstress and paw shock effects on LTP in vitro, our group wasinvestigating how stress affected a low threshold form of LTP inCA1 of behaving rats. This form of plasticity, which is referredto as primed burst (PB) potentiation, can be induced by a total ofonly 5 physiologically patterned pulses delivered to CA1 , the elThe hypothesis that stress inhibited hippocampal functioning wassupported by a large number of cognitive and electrophysiologicalstudies conducted in the past decade. For example, we have foundthat stress, involving exposure of rats to either an unfamiliarenvironment or to a predator, impaired hippocampus-dependentmemory  andimpairs spatial and declarative memory. Based on these findings,major figures in the field have stated that stress adverselyaffects hippocampal functioning. For example, according to Nadeland Jacobs , \u201chigh lFinally, perhaps the ultimate denial of a necessary role of thehippocampus in emotional memory processing was stated by Dalgleish, in his We now suggest that the idea that hippocampal functioning isglobally impaired by strong emotionality is incomplete andinaccurate. The following observations illustrate inconsistencieswith the idea that strong stress impairs hippocampal functioning.The hippocampus is an important component of contextual fearconditioning component. In the next section, we present a model of stress-hippocampus interactions which addresses how hippocampal functioning can be impaired by stress, and can also be involved in the formation of emotional memories.enhance hippocampalLTP. This finding was first described by Seidenbecher et al. [increase in the duration of LTP recorded in the dentategyrus (DG). Numerous other studies have replicated and extendedthis finding to show that a variety of arousing experiences, suchas water immersion, exposure to novel places and objects, andspatial learning occurring around the time of the delivery oftetanizing stimulation, all increased the duration of LTP in CA1and DG .\u03b2-adrenergic receptors , as wela et al. ; Lisman a et al. ) and loca et al. ; Wang eta et al. ; Wang eta et al. ; Blank ea et al. ; Chen eta et al. ), all apRecent work has implicated corticosterone in the stress-inducedenhancement, as well as the impairment, of hippocampal synapticplasticity. Jo\u00ebls et al. have shown that brief application ofcorticosterone around the time of tetanizing stimulation enhancedLTP in CA1 in vitro via nongenomic activation of mineralocorticoidreceptors delay from the initiation of the stress experience before tetanizing stimulation was delivered.The time dependency of stress or amygdala activation effects onLTP was demonstrated directly in a series of studies by Akirav andRichter-Levin , 213. ThAccording to the temporal dynamics model, the onset of an emotional experience activates endogenous forms of neuroplasticity in the hippocampus for a period of seconds to minutes, which is revealed as an enhancement of LTP when tetanizing stimulation occurs in this narrow-time window  would min .Ultimately, the rapid stress-induced activation of the hippocampus by steroidal and nonsteroidal neuromodulators would produce a dramatic increase in intracellular calcium levels . ByconThe idea that the threshold for LTP induction is raised in phase 2, rather than there being a complete suppression of hippocampal plasticity, has important functional considerations. We have commented previously that stress appears to reduce the efficiency of hippocampal processing, but does not produce the equivalent ofa hippocampal lesion .In summary, we have reviewed literature which indicates that the onset of stress activates the hippocampus, thereby producing a rapid and dramatic increase in levels of intracellular calcium. The increased calcium serves as the trigger stimulus to briefly produce an enhancement (phase 1), followed by an impairment (phase2), of the induction of endogenous synaptic plasticity in the hippocampus. Although the initiation of phase 2 is theorized to involve a calcium-triggered reduction in the sensitivity of NMDA receptors, its maintenance over hours to days may involvedepotentiating mechanisms as well , the memory of the rats' exposure to the cat was notmeasured, but in other work, we have found that rats develop a strong, extinction-resistant, fear of the context temporally associated with their exposure to the cat . This pIn theory, once the phase 1 activational \u201cwindow\u201d closes, and phase 2 begins, the hippocampus becomes less efficient at processing new information. Therefore, 30 minutes after catexposure occurred, the hippocampus would have been less efficient at storing the memory of the platform location, which explains why rats given minimal water maze training 30 minutes after catexposure had poor memory for the platform location 24 hours later.We have conducted a second test of the temporal dynamics hypothesis by examining the influence of pretraining stress on new learning occurring when the hippocampus presumably was in phase 2,which is a time when we would expect that memory formation (for phase 2 events) should be impaired. It is well known that hippocampal damage or inactivation can interfere with contextual,but not cued, fear conditioning  were given 1 (brief stress) or 10 (prolonged stress) inescapable immersions in a tank of water . Two groups of rats were given a single water stress (1 minute ofwater immersion) and then they were given fear conditioning training either immediately (brief stress-no delay) or 8 minutes later (brief stress-delay). The group of rats given prolongedwater stress swam for an average of 35 seconds per immersion, followed by a 15-second period out of the water, which was repeated 10 times in an 8-minute period. After the tenth immersion in water, the rats in this group were immediately given fear conditioning training (prolonged stress).Adult male Sprague-Dawley rats  pseudorandomly delivered over 30 minutes . Before each of the 10 shocks,a tone was delivered for 10 seconds, with the last 2 seconds of the tone coincident with the delivery of shock. Twenty four hours after training, all rats were reexposed to the shock environmentfor 5 minutes for the contextual fear memory test and then they were placed in a different environment where the auditory cue was delivered for 3 minutes. Conditioning was measured as the percentof time that the rats exhibited immobility (freezing) to the context or cue, as determined by automated detection of their movement (Coulbourne instruments).The rats that were given a single 1-minute immersion in the water immediately before fear conditioning was expected to exhibit intact contextual fear memory because brief water exposure wouldbe expected to drive the hippocampus into the phase 1 state. In contrast, the rats that experienced repeated immersions in the water were expected to exhibit impaired contextual fear memorybecause more prolonged stress would be expected to drive the hippocampus into the phase 2 state .We have found that rats given brief pretraining water stress immediately before fear conditioning exhibited contextual and cued fear conditioning which was equivalent to the degree ofconditioning observed in the nonstressed group . TherefoThe memory performance of rats given prolonged water stress prior to fear conditioning training was quite different from the memory performance of rats given brief water stress. Rats given 8minutes of pretraining stress exhibited intact cued  fear memory, but they exhibited a complete absence of contextual (hippocampus-dependent) fear memory. Thus, tIt is important to point out that the inhibitory effect of water stress on contextual fear conditioning was produced by the repeated immersions of the rats in the water, and not only becausethe water stress began 8 minutes before fear conditioning training. Rats that were given only a single immersion in the water 8 minutes before fear conditioning developed intactcontextual and cued fear memory  followed by inhibition (phase 2) of hippocampal plasticity wouldproduce a relatively brief period, an isolated fragment of time, when the formation of the memories of events occurring at the onset of an emotional experience would be optimized, therebyenhancing the association between otherwise neutral cues with the onset of a traumatic experience . Thus, Third, processes initiated during phase 1 and then active in phase 2, such as the corticosterone-mediated activation of the GR receptor, genomically mediated events, and protein synthesis, would underlie the first phase of the consolidation of the emotional memory. As hippocampal neurons proceed through the molecular sequence of events leading to structural plasticityunderlying the storage of the memory of the emotional event, it would be prudent for the storage process to occur without being contaminated by the processing of new information. Therefore, asthe hippocampus descends into phase 2, it goes partially \u201coffline\u201d for a period of hours as the hippocampus begins to consolidate information acquired during phase 1.Our temporal dynamics model suggests that qualitative features of hippocampal memory processing in response to stress should be different from the type of memory processing which is normallyattributed to the hippocampus. That is, over the past few decades, investigators have developed the view that the hippocampus plays a role in binding together the elements of an experience to generatea \u201ccognitive map\u201d (O'Keefe and Nadel ), or a \u201cThe extensive evidence of a stress-induced impairment of LTP and spatial memory provided strong support for the view that stress suppresses hippocampal functioning. But we suggest that anotherreason why the hippocampus was considered to be dysfunctional in times of emotional trauma is not only because of the stress-LTP work, but because the characteristics of traumatic memories didnot conform to the well-accepted view that the hippocampus generates memories which contain a higher-order (cognitive map/conjunctive) representation of the learning context. Traumaticmemories have been described as disembodied fragments of the original experience only weakly connected with contextual details .Our temporal dynamics model provides a different perspective from van der Kolk's on the possible involvement of the hippocampus in emotional and traumatic memory processing. The model proposes that in times of emotional trauma, the memory storage reportoire of thehippocampus rapidly shifts from its normative cognitive map mode to a flashbulb memory mode, which processes time-restricted, contextually disembodied, fragments of the details of emotionalexperiences. We hypothesize that the great enhancement and durability of memory for the details of arousing experiences is produced in part by the rapid induction of neuroplasticity in thehippocampus in phase 1 , mediateWe would also speculate that in the days, weeks, and even years after a traumatic event occurs, with repeated rehearsals of the experience, a person's hippocampus may attemptto reconstruct a more contextually rich representation of the original emotional experience  flashbuIt is well known that the amygdala is a critical component of emotional learning and memory. This topic has been reviewed extensively by others . We shoThe finding of an enhancement of LTP in the amygdala under stress conditions is consistent with the well-established role this structure serves in emotional memory. There are, however, accountsin which amygdala LTP has been suppressed in response to emotional learning conditions. For example, Tsvetkov et al.  found thWe should emphasize that the amygdala excitability curve in One other case is particularly instructive towards understanding how the amygdala and hippocampus process different components of emotional (traumatic) memories, with potentialrelevance towards understanding the etiology of post-traumatic stress disorder (PTSD). Krikorian and Layton  reportedWe suggest that the initiation of the burying incident triggered a powerful activation of neuroplasticity simultaneously in his hippocampus and amygdala. The independent induction ofplasticity in each of these two structures would normally function to form a flashbulb memory which would contain two components: (1) the explicit, hippocampus-dependent, information about thespecific details of the experience; (2) more global, conscious, and subconscious, amygdala-dependent components which would generate the fear-provoking features of the memory. However,because the man remained in an anoxic state for so long, it is likely that he developed damage to his hippocampus  receptors, supports the idea that PFC functioning, in general, including its capacityto maximize decision making, multitasking, and divided attention, is impaired by stress (discussed above). Therefore, we have illustrated a rapid and prolonged inhibitory shift in functionalexcitability in the PFC in our model of stress-LTP dynamics . This inThe length of time it would take for the stress-induced inhibition of PFC functioning to recover fully to baseline would depend on the nature and intensity of the stressor, interacting with environmental and genetic factors, as well as with individual variability in coping effectively with the stressor  is involved in complex tasks that require working memory, executive processing, decision making, and divided attention. Therefore, the extent to which the PFC is involved in atask and the degree to which the PFC is suppressed by emotionality are primary determinants of whether a task's arousal-performance curve will be linear or curvilinear. That is, if the successful completion of a task requires PFC functioning, then performance on that task is likely to suffer under conditions of high arousal. One example of an application of this strategy is the finding thathigh states of anxiety have little to no effect on performance in simple, single-digit, mental calculations, which place minimal demands on PFC-based working memory capacity. Ashcraft  has showThe mechanistic basis of the PFC-mediated curvilinear component of the Yerkes-Dodson law is well studied. A number of researchers have commented on the inverted-U-shaped relationship betweendopamine receptor signaling in the prefrontal cortex and working memory performance  activity and performance in an attentional task  end of the curvilinear component of the Yerkes-Dodson law is generated largely by a stress-induced suppression of PFC functioning  would be impaired. Wehave substantiated this model with our finding that spatial memory was enhanced when stress and spatial learning occurred in close temporal proximity, but when there was a delay between stress andlearning, memory consolidation was impaired. We have also suggested that strong emotionality changes the hippocampus from a \u201ccognitive map\u201d mode of memory processing to a \u201cflashbulb memory\u201d mode, which enables the hippocampus to store disembodiedfragments of an experience which lack the depth of processing of context normally attributed to hippocampal memory encoding. Overall, our model of how the hippocampus, amygdala, and PFC aredifferentially affected by strong emotionality provides a framework for further advancements in our understanding of the neurobiology of traumatic memory processing."}
+{"text": "Eyewitness testimony has a unique ability to convince juries. The attorney asks the witness to identify the guilty party. The witness points to the defendant, the crowd gasps, and the judge pounds her gavel, demanding order in the court. The jurors casually scribble something in their notes, and everybody knows that the fate of the accused has been sealed. But how reliable is a witness's memory, especially after rehearsing the testimony ad nauseam with a team of lawyers? When a witness presents testimony, is she really remembering the event, or is she remembering something she remembered? Does the initial memory remain intact, or does it degrade like a copy of a copy?The status of witness testimony in court is just one reason neuroscientists want to understand the biochemical underpinnings of memory formation. Consolidation, the process of new memory formation that takes place in the hippocampus, requires certain proteins. Reconsolidation, the reactivation of these memories in the amygdala, requires a different set of proteins. In the past, neuroscientists hypothesized that reconsolidation might allow old and new memories to link up. A new study by Cristina Alberini and colleagues provides evidence that when rats link new memories to old, the molecular basis of this process actually resembles consolidation.To manipulate lab rat memories, the researchers used constructions called inhibitory avoidance apparatuses. The first apparatus had two tiny rooms: a well-lit safe room and a pitch-black electric-shock room. Rats spent ten seconds in the first room, the researchers flipped on a light, and the rats entered the shock chamber. Alberini and colleagues knew that the rats had formed a new memory when they hesitated to enter the dark room.Rats then entered a second apparatus decorated differently from the first apparatus. The safe room smelled of perfume, the walls displayed striped wallpaper, and the floor was made from smooth plastic. For rats in the second apparatus, the researchers flipped on a light but did not let the rats pass into the shock room. Alberini and colleagues deduced that the rats had compiled their memories of both the first and second apparatuses when they hesitated to enter the second dark room during a final test.The researchers found that rats injected with anisomycin, a drug that inhibits protein synthesis, could not form a new memory of the second apparatus and sometimes forgot the first. This showed that, as predicted, both the formation of new memories and the reconsolidation of old memories require protein synthesis. The researchers demonstrated the distinction between the processes of consolidation and reconsolidation by showing that rats require a certain protein in the hippocampus only for memory consolidation and the same protein in the amygdala only for reconsolidation.Using a combination of proteins that took advantage of the differences between consolidation and reconsolidation, the researchers inhibited either the rats' consolidation mechanism or the reconsolidation mechanism. Then, Alberini and colleagues tested the rats' ability to link their memory of the first apparatus to their exposure to the second. Upon repeated trials, the rats with blocked reconsolidation pathways successfully linked memories of both apparatuses, while the rats with blocked consolidation pathways did not. Therefore, the consolidation pathway, and not the reconsolidation pathway, plays a role in memory linkage. As a cautionary word, the researchers emphasized that their results applied to the fear-based memories created by the electric shock. Future studies may reveal if other types of memory yield the same results."}
+{"text": "L-arabitol dehydrogenase (LAD) and xylitol dehydrogenase (XDH) are involved in the degradation of L-arabinose and D-xylose, which are among the most abundant monosaccharides on earth. Previous data demonstrated that LAD and XDH not only differ in the activity on their biological substrate, but also that only XDH has significant activity on D-sorbitol and may therefore be more closely related to D-sorbitol dehydrogenases (SDH). In this study we aimed to identify residues involved in the difference in substrate specificity.Aspergillus niger on human SDH identified two residues in LadA (M70 and Y318), that may explain the absence of activity on D-sorbitol. While introduction of the mutation M70F in LadA of A. niger resulted in a nearly complete enzyme inactivation, the Y318F resulted in increased activity for L-arabitol and xylitol. Moreover, the affinity for D-sorbitol was increased in this mutant.Phylogenetic analysis demonstrated that LAD, XDH and SDH form 3 distinct groups of the family of dehydrogenases containing an Alcohol dehydrogenase GroES-like domain (pfam08240) and likely have evolved from a common ancestor. Modelling of LadA and XdhA of the saprobic fungus These data demonstrates that Y318 of LadA contributes significantly to the substrate specificity difference between LAD and XDH/SDH. L-arabinose and D-xylose are two of the most abundant monosaccharides in nature. They are components of the plant cell wall polysaccharides xylan, xyloglucan and pectin  and therAspergillus niger, Aspergillus nidulans and Trichoderma reesei (Hypocrea jecorina) and, except for L-arabinose reductase and L-xylulose reductase, all genes from the pathway have been identified and characterised [A. niger L-arabitol dehydrogenase and xylitol dehydrogenase demonstrated that L-arabitol dehydrogenase is active on L-arabitol and xylitol, but not on D-sorbitol, while xylitol dehydrogenase is active on xylitol and D-sorbitol, but not on L-arabitol [The pentose catabolic pathway has been studied mainly in cterised -11. In varabitol . In thisA. niger, A. nidulans and A. oryzae at the comparative Aspergillus server from the Broad Institute http://www.broad.mit.edu/annotation/genome/aspergillus_group/MultiHome.html. However, the highest hit for these fungi was xylitol dehydrogenase (data not shown). In addition, the KEGG website http://www.genome.ad.jp/dbget-bin/www_bget?enzyme+1.1.1.15 was searched for putative D-sorbitol dehydrogenases of A. niger. Two of these corresponded to ladA and xdhA, while a third was An09g03900. In addition, two homologues of A. nidulans ladA, ladB and ladC, have been described [ladB were only found in A. niger and A. oryzae, while orthologues for ladC were only absent in N. crassa and T. reeseii out of the 8 fungi tested in this study.To determine whether fungal genomes contain homologues of D-sorbitol dehydrogenases of higher eukaryotes, the human D-sorbitol dehydrogenase  amino acescribed  althoughA. niger gene found in the KEGG database splits of from the xylitol dehydrogenase branch, although this clade only has a low bootstrap support (50%). The ladB and ladC groups split of from the ladA branch forming clearly defined groups.To determine the phylogenetic relationships between L-arabitol dehydrogenases, xylitol dehydrogenases and D-sorbitol dehydrogenases, an alignment was performed using amino acid sequences of established and putative L-arabitol and xylitol dehydrogenases of eight fungi, D-sorbitol dehydrogenases of ten eukaryotes and the other genes found in the analysis described above. A bootstrapped NJ tree  are located close to the substrate   Table . In conter Table .Comparison of the deduced amino acid sequences of LadA and XdhA to other L-arabitol, xylitol and D-sorbitol dehydrogenases, as well as some putative dehydrogenases with unknown function demonstrated that these enzymes form distinct groups in the family of dehydrogenases containing an Alcohol dehydrogenase GroES-like domain (pfam08240). Previously it was suggested that L-arabitol dehydrogenase might be the fungal orthologue of D-sorbitol dehydrogenase of higher eukaryotes . HoweverA. niger ladA and xdhA appears highly specific for L-arabinose and D-xylose [A. niger (An09g03900) that is in the groups that splits of the XDH branch in the tree. As orthologues for this gene were found in all tested fungi, it appears to encode a conserved function. However, bootstrap support for similarity of these enzymes to SDH is weak, indicating that no reliable prediction of function is possible based on these results.Interestingly, our study suggests that there is no clear fungal orthologue of SDH, based on BLAST and KEGG analysis. As the expression of D-xylose , it is uA. nidulans [The two homologues of LadA described for nidulans  cluster nidulans , as a UVA. niger LadA and XdhA on human D-sorbitol dehydrogenase revealed a large number of amino acids that are conserved in all three types of dehydrogenases, including the residues involved in Zinc binding  [Modelling of the structure from equence) . None ofequence)  this couA. niger resulted in almost complete inactivation of the enzyme on a variety of substrates. The reason for this is not clear at this point, but a possible explanation could be that M70 in this particular enzyme influences the 3-dimensional structure; thus promoting enzyme activity. As the aim of this study was to identify residues important in substrate specificity, we did not further investigate this mutation.The M70F mutation of LadA of max and Kcat increased for L-arabitol and xylitol. Projection of the catalytic site of LAD, SDH and XDH predicts that the tyrosine residue in LAD and the phenylalanine in SDH and XDH are in exactly the same position . D-sorbitol and xylitol differ structurally from L-arabitol with respect to positioning of the OH-group on C2 and C4, while D-sorbitol has an additional OH group at C5 compared to xylitol . Transformation and purification of the recombinant proteins using Ni-agarose (Qiagen) was performed according to the supplier's instructions.Derivatives of the expression vector pQE32 containing wild type and mutated versions of + and 100 mM substrate. Reductase activities were determined using 50 mM sodium phosphate pH 7.6, 0.2 mM NADH and 100 mM substrate. Absorbance changes at 340 nm (\u03b5 = 6.22 mM-1 cm-1) were measured on a Unicam UV-1 spectrophotometer . Sheep liver SDH was obtained from Sigma (S3764).All enzyme assays were performed at 20\u00b0C. Dehydrogenase activities were determined using 100 mM glycine pH 9.6, 0.4 mM NADA. niger LadA and XdhA structures were generated using the SWISS-MODEL program http://swissmodel.expasy.org//SWISS-MODEL.html[Models of ODEL.html-21 with ODEL.html. The modODEL.html.Site directed mutagenesis was performed using the Quik Change protocol . Two complementary oligonucleotides of 30\u201334 nucleotides were designed for each mutation, carrying the mutation in the middle of the oligonucleotide. PCR mixtures contained 50 ng of DNA template, 125 ng of each oligonucleotide, 1 \u03bcl of a 10 mM dNTP stock, 5 \u03bcl of 10\u00d7 pfu buffer, and sterile water to a total volume of 24 \u03bcl. Before the start of the PCR, 1 \u03bcl of pfu DNA polymerase (Stratagene) was added. The reaction parameters were: denaturation of the DNA for 5 min at 95\u00b0C, followed by 16 cycles of 30 s denaturation (95\u00b0C), 1 min annealing (56\u00b0C) and 15 min amplification (68\u00b0C). The product was incubated for 4 h with DpnI at 37\u00b0C. This enzyme degrades methylated (template) DNA but not the DNA amplified during the PCR.LR carried out the modelling studies. CR and BTA carried out the biochemical analysis. RPdV drafted the manuscript. All authors read and approved the final manuscript."}
+{"text": "The decline of coral reefs globally underscores the need for a spatial assessment of their exposure to multiple environmental stressors to estimate vulnerability and evaluate potential counter-measures.This study combined global spatial gradients of coral exposure to radiation stress factors , stress-reinforcing factors (sedimentation and eutrophication), and stress-reducing factors  to produce a global map of coral exposure and identify areas where exposure depends on factors that can be locally managed. A systems analytical approach was used to define interactions between radiation stress variables, stress reinforcing variables and stress reducing variables. Fuzzy logic and spatial ordinations were employed to quantify coral exposure to these stressors. Globally, corals are exposed to radiation and reinforcing stress, albeit with high spatial variability within regions. Based on ordination of exposure grades, regions group into two clusters. The first cluster was composed of severely exposed regions with high radiation and low reducing stress scores  or alternatively high reinforcing stress scores . The second cluster was composed of moderately to highly exposed regions with moderate to high scores in both radiation and reducing factors , Central Pacific, Polynesia and the western Indian Ocean) where the GBR was strongly associated with reinforcing stress.Despite radiation stress being the most dominant stressor, the exposure of coral reefs could be reduced by locally managing chronic human impacts that act to reinforce radiation stress. Future research and management efforts should focus on incorporating the factors that mitigate the effect of coral stressors until long-term carbon reductions are achieved through global negotiations. Corals globally are exposed to diverse and often interacting physico-chemical and biological disturbances Given the bleak view of the status and prognosis for coral reefs globally, timely identification of spatial gradients of their exposure to global and local stressors is needed so that appropriate counter-measures can be formulated and implemented. The management strategies proposed include among others: (i) protecting coral reef locations with biological and environmental conditions that render them less exposed or vulnerable to stress Ecosystem vulnerability, although defined in different ways, is most often conceptualized as a function of the exposure, sensitivity and adaptive capacity of the perturbed organisms or ecosystems In this study, we derive a generic exposure metric and translate it into fuzzy logic mathematical expressions. The modelling of coral exposure, like many reef processes, is often hindered by poor knowledge of the physiology of corals complicated by contradicting theories on coral-environment interactions In benthic aquatic habitats, the light and temperature environment is highly dynamic and is primarily a function of hydrodynamics , cloud cover, and turbidity among other factors xa and xb) based on the distribution of global environmental data for locations where corals are found. We assume that geophysical variables in coral reef areas are distributed normally, where xa and bx are two standard deviations from the mean on the lower and upper tail. For simplicity, we assign a normal cumulative function (represented as logistic curve in fuzzy logic membership function) as the response of the interaction between coral and environment, where coral exposure is a function of the environmental variables considered, and initially increases or decreases exponentially along the environmental gradient respectively above or below the user defined minimum threshold (xa), before levelling off at a user defined maximum threshold (bx) Most methods for estimating thresholds of environmental attributes, such as thermal and sediment levels, above which stress responses such as coral bleaching, diseases and mortality are likely to occur Because coral bleaching and mortality is driven by factors such as temperature and their interactions with other stressors like pollution and sedimentation, it may be possible to prevent some damage by reducing the impact of stressors that are not related to climate change We used environmental data from satellite observations and model outputs to derive variables that represent temperature and UV light (radiation), reinforcing and reducing stress.in situ observations from different coral reef locations globally and at depths ranging from 0\u20139 m, which corresponds to depths of most coral reef habitats 2) of 0.72\u20130.96 in situ measurements are based on bulk temperature at shallow depths.Sea surface temperature derived variables were obtained from the second version of the coral reef temperature anomaly database (CoRTAD) http://www.nodc.noaa.gov/sog/Cortad). Two different cumulative estimates of thermal stress were computed from each of these metrics: TSAs and WSSTAs were summed for each year and averaged over 27 years; and for each year, a maximum duration (in weeks) that WSSTA and TSA were greater than or equal to 1\u00b0C were computed and averaged over 27 years. These two metrics, the mean annual cumulative and mean yearly maximum duration, represent the characteristic magnitude and duration of the anomalies at a given location, which are important predictors of coral stress We downloaded time series of weekly SST anomalies (WSSTAs), defined as the weekly averaged temperature in excess of 1\u00b0C or more above that week's long term average value; and thermal stress anomalies (TSAs), defined as the temperature excess of 1\u00b0C or more above the climatologically (long-term average) warmest week of the year  a, total suspended matter (TSM), and colored dissolved organic matter (CDOM) Oceanic satellite observations in the visible and near-infrared bands allow for the measurement of a variety of ocean color information including phytoplankton chlorophyll-The application of ocean color data in coral reef areas is limited by the complexity of the water's optical properties in shallow coastal environments where they are found. The standard Case I algorithm for deriving chlorophyll concentration fail in turbid coastal waters resulting in over estimation of chlorophyll along most coastal areas http://hermes.acri.fr/GlobColour) was used to process Level 2 data from the three sensors to derive monthly level-3 binned products, including case I and case II chlorophyll concentrations with their respective flags, at a resolution 4.63 km at the equator (http://www.GlobColour.info/products_description.html). Data from all the three sensors were merged to derive case I Chlorophyll, while MERIS Case II algorithm was used to retrieve case II chlorophyll To derive chlorophyll estimates taking into account these problems we carried out a series of analyses with ocean color observations from the Sea-viewing Wide Field-of-view Sensor (SeaWiFS), Moderate Resolution Imaging Spectro-radiometer (MODIS), and Medium Resolution Imaging Spectrometer Instrument (MERIS) sensors . The Glo\u22121) estimates for 10 m above sea level at a 28-km resolution are available from the National Climatic Data Center . NCDC wind data is based on the blended observations from multiple sensors, with reduced spatial and temporal gaps of individual satellite samplings, and reduced sub-sampling aliases and random errors Global sea surface wind speed  and multiplying this by the 10-year mean monthly average.Daily averaged wind speeds (2000\u20132009) and the averaged 10-year mean monthly wind speeds (1995\u20132004) were downloaded. The National Oceanic and Atmospheric Administration (NOAA) coral reef watch defines doldrums as wind conditions with a daily mean of less than 3 m sOver the last decade, the tidal research group of Le Provost and collaborators have produced a series of finite element solution (FES) tidal atlases; FES-2004 is the latest release. Data are computed from the tidal hydrodynamic equations and tide gauges and altimeter data assimilation http://www.legos.obs-mip.fr/en/soa) The digital FES-2004 tidal model and the associated extraction software were downloaded from the Laboratoire d'Etudes en G\u00e9ophysique et Oc\u00e9anographie Spatiales website (2) in a 1 by 1.25 degree grid were retrieved for 1996 to 2001 from the NASA website (http://toms.gsfc.nasa.gov) Daily global maps of UV-erythemal  irradiance at the Earth's surface , representing sedimentation and eutrophication; and (3) stress reducing variables, consisting of SST variability and tidal range. Values of each variable that correspond with the approximately 4000 reef locations were extracted, and examined for normality and log10-transformations applied where necessary (A using a suitably chosen function \u03bc(x) ax and bx are control values and correspond to the lower and upper bound of a stressor values, respectively  radiation variables, consisting of variables derived from temperature , UV-erythermal and wind speed data (doldrums index); (2) stress reinforcing variable  was used to combine the standardized variables within each category. Principal Component Analysis transforms each variable into a linear combination of orthogonal common components (output layers), or latent variables with decreasing variation. The linear transformation assumes the components will explain all of the variance in each variable. Hence, for each output the latent component layer carries different information, which is uncorrelated with other components. This enables a reduction of output maps because the last transformed map(s) may be discarded as they have little or no variation left and may be virtually constant. The component weightings were calculated using coefficients of linear correlation to weigh the contribution of factors in spatial principal component analysis A and B, the fuzzy sum operator produces a layer whose values are equal to or greater than each of the input layers A and B and results in an increased effect i-th map, and i\u200a=\u200aA, B, n maps.The output maps were standardized between zero and one, representing low and high exposure respectively. To combine the stress reducing and radiation variables, SPCA procedure described above was repeated with standardized radiation and reducing variables as the input variables. The output PC's were synthesized using a weighted sum equation (Eq. 3) to yield a layer with estimates of exposure to radiation taking into account the contribution from reducing variables. Fuzzy-integration-based approach was used to integrate the output from this procedure with the reinforcing variables into a single composite layer. http://reefgis.reefbase.org/) and the Wildlife Conservation Society monitoring sites in the western Indian Ocean Coral reef location data was obtained from the Reef Base website  from tidal movement and high temperature variability, while the central Indian Ocean, Central and Eastern Pacific, Polynesia, and South East Asia were relatively exposed to low reducing effect as shown by the high partial exposure scores attributed to low stress reducing conditions . WesternThe Central Pacific, Micronesia and Polynesia oceanic provinces were weakly exposed to reinforcing variables, and the overall exposure was largely due to high exposure to radiation stress  are common in all regions, but differ in their intensity and co-occurrence with radiation and reducing stressors.In the western Indian Ocean, coral locations exposed to high reinforcing stress correspond to those areas with high river runoff and sedimentation The central Indian Ocean lies within a different domain of exposure, where corals are exposed to high radiation stress but have little reinforcing stress, except in Sri Lanka and off India. Despite most of this region having small direct human impacts, synergistic effect of increased temperature and UV is the dominant stressor and has led to current significant coral declines associated with climatic anomalies In the Middle East, there was moderate to high radiation stress, with recent reports indicating exposure to high thermal anomalies In the Caribbean, coastal development\u2014among other disturbances such as diseases and bleaching\u2014has been associated with mortality of corals and the increase in macroalgae While these results are largely expected to correspond to the observed degree or extent to which coral reefs are subject to the perturbations, including the proximity to river discharges, coastal cities and agricultural areas, they may not necessarily correlate with the current reef status and observed changes in the respective regions or specific coral reef locations. Internal elements of biological and ecological adaptive capacity  and sensitivity  that are critical to such predictions are not considered here and may explain mismatches between exposure and vulnerability. Recent model predictions are indicating that adaptations of corals through physiological and genetic changes of corals and zooxanthellae will not match the rate of temperature increase from climate change under the business-as-usual scenarios The global variability in coral exposure to stresses, as evidenced by the distribution of coral locations by region in the exposure space  portraysThe outputs of this study are constrained, among others, by the uncertainty conferred on the results of the membership functions and standardization algorithms. Insufficient or contradictory knowledge on the response of corals to environmental stimuli in the field and the local adaptation and species-specific responses to stress is the main limitation to creating predictive models. In addition, the use of proxies as a substitute for unavailable environment data, may limit the validity of the assumptions because of potential weak causation associated with correlation-based studies. For example, sedimentation and eutrophication proxy is used as a reinforcing variable and defined using a monotonically increasing sigmoid function, as suggested by some field studies Our model assumes a negative linear relationship between thermal stress and SST variability whereas the relationship may be more complex While the low-moderate resolution remote sensing data used in this study demonstrates sufficient variability for explaining large-scale biological processes Despite the limitations described above, these results can be applied to specific reefs if they are downscaled to incorporate indicators of resilience at reef scale There is high spatial variability of the relative exposures of corals to radiation and reinforcing stressors. Despite radiation stress being dominant, most reef locations identified as severely exposed due to radiation and reinforcing stress are expected to have a lower severity grade if the reinforcing effect from sedimentation and eutrophication were managed. Future studies should focus on incorporating additional coral threats such as acidification, the removal of grazers, and multiple interacting stresses. Enhancement of the knowledge base of the physiological response of corals to environmental stimulus can help improve future models.Appendix S1A summary of conceptual deductions of reef coral responses to environmental variables (adopted from ).(DOC)Click here for additional data file.Appendix S2A conceptual framework adopted for the analysis of ocean color data.(TIF)Click here for additional data file.Appendix S3Normal cumulative density functions fitted on respective environmental parameters (log transformed except for SST and UV).(TIF)Click here for additional data file.Appendix S4A table of coral exposure indices i.e. radiation, reducing, reinforcing, each set of coordinates represents coral reef location within respective ocean provinces.(DOC)Click here for additional data file."}
+{"text": "In phenylephrine (1\u2009\u03bcM) precontracted rings, VPR (0.01\u2013300\u2009\u03bcg/mL) induced a concentration-dependent relaxation (maximum response (MR) = 75.4 \u00b1 4.0%, EC50 = 5.97 (3.8\u20139.3) \u03bcg/mL, n = 6]); this effect was significantly modified after removal of the endothelium (EC50 = 39.6 (27.2\u201357.6) \u03bcg/mL, P < 0.05). However, VPF-induced vasorelaxation was less effective compared to VPR. When rings were preincubated with L-NAME (100\u2009\u03bcM) or indomethacin (10\u2009\u03bcM), the endothelium-dependent relaxation induced by VPR was significantly attenuated . In rings denuded endothelium, precontracted with KCl (80\u2009mM), or in preparations pretreated with KCl (20\u2009mM) or tetraethylammonium (1 or 3\u2009mM), the vasorelaxant activity of VPR was significantly attenuated . In contrast, neither glibenclamide (10\u2009\u03bcM), barium chloride (30\u2009\u03bcM), nor 4-aminopyridine (1\u2009mM) affected VPR-induced relaxation. Taken together, these results demonstrate that hypotension induced by VPR seems to involve, at least in part, a vascular component. Furthermore, endothelium-independent relaxation induced by VPR involves K+ channels activation, most likely due to BKCa channels, in the rat superior mesenteric artery.Assays  Valeriana L. used in the folk medicine for the treatment of psychosomatic disorders, such as anxiety and insomnia [Valeriana prionophylla Standl. is a species distributed throughout Latin American, mainly Costa Rica, Guatemala, and Mexico, and is known as \u201cValeriana del monte.\u201d Studies performed in animals have demonstrated that rhizomes of this species affect central nervous system activity, demonstrating sedative, hypnotic, anxiolytic, and antidepressive effects [The Valerianaceae family is well known for an abundance of different species of the genus insomnia , 2. Vale effects , 4. HoweV. prionophylla identified the presence of valepotriates [2+ channel [Furthermore, phytochemical analysis of rhizomes of otriates , and newotriates  demonstrotriates . Lignans channel .Many cardiovascular disorders, such as hypertension, angina, and heart failure, are often treated with vasodilator drugs that act directly on the vascular smooth muscle, causing vasodilation, indirectly by stimulating the release of endogenous vasorelaxant factors or by inhibiting the release of vasoconstrictive factors .Valeriana prionophylla Standl. in the cardiovascular system and the mechanisms underlying the vascular response induced by this species in isolated rat mesenteric artery.Thus, the aim of this study was to evaluate the peripheral actions of 2, 2.0; MgCl2, 1.05; NaH2PO4, 0.42; NaHCO3, 10.0, and glucose, 5.6. K+-depolarizing solutions (KCl 20 and 80\u2009mM) were prepared by replacing 20 or 80\u2009mM KCl in Tyrode's solution with equimolar NaCl, respectively.The drugs used in this study were Cremophor EL, dimethyl sulphoxide (DMSO), L-phenylephrine chloride (Phe), acetylcholine chloride (Ach), glibenclamide, tetraethylammonium, 4-aminopyridine, and barium chloride (SIGMA). All compounds were dissolved in distilled water, except glibenclamide that was dissolved in DMSO. The composition of Tyrode's solution used was as follows (mM): NaCl, 158.3; KCl, 4.0; CaClValeriana prionophylla Standl., Valerianaceae, were collected from cultivations in Tierra Blanca, Concepci\u00f3n Tutuapa, San Marcos , Guatemala, a vegetative zone that resides in a very humid and low mountainous forest. Three-year-old rhizomes and roots were dug up, washed, and shade-dried. Botanical samples were determined by Mario Veliz at Herbarium BIGU, School of Biology, USAC, and a voucher sample deposited (no. 49183). in vitro experiments, extracts of the roots and leaves from the Valeriana prionophylla Standl. species  were dissolved in a mixture of distilled water/Cremophor and diluted to the desired concentrations with distilled water just before use; the final concentration of Cremophor in the bath never exceeded 0.01%.Dry material was ground, wetted with 50% ethanol, and placed in a stainless steel percolator. 50% ethanol was added to obtain a tincture, which was concentrated in a rotavapor. Fresh ethanol was added for five consecutive days, and the extract was concentrated. The final drying was performed in a vacuum dryer with silica gel, as described by Holzmann et al. . The aveMale Wistar rats (250\u2013300\u2009g) were used for all experiments. Animals were housed under controlled temperature (21 \u00b1 1\u00b0C), exposed to a 12\u2009h light-dark cycle with free access to food  and tap water. The study was carried out in accordance with the Guide for the Care and Use of Laboratory Animals as adopted by the US National Institutes of Health.2 and 5% CO2, maintained at 37\u00b0C and at pH 7.4. Isometric tension was recorded under a resting tension of 0.75\u2009g. The solution was changed every 15\u2009min during a stabilization period of 1\u2009hr to prevent the accumulation of metabolites [\u03bcM) to induce more than 90% relaxation of pre-contracted vessels with Phe (10\u2009\u03bcM) and the absence, less than 10% of relaxation induced by Ach.Rats were euthanized, and superior mesenteric artery was removed, cleaned from connective tissue and fat as described by Silva and colleagues . Wheneveabolites . The iso\u03bcM), increasing cumulative concentrations of VPF and VPR  were separately and continually added to the bath until a maximum response for the added extract was observed, as indicated by a plateau response (approximately 4\u20136\u2009min). In this experiment, sustained Phe-induced contractions were obtained in isolated rat superior mesenteric artery rings with or without endothelium. In the tonic phase of the second contraction induced by Phe (1\u2009\u22124\u2009M) or indomethacin (10\u22125\u2009M)  or cyclooxygenase inhibitors, resp.) before the second application of Phe (1\u2009\u03bcM), and the vasorelaxation induced by VPR (300\u2009\u03bcg/mL) was investigated before and after the addition of the inhibitors.To investigate the involvement of NO and prostanoids, endothelium-intact rings were incubated for 30\u2009min with L-NAME (10\u03bcg/mL) were added cumulatively to the organ bath, and relaxations were measured, as previously described. After the stabilization period, rings without endothelium were precontracted with high potassium concentration solution (KCl 80\u2009mM), and, in the tonic phase, different concentrations of VPR  to attenuate K+ efflux [+ channel blockers before the second application of Phe (1\u2009\u03bcM), and the inhibition was calculated by comparing the response elicited by VPR, before and after the addition of the inhibitors. Preparations were exposed to tetraethylammonium , a nonselective K+ channel blocker; TEA (1\u2009mM), a large-conductance calcium-activated K+ channel (BKCa) selective blocker in this concentration; 4-aminopyridine (4-AP) (1\u2009mM), a voltage-dependent K+ (Kv) channel blocker; glibenclamide (Glib) (10\u2009\u03bcM), an ATP-sensitive K+ (KATP) channel blocker; and barium chloride (BaCl2) (30\u2009\u03bcM), an inward rectifier K+ (Kir) channel blocker. To investigate the involvement of K+ efflux . Additio2 (10\u22126\u201310\u22122\u2009M) were added in medium containing Ca2+-free depolarizing solution  in absence (control) or in presence of VPR (300\u2009\u03bcg/mL). To investigate the hypothesis that VPR act through the blockade of extracellular calcium influx in endothelium-denuded rings, cumulative concentrations of CaCl50) filled with heparinized saline solution (1000\u2009U/mL) was inserted into the left carotid artery under ketamine/xylazine anesthesia and exteriorized at the nape of the animal's neck to permit blood pressure recording. An additional catheter was placed in the right femoral vein to allow intravenous drug administration. After 24 hours, arterial pressure was continuously monitored through the carotid catheter connected to a blood pressure transducer (World Precision Instruments) whose signal was amplified and digitally recorded by an analog-to-digital interface  and recorded (1\u2009kHz) on a microcomputer for later analysis. Mean arterial pressure (MAP) was calculated from systolic and diastolic pressure data, while heart rate (HR) was determined by the pulsation of arterial pressure using the AcqKnowledge software program, version 3.5.7, developed by Biopac Systems, Inc., California, USA.The day before the experimental session, a catheter . EC50  values were calculated from the fitted sigmoidal curves. Statistical analyses were performed by comparing Emax\u2061 and EC50 values between groups from independent observations. Unpaired Student's t-test or one-way ANOVAs were used to compare 2, 3, or more groups, respectively, with the addition of Bonferroni's multiple comparisons post-est. Two-sided P < 0.05 was considered statistically significant.Data are presented as the mean \u00b1 SEM, and \u03bcg/mL) decreased in a concentration-dependent manner following Phe-induced contraction (1\u2009\u03bcM) \u2009\u03bcg/mL) \u2009\u03bcg/mL; P < 0.05) (\u03bcg/mL) induced a vasorelaxant effect in the presence and absence of vascular endothelium (maximum response (MR) = 29.39 \u00b1 9.4%, MR = 27.05 \u00b1 6.2%, resp.; n = 4) .In isolated rat superior mesenteric artery rings, VPR (0.01\u2013300\u2009)\u2009\u03bcg/mL) . In the  < 0.05) , Table 1; n = 4) ; however\u03bcM) or indomethacin (10\u2009\u03bcM) before the second contraction with Phe (1\u2009\u03bcM). \u03bcg/mL) was significantly reduced in the presence of these inhibitors.To investigate the involvement of NO and prostanoids, endothelium-intact rings were preincubated for 30\u2009min with L-NAME , 4-AP (1\u2009mM), or BaCl2 (30\u2009\u03bcM), VPR-mediated relaxation in rings lacking the vascular endothelium and precontracted with Phe was not significantly reduced. In the presence of TEA (1\u2009mM), the vasorelaxant response was significantly attenuated  was not able to inhibit CaCl2-induced contractions, demonstrating that VPR extract probably does not inhibit extracellular calcium influx.To investigate the hypothesis of the residual vasorelaxant effect induced by VPR being the same as in the presence of the Kn = 5)   .Valeriana prionophylla Standl. in the cardiovascular system have yet to be fully elucidated. This study aimed to increase our understanding of this natural medicine and highlight its potential pharmacological contribution. Specifically, this work demonstrated cardiovascular pharmacological effects of VPR in rats using in vitro and in vivo protocols.The biological effects of in vitro experiments using rat superior mesenteric artery rings. VPR significantly reduce Phe-induced contractions, a selective \u03b11-adrenergic receptor agonist, in a concentration-dependent manner [Initially, we evaluated the peripheral vascular effects of VPR and VPF by performing t manner . VPF alsIt is well known that the endothelium is an important regulator of the vascular tone, releasing endothelium-derived relaxing factors, including NO, COX-derived products, and endothelium-derived hyperpolarization factors (EDHFs) , 14. To This suggests that the presence of a functional endothelium is important but not essential to the relaxation response mediated by VPR, and that an endothelium-independent pathway is also involved in this effect, which led to the subsequent experiments exploring VPR-mediated vasorelaxation in the absence of the endothelium.Vascular tone, the contractile activity of vascular smooth muscle cells (VSMCs), is the major determinant of blood flow resistance through the circulation. Therefore, vascular tone plays an important role in the regulation of blood pressure and the blood distribution . Due to + concentration is mediated by an increase in membrane depolarization and, consequently, an increase in Ca2+ influx through voltage-dependent calcium channel (Cav) [+ concentration may also be mediated by Ca2+ release from the sarcoplasmic reticulum [2+ entry through store-operated channels (SOC) and/or transient receptor potential (TRP) channels [The literature reports that VSMC contraction induced by high extracellular Kel (Cav) . Furthereticulum , resultichannels .+ solution (KCl 80\u2009mM) in order to observe VPR responses before nonspecific generated contractions and averting activation of membrane receptors. In the presence of this depolarizing solution, the concentration-response curve induced by VPR was significantly shifted to the right, when compared to the response of VPR in the presence of Phe, changing both the efficacy and potency of VPR.Endothelium removed mesenteric rings were precontracted with a depolarizing K+ channels) in VSMCs. The opening of these channels in VSMCs results in an increase in K+ permeability, leading to K+ efflux. The exit of K+ from the VSMC induces membrane hyperpolarization and consequently the closing of voltage-operated Ca2+ channels, leading to vasorelaxation [+ channels are effector proteins that contribute to membrane potential regulation in electrically excitable cells, such as VSMCs. Therefore, drugs that activate these channels could be beneficial in hypertension treatment [Based on these preliminary results, we speculate that this VPR-mediated vasorelaxant effect requires activation of potassium channels , a nonselective K+ channel blocker [+ channels in mesenteric artery rings.To confirm the involvement of K blocker . In the + channels are expressed in membrane of VSMCs, and each of these channels plays an important role in the control and maintenance of the contractile tone of the arterial muscle [+ channels subtypes identified includes voltage-dependent K+ (Kv) channels, whose activity is increased upon membrane depolarization and are important regulators of vascular smooth muscle membrane potential in response to a depolarizing stimulus [2+-activated K+ (BKCa) channels, which respond to changes in the concentration of intracellular Ca2+, regulating membrane potential, and have an important role in control of myogenic tone in smaller resistance arteries [+ (KATP) channels, which respond actively to changes in cellular metabolism and are targets of a variety of relaxing stimuli [+ (KIR) channels, regulating membrane potential of various types of resistance vessels of small diameter [Several types of Kl muscle . In VSMCstimulus ; large-carteries ; ATP-sen stimuli ; and inwdiameter .+ channels subtypes, experimental preparations were separately preincubated with different selective blockers of these channels. In the presence of a KATP channels blocker, Glib (10\u2009\u03bcM), or a Kv channels blocker, 4-AP (1\u2009mM), the maximum effect of VPR was not changed. The same response occurred in rings preincubated with BaCl2 (30\u2009\u03bcM), Kir channels blocker, suggesting that KATP, Kv, and Kir channels do not participate in VPR-mediated vasorelaxation.Thus, to investigate the possible participation of these different KCa channels are divided into a subfamily of small (SKCa), intermediate (IKCa), and large (BKCa) conductance. The BKCa channels are expressed in vascular tissues with a high density; they are a major component that mediates the degree of depolarization and contraction in vascular smooth muscle; they are preferentially expressed in vascular smooth muscle, while the SKCa and IKCa are expressed in a variety of cell types such as secretory epithelial cells, fibroblasts, T lymphocytes, melanoma cells, granulocytes, macrophages, erythrocytes, cultured cell lines, and endothelial cells [Ca channels act by inhibiting the increase of intracellular Ca2+. Furthermore, several recent findings support the importance of BKCa channels in the regulation of vascular smooth muscle tone and regulation of blood pressure [The Kal cells , 30. BKCpressure .Ca channels at concentrations lower than 1\u2009mM [Ca channels mediate VPR-induced vasorelaxation, demonstrating that in addition to the neuronal actions, VPR exhibits important peripheral vascular effects as well.The data shows that VPR-mediated vasorelaxation at the highest concentration was significantly attenuated in rings preincubated with TEA (1\u2009mM), which preferentially blocks BKhan 1\u2009mM . These rin vivo experiments were performed to evaluate VPR effects on cardiovascular parameters in nonanesthetized normotensive rats, in order to avoid the influences of anesthesia and postsurgical stress. In these animals, VPR induced a hypotensive response associated with tachycardia. The hypotensive effect caused by VPR may be due to decreased peripheral vascular resistance, and the tachycardia may be a reflection of the decrease in blood pressure.Therefore, + channel activation, most likely through BKCa channels, in smooth muscle inner from rat superior mesenteric artery. Furthermore, endothelium-derived relaxing factors (NO and prostanoids) are involved in endothelium relaxation dependent on VPR.Taken together, these results demonstrate that VPR induce vasodilatation probably involving K"}
+{"text": "Moreover, 3/4 intrinsically disordered proteins could be correctly distinguished from proteins with fixed three-dimensional structure belonging to all four SCOP structural classes by combining 3\u20134 different cleavages. Additionally, in some cases the protein cellular localization (cytosolic or membrane-associated) and its host organism (Firmicute or Proteobacteria) could be predicted with around 80% accuracy. In contrast to cytosolic proteins, for membrane-associated proteins exhibiting specific structural conformations, their monotopic or transmembrane localization and functional group  could be also predicted with high accuracy and particular robustness against missing cleavages.Structural, localization and functional properties of unknown proteins are often being predicted from their primary polypeptide chains using sequence alignment with already characterized proteins and consequent molecular modeling. Here we suggest an approach to predict various structural and structure-associated properties of proteins directly from the mass distributions of their proteolytic cleavage fragments. For amino-acid-specific cleavages, the distributions of fragment masses are determined by the distributions of inter-amino-acid intervals in the protein, that in turn apparently reflect its structural and structure-related features. Large-scale computer simulations revealed that for transmembrane proteins, either  In the last decades, due to the intensive development of omics technologies, there is an increasing demand in predicting the structural and structure-related properties of biological polymers. While several experimental methods to uncover the structure of biological molecules such as X-ray crystallography, nuclear magnetic resonance and cryo-electron microscopy have been established, they still appear expensive and time-consuming and thus can cover a relatively small part of the rising number of laboratory research activities. Therefore the structural characterization of biological polymers like proteins and RNA is largely based on reconstructions from the arrangement of monomers in their primary sequences.q-exponential law in both pro- and eukaryotes at relatively small scales, while at large scales a second additive q-exponential term with the same q can be observed specifically in eukaryotesAn important step in the statistical analysis of biomolecular structures was the discovery of pronounced long-range correlations (LRC) in the DNA primary sequences in the early 90s123478910\u03b1-helixes. Proline (P) and glycine (G) have unusual conformational abilities and disrupt the regularity of the \u03b1-helical backbone conformations. The large aromatic residues such as tryptophan (W), tyrosine (Y) and phenylalanine (F) as well as the branched-chain amino acids including isoleucine (I), valine (V), and threonine (T) prefer to adopt \u03b2-strand (or \u03b2-sheet) conformations. Most proteins contain both \u03b1-helixes and \u03b2-sheets, and the way of their alternation along the polypeptide chain and bending determines the tertiary and the quaternary structures of the functional protein. Based on the relative fractions of \u03b1-helixes and \u03b2-sheets as well as the ways of their spatial orientation a common structural classification of proteins (SCOP) notation has been introduced in\u03b1, all-\u03b2, \u03b1/\u03b2 and \u03b1\u2009+\u2009\u03b2 classes  time-of-flight (TOF) spectrometry, a sophisticated technique allowing to determine the oligopeptide molecular masses with high accuracy and this way providing explicit information on their content, but not on the arrangement of amino acid residues in the polypeptide chain. The identification is based on the comparison of the experimental mass spectrum with the theoretical mass spectra obtained by a software simulation of the amino acid specific cleavage of known proteins from a database  random allocation of amino acid residues along the polypeptide chain. In this case, the distribution of intervals between the consecutive positions of any given amino acid residue is theoretically expected to decay by a simple exponential, leading to the same asymptotic behaviour of the post-cleavage mass distribution. Therefore we focus our prediction strategy on the analysis of the deviations of the empirical exceedance probability distributions from the theoretical null hypothesis  distribution, this way emphasizing the (presumably) structure-associated non-random arrangement of the amino acids in the primary polypeptide chain. To quantify these deviations, we focus on the maximum discrepancy between the empirical and the theoretical (null hypothesis) exponential distributions, a quantity that is used in the widely adopted Kolmogorov statistical test. Based on this quantity, we next suggest a simple prediction model design. To further improve the prediction accuracy, we subsequently combine the  statistics for different cleavage rules into a single logistic regression model. The overall performance of the prediction model is then evaluated by receiver operator characteristic (ROC) analysis\u03b1-helixes or \u03b2-sheets in their secondary structure as well as (ii) the prediction of membrane-associated proteins from either Firmicutes or Proteobacteria according to their host bacteria phylum. We show explicitly that the secondary structural classification of transmembrane proteins could be correctly performed in approximately 90% cases by using a single cleavage rule, while proteins with specific localization in bacterial cell membranes could be correctly predicted as belonging to either Firmicutes or Proteobacteria in more than 80% cases by combining three to four different cleavages.For a detailed stepwise demonstration of the entire analysis including the decision-making procedure, we focus on two prominent examples where binary classifications are suitable. In particular, we consider in detail (i) the prediction of transmembrane proteins carrying either In the following, to test the potential applicability of our approach to predict a number of structural, localization and functional properties of a given protein, we perform a large-scale validation analysis using various protein groups obtained from the general proteomic databases UniProtKB/Swiss-ProtB.subtilis  defined as the probability that the interval exceeds a given value l as a function of l .In the last decades, many investigations confirmed that a complex secondary structure of biological polymers is reflected in the distribution pattern of monomers in their primary sequences  for the intervals between amino acids in 5904 transmembrane proteins from pro- and eukaryotes with different secondary structures forming either \u03b1-helixes or \u03b2-sheets (obtained fromR(l) for the considered protein group is shown.\u03b1-helixes that cannot be observed in \u03b2-sheets. This finding further supports the relationship between the interval distribution and the structural complexity of biomolecules that we have recently discovered in DNA\u03b1-helical and \u03b2-barrel transmembrane proteins are determined by arrangement of amino acids in their primary sequences.The figure shows that with an exception of a single amino acid residue C (cytosine), for other 19 amino acids heavy-tailed interval distributions  appear a specific feature of Nowadays, identification of unknown proteins is commonly based on their amino acid-specific proteolytic cleavage followed by the comparison of the experimental molecular mass spectrum of the obtained cleavage fragments against the simulated mass spectra of the same cleavage of all proteins in the given database. Since the oligopeptide sizes are directly determined by the interval distributions between the amino acids that specify cleavage sites see , and the\u03b1-helixes or \u03b2-sheets in their secondary structure exemplified for 100 randomly selected proteins from each group and for 16 different cleavage rules that can be implemented using commercially available enzymes/reagents , leucine (L) and methionine (M) involved in the formation of \u03b1-helixes as well as phenylalanine (F), isoleucine (I) and valine (V) involved in the formation of \u03b2-sheets as cleavage sites appear considerably broader in proteins carrying \u03b1-helixes in their secondary structure , isoleucine (I), valine (V), tryptophan (W) and tyrosine (Y) involved in the formation of \u03b2-sheets as cleavage sites , tryptophan (W) and tyrosine (Y) involved in the formation of \u03b2-sheets as cleavage sites  random arrangement of the amino acid residues in the primary polypeptide chain as a theoretical null hypothesis. In the Kolmogorov statistical test one considers the maximum difference between the observational and the theoretical (null hypothesis) cumulative probability distributions \u03b1-helixes and \u03b2-sheets in their secondary structure exhibiting the smallest overlap for the Thermolysin (AFILMV) and Proteinase K (FLWYAEQ) cleavages , Pepsin with LIV) see . The ove\u03b1-helical proteins than for the \u03b2-sheet proteins, like it happens for example for cleavages by GluC(phosphate) (DE), GluC(phosphate)+LysC (DEK) and AspN/LysC (DK)  see . To empl\u03b1-helical proteins than for the \u03b2-sheet proteins, are included in the model with a positive sign. In contrast, those cleavage rules where \u03b1-helical proteins than for the \u03b2-sheet proteins, are included in the model with a negative sign. For deeper details on the design of the logistic regression model, we refer to the Methods section of this paper. Next, the resulting linear combination of To test whether the prediction accuracy could be further improved by combining the  complementary cleavage rules, we next design a binary logistic regression model. The model provides an optimized linear combination of Firmicutes  and Proteobacteria .Since the secondary and particularly the tertiary structure of proteins are often associated with their localization and function, we next performed a similar analysis of bacterial proteins with different localization and functional role in the cell. We have compared different functional groups of bacterial proteins of pathogenic Firmicutes, that have a single cell membrane and a thick cell wall , which are located in cytosol and obey similar functions in both bacterial groups . Again, Firmicutes and Proteobacteria as a prominent example of a structure-driven protein property, we check whether they can be classified using the mass spectra of proteolytic cleavage fragments following a similar algorithm as for the secondary structure.Next using the structural differences of the membrane-associated adhesion and invasion factors of Firmicutes and Proteobacteria exemplified for the same 16 different cleavage rules as used previously for the prediction of protein secondary structure. The figure shows that there are moderate discrepancies between the oligopeptide mass distributions, while they are less pronounced compared to the proteins with different secondary structure.Firmicutes and Proteobacteria. Like in the previous example +LysC shows the best accuracy of 71% that can be further enhanced to nearly 80% by adding three other cleavages see . FindingOnce more considerably lower performance has been observed in tests for non-membrane proteins. In particular, for distinguishing between proteins localized either in the cytosol or in the cell nucleus, best single-cleavage accuracy of 70% is obtained for Proteinase K, and adding further cleavages barely enhances the predictability see .Firmicutes and Proteobacteria  and the cytosol located glutamine synthetase (GS), are being consecutively tested against several binary classifiers. Each example contains multiple tabs, where the first tab summarizes the classifiers and illustrates the binary classification procedures based on logistic regression models, while the other tabs illustrate the calculation of m. In the test examples, these data has been obtained directly from the Expasy web service4950M to obtain the normalized mass spectrum. In columns D and E, the observational and the theoretical null hypothesis  exceedance probability distributions are being calculated, respectively. For the graphical representation of the distributions, one can plot columns D and E as a function of column C, respectively. Finally, column F is simply the difference between columns D and E. By definition, the maximum difference is the decision statistics used in the Kolmogorov statistical test, that we denote here as To emphasize the simplicity of our analysis, we implemented two simple test examples as spreadsheets . In the fifth test, we find that its host organism likely belongs to Firmicutes. Finally we look for the most probable functional role of this protein in the living cell. Since most Firmicutes do not exhibit photosynthesis, some functional groups such as photosynthetic proteins and rhodopsines are not being considered. Furthermore, since our predictions indicate that it is a transmembrane protein, we also do not consider the ATP-binding functional group that contains only monotopic proteins. Thus among large functional groups only transporters and G-protein receptors remain in the analysis that allows us again to reduce to a binary criteria. Finally, we have predicted that the AmtB protein is likely a transporter protein.In the following, a similar procedure is repeated for a number of binary classification criteria. Since in the first test the AmtB protein was (correctly) predicted as a membrane-associated protein, in the next step we test whether it is a monotopic or a transmembrane protein. After we have confirmed it is a transmembrane protein, in tests 3 and 4 we try to predict its organization in the membrane (single- or multi-pass) as well as its secondary structure  equal probability assumptions for all other parameters except the mass distribution discrepancy, an end user ready prediction tool should incorporate many other  issues such as different fractions of amino acids in primary polypeptide chains of different proteins, existing combinations of protein structural, localization and functional properties and so on. Presented test model design takes neither of those factors into account. For the same reason, we did not provide similar test examples for multiple classification criteria. The efficacy of multiple classification criteria design depends drastically on the appropriate choice of metrics, background probabilities as well as other factors mentioned above, that is beyond the scope of this paper. Finally, by eliminating other factors or considering most trivial equal probability hypothesis we could quantify explicitly the amount of information about a given protein that can be extracted using exclusively the suggested approach based on the analysis of the distributions of polypeptide cleavage fragment masses.To summarize, we have suggested a statistical approach to predict several structure-associated properties of arbitrary proteins directly from the mass distributions of their proteolytic cleavage fragments without reconstruction of primary polypeptide chains. As we show below, in some cases this leads also to the successful prediction of cellular localization and functional group of the studied proteins. The suggested approach is especially efficient in those cases when the localization and function of studied proteins are largely associated with their structural conformations, which in turn are governed by the arrangement of amino acid residues in their primary sequence. In turn, the arrangement of amino acid residues is explicitly reflected in the functional forms of the mass distributions of the polypeptide chain fragments after its amino acid-specific proteolytic cleavage.Our approach has been originally inspired by the recent studies of interval statistics in various complex systems including biological polymer structures125253In contrast to the existing methods to predict structure and function of the analyzed protein from its primary amino acid sequence that are largely based on similarity principles and thus require highly homologous proteins to be reviewed, our approach is based on the direct analysis of the mass distribution of polypeptide cleavage fragments that contains the distinct reflection of the protein structural conformation complexity. Therefore we think that the major advantage of our approach is that it neither requires nor reconstructs the protein sequence and thus can be used to characterize unknown proteins directly from their post-cleavage mass spectrometry data. Besides that, the overall statistical analysis procedure appears quite simple and easy to implement.An obvious limitation of our approach is that it bases solely on the analysis of the arrangement of amino acid residues in the primary polypeptide chain by its comparison with the random (null hypothesis) assumption. Thus it requires that at least one of the analyzed protein groups exhibits some characteristic structural features clearly reflected in the arrangement of monomers in their primary polypeptide chain. For that reason, our approach distinguishes well between proteins with different structural patterns like transmembrane proteins, while exhibits considerably lower accuracy for distinguishing proteins without pronounced structural discrepancy like globular proteins with different functions.\u03b1-helical or \u03b2-barrel) can be correctly predicted in approximately 90% cases by using a single cleavage by Thermolysin, while three best cleavage rules are required to correctly predict a membrane-associated protein as belonging to either Firmicutes or Proteobacteria in about 80% cases. Results of further extensive statistical validation of the suggested approach on several hundreds of thousands of reviewed proteins indicate that the cellular localization of proteins  can be predicted with 70\u201380% accuracy using the mass-spectrometry data after a single cleavage by GluC(phosphate)+LysC. While the correct attribution of protein to one of four SCOP structural classes is low (barely exceeding 40% accuracy), we could distinguish about 3 out of 4 intrinsically disordered proteins from SCOP-classified proteins. Moreover, using binary classification matrices, we could identify the putative protein function with about 60\u201380% accuracy.Our first results indicate that for the transmembrane proteins the secondary structural class  and thus protein characteristics cannot be predicted by sequence alignment methods. Therefore, distributions of inter-amino-acid intervals or polypeptide cleavage fragment masses could be used as L is the average interval. In linearly long-range correlated data, one expects the asymptotic PDF of the intervals to follow a stretched exponential H is the Hurst exponent characterizing the LRC. In the presence of nonlinear correlations, the PDF gets even broader and decays asymptotically by a power-law \u03b4 decreases when the LRC gets more pronounced5253Interval distributions between the positions of certain items in a sequence are important quantities that are widely used to characterize both structural and dynamical features of complex systems in physics, biology, geosciences, climate, finance and many other applications. In time series analysis interval distributions between the consecutive occurrences of certain events  explicitly reflect the persistence properties of the analyzed system. In a fully random (uncorrelated) data series the expected probability density function (PDF) of the intervals between such events follows a simple exponential To understand the reflection of the protein structure and amino acid arrangement in the interval distributions, let us follow the polypeptide chain in one direction (e.g. from N-term to C-term) and mark all positions where a particular amino acid residue (e.g. \u2018R\u2019) characterized by its specific mass value is observed see . First, L is the average interval between particular amino acid residues in a given polypeptide chain.Commonly empirical PDF estimates are obtained from the histograms of observational data, the method that is hardly applicable to short protein sequences where often only a few occurrences of a given amino acid residue could be observed. Therefore instead of using B.pumilus after its cleavage by trypsin (cleavages at \u2018K\u2019 and \u2018R\u2019). Typical experimental mass spectra contains a lot of background \u201cchemical noise\u201dM is the average oligopeptide mass for the particular protein and a given cleavage rule. To quantify the deviation of the oligopeptide mass distributions from the theoretical (null hypothesis) exponential distribution, we employ the standard Kolmogorov statistics The simulation of the proteolytic cleavage of the proteins was performed for 16 different cleavage rules corresponding to the commercially available enzymes/reagentsNext for each cleavage rule we suggest a decision threshold At ith cleavage rule. In the fourth step, the performance of the resulting model is tested by calculating p for each protein and comparing it against a varying decision threshold p is smaller or larger than z ."}
+{"text": "Using NaYF4:Yb,Er (18\u00a0nm) as an example, we evaluate the properties of as-prepared water-soluble nanoparticles (NPs) by using thermogravimetric analyses (TGA), Fourier transform infrared spectroscopy (FTIR), zeta potential (\u03b6) testing, and 1H nuclear magnetic resonance (1HNMR). The measured \u03b6 value shows that the newly prepared hydrophilic NaYF4:Yb,Er NPs are the positively charged particles. Acting as reactive electrophilic moiety, the freshly prepared hydrophilic NaYF4:Yb,Er NPs have carried out the coupling with amino acids and fluorescence labeling and imaging of HeLa cells directly. Experiments indicate that the method of hydrion rivalry aided by ultrasonic provides a simple and novel opportunity to transform hydrophobic NPs into hydrophilic NPs with good reactivity, which can be imaging some specific biological targets directly.A novel method of fabricating water-soluble bio-probes with ultra-small size such as NaYFThe online version of this article (doi:10.1186/s11671-016-1651-y) contains supplementary material, which is available to authorized users. Compared with conventional fluorescent materials, such as rhodamine, fluorescein, isothiocyanates, cyanine dyes , glycine [NH2CH2COOH], glutamic acid [HOOCCHNH2(CH2)2COOH], and l-lysine [H2NCH2CH2CH2CH2CH(NH2)COOH] are employed to couple with the aging-UCNPs (18\u00a0nm) and new-UCNPs (18\u00a0nm), respectively. The FTIR spectra of the complexes of amine acid coupling with NaYF4:Yb,Er NPs are shown in Fig.\u00a0\u22121 come from the asymmetric and symmetric stretching vibrations of the C\u2212H bond (\u2013CH2), respectively [\u22121 correspond to the typical amide carbonyl absorption band. The absorption bands located at 1615 and 1672\u00a0cm\u22121 are attributed to the N\u2212H bending mode of amino group (\u2212NH2) [\u22121 is attributed to the stretching vibration of amine groups. The peaks of 1424, 1506, and 1509\u00a0cm\u22121 belong to the stretching vibrations of the C\u2212N bond. The absorption bands of 1211\u00a0cm\u22121 and  belong to the C\u2013N and C\u2013O bond, respectively. The peaks at 807\u00a0cm\u22121 are attributed to the C\u2013O\u2013Y vibration [4:Yb,Er NPs have coupled with glutamic acid and lysine successfully. Why glutamic acid and lysine? Figure\u00a0Amino and carboxy are electron-donating group, which can attract with positively charged ions, such as the unsaturated bonding of rear earth ions exist on the surface of the new-UCNPs to form adducts. Herein, alpha-amino-beta-hydroxybutyric acid [CHectively . The peap (\u2212NH2) . The peaibration . All of 3+ will act as steric hindrance to hinder the electron-donating group, carboxylate ion, to couple with positively charged ions, and leads to CH3CH(OH)CH(NH2)COOH and NH2CH2COOH seldom react with new-UCNPs finally.As known, adjacent amino and carboxy of amino acid can form into inner-salt in the aqueous solution. So, the group of \u2212NH2(CH2)2COOH and H2NCH2CH2CH2CH2CH(NH2)COOH, such as in Fig.\u00a03+ acting as steric hindrance will hinder the coupling between carboxyl and UCNPs; the other end of the molecules keeps the strong nucleophilicity group, carboxyl 2COOH and H2NCH2CH2CH2CH2CH(NH2)COOH can couple with newly UCNPs directly, as shown in Fig.\u00a02(CH2)2COOH coupling with UCNPs is better than that of H2NCH2CH2CH2CH2CH(NH2)COOH. The reason may be that carboxyl nucleophilic performance is better than that of amino.For HOOCCHNH3+  on the surface of particles, which should be able to bind with the negatively charged groups on the surface membranes of HeLa cells. Figure\u00a04:Yb,Er UCNPs.It is common sense that the cell membrane is always negatively charged, so the cationic particles tend to binding negatively charged groups on the cell surface  . As posiUCNPs\u2009=\u200910\u00a0mg/ml) for 16\u00a0h at 37\u00a0\u00b0C, the cells are washed five times using PBS to get rid of the residual UCNPs thoroughly and then imaged using a confocal microscope equipped with a 980-nm NIR laser. Figure\u00a0To ascertain whether the new-UCNPs (18\u00a0nm) have been conjugated HeLa cells after incubation (C4:Yb,Er NPs have some positive charges, which is demonstrated to couple with amino acid and label and image the HeLa cells further. The biology experiment illustrates that the freshly prepared OA-free UCNPs can act as bio-probe for some specific target applications directly without any surface functional treatment.We present an effective method to carrying out the solubility switch of nanoparticles from oil-soluble to water-soluble in terms of hydrion rivalry aided by ultrasonic; furthermore, the method is suitable for the ultra-small particles. The measured zeta potential indicates that the newly prepared OA-free NaYF"}
+{"text": "To compare diagnostic performance and time efficiency between 3D multipath curved planar reformations (mpCPRs) and axial images of CT angiography for the pre-interventional assessment of peripheral arterial disease (PAD), with digital subtraction angiography as the standard of reference.Forty patients , referred to CTA prior to endovascular treatment of PAD, were prospectively included and underwent peripheral CT angiography. A semiautomated toolbox was used to render mpCPRs. Twenty-one arterial segments were defined in each leg; for each segment, the presence of stenosis >\u00a070% was assessed on mpCPRs and axial images by two readers, independently, with digital subtraction angiography as gold standard.p\u00a0=\u00a00.08; Reader 2: 89 vs. 93%, p\u00a0=\u00a00.03) but significantly higher specificity  with mpCPRs than with axial images. Reader 1 achieved significantly higher accuracy with mpCPRs , and Reader\u00a02 had similar overall accuracy in both evaluations . Both readers read mpCPRs significantly faster than axial images .Both readers reached lower sensitivity  contains supplementary material, which is available to authorized users. Peripheral arterial disease (PAD) and its associated morbidity place a significant burden on both patients and healthcare systems. Based on demographic projections and PAD particularly affecting the elderly , 2, the This prospective single-center study was approved by the local ethics committee. Written informed consent was obtained from all patients prior to recruitment. Patients were referred from the Division of Angiology and Vascular Surgery. The following served as inclusion criteria: Rutherford Category 2\u20136; age\u00a0\u2265\u00a018\u00a0years; and normal TSH levels. The following served as exclusion criteria: patient on dialysis (estimated glomerular filtration rate\u00a0<\u00a030\u00a0ml/min); pregnancy; and breastfeeding. The time interval between CTA and DSA had to be equal to or less than 30\u00a0days to avoid a bias attributable to disease progression. Patients who did not ultimately undergo DSA, or who exceeded the required 30-day interval between CTA and DSA, were excluded from the study.All patients underwent CTA on a second-generation, dual-source, multidetector CT scanner . A programmable power injector with a dedicated injection protocol  was used to administer 90\u00a0ml of a low osmolar, non-ionic iodinated contrast agent . In this protocol, a monophasic contrast agent injection with an exponentially decreasing flow rate (3.5\u20132.6\u00a0ml/s) over 35\u00a0s was followed by a 35-ml saline flush at a flow rate of 2.6\u00a0ml/s . Startinz-axis. In other words, if a dataset consisted of 2000 axial images, the reformations had a resolution of 512\u00a0\u00d7\u00a02000 voxels.The axial slices were transferred over a Digital Imaging and Communications in Medicine (DICOM) network to our prototype 3D workstation . Image pAll DSA studies were performed routinely on an Axiom Artis, Angiostar or an ArtisZeego Digital Angiography System  via antegrade or retrograde puncture of a common femoral artery. A low osmolar, non-ionic, iodinated contrast agent  at a concentration of 350\u00a0mg iodine per ml was used.Image analysis was performed on a picture archiving and communication system (PACS) workstation . The arterial tree of each leg was divided into 21\u00a0segments . Nominal data are described using absolute frequencies and percentages. The sample size calculation was performed for the accuracy assessment based on data of previous studies at our institution , 9, 23. During the study period of 12\u00a0months, 183 PAD patients were referred to CTA of the peripheral arteries. A total of 121 patients had to be excluded because no endovascular, but surgical or conservative treatment was performed after CTA. In another 22 patients, endovascular therapy was not performed within 30\u00a0days after CTA, so that the final study cohort consisted of forty patients  as displayed in Fig.\u00a0Due to ethical considerations, the DSA procedure was not specifically adapted for study reasons. As a result, DSA did not depict the entire vasculature of both legs in each patient, but only the treatment-relevant areas, including in- and outflow. In particular, interventions were limited to one leg in 31 patients. In 16 of those patients, DSA was performed after antegrade arterial puncture of the common femoral artery, thus depicting only segments downriver of the puncture site. In the other 15 patients, retrograde puncture of the contralateral common femoral artery was followed by a crossover maneuver, which provided images of the bilateral iliac arteries as well. In the remaining nine patients, the vasculature of both legs was completely depicted by DSA. Altogether, 888 segments were depicted by DSA and could be included in the analysis.Of these 888 segments, Reader\u00a01 rated 44 (5.0%) and 76\u00a0(8.6%) segments non-assessable on mpCPRs and axial images, respectively . Reader\u00a02 rated only 25 (2.8%) and 29\u00a0(3.3%) segments non-assessable on mpCPRs and axial images, respectively .p\u00a0=\u00a00.03), but not for Reader 1 . With regard to specificity, both readers performed significantly better using mpCPRs . Reader\u00a01 also achieved significantly higher accuracy with mpCPRs , whereas Reader\u00a02 had an overall accuracy that was similar with both mpCPRs and axial images . In addition, both readers had a higher overall positive predictive value (PPV) in the evaluation based on mpCPRs (p\u00a0<\u00a00.01 and p\u00a0=\u00a00.07). An opposite trend was observed regarding the overall negative predictive value (NPV), as both readers had lower NPVs based on mpCPRs . Detailed statistical parameters for each vascular territory are provided in Table\u00a0Overall, both readers yielded lower sensitivity values with mpCPRs compared to axial images. However, the difference was significant only for Reader 2 , and the difference in diagnostic accuracy between axial images and mpCPRs was not affected by the clinical stage of PAD (p\u00a0=\u00a00.16). The same applies for the expert reader .Different stages of PAD had no significant effect on the diagnostic accuracy of the less-experienced reader . Detailed inter-reader agreement values for each vascular territory are provided in Table\u00a0Overall inter-reader agreement was excellent for both mpCPRs and axial images, with 92 and 90% agreement, respectively. The inter-reader agreement showed no significant difference between mpCPRs and axial images . Reader\u00a01 was, on average, 25% faster with mpCPRs  than with axial images . Reader 2 was, on average, 33% faster, when the evaluation was based on mpCPRs  compared to axial images .Both readers were significantly faster when using mpCPRs than when using axial images  and on axial images (n\u00a0=\u00a0138). The expert reader, on the other hand, showed no significant difference between mpCPRs and axial images in any statistical test, for the infra-popliteal arteries. Therefore, we hypothesized that the higher number of false-negative findings below the knee for the less-experienced reader might be attributed to some cases with occluded infra-popliteal arteries and early enhancement of the accompanying veins. In these cases, the automatic vessel tracking algorithm can misinterpret the venous overlay as the correct vessel path. Figure\u00a0Interestingly, below-the-knee arteries, in particular their limited number of orthogonal viewing pairs observed in an initial analysis of mpCPRs in 2007, were the reason for the recommendation to use mpCPRs not alone, but rather in conjunction with spCPRs, MIPs, and axial images . LookingAlthough we showed that mpCPRs of the infra-popliteal arteries can comprise pitfalls for less-experienced readers, this reformation technique was advantageous, especially for the less-experienced reader. He reached a higher level of specificity and accuracy than that reached with axial images, overall, and, in particular, in the femoro-popliteal arteries, while maintaining a similar level of sensitivity.Furthermore, the reading of mpCPRs was statistically significantly faster compared to that of axial images, although the absolute time saving was smaller than anticipated. In particular, for the less-experienced reader, a more pronounced effect was expected. An explanation for the smaller difference might be the sub-segments that were defined for long vessels in this study. For each sub-segment, a separate rating was necessary and the allocation of stenoses to the correct segment required additional time for both axial images and mpCPRs. Of note, technologists routinely perform the image post-processing at our institution and the mpCPRs are stored in the PACS. In other institutions, where radiologists are performing image post-processing themselves, the required post-processing time would exceed the time savings of mpCPRs during image analysis. However, in addition to being faster with the mpCPR images, both readers reported that the reading of axial images was more tiring. In theory, this could lead to an increased number of careless mistakes during the stressful clinical routine . BesidesThere are certain limitations to this study that need to be addressed. First, the DSA procedure was not specifically modified for study reasons due to ethical considerations about radiation exposure. Therefore, DSA was not obtained for all segments. However, this was considered in the initial power analysis. In addition, most vessel segments were visualized by a single plane of DSA; a second plane was only acquired if clinically indicated during the procedure. Second, none of our patients had a femoro-femoral crossover bypass, which causes severe artifacts in mpCPRs due to their path running parallel to the horizontal axis . We recoIn conclusion, mpCPRs are a promising reformation technique that facilitates a fast assessment of PAD with high diagnostic accuracy. However, radiologists need to be aware of possible reformation-related pitfalls in case of occluded infra-popliteal arteries with venous overlay.Supplementary material 1 (MP4 2205\u00a0kb)Supplementary material 2 (MP4 1971\u00a0kb)A 75-year-old male patient with hypertension and hyperlipidemia and a history of stent implantation in both superficial femoral arteries was referred to interventional radiology with PAD category 2 according to the Rutherford classification. 21 Maximum Intensity Projections  and 21 Multipath Curved Planar Reformations  were rendered over a viewing range of 180\u00b0 in 9\u00b0 intervals."}
+{"text": "Saccharomyces cerevisiae, have the potential for improving the enteric health of piglets, but little is known about the mechanisms by which the administration of yeast counteracts the DON-induced intestinal alterations. Using a pig jejunum explant model, a whole-transcriptome analysis was performed to decipher the early response of the small intestine to the deleterious effects of DON after administration of S. cerevisiae boulardii strain CNCM I-1079. Compared to the control condition, no differentially expressed gene (DE) was observed after treatment by yeast only. By contrast, 3619 probes\u2014corresponding to 2771 genes\u2014were differentially expressed following exposure to DON, and 32 signaling pathways were identified from the IPA software functional analysis of the set of DE genes. When the intestinal explants were treated with S. cerevisiae boulardii prior to DON exposure, the number of DE genes decreased by half (1718 probes corresponding to 1384 genes). Prototypical inflammation signaling pathways triggered by DON, including NF-\u03baB and p38 MAPK, were reversed, although the yeast demonstrated limited efficacy toward some other pathways. S. cerevisiae boulardii also restored the lipid metabolism signaling pathway, and reversed the down-regulation of the antioxidant action of vitamin C signaling pathway. The latter effect could reduce the burden of DON-induced oxidative stress. Altogether, the results show that S. cerevisiae boulardii reduces the DON-induced alteration of intestinal transcriptome, and point to new mechanisms for the healing of tissue injury by yeast.Type B trichothecene mycotoxin deoxynivalenol (DON) is one of the most frequently occurring food contaminants. By inducing trans-activation of a number of pro-inflammatory cytokines and increasing the stability of their mRNA, trichothecene can impair intestinal health. Several yeast products, especially  The intestine has been identified as one of the critical targets of the food-borne mycotoxins ,2. TrichSaccharomyces cerevisiae in particular has demonstrated its potential for improving enteric health of piglets [Among the ways to tackle the variety of factors threatening intestinal health, probiotics are considered good candidates, since they not only suppress the growth and binding of pathogenic bacteria, as well as improving the barrier function of the intestinal epithelium, but also tune the immune activity of the host ,12. Seve piglets ,14. It w piglets .S. cerevisiae improves intestinal health. Preliminary in vitro data obtained in human monocytic, colonic, and gastric epithelial cells suggest that S. cerevisiae boulardii decreases inflammation by inhibiting NF-\u03baB-mediated IL-8 gene expression [S. cerevisiae boulardii decreases the activation of p38 MAPK pathway, and reduces the expression of downstream inflammatory cytokines; this yeast also promotes the expression of anti-apoptotic genes, and inhibits apoptosis in porcine alveolar macrophage cells [Little is known about the mechanisms by which pression . Regardige cells .S. cerevisiae boulardii in response to the deleterious effects of DON, a whole transcriptome analysis of intestinal tissue was performed. Pre-treatment of the intestinal tissue with the yeast significantly reduced the global impact of DON on the transcriptome, and reversed prototypical inflammation signaling pathways including NF-\u03baB and p38 MAPK. The yeast also restored the lipid metabolism signaling pathway and reverted the down-regulation of the antioxidant action of the vitamin C signaling pathway.In order to understand the early response of the small intestine to the administration of S. cerevisiae boulardii to counteract the intestinal effect of DON, a pan genomic analysis of the transcriptomic fingerprint was conducted in control jejunal explants, explants treated with the yeast, and explants challenged with 10 \u03bcM DON in the presence, or absence, of S. cerevisiae boulardii. In human gut, concentrations of 0.16\u20132 \u03bcg DON/mL (0.5\u20137 \u03bcM) are considered realistic [S. cerevisiae boulardii, the EFSA expert panel concluded that the additive has the potential to be efficacious in weaned piglets at a dose of 2 \u00d7 109 CFU/kg feed [To analyze the ability of ealistic . The lowealistic . In a reealistic . Regardi/kg feed . The yeap value < 0.05). As expected, and as shown on the heatmap   following exposure to DON, with fold-change values ranging from \u22123.43 to 11.44. No DEG was observed for the yeast condition  and interleukin 22 (IL-22), the macrophage inflammatory proteins genes MIP-2 alpha and MIP-3 alpha , the receptor for MIP-3 beta chemokine gene (CCR7), the positive regulatory domain I-binding factor 1 gene (PRDM1) which drives the maturation of B-lymphocytes into Ig secreting cells, and the A disintegrin and metalloproteinase with thrombospondin motifs gene (ADAMTS) which may be associated with various inflammatory process. The amphiregulin gene (AREG), which can be expressed by multiple populations of activated immune cells under inflammatory conditions, was also up-regulated. Other genes in the top up-regulated category included FOSL-1, which regulates cell proliferation, differentiation, or transformation, PLK-2, which may play an important role in cells undergoing rapid cell division, and the transcriptional co-activator/repressor IFRD1, which controls the growth and differentiation of specific cell types.The top-regulated genes are listed in S. cerevisiae boulardii prior to DON exposure decreased the number of DEGs by 50%, as only 1384 genes (1718 probes) were differentially expressed in DON + yeast treated explants , the 15 other genes expressed in both experimental conditions were slightly less expressed in the DON + yeast condition  on a set of 12 DE genes in DON and DON + yeast conditions. A significant Spearman correlation coefficient (r = 0.896) was observed between the two techniques , confirmS. cerevisiae boulardii, a comparative functional analysis of DEGs in DON and DON + yeast conditions was performed using the core analysis comparative function of Ingenuity Pathway Analysis (IPA) software.To further investigate the protective effect of p-value < 0.05, \u22122 > IPA Z-score > +2). As previously described, the foremost up-regulated signaling pathways in the DON condition, including HMGB1 signaling, IL-6, IL1, TNFR1, p38 MAPK, and TREM1 signaling, were related to immunity/inflammation [ammation . The B-cammation ,23. LastS. cerevisiae boulardii to the jejunal tissue prior to DON exposure reduced the number of activated canonical pathways from 32 to 13  inflammation, (ii) oxidative stress, and (iii) lipid metabolism.Aside from these few cases, the shutdown of the 24 other DON-triggered signaling pathways is evidence that the yeast administration significantly restrained the detrimental effects of this mycotoxin on the intestine. The application of S. cerevisiae boulardii prior to DON exposure. These four signaling pathways were IL-1 and TREM signaling, the LPS/IL-1 mediated inhibition of RXR function, as well as the role of IL-17 in allergic inflammatory disease pathway. Treatment with S. cerevisiae boulardii prevented the triggering of other inflammation pathways including HMGB1 signaling, TNFR1 signaling, and the IL-6 signaling pathway, as well as the pivotal NF-kB signaling and p38 MAPK signaling pathways.Only four out of 19 inflammation/immunity signaling pathways triggered by DON were still observed in explants treated with HMGB1 belongs to a family of endogenous compounds termed \u201calarmins\u201d, which can be released in the extracellular milieu during states of cellular stress or injury leading to infectious or non-infectious conditions . IL-6 isS. cerevisiae boulardii was shown to attenuate p38 MAPK signaling by alleviating DON-induced phosphorylation and mRNA expression of p38 MAPK protein [S. cerevisiae boulardii treated tissue before DON exposure  and a member of the cytosolic phospholipase A2 family (cPLA2), and up-regulation of the TNF receptor associated factor 6 (TRAF6). Recent studies revealed the involvement of ASK1 in ROS- or ER stress related diseases, suggesting that ASK1 could be a therapeutic target [S. cerevisiae boulardii was also seen to downscale the DON-induced activation of the signal transducer and activator of transcription 1 (STAT1), which translocates to the nucleus to promote expression of cytokine response genes [The p38 MAPK pathway is a key regulator of pro-inflammatory cytokines biosynthesis at the transcriptional and translational levels, which makes it critical for normal immune and inflammatory response . In isol protein . A compaexposure  shows thc target . The memc target . Finallyse genes .S. cerevisiae boulardii on the NF-\u03baB signaling pathway. Activation of NF-\u03baB signaling via canonical or alternative pathways regulates various biological processes, including immune response, inflammation, cell growth and survival, and development [S. cerevisiae boulardii prior to DON exposure  was also down-regulated. As a phosphoprotein, the transcriptional activity of PPAR\u03b3 is affected by the extracellular receptor kinase-mitogen activated protein kinase (ERK-MAPK), and thereby its constitutive activators insulin and PDGF [Interestingly, expression of the insulin receptor gene and of the platelet-derived growth factor receptor gene  purchased from Sigma  was dissolved to 10 mM in dimethylsulfoxide (DMSO), and stored at \u221220 \u00b0C before dilution in complete culture media.Saccharomyces cerevisiae boulardii CNCM I-1079) from Lallemand Animal Nutrition  was rehydrated (10 g/100 g) in a suspension medium  and allowed to rehydrate for 20 min with gentle agitation (120 rpm) in a shaking water bath at 37 \u00b0C. Serial dilutions were performed in peptone saline water , and a 1/1000 dilution containing 4 \u00d7 106 CFU/mL of live cells was used. The yeast solutions were prepared just before use. Whole culture material was used in this experiment, since it is established that the effects of S. cerevisiae boulardii on the host result from cell to cell interactions, as well as from interactions between yeast secreted molecules and epithelial cells [Industrial dry yeast Levucell SB20 . Two explants/wells were deposited villi upward on 1-cm2 biopsy sponges  in six well plates  containing the control medium, supplemented or not with S. cerevisiae boulardii containing medium. The culture medium contained 100 U/mL penicillin, 100 \u03bcg/mL streptomycin, and 50 \u03bcg/mL gentamycin . All these operations were achieved in less than one hour after the piglets were euthanized.Jejunal explants were obtained from 5-week old crossbred castrated male piglets, as described previously ,43,44. BS. cerevisiae boulardii. I-1079 (which corresponds to 3 \u00d7 105 colony forming units) for 30 min, and then challenged with 10 \u03bcM DON for 4 h at 39 \u00b0C. The dose of DON and S. cerevisiae boulardii I-1079 were chosen to reflect doses in feed equivalent to 3 ppm of DON and 2 \u00d7 109 CFU/kg of feed of S. cerevisiae boulardii I-1079, respectively. A toxin vehicle (DMSO) condition, and an S. cerevisiae boulardii I-1079 condition, were used as controls. After incubation, treated explants were stored at \u221280 \u00b0C before RNA extraction.The experiment was conducted according to the guidelines of the French Ministry of Agriculture for animal research. All animal experimentation procedures were approved by the Ethics committee of Pharmacology-Toxicology of Toulouse-Midi-Pyr\u00e9n\u00e9es in animal experimentation (Toxcom\u00e9thique), N\u00b0 TOXCOM/0017/IO PP, in accordance with the European Directive on the protection of animals used for scientific purposes (Directive 2010/63/EU). The date of approval is 1 September 2017. The three authors  have an official agreement with the French Veterinary Services allowing animal experimentation. The explants were pre-treated, or not, with 75 \u03bcL of the Jejunal explants were lysed in 1 mL of Extract All reagent  with ceramic beads . Total RNA was extracted according to the manufacturer\u2019s recommendations, as previously described ,46. The www.r-project.org, R v. 3.1.2) and the Bioconductor packages , as described in GEO entry GSE97821, which also contains all the details of the experiments.The microarray GPL16524  used in this experiment consisted of 43,603 spots derived from the 44 K (V2:026440 design) Agilent porcine-specific microarray . This mihttp://www.ingenuity.com) to identify gene networks and signaling pathways affected by each treatment. The IPA output included statistical assessment of the significance of gene networks and signaling pathways based on Fisher\u2019s exact test; only networks and pathways that presented a p value < 0.05 or a \u2212log p value exceeding 1.30  and a Z-score with an absolute value \u2265 2 were retained.Network analysis and functional analysis of the DE genes were performed using the Ingenuity Pathway Analysis tool , as previously described [CycloA), \u03b2-actin, \u03b22-microglobulin, Ribosomal Protein L32 (RPL32), and Hypoxanthine Phosphoribosyl transferase 1 (HPRT-1)) across different experimental samples has been investigated; it was demonstrated that RPL32 showed the highest stability  [RPL32 and CycloA were chosen as housekeeping genes, and the 2-\u2206\u2206Ct method was used to calculate the fold change in gene expression. For comparison with microarray data, the Spearman correlation between the microarray Log2 (FC) and qPCR Log2 (2-\u2206\u2206Ct) values was calculated.The reverse transcription and real-time qPCR steps were performed on total RNA samples (escribed . The pri= 0.971) . RPL32 ap values \u2264 0.05 (FDR correction using the Benjamini Hochberg procedure) were differentially expressed between the treated and control conditions. Hierarchical clustering was applied to the samples and the probes, using the 1-Pearson correlation coefficient as the distance and Ward\u2019s criterion for agglomeration, and was then illustrated as a heatmap presenting gene expression profiles of selected regulated genes.The microarray data were analyzed using the R Bioconductor packages and the limma lmFit function, as previously described . Probes For gene expression quantification by qRT-PCR, the mRNA expression of the target genes was normalized to the expressed housekeeping genes using REST\u00a9 2009 software , which uses the pair-wise fixed reallocation randomization test as the statistical model ."}
+{"text": "Research on the field of nanomaterials in environment has continued to be a major area of interest in recent years. To present the up-to-date progress in this field, a bibliometric study is conducted to analyze 7087 related publications in the Science Citation Index (SCI) core collection of Web of Science based on the expanded SCI. These publications are identified through using representative keywords in the research directions environment of the Web of Science. This study finds that China and the United States dominate the field; one difference between them is that China issued more independent publications and the United States issued more cooperative publications. In addition, the number of the related publications in Asian countries has exceeded that of European and American ones. A Chinese institution, the Chinese Academy of Sciences, has an absolute dominance in this field. Traditional high-impact environmental journals have ruled this field. The number of publications in the Energy and Environmental Science field has gradually decreased. In addition, a co-citation analysis shows that previous studies in this field can be divided into four major branches, and that graphene oxide and nano-inorganic particles are increasingly becoming research hotspots.  Gleiter et al.  developeSpecifically, a series of nanomaterials-related studies have been conducted in environmental sciences and engineering. For instance, Gottschalk et al  simulateTo achieve such an analysis, bibliometrics, i.e., a statistical analysis of existing literature in a comprehensive knowledge system, is a potentially effective method. In this method, mathematics, statistics, and philology are integrated for quantifying literature characteristics . BibliomFurthermore, it is necessary to analyze the correlation of word frequencies, especially for the subjects of multiple branches of studies. A few studies of coupled analyses of word frequencies have been reported. For example, Li et al.  evaluateTherefore, this study focuses on a bibliometric analysis of literature regarding NME  . Based oNME-related publications are searched from the database of Web of Science Core Collection. The search-related parameters and strategies are set as follows. Specifically, the \u201cScience Citation Index Expanded (SCI-EXPANDED) 1900-present\u201d is selected as the Citation Indexes in More Settings . RelatedTo limit the scope of types of publications, some empirical factors were selected in this study . The DocIn this research, Excel and R language (R) were the main tools, while other tools were used to assist, calibrate, and visualize. Excel is powerful in filtering information. Many simple statistical analyses are completed by Excel . R is alCitespace was used for the co-citation analysis in this research. Citespace is a visual analysis tool that focuses on the correlations between references cited by high-impact publications, and can present the relationships between different research branches . In addiSome software such as Pajek  and VOSvStep 1: Raw files in plain texts were automatically merged into available Excel files with abbreviated titles by Bibexcel   was analyzed with Citespace for the Excel files produced in Step 1.Step 4: High-frequency words in all publication titles were counted in R. A co-word analysis provides the words frequency of co-occurrence to analysis the value of words. Afterwards, a correlation analysis was delivered by R for revealing the relationship of the high-frequency words.The detailed steps of a holistic approach are illustrated in Many potential relationships exist for the variations of high-frequency words with different years . Therefore, it was necessary to analyze the correlation of high-frequency words comprehensively. i is the word frequency at the ith year and yi is the word frequency at the ith year. A scatter diagram can describe whether the correlation between two variables  is linear correlation or discrete relation . A frequency distribution shows the frequency of the variable at each level . In this study, several high-frequency words with research value  were selected for a correlation analysis. We choose nine words with research value from all initially obtained words. In this study, the correlation between any two selected high-frequency words was analyzed by R. The map of all correlation includes the following information: Pearson Correlation Coefficients in the upper triangle , frequency distributions of variables  in the main diagonal, and scatter diagrams . Among them, the Pearson Correlation Coefficient between variables X  and Y  was calculated by : (1)PCC in this field, 99 of which were published in the journal of Environmental Science and Technology. An increase in the total global citation score  indicates the increasing influence of NME . Among tThe 7087 publications in this research were from 76 countries and territories, and 5,201 (73.4%) publications were without international cooperation from 65 (85.5%) countries and territories. China and the United States play a leading role in the research of nanomaterials in the environmental field. The total number of publications published by the two countries were 4,488 (63.28%), including 1762 publications issued by China alone, 728 publications involving international cooperation with China, 1155 publications by the United States alone, and 843 publications involving international cooperation with the US. China has experienced a rapid development in this field from seven publications written by China alone in 2004 to 303 publications in 2017. The United States also grew from seven publications published by the US alone in 2004 to 74 publications in 2017. This data cannot completely confirm that China was ahead of the United States in terms of research in these areas. The United States has a large number of collaborative research publications with other countries. However, the data shows that China is indeed developing rapidly in this field due to the support and investment of the Chinese government.According to As shown in To understand the trend and variation of the research areas of NME, 7087 publications from Web of Science categories  and journals were analyzed in this study. These publications were from 43 Web of Science categories of which the two most important categories  were \u201cEnThe 7087 publications analyzed by this research were published in 166 journals. There are 22 journals in which more than 50 publications have been published, with the total of 5554 publications (78.4%). There are five journals with more than 300 publications published in the field, namely, ENVIRONMENTAL SCIENCE and TECHNOLOGY  , JOURNAL OF HAZARDOUS MATERIALS  , ENERGY and ENVIRONMENTAL SCIENCE  , APPLIED CATALYSIS A-GENERAL , and CHEMOSPHERE  . Among them, only EES showed a significant downward trend in the past three years, which may be related to its variation of research orientation. It may be more difficult for NME publications to be submitted to EES. The other four journals still show an upward trend, although their fluctuations are erratic. There are 95 (57.2%) unpopular journals in which the number of publications is not greater than 10; 278 (3.9%) publications were published in these journals. This section demonstrates the variation of attention for these journals in NME . The attA co-citation analysis  proved t7087 publications are divided into 18 clusters. Each cluster has a clear meaning with the Contour coefficient of 0.92 to 0.99. The map as a whole was represented by a center-to-around divergent pattern. This was consistent with the research progress gradually developed from the preliminary research to multiple branches. Moreover, cluster and network summary of co-citation analysis are shown in As shown in As shown in The key finding in Branch 1 is the physiological effect of C60 on the brain of perch that was published by Fortner et al. . An impoIn Branch 2, two clusters of multi-wall carbon nanotubes are the main component of this part. Among them, the most influential findings are the behaviors of nanoparticles throughout the cycle , which iBranch 3 developed progressively. On the center of Branch 4 is the most influential branch of nanomaterials in the environmental field. This branch contains a number of high-impact researches, and some of the results have long-term influence. The two most cited publications in this research are from this branch. For example, the multi-nanomaterials multi-environment concentration model developed by Gottschalk et al. always has high influence in the field . JapanesIn addition, a co-citation analysis is shown by a line chart  to proviTo further emerge the intellectual evolution of the NME research, the co-citation result was further described in a Timezone view i.e., , in whicMany words in titles can express research contributions. An analysis of the variation correlation between high-frequency words can reveal the potential impacts of different contents. Firstly, based on occurrence frequencies, co-occurrence frequencies, and research significances, nine words  were selected to analyze their correlations. To ensure the validity of the correlation analysis, a co-word analysis was applied to pledge that a publication only represents one research direction. As shown in As shown in NME has many research directions. Therefore, the co-word analysis cannot play an effective role in characterizing the relationships of words. The correlation analysis can prove to be an efficient tool in this area. In this bibliometric research, data of 7087 publications were analyzed which are recorded in the SCI core collection of web of science, and the citation index is selected as Science Citation Index Expanded (SCI-EXPANDED). The publications were searched by using restricted search terms and the research area of Web of Science. Analysis methods included frequency analysis, co-citation analysis, and correlation analysis of high frequency words. As summarized below, a series of findings regarding the bibliometric of nanomaterials in the environmental field were found. In particular, China and the United States dominate NME studies; China issued more publications independently, and the United States issued more publications cooperatively. The number of publications in Asian institutions  has exceeded that of European and American countries, showing their absolute dominance in NME studies. Traditional high-impact environmental journals have ruled NME, and the number of publications in Energy and Environmental Science is gradually decreasing. A co-citation analysis suggests that the development history of NME studies can be divided into four major branches. Among them, more complex structure and details may be the research hotspots in NME. Organic or inorganic carbon nanoparticles may still have the strongest influence in NME. Moreover, correlation analysis is an efficient tool for word frequency analysis in bibliometrics.In the future, we will continue to focus on this area. Meanwhile, we will explore the feasibility and practicability of more methods in bibliometrics, such as factor analysis and cluster analysis."}
+{"text": "Clinically, when applying multiparametric magnetic resonance imaging (MRI) examinations in renal diseases, assessment of renal structure and function has to account for age- and sex-related effects. The aim of this study was to investigate the influence of age and sex on multiparametric MRI assessment of renal structure and function in healthy human beings. Studies on 33 healthy volunteers were performed using multiparametric MRI on a 3.0-Tesla MR scanner, including T1-weighted imaging, blood oxygen level-dependent MRI (BOLD MRI), diffusion-weighted imaging (DWI) and diffusion tensor imaging (DTI). Our results revealed that the mean renal cortical thickness (RCT), ratio of cortex to parenchyma (CPR), and cortical R2* values were higher in males than in females. The cortical R2* value was higher in older group than in younger group ; there was no significant difference in medullary R2* between the older and younger groups . The parenchymal thickness (PT) and medullary fractional anisotropy (FA) were lower in older group than in younger group . Pearson\u2019s correlation analysis showed that PT and medullary FA were inversely related with age  while cortical R2* values was positively related . The medullary apparent diffusion coefficient (ADC) value had a significant association with PT . This study indicated that multiparametric renal MRI parameters are age and sex dependent. The renal medulla consumes more oxygen in the thick ascending limb by the Na-K ATPase activity than the cortex, which suggests hypoxia of the medulla in normal conditions2.The kidney is an intricate organ, which plays an important role in ensuring acid-base balance, regulating electrolytes and blood pressure as well as filtering blood to remove waste substances  from the body. These physiological activities utilize oxygen and heavily depend on water molecule transporting ability of the kidney, which is strikingly different in renal cortex and medulla due to different vascular and tubular arrangement4. The cortical atrophy roughly reflects decreased number of functioning nephrons, and few glomeruli appear sclerosed under the age of 404. In terms of renal functions, there is increased renal vascular resistance and filtration fraction, reduced renal blood flow (RBF), glomerular filtration rate (GFR), urine concentrating capacity and hormone secretion with age4. Although the GFR decline usually begins from mid 40\u2009s, the decline rate varies with gender, race, and burden of comorbid disease4.A normal aging kidney is accompanied by structural deterioration and progressive decline in renal function. Morphologically, the aging kidney shows a decrease in cortical mass and total nephron size and number, increase in arteriosclerosis, glomerulosclerosis, tubular atrophy, interstitial fibrosis, tubular diverticula, and to a lesser extent nephron hypertrophy5. As 3.0\u2009T MR systems became more and more commonly used in the clinical field, many noninvasive MR sequences are being used in daily scanning to acquire information with higher signal-to-noise ratio and are suitable for kidney examination with no Gd-based contrast agent exposure6. Many studies using single MRI techniques have been used to detect alterations in intrarenal microstructure, oxygenation or perfusion in patients10. However, it is difficult to determine which are the optimal MRI measures or combinations of measures for a given biological process. Multiparametric MRI including conventional T1-weighted imaging, blood oxygen level-dependent (BOLD), diffusion weighted imaging (DWI) and diffusion tensor imaging (DTI), which combines multiple MRI biomarkers, is likely to be more effective at assessing biophysical tissue properties and providing insight into different pathological processes in-vivo in a single scan session. It is therefore necessary to establish the normal values of related parameters and their relevant influencing factors in healthy population before clinical application. However, it has only been performed in limited studies that analyze the impact of sex and age15. Thus, the objective of this study was to investigate the influence of age and sex on renal structure and function in healthy human beings with multiparametric MRI examination on a 3.0\u2009T MR system.Morphological changes of diffuse renal diseases can be detected only at advanced stages, which often leads to a delay in adequate treatment. Laboratory parameters, such as serum creatinine, cystatin C and urinary albuminuria leakage, are commonly used for providing renal filtration information. However, these parameters are insensitive to significant subtle changes. In the meantime, potential toxicities associated with contrast media used to measure GFR may restrict repetitive examinations within a short periodTable\u00a0Multiparametric MR images and ROI locations are demonstrated in Fig.\u00a0Table\u00a0The mean values of RCT, PT and CPR are shown by box plot Fig.\u00a0, which dThe between session and inter-observer variability of the MRI measurements were also analyzed. The ICCs (intra-class correlation coefficients) and CoV (coefficient of Variation) for between session variability were 0.76 to 0.88 and 3.7% to 13% respectively, 0.683 to 0.790 and 4.4% to 10.5% for inter-observer variability  is quite invariable in people of different age and sex; and CPR (SD 0.02) seems to be more stable as shown in Table\u00a021; however, like the result of Gourtsoyiannis et al.21, the significance is lost between sexes when measurements were corrected for body size (BMI). In addition, we found that the upper and lower thickness in coronal plane was significantly larger than the value in axial renal hilum plane, which has not yet been reported in the literature and could be one reason why the mean RCT in our study (0.51\u2009\u00b1\u20090.04) was smaller than (0.91\u20130.92) as reported by Mounier-Vehier et al.19 in contrast-enhanced CT study which measured RCT only at the upper and lower poles.The kidney size is of great clinical significance, since many diseases are associated with it; and it is influenced by individual variability. In our series, PT, RCT and CPR were decreased after 40 years old, and only the change of PT had statistical significance which is inconsistent with the findings that both RCT and PT decreases with age23. BOLD-MRI that measures renal tissue deoxyhemoglobin levels voxel by voxel has become a widely used and robust non-invasive method to estimate renal tissue oxygenation25. This method explores the fact that oxyhemoglobin is diamagnetic, whereas deoxyhemoglobin is paramagnetic which can induce inhomogeneity and increased T2* decay represented by decreased intensity on T2*-weighted images and increased R2* value26. Increases in R2* correspond to higher deoxyhemoglobin concentrations and indicate low tissue oxygenation, whereas decreases in R2* indicate high tissue oxygenation. A wide range of renal cortical and medullary R2\u2217 (T2\u2217) values have been presented in the literature, where R2* value of the medulla was higher than that of cortex, confirming the significant cortico-medullary gradient of oxygenation27. The R2\u2217/T2\u2217 values presented in our study are in the range of those described in the literature for baseline results28, while other studies have recorded lower29 or higher25 R2\u2217 values. Our study demonstrated that cortical R2* value was higher in the older group and was positively correlated with age, and there is a trend for increased medullary R2* in old people, similar to previous findings where both cortical and medullary R2* values increased with age29 and only medullary R2* values increased with age30. However, Gloviczki et al.31 and Grassedonio et al.13 did not find correlation with age. The reason for this may be that Gloviczki et al.31 included middle-aged and elderly patients with pronounced hypertension or atherosclerotic renal artery stenosis in whom the age range is small and renal tissue oxygenation may mainly be influenced by diseases. However, Grassedonio et al.13 included small number of young and middle-aged healthy subjects with small age range in subjects whose renal tissue oxygenation may not have been altered significantly and each of their ROI covered both the cortex and medulla. Our results indicated that the aging kidney suffered extensive degrees of hypoxia, which is most prominent in the cortex. This has been confirmed by the animal experiment that increased hypoxia has been demonstrated throughout the aged rat kidneys, most prominently in the cortical zone, as detected by hypoxia\u2013sensitive marker pimonidazole32. Several potential mechanisms can be postulated, and more than one might be involved: Within the aging kidney, there are important changes to blood vessel structure and function, which may compromise RBF. RBF has been shown to reduce with age, with redistribution of blood from the cortex to the medulla and leading to low oxygen supply to the renal cortex. Decreased glomerular density and glomerulosclerosis with aging seems to preferentially affect the more superficial nephrons4. Likewise, a pathological study has demonstrated that arteriolar sclerosis seen with aging involves smaller vessels of the cortex primarily, with secondary changes in the arcuate and inter-lobar vessels33. In addition, radiological study with aging man has demonstrated that the angiographically demonstrable changes associated with aging progress is in a centripetal pattern, with the more peripheral portions of vascular bed showing the earliest changes34. As to the blood vessel function in aging kidney, there are intrinsic causes of decreased RBF that is the aging kidney has diminished responsiveness to vasodilators and increased sensitivity to vasoconstrictors4.Tissue hypoxia is considered pivotal in the development and progression of many kidney diseaseset al.35 however, other studies didn\u2019t see a difference between males and females30. Our result suggests that cortical oxygenation might be regulated differently in men and women, and it may provide some clues why renal function declines faster in men. A possible explanation for this is that atherosclerosis, increasing oxidative stress with ageing and vascular nitrous oxide (NO) deficiency in males are more pronounced than in females, and are possibly androgen-induced37. Although there was a trend of higher medullary R2* value in male group, no significant difference was observed between different the two sexes. Possible reason for this may be that it is too weak to be detected with the data used in this study or it is merely due to limited number of samples.The cortical R2* value was found to be significantly higher in males compared with females, which is consistent with the findings of Pruijm 10. Some studies have showed a decreased ADC in CKD and obstructive renal diseases39, which may be the results of worsen renal function  and renal fibrosis. The renal ADC value integrates both the effects of capillary perfusion and water diffusion in the extravascular space. Some literature has demonstrated that the measured ADC is affected by the b-values adopted. Using only high b-value (500\u20131000\u2009s/mm2) will result in a low measured ADC which approximates the true diffusion; while applying only low-b values (0\u2013100\u2009s/mm2) will result in a high calculated ADC which reflects both perfusion and diffusion. When a wide range of b-values are used, it will provide the least variation40. Thus, 3 b values were used in our series to balance the \u201cT2 shine-through\u201d and capillary effects. Our results are comparable to that of Cox11 and Thoeny40. However, Cutajar17 reported higher ADC than ours, which may be due to the fact that they only used two b-values (0 and 400\u2009s/mm2). Furthermore, DW images with b\u2009=\u20090 were used in our study to locate renal cortex and medulla, and we found that ADC value of cortex exceeded that of medulla with statistical significance. The reason for this could be faster water molecule transporting in the cortical glomerulus. We found that medullary ADC value was positively correlated with parenchymal thickness, which may be explained by the reason that kidneys with thicker renal parenchyma have lesser nephrosclerosis, tubular atrophy and renal fibrosis, and better renal function. Similar to the study by lavdas et al.14, our study did not find dependence of ADC values with age and sex, a recent study in 137 healthy participants did find that ADC values in the kidney may be age- and gender-dependent15.DWI is a non-invasive method to detect the displacement of water molecules within the architecture of tissue that can be quantified from ADC. As one of the simplest parameters reflecting tissue microstructure, the ADC is an overall measurement of water diffusion and microcirculation in the tissue. It is now known that DWI is particularly sensitive to alterations in the renal interstitium, for instance, renal fibrosis, cellular infiltration (inflammatory or tumorous) or edema, intrarenal perfusion and in water handling in the tubular compartmentet al.41 in the kidneys of healthy volunteers, and some studies showed that FA values may aid in the detection of renal microstructural abnormalities in patients43. DTI studies including ours have demonstrated that diffusion anisotropy in the medulla is considerably higher than in the cortex45, and the tractography reveals a radial diffusion orientation. The reason for this was presumably due to a well-defined renal structure with tubules, collecting ducts and vessels radially oriented towards the pelvis and in which molecules move in a preferential direction. In addition, our study demonstrated that medullary FA decreased with age, which implied structural and functional changes of renal medulla in aging kidneys and may be explained by the aging-related process of potential vascular abnormalities, reduced tubular flow rate, tubular ultrastructural damage (e.g. tubular dilation and atrophy), and interstitial fibrosis4.DTI is a development from diffusion-weighted MRI, it can provide insight into the structural properties of tissue by assessing the directionality of water diffusion which is quantified as the percentage of spatially oriented diffusion signal . Diffusion anisotropy is related to structural organization and therefore could be compromised in a pathological process. It was first used by Ries There are several limitations in this study. First, the number of subjects enrolled was relatively small, which may limit the statistical analysis. Further studies with larger sample sizes are needed to further validate the results. Second, GFR and other MRI modalities that measure RBF and perfusion were not performed in this study, this may help in the interpretation of our results. We did not investigate the physiological influence of hydration, furosemide or 100% O2 breathing on renal tissue oxygenation represented as R2*. Third, the pathological results of aging kidney such as decrease in RCT, PT and increase in arteriosclerosis, glomerulosclerosis, tubular atrophy, interstitial fibrosis, and so on were not collected for correlation. Further experimental or clinical studies with pathological findings will be useful to reveal the specific mechanism of R2*, ADC and FA changes in people with different age and sex.In conclusion, this paper has outlined a multiparametric MRI acquisition to assess the renal morphology and function, and it has shown that PT, cortical R2* and medullary FA values are age dependent and RCT and cortical R2* values are sex dependent. Age- and gender-related effects should be considered in future multiparametric MRI studies using normal values from health controls.The study was carried out in accordance with the principles of the Declaration of Helsinki. Thirty-three healthy subjects  with no history of renal disease, hypertension, diabetes, vascular disease, malignant tumors or medication use were recruited from January 2018 to June 2018. The spot urine samples tested negative for proteinuria by dipstick. In addition, patients were excluded if they had any degree of renal artery stenosis or a history of percutaneous or surgical renal intervention . Other exclusion factors included multiple renal cysts, polycystic kidney disease, hydronephrosis, a unilateral kidney, and inadequate MRI quality for the reason of extensive respiratory motion. The participants were divided into groups . Written informed consent was obtained from all the participants after having full understanding of our study which was approved by the ethics committee of Sichuan Cancer Hospital and Institute.All the subjects were scanned during the morning from 10:00\u201311:00 am using a 3.0-Tesla MR whole-body scanner  with a six-channel flexible body matrix coil. Prior to their MR scans, it was ensured that participants had fasted for at least 4\u2009hours and refrain from smoking for at least 12\u2009hours.2) were used to acquire diffusion trace weighted images in the coronal planes, and the average ADC, FA color and tensor maps were subsequently created automatically on the scanner. The average ADC map was calculated from all b values with a monoexponentially fitting model which includes contributions from both diffusion and perfusion. Furthermore, to determine the between session variability of MRI measures, a subset of 15 subjects  repeated the MRI scans 3 days later.At first, in-phase and opposed-phase images in axial and coronal plane were taken covering both kidneys as scout images . Then, BOLD MRI was obtained with an end-expiration breath-holding of 48\u2009s. The multiple gradient-recalled echo sequence  was used to acquire 8 sets of T2*-weighted images in coronal planes, and quantitative T2* maps were calculated on the scanner. DW MRI was acquired with free breathing, which was not respiratory triggered, and the scan time was 97\u2009s. The echo-planar imaging (EPI) technique and fast gradient sequence  for analysis. First and foremost, two professional radiologists (more than 5 years of experience) independently analyzed all the images of the first MRI scans and recorded the measurements. Then, one of the experienced radiologists analyzed all the images of the repeated MRI scans. In each kidney, RCT and PT were measured in T1-weighted images at the anterior, lateral and posterior area in axial planes, and the upper pole, middle and lower pole in coronal planes, respectively  to exhibit adequate anatomic details. Then, they were automatically matched on ADC and FA maps for quantification. Diffusion tensor maps were imported to Neuro 3D workstation for analysis.Analysis of the maps for BOLD and DW imaging was performed. In each kidney, 6 circular regions of interest (ROIs) with a fixed 21-voxel diameter were manually placed in the upper, middle and lower poles of bilateral renal cortex and medulla for the measurement of R2*, ADC, and FA values . The results were expressed as the mean\u2009\u00b1\u2009standard deviation (SD). Paired t-test was used to compare the MRI parameters between the left and right kidney. One-way analysis of variance (ANOVA) followed by Student-Newman-Keuls (SNK) test was performed to compare different areas of RCT and PT in the kidney. The baseline characteristics and MRI parameters were compared between different sex and age groups using independent sample t-test; and the mean R2*, FA and ADC values were also compared between renal cortex and medulla with the same method. In addition, Pearson\u2019s correlation analysis was used to detect the correlation between these parameters and associated factors such as height, weight and BMI. To determine the between session and inter-observer variability of MRI measures, the intra-class correlation coefficients  and coefficient of variation  were assessed. A two-tailed p value of <0.05 was considered statistically significant in all analyses."}
+{"text": "Purpose: Diffusion weighted magnetic resonance imaging (DW-MRI) of the kidneys provides noninvasive information on renal function in healthy volunteers, and it is feasible in severely ill patients. It may provide information on the degree of kidney dysfunction.The purpose of this study is to evaluate apparent diffusion coefficient (ADC) values using DW-MRI in patients with obstructive uropathy and elevated serum creatinine levels.Methods: Fifty patients with high serum creatinine levels and diagnoses of chronic urinary obstruction detected by ultrasonography were included in this study.DW-MRIs were obtained from 50 patients with hydronephrotic kidneys and 26 healthy volunteers using a 1.5T whole-body MR scanner.Results: ADC measurements of renal parenchyma in hydronephrotic kidneys were significantly lower compared to normal kidneys (p < 001).Conclusion: The measurement of ADC values has potential value in the evaluation of the functional status of hydronephrotic kidneys. Urinary tract obstruction that causes hydronephrosis may lead to an increased pressure proximal to the obstruction, including the tubules and the renal interstitium, thus causing tubular dysfunction, a decrease in glomerular filtration rate (GFR) and increased serum creatinine levels. Early diagnosis and treatment of obstructive hydronephrosis is important to preserve renal function. Imaging studies have a key role in diagnosis and follow-up of the renal obstruction . DetaileThe purpose of this study is to evaluate the value of apparent diffusion coefficient (ADC) values from DW-MRI in patients with obstructive uropathy and elevated serum creatinine levels.The study protocol was approved by the local ethics committee, and informed consent was obtained from all volunteers and patients.Fifty patients  with increased serum creatinine levels (2 \u00b1 0.89) mg/dL and the diagnosis of chronic urinary obstruction due to urinary stone, tumour or fibrosis were included in this study. All patients had a history of obstructive uropathy longer than 6 weeks. The control group consisted of 26 healthy volunteers  who had no history of renal disease and had normal creatinine levels (0.7 \u00b1 0.12). All volunteers were referred for upper abdominal magnetic resonance imaging (MRI) for hepatic haemangioma. Serum creatinine values were obtained from all patients on the day of the MRI examination.b values of 100, 600 and 1000 s/mm2. Maximum 26\u201340 number of slices was obtained, examination time was 30 sec and direction of diffusion all. All images were obtained without breath holding.MRI examinations were performed on a 1.5T whole-body superconducting MR scanner  with high-speed gradients. A body coil was used for all sequences. Axial T2-weighted fat saturation spin-echo images  were obtained from each patient for demonstration of the excretory system. Diffusion weighted images  were obtained using single-shot spin-echo, echo-planar imaging (EPI) sequences with diffusion gradient b values . The ADC maps were calculated automatically with the MR-system, and ADC values were expressed in square millimetres per second (mm\u00b2/s).The DW-MRI data were transferred to a workstation . Monoexponential fitting of the diffusion decay curves were utilized. A circular region of interests (ROI) was placed at the corticomedullary junction for the measurement of ADC values in normal and obstructed kidneys. For each kidney, three ROIs were placed in the middle portion Fig. . For eact test was used for the comparison of parenchymal ADC values and the comparison of the values of normal kidneys and obstructed kidneys. A p value of less than .05 was considered a statistically significant.Statistical analyses were performed with the SPSS 12.0 software package program. The ADC values of the volunteers and patients were reported as the mean \u00b1 standard deviation. Independent samples DW-MRI studies were of diagnostic quality in all cases, and no cases were excluded from this study. Seven of the patients had bilateral hydronephrosis. DW-MRI of 57 hydronephrotic kidneys were obtained from 50 patients, and images of 52 presumably healthy kidneys were collected from 26 volunteers.b values, a significant decline in renal signals was observed in the normal and hydronephrotic kidneys. ADC maps were created from diffusion weighted echo-planar images and displayed in colour. The colour map was dependent on increasing b values and decreasing ADC values in both normal and hydronephrotic kidneys  \u00d7 10\u20133 and (2.09 \u00b1 0.19) \u00d7 10\u20133 mm2/s, respectively. The mean ADC values of obstructed kidneys with b100, b600 and b1000 values were (3.10 \u00b1 0.56) \u00d7 10\u20133, (2.45 \u00b1 0.55) \u00d7 10\u20133 and (1.87 \u00b1 0.26) \u00d7 10\u20133 mm2/s, respectively. Mean ADC values of hydronephrotic kidneys for b100, b600 and b1000 were significantly lower than normal kidneys (p < 0.001)  \u00d7 1001) Fig. .b values are applied, the ADC values predominately represent true diffusion. Low b values are influenced by both perfusion and diffusion [The DW-MR is a technique based on the principle of measuring diffusion activity, which is the Brownian motion of the spins in biologic tissues. This technique enables the quantitative measurement of the ADC values of lesions. ADC combines the effects of capillary perfusion and water diffusion in the extracellular extravascular space. Thus, DW-MR provides simultaneous information about perfusion and diffusion in any tissue. When only high iffusion . DW-MRI iffusion .\u20133 mm2/s. In a second study, the researchers [\u20133 mm2/s; for hydrated subjects the mean was 3.56 \u00b1 0.32 \u00d7 10\u20133 mm2/s. Fukuda et al [\u20133 and 1.50 \u00d7 10\u20133 mm2/s than the ADC values that we found in our study. A large range of ADC values in human kidneys was reported in the literature. In several studies, authors evaluated ADC values separately in the cortex and in the medulla. Cova et al [Several investigations have reported on ADC measurements in the human kidney. Muller et al  found a earchers  investigda et al  and Toyoda et al  reportedva et al  placed tva et al . The resva et al . In the Namimoto et al  found thUnilateral ureteral occlusion was performed by Muller et al  in pig kThoeney et al  evaluateMechanical obstruction of the urinary outflow rises the luminal pressure and with dilatation of the proximal collecting system. Rise in luminal pressure increases the interstitial pressure in the cortex and medulla and decreases renal blood flow and thus contributes to decrease in ADC values . In the With new developments, probably the role of functional MRI will increase in the management of patients with renal disease. These techniques include perfusion studies for assessment of the renal blood flow and measuring the renal function with blood-oxygen level-dependent imaging techniques or dynamic contrast-enhanced studies. Contrast-enhanced dynamic MRI can measure the time-dependent concentrations of Gd-DTPA in the cortex and the medulla that reflect renal function .Currently, the gold standard examinations are normally performed for measuring kidney perfusion and function, namely the radioisotopic methods which can provide reliable results with excellent reproducibility concerning glomerular filtration rate, effective renal plasma flow, renal perfusion and urine drainage. The main limitation of our study is, there is no gold standard correlation such as kidney radioisotope examination.DW-MRI is a non-invasive method that gives reproducible data reflecting renal function. The measurement of ADC values by DW-MRI has potential value in the evaluation of the functional status of hydronephrotic kidneys. The ADC values of renal parenchyma in obstructive uropathy are significantly lower than in normal kidneys. However, further investigations are needed to support these results and to evaluate the usefulness in clinical practice.The authors declare that they have no competing interests."}
+{"text": "The MSCs expressed CD90 and CD29, did not express CD45, CD34, CD11b and CD31 and could differentiate into osteogenic, chondrogenic and adipogenic lineages. Cells were labeled with either PKH-26 or GFP and transplanted systemically or locally to female SD rats, just after a standardized vaginal incision was made. Engraftment after local transplantation was less efficient at all-time points compared to systemic administration. In the systemically transplanted animal group, MSCs migrated to the injury site and were present in the healed vagina for at least 30 days. Both systemic and local MSCs transplantation promoted host angiogenesis. Systemically transplanted MSCs created new vascular-like structures by direct differentiation into endothelium. These findings pave the way to further studies of the potential role of MSCs transplantation in improving surgical outcome in women with PFD.The beneficial effect of mesenchymal stem cells (MSCs) on wound healing is mostly attributed to a trophic effect that promotes angiogenesis. Whether MSCs can contribute to the formation of new blood vessels by direct differentiation is still controversial. Pelvic floor dysfunction (PFD) is a group of disorders that negatively affect the quality of women\u2019s lives. Traditional vaginal surgical repair provides disappointing anatomical outcome. Stem cell transplantation may be used to supplement surgery and improve its outcome. Here we aimed to examine the engraftment, survival, differentiation and angiogenic effect of transplanted MSCs in a vaginal injury rat model. MSCs were obtained from the bone marrow of Sprague Drawley (SD) rats, expanded and characterized  Mesenchymal stem cells (MSCs) have been reported to possess a potential therapeutic effect in various human pathological conditions \u20133. They Proper healing of a damaged tissue relies on the creation of new blood vessels . The benThe neural crest is suggested as a potential origin of MSCs. Recent studies have shown that bone marrow MSCs exhibit phenotypes of neural crest cells ,22. AddiPelvic floor dysfunction (PFD) is a group of common disorders that adversely affect women\u2019s quality of life. These include pelvic organ prolapse (POP), stress urinary incontinence (SUI) and sexual dysfunction ,25. POP Stem cell transplantation may be used as a biological therapeutic method supplementing the surgical treatments. MSCs transplantation has been studied in other pelvic floor conditions, such as SUI. MSCs were transplanted to the sub-urethral tissue in different animal models of PFD \u201329, inclIn this study, we examined the engraftment, survival and differentiation of transplanted MSCs in the vaginal injury rat model.Sprague Dawley (SD) female rats were held at the SPF unit in Hadassah medical school with food and water ad libitum. All rats were 10 weeks old, with an average weight of 200gr, when operated.This study was approved by the Hebrew University Animal Care and Use Committee. 2, 37\u00b0 Celsius incubator [MSCs were isolated from the tibia and femur bones of 10 weeks old female SD rats. Bone marrow was flushed with DMEM. Cells were resuspended and went through a 70\u03bcm cell strainer  to remove bone debris and blood aggregates. Cells were then centrifuged at 4\u00b0 Celsius, 1200 rpm for 5 minutes. The supernatant was removed and cells were resuspended with DMEM containing 10% FBS, 1% pen- strep and 1% glutamine . Ten (10) ml cell suspension was seeded into 10 cm culture petri dish for a total of two dishes in a 5% COncubator . Medium Dissociation of the cells was done by trypsin- EDTA (Gibco). 100,000 cells were taken for the detection of each marker. Cells were briefly centrifuged and resuspended in 45 \u03bcl cold FACS buffer. The following conjugated antibodies were added for 30 minutes on ice: CD90.1-FITC and the isotype control: Mouse IgG2a- FITC, CD-29 with the hamster IgG\u03bb FITC isotype, CD-45-PE, CD11b/c- PE and CD34- PE, CD31- PE, all four with the isotype control REA (S)-PE, . Cells were then washed twice with FACS buffer and analyzed using FACS Calibur system (Becton Dickinson).4 cells/well were seeded in 24- well plate. Cells were incubated for 21 days, with medium replacement every 3 days. Evaluation of osteogenesis was done with 2% Alizarin red S (Sigma). For chondrogenic differentiation, 1x105 cells/well were seeded in 96-well U bottom culture plate. Spheroids were spontaneously formed within 24\u201348 hours and the medium was changed to MSCgo\u2122 chondrogenic XF medium. Evaluation of chondrogensis was done with Alcian blue.Cells were grown until passage 5\u20136 in MSCs medium. The cells were then transferred to specific medium conditions to induce differentiation into adipogenic, osteogenic and chondrogenic lineages. Evaluation of adipogenesis was done by Oil red O staining. For osteogenic differentiation, 6*106 293T cells were transfected using the TransIT-293 Transfection Reagent (Mirus) with a total of 20\u03bcg of plasmid DNA: 3.5\u03bcg of the envelope plasmid pMD.G harboring the gene encoding VSV-G, 6.5\u03bcg of the packaging plasmid pCMV\u0394R8.91, and 10\u03bcg of the transfer vector expressing eGFP. The medium was replaced 24 hours after transfection with the MSC medium. The medium, which contains the viral particles, was collected 48 and 72 hours after transfection and filtered through 0.45-\u03bcm filters . The efficacy of the transfection was evaluated by FACS analysis.Cells were labeled with either PKH-26 or with green florescent protein (GFP). For PKH-26 labeling, cells were dissociated by trypsin EDTA and then centrifuged, washed and incubated with PKH-26  accordin6 cells.Rats were anesthetized by a mixture of Ketamine and Dormitor (75 mg/kg BW and 0.5 mg/kg BW). A standardized posterior midline vaginal incision was performed. Rats were given Atipamezole (1mg/kg) at the end of the operation to reverse the anesthetic effects. MSCs were transplanted either systemically- intravenously (I.V.) to the tail vein, or locally, to the vaginal sub-epithelial fibro-muscular tissue at the injury site. Both groups were transplanted with 2*10The following groups were included in this study (n = five rats/ group):I.V. MSC, which were transplanted with MSCs systemically, following vaginal incision.Local MSC, which were transplanted with MSCs into the vaginal sub-epithelial fibro-muscular tissue, following vaginal incision.Sham rats, which received medium only, either systemically or locally following vaginal incision.No incision group, which were transplanted with MSCs systemically but no incision was made.Na\u00efve rats, which had no surgery and received no treatment.Rats were monitored on a daily basis after the incision. According to the protocol, in case of excessive bleeding, rats were excluded from the experiment. In each treatment group, rats were sacrificed at three days, seven days and thirty days post transplantation (n = 5 rats/ group/ at each time point).Rats were sacrificed with an overdose of CO2. The vagina was dissected and fixed with 4% PFA for one week. 6\u03bcm cuts were prepared and were taken for staining. The following primary antibodies were used: anti- GFP antibody ab6673 , anti- CD31 sc-376764 , anti laminin rb0821a , mouse anti human muscle actin , anti -von Willebrand factor (vWF) bs-10048R  and anti trimethyl-Histone H3 (Lys27) . Incubation with primary antibodies was for 24 hours in 4\u00b0 Celsius. It was followed by three washes with 1xPBS  and the appropriate secondary antibodies were added: donkey anti goat- 488, donkey anti mouse-594, donkey anti rabbit- 488 and donkey anti rabbit- 594 .Identification of blood vessels was done by immunostaining with the typical markers aSMA and CD31. In each group, one slide from the anterior, middle and posterior parts of the vagina, were taken for quantification (three slides were taken from each rat). In each slice, five different fields were arbitrary chosen for analysis. The average number of blood vessels in each field was calculated.P values of <0.05 were considered significant.All data (means \u00b1 standard errors of the means) were analyzed by multivariate analysis of variance, followed by post hoc tests. MSCs were characterized by their well-spread typical morphology after attachment to the culture dish , by theiMSCs could differentiate into the osteogenic , chondroA standardized vaginal incision was made in female SD rats. Cells were labeled either with PKH-26 or by infection with lentiviral vector constitutively expressing GFP. Both methods were highly efficient, as detected by fluorescence microscopy before transplantation. FACS analysis confirmed that 99% of infected cells expressed GFP (data not shown). Labelled MSCs were transplanted immediately after the injury either I.V. to the tail vein or locally, to the vaginal sub-epithelial fibro-muscular layer, at the injury site. Healing was analyzed and compared at sequential time points between the locally, I.V. transplanted and sham operated groups. Vaginal tissue was dissected at different time points post injury (n = five rats/ each time point) and the incision region, which was located opposite to the urethra, was analyzed in H&E stained cross sections. On day one post injury, disruption of the epithelial layer and the adjacent lamina propria was noted in all groups . On day On day three post injury, GFP- labeled cells homed to the injury site in the I.V treated group . GFP posin vivo.Analysis on day 7 after systemic transplantation, showed GFP and PKH-26 labeled cells distributed within the lamina propria at the injury site. Interestingly, some of the transplanted labeled cells were organized in capillary-like structures . To charin vivo and were capable to contribute to the formation of new blood vessels.Confocal imaging of the site of injury, 30 days after transplantation, confirmed that transplanted PKH-26+ cells  within cTo rule out the occurrence of fusion between transplanted MSCs and the host endothelial cells, slides were stained with anti-trimethyl histone H3 . This antibody reacts with the inactive X chromosome of females. Since the MSCs were derived from female rats, if fusion occurred, cells would be expected to have 2 inactivated x chromosomes ,46, maniTo confirm the validity of the system, we stained a karyotypically abnormal (93 XXXXY) induced human pluripotent stem cell (ihPSC) line. The line was formed as a result of fusion of two iPSC lines with 46XX and 47XXY karyotype. Staining with anti-trimethyl histone H3 revealed cells that clearly expressed two red foci .in vivo and all analyzed cells expressed one red focus. Transplanted GFP+ cells in the wall of a capillary-like structure  and MSCs. The distinction between them relies on the expression of a different set of markers by each cell type . The MSCin vivo into endothelial cells and promoting neovascularization, is still controversial [in vitro into endothelial cells [in vitro formed neo-vascular structures in vivo, in SCID mice [in vivo [in situ into endothelial cells.The vasculogenic properties of MSCs are of great interest in many pathological conditions, and whether MSCs are actually capable of differentiating oversial ,8,11,47.al cells ,49 in thal cells ,50. MSCsCID mice . Studies[in vivo ,53. In c[in vivo \u201356. Our The new capillary-like structures that included endothelial cells originating from MSCs differentiation constituted 22% of all blood vessels observed in the vagina. This rate remained stable between days 7 and 30 post-injury. This is in accordance with previous studies \u201359 that in vivo, could potentially result from fusion between transplanted MSCs and host endothelial cells [The endothelial phenotype of the transplanted cells al cells ,61. In oPotential therapeutic effect of MSCs transplantation in PFD was suggested on the basis of two mechanisms; paracrine and anti- inflammatory effect ,62 and din vivo in the vagina.In line with these studies, we observed poor survival of the MSCs following local transplantation to a vaginal injury site. Nevertheless, our study is the first to demonstrate vaginal engraftment and long- term survival of MSCs for at least 30 days, after systemic transplantation. MSCs were not found in other organs (lung and liver) at later time points following transplantation. Moreover, to our knowledge, this is the first study to show the differentiation of MSCs into endothelial cells Aging is one of the main contributing factors for PFD. Many of the patients suffering from PFD are middle aged or elderly. Studies have shown that aging has a detrimental effect on wound healing processes, partly due to reduced vascularity ,73. The These findings pave the way to further studies of the potential role of MSCs in improving surgical outcome in women with pelvic floor disorders.S1 Fig\u2122 for 21 days and then stained with Alizarin red S. The staining of mineralized bone matrix is shown in red. (F) Cells were grown with MSC go Chondrogenic XF\u2122 for 21 days. Cartilage containing aggrecans stained blue after incubation with alcian blue. (G) MSC were grown with MSC go Adipogenic XF\u2122 for 21 days and stained with Oil red-O. Intracellular lipid droplets are seen in E and not in (H), where cells were grown in the control medium. (I) Representative figures from FACS analysis for CD90, CD29, CD34, CD45 and CD11b/c are shown. The cells stained positive for CD90 and CD29 and negative for the typical hematopoietic markers CD34, CD45 and CD11b/c. Scale bar: A, B, D, E, G, and H = 200\u03bcm; C, F = 100 \u03bcm.(A) Cells were isolated from the bone marrow and plated in two petri dishes. (B) Few spindle like cells are starting to appear 48 hours after plating, marked with the black arrows. (C) A higher magnification of one attached cell 48 hours after plating. (D) Three weeks after plating, cells had a fibroblast-like appearance and reached 85\u201390% confluence. (E) Cells were grown with MSC go Osteogenic XF(PPT)Click here for additional data file."}
+{"text": "The discovery of heat shock proteins shaped our view of protein folding in the cell. Since their initial discovery, chaperone proteins were identified in all domains of life, demonstrating their vital and conserved functional roles in protein homeostasis. Chaperone proteins maintain proper protein folding in the cell by utilizing a variety of distinct, characteristic mechanisms to prevent aberrant intermolecular interactions, prevent protein aggregation, and lower entropic costs to allow for protein refolding. Continued study has found that chaperones may exhibit alternative functions, including maintaining protein folding during endoplasmic reticulum (ER) import and chaperone-mediated degradation, among others. Alternative chaperone functions are frequently controlled by post-translational modification, in which a given chaperone can switch between functions through covalent modification. This review will focus on the Hsp70 class chaperones and their Hsp40 co-chaperones, specifically highlighting the importance of post-translational control of chaperones. These modifications may serve as a target for therapeutic intervention in the treatment of diseases of protein misfolding and aggregation. All proteins consist of specific combinations of twenty different amino acids. Since the residues of amino acid side chains differ in size, charge, and polarity, each amino acid offers an incredible amount of biochemical diversity that defines the subsequent structure and function of each respective protein after translation and folding. While the amino acid sequence of a protein cannot be altered post-translationally, the chemistry of specific amino side chains can be altered through a collection of post-translational modifications (PTMs). Modifying the biochemical characteristics of a given protein through PTMs immediately results in the modified protein exhibiting an altered form, function, and dynamic, exponentially increasing proteomic diversity within the cell and allowing for the cell to respond efficiently to specific stimuli.PTMs occur in response to changing cellular environments and are catalyzed on specific residues of target proteins by a collection of specialized enzymes. Typically, these enzymes are part of a greater network of cell communication pathways to allow for the immediate response to altered cellular conditions. The ability to enact an immediate cellular response to dynamic environmental conditions is generally advantageous compared to the synthesis of proteins de novo, as the latter is associated with greater metabolic expense. Through PTMs, proteins can be synthesized in one form and subsequently modified and perform alternative functions upon stimuli. For example, glycogen phosphorylase is an enzyme that catalyzes the breakdown of glycogen to produce glucose. Glycogen phosphorylase activity can be attuned to the needs of the cell: if there is sufficient energy, the enzyme remains inactive; upon low energy signaling, cascades will lead to the phosphorylation of glycogen phosphorylase to activate glucose production . ModificSeveral types of PTMs, including phosphorylation, methylation, and acetylation, occur through the addition of small functional groups  to specific side chains within the target protein. Phosphorylation occurs at the terminal hydroxyl residues of serine, threonine, and tyrosine, and significantly alters the charge of the protein by adding a \u20132 charge to the modified residue ,4. LargeWhile it is known that a dynamic assembly of cellular proteins undergo PTMs, there is mounting evidence that chaperone proteins are also subject to such modification. In brief, chaperone proteins are ubiquitous, conserved enzymes that maintain proteostasis within the cell by mediating the protein structure in vivo via a variety of mechanisms, acting as a preventative measure against stress-induced protein misfolding and aggregation . The limL,1) that allows the allosteric coupling of the domains, which is indispensable for proper Hsp70 function [Hsp70 proteins are dynamic chaperones notable for their functional diversity, which includes both promiscuous association to either unfolded, misfolded, or aggregated substrates as well as selective binding to folded substrates ,10,11. Hfunction . The intfunction ,16,20. Hfunction ,15. Whilfunction ,22,23 Infunction . Reiterafunction . The regMembers of the Hsp70 chaperone family exhibit either constitutive gene expression or are stress inducible, hence their classification as heat shock proteins ,25,26. GSaccharomyces cerevisiae (yeast), there are at least fourteen Hsp70 isoforms that are categorized into five subclasses according to conservation of amino acid sequence identity [Organelle-associated Hsp70s are typically encoded by single genes in the majority of organisms, although cytosolic Hsp70 isoforms are encoded by a series of homologous genes . In Saccidentity ,30. Onlyidentity . In contidentity ,31.Ssa3 and Ssa4 genes are strictly stress-inducible, with Ssa3 being induced under starvation conditions and Ssa4 induced primarily by thermal stress [ssa1ssa2 double mutants exhibit slowed growth and thermosensitivity, suggesting that complete complementation among the Ssa genes is not possible, even with overexpression [The Ssa (stress-seventy A) Hsp70 subfamily consists of four members, Ssa1\u20134, which are highly homologous but differ in their expression patterns . Of the l stress ,32. Whill stress . Acknowlpression .Ssb1 and Ssb2, neither of which are inducible by heat shock [Like the Ssa Hsp70s, the Ssb subclass of Hsp70 chaperones also occupies the cytoplasm ,35. The at shock . The Ssbat shock ,34.ssb1ssb2 deletion mutants [While the Ssa and Ssb Hsp70 subfamilies share 60% amino acid identity and are both cytosolic in distribution, members of these subclasses are unable to functionally substitute for one another, even when Ssa1 is expressed from the Ssb1 promoter or vice versa . The fun mutants .This is not to argue that there is no functional distinction between cytosolic, endoplasmic reticulum, or mitochondrial Hsp70s, as such distinctions have been thoroughly documented ,39. RathMembers of the Hsp70 family act in concert with individual Hsp40 co-chaperones to facilitate a variety of cellular processes via a highly conserved, transient mechanism ,42. In bEscherichia coli DnaJ: the J-domain, a G/F-rich containing region or G/F-rich motif, a zinc-finger-like domain, and a C-terminal peptide binding fragment [Hsp40 family members exhibit distinct combinations of four conserved domains initially described in fragment ,46. Onlyfragment ,47,48. Ofragment .All Hsp40 family members contain a J-domain, a helical hairpin structure of 70\u201375 residues in length ,44,46. TFollowing the J-domain is the G/F-rich motif, a stretch of approximately 30 residues that are rich in the amino acids glycine and phenylalanine ,49. OnlyNotably, variations in domain composition among Hsp40 members are thought to be responsible for differences in substrate selectivity and functional diversity among both individual Hsp40 proteins and Hsp70/Hsp40 functional pairs ,41,51. FProteomic meta-analysis identified regions of Hsp70 that are enriched for phosphorylation. Many phosphorylation sites cluster at the N-terminal NBD  and at the C-terminal SBD  . AlanineHsp70 activity is required during times of growth due to rapid translation and protein accumulation. In this way, Hsp70 acts as a checkpoint for transitions in the cell cycle. Hsp70 acts to stabilize various cyclin proteins as the cell progresses though G1 to the S phase. In times of nutrient starvation, the kinase Pho85 phosphorylates Hsp70 at T38, which disrupts Hsp70 binding with the yeast Hsp40 co-chaperone, Ydj1. Loss of co-chaperone binding decreases chaperone activity and affinity for cyclin proteins. As a result, the cyclins are broken down, halting the cell cycle in G1 until nutrient conditions improve .Hsp70 can also act as a checkpoint during mitosis. Plk1 is a kinase that is activated upon oxidative stress and is known to phosphorylate Hsp70 at multiple locations . Hsp70 is normally localized to the cytoplasm but will co-localize with the centrosome upon Plk1 activation and phosphorylation. Upon its localization, Hsp70 will stabilize centrosomes and spindle microtubules, halting mitosis until the oxidative stress is alleviated . AdditioThe Hsp40 co-chaperone HOP/STI1 is also phosphorylated in response to the cell cycle. When Sti1 is incubated with the cell cycle kinase casein kinase 2 (CK2) in vitro, a phosphate group is added to Sti1 at S189. Additionally, Cdc2 kinase also phosphorylates Sti1 at T198. It remains unknown if phosphorylation alters Hsp70 or Hsp90 binding, although the phosphorylation of HOP alters its localization from the cytoplasm into the nucleus and acts as a recruiting agent specifically for Hsp90 .Hsp70 sits at a vital nexus to determine the fate of client proteins. Besides its refolding activity, Hsp70 can act as an agent for the ubiquitin-proteasome system and aid in tagging proteins for degradation. It is clear that phosphorylation (and acetylation) act as the molecular switches between these pathways .Since Hsp70 interacts with a host of co-chaperones that define its overall function, it is of no surprise that PTMs can alter this dynamic. Hsp70 is typically found as a monomer when present in the cytosol; however, it was recently demonstrated that mammalian Hsp70 can form a dimer in the cytoplasm. Phosphorylation on T504 promotes and stabilizes antiparallel homodimers of Hsp70 in a structure that is reminiscent of the Hsp70-Hsp90 client loading complex. Phosphorylation and subsequent dimerization stabilizes client proteins and increases time to client release . It is sThere are patterns emerging that suggest how Hsp70 favors refolding client proteins over degradation and how HOP/Sti1 binding shifts the balance towards client refolding. Multiple phosphorylation sites play a role in stabilizing the Hsp70/HOP interaction and, thus, influence client refolding. The extreme C-terminus of Hsp70 is phosphorylated by casein kinase 1, casein kinase 2, and GSK3-\u03b2, and in vitro analysis of these phosphorylation events promotes binding to HOP. Phosphorylation of T636 increases Hsp70 affinity for HOP but does not appear to influence affinity of other chaperones. T636 is commonly found in excess in cancer cells to promote protein stability and favor a more active cell cycle ,65. StabCHIP (C-terminus of Hsc70 interacting protein) is an E3 ubiquitin ligase responsible for recognizing target proteins that will be modified with ubiquitin and subsequently degraded by the proteasome. CHIP behaves similarly to other co-chaperones binding to the extreme C-terminus of Hsp70. Peptide binding analysis suggest that Hsp70 has high affinity for HOP, CHIP, and DnaJ, but when the C terminal peptide of Hsp70 is phosphorylated, HOP and DnaJ are unaffected, yet CHIP losses all affinity . C-termi\u2013/\u2013 cells prevented cell death by interacting directly with the caspase-independent mitochondrial intermembrane flavoprotein apoptosis inducing factor (AIF), preventing AIF-induced chromatin condensation [Beyond refolding or targeting client proteins for degradation, Hsp70 also influences apoptotic signaling pathways. In response to given environmental stressors, cells engage a variety of intracellular signaling pathways that promote either cell survival or initiate cell death . Cell deensation . Consideensation .Apoptotic signaling can originate from internal or external stressors that ultimately involves a cleavage cascade of caspase proteins . For exaRecent work has demonstrated that lysine acetylation also plays a role in modulating Hsp70 activity. We have already discussed the role of Hsp70 in apoptosis, but it is also involved in chaperone-mediated autophagy ,78. The Apoptotic and autophagic signaling are also controlled by Hsp70 acetylation at K77. Overexpression of Hsp70 leads to a decrease in apoptotic signaling and appears to have a protective effect from lysosome membrane permeabilization. This protective effect is eliminated by a K77R mutation, indicating that K77 needs to be acetylated to inhibit apoptotic signaling . It appeWhile lysine acetylation is more widely studied, Hsp70 is also acetylated at the N-terminus by the N-terminal acetyltransferase A complex (NatA). N-terminal acetylation is a constitutive modification that happens co-translationally to all copies of Hsp70, as opposed to modifications that occur during a specific cellular response. Cytoplasmic proteins are acetylated in a sequence-dependent manner, and there are a range of effects on target proteins, from influencing binding partners to preventing degradation ,88. TherMultiple reports of proteome-wide post-translational modifications offer insight to the extent of modification to which Hsp70 or its associated Hsp40s are subject. Hsp70 and Hsp40s were identified in multiple screens enriched for ubiquitinylation. These screens did not evaluate the physiological relevance of ubiquitinylation, nor did they describe the effect of these specific modifications. It remains to be determined if ubiquitnylation targets these chaperones for degradation or if it simply alters their subcellular localization. One report demonstrated how the co-chaperone Ydj1 delivers substrates to E3 ubiquitin ligases. The effect is not controlled by Ydj1 ubiquitinylation but presumably by interactions with Hsp70 ,91,92.A methylated form of Hsp70 was identified in human tissue culture cell lines. Jakobsson et al. identified a novel methyltransferase METTL21A, and they found that it interacts with Hsp70 isoforms in vivo. Additionally, METTL21A trimethylates K546 on Hsp70, and it is worthy to note that K546 is conserved in all Hsp70s, yet these organisms lack the modification or the requisite methyltransferase. Methylation at K546 does not alter the ATP hydrolysis rate, but it demonstrates a decreased binding to \u03b1-synuclein aggregates. The ability of methylated Hsp70 to prevent \u03b1-synuclein aggregate formation was also hindered .Prenylation is the addition of an isoprenyl functional group to a protein. Isoprenyl groups are hydrophobic and typically localize proteins to a particular membrane, similar to a gycosylphosphatidylinositol (GPI) anchor . FarnesyGlycation is a post-translational modification where glycolysis intermediates are added to free amines of a protein. Glycation of proteins has gained interest recently as rates of glycation are increased in diabetics with high circulating glucose levels, potentially contributing to disease progression or age-related decline of protein function . MethylgThe mechanism of Hsp70 activity is defined by the ability of the chaperone to undergo large conformational changes that dictate binding to co-chaperones and client proteins. It was shown that subtle changes in lid positioning, based on different client bindings, could lead to changes in activity. A range of structures demonstrate that the SBD helical lid changes position when binding to large versus small proteins, unstructured polypeptides, or even amyloid fibrils . The domHow can post-translational modification research on the Hsp70/Hsp40 system inform novel mechanisms to treat diseases of protein misfolding? We have discussed multiple examples of how PTMs can act as a molecular switch between pathways, alter binding between co-chaperones, alter binding to client proteins that can alter cellular signaling, and even increase affinity or rates of client refolding. If pharmaceutical interventions can be used to manipulate these events, it might be possible to influence overall chaperone function within a cell. Hsp90 plays a role in cancer and has been a target of potential mechanisms for chemotherapy, yet co-chaperones and PTMs alter the efficacy of these compounds . It is pCurrently, there are a host of pharmaceutical methods that are being investigated that may alter chaperone activity, with the intent on being developed for disease intervention. There are multiple compounds that bind to allosteric sites delaying the release of ADP from the nucleotide binding pocket, and this increases the amount of time a client protein interacts with Hsp70 . AdditioSimilarly, by influencing the interactions between Hsp70 and HOP or CHIP, the balance between refolding and degradation can be shifted. This strategy is utilized with a compound that promotes HOP binding to Hsp90, wherein if HOP is forced to interact with Hsp90, it cannot interact with Hsp70. This enables CHIP binding and targeting proteins for degradation, which has proven effective for alpha-synuclein aggregate clearance . Since P"}
+{"text": "Escherichia coli, and organised all RBPs in this organism into a comprehensive database named EcRBPome. It contains RBPs recorded from 614 complete E. coli proteomes available in the RefSeq database (as of October 2018). The database provides various features related to the E. coli RBPs, like their domain architectures, PDB structures, GO and EC annotations etc. It provides the assembly, bioproject and biosample details of each strain, as well as cross-strain comparison of occurrences of various RNA-binding domains (RBDs). The percentage of RBPs, the abundance of the various RBDs harboured by each strain have been graphically represented in this database and available alongside other files for user download. To the best of our knowledge, this is the first database of its kind and we hope that it will be of great use to the biological community.The repertoire of RNA-binding proteins (RBPs) in bacteria play a crucial role in their survival, and interactions with the host machinery, but there is little information, record or characterisation in bacterial genomes. As a first step towards this, we have chosen the bacterial model system The online version of this article (10.1186/s12864-019-5755-5) contains supplementary material, which is available to authorized users. RNA-binding proteins (RBPs) are important regulators of cellular function, being involved in processes at the transcriptional, post-transcriptional, translational, as well as post-translational levels. They mediate transport, stabilisation, metabolism and degradation of transcripts within the cell . Hence, H. sapiens, M. musculus, D. melanogaster and C. elegans, but not from E. coli. The ATtRACT database [The complete RBP repertoire of a few model organisms have now been identified by various research groups, including ours \u20135, but tdatabase , reportedatabase , 8 contahttp://caps.ncbs.res.in/ecrbpome), a comprehensive database of E. coli RBPs. The database documents RBPs identified in all complete E. coli proteomes  by computational sequence search algorithms and methods as described earlier [Here, we report EcRBPome  , all RBPs (with links to the RefSeq page and their downloadable FASTA sequences) and their domain architectures (DAs) [The users can browse through the list of all the es (DAs) . The pates (DAs) .The distribution of various RBDs and DAs (domain pairs) in pathogen-specific and nonpathogen-specific proteins have also been represented in various tables   Fig.\u00a0b, presenns) Fig.\u00a0c, as welns) Fig.\u00a0d. A pairEcRBPome provides annotations for each RBP by establishing links to other resources like, UniProt  .Additional file 2:Supplementary Video. Various features of the database have been presented in this file (MP4 11774 kb)E. coli proteomes (as of October 2018), and also links the data present in this database to other sequence, structure and function annotation resources. Hence, it is a \u2018one-stop solution\u2019 for all researchers who prefer to understand the global landscape of E. coli RBPs, as well as those who are interested in specific strains or proteins. It also predicts the function(s) and cognate RNA partner(s) for each of the RBPs present in this database, through our in-house algorithm, named RStrucFam. A total of 419 gene products, annotated as \u2018hypothetical protein\u2019 could be assigned to one of the RBP families , with a previously annotated primary function, have been predicted to retain RNA-binding property through our pipeline and mathematical models. For example, RStrucFam  and EcRBStructural alignment of 2B3JD and largest of the query protein structures, 2G6VA (with the best resolution) were performed using the structural alignment tool, Matt . The RNAas calculated using PDB2PQR [Electrostatic potential w PDB2PQR  , which might be of special interest to researchers working with the molecular biology of the E. coli model system. These moonlighting RBPs cannot be identified by pure sequence search-based methods, like BLAST, due to the lack of structural restraints in these searches.Interestingly, none of these residues are associated with the originally annotated bifunctional enzymatic activity. On the analysis of the NADP-bound structure of this protein (PDB code: 2O7P), it was seen that RibD uses a different site to bind the oxidised NADPE. coli model system. Homology-based inferences maybe further drawn from E. coli to assign RNA-binding properties to yet-unknown \u2018RBPs\u2019 in higher organisms, including humans.With the growing advent of next generation sequencing technologies, the gap between protein sequence data and their functional annotation is ever-increasing. Biochemical functional tests can assign a \u2018dominant\u2019 (primary) function to these proteins but fail to foresee the \u2018recessive\u2019 (secondary) function. Due to the immense importance of RBPs in molecular processes, it is important to identify all RBPs (with RNA-binding as a primary or secondary function), which might help the biological fraternity to address many unanswered questions. On these lines, EcRBPome will serve as a reference to all RBPs in the E. coli genome, requires painstaking efforts and huge amounts of time. Computational approaches offer the first glimpse of putative RBPs using mathematical models of known RBPs and searches in whole genomes.RBPs and sRNAs play important roles in bacterial post-transcriptional regulation of gene expression, and have been highly studied over the past decade , 23. TheE. coli. Sequences of RBPs reported in this database can also be used to select target gene products for detailed characterisation and to serve as start points for identifying sequence homologues in other microbial proteomes. Especially, the less studied species, where performing studies using experimental techniques are a challenge. For example, gene products of microorganisms that are highly pathogenic or the ones that are difficult to culture in the laboratory could be studied using this approach. The existing study will be further extended to the ever-growing number of complete E. coli proteomes and the EcRBPome will be updated with cross-references to a greater number of in-house, as well as external databases and softwares, to enrich the existing repository of information. RBPs can then be followed over taxonomic lineages to understand their patterns of conservation.EcRBPome is a comprehensive platform for information on all RBPs from a popular model organism, Additional file 1:Supplementary Methods. Further details of the genome-wide survey and cross-genome comparison methods have been presented in this file (DOCX 21 kb)Additional file 3:Table S1v List of hypothetical proteins from E. coli proteomes that were annotated as RNA binding proteins through detection of RNA binding domain (DOCX 49 kb)"}
+{"text": "Many cancer patients experience gastrointestinal adverse reaction during chemotherapy. Pharmacological interventions are commonly used to treat chemotherapy-induced gastrointestinal side effects but have various limitations. Clinical trials have indicated that moxibustion may alleviate gastrointestinal dysfunction and improve quality of life (QoL) after chemotherapy. This study aims to assess the efficacy and safety of moxibustion for chemotherapy-induced gastrointestinal adverse reaction through a systematic review and meta-analysis.All randomized controlled trials (RCTs) related to moxibution targeting chemotherapy-induced gastrointestinal adverse reaction will be searched in online databases, such as PubMed, EMBASE, the Cochrane Library, Web of Science, China National Knowledge Infrastructure (CNKI), the Chinese Scientific Journal Database (VIP Database) and WanFang Database from their inception to May 1, 2020. The primary outcome is the incidence and severity of chemotherapy-related gastrointestinal toxicities . The secondary outcomes include the quality of life, biological parameters\u2019 alteration, and adverse events. Study selection, data extraction, and assessment of risk of bias will be performed independently by 2 researchers. The Cochrane Collaboration's Review Manager (RevMan 5.3) software will be used to conduct the direct meta-analysis.This study will provide a comprehensive review of the available evidence for the treatment of chemotherapy-induced gastrointestinal adverse reaction with moxibustion.The conclusion of this study will provide evidence to judge whether moxibustion is an effective and safety therapeutic intervention for chemotherapy-induced gastrointestinal adverse reaction.CRD42020182990. Among these toxic side events, chemotherapy-induced gastrointestinal reactions, including CINV, CID and CIC, were the most widely influential and severe symptoms.Chemotherapy is recognized an effective way during the anti-cancer treatment, while it has greatly improved overall survival in variety types of cancers, also brings side effects, such as chemotherapy-induced nausea and vomiting (CINV),,5 may lead to extra adverse events. For instance, 5-HT3 receptor antagonists, the commonly used medications in treating CINV, are seemed to be associated with electrocardiogram alteration and increased risk of arrhythmia. Loperamide and octreotide, 2 mainly drugs during the treatment against CID, will lead to severe constipation, abdominal pain or dizziness.,10 The drugs used in treating CIC are frequently related to increased risk of electrolyte imbalance, serious dehydration, and laxative dependence. Given that the commonly used pharmacological interventions have obvious side effects, and also heavy financial burden, a complementary and alternative therapy is needed, which take minimum adverse reaction, less economic burden and effectiveness into account.Current managements against those chemotherapy-related gastrointestinal adverse reactions were mainly pharmacological approaches, the drugs mainly focus on diminishing the severity of symptoms, is performed by burning herbal preparations containing dry Artemisia vulgaris on or above the skin at acupoints, to obtain the therapeutic effects in clinical practice. Traditional moxibustion techniques involve either direct moxibustion with a moxa cone or a moxa stick, whereas indirect moxibustion, achieved by placing certain types of materials such as salt, ginger or garlic between the skin and a burning moxa at the acupoint. According to Chinese Medicine theory, disease is the result of the body's disharmony, and moxibustion aims to counterbalance the disharmony, by strengthening the host immunity, strengthening the body resistance and eliminating pathogens from the body. A systematic review revealed that moxibustion is effective in alleviating chemotherapy-induced side effects, and improving cancer patients\u2019 quality of life,\u201318 especially in treating gastrointestinal adverse events, such as CINV,,21 CID and CIC. Given that the underlying mechanism of chemotherapy-induced gastrointestinal adverse reaction remains unclear, previous studies suggested that it may correlated with multiple factors, including inflammation, secretory dysfunctions, dysmotility and innervation alterations in gastrointestinal. Previous studies have revealed that moxibustion is effective in alleviating inflammatory response, promoting immunity,\u201326 regulating the gut microbiota and the membrane.Moxibustion, as a noninvasive external method in traditional Chinese therapy,However, current systematic reviews or meta-analyses did not focus on the efficacy of different types of moxibustion on different types of gastrointestinal adverse events induced by chemotherapy. This study will summarize the current evidences and conduct meta-analysis to evaluate the effectiveness and safety of moxibustion for patients who received chemotherapy and developed gastrointestinal adverse reaction. Moreover, it will help to define which gastrointestinal adverse symptom that moxibustion more focus on, to further provide instructions for clinical doctors, medical students and researchers.22.1\u201330 The PROSPERO registration number is CRD42020182990.This protocol is reported in compliance with the preferred reporting items for systematic reviews and meta-analyses protocols (PRISMA-P) statement guidelines, and will be guided by the PRISMA guidelines and the recommendations of the Cochrane Handbook.2.22.2.1All the RCTs of moxibustion for the management of chemotherapy-induced gastrointestinal adverse reactions will be included. Owing to the language restriction of the researchers, we will limit the language of search literature to Chinese and English. Non-RCTs, quasi-randomized trials, reviews, case reports, secondary analysis, animal experiments, or trials without full texts were excluded.2.2.2We included participants diagnosed with cancer and suffered from gastrointestinal adverse reaction like nausea and vomiting, diarrhea and constipation after receiving chemotherapy. There will be no limits for age, gender, ethnic origin, and educational or economic status among patients. Patients with gastrointestinal adverse reaction caused by other reasons, will be excluded.2.2.3The intervention group should be treated by moxibustion, including direct moxibustion and indirect moxibustion. We excluded the trials that the intervention group is moxibustion combines with other conventional therapy or moxibustion is used as an adjuvant intervention, because it may difficult to evaluate the effectiveness of moxibustion alone. Basic chemotherapy treatment or supportive care should be identical in the intervention and control groups. Control group involving sham moxibustion, placebo, medication, no treatment will be included.2.2.42.2.4.1The primary outcomes will be defined as the incidence and severity of chemotherapy-related gastrointestinal toxicities  by using validated scales to determined.2.2.4.2The European organization for research and treatment of cancer quality of life questionnaire-C30 (EORTC QLQ-C30) was used to assess quality of life. Changes in biological parameters aimed at assessing side effects of chemotherapy . Adverse events will also be assessed.2.3Our systematic review will search all RCTs for moxibustion on chemotherapy-induced gastrointestinal adverse reaction, electronically and manually, regardless of publication status, till May 1, 2020. Online databases include PubMed, EMBASE, the Cochrane Library, Web of Science, China National Knowledge Infrastructure (CNKI), VIP Database and WanFang Database. Ongoing trials with unpublished data will be retrieved from the 4 following clinical trial registries: the Australian New Zealand Clinical Trials Registry (ANZCTR), the Clinical Trials.gov, World Health Organization (WHO) and the International Clinical Trials Registry Platform (ICTRP). The reference lists of the selected studies and published systematic reviews will be screened for additional studies. Manually search for the grey literature, including conference proceedings.2.4Two reviewers will independently search the studies in electronic databases according to the systematic review protocol. According to intervention, patients, and study type, the following search terms are used: moxibustion, chemotherapy, nausea and vomiting, CINV, emesis, diarrhea, CID, constipation, CIC, randomized, randomized controlled trial and so on. The search strategy will be adapted to different databases demands. Search strategy in PubMed is shown in Table 2.52.5.1During the literature screening process, search results will be imported into Endnote X9 software and the duplicated studies will be deleted. The preliminary study selection will be independently performed by 2 researchers, who will screen all retrieval researches, read the titles, abstracts and keywords to determine which studies meet the inclusion criteria. We will obtain the full texts of all relevant studies for further evaluation. Studies excluded after reading the full text will be recorded and explained. The selection results will be cross-checked by the two researchers. Any disagreement between two researchers will be discussed and decided by a third researcher. The primary selection process is shown in Figure 2.5.2The data will be extracted by 2 researchers independently using a predefined data extraction form. Data extracted from the included studies will cover the characteristics of study , participants , intervention dose , acupoints formula, comparisons, treatment outcomes, measurement tools, and adverse events. Disagreements will be resolved after discussed with a third researcher. For publications with insufficient or ambiguous data, we will attempt to obtain information from the corresponding author via e-mail or telephone.2.5.3Two researchers will independently evaluate the risk of bias using the Cochrane Collaboration's bias risk assessment tool. The following factors will be assessed: selection bias , performance bias , attrition bias (incomplete outcome data), reporting bias, and possible other sources of bias. Disagreements between 2 researchers over the risk of bias in particular studies will be resolved by discussed with a third researcher. We assessed publication bias by using funnel plots.2.5.4The results of the studies will be presented as risk ratio (RR) with 95% confidence interval (CI) for dichotomous data, whereas the continuous data will be presented as standardized mean difference (SMD) with 95% CI.2.5.5I2 statistic: when I2 is less than 50%, a fixed-effect model will be used for pooled data; otherwise, a random-effect model will be considered.The heterogeneity between studies were measured using the 2.5.6Funnel plots will be used to evaluate the publication biases if a sufficient number of included studies  are available.2.5.7I2\u200a<\u200a50% or I2\u200a>\u200a75%, I2\u200a<\u200a50% will be classified as having low heterogeneity, whereas those with I2\u200a>\u200a75% will be classified as having high heterogeneity. When I2\u200a>\u200a75%, we will then perform a subgroup analysis or a sensitivity analysis.The Cochrane Collaboration's Review Manager (RevMan 5.3) software will be used to conduct the direct meta-analysis. For dichotomous data, the RR with 95% CI was utilized for analysis. The fixed-effect model will be put into use if 2.5.8Subgroup analyses will be used if there is an adequate number of studies, according to the type of moxibustion therapy , the type of control group, the treatment duration, the clinical manifestation of chemotherapy-induced gastrointestinal adverse reaction like CINV, CID, and CIC.2.5.9Multiple sensitivity analysis will be performed when sufficient trials are available, to assess the robustness of the summary estimates and to detect if any particular study accounted for a large proportion of heterogeneity. These will be based on different statistical approach, heterogeneity quality and sample size. The meta-analysis will be reused, and more inferior quality studies will be excluded.2.5.10We will use the Grading of Recommendations Assessment, Development and Evaluation (GRADE) to evaluate the quality of evidence which is classified into 4 levels: very low, low, moderate, or high.3 To date, given that the underlying mechanisms of chemotherapy-induced gastrointestinal adverse effects remain unclear, the current pharmacological interventions mainly take strategies on relieving symptoms, while did not receive satisfied results. Non-pharmacological therapies have shown their advantages, moxibustion, is one of the useful and safety methods, and widely used in Asia countries. Studies have reported that moxibustion is an effective therapy, that could reduce the inflammatory expression, regulate gut microbiotic and the gastrointestinal motility, to improve the QoL of cancer patients undergoing chemotherapy, besides, moxibustion has fewer side effects and relatively lower cost.Gastrointestinal adverse reaction is one of the most common unavoidable harmful events during chemotherapy, may leading to treatment interruption and delay, even discontinuation among cancer patients.,32 Most studies discuss the combination effects of other interventions and moxibustion, the effectiveness of moxibustion alone on chemotherapy-induced gastrointestinal adverse reaction should be evaluated. Although the previous published systematic review focus on moxibustion therapy alone on treating CINV, it was only included studies from 2005 to 2016, the included trials should be proper and updated.However, most of the current studies mainly focused on acupuncture rather than moxibustion, the recent published studies in 2020 are prepared to evaluate the CINV with acupuncture, which did not mention moxibustion.Moxibustion has been identified to be effective in treating multiple types of chemotherapy-associated gastrointestinal adverse events, our study is aiming to critically evaluate all the RCTs of cancer patients receiving chemotherapy and displayed gastrointestinal adverse effects, and analyze moxibustion is inclined to treat which kind of gastrointestinal side symptoms. Besides, we will examine the effect and safety of different types of moxibustion on gastrointestinal adverse reaction, hoping to provide convincing evidence for clinicians when made decisions.Conceptualization: Han-Xiao ZhangData curation: Peng Lv, Chuan-Yi Zuo, Rui-Zhen HuangFormal analysis: Qian-Ning Mo, Yi-Feng BaiFunding acquistion: Cheng-Shun Zhang, Xiao-Qin DaiInvestigation: Xiao-Qin DaiMethodology: Han-Xiao Zhang, Chuan-Yi ZuoSoftware: Han-Xiao Zhang, Yi ZhouSupervision: Cheng-Shun ZhangWriting \u2013 original draft: Han-Xiao ZhangWriting \u2013 review & editing: Han-Xiao Zhang, Cheng-Shun Zhang, Xiao-Qin Dai"}
+{"text": "The numerical calculations based on the finite element method (FEM) were performed to validate the empirical results. The full characteristics of one-directional tension tests were taken into account in order for them to be constant or dependent on the temperature change. Numerical computations were conducted by employing Green\u2013Lagrange equations for large deflections and strains. Based on our own experiment, the thermal property of titanium as a linear expansion coefficient was stable up to 300 \u00b0C in contrast to its mechanical properties. The paper shows the influence of varying material properties as a function of temperature on the behaviour and load-carrying capacity of columns. These aspects cause thin-walled columns made of titanium to endure, in elevated temperatures, significantly smaller maximum loads. Moreover, the critical buckling loads for several types of stiff supports were compared to the maximum loads of columns. The results obtained indicate that the temperature rise in columns by 175 K with regard to ambient temperature brings about the decrease of the maximum load by a half.The analysis of structures under higher temperature is important for predicting the ultimate strength of a structure. Therefore, many experimental tests on samples should be undertaken to observe their behaviour and to determine ultimate load. The present work includes the study on a thin-walled C-column made of titanium compressed in an elevated temperature. The phenomenon of buckling and the post-buckling state of columns were investigated during heating or compressing in higher temperature. The tests of compression were conducted for several temperature increments by assuming the same preload to determine the load-carrying capacity. The deformations of columns until total damage were measured by using the non-contact Digital Image Correlation Aramis Titanium alloys are used in special structures and members given their high strength, high-temperature resistance and good corrosion resistance that are outlined in references ,2. Moreo\u00ae system (DICAS) [In general, referring to the aforementioned literature, one can find many papers where the mechanical material properties in higher temperature for simple samples were obtained. This was owing to the fact that the studies of the stability on thin-walled structures in higher temperature were considered in a few papers. Thus, the verification of behaviour of thin-walled structures in temperature field is still desirable. Therefore, the present paper refers to the analysis of the post-buckling state of thin-walled titanium columns under compression in elevated temperature. Moreover, as was noticed based on accessible literature, titanium structures just in similar conditions have not been investigated yet. In this work, the edges of columns were put into grooves of special plates to realize supports corresponding or comparable to articulated supports. The tests of compression on columns lasted until peaks of loads were reached to determine the curves of work and the load-carrying capacity of studied columns. In addition, the Digital Image Correlation Aramis (DICAS)  suitableA thin-walled C-profile column with dimensions of L = 250 mm, b = 80 mm, a = 40 mm and thickness t = 1 mm under compression in elevated temperature was investigated . The tesThe tests of compression were executed in thermal chamber  by means of an Instron machine-model 5982 . This madT) where grips of the machine remained unmoveable (this then caused the reaction forces to increase). The heating process of columns took usually about 2 h. The last step related to compression in elevated temperature to determine the post-buckling equilibrium paths and the peaks of loads (the load-carrying capacity). The experimental study was composed of three stages. The first stage involved a initial load of sample (circa 5\u201310% of maximum load). The second stage was based on the temperature increase by appropriate temperature increment . Of course, the assumed types of support  are pretty different from those realized in experiments because the articulated support of columns would be hard to elaborate. In the case of the determination of the critical temperature increments, the uniform temperature increase in the entire structure of the column was taken into account. The critical values were computed for the first five buckling loads. Based on FEM results, differences in critical forces in the case of thermal buckling are meaningful  relative to ambient temperature. Compression of columns for each considered temperature increment for two samples was performed (except for 175 K). The detailed tests were denoted: EXP_1_1 and EXP_1_2 for dT = 25 K, EXP_2_1 and EXP_2_2 for dT = 50 K, EXP_3_1 and EXP_3_2 for dT = 75 K, EXP_4_1 and EXP_4_2 for dT = 100 K, EXP_5_1 and EXP_5_2 for dT = 125 K, EXP_6_1 and EXP_6_2 for dT = 150 K, EXP_7_1 for dT = 175 K. By taking into consideration the maximum loads, some decrease of load-carrying capacity with an increase of temperature can be observed. The maximum mean load for DT = 25 K amounted to 19.1 kN (decrease by circa 6% with respect to load-carrying capacity in ambient temperature). The maximum mean load for other temperature increments dT = 50 K, dT = 75 K, dT = 100 K, dT = 125 K, dT = 150 K and dT = 175 K amounted to 17.3 kN, 16.3 kN, 15.1 kN, 13.6 kN, 10.9 kN and 10.2 kN, respectively. It can be clearly noted that the mechanical properties of titanium are quite strongly temperature-dependent even for small temperature increase. dT = 175 K  but already during heating (BC-2). Indeed, this value is very close to maximum load achieved in the experiment but in the case of the experiment the maximum load occurred during just compression (BC-3). In general, it should be emphasised that in contrary to the experiment, higher reaction forces were collected in the FEM. This subsection presents the results of the experiment and numerical approach. dT = 25 K and greater by 38.2% for dT = 150 K (for this variant difference is the biggest). The maximum loads for all variants are given in Based on curves for stable mechanical properties of columns (temperature-independent), the load-carrying capacities remain almost on this same level regardless of the temperature increase . In addition, it can be noticed that all these values are higher than the maximum load obtained during compression in ambient temperature. By taking into consideration the temperature-dependent mechanical properties, the attained characteristics approach the experimental curves  but in the case of FEM places of damage appeared always in the vicinity of one of the supports.Both mechanical properties and load-carrying capacity of titanium columns are very sensitive to temperature rise although the titanium is resistant moderately to high temperature. The increase of temperature increment by 175 K referring to ambient temperature causes the load peak during compression to decrease almost by a half. Moreover, as was observed, titanium columns under load in elevated temperatures became slightly mild which might bring additional local deformation diminishing the general load-carrying capacity of columns.The assumption of stable mechanical properties of titanium (temperature-independent) in numerical simulations does not allow proper load-carrying capacity to be achieved which can be compared to experiment. In the case of consideration of stable mechanical properties of titanium, obtained load peaks for higher temperatures are almost the same.Regarding buckling loads, considered boundary conditions S_3 and S_4 (Temp) gave the highest critical forces . The visible clues of appearing half-waves in columns during experiments were noticed to be also in a range of loads of 8\u201310 kN. Moreover, estimated critical loads were circa two times smaller than the load-carrying capacity of the column in ambient temperature.The maximum loads obtained numerically were pretty close to experimental ones although the discrepancies amount up to 40%, at most (for temperature increment 150 K). It can be explained that the analysed phenomenon of full behaviour of thin-walled columns in a thermal field seems to be very complex. Firstly, studied columns could be imperfect resulting from a tolerance of thicknesses, other dimensions and the whole shape. Secondly, mechanical properties of titanium are very dependent on temperature changes. Thirdly, the steel plates (upper and lower) with made channels (grooves) holding the columns possess a proper thermal expansions coefficient, which is slightly different from the thermal expansion coefficient of titanium. Therefore, during compression the conditions of supports could continuously change. Furthermore, in numerical simulations, some simplifications  were applied to solve the problem in an approximate way.The curve of force vs. shortening of the column for ambient temperature for numerical model is comparable in reference to experimental curves but in the case of numerical model, the obtained range of shortening in column was shorter. This could result from the fact that numerical model was assumed as perfect what brings locally to concentrations of maximum plastic stresses after the load peak. Therefore, the effect could cause a drop of load to follow violently.By comparing DICAS and FEM maps, the modes of deformation in all phases seem usually to be alike. Both greater discrepancies and completely different modes can be observed as well. It can be clarified that each column under compression in elevated temperature can deform in different way.dT = 25 K, dT = 50 K, dT = 125 K).The appearance of mechanisms (large deformations) of the columns during the last stage of complete damage occurred in the vicinity of that of support . In the case of some samples, failure of the columns occurred in the middle (This paper includes the result of the study of compressed thin-walled columns at elevated temperature. The experimental and numerical investigations were performed to examine the behaviour of titanium columns supported in grooves of plates. Based on the results, the main conclusions that can be drawn are:"}
+{"text": "Luteinizing hormone/choriogonadotropin receptor (LHCGR) regulates gonadal testosterone production and recent studies have suggested a growth-regulatory role in somatic cancers. Here, we established that LHCGR is expressed in a fraction of seminoma cells and germ cell neoplasia in situ (GCNIS), and the seminoma-derived cell line TCam2 released LHCGR into the medium. LH treatment induced proliferation of TCam2 cells in vitro, while hCG treatment induced a non-significant 51% increase in volume of tumors formed in a TCam2 xenograft model. A specific ELISA was used to detect a soluble LHCGR in serum. Serum concentrations of soluble LHCGR could not distinguish 4 patients with GCNIS and 216 patients with testicular germ cell tumors (TGCTs) from 297 infertile or 148 healthy young men. Instead, serum LHCGR levels were significantly higher in 112 patients with a seminoma >5 cm or elevated serum lactate dehydrogenase (LDH) compared with men harboring smaller seminomas <2 cm or normal LDH levels. Serum LHCGR levels in TGCT patients could not predict relapse irrespective whether determined pre- or post-orchiectomy. Combined, these novel findings suggest that LHCGR may be directly involved in the progression and growth of seminomas, and our retrospective pilot study suggests that serum LHCGR may have some prognostic value in men with seminoma.  Testicular germ cell tumors (TGCTs) represent one of the most common solid tumors in young men . TGCTs oA search for novel biomarkers for seminomas is particularly warranted because the existing clinical markers such as human chorionic gonadotropin (hCG) and/or \u03b1-fetoprotein (AFP) are used primarily as reliable biomarkers and proxy for the presence of non-seminomas . SeminomRT-PCR using a primer set targeting exon 11 coding the intracellular and transmembrane region resulted in one clear band that was sequenced and confirmed to be LHCGR. This transcript was present in normal testis with spermatogenesis (NT), seminoma (SEM), and the seminoma-derived cell line TCam2 but not in the embryonal carcinoma-derived cell line NTera2. The primer set targeting exons 2\u20134 coding the extracellular region presented with multiple bands and two of these bands (indicated by red arrows) were confirmed to be LHCGR by direct sequencing. These transcripts were present in NT, GCNIS, and seminoma samples A. qPCR sThe monoclonal antibody LHR029, used for WB, and the polyclonal antibody LHRsc both targeting the extracellular domain of the LHCGR  showed presence of LHCGR in normal testis, GCNIS and TGCTs. Interestingly, most GCNIS cells did not express LHCGR, however, staining with LHRsc revealed localization of LHCGR in the membrane of a subset of GCNIS cells . In accop = 0.004) and 48 h  following treatment with LH compared with vehicle  were stratified according to tumor histology and subsequently sub-grouped according to serum levels of routinely used tumor markers: hCG, LDH, and AFP. In 112 patients with seminoma, serum LHCGR levels were associated with tumor size; patients with large tumors above 5 cm in diameter had higher serum concentration of LHCGR than men with small tumors <2 cm (p = 0.04) (p = 0.009). No difference in serum LHCGR was found between patients with normal or elevated hCG levels (>3 IU/L) (p = 0.03) (p = 0.002) (p = 0.026) (p = 0.0097) and AFP (p = 0.025) at the time of diagnosis  and two patients with either seminoma or non-seminoma and high serum LHCGR levels measured by a specific ELISA platform. WB showed two bands at 50 and 75 kDa in the albumin and immunoglobulin depleted serum samples with all three antibodies, and thus of similar size as the bands detected in human testis A. The us = 0.04) A. LDH is>3 IU/L) B. The ri = 0.03) C, high L= 0.002) F, while = 0.002) D,E. In p= 0.002) G, but it= 0.026) H. Risk o= 0.026) I,J, but iagnosis K,L.The diagnostic value of serum LHCGR for detection of relapse was investigated in 23 patients with non-seminoma and 20 patients with seminoma followed longitudinally after orchiectomy. All included patients had stage 1 disease and were not treated with chemotherapy or any other adjuvant treatment. Blood samples were taken at the first control visit after orchiectomy and continuously at every visit during the follow-up period. Nine of 20 included patients with seminoma experienced a relapse and the average time from orchiectomy to relapse was 701 days (median: 384 days). Among the patients with non-seminoma, 11 out of 23 had a relapse and the mean time from orchiectomy to relapse was 253 days (median: 157 days). Serum LHCGR levels were not different between patients with and without relapse for both types of TGCTs at all the investigated timepoints A\u2013D. TherThis study provides novel evidence for a non-classical role of LHCGR in transformed germ cells. A prerequisite for functional relevance is presence of the receptor, which was verified by showing expression of LHCGR at mRNA and protein level in some GCNIS and seminoma specimens from TGCT patients. Previous studies have shown that LHCGR exists in various isoforms and some of them may even be secreted. The direct comparison of a primer set targeting exon 2\u20134 (the extracellular region) with a primer set targeting exon 11 (intracellular and transmembrane region) was performed to determine whether a truncated LHCGR isoform without the transmembrane/intracellular domain could be present. Presence of exon 2\u20134 and exon 11 in both seminoma and some GCNIS specimens suggests that LHCGR is available either as full-length or at least possesses the ability to signal intracellularly. The functional significance of all the LHCGR isoforms in seminoma remains to be established, but the presence of additional likely unspecific signals with the primer set targeting exon 2\u20134 highlights that caution is warranted during assessment of LHCGR expression. qPCR of a larger number of specimens corroborated the presence of LHCGR in seminoma and GCNIS specimens, while non-seminomas had low LHCGR or undetectable expression. The expression of LHCGR in GCNIS was higher with qPCR than observed with RT-PCR, which may be explained by cellularity due to a higher GCNIS abundance in the specimens and/or normalization to a housekeeping gene. The observed differences in gene expression levels between the samples were not evident at the protein level as few GCNIS cells in each specimen expressed LHCGR. LHCGR antibodies have a poor reputation and here we tested three different antibodies that all showed a similar band size of LHCGR around 50 kDa in normal testis, GCNIS, seminoma, and EC. Bands of similar size have been found in other studies investigating LHCGR in human tissues ,19. HoweTo investigate the effect of LHCGR in seminomas, the seminoma-derived TCam2 cells, which had a cytoplasmic/membranous expression of LHCGR, were exposed to LH treatment, which increased proliferation. This suggested a growth regulatory role, which only partly could be corroborated in vivo using treatments with LHCGR agonists. We used a TCam2 xenograft mouse model, which showed no effect of LH and a large variability in the hCG-induced tumor size. Nevertheless, the observed average 51% increase in tumor volume in the hCG treated mice compared with vehicle treatment could be of relevance despite of not reaching statistical significance. Especially since the tumor growth reducing effect of cisplatin treatment also did not reach statistical significance compared with vehicle treatment, which indicates that even clinically relevant effects may be underestimated. The selected doses of LH and hCG in the in vitro and in vivo studies were based on previous studies investigating these drugs in cancer cell lines ,21 and xDetection of LHCGR in the medium from TCam2 cells indicates that seminoma cells in patients also may release LHCGR. Presence of a factor in human serum, which can bind to LH and hCG has previously been shown  but soluHuman adult testis and TGCT samples were collected from patients undergoing orchiectomy. Samples were collected in accordance with the Helsinki declaration after approval from the local ethics committee (permit no. H-1-2012-007). Each sample was divided and either snap frozen and stored at \u221280 \u00b0C or fixed in formalin, Bouin\u2019s, or in modified Stieve\u2019s fixative at 4 \u00b0C overnight followed by paraffin embedding. Each of the samples were carefully evaluated by an experienced pathologist and specific markers were used to determine the subtype of TGCT. In addition, testis samples retrieved after orchiectomy from a patient with an activating mutation in LHCGR was also included . The inc2 and the medium was changed every second day. \u2018Normal testis\u2019 RNA was purchased from three different companies  and \u2018normal ovary\u2019 RNA was purchased from Abcam Plc, Cambridge, UK. RNA purification from tissues and cell lines, cDNA synthesis, and RT-PCR were performed as previously described [\u00ae Green QPCR Master Mix . PCR conditions were: 15 min at 95 \u00b0C followed by 40 cycles of 15 s at 95 \u00b0C, 1 min at 62 \u00b0C and a subsequent melting curve analysis. Changes in gene expression were quantified using the 2\u2212\u0394\u0394Ct method with RPS20 as internal control. The following primers were used: RPS2O , LHCGR exon 2\u20134: , and LHCGR exon 11 . A cell proliferation BrdU assay  was used to analyze proliferation according to the manufacture\u2019s protocol. Briefly, cells were incubated in the presence of the test substance in a 96-well microplate in a final volume of 100 \u00b5L/well for 6, 24, and 48 h. 4 h before the end of each treatment period, 10 \u00b5L of BrdU labeling solution was added to each well and the cells were re-incubated at 37 \u00b0C. After 4 h the labeling medium was removed, and the cells were fixed and their DNA was denatured by addition of 200 \u00b5L of FixDenat. Next, cells were incubated with a BrdU antibody for 90 min at RT. Cells were washed three times in PBS before addition of a substrate solution and light emission was measured using a scanning multi-well spectrophotometer at 370 nm with a reference wavelength of 492 nm. Treatments included: 1 IU/mL LH , 1 IU/mL hCG , and vehicle (H2O + 0.01% BSA).All cell experiments were carried out using the embryonal carcinoma-derived cell line NTera2  and the escribed . cDNA waTissues and cell pellets were homogenized in lysis buffer  and diluted in SDS loading buffer  followed by heating at 95 \u00b0C for 5 min. 10 \u00b5g of each protein sample was loaded onto a 4\u201320% precast polyacrylamide gel  and run for 1 h at 100 V to separate proteins. For detection of serum proteins, a Pierce Albumin/IgG Removal kit  was used to decrease the abundant albumin and IgG components before loading of the samples onto the gel. After gel electrophoresis proteins were transferred to a polyvinylidene difluoride (PVDF) membrane  using a wet blot apparatus. Membranes were blocked for 1 h in Tris Buffered Saline (TBS) containing 5% nonfat dry milk before incubation with primary antibodies at 4 \u00b0C overnight and with secondary antibodies at RT for 1 h, both diluted in TBS containing 1% nonfat dry milk and 0.1% Tween 20. Membranes were developed using enhanced chemiluminescence (ECL)  and a chemiDoc MP imaging system  was used for photodetection. Immunohistochemical staining was performed as previously described with small modifications . BrieflySerum samples were collected from 4 patients with GCNIS and 216 patients with TGCT prior to orchiectomy during their visit related to sperm freezing, and all samples were analyzed for LHCGR and routine tumor markers. Serum samples from 23 patients with non-seminoma (11/23 patients with relapse) and 20 patients with seminoma (9/20 patients with relapse) were obtained post orchiectomy and were only included if the men were followed longitudinally (minimum 3 samples/person) until relapse or the end of the 5 year follow-up period. Serum samples from 148 normal men, 297 infertile men, 5 men with Leydig cell tumor, and 4 men with infertility and Sertoli cell only pattern in testis biopsy were used for comparison. All men were included after approval from the regional ethical committee . Measurements of LHCGR in serum were performed using a LHCGR ELISA , Nijmegen, Netherlands and Origin Biomarkers, Hertfordshire, UK). The LHCGR ELISA has a limit of detection of 0.01 pmol/mL and an upper detection level of 15.55 pmol/mL and the validity of the assay has been described previously [3 in size , mice were randomized in different treatment groups  and test articles were administered. Mice were treated with three-times the usual adult dose 3 IE/kg LH 5 times weekly , 1000 IE/kg hCG three times weekly , 6 mg/kg Cisplatin once  or vehicle (PBS) three times weekly . The treatment groups with Cisplatin and vehicle were also used in a separate study to reduce the total number of animals [3, 12 mm diameter). After termination tumors, tissues and serum were isolated.All animal procedures were approved by the Danish Animal Experiments Inspectorate . 6\u20138 weeks old NMRI nude mice (Fox1nu) were obtained from Taconic Europe. Mice were housed and interventions were performed at Pipeline Biotech in a designated pathogen-free area. European standard cages type 2 were used, and mice were fed Altromin 1324 ad libitum . TCam2 and NTera2 cells were grown under standard conditions and plated in 175-cm2 flasks, and medium was changed every 48 h. Cells were injected subcutaneously into the right and left flank of male nude mice. Body weight was measured once a week and tumor volume three times a week from the time of inoculation until termination. Tumor volumes were calculated from two tumor diameter measurements using a Vernier caliper: tumor volume = L \u00d7 W \u00d7 1/2W. When the tumors reached about 150 mm animals . Mice wet-test or ANOVA analysis followed by Dunnett\u2019s test was used for comparison between groups, as appropriate. Human cohorts were analyzed with SPSS. p < 0.05 was considered statistically significant.Analysis of molecular data was performed using GraphPad Prism Software. Data are presented as mean \u00b1 SEM. Data from human cohorts were analyzed after stratification according to the histological subtype of the tumor and mean was calculated. Student\u2019s To sum up, this study shows that the expression of LHCGR in few GCNIS and a fraction of seminoma cells may be important for tumor growth if the stimulatory effects on proliferation of the TCam2 cells can be extrapolated into the clinical setting. The proposed direct stimulatory effect is supported by GCNIS and seminoma development in two patients with activating mutations in LHCGR, the release of LHCGR from seminoma cells, and the positive link between serum LHCGR and LDH and tumor burden in seminoma patients."}
+{"text": "Micro-RNAs (miRNAs) play a pivotal role in the development and physiology of the cardiovascular system while they have been associated with multiple cardiovascular diseases (CVDs). Several cardiac miRNAs are detectable in circulation  and are emerging as diagnostic and therapeutic biomarkers for CVDs. c-miRNAs exhibit numerous essential characteristics of biomarkers while they are extremely stable in circulation, their expression is tissue-/disease-specific, and they can be easily detected using sequence-specific amplification methods. These features of c-miRNAs are helpful in the development of non-invasive assays to monitor the progress of CVDs. Despite significant progress in the detection of c-miRNAs in serum and plasma, there are many contradictory publications on the alterations of cardiac c-miRNAs concentration in circulation. The aim of this review is to examine the pre-analytical and analytical factors affecting the quantification of c-miRNAs and provide general guidelines to increase the accuracy of the diagnostic tests in order to improve future research on cardiac c-miRNAs. Cardiovascular diseases (CVDs) are one of the leading causes of death in developed countries, highlighting the need to identify novel prognostic and diagnostic biomarkers for the prevention and treatment of such diseases ,2. HowevCell-secreted miRNAs facilitate the exchange of genetic information between cells and play an important role in cell-to-cell communication. They are also implicated in physiological processes such as the regulation of immunity and angiogenesis or cellular migration, while they are also involved in various pathological conditions . ImportaEven though several biological molecules, including cytokines, peptides, proteins, and metabolites are currently being evaluated as potential prognostic and diagnostic biomarkers for CVDs , c-miRNASeveral studies have highlighted the potential of c-miRNAs as biomarkers for the early diagnosis of CVDs while others have demonstrated their potential as tools for prognosis and treatment interventions of several CVDs . In pathIn this review, the pre-analytical and analytical challenges during the determination of c-miRNAs concentrations will be discussed. Initially, we will summarize the current knowledge regarding circulating miRNAs as potential biomarkers in CVDs. Subsequently, we will discuss the effect of pre-analytical and analytical variables on c-miRNAs expression levels and address some of the challenges and opportunities.CVDs include several diseases such as coronary artery disease (CAD), hypertension, hyperlipidemia, congestive heart failure (CHF), stroke, cardiac hypertrophy (CH) and arrhythmia . DiagnosMiRNAs  have been identified in cardiac tissue at all stages of development ,42 and pHowever, to date, there is no accurate, consistent and robust method for detecting and measuring c-miRNAs in serum/plasma samples as summarized in The most important pre-analytical, analytical, and other specific technical issues that should be addressed during the evaluation of miRNAs expression levels in blood samples including plasma and serum are discussed in the following paragraphs. As we discussed above, c-miRNAs could make excellent (i) biomarkers for prediction and prognosis, and (ii) therapeutic targets for CVDs, and despite their numerous advantages as biomarkers, there are still several issues to overcome before their clinical application. The most essential technical issues are the isolation and purification of samples since the integrity and purity of RNA are the basis of detection and quantification. Analysis of c-miRNAs for CVDs requires the careful consideration of the unique properties of body fluids that can make the reproducible and quantitative assessment of RNA challenge. For example, enzymes involved in the amplification and analysis of RNA can be affected by blood components that co-purify with miRNA. Thus, if miRNAs are to be effectively utilized as biomarkers, it is important to establish standardized protocols for blood collection and miRNA analysis to ensure accurate quantitation .A major challenge in c-miRNAs biomarker discovery and validation for several diseases, including CVDs, is the biological complexity of the mechanism of the disease pathogenesis. There are also many technical issues hindering this process, such as the lack of standardization in sampling, processing, and storage of samples. Variations in the amount of starting material and isolation method to obtain miRNA may introduce bias and contribute to quantification errors . The evaluation of miRNAs in circulation begins with the collection of blood samples from CVD- patients and/or from healthy individuals. As mentioned above, the selection of blood fraction  and handling/storage conditions have a great impact on the miRNAs profile and several factors during this early stage affect the quality of the results that are usually overlooked. The effects of both the selection of blood fraction and anticoagulant on the quality of the results are highlighted in the example of In the example given in Overall, based on the above example, it could be suggested that results from studies using different blood fractions and blood tubes should not be directly compared to each other and most importantly only miRNAs that are not marginally up- or down-regulated will be suitable as clinical biomarkers.The sample source is one of the most critical aspects of c-miRNA levels determination . The expPlasma is usually preferred over serum in studying c-miRNAs because, during the coagulation process, RNA molecules are released and may change the true profile of circulating miRNAs. However, plasma contains cellular components that may contribute miRNAs from apoptotic or lysed cells , as well as anticoagulants such as heparin that can inhibit downstream methodologies (discussed further below), and therefore serum is considered the best fraction for c-miRNA detection ,81.However, there is an inconsistency in the results published by different groups when comparing the levels of the same miRNAs  in plasma and serum from healthy volunteers . Wang etIt has been proposed that the c-miRNA concentrations differ in plasma and serum due to the RNA/miRNA \u201ctrafficking\u201d between cellular compartments and the extracellular environment  that is used for plasma isolation may also have an impact on miRNAs expression levels . For exaIn conclusion, expression levels of miRNAs that have been obtained from blood samples collected from different blood fractions or in the case of plasma from tubes containing different anticoagulants should not be included in the same study or directly compared to each other, to avoid conflicting results .Another important factor that is usually overlooked and may have an impact on the miRNA profile in both the serum and plasma samples is the centrifugation conditions such as the applied force, centrifugation time, temperature acceleration, etc. . In addiIn the example of Taken together, the results of the above examples suggest that the centrifugation conditions  that are applied to recover plasma or serum samples or to remove precipitates and other contaminants from samples prior to RNA extraction needs to be standardized as residual platelets, cell debris, etc., can alter miRNA levels . ImportaSeveral studies have demonstrated that hemolysis occurring during blood collection and processing has a substantial impact on the miRNA content in plasma/serum . HoweverHemolysis is usually estimated by measuring the absorbance of the plasma/serum samples at 414 nm which is the maximum absorption wavelength (\u03bbmax) of free hemoglobin . HoweverTogether, the above results suggest that the levels of other potential miRNAs biomarkers could be affected by hemolysis. Even though in vivo hemolysis cannot be avoided, in vitro hemolysis could be significantly reduced by following the guidelines of blood collection and handling that have been proposed by the Early Detection Research Network (ERDN) . InteresClinical studies aiming to identify c-miRNAs as biomarkers will probably compare retrospective archived serum/plasma with freshly collected samples. Subsequently, a standard operating procedure must be employed for the isolation, storage, and handling of such samples in uniform conditions . It is wSurprisingly, the thaw speed and temperature  also affect the c-miRNAs level. Farina et al.  reportedGlinge et al.  reportedA major issue during the design of retrospective studies is how to carefully handle precious, and often irreplaceable, patient samples. Many archived samples are stored in volumes larger than required for a single RNA isolation. In addition, future detection of other biomolecules, such as DNA and protein, may be desired from the same sample. Thus, it is recommended that each serum/plasma sample be divided into 1 mL aliquots and unused aliquots be re-frozen to \u221280 \u00b0C at the time of RNA isolation. Proceeding with RNA isolation from at least 1 mL of serum followed by storage of RNA in small aliquots at \u221280 \u00b0C for future analysis eliminates multiple freeze/thaw cycles and precious patient samples are optimally utilized. Importantly for prospective studies, freshly isolated serum should be stored at \u221280 \u00b0C, at least overnight, to allow direct comparison to archival samples . In addimiRNAs are relatively stable and can be reliably measured in tissues, as well as in biofluids . HoweverCaenorhabditis elegans) should be added at the beginning of the purification step (discussed further below) ) reported general guidelines when miRNAs in HF patients are measured and compared in the same sample sets of various laboratories to search for differences in technological approaches and data normalization ("}
+{"text": "COVID-19 vaccines will become available in China soon. Understanding communities\u2019 responses to the forthcoming COVID-19 vaccines is important. We applied the theory of planned behavior as the theoretical framework.This study investigates the prevalence of and factors associated with behavioral intention to receive self-financed or free COVID-19 vaccinations among Chinese factory workers who resumed work during the pandemic. We examined the effects of factors including sociodemographics, perceptions related to COVID-19 vaccination, exposure to information about COVID-19 vaccination through social media, and COVID-19 preventive measures implemented by individuals and factories.Participants were full-time employees 18 years or older who worked in factories in Shenzhen. Factory workers in Shenzhen are required to receive a physical examination annually. Eligible workers attending six physical examination sites were invited to complete a survey on September 1-7, 2020. Out of 2653 eligible factory workers, 2053 (77.4%) completed the online survey. Multivariate two-level logistic regression models and ordinal logistic regression models were fitted.The prevalence of behavioral intention to receive a COVID-19 vaccination was 66.6%  and 80.6% . After adjusting for significant background characteristics, positive attitudes toward COVID-19 vaccination , perceived support from significant others for getting a COVID-19 vaccination , and perceived behavioral control to get a COVID-19 vaccination  were positively associated with both dependent variables . Regarding social media influence, higher frequency of exposure to positive information related to COVID-19 vaccination was associated with a higher intention to receive a COVID-19 vaccination at market rate  or a free vaccination . Higher self-reported compliance with wearing a face mask in the workplace  and other public spaces , hand hygiene , and avoiding social gatherings  and crowded places  were also positively associated with both dependent variables. The number of COVID-19 preventive measures implemented by the factory was positively associated with the intention to receive a COVID-19 vaccination under both scenarios .Factory workers in China reported a high behavioral intention to receive a COVID-19 vaccination. The theory of planned behavior is a useful framework to guide the development of future campaigns promoting COVID-19 vaccination. The COVID-19 pandemic remains out of control worldwide. As of September 20, 2020, there were 30,675,675 confirmed cases and 954,417 deaths [Development of the COVID-19 vaccines is on the way. According to the World Health Organization, there are 34 and 142 candidate vaccines in clinical and preclinical evaluation, respectively, as of September 3, 2020; four Chinese candidate vaccines have entered phase III clinical trials . The ana0) was 2.5 and vaccination occurred when 5% of the population had been exposed to SARS-CoV-2, a vaccine efficacy of 80% with 75% coverage could reduce the total number of SARS-CoV-2 cases by 85% without any other measures such as social distancing [The effectiveness of pandemic vaccination campaigns is dependent on both the vaccines\u2019 effectiveness and people\u2019s willingness to be vaccinated. Simulation experiments have shown that, when the reproduction number , presence of comorbid conditions, and trust in government. Moreover, perceptions related to COVID-19  and COVID-19 vaccination  influenced their intention to receive a COVID-19 vaccination -24. We cAcross countries, it is common to encounter vaccination-related information on social media . PreviouTo the best of our knowledge, there have been no studies investigating behavioral intention to receive a COVID-19 vaccination and associated factors among factory workers who resumed work during the COVID-19 pandemic. To address these gaps, this study investigated behavioral intention to receive a self-financed or free COVID-19 vaccination among a sample of factory workers in Shenzhen, China. We examined the effects of factors including sociodemographics, perceptions related to COVID-19 vaccination based on the TPB, exposure to COVID-19 specific information through different media, and COVID-19 preventive measures implemented by individuals and factories.We conducted a cross-sectional closed online survey of 2053 factory workers in Shenzhen, China on September 1-7, 2020. Of the 13 million residents in Shenzhen in 2018, 65.1% were internal migrants and 34.3% were factory workers .This study was conducted in the Longhua district of Shenzhen. In Shenzhen, the majority of the factories are located in Longhua. As of 2018, there are over 2000 factories and about one million factory workers in Longhua. Participants were full-time employees of factories in Shenzhen that were 18 years or older. In Shenzhen, factory workers are required to receive a physical examination at designated hospitals or the Centre for Disease Control and Prevention (CDC) annually. All five designated hospitals (three public and two private) and the one district CDC providing physical examination services to factory workers in Longhua were our study sites for recruitment. To avoid selection bias, the fieldworkers approached all adults attending these sites for physical examination during the study period. They briefed prospective participants about the study details, confirmed their eligibility, and invited them to join the study. Participants were guaranteed that participation was voluntary, refusal would have no effect on them, the survey would not collect personal contacts or identification, and data would be kept strictly confidential and only be used for research purposes. Verbal consent was obtained instead of written consent to allow participants to maintain anonymity. We developed an online questionnaire using Questionnaire Star, a commonly used online survey platform in China. Quick Response (QR) codes were generated to access the online questionnaire. Prospective participants were asked to scan the QR code on site to complete the survey. Each mobile device was only allowed to access the online questionnaire once to avoid duplicate responses. The participants were asked not to disseminate the QR codes to access the survey to other people. The survey had 66 items (about 15 items per page for four pages), which took about 15 minutes to complete. The Questionnaire Star performed completeness checks before the questionnaire was submitted. Participants were able to review and change their responses through a \u201cBack\u201d button. An e-coupon of \u00a510 (US $1.54) was sent to participants upon completion. In case participants did not have internet access or a smartphone, the research team prepared a tablet computer in each study site for them to complete the online survey. All data was stored in the online server of Questionnaire Star and protected by a password. Only the corresponding author had access to the database. Ethics approval was obtained from the Longhua District CDC (reference: 2020001).A panel consisting of one CDC staff, two public health researchers, a health psychologist, a senior factory manager, and a factory worker was formed to develop the questionnaire used in this study. The questionnaire was pilot-tested among 10 factory workers to assess clarity and readability. These 10 workers did not participate in the actual survey. Based on the workers\u2019 comments, the panel revised and finalized the questionnaire.Participants were asked to report on sociodemographics such as age, gender, relationship status, whether they had a child, highest education level, monthly personal income, status as frontline workers or management, and type of factory they were working in. In addition, participants were also asked about history of seasonal influenza vaccination and whether they had a family member with a history of COVID-19.Participants were briefed with the following: \u201cCOVID-19 vaccines developed by China are likely to become available by the end of 2020.\u201d We assessed behavioral intention to receive COVID-19 vaccination under four scenarios: (1) conditional on 50% vaccine efficacy and market rate (\u00a51000 or US $154), (2) conditional on 80% vaccine efficacy and market rate, (3) conditional on 50% vaccine efficacy and free vaccines, and (4) conditional on 80% vaccine efficacy and free vaccines. On June 2020, the US Food and Drug Administration released guidance for development and licensure of vaccines to prevent COVID-19, which stated that the primary efficacy end point estimate for a placebo-controlled efficacy trial for a COVID-19 vaccine should be at least 50% to ensure that a widely deployed vaccine is effective . Based oThe response categories were 1 (very unlikely), 2 (unlikely), 3 , 4 (likely), and 5 (very likely). Behavioral intention was defined as \u201clikely\u201d or \u201cvery likely.\u201d This definition has been commonly used in previous studies -53. In tCOVID-19 vaccination is highly effective in protecting you from COVID-19), (2) the four-item Negative Attitude Scale , and (3) the two-item Perceived Subjective Norm Scale . The Cronbach \u03b1 of these scales ranged from .67 to .85; single factors were identified by exploratory factor analysis, explaining for 50.7%-54.0% of total variance. In addition, perceived behavioral control to receive a COVID-19 vaccination was measured by a single item .Three scales were constructed to assess perceptions related to COVID-19 vaccination based on the TPB. They were (1) the five-item Positive Attitude Scale  in the past month . Such information included positive information related to COVID-19 vaccination , negative information related to COVID-19 vaccination , testimonials given by participants of the COVID-19 clinical trials, and negative information about vaccine incidents in China .Participants were asked to report frequency of wearing face masks when having close contact with others in a workplace and other public settings (public spaces or transportation) in the past month . Participants also reported frequency of sanitizing hands using soaps, liquid soaps, or alcohol-based hand rubs after returning from public spaces or touching public installations or equipment and whether they avoided social or meal gatherings with people who they do not live with and crowded places in the past month. The Shenzhen government advocated that eight preventive measures should be implemented in the factories, including (1) prohibiting nonemployees from entering workplaces, (2) taking body temperature and sanitizing hands for all employees before entering the workplace, (3) providing face masks to all employees, (4) keeping adequate distance  between workstations, (5) requiring employees to wear face masks when they have close contact with other people, (6) disinfecting the workplace frequently, (7) maintaining adequate ventilation in the workplace, and (8) setting up partitions in factory canteens ,55. PartThe target sample size was 2000. Given a statistical power of 0.80 and an alpha value of .05, and assuming the level of behavioral intention to receive a COVID-19 vaccination in the reference group (without a facilitating condition) to be 30%-70%, the sample size could detect a smallest odds ratio (OR) of 1.29 between those with and without such facilitating condition .P<.05 in univariate analysis were adjusted in the multivariate two-level logistic regression model.The binary variables on behavioral intention to receive a COVID-19 vaccination conditional on 80% vaccine efficacy and market rate and conditional on same efficacy and free vaccines were used as the dependent variables. Multilevel logistic regression models  were used to analyze factors associated with the dependent variables. Random intercept models were used to allow the intercept of the regression model to vary across study sites, which could account for intracorrelated nested data. Multilevel logistic regression models are commonly used in studies with similar sampling methods ,56. A unr) were obtained. SPSS version 26.0 (IBM Corp) was used for data analysis, with P<.05 considered statistically significant.In addition, using behavioral intention to receive a COVID-19 vaccination conditional on 80% vaccine efficacy and market rate and conditional on same efficacy and free vaccines were used as ordinal dependent variables (from 1 to 5), and background characteristics were used as independent variables; ORs were obtained using ordinal logistic regressions. Adjustment for significant background characteristics, associations between independent variables of interest  and the dependent variables were then assessed by adjusted odds ratios (AORs). A similar approach was used in previous studies . PrincipOut of 2653 eligible factory workers (between 60 and 1200 across study sites) that were approached, 2053 completed the online survey (between 40 and 968 across study sites). The overall response rate was 77.4% (ranging from 66.7% to 80.7% at different sites). Main reasons for nonresponse were lack of time and other logistic reasons. All participants that were approached had access to the internet or a smartphone, and none of them used the tablet computers prepared by the research team. Over half of the participants were younger than 40 years , were female , were married , had children , did not receive tertiary education , had a monthly income less than \u00a55000 , were frontline workers , and were working for electronic device manufacturers . Among the participants, 20.3% (n=416) had received a seasonal influenza vaccination at least once, and 1.6% (n=32) had at least one family member with a history of COVID-19 .The prevalence of behavioral intention to receive a COVID-19 vaccination was 53.5% , 66.6% , 75.6% , and 80.6%  and 81.6% (n=1675) of participants reported wearing a face mask every time they had close contact with other people in the workplace and in other public settings, respectively. More than half of the participants self-reported sanitizing hands , avoiding social or meal gatherings , and avoiding crowded places , perceived support from significant others on COVID-19 vaccination uptake , and perceived behavioral control to get a COVID-19 vaccination  were positively associated with both dependent variables . Regarding social media influence, higher frequency of exposure to positive information related to a COVID-19 vaccination was associated with higher intention to receive a COVID-19 vaccination at market rate  or to receive a free vaccination . Higher self-reported compliance with wearing a face mask in the workplace  and other public spaces , hand hygiene , and avoiding social and meal gatherings  and crowded places  were also positively associated with one or both dependent variables . A higher number of COVID-19 preventive measures implemented by the factory were significantly associated with a higher intention to receive COVID-19 vaccination under both scenarios  and used as dependent variables, the same sets of associated factors were identified by univariate and multivariate ordinal logistic regression models. The results are presented in r=0.083; P<.001), perceived subjective norm , and perceived behavioral control  related to a COVID-19 vaccination. A negative correlation was found between social media exposure and negative attitudes toward a COVID-19 vaccination . Moreover, frequency of exposure to positive information related to COVID-19 vaccinations on social media was negatively correlated with positive attitudes , perceived subjective norm , and perceived behavioral control  related to a COVID-19 vaccination. Furthermore, frequency of exposure to testimonials given by COVID-19 vaccine clinical trial participants on social media was negatively correlated with positive attitudes  but was positively correlated with perceived behavioral control to get a COVID-19 vaccination . In addition, frequency of exposure to negative information about other vaccines in China on social media was negatively correlated with positive attitudes  and perceived subjective norm  related to a COVID-19 vaccination  when comparing behavioral intention conditional on 50% vaccine efficacy and those conditional on 80% vaccine efficacy. The prevalence of behavioral intention conditional on free vaccination was higher than that reported in the United States  and SaudOur findings provide empirical insights to inform health promotion development. Similar strategies can be used to promote COVID-19 vaccinations at market rate or free vaccinations, as the associated factors of these two dependent variables were similar. Older participants had a lower intention to receive a COVID-19 vaccination. This finding is consistent with a previous study targeting the general population in the United States . YoungerThe TPB is a potentially useful framework to guide the development of future programs, as three of the four TPB constructs used in this study were significantly associated with both dependent variables in expected directions. It would be useful to increase positive attitudes toward COVID-19 vaccination, as this was found to be a facilitator. In addition to the beneficial effect for oneself , health communication messages should also emphasize that COVID-19 vaccination uptake would result in herd immunization, which could contribute to COVID-19 control. Building up confidence related to the vaccine supply may also be a useful strategy. Over 60% of participants perceived that medical professionals, family, and friends would support them in taking the COVID-19 vaccination. This perception was also a facilitator. Future programs should consider involving the significant others of factory workers to create a subjective norm favoring COVID-19 vaccination uptake. It would also be useful to enhance perceived behavioral control, as this was another facilitator. There is more room for improvement. Outreach in the factories and providing vaccination on-site may be a useful strategy to improve perceived behavioral control among the workers. Relatively few participants had concerns related to cost, side effects, and duration of vaccine protection. The associations between these concerns and behavioral intention were not statistically significant. Addressing these concerns might not be a useful strategy in future promotion campaigns.Our findings suggest that COVID-19 vaccination triggered intensive responses on social media, as about 60% of the participants sometimes or always were exposed to information specific to COVID-19 vaccination on different social media platforms. Our results showed that exposure to positive information related to COVID-19 vaccination through social media was positively correlated with positive perceptions  related to COVID-19 vaccination. These positive perceptions were determinants of behavioral intention to get a COVID-19 vaccination in this study. It is possible that higher amounts of positive information exposure on social media would enhance these positive perceptions, which in turn increases behavioral intention to get a COVID-19 vaccination. Longitudinal studies are needed to test whether this pathway exists. Negative information about vaccines is uniquely attractive to social media. Studies have shown that a major vaccine incident (Changchun Changsheng) had significantly impaired the confidence of vaccines among Chinese people . HoweverFactory workers who reported higher compliance to personal preventive measures were more willing to receive a COVID-19 vaccination. These people may have stronger motivation and self-efficacy to protect themselves, and a COVID-19 vaccination is likely to be considered as a useful means for protection. Preventive measures implemented by the factories also played important roles. More measures implemented by the factories was associated with a higher intention to receive a COVID-19 vaccination. Through implementation of these measures, factories could cultivate widely shared organizational norms to facilitate behavioral changes among the workers ,62.This study has some limitations. First, a direct measure of perceived behavioral control should assess self-efficacy and perceived controllability . PreviouIn summary, factory workers in China reported a high behavioral intention to receive a COVID-19 vaccination. The behavioral intention was cost-sensitive, and the proposed market rate was accepted by the majority of the participants. The TPB is a useful framework to guide the development of future campaigns promoting COVID-19 vaccination in this group."}
+{"text": "The participants were recruited in a cross-sectional study, which included answering an online questionnaire. Data were collected from 10 September through 23 November 2020. Respondents answered questions asking whether they intended to be vaccinated and provided the main reason for their answers. To estimate associations between vaccination hesitancy and independent variables, we fit Poisson regression models with robust variance. (3) Results: One thousand and two responses were obtained, of which only 731 were validated. One hundred and sixty-four participants stated that they would not be vaccinated (22.43%), of which 20\u201324% were non-health workers or unemployed, 17.5% physicians, 31.5% other health workers, and almost 35% nurses. Concerns about lack of effectiveness of the vaccination, lack of safety when vaccinating and possibly dangerous adverse effects were the main causes provided. (4) Conclusions: This study indicates that more interventions are needed to achieve better communication with the population and health professionals. Receptiveness to the message of the importance and security of the COVID-19 vaccination could be an important strategy for improving these results.(1) Background: This study aims to delineate a pattern on vaccine hesitancy in a sample of the Spanish population, considering age groups and status as healthcare workers. (2) Methods: Participants were recruited using Twitter Vaccination has played a fundamental role in global public health, leading to increased life expectancy  while reThe rejection of vaccination has led the World Health Organization (WHO) to be concerned about vaccine hesitancy and named it as one of the 10 main global threats in 2019 . HoweverNotably, the people most reluctant to be vaccinated are those from low social classes , which iIn the US, 49% of the survey participants were receptive to vaccination , 31% werAfter reviewing these data, a question arises: why does this level of uncertainty exist for the future COVID-19 vaccine? A probable set of factors influence the population , such as fear of its safety , fear ofMany of the anti-vaccination supporters use social networks to easily and quickly spread their messages and ideologies. On Twitter, a medium and communication platform , influenMany research studies about COVID-19 vaccine hesitancy have been conducted in Europe, the USA and Asia, but not in Spain. It is crucial to determine the population\u2019s attitude towards a COVID-19 vaccination as to manage the COVID-19 pandemic, the vaccine hesitancy factors of the population must be identified. We need more than 70% of people vaccinated in a community to achieve herd immunity ,23, whicTo devise appropriate policies and preparations for the COVID-19 vaccination, we must first identify the negative perceptions from the population in order to counter them. The wrong policy could create more rejection than affinity. For example, in many countries the possibility of mandatory vaccination has been approached; however, it seems to be inadequate in individual societies due to the increase in anti-vaccine sentiment ,12. TherTo identify the possible factors related to COVID-19 vaccination hesitancy, we have considered Thomson\u2019s \u201c5A\u201d to describe vaccine adoption: access, affordability, awareness, acceptance and activation . ConsideA self-report design was used in which participants answered an internet-based survey delivered by Twitter that included demographic questions, profession identification, vaccination intention and attitudes towards the COVID-19 vaccination.To obtain a more geographically diverse sample of the Spanish population, we decided social networks were an adequate source to disseminate our survey because there were more than three million social media posts from January to mid-March 2020 related to COVID-19 vaccination . TwitterSome tests are described to measure vaccination attitudes, such as the Vaccination Attitudes Examination (VAX) Scale . HoweverAge groups were established between 18 and 35 years (Group 1), between 36 and 55 years (Group 2), between 56 and 75 years (Group 3), finally those older than 75 years (Group 4).Data were collected from 10 September 2020 until 23 November 2020. There were 1002 answers collected from the survey; two hundred and fourteen of them were excluded because they were answered from a country other than Spain . Nine responses were excluded because they were completed by participants under the age of 18.Firstly, we described the sample to establish the main characteristics of the participants. Then, we estimated the prevalence of participants who reported that they would not be vaccinated for the whole sample and for each independent variable. Finally, in order to determine whether there was an association between the intention to be vaccinated and each of the independent variables, we estimated Poisson regression models with robust variance, with their corresponding 95% confidence intervals (95%CI) . All staThe total number of participants from Spain was 731 . The average age was 50.58 years (between the ages of 21 and 85). Thirty-seven of those surveyed were 49 years old (higher number of participants). The groups with the most respondents were Group 2 with 335 participants (45.82%) and Group 3 with 293 participants (40.08%). In other words, the largest number of participants was between 36 and 75 years old.Five hundred and sixty-seven participants or 77.56% of those surveyed were in favour of being vaccinated. Although there were no statistically significant differences, the prevalence of vaccination acceptance was slightly higher in older age groups .One hundred and sixty-four participants or 22.43% of those surveyed stated that they would not be vaccinated. The reasons provided for not being vaccinated were diverse, among them: a lack of effectiveness of the vaccination, a lack of safety when vaccinating or possibly dangerous adverse effects; beliefs that vaccines in general are harmful and/or that COVID-19 does not exist; already had COVID-19 and belief in having immunity; beliefs that these vaccines are not safe because of the speed at which they were generated; having a chronic disease for which the vaccine is not recommended; a lack of evidence about COVID-19 vaccines; and beliefs that these vaccines may contain nanorobots that will track people and control their thinking .In the analysis, we did not find any correlation on the intention to be vaccinated or not with sex, age, or profession. Only one association with profession was observed .n = 293) of the participant physicians responded that they would be vaccinated against COVID-19. Meanwhile, almost 65% (n = 48) of participating nurses responded that they would like to be vaccinated, meaning that 1 out of 3 nurses do not want to be vaccinated, the main reason being the insecurity of the vaccine.Knowing the number of physicians and nurses who are willing to be vaccinated is also important. Our results show that almost 81% (n = 55.2%) would prefer to wait to know the effects of a secondary vaccination against COVID-19 [This is the first study to investigate the impact of the COVID-19 vaccine hesitancy in Spain. Our results show that 77.56% (567 participants) of those surveyed were in favour of being vaccinated, well above what televised surveys have reported, which state that more than half of Spaniards  of participating nurses responded that they would not be vaccinated versus 17.5% (n = 58) of doctors, stating the main reasons as the insecurity of the vaccine and the fear of the vaccine\u2019s side effects. Most nurses are not vaccination immunology skilled, and they would share the same concerns as the untrained population . This is not a new concern; in previous campaigns before COVID-19 the same problem occurred with influenza vaccination [Vaccination hesitancy is not only a problem for the general population but also among healthcare workers . The rolcination .The large number of participants between 56- and 75-years old means that social networks can be used to communicate not only to young adults and/or adolescents but also to older adults . On the Social networks can be a tool for physicians that could be used to improve patient-physician interactions, enhance patient motivation, drive awareness, provide accurate information, raise timely issues, facilitate the exchange of ideas, frame and reframe health-related questions, engage a larger community, and ultimately produce improved outcomes across health systems . HoweverThe news media plays an important role in resolving doubts about vaccination. Catalan-Matamoros and Elias noted in their study the possible political burden on the media and the failure to review journalists\u2019 sources who rely on sensationalist media .The results could provide a basis for establishing communication strategies with the Spanish population, but studies with a larger number of participants are needed, perhaps only focused on the causes that could discourage the population from vaccination, to prepare for possible doubts in the population when the COVID-19 vaccine arrives. Our findings should be interpreted in light of several limitations. Firstly, attitudes towards COVID-19 vaccination may change over time . It is also worth noting the characteristics of the period in which our study was conducted, which may have influenced the results. When the survey was carried out, there was a state of emergency across Spain, which had been reimposed by the government. There was also a nationwide curfew to counter a resurgence of the coronavirus, and no vaccination deployment date had yet been established. Secondly, as a survey-based study, all data was self-reported by participants, and this may have been a source of response bias. However, since the survey was anonymous and participants completed it online without having to interact with any interviewer, this ensured that responses were more honest and accurate. Lastly, the survey we used was a new, non-validated survey tool for determining vaccination intention and attitude towards COVID-19 vaccination. However, we believe that the survey questions we posed were pragmatic in nature and that the responses accurately reflected the sentiment of all groups.To maximize the acceptance of the COVID-19 vaccine (when available), it is imperative to recognize the main anti-vaccination beliefs found in our study and other investigations. When the reasons why people do not want to be vaccinated  are better understood, communication and education strategies can be established, including the use of social networks, to resolve main doubts to achieve a higher vaccination rate and ultimately, the desired herd effect.To achieve more effective communication, two-way models should be used, which would allow the message to be better perceived by the target group to whom the communication is directed. In other words, the message to be transmitted should be oriented to the needs of the listener. The use of andragogy would be an important advantage."}
+{"text": "COVID-19 has caused a devastating impact on public health and made the development of the COVID-19 vaccination a top priority. Herd immunity through vaccination requires a sufficient number of the population to be vaccinated. Research on factors that promote intention to receive the COVID-19 vaccination is warranted. Based on Diffusion of Innovations Theory, this study examines the association between the perceived efficacy of the COVID-19 vaccination, use of social media for COVID-19 vaccine-related information, openness to experience and descriptive norm with the intention to receive the COVID-19 vaccination, and the moderating role of openness to experience among 6922 university students in mainland China. The intention to receive the free and self-paid COVID-19 vaccination is 78.9% and 60.2%, respectively. Results from path analyses show that perceived efficacy of the COVID-19 vaccination, use of social media for COVID-19 vaccine-related information, and openness to experience and descriptive norm are all positively associated with the intention to receive COVID-19 free and self-paid vaccination. The association between the perceived efficacy of the COVID-19 vaccination and descriptive norm with the intention to receive the COVID-19 vaccination is stronger among those with a lower level of openness to experience. Our findings support the usefulness of Diffusion of Innovations Theory and the moderating role of openness of experience in explaining intention to receive the COVID-19 vaccination. The emergence of coronavirus SARS-CoV-2  strain and its devastating impacts on global health and economy have made it a top priority to develop effective and safe vaccines for this disease , some ofThe public availability of vaccination is crucial, since herd immunity can be achieved through large-scale vaccination programs , therebyThe reasons behind the decision to receive vaccinations varied. Studies investigating factors associated with uptake of vaccinations, such as influenza vaccinations, have demonstrated that vaccination uptake was influenced by a range of personal and interpersonal factors ,8. CurreIt is no doubt that the COVID-19 vaccination is an innovative behavior; a framework that can explain the uptake of the novel vaccine is, therefore, essential. Most of the behavioral theories used to explain COVID-19 vaccination acceptance so far failed to explain how an innovative behavior will be adopted in the early phase and gradually become diffused as a common practice. The DOI is one of the most popular theories for understanding the adoption of innovative behavior ,21, desiAttributes of the innovation refer to several perceived qualities, such as relative advantage, compatibility, complexity, trialability, and observability of the innovation. Among which, the relative advantage is the most relevant construct to explain the intention to adopt the COVID-19 vaccination. In the COVID-19 pandemic, the key concerns about the COVID-19 vaccination were mainly about safety, efficacy, and need for new vaccines ,25. HighCommunication channels refer to the medium through which people obtain information about the innovation and perceive its usefulness. In recent decades, social media has been increasingly used as a platform for searching health information . During Characteristics of the adopter refer to the level of innovativeness and openness of the individual. According to the DOI, innovators and early adopters of innovation have been repeatedly shown to be more adventurous, open to change, and attracted to new ideas and practices . In partThe social system refers to the structure of the social system that might affect the individual\u2019s attitudes towards innovation. The perception of which the behavior will be performed by the majority of the population within the social system, known as the descriptive norm, has been found to be an important factor that explains the uptake of innovation . The socIn DOI, the inclination of adopting an innovative behavior is considered as a direct factor, as well as a moderator, which shapes the attitude, and the norms that impact behavior . It is cBased on the DOI, the present study examined the association between the perceived efficacy of the COVID-19 vaccination, use of social media for COVID-19 vaccine-related information, OE, and descriptive norm with the intention to receive the COVID-19 vaccination among Chinese university students. The moderating role of OE on the association between the perceived efficacy of the COVID-19 vaccination, use of social media for COVID-19 vaccine-related information, and descriptive norm with the intention to receive the COVID-19 vaccination was also examined.A cross-sectional online survey was conducted during 1\u201328 November 2020 among university students in China.Target participants were university students. Inclusion criteria were: (a) Full-time student of the selected universities, and (b) able to read and write Chinese.Participants were recruited from five universities from five provinces  of mainland China. The five provinces were geographically and socioeconomically representative of mainland China to some extent  and \u201clucky money\u201d of 1 RMB to around half of the participants for each university. Ethical approval was obtained from the ethics committee of the corresponding author\u2019s affiliated university. A total of 6940 completed responses were collected (response rate = 72.3%). After excluding 18 participants who have already received the COVID-19 vaccination by the time of the survey, the final sample size was 6922.Perceived efficacy of the COVID-19 vaccination was measured by a single item: To what extent do you think the COVID-19 vaccine will be effective in preventing COVID-19 infection? Participants were asked to input a number that represented the percentage of the efficacy of the vaccination.Social media use for COVID-19 vaccine-related information was measured by a single item: \u201cIn the past month, how long have you been exposed to information about the COVID-19 vaccine  through social media on an average week?\u201d Items are rated on a 5-point Scale: 0 = almost none, 2 = less than 30 min, 3 = 30 min to 1 h, 4 = 1 to 2 h, 5 = 2 h or more.Descriptive norm was measured by a single item: \u201cIn the first 6 months since the official launch of COVID-19 vaccine in China, how many percentage of the people whom you closely contact with  will be vaccinated?\u201d Participants were asked to input a number that presented the percentage of the people who will be vaccinated.OE was measured by the OE subscale of the Ten-Item Personality Inventory (TIPI), a valid brief measure of the Big Five personality with satisfactory psychometric properties . Items wIntention to receive the COVID-19 vaccination. Participants were asked to rate their likelihood of receiving the COVID-19 vaccination under the following conditions if the vaccine was launched in China: (1) The vaccine was recommended by the government and offered free; (2) the vaccine was recommended by the government and was self-paid. The items were rated on a 5-point Scale from 1 = definitely no to 5 = definitely yes.Background characteristics, such as age, gender, ethnicity, discipline of study, and year of study, were recruited.p < 0.05 level were also adjusted for in the path analyses. The following indexes were used to evaluate the model fit: Comparative fit index (CFI), Incremental Fit Index (IFI), and Root Mean Square Error of Approximation (RMSEA). Analyses were conducted using AMOS 26.0.Descriptive statistics and correlation between variables were first presented. There are two dependent variables in the present study: Intention to receive the COVID-19 vaccination (free) and intention to receive the COVID-19 vaccination (self-paid). The association between the perceived efficacy of the COVID-19 vaccination, use of social media for COVID-19 vaccine-related information, OE, and descriptive norm with the two dependent variables were tested using path analysis. To test the moderating role of OE on the association between the other three independent variables and the two outcomes, OE and the other three independent variables were first standardized, and interaction terms between OE and each of the three independent variables were created. A series of path analyses were conducted, with each of the independent variables, OE, and their respective interaction terms and the two dependent variables being entered in the model. All background variables there were significant at the Around two-thirds of the sample (63.6%) were female, and their mean age was 19.4 years (SD = 1.51). The majority of them were Han ethnicity. About half of them (50.9%) studied in medicine-related discipline, and 43.2% of them were freshmen. The intention to receive the free and self-paid COVID-19 vaccination was 78.9% and 60.2%, respectively .r = 0.03, p< 0.05) and intention to receive the COVID-19 vaccination (self-paid) . Ethnicity (reference group: Han) had a negative correlation , while discipline of study (reference group: Medicine) had a positive correlation  with the intention to receive vaccination (free). Age  and year of study  had a negative correlation with the intention to receive vaccination (self-paid).r = 0.05 to 0.23, p < 0.001) and intention to receive the COVID-19 vaccination (self-paid) .Among the DOI variables, perceived efficacy of the COVID-19 vaccination, social media use for COVID-19 vaccine-related information, OE, and descriptive norm all had a significant positive correlation with the intention to receive the COVID-19 vaccination (free) (2 (33) = 455.25, CFI = 0.97, IFI = 0.97, RMSEA = 0.03. Perceived efficacy of the COVID-19 vaccination, OE, and descriptive norm had positive association with the intention to receive the COVID-19 vaccination (free)  and intention to receive the COVID-19 vaccination (self-paid) . Social media use for COVID-19 vaccine information had significant association with the intention to receive the COVID-19 vaccination (free) , but no association with the intention to receive the COVID-19 vaccination (self-paid)  .2 (28) = 308.10, CFI = 0.98, IFI = 0.98, RMSEA = 0.04. OE, perceived efficacy, and the interaction term of OE and perceived efficacy of the COVID-19 vaccination all had significant association with the intention to receive the COVID-19 vaccination (free)  and intention to receive the COVID-19 vaccination (self-paid)   . Furtherctively) .The association between background variables and intention to receive the COVID-19 vaccination (free and self-paid) were omitted for clarity.Moderation effect of OE on the association between social media use for COVID-19 vaccine information and intention to receive the COVID-19 vaccination.2 (28) = 305.10, CFI = 0.97, IFI = 0.97, RMSEA = 0.04. OE and social media use for COVID-19 vaccine information had significant association with the intention to receive the tCOVID-19 vaccination (free)  and intention to receive the COVID-19 vaccination (self-paid) . However, the interaction term of OE and social media was not significant (data not tabulated).Findings of the path analysis showed that the model had a satisfactory fit, \u03c72 (28) = 405.8, CFI = 0.97, IFI = 0.97, RMSEA = 0.04. OE, descriptive norm, and the interaction term of OE and descriptive norm all had significant association with the intention to receive the COVID-19 vaccination (free)  and intention to receive the COVID-19 vaccination (self-paid)   . Furtherctively) .The association between background variables and intention to receive the COVID-19 vaccination (free and self-paid) were omitted for clarity.Vaccination is one of the most powerful public health interventions and an important means for preventing communicable infectious diseases. To maintain herd immunity, it is important to understand the factors that underlie public acceptability and adoption of novel vaccines. Previous studies have demonstrated the usefulness of DOI in understanding the adoption of innovative health behaviors. Using DOI as the theoretical framework, the present study examined the role of perceived efficacy of the COVID-19 vaccination , use of social media for COVID-19 vaccine-related information , OE (characteristics of the adopters) and descriptive norm  on the intention to receive free and self-paid the COVID-19 vaccination among university students in China. Consistent with the extant literature that identified perceived benefits as critical factors affecting vaccination decisions ,13,14,46In an era when individuals are exposed to loads of information about the benefits and potential risk of vaccination over the Internet and social media, it is important to understand the degree to which exposure to social media for COVID-19 vaccine-related information will influence one\u2019s beliefs and willingness to accept the COVID-19 vaccination. The present study revealed that using social media for COVID-19 vaccine-related information was associated with a higher intention to receive the vaccination. Our findings are in line with the literature that demonstrates the crucial role of social media in promoting healthly behavior ,48. SociThe present study also reported a positive association between descriptive norm and intention to receive the COVID-19 vaccination. Our findings provide the support that individuals\u2019 perception of what other people will do is a powerful predictor of innovative behavior . Since COE has been linked to the adoption of a range of innovation behaviors and positive health behaviors in the literature ,37,38,39With the rapid development of potential vaccines for COVID-19, there is an urgent need to understand the factors that predict COVID-19 vaccination intention, as such factors may guide the design of interventions to prepare for its public availability and maximize public acceptance . The DOIThe widespread use of social media has made it a ready platform for health promotion. The positive association between social media exposure to COVID-19 vaccine-related intention and willingness to receive vaccination has proven the promise to encourage the public to receive the COVID-19 vaccination through disseminating information about the COVID-19 vaccine on social media. Health care professionals should recognize the potential of social media for reaching a large group of audience and empowering them in their health care decision. It would be essential to take advantage of social media to publish professional advice and scientific knowledge about the COVID-19 vaccination. Message design should account for user characteristics, information preferences, mode of social media, and at the same time, ensure the information accuracy to improve communication effectiveness.The significant role of descriptive norm evidenced in the present study suggests that more efforts should be placed on the influence of the social system when promoting the COVID-19 vaccination. There has been evidence that manipulating descriptive norms can effectively change a health behavior ,54. For Finally, findings also suggest that OE plays an important role in the diffusion process. Individuals who are open to new experiences are more likely to receive the COVID-19 vaccination, and their decision to be vaccinated is less likely to be affected by perceived norms and the attribute of the vaccination. Intervention that seeks to launch the new idea of the COVID-19 vaccine in the community should recruit individuals who are high in OE as they can serve as a gatekeeper and role model to introduce the new idea into their social system, and help to speed up the diffusion process. On the other hand, findings also reveal that individuals who are less open to new experiences tend to be more responsive to the descriptive norm and perceived efficacy of the vaccine in forming their vaccination intention. Interventions that promote the COVID-19 vaccination among people who are lower in OE should highlight the scientific evidence of the benefits of the vaccination, and the norm and subjective evaluation of the innovation by other community members.There are several limitations of the study. First, the study was cross-sectional in nature, so no causality between the variables can be assumed. Data was only obtained from five provinces, and our sample contained a relatively larger number of freshmen and students from the medical discipline, so it might not be representative of the university student population in mainland China. Participants were self-selected and self-reported measures were used; therefore, the intention to receive the COVID-19 vaccination and beliefs about the vaccine might have been over-estimated. Due to issues regarding the length of the questionnaire, a single item was used for most of the variables. The validity of such measures, therefore, should be cautioned. The present study included only university studies, who are young and more educated, and may be more likely to adopt an innovation . Future studies should include those with lower socioeconomic status, such as older populations, those living in rural areas, or individuals with a lower level of education and test the applicability of DOI in these populations. Furthermore, the present study was conducted among the Chinese population, who tends to be collectivistic and shows a higher tendency to respect the authorities and follow the social norms. Future studies should explore if the factors understudied could be applied to an individualistic culture. Lastly, future studies may also benefit from comparing participants\u2019 intentions to receive COVID-19 vaccinations to the adoption of other innovations that have a less distinct effect on quality of life. Such comparison would provide more insights on the role of DOI in the adoption of innovations under different contexts.The present study concluded that factors under the DOI, namely, perceived efficacy of the COVID-19 vaccination, social media use for COVID-19 vaccine-related information, OE, and descriptive norm, were all significant factors in influencing intention to receive the COVID-19 vaccination. The association between the perceptions of COVID-19 was also found to be stronger among those with a lower level of OE. Our findings underscore the importance of promoting the efficacy and norms of vaccination, and engaging people who are open to experience in the early diffusion process. Such health education effects can also take advantage of social media to promulgate the effects."}
+{"text": "Such results are obtained by the linear and nonlinear modulation of the intensities of the diffraction peaks as a result of multi-wave-mixing-induced modification of spatially modulated coherence in a closed four-level atomic system. Novelty of the results lies in predicting the diffraction pattern with uniform peak height due to the dominance of the amplitude part of the grating-transfer-function at the condition of exact atom-field resonance, which is unique to the present model. Efficacy of the present scheme is to apply it in producing nonlinear light generated by four-wave-mixing-induced control of spatially modulated coherence effect. The work also finds its importance for its applicability in the field of all-optical devices.We propose an atomic model in close-loop configuration, which exhibits controllable  In the case of Electromagnetically Induced Diffraction (EID), any aperture, or obstacle responsible for diffracting light beam can be built directly or indirectly by one or more external electromagnetic fields1. The formation of a grating as a result of the way of applying the external fields interacting resonantly with an atomic medium gives rise to the concept of electromagnetically induced grating (EIG). In contrast to the four-wave-mixing (FWM) induced grating3, the features of spatially modulated absorption and transparency of a laser beam passing through a coherently prepared atomic medium are explored to demonstrate EIG8 both theoretically and experimentally at far-field regime, where z being the distance of probing the output between the grating and the image plane, D, the lateral dimension of the aperture and With the advancement of laser based science and technology, it has been possible to construct new optical device like Electromagnetically Induced Grating (EIG)9, double-EIT (DEIT)10, Electromagnetically Induced Absorption (EIA)11, laser-controlled Decay Interference Induced Coherence (DIIC)12 may lead to obtain spatiallymodulatedatomiccoherence under the standing-wavefield configuration. Owing to such coherence effects, a number of works26 have presented EIG in various atomic models. More specifically, EIG in terms of spatially modulated EIT or DEIT has been analyzed in Refs.25 and EIG based on EIA has been explained in Ref.17. Impact of the DIIC effect on the spatially modulated coherence is reported in Refs.19 and the gain-assisted control of EIG has been shown in Ref.21. Contribution of coherent phase-modulation of the transfer function, which is attributed to the presence of standing-wave regime, has been shown to be essential for the enhancement of the first and second order peaks as compared to the central peak20. The appearance of EIG with Rydberg atoms has also been discussed in Refs.24. It is worth mentioning that, in case of Rydberg atoms, one can obtain the phenomenon of EIG for the excited states wherein strong optical nonlinear effect is induced due to dipole-dipole interaction. In the present model our objective is to generate nonlinear generation of diffraction peaks as a result of the non-degenerate four-wave mixing (FWM) process where the excited energy levels are different from those used in Rydberg atoms. In recent days, photonic graphene lattice originated via the effect of EIT in an atomic vapor cell is a highly promising candidate for generation of various nonlinear optical effects29. Evolution of optical 31. Cross-grating like structures based on two-dimensional (2D) EIG is described in Refs.34. Experimental observation of the diffraction pattern in a 2D-optically induced atomic lattice is reported35 in a three-level atomic system. The mechanism of electromagnetically induced Talbot effect similar to EIG has been discussed in Ref.36 and also demonstrated experimentally37.The phenomena like Electromagnetically Induced Transparency (EIT)44. A different method of obtaining dual EIG has been studied on the basis of spatially modulated biexciton coherence in Ref.40. Phase-dependent generation of EIG has been addressed also in those works41. A new scheme based on semiconductor quantum dot and metal nanoparticle hybrid system is proposed to realize EIG43. In a tripod-type atomic model the appearance of dual EIG is also reported in the presence of an incoherent pump field45.Following the generic models in rarefied medium a good number of attempts have been made to explore the phenomenon of EIG in solid state media such as, semiconductor quantum nanostructures3 for detection of light signal based on the FWM technique. To this aim, electromagnetically induced far-field diffraction of a weak coherent optical beam is investigated after passing it through an atomic system interacting with the assembly of travelling and standing wave fields as shown in Fig.\u00a0multi-wave-mixing-inducedcoherence (MWMIC). It is worth pointing that, in absence of the field applied between the levels The mechanism of EID rendering EIG as presented in this article may lead to construct a device called opto-atomic grating for the study of diffraction of laser at high frequency region. The scheme of EIG can be chosen to be an useful technique to generate nonlinear light almost free from background-noise as reported in Ref.In the proposed scheme, generation of spatially modulated coherence is regulated not only by the DEIT, but by the MWMIC also. Such controlling process, at the condition of exact atom-field resonance, is shown to be unique to the given four-level model in inducing a uniform distribution of multiple peaks in the diffraction pattern where peaks of all the orders have almost equal magnitude with significant sharpness. The amplitude part of the grating-transfer-function plays the vital role in forming such peak pattern. It has been shown that a small shift from the condition of exact resonance results in the nonlinear peak modulation due to the effect of MWMIC and in turn controls the asymmetry in the alignment of the higher order peaks. Contextually, we note that the diffraction pattern of c.c.; where The field-coupled energy-level configuration of the atom is shown in Fig.\u00a0mentclass2pt{minim46 for Rubidium  during the propagation of the wave though the atomic medium. We define the propagation vector, 1247, which implies the optical depth of the probe field. For the sake of simplicity of the calculation, C is chosen to be unity. The value of C conforms to the values of the parameters: C) through the expression, i.e. 4. If the value of the amplitude transfer function becomes predominant over the phase part of the transfer function i.e., A dominates over D in magnitude, we obtain the intensity distribution of the grating mostly induced by the absorption. In such a situation we obtain the amplitude grating or absorption grating. With the variation of the system-parameters, if the intensity distribution pattern be dramatically changed due to the significant contribution of the phase part of the transfer function, i.e., D dominates over A in magnitude, we obtain the intensity distribution of a phase grating.The polarization induced in the probe transition is given by performing the quantum average over the corresponding transition momentM is a non-zero positive integer, which implies the allowed number of opto-atomic slits. According to Fig.\u00a0x- direction. The nodal regions where probe suffers no interaction in the absence of spatially modulated field act as slits, whereas the antinodes can be treated as opaque regions due to the interaction of the probe in the presence of spatially modulated field. The amplitude of the probe field z-direction, then the Fourier transform of G(x) gives rise to the resultant amplitude of the Fraunhofer diffraction pattern as given below484950p is defined earlier. In accordance to Eq., 12), 14) and 15). First of all, we set the values of , (14) an and (15). First oIn presenting the results, we mainly concentrate on the absorption and dispersion of the weak probe field propagating through the atomic medium. In this connection, we plot the variation of real and imaginary parts of entclass1pt{minimaentclass1pt{minimaentclass1pt{minimaentclass1pt{minimaentclass1pt{minimaentclass1pt{minimaentclass1pt{minimai.e. T(x)| and the phase part 51 comprising of the complete evolution of nine peaks accompanied by the significantly intense central maximum and incomplete appearance of the marginal peaks (of the fifth order) near the both ends of sin(T(x)|) and the dark-line signifies the null contribution of the phase function With a view to exhibiting the variation of diffraction intensity at the condition of multi-photon resonance x-y plane is obtained (not shown). This unique spatial pattern of diffraction intensity can be envisioned as a 2D multi-channel beam splitter33 with potential applications in optical networking and communication, and also in all-optical device for multiplexing, demultiplexing52 etc. For the wide use of varied diffraction profiles in all-optical devices the detunings and the Rabi frequencies of the fields act as the control-knobs of the input-array pattern in meeting the varying needs of experimentalists for different purposes. Biased by the use of sub-diffraction limited spots in quantum lithography as employed in Ref.53, such 2D diffraction pattern may find special but limited application in high-precision optical lithography. Periodic pattern can be generated by the process of optical writing i.e., by exposing the desired surface of a substrate to the diffraction spots accompanied by periodic but same amount of etching of the illuminated zone of the surface.On exploring such fascinating feature of uniform intensities for all the orders in the one-dimensional (1D) diffraction profile we have examined the diffraction pattern in two dimensions for the same set of values of parameters as chosen in Fig.\u00a0T(x)| and the phase part b in the left panel of Fig.\u00a0a and b together, exhibit evolution of gradually increasing / decreasing peak intensity from one end to another and thereby inducing asymmetry in peak pattern. For these two conditions, it is prominent in the right panel of Fig.\u00a0T(x)| does not change for the cases of the curves of a and b. However, the variation of phase part c in left panel of Fig.\u00a0d in the left panel of Fig.\u00a0T(x)| and c and d.To illustrate how the diffraction pattern evolves due to the resultant effect of two competitive components: amplitude and phase parts of value 0.0 MHz likeT(x) i.e. by setting the phase function T(x) and In order to visualize the effect of the length of the active medium on the diffraction pattern at the detuned condition of the probe, we show the figures in the left and right panels of Fig.\u00a0Based on the findings shown in Figs. ity Fig.\u00a0a,b. If ti-th peak in the grating spectrum, 8 for that particular diffraction peak. In this context, we have drawn the ratio of DE i.e. i=4(sinj=1(sinL of the active medium (Fig.\u00a0L is set as 30 for Fig.\u00a0It is well known that, for the evolution of The basic mechanism leading to EIG in the present scheme is based on multi-wave-mixing-induced coherence effect. So far we have discussed all the results in the life-time broadened regime. In the presence of Doppler Broadening, the appearance of phase dephasing collision rates becomes prominent in all the atomic transitions considered in the atomic model, which significantly affects the atomic coherence needed for obtaining the symmetric diffraction pattern. The incorporation of considerable Doppler width (We have studied nonlinear modulation effect on the diffraction pattern of EIG as a result of spatially modulated four-wave-mixing induced coherence effect in a four-level close-loop interaction system. In order to enhance the applicability of the proposed scheme in practice, Rubidium 87"}
+{"text": "Glioblastoma multiforme (GBM) is the most frequent, invasive, and lethal subtype of glioma brain tumors. Cannabis is commonly used for medical treatment, and individual phytocannabinoids have been shown to trigger GBM cell death. However, cannabis contains hundreds of different compounds, and the optimal combinations of molecules with anti-GBM activity are unknown. Here, we identified fractions from a cannabis strain that substantially reduced human GBM cell viability and motility. The fractions also reduced the ability of GBM cells to form colonies in 2 and 3-dimensional models, suggesting that the cannabis treatments may have the potential for preventing the formation of GBM neurospheres associated with the high resistance to current therapies. Importantly, these compounds also induced cell death in glioma stem cells derived from tumor specimens. The effectiveness of the fractions and combinations of cannabis compounds should be examined in GBM pre-clinical studies and clinical trials.Cannabis sativa is used for the treatment of various medical conditions. Around 150 phytocannabinoids have been identified in C. sativa, among them \u0394-9-tetrahydrocannabinol (THC) and cannabidiol (CBD) that trigger GBM cell death. However, the optimal combinations of cannabis molecules for anti-GBM activity are unknown. Chemical composition was determined using high-performance liquid chromatography (HPLC) and gas chromatography mass spectrometry (GC/MS). Cytotoxic activity was determined by XTT and lactate dehydrogenase (LDH) assays and apoptosis and cell cycle by fluorescence-activated cell sorting (FACS). F-actin structures were observed by confocal microscopy, gene expression by quantitative PCR, and cell migration and invasion by scratch and transwell assays, respectively. Fractions of a high-THC cannabis strain extract had significant cytotoxic activity against GBM cell lines and glioma stem cells derived from tumor specimens. A standard mix (SM) of the active fractions F4 and F5 induced apoptosis and expression of endoplasmic reticulum (ER)-stress associated-genes. F4 and F5 inhibited cell migration and invasion, altered cell cytoskeletons, and inhibited colony formation in 2 and 3-dimensional models. Combinations of cannabis compounds exert cytotoxic, anti-proliferative, and anti-migratory effects and should be examined for efficacy on GBM in pre-clinical studies and clinical trials.Glioblastoma multiforme (GBM) is the most lethal subtype of glioma.  Glioma are primary brain tumors that arise from glial cells and account for ~80% of all malignant brain tumors . AccordiAmong brain tumors, glioblastoma multiforme  is the most frequent, invasive, and lethal subtype ,2. StandCannabis sativa is effective in the treatment of numerous medical conditions -2H- tetrazolium inner salt)  were added to the cells for 2 h at 37 \u00b0C in a humidified 5% CO2\u201395% air atmosphere. Absorbance was recorded by a Synergy H1 hybrid reader photometer (BioTek) at 490 nm with 650 nm of reference wavelength. Cell viability was estimated from the equation:Cells were seeded into 96-well plates at a density of 2 \u00d7 10A490 and A650 are the absorbencies of the XTT colorimetric reaction. The absorbance of medium alone (blank) was subtracted from the readings. For dose-response assays, data points were connected by non-linear regression lines of the sigmoidal dose-response relation. GraphPad Prism version 6.1  was employed to produce dose-response curves and determination of IC50 values.5/mL cells were plated in triplicates in 24 well plates. The cells were treated with the specific compounds, and cell death was determined at 24 and 48 h using the LDH assay kit according to the manufacturer\u2019s instructions and as previously described [For GSCs, cell viability was quantified by counting cells with trypan blue exclusion assay and using the lactate dehydrogenase cytotoxicity (LDH) assay kit. GSC neuro-spheres were disaggregated, and 10escribed . The abs5 in 3 mL of SFM or EMEM and were incubated at 37 \u00b0C overnight to allow attachment. The following day, cells were treated with the treatments in complete medium. After 24 h of incubation, cells were washed twice with 2 mL of PBS, harvested, and centrifuged for 3 min at 1400 rpm, then re-plated in serial cell-density dilutions in SpM for 48 h incubation. Colonies were imaged and counted by using an inverted microscope . Groups of more than 20 cells were identified as a colony [4).A172 or U87 cells were seeded into a 6-well plate at a density of 5 \u00d7 10a colony . The per4 per well in 100 \u00b5L of complete medium. After 24 h, cells in each well were scratched perpendicularly across the center of the well with a 200 \u00b5L pipette tip to produce a cell-free area for investigating the ability of the cells to migrate and close the gap under different treatments. Immediately after scratching, 100 \u00b5L of treatment solution was added. Photos were taken at 0, 14, 20, and 36 h following scratching and the gap area was measured using ImageJ (version 1.53a). The scratch area, indicated by cells migrated into the scratch, was calculated as percent of the scratch area at time x from time 0:A172 cells were seeded into a 96-well plate at a density of 2 \u00d7 104 in 250 \u00b5L complete medium and were incubated at 37 \u00b0C for 60 min to recover. Cells were treated and incubated for 24 h followed by a viability test with resazurin . The inserts were taken out of the medium and the inner part was wiped using a cotton swab to remove the detached cells. The inserts were transferred into a new 24-well plate, fixated using 70% ethanol for 10 min and dried for 50 min, followed by staining in 400 \u00b5L of 0.2% crystal violet, washed with PBS, and dried for 5 min. Cells stained underneath the membrane were counted in an inverted microscope in 3\u20135 different fields.Cells were seeded into the upper chamber of a 24-well plate containing insert with an 8 \u00b5m pore size membrane , at a density of 5 \u00d7 104 in 500 \u03bcL of complete medium. Following 24 h incubation, treatments at different concentrations were added for 24 h. For the staining process, cells were washed with PBS and fixed with 3.7% formaldehyde solution in PBS and incubated at room temperature for 10 min followed by incubation in 0.1% Triton X-100  for 5 min, washed again with PBS, and incubated in 1% BSA  solution for 30 min. Two drops of EasyProbes\u2122 Actin and of Hoechst were applied to each of the samples for 20 min. Image acquisition was carried out using a Leica SP8 laser scanning microscope , equipped with a diode laser with 405 nm and OPSL 552 nm laser, HC PL APO CS 10x/0.40 and HC PL APO CS2 63x/1.20 objectives  and Leica Application Suite X software . The number of F-actin was quantified as the number of filaments crossed once a line was drawn across the soma. The percentage of filaments in treatments was calculated out of the average number of filaments in the control.EasyProbes\u2122 ActinRed 555 Stain was used for F-actin staining and Hoechst 33342  for nuclei staining, according to the manufacturer\u2019s instructions. Briefly, cells were seeded on confocal dishes  at a density of 2 \u00d7 105 cells in 2 mL of SFM per well. 24 h following seeding, cells were treated with treatments in complete medium for 48 h. After incubation, cells were harvested using trypsin and centrifuged for 5 min at 1600 rpm. Cell pellets were resuspended and washed twice with 1 mL of PBS. The cells in each sample were resuspended in 85 \u03bcL of Annexin binding buffer. Cells were stained using 10 \u03bcL of Annexin V-FITC solution and 5 \u03bcL of propidium iodide (PI) working solution followed by incubation in the dark at room temperature for 15 min. Then 400 \u03bcL of Annexin V binding buffer was added to each tube, and flow cytometry was performed using a Gallios flow cytometer (FACS). Cells were considered apoptotic if they were Annexin V+/PI- (early apoptosis) or Annexin V+/PI+ (late apoptosis). Live cells were defined as Annexin V-/PI-, and Annexin V-/PI+ as necrosis.Apoptosis for the A172 cell line was assessed using the aMEBCYTO Apoptosis Kit with Annexin V-FITC and PI . Staining was carried out according to manufacturer instructions. In brief, cells were seeded in a 6-well TC plate, at a density of 4 \u00d7 105 cells in 2 mL of SFM per well. After 24 h incubation, cells were treated with treatments in complete medium for 24 h. Methanol and doxorubicin were used as negative and positive controls, respectively. Cells were harvested and centrifuged for 5 min at 1600 rpm. Cell pellets were washed once with 1 mL of PBS and fixed with 70% cold ethanol overnight at \u221220 \u00b0C. The fixed cells were washed twice with 1 mL of PBS and stained with 250 \u03bcL of PI solution (50 \u03bcg/mL) containing RNase A (100 \u03bcg/mL) for 30 min in dark conditions. 250 \u03bcL of PBS was added to each tube, and the cells were analyzed using FACS.A172 cells were seeded in 6-well TC plate at a concentration of 4 \u00d7 106 cells in 5 mL of SFM per well. After 24 h incubation, cells were treated with treatments in complete medium for 4, 12, and 24 h. Cells were harvested, and RNA was extracted using TRI reagent . RNA was reverse-transcribed in a total volume of 20 \u03bcL  according to the manufacturer\u2019s protocol. PCR was performed in triplicate using a StepOnePlus system . The expression of each target gene was normalized to the expression of GAPDH mRNA using the 2-\u0394\u0394Ct method, presenting the differences (\u2206) in threshold cycle (Ct) between the target gene and GAPDH gene. \u0394Ct=Ct target gene\u2014Ct GAPDH. \u0394\u0394Ct=\u0394Ct treatment- \u0394Ct control. Experiments were repeated 3 times. The primers were: for CB2  (forward) 5\u2032- ATCATGTGGGTCCTCTCAGC -3\u2032 and (reverse) 5\u2032-GATTCCGGAAAAGAGGAAGG-3\u2032; TRIB3 (Gene ID: 57761) (forward) 5\u2032- GGTGCTTATCAGGTGCCAAG -3\u2032 and (reverse) 5\u2032- GTTGTCAGCTCAAGGATGCC -3\u2032; ATF4 (Gene ID: 468) (forward) 5\u2032- GGAAACCATGCCAGATGACC -3\u2032 and (reverse) 5\u2032- ACTTTCTGGGAGATGGCCAA -3\u2032; CHOP (Gene ID: 1649) (forward) 5\u2032- AGCAGAGGTCACAAGCACCT -3\u2032 and (reverse) 5\u2032- CTGGGGAATGACCACTCTGT -3\u2032.Cells were seeded in a 6-well plate at a concentration of 1 \u00d7 106 cells per 400 \u03bcL gel. The solutions were mixed gently and transferred as 25 \u03bcL of gel solution to a 24-well plate. 3D models were cross-linked using CaCl2  and thrombin  for 5 min, after which the 3D structure was washed with PBS and then immersed in 1 mL of EMEM complete medium. Cells in the 3D structures were allowed to grow for 2 days, and then treatments were administered for 8 days (treatments were repeated every 2 days). Structures were stained using EasyProbe Hoechst, as described above. To assess cell viability, the 3D structure was digested using 200 \u03bcL of 0.05M sodium citrate  and 0.05M EDTA  solution for 5 min. The solution was centrifuged for 4 min at 1700 rpm, the cell pellet was washed with PBS, and the Alamar Blue  assay was performed. Groups of more than 20 cells were identified as a colony [Hydrogels (AGFCH) included Sigma-Aldrich products and were prepared using alginate  22.5 mg/mL, gelatin  45 mg/mL, fibrinogen  50 mg/mL, collagen  2.2 mg/mL and hyaluronic acid  2 mg/mL in PBS-glycerol solvent. The gel (AGFCH) was mixed with U87 cells at a concentration of 2 \u00d7 10a colony . The perp \u2264 0.05.Results were presented as mean + SE of replicate analyses and were either representative of or included at least 2 independent experiments. Means of replicates were subjected to statistical analysis by a Tukey\u2013Kramer test using the JMP statistical package  and considered significant when C. sativa strain DQ was found to be cytotoxic to the GBM A172 cell line  determined by GC/MS is presented in In order to confirm the active compositions of F4 and F5, IC50 values of the phytocannabinoid standard mix (SM) of each fraction were examined and calculated. SM is the mix of phytocannabinoid standards equivalent of the primary phytocannabinoids in F4-SM and F5-SM were also active on the U87 cell line, however, at higher concentrations in comparison to active concentrations on A172 cells . F4-SM aSince the SM of the fractions were more cytotoxic than the extract fractions, we also determined the effect of treatments with F4-SM or F5-SM on cell apoptosis. Treatment with F4-SM or F5-SM for 48 h led to 70.8% and 44.3% cell apoptosis, respectively, in comparison to 8.0% apoptosis in the vehicle control and 60.6% in doxorubicin positive control . MoreoveF4-SM treatment of A172 for 24 h led to an increase in the percentage of cells in the G1 phase of the cell cycle (84.5%) in comparison to the control (vehicle) treatment 65.2%; . F5-SM tSince the SM of the fractions were more cytotoxic than the extract fractions, we also determined the effect of adding CB1 or CB2 IA, TRPV1, or TRPV2 antagonists (AN) or TRPA1 blocker (B) on F4-SM and F5-SM activity. A172 cells were treated with F4-SM and F5-SM with or without the IA, AN, or B. In the presence of CB2, the cytotoxic effect of F4-SM was significantly reduced  was expressed in A172 cells, and its expression was reduced with the F5-SM treatments and induced with F4-SM treatment  genes. F4-SM and F5-SM treatments substantially induced these gene expressions  that were generated from a GBM primary tumor. The GSCs were maintained as spheroids, and their self-renewal, differentiation, and tumorigenic abilities were validated as previously reported ,31. We fTo examine the ability of the fractions and SM to attenuate cancer cell motility, the effects of F4, F5, and their corresponding SM on cell migration at sub-lethal concentrations were examined using scratch assays. Treatments of the A172 cell line with F4 or F5 for 36 h led to significant inhibition of cell migration  in comparison to the vehicle control . TreatmeF4 and F5 treatments were the most effective treatments for the inhibition of cell migration . Hence, Since F4 and F5 treatments were the most effective treatments for inhibition of cell migration , we haveTo examine the effect of F4, F5 on colony formation, cells were sorted following treatments to live cells, and these live cells were re-seeded and allowed to form colonies. Treatment with F4 in A172 cells reduced colony formation to a small but significant extent a,c. HoweTo examine the effect of the fractions on colony formation in 3D structures, U87 cells were seeded in extra cellular matrixes, forming 3D droplets, and were treated with F4, F5, F4-SM, F5-SM, or doxorubicin. Multiple colonies were formed in the control  expression, which is a transcription factor with roles in the induction of cell death [Treatment with F4-SM or F5-SM led to cell apoptosis in A172 cells. In many cases, apoptosis resulted from the activation of cell cycle arrest . CBG andtressors . In turntressors . ATF4 alll death . Anotherll death .ATF4, CHOP-10 (GADD153/DDIT-3), and TRIB3 gene transcription, suggesting that indeed the F4-SM and F5-SM treatments induce cell death via ER stress. In agreement, THC induced an ER-stress response in human and mouse glioma cells that promoted autophagy and apoptosis via TRIB3, inducing expression of ATF4, CHOP, and TRIB3 genes [TRIB3 expression peaked at 12 h and reduced at 24 h. This expression profile might be a result of the negative feedback loop impaired by TRIB3 [CHOP mRNA in colorectal cancer (CRC) cells [In our study, F4-SM and F5-SM treatments induced B3 genes ,17,42. BB3 genes . In bothby TRIB3 ,43. CBG C) cells .GBM has a dismal prognosis that is partly attributed to the presence of GSCs that exhibit self-renewal abilities and resistance to radiation and chemotherapy. Indeed, one of the barriers to the successful treatment of GBM is the eradication of the GSC subpopulation. Although GSCs represent only a small percentage of the tumor cells in GBM, they are implicated in tumor recurrence. The potent antitumor effect of the F4-SM and F5-SM compounds on GSCs demonstrated in this study, in addition to the pronounced effects of these compounds on GBM cell lines, emphasizes the potential of these compounds as novel and potent therapeutic agents for the treatment of GBM.CHOP, ATF4, and TRIB3 gene expression, further supporting the idea that the CB2 receptor plays a role in these SMs activity on GBM cells.The antitumor effects of phytocannabinoids are mediated at least partially by targeting the endocannabinoid system ,15. In tCB1 IA blocked the activity of F5-SM, however, we could not detect CB1 gene expression in the A172 cells. Since the CB1 IA used here (AM251) sometimes also acts as an inverse agonist of the CB2 receptor , it migTHC also activates TRPA receptors , and CBGIn contrast to the improved cytotoxic activity of the SMs in comparison to the extract fractions, the SMs and primary phytomolecules  were less effective than the extract fractions in inhibiting cell migration in scratch assays. Again it might be that the other molecules present in F4 and F5, in addition to phytocannabinoids , facilitate the inhibition of cell migration. F-actin integrity is important for cell motility . TreatmeAnother important observation in this study was the substantial reduction of colony formation by F4 and F5. GBM colonies developed in vitro were denoted as spheres  and suggF4-SM and F5-SM were found to have high cytotoxic activity against GBM cell lines and GSCs in vitro and to induce expression of genes associated with ER-stress. F4 and F5 were also demonstrated to inhibit cell migration, invasion, and colony/neurosphere formation in GBM cells in vitro. The different treatments also affected the cell cytoskeleton. It was previously suggested that a combined anti-proliferative and anti-migratory treatment improved the response of GBM in vivo . The can"}
+{"text": "The effectiveness of public health measures to prevent COVID-19 contagion has required less vulnerable citizens to pay an individual cost in terms of personal liberty infringement to protect more vulnerable groups. However, the close relationship between scientific experts and politicians in providing information on COVID-19 measures makes it difficult to understand which communication source was more effective in increasing pro-social behaviour. Here, we present an online experiment performed in May 2020, during the first wave of the pandemic on 1131 adult residents in Lombardy, Italy, one of the world's hardest hit regions. Results showed that when scientific experts recommended anti-contagion measures, participants were more sensitive to pro-social motivations, unlike whenever these measures were recommended by politicians and scientific experts together. Our findings suggest the importance of trusted sources in public communication during a pandemic. Home to about 10 million people and a sixth of the total Italian population, the region had dramatic peaks of both infections and deaths cases during the first wave of the pandemic, between February and May 2020, i.e. almost half of the 34 000 deaths in the whole country \u2019 or not. The source could either be (i) scientific experts, (ii) politicians, (iii) scientific experts and politicians, or (iv) not specified, the latter used as the baseline treatment. Immediately after being shown the vignette, participants were asked whether they wanted additional information regarding the statements in the vignette, which they could download at the end of the experiment. This was to measure the effect of manipulating the source of information on information-seeking behaviour.The experiment was implemented using oTree , which rIn the second block of the experiment, participants were confronted with seven statements regarding suggested measures to contain the COVID-19 pandemic and were asked to rate them on an agreement\u2013disagreement scale. These measures were those debated in the public media as possible counter-measures in the case of norm violation during \u2018Phase 2\u2019 and for social control, including the use of a contact-tracing smartphone app (see appendix A for a full list of these statements).Furthermore, participants were informed that, as part of the experiment, they would receive a lottery ticket giving them a 1-in-50 chance to win a \u20ac50 Amazon voucher. Participants could then choose to instead donate the \u20ac1 value of the lottery ticket to a charity linked to COVID-19 . To avoid path-dependency between the order in which statements and the donation decisions were presented, the order of statement and donation tasks was randomized.In the final block, participants were required to provide demographic information, were debriefed on the purpose of the experiment, were required not to discuss the content of the experiment for one week, and, finally, the lottery was resolved whenever participants chose to keep the lottery ticket.. 2.2Our analysis was focused on the three main decisions that participants had to make: (i) whether they donated their lottery ticket to support a COVID-19-related charity or not; (ii) whether they requested additional information on COVID-19 measures in the vignette or not; and (iii) to what extent they supported potential new COVID-19 public measures. As regards (i), participants had two options of COVID-19-related charities to support: Protezione Civile, a governmental organization which deals with the prediction, prevention and management of public emergencies, or ASST Fatebenefratelli Sacco, a regional governmental healthcare institution, which includes four hospitals and is a recognized research and teaching centre of excellence in many areas from infectious diseases to biomedical research in Lombardy.We assumed that the participants\u2019 decision to give up the lottery in order to support these front-line organizations could be considered as a sign of pro-social behaviour. For (iii), the support of stricter measures to enforce compliance was measured through seven separate statements where participants had to indicate on a scale from 1 to 10 , to what extent they agreed on. These measures included seven options that were under debate during the period of data collection as follows. (1) Increasing fines against citizens who did not follow social distancing and hygiene-related measures. (2) Using law enforcement agencies and the military for pervasive social control. (3) Introducing technologies to trace individual mobility. Promoting a downloadable smartphone application to trace contacts by making (4) its adoption voluntary with individual data anonymous for public authorities, (5) its adoption voluntary with personal identity revealed to public authorities, (6) its adoption mandatory with individual data anonymous for public authorities, or (7) its adoption mandatory with personal identity revealed to public authorities.. 2.3The experiment was performed between 25 and 30 May 2020\u2014i.e. at the end of the first wave of the pandemic and during the initial stages of \u2018Phase 2\u2019, but before the further loosening of mobility restrictions planned in mid-June. Participants included 1131 adults living in Lombardy and recruited through posts in pre-selected Facebook groups  and through sponsored posts. To ensure independence of observations, all participants were required to comply with confidentiality and avoid discussing details related to the experiment during data collection. Comments on Facebook groups were monitored and deleted in case of any violation of confidentiality.. 2.4brms package to estimate the Bayesian models. Data (CovidExp.csv) and the scripts to replicate our analysis  are available on Harvard Dataverse at: https://doi.org/10.7910/DVN/UHNLHP.The analysis was performed using R 3.6.2 with the . 3Of the 1131 participants, 75% were women, the median age was 44 years (s.d. = 14.3), and 56% had a university degree. Details on the sample demographics are reported in appendix A . In totaTables alone, we did not find any consistent pure effect (tables Results in t tables \u20132. In ge. 4In many regions afflicted by the COVID-19 pandemic, such as Lombardy, the efficacy of restrictive measures to contain the COVID-19 pandemic required a high level of cooperation by millions of citizens. Press conferences, political announcements and TV interviews by public authorities were instrumental to inform and reassure the public. During this \u2018infodemic\u2019, politicians and scientific experts often went hand-in-hand urging the public to comply with regulations that, in most cases, required a majority of less vulnerable citizens to pay a cost in terms of liberty and privacy infringements to benefit public health and more vulnerable subjects .While in the case of Italy, norm compliance was probably influenced by fear during the so-called \u2018Phase 1\u2019, where the number of infections and deaths was considerable, understanding just how to ensure regulation enforcement is even more challenging now. Indeed, it is probable that the next pandemic waves will alternate spikes and drops of infection rates, so requiring adaptive regulations and patience by the public. The rise of street protests in various countries, with some episodes of social unrest when restrictions were announced in October and November 2020, suggests that compliance enforcement is still a key point of this global public health emergency .alone without politicians. They were also less willing to accept more restrictive measures whenever these were recommended by politicians alone. Most notably, we found a decline in pro-social motivations whenever the same measures were presented by both politicians and scientific experts.Our results confirm that, at least in our experimental setting, individuals were sensitive to the source of information behind policy measures ,17,18. Iet al. [A possible explanation of this effect is that co-responsibility creates confusion in the information signal . Due to et al.  in a polet al.  can confet al. ,47.While political distrust is not new to Italy  and the Furthermore, while this confusion can have immediate effects on the trust and credibility of politicians, the public role and exposure of scientific experts could backfire on the credibility of science in the longer run. As suggested by Stevens , althougThis said, our study also has certain limitations. The first is the lack of a representative random sample of Lombardy population. While this should be the gold standard of social research, it is difficult to achieve such a standard in behavioural online experiments aiming to examine a timely and urgent issue. In these cases, there is a trade-off between the need to collect data on people's responses to specific circumstances and the quality of the sample. This was the case of Italy during the first wave of the pandemic, with many activities limited or running at a reduced pace, which made it more difficult to use standard offline or online panels. Moreover, our experimental study aimed to test a cause\u2013effect relationship between the source of information and the reaction of subjects, with priority given to internal validity against generalizability.in the making.Another limitation is that participants were recruited through Facebook. While this ensured a good distribution of age, our sample was unbalanced in terms of gender and education, with a disproportionate number of women and highly educated subjects. On the one hand, this could show a higher propensity of this type of population to engage in scientific experiments. On the other, it is probable that the fact that we could not mention any reward in the recruitment Facebook message, given that the reward was part of the experimental manipulation itself, may have discouraged men from participating . While pFinally, our findings further confirm the sensitivity of participants to information signals, which are key especially to public communication . In our Click here for additional data file."}
+{"text": "Purpose: JC virus (JCV) infects 80\u201390% of the population and results in progressive multifocal leukoencephalopathy upon immunodeficiency. The study aimed to pathologically clarify the oncogenic roles of T antigen in human breast cancers.Methods: Breast cancer, dysplasia, and normal tissues were examined for T antigen of JCV by nested and real-time PCR. The positive rate or copy number of T antigen was compared with clinicopathological parameters of breast cancer. JCV existence was morphologically detected by immunohistochemistry and in situ PCR. T antigen was examined by Western blot using frozen samples of breast cancer and paired normal tissues.Results: According to nested PCR, the positive rate of breast ductal or lobular carcinoma was lower than that of normal tissue (p < 0.05). T antigen existence was negatively correlated with E-cadherin expression and triple-negative breast cancer (p < 0.05), but positively correlated with lymph node metastasis and estrogen receptor and progestogen receptor expression (p < 0.05). Quantitative PCR showed that JCV copies were gradually decreased from normal, dysplasia to cancer tissues (p < 0.05). JCV T antigen copy number was lower in ductal adenocarcinoma than in normal tissue (p < 0.05), in line with in situ PCR and immunohistochemistry. JCV copies were negatively correlated with tumor size and E-cadherin expression (p < 0.05), but positively correlated with G grading of breast cancer (p < 0.05). Western blot also indicated weaker T antigen expression in breast cancer than normal tissues (p < 0.05).Conclusion: JCV T antigen might play an important role in breast carcinogenesis. It can be employed as a molecular marker for the differentiation and aggressive behaviors of breast cancer. Breast cancer is the leading cause of cancer death among women, even in less developed countries . EnvironJC virus (JCV) is a member of the polyomavirus family  and has in situ PCR and compared JCV existence with clinicopathological parameters of breast cancer.Intravenous or intracranial inoculation of JCV has been found to cause astrocytomas, glioblastomas, neuroblastomas, and medulloblastomas . In addin = 18), and normal breast (n = 48) tissues were sampled from surgical materials in The Affiliated Hospital of Chengde Medical University and Liaoning Cancer Hospital. Fresh samples of breast cancer and paired normal tissues (n = 10) were collected from both hospitals. The cancer patients did not receive a neoadjuvant before surgical operation. They signed informed consent. The ethics committees of these hospitals approved the study.Formalin-fixed and paraffin-embedded breast cancer (n = 112), breast dysplasia  primers were used for the 1st PCR, whereas T1 and T3 (5\u2032-AGC\u200bAAC\u200bCTT\u200bGAT\u200bTGC\u200bTTA\u200bAGA\u200bGA-3\u2032) were used for the 2nd PCR. The 20 \u00b5l of reaction mixtures contained 0.1\u00a0\u00b5l of Ex Taq HS (TaKaRa) with 2.0\u2002mM of MgCl2, 2.0\u00a0\u00b5l \u00d7 10 PCR buffer, 2.0\u00a0\u00b5l of dNTP mixture, 1\u00a0\u00b5M of each primer, and 200\u2002ng of DNA. The PCR process was 32 cycles of denaturation at 95\u00b0C for 20\u2002s, annealing at 56\u00b0C for 20\u2002s, and extension at 72\u00b0C for 20\u2002s. Nested PCR was carried out using 1% (volume) of the first amplicon. DNA-free amplification was employed as a negative control.PCR was carried out by targeting T antigen: Forward: 5\u2032-GCC\u200bACC\u200bCCA\u200bGCC\u200bATA\u200bTAT\u200bTG-3\u2032 and backward: 5\u2032-GTT\u200bGAC\u200bAGT\u200bATC\u200bCAT\u200bATG\u200bACC\u200bAGA\u200bGAA-3\u2032. In total, the 20\u00a0\u00b5l reaction mixture contained 10.0\u00a0\u00b5l of TaqMan\u00ae ( \u00d7 2) with 1.8\u00a0\u00b5l (10\u00a0\u00b5M) of each primer and 80\u00a0ng of DNA. The PCR protocol was 55 cycles of denaturation at 95\u00b0C for 25\u00a0s, annealing at 55\u00b0C for 50\u00a0s, and extension at 72\u00b0C or 25\u00a0s.SYBR fluorescence PCR was used to quantify JCV copies using the Bio-Rad PCR system. A plasmid of PBS-JCV T antigen was serially diluted for standard reference. These standard and sample DNAs were amplified by targeting Serial sections were deparaffinized with xylene, rehydrated with alcohol, and subjected to antigen retrieval by irradiation in target retrieval solution  for 5\u00a0min with a microwave oven. Five percent BSA was then applied to incubation for 5\u00a0min to prevent non-specific binding. The sections were incubated with anti-SV 40\u00a0T antigen antibody  for 20\u00a0min and then treated with the anti-mouse Envision-PO  antibody for 20\u00a0min. Incubation was performed in a microwave oven for intermittent irradiation as described previously . After e2, 1 \u00d7 PCR buffer, 6.25\u00a0U of Taq polymerase) was put into a membrane, sealing on the tissue. PCR amplification was performed at the condition: Denaturation at 94\u00b0C for 3\u00a0min, followed by 20 cycles of 92\u00b0C for 15\u00a0s, 55\u00b0C for 20\u00a0s, and 72\u00b0C for 30\u00a0s and final extension at 72\u00b0C for 7\u00a0min. The primers were forward: 5\u2032-AGG\u200bTAG\u200bGCC\u200bTTT\u200bGGT\u200bCTA\u200bA-3\u2032 and backward: 5\u2032-TGC\u200bCTA\u200bGAA\u200bCTT\u200bTAC\u200bAGG-3\u2032. After that, the tissue was washed with 2 \u00d7 SSC and incubated with blocking solution  for 1\u00a0h. Subsequently, the sections were reacted with anti-digoxigenin and AP -conjugated antibody  for 90\u00a0min. After being washed for 5\u00a0min and immersed in solution II  for 15\u00a0min, the positive signal was colored using NBP/BCIP. Finally, methyl green was used for counterstaining.A 10-\u03bcm-thick section was prepared with proteinase K for 15\u00a0min. After TBS washing, the tissue slide was fixed with 4% paraformaldehyde and then washed with 2 \u00d7 SSC. After that, 100\u00a0\u03bcl of PCR mixture  in TBST, and then with anti-SV40 T antigen  or rabbit anti-GAPDH  antibody. The membranes were washed with TBST and incubated with anti-rabbit or anti-mouse HRP-conjugated secondary antibody . Bands were visualized with Azure Biosystem C300 by an ECL detection kit.We homogenized breast cancer and normal tissues in RIPA lysis buffer, and a protein assay was performed using Kaumas brilliant blue. A 50\u00a0\u03bcg protein/sample was subjected to 10% SDS-PAGE electrophoresis and electrically transferred to a PVDF membrane, which was incubated with U for the comparison of means. A p value < 0.05 was statistically regarded as significant.SPSS v. 26.0 software was used for statistical analysis. Statistical analysis was carried out using Fisher\u2019s test for the comparison of positive rates and Mann\u2013Whitney p < 0.05). As shown in p < 0.05) and triple-negative breast cancer , but positively correlated with lymph node metastasis , estrogen receptor (ER) expression , and progestogen receptor (PR) expression .As indicated in p < 0.05). They were lower in ductal adenocarcinoma than in normal tissues (p < 0.05). They were negatively correlated with tumor size (p < 0.05) and E-cadherin expression (p < 0.05). In situ PCR demonstrated that positive cells were detectable in breast ductal and lobular epithelium, but no or weak signal was seen in breast cancer, in line with immunohistochemistry  because the distinct distribution of its receptors  determined its different infection . GeoghegIn conclusion, the JCV T antigen might play an important role in breast carcinogenesis. JCV infection, insertion, transcription, translation, degradation, target, and partner chaperons of its T antigen might underlie the molecular mechanisms of its tissue-specific carcinogenesis."}
+{"text": "Scientific Reports 10.1038/s41598-020-79201-5, published online 13 January 2021Correction to: The original version of this Article contained an error in Figure\u00a06B where were the y-axis numbering \u201c0, 10, 20, 30\u201d was incorrectly given as \u201c0, 1, 2, 3\u201d.The original Figure\u00a0The original Article has been corrected."}
+{"text": "In a globalized world with high international factor mobility, crises often spread quickly over large parts of the world. Politicians carry a vital interest in keeping crises as small and short as possible. Against this background we study whether the type of company of owner-managed SMEs, in Germany well-known as Mittelstand firms, helps increasing an economy\u2019s crisis resistance. We study this issue at the example of the Great Recession of the years 2008/2009. Using micro panel data from the ifo Business Survey, we study the comparative performance of Mittelstand enterprises and find supporting evidence for the hypothesis that Mittelstand firms performed more stable throughout the Great Recession than non-Mittelstand firms. We also show that owner-managed SMEs performed significantly better than SMEs and owner-managed large enterprises. Thus, it is rather the combination of firm size and owner-management that leads to more crisis resistance. The German Mittelstand is economically more successful compared to SMEs and large enterprises because of its combination of owner-management and firm size. The German Mittelstand is always seen as the \u201cbackbone\u201d of the German economy and made responsible for Germany\u2019s ability to cope with large external shocks such as the 2008/2009 global recession. To date, this suggestion is not backed by empirical evidence as common data sources do not incorporate information on the ownership structure of German firms. We enrich the micro panel data from the largest monthly business survey in Germany by two questions on the ownership structure of the interviewed firm and can confirm this suggestion. It turns out that it is not firm size or owner-management alone that leads to a higher crisis resistance but rather the combination of both criteria. Our results have practical and political implications as it is possible with our approach to separate the German Mittelstand from the pool of small- and medium-sized enterprises. The information on the ownership structure in our data can initiate future research activities and shed more light on the relevance of owner-management for the economic success of firms. The world has seen many crises over the last two decades, among them several global crises such as the burst of the Dot.Com Bubble early this century, the 2008 Global Financial Crisis and, still ongoing when this paper was written, the economic crisis in consequence of the COVID-19 pandemic. Throughout these crises, economies typically experience significant drops in their gross domestic products and quickly rising unemployment rates. While in general drops in economic activity are almost inevitable in crisis situations, policymakers around the globe have a vital interest to keep the resulting recessions as small and short-lived as possible. It is thus an intriguing question, how a high degree of crisis resistance can be achieved.In this paper we study whether the type of company of the German Mittelstand firm can contribute to a higher degree of crisis resistance. It has often been argued that Mittelstand firms are contributing to more stability throughout crises as they are managed by their owners and thus typically have a much longer optimization perspective than manager-led firms, which are often more interested in short-term profits. The fact that Germany was hit very seriously by the 2008 Global Financial Crisis (primarily due to the export orientation of the German economy) but recovered quickly from the crisis and emerged stronger than before indicates that this explanation might be true ,This paper aims at filling this gap in the literature by analyzing the crisis resistance of Mittelstand firms versus non-Mittelstand firms, thereby taking firm size as well as ownership and management structure into account. We deliver empirical evidence on the performance of German Mittelstand firms throughout the Great Recession in 2008/2009. We base our empirical study on a panel of firm data from the monthly conducted ifo Business Survey, which incorporates a representative sample of 9,000 firms, located all over Germany. By adding a number of special questions to the standard questionnaire we are able to identify Mittelstand firms adequately. Using a panel ordered logit model with interaction effects we find that (on average) Mittelstand firms report a less deteriorating business situation than non-Mittelstand firms over the crisis period. We also show that owner-managed SMEs performed significantly better than SMEs and owner-managed large enterprises. Thus, firm size and owner-management in combination lead to more crisis resistance.The paper is organized as follows. In Section\u00a0As there is much confusion on the exact meaning of the term \u201cMittelstand\u201d we explain it in detail before we turn to our subsequent empirical analysis. Up to now, there is no legal or otherwise generally accepted definition of Mittelstand firms  refers solely to the unity of ownership and management in its definition of the Mittelstand, other definitions also include firm size  for each product of the firms is as follows: \u201cWe assess our current business situation as [...]\u201d. Each respondent can choose from three different, qualitative answers reflecting either a positive, neutral, or negative assessment. The three answers for the business situation are as follows: (+) good, (=) satisfactory, and (\u2013) bad. We decided to choose the business situation as an indicator of firm performance mainly because of the findings from the forecasting literature. The survey on the forecasting performance of the ifo data by Lehmann . However, the transaction costs within the firm tend to increase with a larger number of involved chief operating officers. We therefore follow the related empirical literature and restrict the maximum number of owner-managers allowed to be classified as a Mittelstand firm to four , non-owner-managed SMEs (SME), owner-managed large enterprises (OM LE) or as non-owner-managed large enterprises (LE) see Fig.\u00a0.Fig. 1FThe results of the classification of firms is shown in Table\u00a0Our aim is to study whether Mittelstand firms performed significantly different from non-Mittelstand firms throughout the Great Recession. Our baseline estimation approach therefore consists of estimating the following interaction model,it is the measure for economic performance of firm i at time t. MSit is a Mittelstand dummy which takes the value of one when firm i belongs to the German Mittelstand (and zero otherwise).t controls for the worldwide financial crisis period and takes the value of one throughout the crisis period (and zero otherwise). According to the German Council of Economic Experts (Sachverstaendigenrat zur Begutachtung der gesamtwirtschaftlichen Entwicklung), the crisis period lasted from April 2008 to March 2009. We coded the crisis dummy accordingly. Stateij controls for state-specific effects by a set of J \u2212\u20091 dummy variables indicating whether firm i is located in state j. Similarly, Sectorik controls for sector-specific effects. \u03b5it represents the usual idiosyncratic error term and ai the unobserved heterogeneity at the firm level. Our period under investigation covers January 2006 to March 2009.where Performanceai are treated as random effects. Besides owner-management and a small firm size as the core characteristics of Mittelstand firms, the firm\u2019s location and the sector it is operating in, there can be further unobservable business attributes that might have an effect on firm performance and thus drive our overall results.9As firm performance measure we employ firms\u2019 reported business situation. The reasoning behind this choice is the following. As stated before, the ifo Business Survey distinguishes between four time dimensions: past, present, three-month and six-month expectations. We decided against the past and future dimensions and apply the present category and thus the business situation as it reflects the current state of the firms\u2019 business performance, given recent developments within a firm. We also did so as the ifo Business Situation has been proven to be a good predictor for a variety of macroeconomic aggregates, for example, sectoral gross value added , non-owner-managed SME (SMEit), owner-managed large enterprises (OM LEit), and non-owner-managed large enterprises (LEit). Different from our baseline regression we use the group of Mittelstand firms as comparison group and study via three separate interaction terms whether the other three groups performed significantly different throughout the crisis.So far, we compared the crisis-performance of Mittelstand firms to the group of non-Mittelstand firms. However, the group of non-Mittelstand firms consists of various quite diverse subgroups. In order to find out whether Mittelstand firms systematically differ from non-owner-managed SMEs and owner-managed large enterprises we re-estimate the model taking the four different firm types in our sample (see Table\u00a0The referring estimation results are shown in Table\u00a0MS-self) is gained by an additional special question, we asked within the ifo Business Survey. The wording of this question was \u201cDo you classify your enterprise as part of the German Mittelstand?\u201d Interestingly enough, the results of the self-assessment differ strongly from the classification on objective criteria. While 64.5 percent of all surveyed firms were classified as Mittelstand firms according to the objective criteria, some 83.3 percent of all responding enterprises assess themselves that they belong to the German Mittelstand. Interestingly, only 23.0 percent of all firms that do not fulfill the objective criteria of a Mittelstand firm give a correct self-assessment, thus, 77.0 percent see themselves as a Mittelstand firm whereas they are not according to our objective delimitation. Only a minority of firms (13.7 percent) wrongly classify themselves as non-Mittelstand firms whereas they belong to the Mittelstand based on objective criteria. This especially holds true for very small firms with an average of less than 20 employees  and using it in the regression, we receive the results reported in column (1) of Table\u00a012In order to check the reliability of our main results, we conduct a number of robustness checks. Again, we use the business situation as dependent variable. First, instead of applying the German SME-definition (threshold 500 employees), we apply the European definition, which refers to a threshold of 250 employees. When coding an additional dummy variable accordingly (Aktiengesellschaften), limited liability companies (GmbHs), or limited partnerships (Kommanditgesellschaften). According to their balance sheets, the firms report\u2014in addition to their assets and liabilities\u2014the amount of their equities (in thousand Euros). Combining the ifo Business Survey data with the Amadeus and the Hoppenstedt data thus delivers additional firm information, however, this comes at the price of a significantly shrinking sample size. This is due to the fact that many of the firms in the ifo sample are not liable to prepare a balance sheet. This holds true especially for numerous small firms. As a consequence, the number of available observations per cross-section drops to 2,411 firms in the merged dataset. At the same time the SME-quota drops from 91.7 percent in the ifo data to only 53.6 percent in the merged data.Second, we tried to further enhance our objective identification of Mittelstand firms in the dataset by employing information on turnover from additional datasets, which can be combined with the ifo Business Survey data. As explained earlier, the ifo Business Survey contains no such information. However, the data center at the ifo Institute provides the possibility to combine the ifo Business Survey data with information from the Amadeus- and the Hoppenstedt-Database. The latter two databases provide balance sheet and income statement data and also contain a variety of firm characteristics such as firms\u2019 turnover, founding years, their legal forms and their amount of equity capital. The German law defines several legal forms of companies. We can distinguish between twelve different forms, for example, stock corporations (MS-both). We receive qualitatively the same results as in the baseline regression. Again the coefficient of the interaction effect turns out to be significantly positive, indicating that Mittelstand firms performed significantly better throughout the crisis than non-Mittelstand firms. The results also remain stable when we additionally include a number of control variables on the firm level such as the founding year, the total amount of equity or the firms\u2019 legal form (see columns (3), (4) and (5) in Table\u00a0In column (2) of Table\u00a0Third, we ran a bunch of further robustness checks: (i) we included an interaction effect across the state- and sector-specific effects,A remarkable specialty of the German economy is the comparatively large share of owner-managed small- and medium-sized enterprises. These so-called Mittelstand firms are often qualified as the \u201cbackbone\u201d of the German economy. They are not only seen as the key to Germany\u2019s quick postwar recovery, but also as a type of company allowing the German economy to cope with huge external shocks such as the recession in consequence of the worldwide financial crisis of 2008/2009. However, this claim was yet not backed by suitable empirical evidence. Because Mittelstand firms are often hard to identify in official statistics, the existing empirical evidence on Mittelstand firms in general is still comparatively scarce.This paper contributes to broadening the empirical evidence on the role of Mittelstand firms by delivering an analysis of the relative performance of Mittelstand firms throughout the Great Recession of 2008/2009. Basically, it delivers supporting evidence for the stability hypothesis. After identifying Mittelstand firms as owner-managed SMEs based on objective, measurable features in the ifo Business Survey we find that Mittelstand firms in fact performed better than non-Mittelstand firms throughout the Great Recession of 2008/2009. This result proves to be robust in various stability tests. Interestingly enough, this finding does not carry over to the case where Mittelstand firms are classified in accordance to their subjective self-assessment, which often differs from the objective classification. Thus, we might conclude that further empirical studies of the role of Mittelstand firms should be based on objective criteria rather than on self-assessments of firms. As mentioned earlier, the empirical literature on the relative performance of Mittelstand firms is still in its infancy. This is primarily due to the fact that most available databases do not allow identifying Mittelstand firms properly as they typically lack information on ownership and management structure. Against this background it is highly desirable to increase efforts to build up databases which contain the necessary information as a basis for a more systematic empirical foundation of research on Mittelstand firms.Our empirical results deliver a strong argument against industrial policies, primarily aiming at developing large national champions and to protect them against foreign competitors and takeovers. While such policies have little tradition in Germany, where the Mittelstand is very popular, in February 2019 the Federal Minister of Economics announced a paradigm shift towards such a strategy in his \u201cNational Industrial Strategy 2030\u201d."}
+{"text": "Local estimates of HIV-prevalence provide information that can be used to target interventions and consequently increase the efficiency of resources. This enhanced allocation can lead to better health outcomes, including the control of the disease spread, and for more people.In this study, we used the DHS data phase V to estimate HIV prevalence at the first-subnational level in Kenya, Tanzania, and Mozambique. We fitted the data to a spatial random effect intrinsic conditional autoregressive (ICAR) model to smooth the outcome. Further, we used a sampling specification from a multistage cluster design.iP = 13.6%) and Nairobi (iP = 7.1%) in Kenya, Iringa (iP = 15.4%) and Mbeya (iP = 9.3%) in Tanzania, and Gaza (iP = 15.2%) and Maputo City (iP = 12.9%) in Mozambique are the regions with the highest prevalence of HIV, within country. Our results are based on publicly available data that through statistically rigorous methods, allowed us to obtain an accurate visual representation of the HIV prevalence at a regional level.We found that Nyanza (These results can help in identification and targeting of high-prevalent regions to increase the supply of healthcare services to reduce the spread of the disease and increase the health quality of people living with HIV. One of the most important challenges for Eastern and Southern Africa to achieve the 90-90-90 HIV targets have been initiation and retention in care . The lac2empirical prevalence would be zero, even though that is likely erroneous. Hence, we recognize information is incomplete , and the modeled probability does not reflect the total population at-risk. In addition, because no completely-at-random sampling is feasible, survey data carries selection bias in its estimations. To correct these issues, we conduct prevalence mapping using small area estimation (SAE) [The main issue with prevalence mapping is that estimations across sub-national regions are needed to obtain better information but are usually based on incomplete, local, survey data. Therefore, if no cases are recorded in a particular region, the on (SAE) 6.The aim of this study was to estimate the prevalence in a sub-set of Eastern African countries at the first sub-national level, to create information relevant to locally focused policy decision- making.We used the DHS HIV and geospatial data . The sel8The geospatial information for each country was originally formed by the sampling cluster information and their associated boundaries. The former included the spatial points for all clusters within regions, while the latter included polygons for each region within a country. Using the coordinates of both datasets we identified to which region each cluster belonged. Then, we merged the information. The HIV data were geographically identified only by clusters. We used the merged spatial information to determine to which region each of the clusters in the HIV data belonged to.The final spatial dataset is the appended data of the three countries containing the polygons for each of the sub-national regions. The final HIV dataset was also the appended data of the three countries containing the individual health outcomes , the cluster, and the associated sub-national region.borrows information from neighboring regions, even when these neighbors are in different countries.Considering that the DHS survey used a multistage cluster design sampling, we conducted a SAE, with a spatial random effect intrinsic conditional autoregressive (ICAR) model  \u2013 the BYip, in each region in the first sub-national level, denoted by i, we fitted the data to the following model: [To estimate the spatially smoothed prevalence, g model: ip is the direct (design-based weighted) estimate of the prevalence for the region i, modeled using a logit-link given the binary nature of the outcome; iV is the estimated variance for each region; 0\u03b2 is the intercept which represents the shared, baseline effects; iS the spatial smoothing; and i\u03f5 is the unstructured random effects. This model does not include covariates. We perform the analysis using the SUMMER package [Where  package  in R.This is a secondary data analysis that used publicly available information and had no contact with the participants. As such, it was deemed not human research by the IRB of the University of Washington and no level of IRB-review was necessary.The original dataset, aggregated for the three countries had a sample size of 39,575 observation . After deleting the observation containing missing data in the geographic information only , the final sample size was 39,258 (99.2%). Given the small number of missed observations, we did not perform a missing-at-random analysis.Figure 1). Tanzania was the country with the highest number of regions, 26, and at the same time the smallest sample size for each one. Kenya, with 8 regions, and moreover Mozambique, with 11 regions, have higher associated sample size.We found 45 regions in total. The sample size varies highly across these regions, ranging from 308 to 1,942 observations  of 0.38. Figure 3 shows the point-estimate results for each country. The scale for the color-code is independent for each country in Figure 3.ip = 13.6%), Nairobi (ip = 7.1%), and Western (ip = 6.3%), in Kenya. In Tanzania, Iringa (ip = 15.4%), Mbeya (ip = 9.3%), and Dar es Salaam (ip = 9.1%). Finally, in Mozambique, Gaza (ip = 15.2%), Maputo City (ip = 12.9%), and Maputo (region) (ip = 12.7%). The Supplemental Material contains the estimated prevalence and 95% credible intervals for each region. In Kenya and Tanzania, we can observe that the highest prevalence is almost an outlier compared to the rest of the country. These results warrant a prioritization of these regions for HIV prevention and treatment health services.Our analysis allowed us to identify the three regions with the highest prevalence in each country. Nyanza (We conducted a HIV-prevalence mapping for a subset of east African countries, with a SAE estimation using a BYM model. This approximation has multiple theoretical benefits. First, the SAE is consistent with the small sample size that observed in many of the areas under estimation. Second, our model acknowledges the sampling design and the associated distribution of sampling probabilities. Third, the spatial smoothing process allowed the model to borrow information from the neighbors in the estimation of each posterior to improve the precision of the estimates, which is particularly helpful in the presence of sparse data such as the DHS dataset. Further, our study has an additional advantage because it defines the neighbors beyond the country borders, by taking the sub-set of countries as a unit. We believe this was particularly useful in the estimation of the prevalence for Tanzania, where all its regions had a small sample size.Figure 4 shows that the smoothing process pulled the posterior estimates towards the middle of the distribution, increasing the value of the estimates in the lower half, and reducing it for the estimates in the higher half. The right-side panel shows that the standard errors created by the smoothing analysis tend to be lower in comparison, denoting estimates with higher precision. Thus, because the smoothing model estimates each prevalence using the information provided by its neighbors, the resulting distribution of prevalence for all regions is less disperse, with the extreme values pulled towards the middle.We examined the difference in performance for the estimation of prevalence at the first-subnational level, for the weighted model that includes a correction for cluster sampling, and the weighted-smooth model that includes a smoothing process for the outcome. Regarding the spatial weights for the matrix of neighbors, \u201cB\u201d and \u201cW\u201d are the most used styles . In esseFigure 5, even though the weighted-only model includes a correction for the sampling methodology, the resulting estimates for 4 regions are still not significantly different from zero; i.e., the 95% credibility intervals of these estimates include zero. This demonstrates an important advantage of the smoothing process: by shrinking the estimates towards the mean, it eliminates prevalence estimates non-statically different from zero. Further, it exemplifies the difference between the observed and the empirical prevalence [real risk of infection for HIV.According to evalence . The lacOur estimates are systematically lower compared to previous analysis that have mapped the prevalence of HIV in sub-Sharan Africa , which iThe objective of this study was to present reliable, local prevalence information to inform policy decision in the context of optimize resource allocation. In that regard, the temporality of the data is not as important since the absolute numbers can change but the relative risk is less likely to change over time. Second, our methodology is in concordance with both the nature of the data \u2013 by including a correction due to the sampling design \u2013 and the epidemiology rationale \u2013 by using a smoothing process to limit the probability of having prevalence equal to zero and modeling the outcome in each region as part of a bigger area, rather than in isolation.This study is not without limitations. First, the data that we used were collected between 2007 and 2009. Hence, the picture that our estimates present is likely outdated considering how fast the HIV epidemic variables move over time. We chose the phase DHS-V because that was the only phase in which our sub-set of countries had both HIV and geospatial information. Second, although socioeconomic and demographic variables influence the prevalence of HIV 19 and thOur results are based on statistically appropriate methods that allowed us to obtain an accurate visual representation of the HIV prevalence in the subset of African countries we chose. These results can help in identification and targeting of high-prevalent regions to increase the supply of healthcare services to reduce the spread of the disease and increase the health quality of PLWHIV.This study builds on secondary publicly available data and generates reliable estimates that can be used to target interventions. This creates an important opportunity to apply the same methodology in other settings, where data might be scarce and resources to supplement data collection unavailable.The additional file for this article can be found as follows:10.5334/aogh.3345.s1Supplemental Material.The Supplemental Material contains the estimated prevalence and 95% credible intervals for each region in the three countries analyzed: Kenya, Tanzania, and Mozambique."}
+{"text": "Calcifying nested stromal epithelial tumor (CNSET) is an extremely rare diagnosis among patients treated for primary hepatic neoplasms. There are only 45 cases reported worldwide. Histopathological characteristics are well-demarcated nests of spindle and epithelioid cells in a dense desmoplastic stroma with variable calcification and ossification. It is mostly diagnosed in children and young females. Treatment strategies implemented for the management of CNSET include radiofrequency ablation, transarterial chemoembolization, surgical resection, adjuvant and neoadjuvant chemotherapy, and liver transplantation. Given the small number of available cases, there are still no established standards of treatment for this neoplasm.A 28-year-old female diagnosed with CNSET presented mild abdominal pain, with normal laboratory values. The tumor was initially deemed unresectable, therefore, the patient was disqualified from liver resection. Further deterioration of the patient's clinical condition and local tumor progression led to qualification for liver transplantation. The patient underwent liver transplantation 1 year following initial diagnosis and a 12 months recurrence-free period was observed. During the course of treatment, she did not receive systemic chemotherapy, radiotherapy, or loco-regional treatment.Multiple strategies have been implemented for the treatment of CNSET, with liver resection providing the best outcomes. Transarterial chemoembolization, radiofrequency ablation, and radiotherapy are reported to be insufficient in the management of this tumor. Various chemotherapy regimens turned out to be ineffective as well. There have been only eight reported cases of patients undergoing liver transplantation for CNSET, with tumor recurrence in two cases. CNSET appears to be a neoplasm with low malignancy potential, although an aggressive progression has subsequently been reported. Further investigation is still required in this field. Calcifying nested stromal epithelial tumor (CNSET) is an extremely rare diagnosis among patients treated for primary hepatic neoplasms. There are only 45 cases reported worldwide \u201329. CNSEMultiple treatment strategies have been implemented for the management of CNSET including radiofrequency ablation, surgical resection, adjuvant, and neo-adjuvant chemotherapy, and liver transplantation. Surgery is the most successful method, provides the best outcomes for treatment. There were only four reported cases of recurrence among 35 patients that underwent liver resection as the sole surgical intervention , 16, 26.On October 2019, a 28-year-old female patient was referred to the Department of General, Transplant and Liver Surgery of the Medical University of Warsaw due to an incidental tumor finding in the right liver. At admission, laboratory test results were found to be normal. She presented mild discomfort in the upper-right quadrant of the abdomen throughout the previous 6 weeks. A core needle biopsy was performed. Pathologists diagnosed an intrahepatic cholangiocarcinoma tumor. Due to inadequate future liver remnant (tumor size of 200 \u00d7 180 \u00d7 150 mm with right hepatic vein involvement) the tumor was claimed unresectable at that stage. The patient was referred to the oncologist for systemic therapy. A second core needle biopsy was performed, but this time a different tumor was diagnosed (CNSET).Given an alternative diagnosis, the patient did not receive chemotherapy and was re-evaluated for surgical treatment. Multiple imaging was performed which presented local progression of the disease, increase in tumor size, diaphragmatic infiltration, right and middle hepatic vein obstruction, and right portal vein obstruction. Due to this tumor progression, she was once again disqualified from resection.Throughout the course of consecutive months, the patient's quality of life suffered following increasing abdominal pain, uncontrollable hiccups, slight peripheral edema, and the emergence of paraneoplastic erythematous skin lesions. Yet, she did not receive systemic treatment. In August 2020, a control Computed Tomography Scan revealed tumor volume growth occupying the right liver along with segment IV and segment I with the obstruction of intrahepatic inferior vena cava . PositroThe patient underwent LT on 19 November, 2020, with the use of veno-venous bypass and end-to-end cavo-caval anastomosis. During hepatectomy, a 65 \u00d7 30 \u00d7 10 mm part of the diaphragm was excised en-bloc with the liver due to tumor infiltration, excised specimen weighed 4,800 g. A standard immunosuppression regimen of tacrolimus, prednisone, and mycophenolate mofetil was maintained.Histopathological examination presented a well-circumcised tan-white tumor of a maximum size of 26 cm and another 6 mm infracapsular tumor . MicroscThe patient experienced a 10-min asystolic cardiac arrest on a post-operative day (POD) 6, most likely attributed to sudden hypoxemia caused by an iatrogenic diaphragmatic injury that subsequently led to respiratory failure with the need for mechanical ventilation and sedation until POD 23. The prolonged intubation led to a Serratia Marcescens infection confirmed in blood and bronchoalveolar fluid cultures, infection was treated according to antibiogram with a good outcome.The patient was discharged on POD 42 in good general condition with normalized laboratory liver parameters.The last outpatient follow-up was in January 2022 , where lStenosis of the upper cavo-caval anastomosis with the reversed flow in renal veins was identified and managed with a series of percutaneous transluminal angioplasty using EverCross and Atlas Gold balloon catheters with an adequate outcome. The patient throughout the entire course of treatment did neither receive chemotherapy nor radiotherapy.We presented a case of a patient with unresectable CNSET, an extremely rare primary hepatic tumor. Our patient being a young female, having little to no symptoms at the initial presentation was consistent with previously reported cases , 31. OneThere are reports of patients with Beckwith\u2013Wiedemann syndrome (BWS) that developed CNSET , 24. BWSAll available reports across Pubmed and Cochrane library regarding CNSET describe it as a primary hepatic tumor. There are no reports of CNSET developing primary lesions in other organs. There are however two cases describing distant metastases to the lungs and bone . We stilConsidering the limited number of reports in the literature, therapeutic options for CNSET rely mostly on surgical resection. Liver resection has proven positive outcomes with reported recurrence in just 4/35 cases of patients for whom liver resections were the only surgical intervention. There have been two cases of liver and lymph node recurrence , 26 and In all those cases there were no signs of metastases in preoperative imaging, surgeons obtained R0 resections, and none of the patients received chemotherapy prior to surgery.The most common treatment for recurrence has been systemic chemotherapy. Interestingly the hepatocellular carcinoma regimen turned out to be unsuccessful , also thRadiofrequency ablation (RFA) sparked hope but soon proved far from optimal. Two patients were reported to have been treated with RFA , 12, 26.Meletani et al.  and TsurAdjuvant and neoadjuvant systemic chemotherapy have been applied for the treatment of CNSET utilizing regimens that are commonly used for hepatoblastoma or sarcoma , but thoTo the best of our knowledge, there were eight cases of patients diagnosed with CNSET that underwent liver transplantation. Six of them as a primary method of treatment , 24, 25,In the available reports that provide reasons for qualifying CNSET patients for LT, among the most common indications is the exhaustion of possibilities for radical surgical resection, whether it be tumor size, vascular involvement, significant mass effect, or risk of progressive liver failure , 24, 25.Poland, like many other countries, has experienced a significant decline in the necessity of transplanting cirrhotic hepatitis C-virus (HCV) positive patients. This is mainly due to the fact, that for several years now, direct-acting antiviral agents have been available and successfully administered to this group of patients. This led to a definitive decrease in HCV-positive patients put on the liver transplant waiting list, which in turn has made substantial eligibility for treatment of other hepatic disorders, especially liver tumors. Our decision-making for transplant qualification in cases such as this one is multifactorial. It is based on our center's experience and a near total of 3,000 liver transplants performed throughout the last three decades; evidence in the literature of successful liver transplantation without tumor recurrence, as observed in cholangiocarcinoma patients; the above-mentioned transplant waiting list optimization through lesser numbers of qualified HCV (+) patients. Reasons specifically concerning this patient that led to this transplantation were dictated primarily due to the lack of other therapeutic options in a young, previously healthy individual and progressive but slow tumor growth throughout the 2 years preceding LT. Liver resection was not possible due to the involvement of hepatic veins, and insufficient estimated future liver remanent. Furthermore, quality of life was severely impaired namely by, tumor mass restricting the flow inside the inferior vena cava (IVC) causing systemic circulation congestion or the so called IVC syndrome; diaphragmatic infiltration causing abdominal pain requiring strong opioid administration. The extrahepatic disease was ruled out in consecutive radiology examinations. At LT qualification her patient's model for end stage liver disease score equaled 23 points. The symptoms were clearly associated with the mass effect. It became understandable that taking out the tumor would free the patient from her symptoms, but by being deprived of the possibility to perform a safe and successful liver resection, transplantation became the only resort. Additionally, histopathological examination ruled out the diagnosis of a more aggressive cholangiocarcinoma, which justified the use of a liver graft for this case. Taking all of the above into account, a transplant multidisciplinary team including oncologists, unanimously qualified this patient for deceased donor LT.In the group of 6 transplanted patients, one had documented recurrence. An 8-year-old female that relapsed 2 months post-transplantation with bone metastases was treated with proton beam radiation therapy for bone lesions and systemic chemotherapy for aorto-caval lymph node metastases. We did not find data on the applied regimen, but the authors report negative uptake of fluorodeoxyglucose by the lymph nodes in PET/CT after chemotherapy administration. It is worth noticing that this patient had suspected lymph node metastases in PET/CT prior to LT. The authors do not provide post-transplant follow-up of this patient . Four paTwo patients that underwent transplantation as a second-line therapy both had been diagnosed with recurrent disease after undergoing first-line surgical treatment. The first patient was a 16-year-old girl treated with liver resection, in follow-up she has been diagnosed with numerous new liver lesions that had been treated with TACE, systemic chemotherapy (high-risk soft tissue sarcoma protocol + Imatinib) with no response and was subsequently transplanted. She recurred at 28 months post-transplantation, manifesting bilateral lung metastases. Further treatment was discontinued, and the patient died 37 months post LT . In anotMost authors reporting the cases of patients receiving LT for CNSET do not describe exact immunosuppression regimens, so we remain unaware of potential modifications. Only three authors provided information about used drugs. Hommann et al. implemented Basiliximab, steroids, and Tacrolimus that was subsequently augmented with Mycophenolate Mofetil, on POD 10 patients who experienced mild rejection treated with low dose steroids , CNSET is currently recognized as a primary liver tumor. Nowadays, we know that the use of mammalian target of rapamycine (M-TOR) inhibitors in HCC LT recipients reduces the recurrence rate and we stand in favor of similar immunosuppression standards toward encounters of rare hepatic tumors. From our own observations, we do not see the need for reduced, but possibly low levels of calcineurin inhibitors (CNIs) in the first weeks post-liver transplantation. As our experience is limited in the matter of CNSET we wish to believe that low dose CNIs with mycophenolate mofetil and M-TORs will be acceptable in prolonging graft survival and the recurrence-free period.CNSET appears to be a neoplasm with low malignancy potential, although some authors report aggressive disease progression with local recurrence , 16, 26.Our experience is limited to the presented case of our female patient. She had a high chance of an unfavorable course of the disease given that two additional tissue structures suspected of higher malignancy potential and intrahepatic metastasis were found during pathomorphological examination. Although liver resection remains the most feasible and successful treatment, we believe that in cases such as ours, where large tumor volume is present along with malignant pathology examination, the best therapeutical option is liver transplantation. Immunosuppression does not require alteration and a 1-year observation period does not implicate early recurrence. With the awareness that to this day we do not have a chemotherapy protocol effective enough to prevent the recurrence of CNSET, a safe and margin-free liver resection is the \u201cgolden choice\u201d of treatment. LT would then be advocated only in cases where a safe liver resection may be jeopardized.Given the extremely small group of patients with CNSET worldwide, that underwent LT, a closer look at this disease is mandatory. Reporting of long-term follow-up for these patients is in serious need and would be much appreciated.We contacted the presented patient on January 2022 to inquire about her views and insights on implemented treatment. The patient stated that throughout the course of treatment she has been overall satisfied with the doctor's approach to finding the most optimal solution for her case. During the diagnostic process, she was tormented by uncertainty, since she was aware of the rarity of her condition, she admitted that she tried to research the topic of CNEST on her own but was unable to find any accessible information dedicated to patients. On being asked for the biggest struggle she had to overcome before liver transplantation, she stated that the biggest obstacle was abdominal pain that worsened in a few months preceding liver transplantation and prevented the patient from working, disabled her from performing everyday tasks, and demanded intake of opioid pain medications that heavily altered her ability to focus on basic activities. Asked how her life has been since transplantation she said that she's been working full-time job, is independent, complies with the ordered immunosuppression regimen, and is regularly controlled in the outpatient clinic. She declared that liver transplantation saved her life and wanted to emphasize that she is very much grateful that she has been able to receive successful treatment for her condition. She stated that she is glad that her case will be submitted for publication and believes that it can be helpful in finding treatment solutions for patients with the same diagnosis.The original contributions presented in the study are included in the article/supplementary material, further inquiries can be directed to the corresponding author/s.Ethical review and approval was not required for the study on human participants in accordance with the local legislation and institutional requirements. The patients/participants provided their written informed consent to participate in this study.EK and KK contributed to the manuscript by writing draft manuscript, writing the discussion and the final manuscript, and literature review. PR, BS, WP, and KZ contributed to manuscript revision, read, and approved the submitted version. All authors contributed to the article and approved the submitted version.The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest.All claims expressed in this article are solely those of the authors and do not necessarily represent those of their affiliated organizations, or those of the publisher, the editors and the reviewers. Any product that may be evaluated in this article, or claim that may be made by its manufacturer, is not guaranteed or endorsed by the publisher."}
+{"text": "Limosilactobacillus reuteri, a producer of indole derivatives, regulates mucosal immunity via activating the AHR signaling pathway. However, the effective substance and mechanism of L. reuteri in the amelioration of AD remain to be elucidated. In this research, we found that L. reuteri DYNDL22M62 significantly improved AD-like symptoms in mice by suppressing IgE levels and the expressions of thymic stromal lymphopoietin (TSLP), IL-4, and IL-5. L. reuteri DYNDL22M62 induced an increase in the production of indole lactic acid (ILA) and indole propionic acid (IPA) via targeted tryptophan metabolic analysis and the expression of AHR in mice. Furthermore, L. reuteri DYNDL22M62 increased the proportions of Romboutsia and Ruminococcaceae NK4A214 group, which were positively related to ILA, but decreased Dubosiella, which was negatively related to IPA. Collectively, L. reuteri DYNDL22M62 with the role of modulating gut bacteria and the production of indole derivatives may attenuate AD via activating AHR in mice.Gut bacteria are closely associated with the development of atopic dermatitis (AD) due to their immunoregulatory function. Indole derivatives, produced by gut bacteria metabolizing tryptophan, are ligands to activate the aryl hydrocarbon receptor (AHR), which plays a critical role in attenuating AD symptoms.  Staphylococcus aureus disturbs the epidermal barrier and induces decreases in antimicrobial peptides, an increase in T helper 2 (Th2) type cytokines, and disturbance of skin lipid metabolism [Clostridium difficile, Clostridia, S. aureus, Escherichia coli, and obligate anaerobe species were prevalent but Lactobacillus, Bifidobacterium, Akkermansia muciniphila, and Ruminococcus gnavus were reduced in the feces of patients with AD [E. coli was positively correlated to serum immunoglobulin (Ig) E levels [Bacteroides fragilis decreased IL-4 levels produced by CD4+ T cells in germ-free mice [Clostridia, but not bacilli and E. coli, is significantly related to age at AD onset and negatively correlated with the proportion of eosinophils in the blood [Clostridium was higher, but Blautia and Parabacteroides were lower in healthy controls [Atopic dermatitis (AD) is a common inflammatory disease in the skin and affects many infants, children, and even adults worldwide . Suscepttabolism ,5. In adtabolism ,7. Gut mtabolism ,9. Clost with AD ,11. It hE levels , but Bacree mice . In a cohe blood . Howevercontrols . There acontrols .Limosilactobacillus reuteri, a tryptophan-metabolizing bacterium, produced indole derivatives and protected against Candida albicans colonization and intestinal mucosal inflammation via activating the AHR-IL-22 axis [L. reuteri strains could alleviate the clinical symptoms via AHR activation. Furthermore, the effects of gut microbiota should not be excluded from the process. Therefore, combined with these alterations, this study aimed to explore: (1) the effects of L. reuteri strains on AD symptoms and (2) the mechanism of L. reuteri strains in alleviating AD via the gut microbiota.Tryptophan metabolism involves the development of many diseases. Changes in tryptophan metabolites significantly affect the clinical characteristics of patients with food allergies , depress-22 axis . However-22 axis , and its-22 axis . IL-22 p-22 axis ,35. AHR-L. reuteri strains on the pathological symptoms of AD in vivo, the model was constructed using 2,4-dinitrofluorobenzene (DNFB) solution treatment. The experimental design is shown in L. reuteri DYNDL22M62 and FSDLZ12M1 treatments versus the DNFB group. However, L. reuteri GDLZ105 and FWXBH12M3 treatments could not significantly reduce ear thickness. Furthermore, the skin section was stained using hematoxylin and eosin (H&E) solution to evaluate pathological alterations of skin in AD-like mice. Compared to the control group, DNFB treatment significantly aggravated the inflammatory infiltration and induced an increase in skin thickness, and L. reuteri strain treatments alleviated inflammation of the skin except for L. reuteri GDLZ105  compared with DNFB treatment (L. reuteri GDLZ105 and FWXBH12M3 could not suppress IL-4 levels. Although L. reuteri DYNDL22M62 (p = 0.17), FSDLZ12M1, and FWXBH12M3 reduced the expression of IL-5 compared to the DNFB group, there was no statistical significance (L. reuteri GDLZ105 significantly increased IL-5 levels versus the DNFB group (p < 0.05). Therefore, L. reuteri DYNDL22M62 reduced serum IgE levels and reduced Th2 type response in AD-like mice.To evaluate the immunoregulatory effects of ol group A. L. reuike mice B. L. reureatment C, and L.ificance D. ConverL. reuteri treatments to alleviate AD-like symptoms, targeted tryptophan metabolism analysis was performed using UHPLC Q-Exactive-MS determination, DNFB treatment altered tryptophan metabolites in fecal samples compared to the control group, and indole derivatives including indolelactic acid (ILA), IAld, IAA, indoleacrylic acid (IA), and indole propionic acid (IPA) levels were reduced in the DNFB group , and IA (p = 0.20) showed the increasing trend after L. reuteri DYNDL22M62 treatment   F. L. reuL. reuteri DYNDL22M62 significantly altered gut microbial metabolism according to metabonomics analysis, and this was closely associated with changes in gut microbiota. To analyze the alterations of gut microbiota in the control, DNFB, and L. reuteri DYNDL22M62 groups, a high throughput sequencing for gut microbiota was performed. The indicators of alpha diversity were no significant difference between groups  and Bifidobacteriaceae after L. reuteri DYNDL22M62 treatment. These results showed that L. reuteri DYNDL22M62 treatment regulated gut microbial composition in mice, and this might induce changes in tryptophan metabolism in fecal samples.n groups . Principn groups A. Furthebundance B. DNFB tbacteria C. At thePrevotellaceaeUCG_001, Alistipes, and Rikenellaceae were enriched in the DNFB group, but Bifidobacteriaceae, Dubosiella, and Bifidobacterium were significantly decreased . IAA was positively related to Romboutsia and Bifidobacterium but negatively related to the Ruminococcaceae NK4A214 group and Dubosiella. IAld was positively related to all the differential taxa but the correlations with the Ruminococcaceae NK4A214 group and Bifidobacterium were not significant (p > 0.05). These results implied that L. reuteri DYNDL22M62 treatment regulated tryptophan metabolism by affecting the specific differential taxa in AD-like mice.Linear discriminant analysis effect size (LEfSe) was carried out to find the differential taxa among the control, DNFB, and DYNDL22M62 groups. Compared to the control group, ecreased A,B. HoweFB group B. In FigL. reuteri strains with the role of regulating gut microbial tryptophan metabolism on AD-like symptoms and the underlying mechanism in mice. In AD-like mice, a decrease in the integrity of the skin barrier and inflammatory infiltration due to aberrant immune responses. Therefore, AD was characterized by skin inflammation and excessive Th2-type responses in the acute stage [L. reuteri strain has the potential to alleviate AD symptoms via modulating immune responses. L. reuteri Fn041, a strain secreting IgA, significantly improved skin swelling and inflammatory cell infiltration via restoring the systemic Th1 and Th2 cytokine ratios and Treg proliferation [L. reuteri DYNDL22M62 variably affected AD-like symptoms, which could be shown based on H&E staining and changes in cytokines. Treatment with L. reuteri DYNDL22M62 significantly reduced ear thickness, skin swelling, and inflammatory infiltration in skin lesions suggesting that L. reuteri DYNDL22M62 might have the function of regulating immunity  with AD versus healthy controls [Bacteroidetes, and more abundant Clostridium clusters \u2163 and \u2169\u2163a in gut microbial alterations compared to at this age healthy children [Dermatophagoides farinae extract-induced AD group, the proportion of S24-7_unclassified decreased but Bacteroides increased versus the control group [Firmicutes including Lactobacillaceae, Erysipelotrichaceae, and Peptostreptococcaceae were reduced in mice with AD but they were restored by L. reuteri DYNDL22M62 treatment . deMan Rogosa Sharpe (MRS) broth medium was used to culture strains at 37 \u00b0C under anaerobic conditions for 16\u201324 h.L. reuteri treated groups. AD symptoms were induced based on the method of our previous study [v/v) in the control group. L. reuteri re-suspension solution of 0.2 mL (viable count: 1 \u00d7 109 colony forming units) was fed once a day for three weeks, and mice in the control and DNFB groups were fed equal volumes of sterile saline.Specific-pathogen-free grade mice  were fed in a controlled facility with 12 h/12 h of light/dark cycle, the temperature of 20\u201326 \u00b0C, and a humidity level of 40\u201370%, and were free to intake a standard chow and water. Mice were randomly divided into 6 groups (n = 6) after one week of adaptation: control group, 2,4-dinitrofluorobenzene group , and four us study . BrieflyAfter sacrifice, ear thickness was measured and the skin section was stained using hematoxylin and eosin (H&E) solution after fixation in 4% paraformaldehyde. The paraffin-embedded specimens (5 \u03bcm) were stained using H&E solution after conventional alcohol dehydration and made transparent using xylene. After drying, the sections were scanned to evaluate the pathological symptoms of the skin.Tissue and blood samples were collected and determined to assess alterations of the immune responses. Tissue was treated using lysis buffer with protease inhibitor, after centrifuge, and the protein levels were measured using the bicinchonininc acid  kit. The results of protein were expressed as bovine serum albumin (BSA) equivalents (E). The serum samples were obtained after a 3500\u00d7 rpm centrifuge for 20 min. The supernatant and serum samples were used to measure the alterations of inflammatory cytokines using the commensal ELISA kits  at 450 nm on a spectrophotometer .v/v) to prepare supernatant solution after homogenization treatment . After vacuum concentration , resuspension with 200 \u03bcL extracting solution, and centrifugation , the solution was treated using the 0.22 \u03bcm membrane to obtain the final sample for UHPLC Q-Exactive-MS analysis. Detailed information for the determination of indole derivatives was referred to in our previous article [m/z with a resolution of 70,000. After determination, a quantification analysis of indole derivatives was carried out on Xcalibur 4.0 .After being vacuum freeze-dried, the fecal sample was mixed with 900 \u03bcL extracting solution  package \u201ccorrplot\u201d.Fecal DNA was extracted using the FastDNA Spin Kit for Feces . It was sequenced using a high-throughput sequencing platform  based on the V3-V4 region amplification (341F and 806R). The detailed method was referred to in a previous article . Brieflyp < 0.05, ** p < 0.01, *** p < 0.001, and **** p < 0.0001. Data were presented as the mean \u00b1 SD.Statistical analyses were processed using Statistical Product and Service Solutions version 24.0 . The differences between groups were performed using one-way ANOVA and post hoc Fisher\u2019s least significant difference (LSD) tests, *"}
+{"text": "At 48 h, piglets were euthanized, and the SVZ and its surrounding regions, such as caudate and periventricular white matter, were analyzed for histology using hematoxylin-eosin staining and immunohistochemistry by evaluating the presence of cleaved caspase 3 and TUNEL positive cells, together with the cell proliferation/neurogenesis markers Ki67 (cell proliferation), GFAP , Sox2 , and doublecortin . Hypoxic-ischemic piglets showed a decrease in cellularity in the SVZ independent of cell death, together with decreased length of neural stem cells processes, neuroblast chains area, DCX immunoreactivity, and lower number of Ki67 + and Ki67 + Sox2 + cells. These data suggest a reduction in both cell proliferation and neurogenesis in the SVZ of the neonatal piglet, which could in turn compromise the replacement of the lost neurons and the achievement of global repair.Cellular and tissue damage triggered after hypoxia-ischemia (HI) can be generalized and affect the neurogenic niches present in the central nervous system. As neuroregeneration may be critical for optimizing functional recovery in neonatal encephalopathy, the goal of the present work was to investigate the neurogenic response to HI in the neurogenic niche of the subventricular zone (SVZ) in the neonatal piglet. A total of 13 large white male piglets aged <24 h were randomized into two groups: i) HI group ( During embryonic development, the formation of the central nervous system (CNS) results from a tightly regulated balance between the processes of apoptosis and neurogenesis, which occurs accomplished in time and space , 2. At tIn the CNS, the two neurogenic niches that retain neural stem cells and progenitors with regenerative potential are the subgranular zone of the hippocampal dentate gyrus and the subventricular zone (SVZ) of the lateral ventricle . To datePost-injury neurogenesis is a complex process that can be affected by a number of factors, including the duration, type, location, and intensity of damage . For insAs described, most of the work on neural stem cells and progenitors of the SVZ has been conducted in rodents. The newborn piglet SVZ shares many anatomical similarities with the SVZ in the human infant, and the SVZ persists beyond fetal development serving as a source of piglet new cells . The aimAll experimentation was in accordance with UK Home Office Guidelines [Animals (Scientific Procedures) Act 1986] and approved by the Animal Care and Use Committee of University College London Biological Services and Institute of Neurology.2 saturation was monitored . Isoflurane anesthesia (4% vol/vol) was applied via a facemask during tracheostomy and intubation and was maintained . Piglets were mechanically ventilated to maintain arterial partial pressures of O2  and CO2  allowing for temperature correction of the arterial blood sample.Thirteen large white male piglets aged <24 h were included in this study. Briefly, piglets were sedated with intramuscular midazolam (0.2 mg/kg), and arterial O2, PaCO2, pH, electrolytes, glucose (3\u201310 mmol/L), and lactate (Abbott Laboratories). Bolus infusions of colloid  and inotropes maintained MABP >40 mmHg. Arterial lines were maintained by infusing 0.9% saline solution  with heparin sodium (1 IU/ml) to prevent line blockage. Both common carotid arteries were surgically isolated at the level of the fourth cervical vertebra and encircled by remotely controlled vascular occluders . After surgery, piglets were positioned prone in a plastic pod with their heads immobilized.An umbilical venous catheter was inserted to infuse maintenance fluids , fentanyl (3\u20136 \u03bcg/kg/h), and antibiotics . An umbilical arterial catheter was inserted for continuous heart rate (HR) and mean arterial blood pressure (MABP) monitoring and 6-h blood sampling to measure PaOn = 7) insult was performed according to the original hypoxia-ischemia protocol with transient carotid artery occlusion and contemporaneous hypoxia (n = 6).Before insult, piglets were randomized into two groups, using a computer-generated randomization sequence and opaque sequentially numbered envelopes. The hypoxic-ischemic  to 12% (vol/vol).A magnetic resonance spectroscopy (MRS) surface coil was secured to the cranium, and the animal was positioned in a 9.4 Tesla Agilent MRI scanner, while in the MRI scanner, transient HI was induced by remote occlusion of both common carotid arteries, using inflatable vascular occluders, and reducing the fraction of inspired oxygen (FiOn = 7), cerebral energetics were monitored every 2 min by phosphorus (31P) MRS, and the \u03b2-nucleotide triphosphate  peak height was automatically measured. When \u03b2-NTP peak height had fallen to 40% of baseline, FiO2 was adjusted in order to stabilize \u03b2-NTP at that level for 12.5 min. At the end of this 12.5-min period, the occluders were deflated and FiO2 was normalized; 31P spectra were acquired for a further 1 h to monitor recovery from HI. The time integral of the decrement of \u03b2-NTP/EPP [EPP = exchangeable phosphate pool = inorganic phosphate + phosphocreatine + (2\u03b3 + \u03b2)-NTP] during HI and the first 1 h of resuscitation quantified the acute energy depletion. Piglets were maintained normothermic  throughout the entire experiment by using a warmed water mattress (Tecotherm) above and below the animal. All animals received continuous physiological monitoring (SA instruments) and intensive life support throughout experimentation.During HI  were evaluated. There were five regions of interest, namely, the SVZ, which was in turn divided into 3 subareas : roof, dParaffin-embedded brain samples were stained following the automated procedure corresponding to Hematoxylin-Eosin (H&E) staining by a Shandon Varistain V24-4  using Harris hematoxylin  and eosin Y .2.Histological changes were evaluated in the SVZ , caudate nucleus, and periventricular white matter brain regions at both bregma \u22122.0 and \u22124.0 levels , 2 by usin situ end-labeling of fragmented DNA was carried out on brain slices that were first deparaffinated, hydrated, pretreated in 3% H2O2, and subjected to a protease-K digestion . TUNEL was visualized using avidin-biotinylated horseradish complex  and diaminobenzidine/H2O2  enhanced with CoSO4 and NiCl2. Finally, TUNEL sections were dehydrated and cover-slipped with DPX .DNA fragmentation was revealed by using the terminal deoxynucleotidyl transferase-mediated incorporation of digoxigenin-labeled nucleotide (TUNEL) assay . Briefly, After deparaffination, antigen retrieval was performed using a pH 6 solution of 10 mM sodium citrate + 0.05% Tween20 in distilled water where samples were boiled 3 times before being kept for 20 min at 95\u201398\u00b0C. After cooling at room temperature, the endogenous peroxidase was blocked, and samples were incubated in 5% bovine serum albumin blocking buffer. Brain slices were then incubated with primary antibody rabbit anti-Caspase 3  overnight. The next day, samples were incubated with a biotin-conjugated secondary antibody  for 1 h at room temperature followed by horseradish peroxidase-streptavidin conjugate  plus diaminobenzidine. Right after, sections were counterstained with hematoxylin and mounted with DPX.2) and the average was converted into counts per mm2.An investigator blind to the treatment group performed the quantitative analyses of caspase 3 expression. For each level, section, and brain region, caspase-3 positive cells were counted in three fields  antibody to assess neurogenic activity close to the ventricular wall ; an anti-doublecortin (DCX) antibody was used to identify young neurons/neuroblasts ; cell proliferation was identified by an anti-Ki67 antibody . Double immunohistochemical staining was used to detect the cellular co-localization of Ki67 with Sox2 . Immunoreactivity was revealed using Alexa Fluor 488 and Texas Red  secondary antibodies incubated in the dark for 1 h at room temperature. After final washes, fluoromount aqueous mounting medium  was added, and each section was covered by a cover slip. Negative controls received identical treatment except for the omission of primary antibodies and showed no specific staining.Sections were examined using Fiji/ImageJ image software, and analyses and quantifications were performed by two independent investigators blinded to the treatment group. We extended the analysis including the cell-dense band of DCX + young neurons along the walls of the lateral ventricle levels . The SVZThe length of the GFAP positive cells processes lining the SVZ was measured and averaged using Fiji/ImageJ software in three separate microscopic fields at 40 \u00d7 in the roof, DL-SVZ, and L-SVZ areas with a fluorescence laser microscope. The software was previously calibrated, and the mean length of the processes was obtained after 6 random measurements  for each2.Quantification of Ki67 + and Sox2 + Ki67 + cells was performed in three non-adjacent fields of view at 20 \u00d7 magnification along the DL-SVZ and L-SVZ edges of the lateral ventricle , 19. In From sections stained with H&E, photomicrographs were obtained, and the area of neuroblast chains in the SVZ  was traFor DCX fluorescent immunohistochemical evaluation, all the immuno-positive areas along the SVZ were digitalized, and whole fluorescence was obtained because of the confluence of the expression . Neuroblt-test was performed for comparisons; data were considered significantly different if p < 0.05. Bar graphs appear as mean with 95%CI. Statistical analysis was performed using the Graphpad Prism 8 software package .A two-tailed, unpaired Student\u2019s In the sagittal section, the SVZ can be easily identified using conventional histological stains as an aggregation of small darkly stained cells located immediately adjacent to the ventricles and descending along the length of the dorsolateral  and lateral  walls of the lateral ventricle .p < 0.01), the L-SVZ (p < 0.01), and the DL-SVZ (p < 0.05) subareas showed significantly lower counts of morphologically well-preserved cells after neonatal HI (p < 0.05) and periventricular white matter\u2019s cellularity (p < 0.001) confirmed the decrease in well-preserved cells in the asphyctic piglet in both SVZ-surrounding regions  cells. After a HI event, the cellularity of the SVZ of the neonatal piglet was reduced. The roof (2) or apoptotic-like cells (0.7\u20131.2 cells per mm2) for both experimental groups, with no differences between control and HI in the three SVZ subareas evaluated . The absence of cell death in the SVZ was further confirmed when studying TUNEL immune-stained slices from both control and HI piglets  were rarely observed in the SVZ of control  or HI gr piglets .2; p < 0.01) and apoptotic  cell death, and an increase was observed for periventricular white matter for necrosis  or apoptosis . The lack of DNA fragmentation described above for the SVZ  reduced the length of GFAP + processes in the three subareas of the SVZ  in the SVZ was measured in the three SVZ subareas  to assess the neurogenic activity close to the ventricular wall. GFAP + cells showed a large cytoplasm with thin processes that can extend several micrometers away from the ependyma lining the lateral ventricle toward the inner brain parenchyma . The len the SVZ , graph.2) than in the DL-SVZ (44.13 \u00b1 9.33 cells per mm2). HI reduced cell proliferation by half in both L-SVZ  and DL-SVZ  regions  and DL-SVZ (p < 0.0001 vs. control) subareas  appeared in control  and HI  piglets,R2 = 0.6447, p < 0.0001). HI displayed a significant reduction in the area of neuroblast chains  and DCX immunofluorescence (p = 0.0044) compared with control animals , but few of those cells died , 23, witIn vitro studies support the evidence for strong homeostatic controls over SVZ cells  . GFAP waNeural stem cells give rise to type 2 progenitors that undergo rapid proliferation responsible for most of the expansion of the pool of newly generated cells. The piglet SVZ exhibits high postnatal cell proliferation potency even at 6\u20137 or 32 weeks of age . This caIn this study, the relative high abundance of neuroblasts revealed by H&E and DCX immunostaining in the SVZ of control animals was drastically reduced after HI. DCX is considered a marker of neuronal lineage/migrating neuroblasts. Its expression is thought to be specific for newly generated neurons, since nearly all DCX-positive cells express early neuronal antigens but lack antigens specific for glial, undifferentiated, or apoptotic cells , 37. TheAltogether, these results suggest that neurogenesis is reduced early after neonatal HI in the SVZ of the postnatal piglet, when HI-induced cell death is still ongoing in certain regions of the brain, which could compromise the replacement of the lost neurons and the achievement of global repair.The raw data supporting the conclusions of this article will be made available by the authors, without undue reservation.The animal study was reviewed and approved by Animal Care and Use Committee of University College London Biological Services and Institute of Neurology.DA-A, XG, PG, and NR contributed to the acquisition, analysis, and interpretation of data. DA-A contributed to the conception and design, analysis, and interpretation of data. DA-A and NR wrote the article. All authors revised the original manuscript and agreed on its contents.The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest.All claims expressed in this article are solely those of the authors and do not necessarily represent those of their affiliated organizations, or those of the publisher, the editors and the reviewers. Any product that may be evaluated in this article, or claim that may be made by its manufacturer, is not guaranteed or endorsed by the publisher."}
+{"text": "This study investigated the role of working memory capacity (WMC) in metaphoric and metonymic processing in Mandarin\u2013English bilinguals\u2019 minds. It also explored the neural correlations between metaphor and metonymy computations. We adopted an event-related functional magnetic resonance imaging (fMRI) design, which consisted of 21 English dialogic sets of stimuli and 5 conditions: systematic literal, circumstantial literal, metaphor, systematic metonymy, and circumstantial metonymy, all contextualized in daily conversations. Similar fronto-temporal networks were found for the figurative language processing patterns: the superior temporal gyrus (STG) for metaphorical comprehension, and the inferior parietal junction (IPJ) for metonymic processing. Consistent brain regions have been identified in previous studies in the homologue right hemisphere of better WMC bilinguals. The degree to which bilateral strategies that bilinguals with better WMC or larger vocabulary size resort to is differently modulated by subtypes of metonymies. In particular, when processing circumstantial metonymy, the cuneus (where putamen is contained) is activated as higher-span bilinguals filter out irrelevant information, resorting to inhibitory control use. Cingulate gyrus activation has also been revealed in better WMC bilinguals, reflecting their mental flexibility to adopt the subjective perspective of critical figurative items with self-control. It is hoped that this research provides a better understanding of Mandarin\u2013English bilinguals\u2019 English metaphoric and metonymic processing in Taiwan. Figurative language, e.g., idioms , metaphors , and metonymies , combines semantics and world knowledge with abstract reasoning and is used to convey thoughts, feelings, and ideas that may be inexpressible or less effectively expressed with literal language . TherefoThe issue of hemispherical processing for figurative language comprehension is still a debate. Research on the neural correlates of metaphor comprehension has historically focused on the role of right hemisphere (RH) contributions. Early neuropsychological research has suggested that the RH is necessary for understanding figurative speech ,9, whichOn the other hand, the neural basis for metonymic processing seems to be a new topic. Few previous attempts have discussed this issue. Recent behavioral research  with selThe overlapping process between WM and figurative language competence ,30 has mTwo further novel studies have explained how metaphor and metonymy are different, both cognitively and semantically. Fregni et al.  comparedGiven that both metaphoric and metonymic comprehension require inferential processing ,41,42, iBriefly, working memory (WM) is defined as the aspect of memory that involves the simultaneous storage and processing of information. Theoretically, WM is composed of three subcomponents: an executive attentional controller, a memory buffer for processing phonological information, and a memory buffer for processing visuospatial information ,49. The Neuroimaging research has demonstrated that the neurobiological basis of the WM procedure is known to involve the prefrontal cortex (PFC) ,55,56. FNotably, WM is also reflected in the inhibitory control areas associated with bilingualism and is studied in relation to vocabulary size ,61,62. IThe above arguments thus increased our curiosity about the potential effects of individual differences in vocabulary size, and how bilinguals process metaphors and metonymy. Another motive we have is that vocabulary knowledge and comprehension skills are correlated with verbal working memory and could be quality predictors for metaphor interpretations . ReceptiOur interest in different types of metonymies has been inspired by the only neuro-cognitive study (to the best of our knowledge) in systematic and circumstantial metonymy  so far. As previously described, substantial psycholinguistic ,88,89 anAdditionally, individual differences in cognitive capacities are associated with differences in the recruitment and modulation of working memory and executive function regions ,75, indiMetaphorical processing engages some crucial brain areas with metonymic processing;There are individual differences in WMC for bilinguals when comprehending metaphor and systematic and circumstantial metonymy;There are individual differences in vocabulary size for bilinguals when comprehending metaphor and systematic and circumstantial metonymy.Alternatively, we could expect a common neural signature for all types of figurative language processing because they all require a certain amount of non-literal understanding that goes beyond literal expression. As predicted by the standard pragmatic model, all types of figurative language violate the maxim of truthfulness ,92. PoteWhat are the neural correlates between metaphor and metonymy processing in Mandarin\u2013English bilinguals\u2019 minds?What is the role of working memory capacity in metaphor and metonymy in Mandarin\u2013English bilinguals\u2019 minds?What is the role of vocabulary size in metaphor and metonymy comprehension in Mandarin\u2013English bilinguals\u2019 minds?As such, we propose three research questions to guide the study:Data were initially collected from twenty-one Mandarin\u2013English bilinguals  recruited through various universities in northern Taiwan. Of these, 4 participants were excluded because of excessive head motion (greater than 2 mm) during fMRI data analysis; the remaining 17 participants, comprising 5 males and 12 females , were included for the whole-brain imaging analysis. All participants were right-handed and self-reported to have no history of neurological illness, brain injury, or psychiatric disease. They had normal or corrected-to-normal vision. Written informed consent, in accordance with the guidelines set by the National Tsing Hua University Research Ethics Committee and Imaging Center for Integrated Body, Mind, and Culture Research, National Taiwan University was obtained, and compensation fees were given to all participants.In addition to the scanner, a Language Background Questionnaire with selected parts from the Language Experience and Proficiency Questionnaire (the LEAP-Q) , a readiInside the scanner, the subjects undertook a valence judgement task under three intermixed conditions  of five language subtypes: systematic literal, circumstantial literal, systematic metonymy, circumstantial metonymy, and metaphor.The Language Background Questionnaire was designed anew; the LEAP-Q was adapted and utilized in this study in order to scrutinize subjects\u2019 English language learning experience, background, and proficiency. The LEAP-Q was constructed to assess foreign language learning experience and proficiency profiles in second and other foreign languages, irrespective of the specific languages involved. The internal validity of the LEAP-Q, the criterion-based validity of the LEAP-Q, and the predictive relationships between self-reported measures and performance on standardized language tests, as well as predictive relationships between language history and self-reported proficiency levels, have been recognized . Howeverhttp://www.pitt.edu/~tol7/res/research/psych-tests/rspan/, accessed on 7 May 2016), to indicate the significant reliability of working memory tests.Reading span tasks in both Mandarin and English were taken by 21 participants after the fMRI scan. According to Daneman and Carpenter\u2019s  classic During the RST procedure, subjects were required to remember two, three, four, five, or six alphabets while completing sentence semantic judgement tasks. That is, for each trial, two, three, four, five, or six alphabets would present, equally, three times in five blocks. Thus, there were 66 sentences. Another set of three two-alphabet trials in one block were used as practice trials.The Nelson\u2013Denny Reading Test  providesThe stimuli for the fMRI valence task were 63 English dialogic sentence sets with equal amounts of 21 literal, metaphorical, and metonymic dialogic sentence sets in English. Literal, metaphorical, and metonymic stimuli were all controlled in each task. Circumstantial metonymy is less contextualized than systematic metonymy. Hence, we assume that participants process circumstantial metonymy longer than systematic metonymy because of the familiarity shown in metaphorical comprehension ,108,109.A valence task was selected for several reasons. As Rapp et al.  proposedSubjects were given instructions and practice trials prior to performing the event-related design. There were two types of sentences in each trial: a context sentence and a target sentence. They were sectioned from a string of relevant pragmatic, daily, colloquial dialogue by different interlocutors or two logical narrative sentences. The context sentence was followed by the target sentence. During the valence task, in which subjects read and made a valence judgement within six seconds, they were asked to read each presented target sentence in the mind and decide, as fast and as accurately as possible, whether this condition (context plus target sentence) had a positive, negative, or neutral meaning, indicating their decision by pressing one of three buttons after reading the context sentence. The left index finger responded to negative meaning, the right index finger responded to positive meaning, and the right middle finger responded to neutral connotation. Complete sentences were visually presented via a mirror mounted above the head coil within the scanner. Each sentence was shown on one line in silver\u2013white letters against a black background. The task was implemented in 3 runs, with each run containing 21 stimuli of 3 intermixed conditions . For instance, in the literal condition, the context sentence \u201cOne Emergency Room nurse says to another:\u201d was followed by the target sentence for another 6 s, during which the participants made a valence judgement: \u201cThe patient in room 17B says she needs another pain pill.\u201d In the metaphor condition, the context could be \u201cAt a restaurant, a server says to a cook:\u201d and the following target sentence: \u201cThe fat pig on table 7 says he doesn\u2019t have enough eggs.\u201d In the metonymy condition, the context was provided as: \u201cIn a bar, an old bartender says to the new hire:\u201d, and then, the target sentence followed: \u201cThe martini at table 10 is a regular customer.\u201d During the inter-stimulus intervals, a fixation cross was displayed on the screen for 6 s.www.pstnet.com/e-prime/, accessed on 4 July 2016).The number of positive-valenced and negative-valenced sentences was balanced in all conditions. Each condition had an equal number of high- and low-concrete, familiar, and imageability sentences. Each inter-stimulus interval was 6 s. During the inter-stimulus intervals, a fixation cross was shown on the screen. Subjects\u2019 responses and reaction times (RTs) were recorded with E-Prime 2.0 software .Subjects\u2019 responses and RTs were recorded with E-Prime 2.0 software . Head motion was minimized using foam padding on the sides of the head. Right before the start of the experimental sessions, T2-weighted anatomical images were acquired in the same plane as the functional images using a turbo spin echo sequence . In each experimental session, 152 whole-brain echo-planar functional images were acquired in 33 contiguous 4 mm axial slices parallel to the AC-PC line . Before analyses, the first three scans of each session were discarded to account for the magnetic saturation effects. Whole-brain T1-weighted anatomical images (1 mm3) were also acquired prior to the experiments.Brain imaging data were acquired using a 3T Siemens Magnetom Trio, A Tim System scanner  equipped with a 12-channel standard head coil. Functional images were acquired with an echo-planar image sequence sensitive to BOLD-contrast . The volume covered the whole brain with a 64 \u00d7 64 matrix and 46 transverse slices . High-resolution MPRAGE 3D T1-weighted scans were also acquired for anatomical localization. Participants lay supine in the scanner where they could directly hear and respond verbally with the vocal transceiver in the scanning room from where instructions and auditory cues were delivered. Behavioral responses  were given via an MRI-compatible response  pad connected to a computer that logged reaction times. The same computer ran with E-Prime 2.0 software . Slice timing correction was performed, using the first slice as a reference, followed by the realignment and adjustment of head motion using the first image of each session as a reference after realigning the first image of each session to the first image of the first session ; functional and anatomical images were co-registered using a two-step procedure involving the participant\u2019s T2- and T1-weighted anatomical images. Functional images were spatially normalized to the standard stereotaxic Montreal Neurological Institute (MNI) space by applying the transformation matrix, derived by normalizing the T1-weighted anatomical image to the SPM 8 templates/T1.nii image.The resulting functional scans were preprocessed using Matlab  and SPM 8  outliers . Result2 = 0.757). This illustrates that, in Mandarin\u2013English bilingual minds, English WMC is strongly correlated with Mandarin Chinese WMC, which validates our research in studying the role of bilingualism in English and Mandarin speakers.Mean score of the reading comprehension was 21.62 , and the mean score of vocabulary was 35.50  from The Nelson\u2013Denny Reading Test . Englishp = 0.59)  . In consp = 0.08), with mean reaction time in the systematic subtypes  longer than that in the circumstantial subtypes , p = 0.08. Neither the main effect of language type nor an interaction between the two were discovered (both Fs < 1). This confirmed our speculation to such a degree that we further conducted a re-analysis of the fMRI data, focusing on systematic and circumstantial view analyses of the trials.To explore our speculation that items in the systematic literal and metonymies were unfamiliar (more difficult) to our subjects, we constructed another mixed effect model with language type  and subtype  as fixed effects, as well as random participants and items intercepts. The Type II Wald F test with Kenward\u2013Roger df showed a near significant effect of subtype  = 3.03, http://www.fil.ion.ucl.ac.uk/spm/software/spm8, accessed on 8 February 2017). The functional images of each participant were corrected for motion and realigned in the first stage of data analysis. T1 anatomical images were co-registered to the mean of the functional data and normalized with the MNI  152 template. Finally, the functional images were smoothed. Model time courses were calculated by defining stimulus onset asynchrony from the protocol using a convolved with the canonical SPM hemodynamic response function (HRF) to specify the design matrix. Condition and participant effects were estimated according to the general linear model (GLM) in each voxel.All image processing operations and analyses were performed with Matlab , and d SPM 8  written in Matlab by Thomas Nichols , and were in the range of 196 to 270 voxels.At the individual level, brain activity during the execution of the valence task was estimated on a voxel-by-voxel basis using the GLM implemented in SPM 8. The GLM had two regressors of interest in this study: vocabulary scores and working memory capacity scores. In the first level processing analysis, regressors of no interest were the six parameters describing head motion plus the constant regressors accounting for the mean session effect. Linear contrast images were generated for each participant using pairwise comparisons between tasks or between the task and the implicit baseline. The participant-specific contrast images of parameter estimates were used as inputs to a random effects model to permit group-level inferences. The resulting statistical maps were submitted to a voxel-level threshold of For the two variables of interest in the second-level analysis, we constructed two regression models, respectively: one with vocabulary size as a regressor of interest and working memory as a controlled covariate; the other model with working memory capacity as a regressor of interest and vocabulary size as a controlled covariate .In the contrast of META > METO, surprisingly, we did not find a significant difference based on voxel analysis in our Mandarin\u2013English bilinguals. However, understanding how figurative expressions pose a challenge for the overall language processing mechanism is vital. Previous research has presented that metaphorical conceptualizations might be stored as fixed neural circuits in the brain that are automatically activated when processing metaphors . In an fTo process an unfamiliar figurative expression, increasing the engagement of the RH in order to compute more complex semantic information has been reported in Giora, Zaidel, Soroker, Batori, and Kasher\u2019s research . They foThe contrast of METO > META in our study, which has not yet been compared in other studies, suggests the primary involvement of the SupraMarginal, cerebellum, and precentral gyrus regions, as displayed in This speculation is supported by our cerebellum evidence. As formerly mentioned, we have pinpointed cerebellum activation to attention, phonological, and semantic activity. Essentially, the role of the cerebellum is empirically related to its role in linguistics , as wellWhile research into the lesions of these regions has identified the cerebellum\u2019s linguistic role, our findings may provide new insights into the neural connection between the cerebellum and different figurative language types. Therefore, in line with the recent studies in cerebellar theory related to reading, our findings further strengthen the link between the cerebellum and figurative language processing. In addition, the precentral gyrus has been implicated in mental imagery strategies and episodic memory retrieval , which aIn order to fulfill our research questions further, we conducted another whole-brain correlation analysis. We distinguished our stimuli with three conditions  into \u201csystematic\u201d and \u201ccircumstantial\u201d views and, thus, into five subtypes: systematic literal, circumstantial literal, systematic metonymy, circumstantial metonymy, and metaphor contrasts.In This contrast presented in Our results of large right-activated regions in the superior temporal gyrus (STG) and posterior cingulate cortex are in line with RH involvement with increased demands ,129 and The role of working memory capacity is primarily significant in metonymic processing and is highlighted under both circumstantial metonymy and circumstantial literal comprehension.Remarkably, the cuneus has been found to be mainly evoked in the RH. In addition to the traditional role as a site for fundamental visual processing, gray matter volume in the cuneus is associated with better inhibitory control . BilaterEvidently, the cerebellum was prominent in the correlation between working memory capacity and circumstantial metonymy condition in our study . In the In this study, similar fronto-temporal networks for figurative language processing patterns were found: the superior temporal gyrus (STG) and the inferior parietal junction (IPJ) for metaphor and metonymy comprehension, respectively. The STG was activated in metaphorical comprehension, as is also discussed in the previous literature . The IPJWe found out that the described neural correlates link directly to metaphor and metonymy processing, as well as the effects of WM and vocabulary size. Our first hypothesis was supported by the metaphorical processing demonstrated, which linked some important areas of the brain with metonymic processing. Our results are also consistent with the cognitive and linguistic activities of cerebellar engagement in metonymy interpretation. The second and third hypotheses were partially supported by the whole-brain volumetric analysis, but the effects of WM and vocabulary varied. The only WM effect that this study has proven is circumstantial metonymy contrast. We did not find neural correlation between working memory capacity and metaphor comprehension, as presented in Chiappe and Chiappe\u2019s inquiry . HoweverNo neural correlations were found between systematic metonymy, the effects of WM, or the size of the lexicon. According to the Graded Salience Hypothesis ,105,106)Furthermore, as previously unfolded in our literature review, the evidence from psycholinguistic and neurolinguistic studies propose that metonymy comprehension not only involves consideration and the subsequent rejection of a literal sense, but it also often involves the knowledge of cultural conventions and idealized cognitive models, if only at a subconscious level. As a result, beyond the traditional definitions and linguistic structures of both metaphor  and metonymy  , we propSince the awareness of conceptual metaphors does not guarantee bilingual learners\u2019 automatic access to conceptual metaphor and metonymy comprehension, nor their active computation of metaphorical/metonymic mappings  during fIn our study, several limitations regarding the sample size and individual study parameters should be acknowledged. The first limitation stems from the gender distribution. In light of the gender differences in the human brain structure  and in lThe effects of WM and vocabulary size were found in circumstantial metonymy rather than in metaphor and systematic metonymy comprehension. However, inhibitory control and cerebellar association in bilingualism ,149,150 Taken together, in our volumetric analysis, both the left posterior PFC (BA 44/9) and the left PFC (BA 47) received activated responses. Linking with the left tempo-frontal network for figurative language processing, these regions have been suggested to robustly connect with the controlled retrieval and selection of information from semantic memory . The corFuture research should study the relevance between neural efficiency and different types of metonymies  and how the RH recruits more neural resources to support bilateral computation in dynamic patterns for bilingual speakers with native languages other than English. Our fMRI evidence suggests that it is critical to reinforce the neuro-cognitive and neurolinguistic foundations of metaphor and metonymy reading in bilingualism. Apparently, the area of neural correlation between metaphor and metonymy processing with Mandarin\u2013English bilinguals calls for much more research. This approach promises to provide greater insight into the flexible neural mechanisms of figurative languages and other cognitive abilities for bilingualism."}
+{"text": "Current interest toward ionic liquids (ILs) stems from some of their novel characteristics, like low vapor pressure, thermal stability, and nonflammability, integrated through high ionic conductivity and broad range of electrochemical strength. Nowadays, ionic liquids represent a new category of chemical\u2010based compounds for developing superior and multifunctional substances with potential in several fields. ILs can be used in solvents such as salt electrolyte and additional materials. By adding functional physiochemical characteristics, a variety of IL\u2010based electrolytes can also be used for energy storage purposes. It is hoped that the present review will supply guidance for future research focused on IL\u2010based polymer nanocomposites electrolytes for sensors, high performance, biomedicine, and environmental applications. Additionally, a comprehensive overview about the polymer\u2010based composites\u2019 ILs components, including a classification of the types of polymer matrix available is provided in this review. More focus is placed upon ILs\u2010based polymeric nanocomposites used in multiple applications such as electrochemical biosensors, energy\u2010related materials, biomedicine, actuators, environmental, and the aviation and aerospace industries. At last, existing challenges and prospects in this field are discussed and concluding remarks are provided. \u03c0\u2013\u03c0, hydrogen interaction, ion\u2010exchange, electrostatic, and dipolar relations, are discussed in detail.In this study, ionic liquids based polymer composites and their exceptional physicochemical characteristics and their capability to bond by analytes via multiple interchanges, such as  These characteristics differentiate ILs from molten salts. ILs are constituted by various organic cations, and anions that are organic or inorganic. ILs show unique properties depending on their various configurations, based on hydrogen bonding, columbic forces, and van der Waals interactions between ions, i.e., cations and anions. Ionic liquids also possess a moderate vapor pressure, which is lower than their decomposition temperature. The majority of the ILs compounds are liquid at 20\u00a0\u00b0C, i.e., at room temperature.The discovery of water and air\u2010stable ionic liquids (ILs) by Wilkes in 1992 has opened a new field of interest within the advanced multifunctional materials community. During the last 20 years, more focus has been paid to ILs because of their novel and adjustable physical and chemical features.1 ILs  Few ILs\u2010based polymers are supposed to be exclusively ionic, while being defined as deep eutectic solvents (DESs) and protic ILs (PILs) that are rare with the reagent of Olah's. Furthermore, ILs have a significant lower viscosity and vapor pressure, and they may not vaporize easily beneath room temperature. ILs are also soluble in various solvents, can be acid and base, have wide\u2010range temperature steadiness, and are much less prone to corrosion than inorganic acids and bases. Because of their nominal vapor pressure, ILs do not describe the explorer threat compared to ignitable organic solvents. ILs also do not show any harmful effect on the photochemistry of the environment. Furthermore, the essential lack of vaporization in ILs provides nonflammability below room temperatures; this includes some solvents with a lower boiling point, for example, pet ether, dichloromethane acetone, etc.The classical configurations of ILs in ambient condition or beneath \u2264100\u00a0\u00b0C can assume fused, molten, and liquids organic salts.5 Few  Focus has also been placed about the descriptions of distinct functionalities, ILs with chiral center, ILs conversion of a solvent's polarity, bio\u2010based\u2010ILs, polymerized ILs, active ILs, unbiased ILs, protic ILs, metal ILs, base ILs, sustainable ILs, and ILs preparation routes. Herein the presented review, we try to collate a comprehensive list of details related to the general overview of polymer\u2010based composites\u2019 ILs components, including a classification of the polymer matrix. Furthermore, more focus is placed on ILs\u2010based polymeric nanocomposites used in multiple applications . We then finally discuss existing challenges and prospects in the ILs field.Structure and functions of ionic liquids have been previously discussed in scholarly works related to the characterization of ILs.9 Focu2 By providing atmospheric condition, in 1940, at the Rice Institute of Texas, two scientists, Frank Hurley and Tom Weir designed liquid salts. When a salt of alkyl pyridinium chloride was mixed with aluminum chloride (AlCl3) and converted into a transparent liquid, it was called an ionic liquid. Their finding about ILs remained a chemical curiosity until the following years.ILs are usually described as compounds comprised of cations and anions having melting temperature under 100\u00a0\u00b0C. Paul Walden reported the initial IL (ethyl ammonium nitrate) in 1914, and ILs were not recognized as a significant scientific field until after nearly one century.21 By Figure\u00a0Figure\u00a0ILs are liquids prepared from cations and anions. Some general examples of cations and anions have been shown in  materials science, chemical engineering, and environmental science. Furthermore, ILs show clear advantages for the preparation, catalysis, physical chemistry, electrochemistry, energy fuels, heredity, nuclear physics, medicinal chemistry, engineering, at manufacturing and laboratory scales. Figure\u00a0ILs as paradigmatic new classes of fluids have attracted significant attention only during the previous two decades. The number of science citation index (SCI) articles published on ILs has exponentially grown from isolated articles, to more than 5000 between 1996 and 2016; the yearly rates of growth of papers about ILs has surpassed those of other popular scientific topics. This suggests that more and more investigators are involved in the exploration of this exciting field. The investigation of ILs is a multidisciplinary endeavor that involves analytical chemistry,24 matILs are liquids prepared from cations and anions. These ions are generally connected via different kinds of bonds. They are related to multiple physical and chemical characteristics, with deficient to nearly inconsequential vapor pressure, adequate thermal strength, and many more may be utilized as a green solvent and/or composite.2.1\u22121 at 250\u00a0\u00b0C and higher conductivity stability. Further, an IL\u2010based ionic electroactive polymer (IL\u2010iEAP) transducer design for highly developed applications in biological and electronic areas. The advanced functionality of this IL\u2010iEAP is in 3D\u2010printing. A study shows that when alkyl imidazolium\u2010 and alkyl phosphonium\u2010based IL incorporated with biodegradable polymers composite (BPC), i.e., polylactic acid, polybutylene succinate, and polycaprolactone, which all enhance the thermal, chemical, and mechanical properties of polymers composites. Alkyl imidazolium\u2010based ILs provide BPC a prominent elongation quality, excellent thermal stability, and superior compatibility. On the other hand, alkyl phosphonium\u2010based ILs provide BPC with a better tensile loading capacity, superior thermal stability, and better multiphysics interaction. Fan et\u00a0al. reported Ti3C2\u2013MXene blended layer functionalized with polypyrrole and IL\u2010based microemulsion fragments for supercapacitor applications. The above\u2010fabricated film shows outstanding specific capacitance, rate capability as well as cycling stability in between 4 and 50\u00a0\u00b0C. Further, the highest gravimetric density of 31.2\u00a0Wh kg\u22121 (at 1030.4 Wh kg\u22121) was exhibited by the fabricated film at room temperature for devices that are based on symmetric super capacitors.ILs constitute a new category of chemical substances for superior (multi)purpose materials, with excellent prospectives of implementation in numerous fields because of their distinctive properties and functions. The introduction of various other substances can customize the properties of the ILs; one of them is polymers. The amalgamation of ILs with a particular type of polymers opens the opportunity to increase new substances having distinct structure such as membrane, films, fibers, etc. for the stimuli\u2010responses with customization, as a novel proposal for highly developed multifunctional materials. Moreover, the relationship between the chosen IL charges, i.e., cations and anions, also provides a significant functionality to the composite materials when combined with the polymer chains. The amalgamation of various ILs with different polymers opens new areas of applications in the field of sensors, drug delivery, actuators, batteries and fuel cells, environment, and biomedical. The functionalities of ILs can also be instrumental in enhancing the properties of future generations of composite structural batteries; ILs composites/nanocomposites could be integrated within the battery's architecture to increase energy density and tuning of the dielectric properties. For example, an IL, namely, diethyl methylammonium trifluoromethanesulfonate ([dema][TfO]) mixed with a polymer, i.e., polybenzimidazole and an IL\u2010based polymer electrolytes for fuel cells fabricated having operating temperatures above 100\u00a0\u00b0C. The membrane shows better thermal stability, high proton conductivity, i.e., 108.9 mS cmtability.37 Fur2.2This section summarizes the recent strategies for the fabrication process of IL\u2010based polymer composites, such as in situ polymerization, melt mixing, solution blending, and the use of ILs as filler to the polymer matrix. Another example of one\u2010pot in situ polymerization is synthesis of reduced graphene oxide (rGO)@poly(ionic liquide) (PIL)/PBO where 1\u2010vinyl\u20103\u2010aminopropylimidazole tetrafluoroborate (IL) converted to poly(1\u2010vinyl\u20103\u2010aminopropyl imidazolium ionic liquid) (PIL\u2010NH2) by in situ free radical polymerization where PIL attached to rGO by \u03c0\u2013\u03c0 conjugation with improved dielectric properties, thermal stability, and high energy density. Shamsuri et al. provided a review on the employment of ILs as fillers that form a biodegradable polymer composite. Such ILs\u2010based biodegradable polymer composites were found to exhibit dual benefits, including improvement in properties and environment\u2010friendly polymer matrix.A facile and environmentally friendly route of IL\u2010based polymer nanocomposites fabrication involved the use of 1\u2010butyl\u20103\u2010methylimidazolium bromide as ionic liquid and polyaniline as polymer matrix and was synthesized using in situ polymerization and a cationic surfactant CTAB. This method helps retain the composite's conductivity with a frequency 3\u00a0MHz and temperature 120\u00a0\u00b0C.40 Ano6) \u2212 >> (Br)\u2212 also provides a pathway to select the anion for a thermal application. In addition, the length of the alkyl chain could also participate in affecting the properties. Fedosse Zornio et al. studied and compared the chemical nature of 1\u2010butyl\u20103\u2010methylimidazolium, N\u2010trimethyl\u2010N\u2010butyl ammoniun, N\u2010trimethyl\u2010N\u2010hexyl ammonium as cations and bromide, hexafluorophosphate, bis(trifluoromethanesulfonyl)imide as anions in poly\u20101\u2010(methyl methacrylate) (PMMA) polymer matrix.As we know, ILs are composed of different cations and anions. The selection of these during the preparation of ILs\u2010based polymeric nanocomposites plays a crucial role. Apart from the type of polymer matrix, ILs compositions like the size of ions, length of an alkyl chain, type of anion, and interaction between the ions could also affect the properties and hence application of the ILs\u2010based polymer composites. For example, ILs based on ammonium, imidazolium, and phosphonium cations could be an alternative to traditional plasticizers of PVC because of their diffusion rate. The size and molecular structure of cations and anions in an IL contribute to the diffusion rate, intermolecular interactions, and hence localization to the polymer matrix. The thermal stabilities of some of the anions (bis(trifluoromethanesulphonyl) imide, TFSI)\u2212 > , bast , fodder and reed (rice husk), core , seed , and all other types of fibers originated from timber and wood.Figure\u00a0Numerous investigators have documented the benefits of cellulosic fibers: the latter are functional, nontoxic, renewable, low\u2010cost, and provide essential bonding with the matrix for load\u2010transfer capabilities that enhance flexibility and toughness under bending, all properties that affect the structural resistance.51 Cur3.1.2 The function of the matrix is to form a connection with fibers and avail a reinforcement and desired structure to the final composite. The characteristics of the matrix decide the resistance power of the polymer composites to impact damage, attack of chemicals, high\u2010temperature creep, and water absorption. There are various thermoplastic matrices with a broad scope of refreshing characteristics. Due to its lightweight, excessive mechanical power and protection from the adverse consequence of the environment, in various applications, thermoplastics are used as absolute substances.The matrix can be a thermoset polymer like polydicyclopentadiene, epoxy resin, or polyimide or can be a thermoplastic like polystyrene (PS), polypropylene (PP), acrylic, polyesters, and epoxy resins be elastomer type.55 The3.2Figure\u00a0Based on the source, the type of reinforcement and type of matrix polymer composites are classified. 3.2.1 Fiber\u2010reinforced composite materials, unlike other composites, can be recycled 20 times, allowing scrap and can be reused multiple times.Fiber\u2010reinforced composites are high performing fiber\u2010based composites and are composed of cross\u2010linked cellulose\u2010based fiber molecules, which include resins in the fiber\u2010reinforced composite matrix by a patented molecular re\u2010engineering phenomenon, resulting in an invention of excellent structural characteristics. With the aid of molecular re\u2010engineering, wood's desirable material, and structural characteristics are positively cloned and clad in the fiber\u2010reinforced composite product, that yield more significant characteristics and performance than the existing wood.57 Fib Also, natural fiber composites are cost\u2010effective, renewable materials that contribute to reduce CO2 and other emissions, and are environmentally friendly.These are the materials in which the fibers reinforced in nature are made up of some substances like plants and wood that act as renewable resources for carbon dioxide. Their environmental and biological durability is frequently quoted as a critical benefit to them compared to conventional materials. Natural fibers have received special attention from engineers, technologists, manufacturers, and industrialists due to their vast prospective and applications in various engineering functions in the railway, building construction, automotive, defense, packaging, and general secondary\u2010load bearing applications.58 Als Biocomposites frequently mimic the living materials structure involved in the process used for maintaining matrix strengthening properties by always providing biocompatibility. The matrix part is derived with polymers like\u2014for example\u2014polyester and natural rubber. Those polymers are obtained from renewable and nonrenewable resources. Biofibers are divided into two parts, i.e., wood and nonwood fibers, all of which present lignin and cellulose. Fibers are crucial elements in the design of biocomposites and can be obtained from biological sources like animals or plants , silk or crop processing byproducts). Biocomposites are promising materials for potential future applications in the automotive and\u2014more generally\u2014the transport, apparel and packaging industries. Their attractive features, i.e., sustainability and renewability and further being biodegradable, make biocomposites a \u201cmaterial of the future.\u201d Easy to dispose of and because of organic fertilizers characteristic of biocomposites later than the expiration is significant advantages of biocomposites, this is not usually possible with traditional synthetic substances.These are composite materials made up of matrix (resin) and reinforcement of natural fibers.60 Bio3.2.2Depending upon the type of matrix, polymer composites are classified into three types. Basis of used polymer composite material are classified into three categories.It comprises numerous short and continuous fibers bound collectively via an organic polymer matrix. These composites are usually made for load among fibers of a matrix. They are lightweight, highly stiff, and has high strength and reinforcement.63 Bas Due to their higher viscosity, they are less used as a high\u2010tech material because of problems related to the effective wetting of the reinforcement during thermoforming, with the formation of porosity. The thermoplastic matrices are arranged in straight chains that can change the melted form. Generally, they are prepared by heating after shaping, injection, taking out, or thermoforming earlier than cooling. In this way, the final output retains the initially designed configuration, and this process can be reverted. Thermoplastic matrices are resistant to oxidation and corrosion with good electrical and thermal insulating properties; they are used in many applications as ideal materials because of their excellent properties like lightweight and resistance to environmental effect.Thermoplastic resins commonly used in composite materials are typically high\u2010density polyethene, PP, poly(vinylidene fluoride) (PVDF), and polylactic acid.64 Due Those matrices can be fashioned elastic like rubber, tough like metal and concrete, or translucent like glass to obtain multiple functionalities. Those matrices do not oxidize, have an elevated protection from deterioration, and offer superior insulation for heat and electricity. Owing to their lightweight, mechanical stability, and resistance to environmental challenges, thermoplastics are excellent materials for a wide variety of uses.The thermoplastic matrices are present in the shape of unbent chains that may be altered within the melted form. In highly automated manufacturing processes, the thermoplastic matrices are warmed then assembled with injection moulding, extraction or early thermoforming. This process is reversible. Reversibility is important, because it makes thermoplastic matrices recyclable, with a significant positive impact to the life cycle of the products and the overall global warming potential of composites made with those matrices. There are numerous thermoplastics, including a broad range with exciting characteristics.66 Tho They are liquid at room temperature and can be solidified during implementation of warm, and an additional material known as hardener. In this way they are converted by heating, a type of chemical change\u2010making 3D strong bond. This is a permanent change and cannot be reversed. Due to this process, the material becomes insoluble in solvents like alcohols, hydrocarbons, ketones, etc. They are harder than thermoplastic matrices, crease\u2010resistance, and better\u2010woven fibers.Thermoset polymer composites consist of unsaturated polyester epoxy vinyl ester that acts as resins. They are primarily used in automotive, aerospace, naval, and aeronautical applications.67 The The most common used thermoset matrices are polyesters, phenoplasts, epoxy resins, polyurethanes (PUs), phenolic, polymides, bis\u2010maleimides, and silicones.Typically liquid on ambient conditions, thermosets harden when subjected to heat and a hardener stabilizer. Therefore, curing affects the behavior of thermosets, inducing a chemical conversion with three different types of bonds among molecules. This operation is permanent, and once the material is melted is not soluble anymore within the mix of solvents . These materials are stiffer compared to thermoplastic matrices and are appropriate for moulding/resin infuse reinforcements with small, long or woven fibers.68 The Various formulations permit the development of artificial rubbers for different applications. Elastomers are used to manufacture pillows, specific insulators, shoe soles or tires.Elastomer polymers have the same flexible grades of natural rubber. An inactive elastomer includes extended chains of molecules that are joined with each other one by one. The molecules of elastomers may have relative motions relative to each other and distort. For better elastic properties, the base materials are vulcanized. Vulcanization makes the elastomer hard, and helps forming a better or slightly more rigid 3D structure without major detriment to the elasticity of the molecular chains. Sulfur, carbon, and diverse chemically active compounds are present within an elastomer.69 Var To resist high temperatures, i.e., 300\u00a0\u00b0C of metal matrices, carbon\u2010steel fibers are used. Some other commonly used heat resistance metal fibers are tungsten, molybdenum, and boron. Metal matrix composites require reinforcements that are stable over a wide range of temperatures, and chemically inert. Due to an increase of the melting point of the matrix material, their reinforcements becomes small.Metal\u2010based fibers are reinforcements with specific high\u2010toughness. They are generally used for the strengthening of metal matrices via stacking and alternate bonding. Their demand is low because of their high cost.70 To  The single phases of CMCs are brittle, To overcome the disadvantage of monolithic ceramics , CMCs are developed. CMCs are rigid materials and show potential failure behavior during FM bonding. Improvement of the bonding between the reinforcement and the ceramic matrix is generally obtained by using a fiber coating, known as interphase. CMCs are used primarily in applications where resistance to high temperatures and corrosive environments are required. They lack toughness but are quite strong and stiff, although CMC with architected reinforcements can provide significant resistance to high\u2010temperature creep, even at low volume fractions of reinforcement. Matrix materials mainly used in CMCs are silicon carbide, nitrides, mullite, and aluminum oxide, whose strength is maintained up to 1649\u00a0\u00b0C. They are generally used in automobile engines, cutting tools, mining, and spacecraft applications.CMCs are technical ceramics, as well as composite materials. They are designed with ceramic fibers embedded in a ceramic\u2010based matrix.72 Theb\u2010polystyrene)6 ((MS)6), which acts as a polymer gelator host for polymer\u2010based gel electrolyte. The six\u2010armed copolymer exhibits enhanced mechanical characteristics, approximate elasticity \u22482.5 \u00d7 104\u00a0Pa, and better ionic conductivity \u22481.54 mS cm\u22121 at room temperature. Thermal stability also increases by using this star\u2010shaped copolymer . So that recently designs of these polymers attracted much interest for the enhancement in the mechanical and conductive properties of materials. Gelators are present in two forms one is homopolymers, and another is copolymers. A triblock copolymer is a good host material for mechanical robustness out of these two versions of polymers. In a triblock copolymer, both end blocks are insoluble in short ILs. Upon mixing, they aggregated in the form of hard spherical domains and increased the IGs mechanical properties. On the other hand, ILs\u2010soluble midblock of copolymer on mixing with IL makes the ionic conductivity robust and hence initiates the electrochemical process. In this direction, a star\u2010shaped copolymer was fabricated by some researchers (poly(methyl methacrylate)\u2010r Figure\u00a07a.. The fabricated materials show better elasticity of 0.105\u00a0MPa and good ionic conductivity of 1.15 mS cm\u22121. Figure\u00a0\u2010ran\u20101\u2010(4\u2010vinylbenzyl)\u20103\u2010methylimidazolium hexafluorophosphate].Furthermore, by using a reversible addition\u2013fragmentation chain transfer polymerization approach, a conductive IGs can be fabricated by using an IL 1\u2010ethyl\u20103\u2010methylimidazolium bis(trifluoromethylsulfonyl)imide and a copolymer (random) poly[styreneosphate].756)2) and dmFc were mixed within a gel comprised of P[S\u2010r\u2010VBMI][PF6] and [EMI][TFSI] as an electrochromic (EC) chromophore and anodic species. Figure\u00a02+/EV+\u2022 and dmFc+/dmFc ensued reversibly. Depending upon the start potential of dmFc oxidation (\u22120.07\u00a0V) and EV2+ reduction (\u22120.65\u00a0V), it is anticipated that the device coloration to start around \u22480.6\u00a0V. UV\u2013vis absorption ranges were documented to study the potential reliance of the optical characteristics of the apparatus   Figure\u00a0 and opti) Figure\u00a0. Around s Figure\u00a0. to form an IGs. The fabricated ion\u2010gel\u2010based materials were used by various devices like the casting of solvents, printing with aerosol jet, etc. It was also found that these IGs are used in electroluminescent and electrochromic display with sensors, supercapacitors, etc. They are also a good substitute in biocompatible and biorenewable systems. In this an ion gel was prepared by using self\u2010aggregation of triblock copolymers poly(styrene\u2010b\u2010ethylene oxide\u2010b\u2010styrene) and poly(styrene\u2010b\u2010methyl methacrylate\u2010b\u2010styrene) with IL (room temperature) 1\u2010ethyl\u20103\u2010methylimidazolium bis(trifluoromethylsufonyl)imide, the ionic conductivity lies from 3 \u00d7 10\u22125 to 3 \u00d7 10\u22122 S cm\u22121 and specific conductance 0.3 to 10 \u00b5F cm\u22122.A combination of an ABA type copolymers with ILs was shown by Lodge and Ueki76 to 3.2.3Reinforcement is strong inactive and unwoven fiber\u2010like materials mixed with matrix to enhance the physical and mechanical properties, e.g., boron, jute whiskers, asbestos, etc. Based on reinforcement, polymer composite is classified as follows.In today's scenario, we need low cost, lightweight materials with high mechanical properties and good chemical resistance. To attain these achievements, fibers or carbon fibers composite is used as reinforcement material that adds desirable properties to composites, e.g., carbon fibers, glass fibers like metal and ceramic used latterly to make composite materials stiff and heat resistant.79Discontinuous face as fibers which is also known as the dispersed phase.Continuous space as a matrix.Interface is also known as the fine interface part.Fibers composite material has three integral parts.The effect of fibers composite can be evaluated by length, structure, constituents of fibers, and the mechanical impact of the matrix. The alignment of fibers also plays an essential function in the strength of the composite, i.e., the longitudinal direction has excellent strength. Many organic as well as inorganic fibers are used as strengthening materials in the composite. Organic fibers like glass, silicon carbide, carbon fibers or graphite fibers, some multiphase fibers etc., are used, which are of the high elasticity, high thermal strength, and greater hardness compared to organic fibers. On the other hand, organic fibers with low density are stretchable and bouncy. Those are used primarily in electronic ceramics. Polymeric reinforcements and matrices tend to be used quite extensively in transport, aerospace, and constructions applications. Strength and toughness are achieved in laminar ceramic composites by either providing the reinforcement inside the layer, and/or reinforcing the layer interface.Laminar reinforcement composite is used to enhance the mechanical properties of structural units. Laminated composites are made from stacking various layers, leading to improvements of strength and hardness . Laminates are based on tape casting, which allows only a preferred orientation of the reiforcements. Laminar composites tend to be prepared using an organic matrix, leading to the stacking of layers into the different architectures.80 Tho The composites show yield, fatigue, and strength, but in general poor ductility, especially in the case of thermoset matrices. From the early stage of the formation, cracking MS of particles or bonding damage at the matrix interface occur. Particulate\u2010based materials are in general classified as follows.i)Particle reinforced composites, in which particle and matrix do not interact at the atomic/molecular level. Particles are significantly stiffer than the matrix; hence load bearable, e.g., concrete.ii)Dispersed strengthened composites, in which particle and matrix interact at the atomic level, leading to strengthening, e.g., thoria dispersed nickel.Particulate reinforced composites contain hard material dispersed uniformly in a matrix. Those composites are used in engineering components because of their mechanical property. Examples are metal matrix and polymer matrix composites.81 Theparticles\u2019 diameter,interparticle distance, andreinforcement volume fraction.The performance of these composites is based onBesides the above\u2010discussed reinforcement materials, other components like fillers , whiskers, flakes, directionally solidified eutectics, etc., are also used to enhance or improve various desirable sets of properties of polymer, metal or ceramic\u2010based composites.3.3Figure\u00a0ILs consist of some distinctive chemical arrangements that can generate a series of attractive forces like van der Waals, electrostatic, Coulombic forces, and hydrogen bonds. ILs can be applied to different applications by tailoring the choice of particular cations and anions. The various interacting sites of an IL cation imidazolium are shown in  During the formation of IGs, ILs act as structural media while the formation of inorganic IGs occurs. IGs carry all the characteristics of ILs except the nature of outflow. On the other hand, like ILs, they also allow shape\u2010changing and have many applications. As a result, IGs are used to form good types of solid electrolyte membranes used in all types of solid appliances like fuel cells, lithium batteries, dye sensitized solar cells, etc. Further, the function of IGs improved by two methods: i) introduction of organic function in solid matrix, and ii) encapsulation of some molecular moiety into the stable IL phase, this leads to fabrication of some advanced substances like sensors, drug releasing system, formation of biocatalytic membranes, etc.In essence, IGs are solid\u2010electrolyte based ILs and are prepared by the introduction of ILs into solid organic or inorganic type host substances. Compared to conventional ILs, IGs exhibit better chemical, thermal, electrochemical, and mechanical stability and good ionic conductivity.82 Dur also fabricated tetra\u2010arm poly(ethylene glycol) (Tetra\u2010PEG) IGs by introducing an ILs based on imidazolium into less concentration, i.e., 3 to 6 wt% of Tetra\u2010PEG. The prepared Tetra\u2010PEG IG exhibits superior mechanical characteristics as the compression and stretching test results. This IG is also used in electrochemical devices and the formation of membrane that separate and adsorb CO2. Amino acid\u2010based IL is used to make tough IG membrane used in CO2 capture. Further epoxy\u2010amine\u2010based IG membranes were prepared that facilitate the transport of CO2 versus CH4 in a dry either humid mixed gas supply situation that is appropriate to the separation of biogas. Ueki et\u00a0al. reported a composite material that was based on an IL, namely, 1\u2010butyl\u20103\u2010methylimidazolium hexafluorophosphate and a triblock ABA copolymer (A = poly(ethylene oxide) B = thermo\u2010 and photosensitive random copolymers with N\u2010isopropylacrylamide and A = 4\u2010phenylazophenyl methacrylate including azobenzene chromophore). The composite material shows transformation from sol to gel on irradiation of UV radiation at 47\u00a0\u00b0C. The spoiled ABA IG performs a photohealing capability that depends on extreme changes in the flow of IL\u2013polymer composite initiated by illumination of light and results into repairing by filling cracks and cracks was fixed by using gelatin with visible light. Further, a triblock copolymer photoreversible gelation in an IL is synthesized by Ueki et\u00a0al., which shows reversible sol\u2013gel transformation at 53\u00a0\u00b0C. Based on photodimerization of anthracene, a photohealsble IG was fabricated as a movable dative bond. A Tetra\u2010PEG and anthracene\u2010based materials are fabricated and introduced with ILs to form an IG. Further, the photohealing of the IGs was done with the help of the photodimerization process. A highly sensitive porous IGs are fabricated in which an IL 1\u2010ethyl\u20103\u2010methylimidazolium bis(trifluoromethylsulfonyl) imide and a cross\u2010linked polymer poly(ethyl acrylate\u2010ran\u2010styrene\u2010randivinylbenzene) are added with each other by using in situ cross\u2010linking polymerization further sugar cubes inverse replication. When these porous IGs are applied over skin, the resulting ionoskins show superior sensitivity and good detection power . These ionoskins monitor various human activities like swallowing saliva, elbow bending, locomotion, bending and tapping of fingers, and air blow. IGs are used in various electrochemical applications like electrochemical display, smart sensing systems, functional electrochemical energy system like production and its storage.Fujii et\u00a0al.84 als3\u2010doped ITO probe and then positioned another ITO plate at the canopy of the gel. The ideal EC features of the apparatus contained a high coloration efficiency of \u224861.9 cm2 C\u22121, a significant transmittance disparity of \u224891%, and better coloration/bleaching cyclic strength around 10\u00a0000 runs. Significantly, the EC behavior was well\u2010synchronized, including the optical evolution \u2010b\u2010poly(dl\u2010lactide)\u2010b\u2010poly. A thermoplastic elastomer\u2010type self\u2010aggregated cross\u2010linking is formed, leading to the mechanical enhancement with same processing situations, further hydrolytic breakdown of these IGs possible due to the presence of the ester backbone.An IG was prepared by Tang et\u00a0al.92 wit4Figure\u00a0Polymer composites can provide a suitable platform to develop innovative materials with excellent prospective of applications in many fields. Combining a matrix with fiber allows for emerging elegant resources, which harmoniously unite the characters of definite fiber and matrix.93Fig4.1 as a sensor polymer composite material used in various fields like medical, agriculture, defence, etc.Sensing technology comprises many parts, like sensors; another is a data acquisition and transmission system used to verify structural deeds and conduct of structures whenever exposed to circumstances beyond one's control, like an earthquake. The structural health monitoring devices can record actual load, reactions, and forecast environmental measures94 as 4.1.1 Polymer composites based on graphene (Gr) are widely used as a biosensor because of their high mechanical strength, excellent electrical conduction, and biocompatibility. Gr\u2010based polymer composites got much attention for their practical application in enzyme biosensors, DNA biosensors, apt sensors, immunosensors, and optical biosensors. It is used for enzymatic biosensors based on the detection of enzymatically generated hydrogen peroxide (H2O2), electron transfer mediator electrochemistry, and direct electrochemistry of enzyme.Biosensing incorporates an essential function in human beings living for the diagnosis of diseases and examination of diseases. The growth of susceptible, low cost, and selective devices is an excellent way to screen for diseases early. Biosensors are used extensively to recognize biomolecules like dopamine (DA), ascorbic acid (AA), and uric acid.95 PolFigure\u00a0The biocompatibility, comfort of transformation, and preparation of high\u2010performance nanocomposites of graphene oxide (GO) as well as rGO and easy electrode incorporation are the edges of the GO and rGO into biosensor implementations. Figure\u00a098 developed an electrochemical biosensor to detect diclofenac, an analgesic. Figure\u00a0In today's scenario, we all are dependent on various drugs for our survival. These drugs are chemical substances; sometimes, these drugs have side effects on different body parts when taken in overdoses. For monitoring these drugs, we need some analytical tools. The most suitable option for this is electrochemical biosensing. Boumya et\u00a0al.99 dev Electrochemical biosensor based on IL\u2010based polymer composite is also used to detect microbial pathogens present in food and foodborne pathogens. Nowadays, many works are done on this, so we have also paid attention to the selectivity and sensitivity of ILs based electrochemical biosensors. These electrochemical biosensors work very efficiently to detect various biomolecules in our body like enzymes, carbohydrates like glucose, proteins like myoglobin (Myo), hemoglobin (Hb), etc., for the body's proper functioning. Some of them are explained below.An electrochemical sensor that is simple protein molecularity imprinted is basically based on a chitosan/IL\u2010Gr customized glassy carbon electrode (GCE); the sensor exhibits superior performance for detecting bovine serum albumin (BSA).100 El2O2 sensing. A new electrochemical biosensor based on enzyme has the benefit of IL\u2013PPy\u2013Au composite to immobilize horseradish peroxidase (HRP) on the GCE. The synthesized C12\u2013PPy\u2013Au\u2013HRP/GCE based biosensor has an excellent electrochemical activity for detecting H2O2. An IL\u2010based polymer composite based on cholesterol oxidase (Chox) enzyme acts as a biosensor. It has an outstanding performance for the cholesterol of a less quantity of 0.5 to 5\u00a0mm having excellent sensitivity, less responding time, and more stable repeatability. The above\u2010mentioned IL\u2010based amperometric biosensor was prepared by using chitosan (Chi)\u2013IL (1\u2010butyl\u20103\u2010methyl imidazolium tetrafluoroborate) [BMIM][BF4], which is a cross\u2010linked matrix, and gold nanoparticles (AuNPs) onto thiol (\u2010SH) based multiwalled carbon nanotubes (MWCNTs) with cholesterol oxidase (Chox) enzyme. The synthesized biosensor is designated as\u2010MWCNT(SH)\u2013Au/Chi\u2013IL/Chox. Figure\u00a0Enzymes are chemically protein molecules; they work like a catalyst in our bodies, which is why they are also known as biocatalysts. Enzymes control all biochemical activities in our body like digestion, protein synthesis, DNA replication, etc. ILs enhanced the performance of various enzymes for biosensing of various materials\u2014IL\u2013polypyrrole\u2013Au (IL\u2013PPy\u2013Au) composite used for enzyme immobilization for Hing H2O2.102 An prepared an HRP\u2010based biosensor, which has no reagent and works on the direct transfer of an electron between enzyme and electrode. It shows direct electrochemistry as well as bio\u2010electrocatalysis of HRP for H2O2. To prepare this HRP biosensor, the composite material is made up of Chi with room temperature\u2010based IL [BMIM][BF4]. This gives an efficient method for realizing the electrochemistry of various enzymes and exploring third\u2010generation biosensors.Lu et\u00a0al.105 pr In this way, various enzymatic and nonenzymatic biosensors developed from time to time. The enzyme\u2010based sensor, namely, Glu oxidase (GOD), catalyzes the glucose to facilitate the recognition of the Glu amount in the blood.Glucose (Glu) is a carbohydrate, and they are known as body fuel; in this, Glu comes into the monosaccharide part of carbohydrates. Glu is the most straightforward carbohydrate that our body absorbs directly and uses in the various metabolic process of the human body. Glu breaks down into gluconic acid during respiration and releases a tremendous amount of energy. However, sometimes due to some catalytic activities, it increases body blood sugar levels, leading to significant problems like kidney failure, liver failure, etc., this condition is known as diabetes.106 In suitably. A nonenzymatic electrochemical Glu sensor was fabricated that was made up of mixed NPs of Ni\u2013Pd modified IL\u2013rGO on the GCE. The detection of Glu using this sensor shows that it had a broad array of linear Glu detection, i.e., from 0.0002 to 10.0\u00a0mm and a limit of detection of 0.03\u00a0\u00b5m and sensitivity of 1504.61\u00a0mA mm\u22121 cm\u22122. An enzymatic glucose biosensor was developed based on GOD and HRP enzymes. Further, it is combined with an IL\u2010based polymer composite. The above\u2010discussed biosensor was prepared as with which a 3D microporous (3DM) N[3\u2010(trimethoxy silyl) propyl] aniline (PTMSPA) polymer blended with an IL. [BMIM][BF4] deposited on electrode of ITO by electrodeposition method, in which PS spheres were used as a sacrificial template. The 3DMPTMSPA\u2010IL composite had distinctive characteristics like a huge available surface, better biocompatibility, and outstanding chemical stability, an ideal bioassay. The Glu biosensor was prepared by immobilizing GOD and HRP on the surface of 3DM composite film by using Nafion (Nf) as binding material. The biosensor known as Nf\u2013GOD\u2013HRP/3DM\u2013PTMSPA\u2013IL/ITO has an electrochemical performance for glucose over a large concentration array having excellent selectivity as well as sensitivity. It is used in the detection of Glu in the serum of humans.Figure\u00a0On the other hand, in the case of a nonenzymatic sensor, a suitable substance is fabricated on the sensor's surface, which goes with the catalytic activity against glucose to catalyze the Glu99 suiRegarding the Glu biosensors above, the Glu biosensors based on the electron transfer mechanism paid much attention due to the absence of mediators and are referred to as third\u2010generation biosensors. These IL\u2010based Glu biosensors are very important to detect blood sugar levels due to their high sensitivity and selectivity.4/GC, gives a good electrochemical sensor platform for reduction\u2013oxidation proteins and enzymes, and it has various electrochemical applications in biosensors, direct electrochemistry, and biocatalysis. A novel electrochemical biosensor was prepared by immobilizing Hb on a DNA customized carbon IL electrode (CILE) using [EMIM][BF4] as the modifier. The obtained electrochemical impedance spectroscopy (EIS) peaks on the customized electrode show that the Nf and DNA composite material gives a unique biocompatible microenvironment for maintaining the indigenous construction of Hb and enhancing the rate of direct transfer of Hb by using the basal electrode. The electrochemical variable of Hb in the composite film was additionally considered by using the outcomes of the charge transfer coefficient (\u03b1) and the apparent heterogeneous electron transfer rate constant (ks) as 0.41 and 0.31 s\u22121. The prepared electrochemical biosensor exhibited outstanding electrocatalytic performance for reducing trichloroacetic acid (TCA), H2O2, NO2\u2212, and the noticeable Michaelis\u2013Menten constant (KMapp) for the electrocatalytic response were deliberated, respectively.Figure\u00a0Hb and Myo both are proteins and bind oxygen to transport it to the body, but the primary difference between them is that Hb is a heterotetrametric protein and present in erythrocytes; on the other hand, Myo is a monomeric protein and found in muscles tissue in which it is intracellular storage site of oxygen. The IL\u2010based composite resources can be widely utilized as an immobilization matrix to capture proteins and enzymes. Hb was selected as a sample protein to study the hybrid method. A novel composite material, Hb\u2013Chi\u2013BMIMBFatalysis.110 A A noble electrochemical biosensor was prepared to spot acrylamide and was based on Hb capture in IL\u2010carbon paste. The Hb\u2013carbon IL paste electrode (Hb/CILPE) was examined using various electrochemical techniques. The planned biosensor shows superior sensitivity and low observation limit for AA with the standard sample preparation method. That is why the Hb/CILPE must be used for direct electrochemical determination of acrylamide in food samples.112The molecularly imprinted technique is a good substitute for biomolecules recognition systems, including immunoreactions, enzyme\u2010catalyzed reactions, aptamer, etc. For this, the IL 1\u20103\u2010vinyl imidazole bromide was prepared and used to invent a molecularly imprinted layer for making electrochemical sensing of Myo. This layer was decorated on a GCE modified with MWCNT using the IL as the functional monomer. The sensing behavior of the customized electrode was studied by using the hexacyanoferrate structure as an electrochemical reduction\u2013oxidation probe. The outcomes show that the sensor has better selectivity, excellent sensitivity, competent techniques for medical diagnostics, environment protection, and food safety.1133O4\u2013graphene (Fe3O4\u2013GR) composite on the CILE was constructed by using Nf as the thin layer making substance to develop the constancy of protein immobilized on the electrode's surface, and the fabricated electrode was represented as Nf/Myo\u2013SA\u2013Fe3O4\u2013GR/CILE. The invented third\u2010generation biosensor showed a wide linear range from 1.4 to 119.4\u00a0mmol L\u22121, less detection limit as 0.174\u00a0mmol L\u22121 (3\u03c3), better stability and reproducibility for the reduction of TCA, which would be effective of being a potential biosensing proposal in the electroanalysis and electrocatalysis. Further, a biosensor was prepared for the recognition of H2O2 that was based on a Myo composite of Nf and a room temperature IL, namely, 1\u2010butyl\u20103\u2010 methyl\u2010imidazolium chloride [(BMIM)Cl]. The projected biosensor has an inferior detection boundary as compared to many other biosensors that was based on IL\u2013heme protein and it excluded from general interference in H2O2 biosensors.A unique biosensor that is made up of electro\u2010co\u2010deposition of Myo, sodium alginate (SA), Feosensors.114 Epinephrine (EP) is the most essential NTs in mammalians\u2019 central nervous system. Change in EP concentration results in many disorders, so the detection of EP is essential. Unfortunately, EP and AA exist simultaneously in a biological system. The oxidation of AA takes place near the potential of EP at mainly solid electrodes resulting in a coincidental voltametric reaction for EP and AA. To overcome this problem, one can use a modified electrode that can selectively detect the EP in the existence of AA. A new rGO composite GCE modified with IL crystal (ILC), 1\u2010butyl\u20101\u2010methylpiperidinium Hexa\u2010fluoro\u2010phosphate [BMPM][PF6] and cyclodextrin (CD/ILC/RGO/ILC/GC) was made by the mechanical casting of every layer. The personalized electrode was used for the detection of some NTs like DA, EP, norepinephrine (NEP), levodopa (L\u2010DOPA), 3,4\u2010dihydroxy\u2010phenylacetic acid, and serotonin (ST). Atta et\u00a0al. synthesized a new carbon\u2010composite electrode, i.e., based on ILC [BMPM][PF6] and nickel oxide NPs. They were successfully used as an electrochemical sensor to detect paracetamol in a sample of human urine and some NTs like DA, NEP, L\u2010DOPA, and ST. Further, an electrochemical biosensor that was used to know the presence of DA and generally based on IL decorated GO supported NPs of gold (Au), i.e., (IL\u2013GO\u2013AuNPs) that was coated on a GCE.Figure\u00a0Neurotransmitters (NTs) are endogenous hormones that assume a significant role in various brain functions; an anomalous amount of these NTs causes many bodily, psychotic, and neurodegenerative ailments like Alzheimer's, Parkinson's, and Huntington's disorder. That is why, their sensitive and vigorous recognition is an immense clinical consequence\u2014the electrochemical recognition of NTs done by enzymatic and nonenzymatic methods.115 Ep4.1.2 It is however a significant challenge to design humidity sensors with all the most desirable properties, i.e., brilliant linearity, high sensitivity, small hysteresis, fast response time, and many more. Detection of low humidity is always a challenge. In that case, IL ligands were evenly established in a framework of UIO\u201066 to enhance the hydrophilic nature of the sensing substances.Figure\u00a0Humidity is an essential factor for living beings and the environment. The observation of the evolution and role of humidity plays a crucial function in various fields, like medicine, farming and electronics corporations, and health observance. Different components like ceramics, Gr, and polymers promote humidity sensors. Thermoplastic and thermoset\u2010based composites with natural fibers like flax, hemp, and choir and special stacking sequences also show sensitivity and shape change capabilities based on the level of surrounding relative humidity.120 It synthesized a new humidity sensor that was based on polymer composites comprising IL [BMIM][FeCl4] and the PVDF. The moisture reaction of the [BMIM][FeCl4]/PVDF sensor materials consisting of various IL amounts was analyzed by changing the resistance through changeable relative humidity (RH) from 35 to 90% RH at a steady temperature of 25\u00a0\u00b0C. Figure\u00a04] in humidity sensing is present. The reproducibility of various specimens\u2019 sensors was estimated using [BMIM][FeCl4]/PVDF compounds to replicate humidification/dehumidification processes. The outcomes are exhibited in Figure\u00a0Fernandes et al.123 sy4.1.3 Piezoresistive strain gauge sensors are the most widely used sensor among all types of strain gauges used to measure acceleration, force, torque, pressure, and vibration. IL/polymer composites (1\u2010ethyl\u20103\u2010methyl\u2010imidazolium tetrafluoroborate [EMIM][BF4]/2\u2010[[(butylamine) carbonyl]oxy]ethyl acrylate (BACOEA)) were fabricated to use as sensing substances for stretchable piezoresistive tactile sensors. The activity of the piezoresistive sensors was explored with the extent of cross\u2010linking and polymerization of the IL/polymer composites.In the case of piezoresistive sensors, resistivity is dependent on the strain. Acrylate\u2010based polymers are used in union with ILs to support the manufacturing of elastic piezoresistive touch\u2010based sensors. The execution of the piezoresistive sensor was valued up by the degree of the cross\u2010linking and molecular heaviness of the matrix that controls the ability of movement of the polymeric chains and IL domain. The polymerization and cross\u2010linking are managed by changing UV exposure time and the amount of cross\u2010linking agent, respectively, which finally impact the sensitivity of the sensors. It was manifest that the piezoresistive behavior turned into the reorganization of polymeric chains and IL domains within the composite formed through the contortion of the components.124 PiFigure\u00a0The complete living sensing process is displayed in Figure\u00a0127Table\u00a04.2 ILs also used to develop quasi\u2010solid\u2010state electrolytes (QSSEs), which affect the activity of quasi\u2010solid state lithium metal batteries, enhancing the ionic conduction of selected electrolytes with their stability. ILs are also used to prepare high\u2010responding electrodes because of their distinctive microstructures. As we discussed above, IL polymer\u2010based composites have many applications in the field of batteries like QS lithium metal batteries (QS\u2010LMBs), lithium\u2010ion batteries (LIBs), lithium\u2010oxygen batteries, as well as in supercapacitors (SCs), fuel cells, etc.As the population increases rapidly, the energy demand also increases. A possible material to be used to meet energy management requirements from various alternative energy sources is an ILs\u2010based polymer composite for broad energy production applications. the integration of ILs to the solid polymer electrolytes could also improve the ionic conductivity, due to superior energy density, broad electrochemical window, thermal stability, minor vapor pressure, and flameproof.131 IL Besides that, Hern\u00e1ndez et al. have also reported a synthesis route for poly(ionic) electrolytes that they successfully synthesized via anion exchange resin and explained their broad scope of poly(ionic) electrolytes toward energy storage technologies. Some energy\u2010related applications of ILs are discussed in this section. Figure\u00a0The concept of using IG, i.e., IL\u2010based polymer gel as electrolytes, is a new advance in science that pulls great attention due to their properties and hence applications in energy storage. The combination of ionic liquid and polymer allows to form a solid gel\u2010like structure that results in superior properties as well as can be used in lithium cell assembly due to their physicochemical properties.137 Be4.2.1 Many IL electrolyte\u2010based batteries are present, like lithium\u2010based, aluminum\u2010based, dual\u2010graphite batteries, etc. We discuss more those below.ILs are used in batteries due to their safety characteristics in terms of overheating, short circuits, battery explosions, caused by liquid electrolytes. ILs have undergone some significant advances in different areas for the development of battery cells. ILs have also been used to prepare the slurry for producing electrodes, as electrolyte additive in solid electrolyte interphase (SEI), and as a solid polymer electrolyte in various polymer composites.139 Ma+\u2010based batteries are an essential part of today's scenario due to their daily\u2010used gadgets like cell phones, watches, computers, tabs, sports equipment, electric vehicles, etc. The coming\u2010era batteries need the advancement of new ingenious polymers, which is beneficial for better fulfillment on behalf of power density, cyclability, unrefined resources availability, light heaviness, printability, elasticity, and supportability as security. High\u2010thermal stability is expected in IL Li\u2010based battery. Li electrodes\u2010based batteries mainly deal with two problems: poor activity and safety problems. So, the characteristics of the junction of two surfaces and the Li\u2013metal surface/electrolyte interactivity are essential to solve the rest problems and improve this appliance. Ternary polymer electrolytes are an excellent option made by poly(ethylene oxide) (PEO), Li salts, and various ILs present in the middle of two Li\u2013metal blocks. The robust cooperation in the electrolytes and the Li\u2010atoms affects the structure of the electrolyte at its interface area, where minute and flat ions are present in a sound described area along with Li+\u2010ions and with many self\u2010diffusion coefficients. On the other hand, large ions like (methyloxymethyl) triethyl phosphonium [P222mom]+ enhance the density of PEO on the inner side because of the more significant number of species present at the interface. So, the structure\u2010dynamic characteristics at the interface of electrolyte and Li\u2013metal surface can be improved by selecting particular ILs in ternary polymer electrolytes, which prevent the development of SEI above the exterior part of the electrode in this way enhance the activity of the battery.There are many Li\u2010based batteries like LMBs, which are nonrechargeable, known as primary batteries, LIBs and Li\u2013polymer based batteries known as a secondary battery. Lisecurity.140 Hi+ cells. Just only adding 8 wt% of graphene nanoflakes, the TC of nanofiber separators of polyacrylonitrile can be enhanced by 3.5 to 8.5 W (m K)\u22121. Li\u2010ion batteries with liquid electrolytes have limitations like low power and energy density, safety, etc. To overcome these problems, solid electrolytes develop, i.e., QSSEs and all\u2010solid\u2010state electrolytes. Lately, ILs as a biodegradable substance have paid much concern to emerging QSSEs because of their outstanding properties, like thermally and chemically stable, integrated configuration over an extended variety of working temperatures, more electrochemical stability window, better ionic conduction over normal room temperature with incombustibility. The prepared ILs is categorized as a conventional, solvate, and renewable ILs which is completely bio\u2010based for the LMBs with QSSEs. The traditional ILs are broadly based on imidazolium, quaternary ammonium, pyrrolidinium, piperidinium, and many more.Thermal management is also the main problem in the growing use of batteries. Due to this safety concern, extremely thermally conductive (TC) substances are required. Carbon nanotube (CNT) or fibers filled PVDF having superior TC is the best alternative to traditional electrode substances that carry PVDF and lampblack in Li (m K)\u22121.142 LiSome scientists synthesized a novel polymerizable IL monomer, i.e., as a repeating unit, linking a meth acryl functional group with the positively charged ion in an IL molecule with comparatively revoked potential windows. A polymer\u2010based electrolyte is obtained by reacting a small polymer with a binary Li\u2010IL. The obtained electrolyte shows an outstanding rate discharge property for a Li\u2010based polymeric battery; it retains 83% of its discharge capacity and comparatively superior cycle activity. This new Li\u2013polymer cell is fireproof and free from leakage, user friendly, big size lithium secondary, i.e., rechargeable battery.143 A 1:1.5 1,2\u2010 dimethyl\u20103\u2010propylimidazolium chloride:AlCl3 electrolyte is used for new rechargeable cell with positive graphite electrode and aluminum as negative electrode works as reversible chlorine (Cl) intercalation electrode. So, separating the membrane between anodic and cathodic electrolytes is not required. 1.7 V average discharge voltage was produced for 1\u201310\u00a0mA g\u22121 graphite, and more than 150 cycles were obtained at the positive electrode at 100% depth of discharge.Reviews of the literature have shown that imidazolium salts or amide ligands (such as urea) can make IL electrolytes or quasi\u2010IL electrolytes for secondary aluminum batteries. Batteries formed on aluminum provide an applicable option due to their three\u2010electron redox potential, constancy in the metallic form, and much natural occurrence. The advances of this type of battery are based on fireproof electrolytes with less noxious is essential for reducing safety dangers and environmental effects. Due to this motive, ILs have been proposed for energy\u2010storing because of their little vapor pressure and more oversized electrochemical windows. A new type of ILs, known as IL analogues or so\u2010called DESs, usually produced by a mixture of a strong Lewis acid metal halide and Lewis's base ligands, have obtained much consideration due to its own equivalent electrochemical and physical characteristics with less expenditure and lower ecological footmark.144 A  A battery that shows high reversibility and capacity detention and brings a capacity is a new aluminum\u2013graphite dual\u2010ion battery (AGDIB) in an electrolyte, i.e., ethyl\u2010methyl carbonate, having superior energy density.In previous years, much focus has been devoted to the development of cation intercalation\u2010based batteries, but anions had no consideration or less consideration in the electrolyte. Anion intercalation was achieved through a highly concentrated acid solution as an electrolyte, but significant security concerns made this implementation less valuable. The double graphite interpolates melted electrolyte\u2010based batteries that gain attention on implementing anion interject graphite as the positively charged electrode in batteries when we used IL as electrolyte at room temperature.146 A Figure\u00a06\u2212 anions within the electrolyte interpolated in the cathode made from graphite. The Li+ ions in the electrolyte deposition upon the aluminum counter probe to construct an Al\u2013Li alloy. Figure\u00a0+ cations exhibit much stable intercalation/deintercalation property as compared to the TfO\u2212 anion. The main benefit of the [EMIM][TfO]\u2013DGB includes the well\u2010being measurement of the IL electrolyte and the plentiful electrode resources. Moreover, the [EMIM][TfO] IL contains only C, H, O, N, F, and S atoms; this IL is an excellent and promising material for upcoming electrochemical energy storage devices.Natural graphite electrodes are studded and compared with a synthetic graphite electrode (KS6) via CD test. It was found that a dual\u2010natural graphite battery shows better performance than a dual\u2010KS6\u2010graphite battery, e.g., having superior discharge plateau and best plateau retention. The dual\u2010graphite system's principle is known by doing a cyclic voltammetry (CV) test. An invented dual\u2010graphite battery (DGB) formed from the pure [EMIM][TfO] IL electrolyte having a charge/discharge voltage between 1.0 and 3.9\u00a0V. The outcomes show that the EMIM devices.148 present new work with Zn/graphite DIB, in which naturally obtained graphite acts as a cathode and zinc metal is used as anode with zinc trifluoro methane sulphonate (Zn(TSO)2) 98%, an ionic liquid\u2010based electrolyte. Zn(TfO)2/[EMIM][TfO] electrolyte has a vast electrochemical window of 2.8\u00a0V (vs Zn2+/Zn) compared to the water\u2010based systems, and it is also with high ionic conductivity of 7.3\u00a0ms cm\u22121. The IL electrolyte can repress the development of dendrite on the surface of Zn. On the other hand, some additional advanced characteristics of the IL electrolyte are extra attention\u2010seeking, like less volatile nature, incombustible, and elevated temperature constancy. The battery system became safer, between the range of voltage 0.8 and 2.8\u00a0V. Placke et\u00a0al. present dual\u2010ion systems made up of the bis(trifluoromethanesulphonyl) imide (TFSI\u2212) anion intercalation to the graphite from an IL electrolyte, named as Pyr14TFSI. As an anode material, each metallic Li or Li titanate (Li4Ti5O12) was used; both the materials show excellent compatibility with the electrolyte providing a better potential range.Fan et al.149 pr+ based batteries are a better alternative in place of Li+ batteries for fewer expenditure applications due to the less cost and plenty of sodium with comparable intercalation chemistry with Li. A study reported composite gel polymer electrolytes (GPEs), which act as electrolyte/separators in sodium ion\u2010based batteries. The GPEs consist of 0.5 m solution of the sodium trifluoromethanesulfonate (Na\u2010triflate or NaTf) in IL [EMIM][TfO] enclosed in PVDF\u2010cohexafluoropropylene) (PVDF\u2010HFP) scattered with inactive filler aluminum oxide (Al2O3) and active filler sodium aluminate (NaAlO2) molecules. The freestanding layers of the composite GPEs, synthesized from a technique, namely, the solution\u2010cast method, provide the most favorable ionic conductivity (IC) at room temperature , having adequate electrochemical stability and outstanding firmness for temperature up to 340\u00a0\u00b0C. This property makes this composite NaTf/[EMIM][TfO]/PVDF\u2013HFP\u2013GPEs an attractive electrolyte for Na+ batteries. Because of its high potential and lower cost, sodium\u2010ion batteries based on quinone electrodes are more prevalent energy storage devices. However, the main disadvantage of this device is that it has a poor life cycle and less using energy because the quinone electrode dissolved in the aprotic solvents. The forbidden impact of ILs on quinone solvation relates to its tendency of polarization, donor number, and dealings power, as exposed by combined density functional theory and several studies in spectroscopy.Energy alteration and its storage have become the main concern for our benefit in day\u2010to\u2010day life. The much suitable form of energy storage in terms of energy density is chemical energy. For this idea, batteries are suitable devices that store chemical energy to give electricity with high conversing potential and no pollutant in gaseous form. For this, much attention is cheaper, secure, rechargeable batteries with enough voltage, capability, and rate potential. Among a range of existing energy storing technologies, the Li\u2010ion battery, which has dominated the portable electronic marketplace, has become the preferred option to provide energy to the next generation of electric gadgets or appliances and connect electric vehicles. Na with Li.151 A Figure\u00a013], [PY14], and [PP13]) and two anions, namely, [FSI] and [TFSI] that were chosen because of their chemical resilience through metallic Na anode. More fragile polarity and more insufficient donor numbers of ILs favors quashed quinone dissolubility   Figure\u00a0.butane bis[bis(trifluoromethanesulfonyl)imide] (C1\u20104TFSI) monomer with 1\u2010ethyl\u20103\u2010methylimidazolium bis(trifluoromethanesulfonyl)imide\u2010based electrolyte that is present in poly bis(trifluoromethanesulfonyl)imide spongy layer. The elegant concordant organization concurrently gives the fabricated HPILSE having better ionic conductivity (>10\u22123 S cm\u22121 at 25\u00a0\u00b0C) that satisfies electrochemical stability, innate incombustibility, better mechanical potency, and elasticity. The in situ prepared Na0.9[Cu0.22Fe0.30Mn0.48] O2/Na cells with HPILSE have advanced cycle activity with higher specific capacities. The brilliant act of HPILSE and the easy preparation procedure of HPILSE\u2010based solid\u2010state cells make it potentially higher capable electrolyte substances for the future creation of Na+ batteries.There are many problems in dealing with liquid organic electrolytes. Moreover, the electrolytes present in solid\u2010state have a much\u2010established electrochemical window and high protection, which allows highly efficient materials for cathodes and Na metal to act as an anode. Several works have shown that the density of cell energy increases even more than 500\u00a0Wh kgtrolytes.154 FuThe reported studies in this section show the promise of ILs electrolytes as materials platform for different classes of batteries . This section has also discussed the importance and performance of ILs electrolytes in battery applications. Moreover, this section has also provided an overview of the IL\u2010based materials needed in future energy sector applications.4.2.2 FCs are usually designed for various working temperatures and the type of electrolyte used, as described in Table\u00a0Fuel cell (FC) is a tool that changes fuel's chemical energy into electrical energy without leaving any harmful impact on the environment.156 FC By increasing the content of ILs, thermal stability and the OH\u2014 conductivity of the composites increase. Many novel composite membranes were synthesized in laboratory by use of imidazolium\u2010based aprotic ILs with a polymer matrix, namely, sulfonated poly(ether ketone) (SPEK) with the use of solution casting method due to which the thermal stability (due to electrostatic force of attraction in imidazolium cations of ILs and sulfonic acid anionic groups of SPEK), mechanical characteristics, ion exchange potential, proton's conductance, and leaching out of ILs of a fuel cell increases with water. The membranes based on ionic liquid were more flexible than the pure SPEK film because of the plasticization of the ILs. It was observed that at elevated temperatures, ILs work as the ion charge carrier. Composite membranes of hydrophilic type IL were mechanically stable compared to membranes of hydrophobic type IL. Polymer ILs with the IL are used as electrolytes, an ionic conductive membrane, and a catalyst in fuel cell technology with improved properties. PILs like N,N\u2010diethyl\u2010N\u2010methyl\u20103\u2010sulphopropan\u20101\u2010ammonium hydrogen sulphate, N,N\u2010diethyl\u20103\u2010sulphopropan\u20101\u2010ammonium triflate([DESPA][TfO]), etc., are good electrolytes for FCs working in the temperature array 100\u2013120\u00a0\u00b0C. The combination of two PILs, like diethylmethyl ammonium hydrogen sulphate ([dema]HSO4) and diethylmethyl ammonium bis(trifluoromethanesulphonyl)amide ([dema][NTf2]) was formed by blending in different weight ratios used as an electrolyte for FC. This mixture results in good electrochemical action compared with the pure PILs, hence the work procedure and speed of action of the mixture depend upon the composition of the mixtures.FCs containing polymer electrolyte membrane have various merits, like more power density, rapid start, less price, and good durability. The development of composites with ILs enhances fuel cell properties and can implant these types of technologies.158 ByAs per the reported studies in this section, the different possible fuel cells and properties also discussed the additional documented material's importance and performance in FCs applications. Table\u00a04.2.3 To enhance the performance of energy\u2010storing devices like an SC, ILs are used as electrolytes. ILs overcome various disadvantages of previously used organic or aqueous electrolytes. ILs are pure liquid salts with a much\u2010ionized atmosphere, less volatile, wide liquid temperature range, and wide working voltage window. There are many problems with the salvation of ions in bulk in SC. To avoid this problem, ILs are used in electrical double\u2010layer capacitors (EDLCs), e.g., 1\u2010ethyl\u20103\u2010methylimidazolium bis(trifluoromethyl sulphonyl)imide [EMZM][TFSI] was used to stay away from the solvation effect. On the other hand, when we do the electrolyte's redox decomposition at the carbon electrode, the cell potential of EDLCs decreases; so, the use of ILs with a more electrochemical stability window like substituted pyrrolidinium cations permit the cell voltages more than 3.5\u00a0V and the specific energies of commercial EDLCs increases. The asymmetric EDLCs having much specific gravity and some mesoporous positively and negatively charged carbon electrodes of different weights had revealed the growing utilization of pyrrolidinium\u2010based ILs. Tu et\u00a0al. prepared a new redox\u2010active gel polymer\u2010based electrolyte with two function IL for flexible supercapacitor in which they chose an IL, namely, 1\u2010butyl\u20103\u2010methylimidazolium iodide (BMIMI) as a substance that promotes flexibility and reduces the brittleness and redox additive as well as a neutral lithium sulphate (Li2SO4) solution in water to attain more working voltage. A reduction and oxidation\u2010active poly\u2013Li2SO4\u2013BMIMI gel polymer electrolyte was also designed, and it is used for making a supercapacitor that is flexible and mainly based on carbon. This unique method gives a suitable and less expensive method for efficient energy storing devices. Recently, Lian et\u00a0al. explored the relationship between pore size and adsorption of the ion at room temperature IL capacitor concerning nanoporous electrodes, especially given to attention on capacitance and energy\u2010storing optimization. Also, the ILs based polymeric gels, also known as \u201cIG,\u201d provide another addition to their use in the energy storage sector. In this regard, the use of EMIMBF4 IL as an electrolyte for supercapacitor applications could be noticed that enables the wide potential window and ILs potentiality toward energy storage applications both with MXenes and quantum dot\u2010based electrode materials.Supercapacitors are electrochemical devices that store and emit energy by the alternative process of adsorption and removal of ions at the interfaces of two surfaces of electrodes and electrolytes. SCs are recent energy\u2010saving and conversion devices that have the potential of higher power density, excellent circulation properties, fast discharge\u2013charge, less expensive, poor self\u2010discharging, and safely working mechanism.163 To4.2.42 is an ideal alternative to fossil fuel as it is easy to store and clean fuel for future generations. At present, hydrogen is abundantly produced by the electrolysis of water. Still, it needs voltages in extensive of the thermodynamic water splitting potential of 1.23\u00a0V, first and foremost due to the time\u2010consuming rate of the oxygen evolution reaction (OER). So, some competent catalyst is required to enhance OER's rate and lower the overpotential. The utilization of polymer brushes based on IL and poly(IL) was invented by Pham Truong et al. as a rising catalyst for oxygen reduction reaction (ORR). The outcome illustrates that the poly(IL) has a competent electrocatalytic performance associated with the chemical constitution and the nanostructuration of the polymer. On the other hand, they also reveal that poly(IL) is also used at the same time like a host\u2013guest strategy for Pt catalyst. For the mixed substances, a capable catalytic importance is for bearance to crossover response. They also disclose the probable uses of poly(IL) and the mixed substances, poly(IL)/Pt, as a proficient dual functional catalyst for ORR and OER.The need for sustainable pollution\u2010free energy sources is critical, and it has developed into one of the most intense technological challenges of the 21st century. Hotential.169 ThIn this section, the literature reported on OER discussed the IL\u2010based material's catalytic performance and applications. Also, it examined the additional said IL\u2010based polymer materials and their multifunctional applications.4.2.5 In this manner, dicyanamide\u2010based ILs are used as starting materials to synthesize nitrogen\u2010doped mesoporous carbons (NMCs).In recent years electrochemical splitting of water has taken much interest. An electrocatalyst must be developed with high stability and low potential for effective hydrogen evolution reaction (HER) to implement the successful water\u2010splitting technology. Mainly, Pt is used as an electrocatalyst for HER, but its high cost is unsuccessful. On passage of time, various transition metals  doped with Pt to make low\u2010cost catalyst, but the problem is also due to corrosion and oxidation of metals in acidic electrolysis. Further, some electrocatalysts are synthesized by doping some heteroatoms like N, P, B, and S with carbon\u2010based materials for energy\u2010related electrocatalytic reactions.171 In6,6,6,14]2[CoCl4]) with CNTs was used to get the Co2P/CNTs as electrocatalyst by single\u2010step phosphatization. This material shows a good catalytic performance for HER with start overpotential of 85\u00a0mV, a Tafel slope of 47\u00a0mV dec\u22121, and current densities of 10 and 20\u00a0mA cm\u22122 at overpotentials of 150 and 178\u00a0mV, and superior stability to maintain the HER performance. Further in this manner, Cui et\u00a0al. also prepared IL  having iron (Fe) was added with CNTs as precursors to synthesized CNTs\u2013decorated iron phosphide (FeP(MBMG)/CNTs) electrocatalyst for HER. On the other hand, to accelerate the HER, the electrochemical settling of Pt and Pd is done on polymeric brush IL\u2010based on imidazolium [poly]. As a result, various hybrid electrode catalysts have been synthesized. Due to this, the morphology of the nanomaterials changes, resulting in an increased catalytic activity.The synthesized NMCs had much stability and more reactivity as electrocatalysts for HER. An electrode catalyzed synthesized for HER, which is made up of phosphonium\u2010based IL [trihexyl(tetradecyl)phosphonium tetrachlorocobaltate(II)], contains cobalt ion, was helpful as new phosphorus and metal dual\u2010root for preparation of cobalt phosphide. Trihexyl(tetradecyl)phosphonium tetrachlorocobaltate (II) \u2010metal\u2010IL polymer composite, i.e., np\u2010NiPt infuse with a water hating, protic IL with more O2 solubility that shows significant performance in favor of the ORR as comparison to another catalyst that used in this reaction. A superficial and eco\u2010friendly technique has been invented for the fabrication of much efficient N\u2010doped Gr by calcination of a regular fusion of GO and conventional water\u2010loving IL 1\u2010butyl\u20103\u2010methylimidazolium tetrafluoroborate [BMIM]BH4], which act as both N providing as well as a restacking protectant. The catalyst was synthesized at a temperature of 900\u00a0\u00b0C with a mixing N of about 6.6 at% shows the outstanding catalytic activity for ORR in an alkaline medium. Further, an electrode catalyst was synthesized using Pt, Vulcan XC\u201072 carbon, 1\u2010butyl\u20103\u2010methylimidazolium chloride [BMIM][Cl]IL, i.e., Pt@[BMIM][Cl]/XC\u201072 composites by an easy precipitation reduction technique. In comparison to Pt/XC\u201072 composites, Pt@[BMIM][Cl]/XC\u201072 composites show better enhanced electrocatalytic performance and methyl alcohol tolerance toward the ORR in the acidic condition that can be chiefly attributed to electronic factor and steric factor. The competent Pt\u2010based ORR catalyst shows outstanding electrocatalytic performance and methanol tolerance.As the need for energy increases day by day, we aim at using energy\u2010producing appliances that provide energy with high efficiency and less pollution. In this regard, direct methanol fuel cells are the best\u2010provided option, which come under the proton exchange fuel cell category. In this cell, Pt is abundantly used as a cathode catalyst for ORR, but it has two major disadvantages, one is high cost of Pt, and another is fuel crossover by polymer membrane from anode to cathode. This crossover reduces the potential of cathode and efficiency of fuel. To overcome this problem cathode catalyst synthesized for ORR. In this regard an IL 7\u2010methyl\u20101,5,7\u2010triazabicyclo [4.4.0] dec\u20105\u2010ene (MTBD) and lithium salt of bis(trifluoromethylsulfonyl)imide (bTFSI), i.e., [MTBD][bTFSI] having much oxygen solubility, have been utilized to manufacture an interior oxygen\u2010loving electrode, which is nanoporous in nature to improve the ORR activity. On the other hand, by incorporating Gr or IL to Pt catalysts, significant progress has been obtained exclusively in the ORR performance.176 Sn fabricated MWCNT/IL/Au hybrid electrocatalyst using a chemical reduction pathway. This proposal implies working MWCNTs with NH2\u2010IL and in sedentary reduction of HAuCl4 with no further reductant added to it. The synthesized hybrid composite exhibited excellent electrocatalysis for the reduction of ORR. Additionally, the outcome of experiments proved that both NH2\u2010IL and Au extensively enhance the electrocatalytic performance of MWCNTs. Figure\u00a0Wang et al.180 faSome arrays of MWCNT\u2013IL were arranged on silicon (Si) wafers (Si\u2013MWCNT\u2013IL) via a common chemical pathway. The cyclic voltammetry (CV) measurements showed outstanding electrocatalytic performance of Si\u2013MWCNT\u2013IL for ORR in an aqueous medium compared to MWCNT\u2013IL.1810.5Sr0.5Co0.8Fe0.2O\u03b43\u2212 perovskite oxide with the surface amendment of 1\u2010butylimidazolium\u20103\u2010N\u2010propane sulfonate\u2010N,N\u2010bis(trifluoromethyl sulphonyl)amine (BIM3S\u2010HTFSA) IL.Table\u00a0Moreover the ORR also enhanced by engineering the electronic arrangements of BaThe literature reported in this section upon ORR discussed the IL\u2010based material's catalytic performance and applications. Also, it examined the additional documented IL\u2010based polymer materials, and they are multifunctional in applications. Table\u00a04.2.72 layer with pores of nanometer size. The electrolyte is composed of iodide/tri\u2010iodide (I\u2212I3\u2212) reduction\u2013oxidation couples, and due to its lower production costs and potential, it represents an alternative to the conventional photovoltaic devices that have attracted significant attention worldwide. The DSSC are made up of liquid electrolyte having organic solvent, i.e., acetonitrile; the latter provides a total light\u2010to\u2010electricity change potential of about 11% below the illumination of AM 1.5. On the other hand, liquid\u2010intersection cells do not have a long duration, mainly due to evaporation, the outflow of organic solvent is present at high temperatures, and the sealing of the liquid\u2010intersection cells is not easy. To overcome these issues, numerous efforts has been dedicated on substituting liquid\u2010based electrolytes with ILs, solid or QSS electrolytes together with polymer gel electrolytes (PGEs), p\u2010type semiconductors, and organic conductive substances. Furthermore, ionic gels, as well as ionic polymeric electrolytes have been synthesized with the introduction of IL electrolytes within matrices; these composites have been investigated to avoid the outflow and provide a reliable vaporization process for the electrolytes. A new IL PGE having BMIM iodide, PVP, KI, and I2 has been synthesized and characterized. By controlling the BMIM iodide, I2, and KI concentration with 0.9, 0.12, and 0.5 m, respectively, the IL based polymer PGE exhibits the highest IC (at 30\u00a0\u00b0C) of 2.3 mS cm\u22121. An IL PGE with QSS in DSSC was prepared, and a total light\u2010to\u2010electricity exchange efficiency of 5.41% was obtained under the illumination of AM 1.5 (100\u00a0mW cm\u22122). The DSSC employing the IL PGE shows a much more durable photovoltaic activity compared to a DSSC consisting of liquid electrolytes (10.1080/15567030902804764). A new composite polymeric gel consisting of RTIL, (BMIMPF6), and heteropoly acids  in a matrix of poly(2\u2010hydroxyethyl methacrylate) was effectively synthesized and used as an electrolyte in QSS in DSSCs. This composite polymer\u2010based electrolyte presented precise profit as compared to the IL and heteropoly acids that efficiently robust the IC of the composite based polymer electrolyte. This composite\u2010based polymeric electrolyte represents an excellent option for formerly known hole transporting substances to prepare durable QSSs, or solid\u2010state DSSCs. DSSCs are striking solar cell alternative due to their comparatively less preparation cost and ordinary method techniques. A recent study has shown that photoanodes were manufactured using TiO2 NPs (TNPs), TiO2 nanowires (TNWs), and its diverse composites (TNPWs). TNPs and TNWs were synthesized by sol\u2013gel/hydrothermal process and blended at different quantities along with the ratio of their weight, i.e., (100\u00a0wt% TNPs with no TNWs), (50\u00a0wt% TNPs with 50\u00a0wt% TNWs), (90\u00a0wt% TNPs with 10\u00a0wt% TNWs), (10\u00a0wt% TNPs with 90\u00a0wt% TNWs); (whole weight 5\u00a0g). By using cobalt sulphide decorated electrode, DSSCs were developed having an IL PMII (1\u2010propyl\u20103\u2010methylimmidazolium iodide) as electrolyte which was based on Indigo dye\u2010sensitized photoanodes. Photovoltaic investigations show that DSSC\u20104 prepared by using composite photoanode (10\u00a0wt% TNWs+90\u00a0wt% TNPs) had the greatest phototransformation capacity of 2.27% in comparison to DSSC\u20102  as well as DSSC\u20103 . EIS shows that composite TNPWs photoanodes are advantageous for improving the transport of electrons and having higher charge accumulation capability and light harvesting, which result into an improvement of the photoconversion efficiency of DSSCs.The dye\u2010sensitized solar cells (DSSCs) provide a technically and reasonably realistic alternative for presently used p\u2013n junction photovoltaic appliances. DSSCs are made up of a porous dye\u2010sensitized nanometer TiOdide I\u2212I3\u2212 reductidide I\u2212I3\u2212 reductidide I\u2212I3\u2212 reductidide I\u2212I3\u2212 reductidide I\u2212I3\u2212 reductidide I\u2212I3\u2212 reductidide I\u2212I3\u2212 reducti\u22122) enlightenment. The acidic polymeric IL, i.e., P[((3\u2010(4\u2010vinylpyridine) propane sulfonic acid) iodide)\u2010co\u2010(acrylonitrile)] and it is shortly known as P\u2010HI, had been used in IL electrolyte in DSSCs. The new acidic IL polymer/IL composite based polymeric electrolytes do not have iodine, and the activity of these electrolytes has been assessed by inspecting the materials of P\u2010HI and the potency of iodine on the activity of DSSCs. At 100 mW cm\u20132, the overall energy conversion potential of the cell depends on the electrolyte having 20\u00a0wt% P\u2010HI is 6.95% under AM 1.5 irradiation. By using 1,6\u2010hexanediol diacrylate in 1\u2010hexyl\u20103\u2010methyl imidazolium iodide as precursor materials and by means of in situ photopolymerizations a novel type of QSS electrolytes for DSSCs had been synthesized. The conductivities of the electrolytes obtain the most favorable ratio of polymer/IL. An oligomer, namely, polyethylene glycol dimethyl ether (PEGDME) incorporated to robust the polymer and IL. By adding an adequate quantity of PEGDME to the electrolyte, the DSSCs use an electrolyte that is present in a solid state and can show 6.5% of light energy\u2010to\u2010electrical energy change potential in 41 mW cm\u22122. The in situ photopolymerized electrolyte display better constancy followed by 1000 h heat test continuing durability test. A composite gel\u2010based electrolyte, namely, poly(IL)/IL/GO synthesized, which is used in DSSCs and consists of poly(BVIM)(TFSI), 1\u2010propyl\u20103\u2010methylimidazolium iodide, and GO, with no volatile organic solvent. The conductance of the composite\u2010based electrolytes is appreciably improved addition of a suitable quantity of GO. The DSSCs made up of composite electrolytes with GO show superior power alteration potential and improved durability than those which do not contain GO. The disadvantages of volatile liquid\u2010based electrolyte have been overcome by the better durability of the DSSCs, and also give various realistic techniques for the manufacturing of convenient applications for future technology. By the addition of GO with 1\u2010(3\u2010aminopropyl)\u20103\u2010methylimi\u2010dazolium bromide, IL\u2010GO is synthesized, which is followed by the exchange of anion TFSI\u2212. Eco\u2010friendly IL\u2010based composite electrolyte for DSSCs devoid of volatile organic liquid is synthesized by using IL\u2010GO and 1\u2010propyl\u20103\u2010methylimidazolium iodide (PMII). Introduction of adequate quantity of IL\u2010GO is appreciably improved the exchange potential of DSSCs. These outcomes show that the DSSCs made up of IL\u2010GO/IL composite\u2010based electrolytes could again defeat the disadvantages of volatile liquid electrolytes and recommend practicable techniques to prepare DSSCs for future realistic applications. Many imidazolium\u2010containing IL copolymers have been fabricated by using free radical copolymerization's of monomer (MEBIm\u2010I), acrylonitrile, and poly(ethylene glycol) methyl ether methacrylate (POEM), which is an imidazolium\u2010containing IL at diverse molar ratio. A systematic study had been done to learn the impact of the chemical constitution on the IC, catalytic performance, and ionic diffusion coefficients (IDCs) of the IL\u2010based copolymers. The POEM\u2010consisting IL\u2010based copolymer conductivities, as well as IDCs, increase with the existence of the ethylene oxide. The introduction of appropriate amounts of acrylonitrile part increases the catalytic performance of the IL\u2010based copolymers. The EIS and photovoltaic characteristics of DSSCs arranged from these electrolytes that were based on IL copolymer had been assessed. A largest energy exchange potential of 7.57%, with a 16 mA cm\u22122 of short\u2010circuit current density, a fill factor of 57.0%, and 0.84\u00a0mV of an open\u2010circuit voltage had been obtained for IL copolymers\u2010based DSSCs  glass/TiO2/N719 dye/IL polymer\u2010based electrolyte/Pt/FTO glass) under 1.5 AM irradiation with a power of 100 mW cm\u22122.In the entirely known DSSCs that are in solid\u2010state, the electrolyte that is free from iodine is polyhexylimidazolium iodide), which is a polymeric IL are used having an on the whole change competence of 5.29% with 1.5 AM simulated solar light . At present, HAps are synthesized from flora and fauna by means of total present industrialized technology. Innate and man\u2010made biodegradable polymer\u2010based composites are broadly used as scaffolds in repairing of bone because of their outstanding biological as well as mechanical characteristics. The research of Akagi et\u00a0al. compared the effectiveness of HA/poly\u2010d/l\u2010lactic acid (HA/PDLLA) and \u03b2\u2010tricalcium phosphate (\u03b2\u2010TCP) scaffolds employed for implantation as well as repairing of bones. From this result, they concluded that HA/PDLLA composite based scaffolds, while using in the implantation of bones, give excellent bone repairing results due to their new bone formation mechanism, biodegradable nature, less probability of left scaffold at the end of the process with the composite materials as opposite to \u03b2\u2010TCP\u2010based scaffold, and its better direct migration of cells from their sources of origin reveal by immune histochemistry staining. This outcome was collected when surgery was done on both feet of the dog, i.e., right and left, in which some part of dog's tibia bone was substituted by HA/PDLLA and \u03b2\u2010TCP scaffolds, as shown in Figure\u00a0Bones make the outer structure of the living body by making it skeletal, which provides support and safety to delicate organs. Bones consist of nanocrystals of hydroxyapatite (HA), collagen fibers, cells of bone, blood vessels, and mucopolysaccharides. HA is progressively employed for grafting and as fillers of bone to repair fractured bone and can be obtained from the animal's waste bones.214 Wh4.3.2 Polymer\u2010based substances are also used for dressing of injury, which gives an outer covering to injured places, which helps to faster the healing process and help in tissue engineering to regenerate missing or smashed tissues by easy growth of new cells.Skin is the essential part of the body; it protects the inner body part from harsh outer conditions, regulates body temperature by sweating, or acts as the first immune organ of the body by preventing the entrance of any pathogen in the body. During these works, skin faces many severe conditions like skin burning, fungal infections, etc., which leads to skin damage. So, skin regeneration is a severe matter that is overcome by using ILs based polymer composites that are biocompatible and biodegradable. Many researchers have worked on this process for a long time and have given valuable results. Polymer\u2010based hydrogels are drug molecule carriers like anticancer, antibiotic, and antifungal drugs.218 Po These biocomposite based sensors exhibit excellent conduction in the field of sensitivity. They can also identify the cervical gestures by using various wireless gadgets. Ionoskins are skin\u2010based wearable electronic strain sensors based on ionic conduction; they are in essence used for this biomedical purpose with some polymer\u2010based gelators, namely, [TFSI] and [PMMA\u2010r\u2010PBA]. These gelators or ionic conductors are transparent and ultrastretchable in nature.On the other hand, some stretchable ILs\u2010based sensors have been manufactured and used to identify the wrist pulses and are compatible with money\u2010making rubber bands hence woven into ornaments to recognize the signal of hands.220 Th4.3.3 Drugs are of many types like analgesics, antipyretics, antibiotics, etc. We take drugs orally or by injection, but they always go at their target organ and provide relief. However, the drugs based on peptides and proteins are degraded by the stomach's acidic medium, and various biocatalysts present inside the intestine. To overcome this problem, we require some drug delivery agents which properly deliver drugs. An IL monomer, namely, 3\u2010methyl\u20101\u2010methylimidazole and 2\u2010chloroethyl methacrylate, these IL monomers interject inside the montmorillonite membranes and then copolymerized through methacrylic acid. Naproxen, as a representation of medicine was trapped in nanocarriers that were pH\u2010sensitive and carried a positive charge, the in vitro discharge study was recognized independently in the two fluids that are free from enzymes enzyme, i.e., simulated gastric fluid (SGF with pH 1) and simulated intestinal fluids (SIF with pH 7.4). SIF has a greater drug release percentage. As a result, the synthesized nanocomposite could be regarded as an appropriate delivery agent for colon precise anionic drug delivery.Drugs are the chemicals that we take to cure a particular disease.223 Dr Drug delivery systems also depend on ILs, active pharmacological ingredients (API), and polymers. For example, a drug transport system of these kinds was prepared that depends on mefenamic acid (MEF), which is sparingly soluble in water, ammonium\u2010based ILs, and grafted poly(l\u2010lactide) (MEF\u2013IL\u2013LA). By using the emulsion solvent evaporation method, the NPs of MEF\u2013IL\u2013LA were prepared. The shapes of NPs are sphere\u2010shaped and 279 \u00b1 3.6\u00a0nm to 453 \u00b1 4.9\u00a0nm of controlled size having the greatest encapsulation potential up to 92.0 \u00b1 2.7%.A pH\u2010sensitive cationic silica NP was prepared using imidazole\u2010based IL for the controlled release of methotrexate. This graft copolymerization method is used, and vinyl functionalized silica NPs, as well as methacrylic acid, are used as a monomer. The above\u2010explained nanosystem is personalized for an anticancer agent, namely, methotrexate (MTX), for its targeted delivery. The anionic part of MTX carboxylic acid and the transporters cationic rings shows the electrostatic force of attraction. As a result, the nanocomposite\u2010MTX intricate was produced at a physiological pH (7.4). At the same time, the discharge of which can be obtained by the partition of the complex of nanocomposite\u2010MTX by the addition of a proton to carboxyl groups of the MTX part that are sensitive to changes in outer pH at weakly acidic situations. The obtained outcomes may unlock the potential for pH\u2010sensitive specific delivery of MTX to the carcinogenic cells.225 Dr ILs had been employed with functionalized biopolymers in the transport of drug to create delivery methods and medicine preparations . The straightforward synthesis of single\u2010walled CNTs (SWCNTs)\u2010doped molecularly imprinted polymer (MIP)\u2010based nanocomposite dual green porogen arrangement, RTILs, and DESs was established for drug transport mechanism. With FB as a prototype compound, 4\u2010vinyl pyridine (4\u2010VP) was utilized as a working monomer; ethylene glycol dimethacrylate acted as a cross\u2010linked monomer, 1\u2010butyl\u20103\u2010methylimidazolium tetrafluoroborate and choline chloride/ethylene glycol as a dual eco\u2010friendly solvent in the presence of SWCNTs.2274.3.4\u03b2\u2010phase and hence enhance the electrical conductivity of the layer. In the two proposals, nearly 20 wt% of IL increased for the generation of cells of muscle, showing their pertinency for muscle's rejuvenation. Similarly, EA electrospun fiber composites have been developed with 1\u2010ethyl\u20103\u2010methylimidazolium bis(trifluoro methane sulfonyl)amide ([EMIM][TFSI]) and PVDF. The phase crystallization of the PVDF fibers was also initiated by this and hence enhances the ability to live of cell with not affecting the outer structure of myocytes. ILs also have the utility for the dissolution of various proteins, like fibroin of silk, collagen  and keratin  to get scaffolds for TE utility. [BMIM][Cl] was cast\u2010off with fibroin, a silk protein, to obtain sequentially arranged thin layers, and it was exposed to favor the expected propagation and distinction of prime keratin cells. Despite this, a similar IL was utilized to dissolve keratin protein, indicating that the removal of murine embryo fibroblast was quicker while prepared in this mixture scaffolds. Various type of IL was used for the dissolution of collagen protein. [EMIM][Ac] was one of them, the biocompatibility of whose established with the proliferation and adhesion method of a fibroblast.Due to their multifunctional behavior, ILs have been used in tissue engineering (TE) techniques, i.e., scaffolds and artificial muscles. In this way, various types of prospective and composite materials based on ILs have been known from time to time. In exacting, ionic electroactive (EA) layers that made up of ILs and PVDF was prepared by using two dissimilar kinds of ILs, namely, [BMIM][Cl] and [Ch][DHP], presented that its incorporation in to the matrix of polymer initiate the crystallization process of PVDF's polar he layer.228 In Similarly, to dissolve sucrose acetate isobutyrate as well as chitin an IL 1\u2010butyl\u2010 imidazolium acetate ([BMIM][OAc]) was used, which is utilize for the production of spongy form for TE and creating scaffolds having diverse pore value and with no toxic consequences on cells. For advancements in TE in bones, chitin as well as chitosan was also dissolved in IL which is done with mixing of it with hydroxyapatite. [EMIM][Ac] was utilized for the dissolution of chitin in neural TE techniques and made an even dispersal of CNTs, indicating that for the inspiration and restoration of nerve cells, the fabricated composite scaffolds can be used as replaceable electrodes. ILs were also used for the dissolution of a number of polymers, such as cellulose in [BMIM][Cl], along with proteins to get highly porous scaffolds. The formed scaffolds proved the nonexistence of cell toxicity, which is a capable opportunity for TE techniques. For the manufacturing of cellulose\u2010based scaffolds, an IL 1\u2010n\u2010allyl\u20103\u2010methylimidazolium chloride ([AMIM][Cl]) IL acts as a solvent by using the sodium chloride (NaCl) leaching process with BSA. The ability to perform appropriate host responses and biological performance of the scaffolds were shown and as the capability of mesenchymal stem cells to join the formed scaffolds surface. Hydrogel concepts are also used with ILs for TE techniques, to repairing heart tissues, for rejuvenation of derma and transplant functions.On the other hand, for the dissolution of collagen protein, triethanolamine acetate ([TEA][A]) was also utilized. Following the dissolution, the mixture was added to the solution of Na alginate and hydroxyapatite to yield pellets to rebuild osteological disorder, raising a scheme of active bone fillers to regenerate bones.233 Si The prepared patch sticks very well to the murine myocardium by the electrostatic force of attraction between IL and tissue by excluding the requirement of suture for dermal TE utilizations was also obtained by the use of [BMIM][Ac]]. The in vitro study showed that the synthesized hydrogels could assist the adhesion and development of skin fibroblasts. The functional as well as nonliberating konjac glucomannan (KGM), which is an antibacterial hydrogel, and 1\u2010vinyl\u20103\u2010(3\u2010aminopropyl)\u2010imidazolium tetrafluoroborate ([VAPim][BF4]) have also been prepared and utilized for the advancement of wound healing for diabetics.To show the development and in vitro 3D enclosing of chief cardiac muscle cells and hearts fibroblasts, a hydrogel, namely, GelMA/Bio\u2010IL was established. The ability of the cell to survive and its metabolic activity were examined by the dispersion of F\u2010actin/DAPI staining. It was proved that hydrogels, namely, GelMA/Bio\u2010IL displayed a remarkably advanced ability to survive compared to the typical unadulterated hydrogels, i.e., GelMA. Formerly explained, hydrogel was utilized to produce conductive and adhesive heart patches.238 Th The outcomes displayed that the HepG2 and MKN45 cells (carcinogenic cells) scattering reduced much quickly in these hydrogels compared to the blank control, i.e., no further hydrogel cancer cells.On the other hand, hydrogel\u2010based collagen and [EMIM][Ac] were manufactured for TE as well as for cancer treatment.242 ThFigure\u00a0Electrospun patches were set within 1.25% (w/v) Irgacure 2959 into ethyl alcohol around 2 h, heeded through direct acquisition of different absorptions of Bio\u2010IL and cross\u2010linking by the direction toward UV rays for 5\u00a0min Figure\u00a027a. To dFigure\u00a02414.3.5 As we know, the exclusive characteristics of ILs behave as an eco\u2010friendly solvent, like lower vaporization rate, the initial and many profuse uses of ILs are for solubility of cancer\u2010treating drugs. The use of ILs resolves numerous difficulties related to anticancer drugs. Much of the anticancer drug's nature is crystalline solid, showing some related problems like polymorphism and less bioavailability. The decent solvation abilities and IL physical and chemical alteration have been utilized, for illustration, to open the novel, more complicated pathways to the transport of the medicines like topical transport, which is known as the best path for therapy of exterior tumors like melanoma. The more significant figure of probable salts that are ionic makes it to be very clear that a wide variety of well\u2010admired characteristics can prepare ILs, therefore, making it capable of finding better runners with anticarcinogenic characteristics, i.e., act as APIs. This is much significant that the earlier explained properties of ILs as eco\u2010friendly solvents are no longer apparent, as their biological relations have been proved in many types of research.To fight carcinogenic cells, the development of ILs provides an indispensable role. For example, novel advances in sensors used to recognize biomolecules at very low concentrations have come to light. In the manufacturing of pharmaceuticals remedy, it is utilized in their preparation. It works like a solvent enabling its sanitization or permitting its withdrawal from naturally obtained materials and allowing their steadiness. Transport of medicines can act as a transporter, accessory, or unswervingly as an active API.243 As A surge in the acyclic side part of imidazolium, phosphonium, ammonium, and pyridinium based cations has been noticed as an enhancement in cell poisonousness. By contrast, the existence of oxygen on the substituted chain reduces it.Though these have some shortcomings in biotechnology and the environment, these properties are extremely significant in treatments of cancer where cell toxicity is initiated in carcinogenic cells. In that manner, a wide\u2010ranging organization of investigational outcomes had previously been attained by meant for the preferable ILs concerning its cell poisoning for some cancer\u2010causing cells. By giving an illustration, the crucial part of water\u2010hating and lipids loving the cations has been found.246 A  Symptoms like the failure of mitochondria, stress based on oxidation, and programmed cell death have also been detected in carcinogenic cells. In the field of remedial therapy of cancer, the purpose is to enhance the testified poisonousness upon the cancerous cells by minimizing the side effect on a normal group of cells. This dissimilarity in cell toxicity cooperating by means of enhanced permeation retention consequences is the foundation of an effective treatment. Various inspiring outcomes have revealed a high need for cell poisonousness with the cell nature. In this manner for the cells of healthy human embryonic kidney and cancer of brain (T98G), imidazolium, and ammonium based four ILs had been detected, namely, 1\u2010methylimidazolium chloride ([MIM][Cl]), triethylammonium hydrogen sulfate ([TEA][SO4H]), [BMIM][Cl], and triethylammonium hydrogen phosphate ([TEA][PO4H]). Noticeably, when the ILs used in a concentration of more than 0.01\u00a0mg mL\u22121 show less toxic behavior over normal cells but major toxicity toward cancer causing cells, [BMIM][Cl] displayed the maximum anticancer performance. With the utilization of additional traditional ILs like APIs and appreciation of their resourcefulness, it may also be conceivable to change various medicines into an IL (API\u2010IL) directly. Egorava et\u00a0al. defined three routes to change any drug into an IL. The first method involves using a remedy that is ionic in nature with the collaboration of such ions which carry an opposite charge, such as cationic IL, namely, imidazolium, with a negatively charged drug. The second method comprises the dative bond of the medicine with the ILs cationic part, sometimes more rarely, furthermore with the anion. The third method explains the combination of the first and second methods by using two concurrent drugs. This research described seven ILs comprising salicylic acid (SA). In addition, by an enhancement of SA solubility, the cell toxicity also increases on colorectal adenocarcinoma human cell line (CaCo\u20102) associated with traditional ILs that is imidazolium\u2010dependent. While no significant variance in poisonousness was detected in normal cells in this instance, it unlocks the technique for the synthesis of other advanced medicines for cancer therapy.This had been accredited to the inter attraction and addition of the cation inside the membrane of cell.248 Sy designed NPs by combining 1\u2010ethylvinylpyridinium [EVPy] based cation, i.e., poly(IL\u2010co\u2010N\u2010isopropylacrylamide) with an anionic part consist of deoxycholic acid. The shaped NPs were utilized like medicine transporters to convey the doxorubicin (DOX) that is model drug by a skillful transport by changing the temperature and pH. For the transport of 5\u2010fluorouracil, polyacrylate as well choline are used as nanogels.Combining the ILs with other materials provides the best degree of function in cancer therapy. Occasionally, for the transport of medicines, various more advanced substances are synthesized by combining ILs with polymers. Cui et al.253 de The implementation of microwaves creates a temporary enhancement of temperature, which initiates the death of cells in tumor areas. The outcomes displayed the entire elimination of tumors in 16\u00a0days when progressive development of tumors was detected. To upgrade the characteristics of biological hydrogels, ILs are introduced.The IL\u2010based scheme displayed much constancy and a protracted medicine that release at an acidic stomach medium having pH (1.2) for an additional ten days. In a diverse case, combining polydopamine NPs with DOX and [EMIM][PF6] as model IL and anticarcinogenic drugs was known for collective hyperthermia therapy and chemotherapy. The scheme was also used to treat various disorders like tumors in rats, and, remarkably, the IL was not used to initiate poisonousness by self but as a sensitizer for radiations, i.e., microwave.255 Th which are prepared by the cross\u2010linking of microbial transglutaminase in between fishbone collagen (FBC) and genetically engineered collagen . With advanced porosity and higher mechanical strength, the [EMIM][Ac] had substantial belongings on the properties and structure of the hydrogels. Additionally, the IL occupies an important function in preventing the gel's enzyme\u2010based hydrolysis, which is facilitated to sustain the material purposes for a long time. The cell\u2010based studies were done on the gels by using well normal cancer HepG2 and MKN45 cells and normal fibroblasts 3T3\u2010L1 and L929 cells. The fibroblast explosion was enhanced by using the gels FBC as well as HLC. At the same time, they had a much hindering consequence on the growth of carcinogenic cells because of the ILs characteristics against the cancer and the modification of the organizational properties of the gels.For the development of hydrogels, [EMIM][Ac] introduced by Li and Fan242 wh4.3.6 ILs have a unique capability of twinning with the cell walls of microbes, with which they accumulate at the layer's constituents and hence break the integrity of the cell membrane, which is ideal for killing microbes. This property is remarkable, since new materials/substances capable of eradicating or preventing the development of bacteria or fungi is critical to the development of bacterial and viral resistance, as the recent events related to the novel coronavirus SARS\u2010CoV\u20102 have shown. Existing issues related to antimicrobial/viral resistance are exacerbated by the abuse of antibiotics and biomatrix or medicine contaminations through fungi or viruses. One of the remarkable properties of ILs is that they can dissolve in numerous liquids, including H2O, which makes ILs appropriate for biomedical implementations. Some solutions of ILs in water have been certainly known to have effective antimicrobial performance. While dissolved ILs are not regarded as actual ILs because they do not contain entirely of parent ions for a long time, this indicates that the required process is because of one either both ions, collectively both ions show innate performance against microbes.Due to their improved performance, ILs are described as the chief cause for its cell toxicity. Whereas this characteristic is problematic for eukaryotic, mammalian cells, as seen in the case of cancer treatments, it however provides excellent opportunities in microbiology.256 IL redworms, zebrafish, as well as algae. For the biological performance of ILs, the size of cationic chains plays an important role. By accumulating on the anionic membrane of microorganisms, IL's cationic lengthy side chains form a heterogeneous spatial part. These properties made cations much sensitive constituents in the direction of cell walls of microbes, as confirmed by the remark of various physical processes of accumulation of several types of ILs with diverse cations on the surface of bacteria cells, like Escherichia coli. In reality, IL solutions against bacteria have the same chemical arrangements as other recognized cation based chemicals that kill microbes and surface active agents, like quaternary ammonium materials, having both properties like\u2010charged water\u2010loving head part and water\u2010hating tails. These similarities show that ILs may combine to form micelles that are amphiphilic in nature inside the solution, whose capability is enhanced by enhancing its solubility in fats or lipids that may be operated by increasing the side chain of the alkyl group. Micelles are capable of discarding the membrane's wholeness by ionic attraction in the positively charged part of the ILs and the negatively charged part of the cell's membrane, leading to a decrease in the barrier activity of the outermost layer.Initial in vitro research for a relationship involving the construction of the ILs and its probable characteristics against microbes had been conducted on numerous microbes like bacteria,260 re A parallel activity procedure was noticed when alkyl tributyl phosphonium chlorides were put in interaction with the fungi Aspergillus nidulans, harming the filaments and the wall of the cell. The possible poisoning of three alkyls [\u2010(\u2212)\u2010methoxy methyl] dimethylammonium chlorides have also been established for various Gram\u2010negative bacteria , Gram\u2010positive bacteria , and wild type bacteria like Candida albicans, also signifying the consequence of the lengthening of alkyl substituent on their antimicrobial chain length on their antimicrobial action.The described process is the furthermost known process related to the use of ILs for microbes like fungi bacteria, which is chiefly credited to the cations of IL. However, cationic and anionic parts or amalgamation of these two show some activity with the cell layers. During investigations on the layer model interface of ILs in bioengineering duplications, it was found that cations or anions can interact on the bilayer of lipids, altering the organizational and changeable characteristics of the bilayer, which leads to its permeability.268 A  Differently, an antibacterial IL and a peptide that was antimicrobial in nature were coupled by \u201cclick\u201d chemistry, producing against behaviors toward Gram\u2010negative, many drug\u2010resistance medical isolates and anti\u2010biofilm mechanism for an unaffected clinical Klebsiella pneumoniae isolate. To increase the antimicrobial performance of K. pneumoniae, Bacillus subtilis, and S. aureus and the category of some organic salts related to ciprofloxacin as well as norfloxacin are introduced as anions. Chi and lysozyme, which are known natural substances that work against microbes, were also coupled with various ILs to attain an extra effective antimicrobial agent. The guanylate chitosan byproducts presented a more antimicrobial nature than well\u2010ordered Chi. At the same time, when choline, deoxycholate or lauryl sarcosinate were combined with lysozyme and displayed better antimicrobial properties toward the Gram\u2010negative bacteria like E. coli and P. aeruginosa. The ILs efficiency to enhance the activity of peptides that is bioactive in nature has been lately displayed. Using \u201cclick\u201d chemistry, synergy occurs between an antibacterial IL and an antimicrobial peptide. The obtained materials were known to keep the antimicrobial property of peptide's in contrast to Gram\u2010negative bacteria multidrug\u2010resistant clinical isolates and better stability for tyrosinase\u2010mediated tempering.Aside from its immediate consequence on microbes, ILs antimicrobic activity can be surged by combining some additional common biocides, showing a significant current examined center. For example, the 1\u2010alkyl\u20103\u2010methyl imidazolium\u2010based IL had been coupled with anions having Ag and Cu to enhance the antimicrobial property in contrast to various disease\u2010causing bacteria and fungi.259 DiS. aureus and E. coli, the power of which increases by enhancing the length of the chain of cation, at a similar time being supposed to be biocompatible. On treating PVC substrates with an IL, i.e., phosphonium as an outside layer to get a super water\u2010loving exterior that ignored the sticking of P. aeruginos and S. aureus, also with a bactericidal consequence. Poly\u2010IL film that based on imidazolium and quaternary ammonium incorporated with zinc is effective on wound when tested on S. aureus contaminated mice by using in vivo studies of methicillin\u2010resistant.Resources, as well as external surfaces made of ILs, had also been described to ignore bacteria colony formation and biofilm establishment, which is a significant aspect for missing contaminations by the contact with polluted sides. The layers made up of Imidazolium that was based on various anions, and cations have presented nature against bacteria in contrast to esistant.275Table\u00a0The above study shows that ILs feature various antimicrobial properties against different bacteria, algae, and fungus, but they are mostly poisonous to mammals cells. This is a disadvantage of ILs for biomedical applications. For every IL\u2010based antimicrobial research, the toxicity for various types of cells was also assessed, hence determining the proper concentration for their safe use. 4.4Figure\u00a0 As a result, a bending response is originated as an effect of the movement of charged particles, i.e., cations and anions, and their allocation nearby the electrodes. Soft actuators benefit from excellent elasticity, rapid reaction, light, less power utilization, and lower prices.ILs\u2010based polymer composites have been effectively employed to form small voltage and massive, bendable electroactive actuators (EAAs). They are based on ionic polymer composite and two conductive and bendable electrodes located on both sides. On applying an electrical field, there is an ion diffusion of ions that takes place in the polymer matrix Figure\u00a028a,b.[Cl]) and 1\u2010hexyl\u20103\u2010methylimidazolium bis (trifluoromethylsulphonyl)imide ([HMIM][TFSI]) had been synthesized to know the consequence of the size of anion and filled materials on the mixing behavior. It was assessed that polymer crystallization in the EA \u03b2\u2010phase depends on the ILs existence, not on the materials from which it is made. The electrical conductivity of a substance is based on the quantity of IL and the size of the anion. On the spot, the bending is associated with the extent of crystallinity, mechanical characteristics, and IC. The mechanical properties are almost independent of the type IL, while the conductivity is much based on the kind of anion used rather than the alkyl group's size. The effect of the width of film on the behavior of PVDF/[EMIM][TFSI] (1\u2010ethyl\u20103\u2010methylimidazolium bis (trifluoro\u2010methyl sulphonyl) imide) was also examined, and it was found that the mix actuation of the blended materials changes appositively with the width of the sample.The EAAs are steadier over repetitive bending cycling and can work in a wide variety of temperatures because of the heat resistance property of ILs.285 Am The effect of the matrix that was polymer\u2010based on the actuator activity had also been assessed with the IL, i.e., [EMIM][TFSI] inside various fluorine\u2010containing matrixes, communicating that the actuator execution is based on the type of polymer used. PVDF mixed with N,N,N\u2010trimethyl\u2010N\u2010(2\u2010hydroxyethyl) ammonium bis(trifluoromethyl sulphonyl) imide ([N1112OH][TFSI]) and [EMIM][ESO4] to know the effect of cations. The outcome exposed the mixing response is much rather based on the IL amount than its kind. A preformed polymeric membrane on perception with ILs results in electromechanical actuators. The membranes of Nf with [EMIM][TfO] as well as nanoparticles of gold act as anionic part, and its electromechanical activity is a function of its temperature of formally explained anionic part direct to actuators having less cationic curvature with an increase in temperature and the reorganization process was slow with an increase in temperature near 50\u00a0\u00b0C. While more anionic, curvature with increase in temperature was also noticed, and the speed of the reorganization was increasing at a temperature of 60\u00a0\u00b0C  in three layer arrangements, was also assessed.291 Go3SO3]) was synthesized by electrode spray casting. PDMS shows brilliant properties like flexibility, clearness, adaptable surface chemistry, less permeability for water, and low electrical conduction, and thus becomes an attractive aspirant for the synthesis of sensing and the devices, which convert energy from one form into another. The prospective of the manufactured substances as actuators stems from two methods: the electrostatic double\u2010layer capacitor and the Faradic capacitor mechanism. Some IL/polymer actuators are derived from nature and is also developed. Poly(3\u2010hydroxybutyrate)/1\u2010butyl\u20103\u2010methylimidazoliumbis (trifluoro methyl sulphonyl) imide ([BMIM][TFSI]) known as soft actuators and are H2O and humidity proof having a macroscopic bending that can be reversed for giving potentials of 0.1 to 7 V and brilliant working robustness equal to 105 cycles at 2 V was begin. Biodegradable actuators are quick to respond to the application of low voltages.The transparent actuators are prepared from the poly(dimethyl siloxane) (PDMS) and 1\u2010ethyl\u20103\u2010methyl imidazolium trifluoro methane sulphonate  definite custom\u2010made adsorbent substances, having particular physicochemical behavior, which is similar to the nature of a contaminant. Environmental treatment can be done very effectively using sorbent materials and ionic liquid. On the other hand, IL can be used as a greener solvent in place of previously used poisonous solvents to produce materials and reduce the pollution due to the industry.299 Th4.5.1 The world health organization reported that about 6 billion people will face water starvation by 2050. Due to water lack and consumption, the permit for freshwater each day has different approaches to treat wastewater as the primary origin of getting to freshwater. The water remedy is being redirected to implement an efficient and economical way that enables resource retrieval. Therefore, the effect of distinct methods and technologies for the sanitization of polluted water is a crucial environmental issue. Different kinds of adsorbents, like biological/man\u2010made polymers and bio\u2010based substances, have been used to remove contaminants from polluted waters and solutions in water; the usefulness of adsorbents, including the capability to purify polluted water, is a tempting subject in water processing. Thus, assemble creative adsorbents with specific adsorption and good adsorption/desorption behavior below soft and greener circumstances.In recent years, water contamination emerged as one of the many unprecedented crises due to rapid urbanization and automation.300 Th IL\u2010based antimicrobial substances are engaging nominees as adsorbents, including the double role of adsorbing the organic/inorganic impurities and discarding the microbial contaminants from aqueous media. Water pollution has been a major environmental severe problem during the past decades. Various new substances have been prepared for this problem from time to time, in which ILs are the best material to remove this problem. ILs working process is based on photocatalysis and adsorption of pollutants present in water. Many works are done on this application devoted to ILs\u2010based materials.ILs are critical in water treatment due to their higher prospect of withdrawing a broad coverage of contaminants from aqueous media.304 IL synthesized sorbent material to remove water pollutants like anionic dye  nanocomposite. This nanocomposite can be obtained by coating a magnetic core with silica which is further functionalized with PIL in which IL monomer unit is (dimethyl\u2010dodecyl\u20104\u2010vinyl benzyl ammonium chloride). In this AR, sorption efficiency to H\u2010bonds, ionic bonds as well as \u03c0\u2013\u03c0 interactions. On the other hand, a repulsion between MG (cationic dye) and PIL prevents the adsorption of dye and enhances selectivity. Fe3O4@SiO2@PIL can adsorb AR selectively after magnetic separation of a solution of AR and MG, leaving MG in the solution . When the adsorption test was done with 2,4\u2010dichlorophenol , 2,4\u2010dinitrophenol , bisphenol A (BPA), etc., using various silica surfaces like vinyl silica pristine silica, it was found that the IL\u2010P sample adsorbed a high amount of water pollutants in less time. This shows an advanced result in the existence of IL on the surface of silica, in which ionic as well as \u03c0\u2013\u03c0 interactions occur involving the imidazolium ring (IL), which is positively charged and negatively charged aromatic ring which is related to phenolic pollutants. It is also found that ILs are reusable after treating polluted water. By combining cellulose\u2013Fe3O4 with PIL using epichlorohydrin and 1\u2010methyl imidazole, a magnetic sorbent material was generated tested for an anionic dye like Congo red (CR)[307]. CR adsorption attains equilibrium after 11\u00a0min with 131\u00a0mg g\u22121  from the polluted water. IL\u2010hydrogels also act as sorbent material for cationic and anionic pollutants. Similarly, IL\u2010based cross\u2010linked polymer like polydivinyl benzene (PDVB) 1\u2010aminomethyl\u20103\u2010vinylimidazoliumchloride hydrochloride IL (PDVB\u2010IL) was used to get rid of Cr (VI) from H2O. In which maximum work capacity is between 12 and 2\u00a0pH values.By combining chitosan and IL (CS\u2010IL), natural polymer\u2010based materials were prepared for the adsorption of anions , are severe environmental concerns pushing extreme harm to human fitness. Air pollution is detrimental to the air passageways and lungs and may harm other human body organs. Therefore, there have been increasing worries about decreasing or eradicating the threats originating from air impurities. Air separation processes may eliminate air impurities and enhance respiratory air grade. The separation composites recreate a vital part within the air infiltration method, and the invention of creative air filters has acquired significant concentration in current days. Nevertheless, traditional filtration substances are useless for dismissing microscopic particles. Therefore, air purification utilizing nanofibrous sieves and nanofibrous membranes has garnered significant favor; wildly; electrospun nanofibrous membranes have achieved importance within the percolation field owing to their distinguished effects.Fast urbanization and automation for enhancing social life have obtained undesirable air pollution problems. Air contaminants, particularly CO fitness.312 Ai Nowadays, ILs\u2010based substances are among the possible prospects of air filter incorporation due to their unique gas split, photoresists, disinfectant effect, and anticorrosion, allowing a relatively unique method to evolve within the last two years. Different ILs\u2010based membranes have been laid for air treatment with reinforced IL membranes, polymer/IL compounds, polymer/IL/inorganic, and IL\u2010gelled films.Tiny PMs, for example, bioaerosols, can have different germs, microbes, and fungi that may induce intense allergic, respiratory, and communicable disorders via communication in the air, therefore, it is essential for the vision of antimicrobial, antiviral medicines, air sieves.316 No2 continuous surging rate. Different work is done to solve this problem from time to time for gas sensitivity, and gas separation composites are made up of polymers and ILs. These ILs based on imidazolium are mainly used in the gas separation process because they are highly soluble in CO2, highly diffusible, and much permeable. Their infusibility and selectivity are greater than ammonium as well as ILs that were based on phosphonium. The H present that is acidic in the cationic part affects the carbon dioxide solubility of H\u2010bonding. Due to fluoride anions like PF6, BF4, and TFSI give much solubility in CO2 based compounds. These anions act as Lewis's base, and CO2 acts as Lewis's acid. Due to this, the CO2 and anions solubility increase. Poly(amide\u2010b\u2010ethylene oxide) (Pebax) acts as a good separating material for carbon dioxide from polluted air. Due to its high separation performance, Pebax 1657 is the commercially best Pebax. Polar components are present in both hard and soft segments of Pebax 1657; due to this, it has high solubility selectivity for CO2/H2 compared to other Pebax. The anion plays an essential part in the permeability of CO2. The introduction of IL also increases the affinity of NPs with the polymer matrix, primary to superior CO2/N2 selectivity. The result of [EMIM] [BF4] inclusion into Pebax 1657 is a hollow\u2010fiber gel membrane and based on Pebax, which is shown after the adding up of IL, after that a CO2 permeability was observed up to 300%. Figure\u00a0Among various problems of the environment, high energy utilization among global warming paid much attention to gas separation, most likely COermeable.318 Th2 superhydrophobic membranes that are made from using nanocomposite, i.e., tetramethylammonium hydroxide IL, are utilized for separation of water vapor (WP). The composite membrane was used as another method for the separation of WP separation from flue gas.Nf\u2013IL\u2013SiOflue gas.3234.5.3 Despite all these steps, implementations like in biomedical tools, edible layers, and packings, bioactive sheets and functional packaging demand additionally breakthrough investigation. By the breakdown of collagen with water, a protein (gelatin) is produced. Gelatin also may produce flicks and covers through fine optical opaqueness and robotic potency. The actual content of aromatic amino acids has an intrinsic UV intercepting capability, creating universal materials.The development of materials from renewable sources is becoming a paramount and paradigmatic activity for the R&D and industrial communities. Significant work is undergoing to design sustainable and functional substances from biopolymers that may substitute traditional non\u2010biodegradable compounds.324 De Green antimicrobial hybrid layers have been designed utilizing\u2010allyl\u20103\u2010mthylimidazolium chloride and biopolymers, for example, cellulose, lignin, and starch, as qualified prospects for fresh food wrapping.Food packing is essential to enhance food protection and security. The evolution of novel, inventive packaging substances with antimicrobial effects may be accomplished through counting agents like antimicrobial ILs to hinder microbial development by facilitating live calculations of microbes.327 GrFigure\u00a0Bacillus subtilis  via controlling oxidation in the air  is certified to their insulating property and the opportunity of manipulating them to have extensive\u2010Z fillers that are harmless and give advanced protection from X\u2010ray.The aviation and aerospace industry are one of the largest adopters of high\u2010performance composites, using 50% of the total production of advanced composites in the US. The motivation of using composites in aerospace is similar to the automotive and marine industries.341 Th PCMs can also be utilized for various parts in aircraft like brakes, window frames, bulkheads, rotors, fuselage, brackets, wing boxes, fittings, airframe, blades, food tray arms, vertical fins, and tail assemblies due to their durability, much tolerance to atmospheric conditions, flexibility, corrosion resistance, with reduced noise level as well as resistance to fracture in nature. The aircraft's specific potency and rain erosion opposition can be enhanced by using hybrid kenaf/glass fiber FRPCs. On the other hand, temperature endurance can be increased by using carbon fiber reinforced silicon carbide in aircraft brakes as high as 1200\u00a0\u00b0C.The NPs based on carbon like graphene, CNT, and carbon black offer excellent aircraft protection from oxidation in the air.344 PC5The published work demonstrates that various IL\u2010based adsorbents have been designed utilizing distinct synthesis approaches to complete the necessities of different sample practice technologies for extraction. Adsorbents that were based on IL, particularly IL\u2010based magnetic compound adsorbents, have been effectively used to initial\u2010concentrate all types of foodstuff pollutants into food samplings. Despite the significant improvement in preparing and applying IL\u2010based adsorbents to food research, a few issues must be managed. The primary issue is the shortage of IL\u2010based adsorbents, including positively discerning adsorption capability. Incorporating IL\u2010based MIPs have delivered a unique approach to designing IL\u2010based adsorbents, including elevated extractive selectivity.Nevertheless, the numeral of ILs which may be utilized to design IL\u2010based MIPs is restricted to imidazole\u2010based ILs. Additionally, steps should be committed to developing the usage of new kinds of ILs to prepare MIPs. Similarly, compounds with other encouraging substances such as COFs may enhance the adsorption selectivity of IL\u2010based adsorbents. One more point is that IL\u2010based adsorbents toward food research are established explicitly upon IL\u2010based magnetic complexes.Additionally, NP distributions and exterior functionalization, ILs and NPs may be incorporated within other composites to produce synergistic consequences. Colloidal gels are assembled while inconsistent dispersed NPs interconnect to create a 3D system, while colloidal glasses are acquired when interfacing NPs entangle the concentrated spread NPs. Additional NP and IL hybrid systems classes possess NP and IL\u2010based fluid crystalline catalysts and NP\u2010stabilized IL\u2010based emulsions. IL and NP combinations are usually incorporated within membranes or layers as covering composites toward electrodes, substrates solid\u2010phase composites, or gas partitions. Enhanced activity of the membranes has been completed the modification of NP and ILs subsequently. Membranes containing ILs and NPs have been broadly investigated to isolate gases. The examined more reasonable selectivity for gas detachments has been attributed to the interchanges among NP/IL and the response or separation solution. A unique synergistic impact of NP and the IL\u2010incorporated sheet was followed, improving the catalytic performance and stability due to establishing a more effective porous connection area among liquid and gas stages in the membrane network. The structure of the film permitted more ionic interchanges between the NP and various charged entities, leading to higher conductivity and better electrochemical and thermal steadiness. Electrochemical sensors with sheets simulated with ILs and NPs exhibited better sensibility and reaction.Improved performance of the affinities between interactions, configuration, and effects of IL and NP combinations could enable the analytical method of such substances toward different applications. An optimized interpretation under specified working necessities may be executed for the preferred usage by carefully selecting NPs and ILs and their following community within a network which performs most suitable toward this distinct possibility. The applications of IL and NP have grown in current times, inspired by the improved effects of these substances. By encouraging implementations, additional investigation of the structure\u2013property connections of NP and IL mixtures is balanced to enable the practical design of these novel substances and their conversion to research.Further, to remarkably enhance the production of IL\u2010based polymeric materials, a design, including a high dissociation stable on low heat, must be developed. Few potential methods may be accepted, such as designing unique ILs and IL\u2010based monomers, hybrid ILs, and DESs possessing two or more ILs and employing these within the polymeric chain. We expect this perspective to understand ion gels and their implementations better, and lock the hole among the numerous corresponding areas. Furthermore, to the LIBs and SCs discussed within this article, it is envisaged that IL investigation advancements will be used in the forthcoming ESS and transformation appliances, for example, polyvalent ion batteries, metal\u2013air batteries, and competent fuel cells. Further ILs also used in the treatment of waste water in which many ILs are used, so in the future; we need to develop some methods for the regeneration of ILs from wastewater for further use and development of nontoxic ILs.Due to their distinctive characteristics and nature, ILs have been growing as candidates for advanced materials. The development of novel ILs depends upon the choice of their cations and anions and the choice of the polymer matrix, which leads to the formation of work specific ILs with extraordinary characteristics. For the use in various fields, ILs/polymers can be modified into various forms like gel, fibers, films, and accordingly, their properties also changed. This discussion is ongoing as we are moving toward developing green chemistry, but volarization, i.e., separation and oxidation of lignin, is an important challenge. To overcome this problem, lignin dissolved into the ILs and was extracted. The sulphonate and phosphate anion based ILs selectively dissolve the lignin and oxidize it to give more valuable renewable chemicals.346 Fu6\u03c0\u2013\u03c0, hydrogen interaction, ion\u2010exchange, electrostatic, and dipolar relations, have been discussed in detail. Different IL and polymer\u2010based NP combinations have been discussed based on a proportion of numerous intermolecular relations. These combinations may incorporate unexplored effects of NPs and ILs, which help possible implementations. This article discussed synergistic consequences of IL and polymer\u2010based NP hybrids in the context of appearing applications of such mixtures within the domains of catalysis, biomedicine, environmental, actuators, electrochemistry, and purifications.IL\u2010based adsorbents and electrolytes have considerably drawn concentration within the polymeric material synthesis area in current years. In this study, ILs based polymer composites and their exceptional physicochemical characteristics their capability to bond by analytes via multiple interchanges, such as Different configurations of IL and polymer\u2010based NP mixtures have been used to sufficiently sustain these applications. Steady NP distributions within ILs may be executed while repulsive intermolecular relations are more robust than stunning intermolecular synergies among neighboring NPs. The IL may comprise a coating near the NPs to avoid the accumulation and/or corrosion that enhances the operational efficiency of apparatuses or grows their activity under extreme working circumstances. Rationally developed MNP and IL\u2010based compounds have been used as positively capable materials in various phase catalytic responses. The better proton\u2010transfer effects of ILs and the increased electronic performance of MNPs distributions within ILs have been employed in electrochemical usages like batteries and electrochemical\u2010based sensors. Incorporating ILs\u2010based NPs in electrolytes toward energy storage material has been demonstrated to enhance the cations diffusion coefficient within the IL solution, electrical activity, thermal and electrochemical strength, and decrease corrosion. The accumulation of NPs, including catalytic effects, may reduce the overpotentials of multiple electrochemical responses, contributing to susceptible electrochemical sensor strategies. Still, there is room to develop a rational design for the fabrication of ILs\u2010based polymer nanocomposites that could provide advanced methods without compromising the extensive properties of ILs and could harness them in the end product.The authors declare no conflict of interest."}
+{"text": "Natural creatures always display unique and charming functions, such as the adhesion of mussels and the lubrication of Nepenthes, to maintain their life activities. Bio-inspired interfacial materials infused with liquid, especially for ionic liquids (ILs), have been designed and prepared to meet the emerging and rising needs of human beings. In this review, we first summarize the recent development of bio-inspired IL-based interfacial materials (BILIMs), ranging from the synthesis strategy to the design principle. Then, we discuss the advanced applications of BILIMs from anti-adhesive aspects  to adhesive aspects . Finally, the current limitations and future prospects of BILIMs are provided to feed the actual needs. In nature, the structure and function of biotas provide continuous inspiration for technological development and material fabrication. Learning from nature, a series of bio-inspired interfacial materials have been developed for meeting actual needs, such as lotus leaf-inspired self-cleaning materials , cactus-Inspired by pitcher plants, a liquid-infused material was developed for antifouling and anti-corrosion by preventing direct contact between fouling and the substrate through the liquid barrier layer on the surface. Ionic liquid (IL) is a liquid organic salt composed of organic cations and inorganic or organic anions. In the 1970s and 1980s, the first generation of ILs with non-volatility and thermal stability was established. To meet practical needs, the second generation of ILs with adjusted and specific physicochemical properties was developed in 1992. In the early 21st century, the third generation of biocompatible ILs attracted more research interest. The fourth generation of ILs with unique and unpredictable properties in solution or after mixing with other molecular liquids was first proposed in 2018. As a non-volatile lubricant, IL has attracted significant attention for extending the durability of liquid-infused surfaces. In contrast, the IL-based interfacial materials exhibit strong adhesion when the IL is tightly bonded within the polymer network. Meanwhile, the lubricity and adhesion of IL-based interfacial materials can be controlled intelligently by regulating the state of IL on the surface or inside the polymer. Therefore, the potential applications of advanced IL-based interfacial materials can be improved and enriched by employing appropriate ILs because of their attractive advantages such as adjustable wettability, structural variability, and desirable electrochemical stability.Distinct from the previous reviews on IL materials, this review mainly reexamines the development history of bio-inspired IL-based interfacial materials (BILIMs), as shown in Inspired by nature, four main types of BILIMs divided by spatial dimension have been prepared, ranging from one-dimensional (1D) IL polymer brush, 2D IL-infused porous surface, and supported membrane to 3D ionogel .By linking one end of the IL polymer chain, a 1D IL polymer brush can be formed on the surface of various substrates, thereby integrating excellent chemical and physical properties of ILs into these substrates . HoweverGenerally, the IL polymer brush was prepared on the surface of substrates by forming active free radicals and then polymerization such as ATRP, RAFT, and NMP. ATRP was performed by utilizing organic halides as initiators and transition metal complexes as halogen atom carriers to form a fast conversion \u201cfree ion to silyl ketene acetal\u201d equilibrium system through a redox reaction, thus realizing the control of polymerization reaction. ATRP has been widely used in the preparation of modified IL membranes due to its strong controllability. For example, 1-dMIm][PF6] to Au or silicon substrates through ROMP as shown in Different from the abovementioned methods, the double bond contained in the monomer is still retained in the polymer obtained by ROMP. ROMP is the ring-opening polymerization of ring alkenes. Its occurrence requires the following four aspects: the presence of ring alkenes, carbene complex catalysts, the breaking of double bonds, and the end-to-end connection. For instance, Although IL polymer brushes strengthen the interfacial interaction between ILs and substrate, it still confronts some problems such as the uncontrollable accurate density of grafted ILs and the limited types of available ILs . At presTo solve the fouling problem of pollutants, the slippery liquid-infused porous surface (SLIPS) has been developed by Aizenberg due to the existence of the lubricant layer. However, the SLIPS often face a problem caused by the loss of lubricant from the coating surface, and durability is still a challenge for the SLIPS. The loss of lubricant is a common phenomenon that may lead to the failure of SLIPS coating. Due to their advantages , ILs as one of the lubricants may alleviate this failure. The IL-infused porous surface was prepared by superwetting of the ILs on the surface through the capillary interaction or the hydrophobic interaction between the micro-/nanostructure and the ILs . To obta8,8,8,1][NTf2] was captured by the Al-MIL-110 porous surface to obtain an anti-biofouling coating with excellent stability and low lipopolysaccharide adsorption capacity. It as a novel synergistic coating has potential applications for the degradation and release of pollutants. Compared with the traditional in situ synthesis method, the hydrothermal method only needs to place the substrate directly into the precursor solution to obtain a porous surface. However, the hydrothermal method also has some obvious disadvantages, such as the need for high temperature and high pressure and other harsh conditions, which makes it more dependent on production equipment, which also hinders the universality of preparing porous surfaces on any substrate. Moreover, the mechanical robust and long-term properties of this coating are still a challenge in practical application.The hydrothermal method is a process of precursor chemical reaction on the substrate under high-temperature and high-pressure conditions. For example, 61-butyric acid methyl ester (P3HT/PCBM) binary system. Compared to the porous material prepared by the traditional directional freezing technology, the porous material prepared by the interface directional freezing technology exhibits anisotropy from bulk to the interface. However, this method is expensive and difficult to scalable manufacturing.The interfacial directional freezing technique is usually used to prepare porous materials with anisotropic interfaces. For instance, on the basis of the anisotropic porous film, Spraying\u2013deposition is a process of spraying solution to the substrate surface through a spray gun to obtain coating. As shown in These methods merely provide porous surfaces, but the successful preparation of IL-infused surfaces requires suitable interactions between the IL and the porous surface. Also, the function of the IL-infused porous surface depends on the characteristics of the IL existing on the surface, such as repellency, lubricity, wetting properties, and self-healing. Although many efforts have been made to improve the affinity between ILs and porous surfaces, the attractive force is still weak, and the content of ILs trapped by micro-/nanostructures is limited, leading to poor mechanical stability and easy to fail in extreme conditions . At presThe IL-based supported membrane was prepared by loading ILs into membrane internal channels . Compare2/N2, ethylene/ethane, amino acids, and propan-2-ol/H2O. For example, the IL/graphene hybrid membrane was prepared by impregnating ILs into the pores of the film by capillary force  (PAAILs) with polyvinylidene fluoride (PVDF) and reducing the viscosity of PAAILs by heating at 80\u00b0C to prepare the IL-infused supported membrane for separation amino acids in The multifunctional IL-infused supported membrane can be prepared by employing ILs with tunable properties such as density, viscosity, wettability, and chemical affinity . HoweverIonogel was formed by infusing ILs into the polymer matrix . In cont2O hydrogels exhibit the advantages of robustness, high flexibility, and elasticity under the effect of hydrogen bonds, but it is prone to failure in extreme environments. In order to solve this problem, the electrostatic interaction based on chemical bonds between anions and cations can be further introduced. For instance, 12(mim)Br). Under the effect of the host\u2013guest interaction, the ionogel can be used as a quasi-solid electrolyte for dye-sensitized solar cells with excellent long-term stability.Ionogel can be mainly formed between the IL and the polymer chain by the physical crosslinking method through hydrogen bonds, electrostatic interaction, and host\u2013guest interaction. The hydrogen bond was formed by the combination of H atoms and high-electronegative atoms in molecules, endowing ionogel with good reversibility and controllable crosslinked strength. For instance, The polymer chain entanglement of physically crosslinked ionogel is instantaneously reversible , but the4) methanol solutions without additional oxygen, humidity, or heating condition  (PNIPAM), physically crosslinked iron ions, and a carboxyl group. Physical crosslinking formed by ion coordination can improve the mechanical strength of ionogel, making it controllable between the strong coordination of Fe3+ and the weak coordination of Fe2+. In addition, covalent crosslinked PNIPAM and conductive ILs are used as thermal switches to obtain thermal/redox dual stimuli-responsive ionogel  can pose serious problems to humans in daily production and life. Undesired scale adhesion in pipes will cause fuel waste due to decreased heat transfer efficiency. Furthermore, once ice forms on a surface , it will seriously endanger the normal operation of the equipment and put humans in danger. Therefore, dealing with the solid adhesion problem is of great significance to ensure normal operation. BILIM has achieved success in antifouling and anti-icing applications due to the existence of the liquid barrier layer on the surface.3) was significantly reduced by 18 times, offering a novel solution for anti-scaling. In addition, 3 layer on X65 carbon steel to prepare a novel kind of BILIM  with good stability and synergistic sensitivity, 3)[PF6]2, IL: [EMIm][TFSI]), and the mechanical performance is controlled by polyurethane matrix   . The ioncrylate) . Cationscrylate)   . The ionIL-based adhesive tapes take full advantage of the characteristics of ILs and polymer networks to obtain high adhesive strength through physical interaction including hydrogen bonds and charge interaction. The adhesive strength, self-healing ability, stretchability, optical transparency, electrical conductivity, and other properties of IL-based adhesive tape can be controlled by reasonably designing the structure of ILs.3+ onto the main chain of hydrogel through covalent interaction. On the one hand, ILs can promote the hydrophobic interaction between hydrophobic segments of hydrogel, which can show the good mechanical properties of hydrogel after absorbing water. On the other hand, charged ILs can promote the migration of Al3+, improving the self-healing performance of hydrogel and accelerating the self-healing of rat wounds. The synergistic effect of strong adhesion and antibacterial properties of the IL-based wound dressing will play a huge role in wound healing.Many efforts have been made to apply adhesive materials to wound dressings; however, little attention has been paid to combining high adhesion with antibacterial/antiinflammatory functions in existing solutions. The incorporation of ILs brings high adhesion to antibacterial wound dressings, which makes up for the aforementioned problem. As shown in Considering the biosafety of BILIMs in bio-adhesion and wound dressing, numerous studies have shown that choline, some ammonium ions, and glycine betaine can be utilized as cations to obtain biological ILs with biodegradable and low toxicity . IL-baseDue to the negligible vapor pressure, adjustable charge, liquid lubricity, freezing tolerance, non-flammability, and electro-chemical stability of ILs , BILIMs Although BILIMs have been used for anti-microbial purposes, the mechanism is still unclear: the increase in the alkyl chain length of ILs does not increase the antibacterial ability for all bacterial species, and the effect of structural changes on their antimicrobial capacity has not been widely discussed. The currently accepted mechanism is the interaction between the negatively charged bacterial cell membrane and the positive charges of the ILs disturbing the cell membrane, the hydrophobic segment of the ILs is inserted into the cell membrane, resulting in the death of bacteria. However, this theory has not yet been confirmed, and the antibacterial mechanism of ILs should be clarified in the future. Of course, with IL as an ideal lubrication layer, the loss of the IL layer on the porous surface is an inevitable problem when it is in a complex fluid environment. In future development, improving the stability and durability of the IL-infused coating is the primary problem to be solved and may be considered from the aspects of intelligent control of the state of the IL layer on the surface and intelligent release.The existing IL-based electronic devices may have undesired chemical reactions under high pressure, which may cause a decrease in conductivity and short circuits, thus leading to the failure of these electronic devices. Encapsulating ILs can alleviate this failure mechanism to some extent, yet brings problems of compatibility with the package interface, such as poor adhesion, poor toughness, and difficulty in bonding. Therefore, it is necessary to further explore the internal composition and crosslinking forms of ILs materials to improve the electrochemical performance, durability, stability, and compatibility of biological sensors.Due to the diversity and the adjustment of anions and cations, IL-based stimuli-responsive materials can achieve controllable physical and chemical properties as well as functions by reasonably designing ionic species anion, cation, hydrophilicity, and hydrophobicity of ILs. Although many efforts have been made to develop various IL-based smart devices, it is necessary to systematically study the mechanism between the properties of ILs and the stimuli-responsive performance of ILs. From the perspective of practical applications, there are still many challenges and opportunities."}
+{"text": "Bacillus amyloliquefaciens is a probiotic for animals. Evidence suggests that diets supplemented with B. amyloliquefaciens can reduce inflammation; however, the underlying mechanism is unclear and requires further exploration. The exopolysaccharides of B. amyloliquefaciens amy-1 displayed hypoglycemic activity previously, suggesting that they are bioactive molecules. In addition, they counteracted the effect of lipopolysaccharide (LPS) on inducing cellular insulin resistance in exploratory tests. Therefore, this study aimed to explore the anti-inflammatory effect and molecular mechanisms of the exopolysaccharide preparation of amy-1 (EPS). Consequently, EPS reduced the expression of proinflammatory factors, the phagocytic activity and oxidative stress of LPS-stimulated THP-1 cells. In animal tests, EPS effectively ameliorated ear inflammation of mice. These data suggested that EPS possess anti-inflammatory activity. A mechanism study revealed that EPS inhibited the nuclear factor-\u03baB pathway, activated the mitogen-activated protein kinase (MAPK) p38, and prohibited the extracellular signal-regulated kinase 1/2, but had no effect on the c-Jun-N-terminal kinase 2 (JNK). EPS also activated the anti-oxidative nuclear factor erythroid 2\u2013related factor 2 (Nrf2) pathway. Evidence suggested that p38, but not JNK, was involved in activating the Nrf2 pathway. Together, these mechanisms reduced the severity of inflammation. These findings support the proposal that exopolysaccharides may play important roles in the anti-inflammatory functions of probiotics. Inflammation involves a series of defensive reactions, including removal of impaired tissues, and fighting against invading pathogens or harmful factors. However, prolonged or excessive inflammation results in tissue damage and prompts the development of several chronic disorders, such as cancers, type 2 diabetes, and cardiovascular diseases . ProbiotBacillus amyloliquefaciens, a Gram-positive bacterium, has been suggested to be probiotic and prebiotic for animals [B. amyloliquefaciens can reduce inflammation. For example, dietary supplementation with B. amyloliquefaciens improved the growth performance and decreased intestinal inflammatory responses in piglets with intra-uterine growth retardation [B. amyloliquefaciens SC06 showed decreased levels of the pro-inflammatory cytokines interleukine-6 (IL-6) and tumor necrosis factor-\u03b1 (TNF-\u03b1) in the ileum [B. amyloliquefaciens administration reduced biomarkers of inflammation in dextran sulfate sodium-induced colitis in mice [B. amyloliquefaciens, the exact molecular mechanism is still unclear. Nonetheless, a potential clue is that the extracellular extracts of B. amyloliquefaciens MBMS5 were reported to possess antioxidant activity and anti-inflammatory property [B. amyloliquefaciens may play a vital role in the anti-inflammatory function of this probiotic. In line with this, scholars have proposed that exopolysaccharides produced by probiotics likely have immunomodulatory and/or anti-inflammatory functions [ animals ,5,6,7,8, animals . It is u animals , and is  animals . Recentlardation . Likewishe ileum . Moreove in mice . Althougproperty . Thus, tunctions ,17.B. amyloliquefaciens amy-1 have been characterized in our previous study [Escherichia coli, because the occurrence of type 2 diabetes is closely associated with chronic inflammation-induced insulin resistance [Microbial exopolysaccharides are carbohydrates synthesized and accumulated extracellularly by micro-organisms ,18,19. Sus study . They arus study . In our sistance . Consequsistance , whereassistance ,24,25. BExopolysaccarides were isolated from the medium of amy-1 culture. The total carbohydrates in this preparation  occupied 95.65 \u00b1 0.68% of the total mass, while proteins, lipids, and polyphenols were undetectable in EPS. The cytotoxicity of EPS to the model cell line THP-1 was examined. B. amyloliquefaciens that does not produce exopolysaccharides should be cultured simultaneously, and the resulting medium being subjected to the same isolation protocol used for EPS preparation. However, we do not know any strain of B. amyloliquefaciens that does not produce exopolysaccharides. Thus, the control for EPS was prepared by incubating the same volume of sterile medium at 37 \u00b0C for 48 h, mimicking the condition of amy-1 cultivation except that the medium was not inoculated with any micro-organisms. The medium was then subjected to an isolation protocol, the same as that used for preparing EPS. The resulting powders, abbreviated as PPT  stimulation caused ear edema in mice at 4, 16, and 24 h after TPA application (Group 2). EPS treatment  resulted in dose-dependent amelioration of the ear edema in mice at these time points. The effects of 500 and 750 \u03bcg/ear of EPS were close and were both similar to that of 500 \u03bcg/ear indomethacin (Group 3), an anti-inflammatory medicine. These data demonstrate that EPS has an obvious anti-inflammatory effect in vivo.LPS activates the proinflammatory IKK/NF-\u03baB pathway ,25. ThusMAPKs are also activated by LPS through the activation of toll-like receptor 4 . Figure Thus, EPS inhibits ERK1/2 and has no effect on JNK, but activates p38, and p38 is known to promote inflammation through the activation of activator protein 1 (AP-1), which promotes the expression of inflammatory cytokines . NonetheNrf2 induces the expression of anti-oxidative enzymes, including heme oxygenase-1 (HO-1) and the glutamate\u2013cysteine ligase modifier subunit (GCLM) . TherefoSubsequently, when p38 inhibitor was added, the expression of HO-1, GCLM, and Nrf2 was obviously decreased in LPS and EPS cotreated cells B, Lane 5The anti-oxidative effect of EPS was then examined through analysis of the intracellular level of reactive oxygen species (ROS). As shown in B. amyloliquefaciens amy-1 was shown to impede the proinflammatory actions of LPS on THP-1 cells including: LPS-induced expression of iNOS, COX-2, TNF-\u03b1, and IL-6, phagocytic activity of the cells, and activation of the IKK/NF-\u03baB pathway. In the animal tests, EPS effectively ameliorated ear inflammation in mice, and the efficacy of EPS was similar to that of the clinical anti-inflammatory medicine indomethacin. These results suggest that EPS possesses anti-inflammatory activity. Our study further indicates that the underlying mechanisms are associated with several intracellular signaling pathways. EPS inhibits LPS-induced activation of the IKK/NF-\u03baB pathway and that of ERK1/2, yet at the mean time activates p38 and the Nrf2/HO-1 pathway. The former reduces the intensity of inflammation caused by LPS; the latter enhances anti-oxidative function of the cells that decreases oxidative stress caused by inflammation, protects cells from oxidative damages, and also reduces the intensity of inflammation. Moreover, we found that JNK is likely not involved in activating the Nrf2 pathway in THP-1 cells.In this study, the exopolysaccharide preparation of The compositions of EPS and PPT are obviously different, because the carbohydrate content of EPS is over 95% of its total mass, whereas PPT contains 52% carbohydrates and a substantial amount of proteins (over 10%). PPT was likely composed of ethanol-insoluble components of the MRS broth. The effect of PPT was also tested to explore whether medium ingredients might have contributed to the observed activity of EPS. As a result, EPS and PPT exhibited distinct effects on the growth of THP-1 cells. PPT mildly yet significantly inhibited the growth of THP-1 cells at 150 and 200 \u03bcg/mL, yet EPS did not. It is speculated that at higher concentrations the content of PPT might have significantly affected the osmotic pressure of the culture medium of THP-1 cells, leading to the observed dose-dependent effect of PPT on the survival of THP-1 cells. Moreover, unlike EPS, PPT did not show any anti-inflammatory activity. PPT had no effect on suppressing LPS-induced iNOS and COX-2 expression, did not inhibit nor activate MAPKs, and neither promoted HO-1 expression, suggesting that the ethanol-insoluble components of the medium have no anti-inflammatory activity. Taken together, we conclude that the activity of EPS was not contributed by medium ingredients.EPS demonstrated differential effects on MAPKs. EPS alone activated p38 and inhibited ERK1/2 in a dose-dependent manner, but did not activate, nor inhibit JNK. LPS was reported to activate ERK1/2, JNK, and p38 , and ourERK1/2 ,30, p38 Therefore, our proposed mechanisms underlying the anti-inflammatory effect of EPS are depicted in B. amyloliquefaciens MBMS5 contained anti-inflammatory function [Lactobacillus paraplantarum [Bacillus subtilis [Lactobacillus reuteri [Lactococcus lactis [Bifidobacterium longum [B. subtilis exopolysaccharides were reported to inhibit NF-\u03baB expression [That EPS contains anti-inflammatory activity which coincides with the finding that the extracellular extracts of function . Other plantarum , Bacillusubtilis ,41, Lact reuteri , Lactocos lactis , Bifidobm longum , etc. Hopression . This stGanoderma lucidum were suggested to increase immunity, and one of the evidences was that they increased the phagocytic activity of macrophages [Angelica dahurica were suggested to have immunomodulatory properties and were shown to enhance the phagocytic activity of RAW264.7 cells [Treating THP-1 cells with EPS alone obviously increased the phagocytic activity of the cells , and cultured in a serum-free, antibiotic-free medium containing 0.2% bovine serum albumin and 100 ng/mL TPA for 24 h to allow cells to differentiate into M0-state macrophage-like cells [THP-1 cells were purchased from Bioresource Collection and Research Center  and cultured in antibiotic-free RPMI 1640 medium containing 10% fetal bovine serum at 37 \u00b0C in a humidified incubator supplied with 5% COke cells . Then, tAn antibody against iNOS was purchased from Novus Biologicals . The primary antibodies targeting COX-2, the IKK\u03b1, IKK\u03b2, phosphorylated IKK\u03b1 (Ser176)/IKK\u03b2 (Ser177), NF-\u03baB p65 subunit, I\u03baB\u03b1, phosphorylated I\u03baB\u03b1 (Ser32/36), p38, phosphorylated p38 (Thr180/Tyr182), JNK, phosphorylated JNK (Thr183/Tyr185), ERK1/2, phosphorylated ERK1/2 (Thr202/Tyr204), HO-1, and Nrf2 were purchased from Cell Signaling Technology . SP600125 and an antibody against actin were purchased from Calbiochem . Antibodies for Lamin B1, \u03b1-tubulin, GCLM, and SB202190 were bought from Abcam . The secondary antibody mouse anti-rabbit IgG conjugated with horseradish peroxidase (HRP) was purchased from Santa Cruz Biotechnology . The secondary antibody goat anti-mouse IgG antibody conjugated with HRP, protease inhibitor cocktail, and phosphatase inhibitor cocktail were from Merck Millipore. Other chemicals were ordered from Sigma-Aldrich .B. amyloliquefaciens amy-1 through ethanol precipitation as described previously [Exopolysaccharides were isolated from the culture medium (MRS broth) of eviously . The isoeviously .The control was prepared by incubating the same volume of sterile MRS broth without inoculating any micro-organism in a shaking incubator at 37 \u00b0C for 48 h like the cultivation of amy-1. The medium was then subjected to ethanol precipitation by the same protocol used for preparing EPS. The resulting precipitate (PPT) was collected, lyophilized, dissolved in sterile distilled water, and assayed for total carbohydrates and total proteins. In experiments, the vehicle control for EPS or PPT was the same volume of sterile distilled water.THP-1 cells were cultured and treated as aforementioned. Cells were incubated for 16 h for the analysis of iNOS and COX-2; 10 min for that of IKK and I\u03baB; 90 min for nuclear p65; 1 h  or 24 h Equal amounts of proteins were sampled from each treatment, subjected to acrylamide gel electrophoresis, and then transferred onto Immobilon-P Membrane PVDF membrane (Merck Millipore). After blocking the membranes with BlockPRO Protein-Free Blocking Buffer  for 1 h at room temperature, they were hybridized with primary antibodies diluted  in Immobilon Signal Enhancer for Immunodetection (Merck Millipore) at 4 \u00b0C overnight. Then, they were washed at least thrice with Tris-buffered saline (pH 7.4) containing 0.1% Tween-20 (TBS-T), and hybridized with HRP-conjugated secondary antibodies for 1 h at room temperature. Subsequently, they were washed thoroughly with TBS-T, and a proper volume of SuperSignal West Pico PLUS Chemiluminescent Substrate (Thermo Fisher Scientific), or Clarity Max Western ECL Substrate , was added to the membranes. Signals were detected using an imaging system , and band intensities were analyzed using the supplied software .6 THP-1 cells were seeded into 35 mm culture dishes and differentiated to M0-state macrophage-like cells by TPA as aforementioned. Then, they were washed twice with PBS and treated with SB202190 (Group 4 of 1 \u00d7 104 cells/well) and differentiated to M0 state by using TPA. After washing the cells twice with PBS, they were treated with 1 \u03bcg/mL LPS and/or 100 \u03bcg/mL EPS for 24 h. Then, they were washed twice with PBS, incubated in PBS containing 40 \u03bcg/mL neutral red for 1 h at 37 \u00b0C, and washed twice with PBS again. Subsequently, the cells were incubated in a lysis solution  for 1 h at room temperature. Absorbance at 492 nm was then measured using a microplate reader .THP-1 cells were seeded into 96-well culture plates  and allowed 2-week acclimation before the experiments. The mice were housed under a 12 h light\u2013dark cycle, allowed free access to water and food, and fed with a regular laboratory rodent diet. The mouse ear edema assay was conducted as described previously , with mo6 cells/dish) and differentiated to the M0 state by using TPA. The cells were then treated with serum-free media containing 100 \u03bcg/mL of EPS for 1 h. After washing the cells twice with PBS, they were incubated in serum-free media containing 10 \u03bcM dichlorofluorescin diacetate and 20 \u03bcM SB202190 (or vehicle) for 30 min. The cells were washed with PBS again and treated with serum-free media containing 1 \u03bcg/mL LPS (or vehicle) for 1 h. Then, they were washed twice with PBS and scraped off the dish under PBS. The resulting suspension was analyzed for fluorescence intensity (excitation wavelength 504 nm and emission wavelength 529 nm) in a fluorescence detector .THP-1 cells were seeded into 35-mm culture dishes (1 \u00d7 10p < 0.05.Data were analyzed through one-way analysis of variance followed by Scheffe\u2019s post hoc test by using the Microsoft program Excel. Significant difference was identified when"}
+{"text": "BRAF-mutated/ABCC1-expressing tumors.Encorafenib , a novel BRAF inhibitor, has been approved for the treatment of melanoma and colorectal cancer. In the present work, we evaluated encorafenib\u2019s possible antagonistic effects on the pharmacokinetic mechanisms of multidrug resistance (MDR), as well as its perpetrator role in drug interactions. Firstly, encorafenib potently inhibited the efflux function of the ABCC1 transporter in drug accumulation assays, while moderate and null interaction levels were recorded for ABCB1 and ABCG2, respectively. In contrast, the mRNA expression levels of all the tested transporters were not altered by encorafenib. In the drug combination studies, we found that daunorubicin and topotecan resistances were synergistically attenuated by the encorafenib-mediated interaction in A431-ABCC1 cells. Notably, further experiments in ex vivo patient-derived explants confirmed the MDR-modulating ability of encorafenib. Advantageously, the overexpression of tested drug efflux transporters failed to hinder the antiproliferative activity of encorafenib. In addition, no significant modulation of the CYP3A4 enzyme\u2019s activity by encorafenib was observed. In conclusion, our work indicated that encorafenib can act as an effective chemosensitizer targeting the ABCC1-induced MDR. Our in vitro and ex vivo data might provide valuable information for designing the novel effective scheme applicable in the clinical pharmacotherapy of  With a global estimation of 19 million new diagnoses and 10 million deaths every year, cancer is undoubtedly one of the major threats to human health .Pharmacokinetic factors promoting MDR are mainly associated with the decrease in drugs\u2019 intracellular levels and/or the enhancement of the drug-deactivating process ,4. ATP-bBRAF gene codes for the BRAF serine/threonine kinase, which regulates the mitogen-activated protein kinase (MAPK) pathway, an important cascade governing cell functions such as proliferation, differentiation, cell survival, and apoptosis. BRAF mutations are important drivers of tumorigenesis  (FITC) (cat. no. ab52459) and anti-\u03b2-actin (cat. no. ab8226) were purchased from Abcam . TRI Reagent was purchased from the Molecular Research Center . ProtoScript2 atmosphere at 37 \u00b0C . For the experiments, cells from passages 10\u201325 were used. High-glucose DMEM containing 10% FBS was applied for the maintenance of MDCKII and A431 cells, while RPMI-1640 supplemented with 10% FBS, 10 mM HEPES and 1 mM sodium pyruvate was used for the cultivation of NCI-H2228 and HCC827 cells. Encorafenib and some other compounds were dissolved in DMSO; its concentration was kept lower than 0.5% for all experiments. Relevant vehicle controls were employed for the elimination of possible influences of DMSO on the measurement outcomes.Parent Madin-Darby canine kidney II (MDCKII-par) cell line and its human ABC transporter-overexpressing counterparts  were obtained from Dr. Alfred Schinkel . Parent human squamous carcinoma A431 cells and their human ABC transporter -transduced sublines were accessed from Dr. Balasz Sarkadi . NCI-H2228 and HCC827 (human NSCLC cell lines) were obtained from the American Type Culture Collection . The cells were cultured under a 5% COg for 5 min, the obtained pellet was resuspended in BSA-containing MEM solution. The Ficoll Paque Plus was pipetted into the suspension, which was subsequently centrifuged at 100\u00d7 g for 10 min. Cells were collected from the interfacial area into a c-based media. In the resulting suspension, the residual Ficoll was further removed by centrifugation at 200\u00d7 g for 5 min. Finally, the obtained pellet was carefully resuspended in c-based media and then placed into a cell culture flask pre-coated with collagen I. The culture medium was replaced every 2\u20133 days until the confluence of cells reached 60\u201370%. For the removal of fibroblast contamination, anti-fibroblast microbeads  were applied according to the manufacturer\u2019s protocol. Possible interferences caused by the physiological cells were eliminated by replacing the initially used media with the media containing 10% FBS (after the cells reached 70% confluence again). Anti-cytokeratin 18 antibody was used for staining the cells and the epithelial origin was further confirmed by using Sony SA3800 spectral cell analyzer . For the whole experimental duration, the number of passages for NSCLC primary culture cells was no more than 4.Tumor biopsies taken from NSCLC patients were generously provided by the Department of Cardiac Surgery, University Hospital Hradec Kralove. The text of the informed consent was approved by the University Hospital Ethics Committee (study no. 202002 S04P) and was signed by all participants. In this study, samples 1, 2, 3, 4, 5, and 6 were obtained from adenocarcinoma , squamous carcinoma , adenocarcinoma , adenocarcinoma , combined neuroendocrine carcinoma , squamous carcinoma , respectively. After the lung lobectomy, tumor tissue was immediately excised by the pathologist to collect an NSCLC sample. The isolation of lung cancer cells was based on the method reported in published papers with minor optimizations ,19,20. F5, 1.5 \u00d7 105, 2.5 \u00d7 105, 2.2 \u00d7 105, 1.5 \u00d7 105 cells/well, respectively. After 24-h cultivation, cells were carefully rinsed with warm 1 \u00d7 PBS and then exposed to the designed encorafenib\u2019s dilutions or model inhibitors  for 10 min. Fluorescent substrates of ABC transporters (2 \u03bcM daunorubicin or 5 \u03bcM mitoxantrone) were subsequently added to the cells for a 60-min treatment. Afterwards, plates were placed on ice, and cells were treated with phenol red-free trypsin. The ice-cold 1 \u00d7 PBS solution containing 2% FBS was added to resuspend the cells. Using a flow cytometer , substrates\u2019 levels were detected under the excitation/emission wavelengths equal to 490/565 and 640/670 nm for daunorubicin and mitoxantrone, respectively.The drug accumulation study was performed following the descriptions in our previous papers ,21,22. M4 cells/well; A431-par, A431-ABCB1, A431-ABCG2, and A431-ABCC1: 2.0 \u00d7 104 cells/well; NCI-H2228: 1.2 \u00d7 104 cells/well; HCC827: 4.0 \u00d7 104 cells/well; NSCLC primary culture cells: 1.0 \u00d7 104 cells/well. After 48-h exposure to several concentrations of single drugs or drug combinations, cells were rinsed with a warm 1 \u00d7 PBS solution and then incubated for 1 h with freshly prepared MTT solution in Opti-MEM (1 mg/mL) at 37 \u00b0C. Subsequently, the MTT solution was discarded, and the formazan crystals were dissolved by DMSO, which was followed by a 10-min incubation. The microplate reader  was used for the determination of the absorbance at wavelengths of 570 nm and 690 nm. For further data processing, background absorbance at 690 nm was deducted from the data obtained at 570 nm. A medium-containing-vehicle or 40% DMSO served as 100% or 0% cell viability controls, respectively.Cell viability was evaluated based on the MTT assay as described in our previous papers ,20. The Drug combination studies in A431 and NSCLC primary culture cells were carried out similarly as in our previous descriptions ,20,22. C3VO4, and 10 mL/L Triton; 10 \u03bcL/mL protease inhibitor cocktail was supplemented into the buffer before use). Total protein was extracted from the whole cell lysate after the centrifugation . The Bradford assay reagent was subsequently applied for the measurement of the concentration of obtained total protein. For the separation of protein samples , 8% SDS-PAGE gel was used. Then, using the Trans-Blot TurboTM Transfer System , separated proteins were transferred to PVDF membranes, which was followed by blocking with TBST buffer (containing 5% non-fat dry milk) for 90 min at room temperature. The specific primary antibodies were diluted in TBST buffer in the following ratio: anti-ABCC1 (1:500) and anti-\u03b2-actin , and then applied to the membranes at 4 \u00b0C overnight. Afterwards, membranes were washed 3 times with TBST buffer, incubated with HRP-conjugated anti-mouse secondary antibody diluted in TBST buffer (1:2000) for 1 h at room temperature and additionally washed 3 times with TBST buffer. Then, Immobilon Western Chemiluminescent HRP Substrate  was added to the membranes. The bands were visualized by using the Chemi DocTM MP Imaging System  and quantified by ImageJ software .Western blotting experiments were performed according to the previous description ,20. Brie5 and 2.0 \u00d7 105 cells/well, respectively. After 24 h incubation, the cells were treated with the solution of 1 \u03bcM encorafenib or 25 \u03bcM rifampicin, which was followed by the 24 h or 48 h incubation. TRI Reagent was used for the extraction of total RNA from cells, while NanoDrop ND-1000 spectrophotometer  was employed for the quantification of its concentration. Two-step reverse transcription was performed using the T100 Thermal Cycler . First, 5 \u03bcM oligo(dT) was added to the RNA sample (1 \u03bcg) for hybridization at 65 \u00b0C for 5 min. Then, a mastermix  was supplied to the sample, and the cDNA synthesis cycle was finished in the thermal cycler (42 \u00b0C for 50 min followed by 65 \u00b0C for 20 min). Subsequently, qRT-PCR based on Taqman probes was performed in 384-well plates with a total final volume of 10 \u03bcL via QuantStudio 6 , following the protocol which was provided by the manufacturer of Taqman systems. The mRNA expression levels of transporter genes were evaluated by the 2\u2212\u0394\u0394Ct method, while GAPDH and HPRT1 were applied as internal references.A quantitative real-time reverse transcription polymerase chain reaction (qRT-PCR) assay was performed for the detection of gene expression as described in our previous paper . NSCLC c+ and the Vivid CYP3A4 substrate. Fluorescence was immediately detected by the microplate reader Tecan Infinite M200 Pro at 1 min intervals for 1 h. The raw data from 15 min were utilized for further analysis. In this experiment, the possible interference caused by DMSO (the solvent for pre-dilution of encorafenib and ketoconazole) was eliminated by applying a final concentration of DMSO (0.5%) in all encorafenib variants and both 100% and 0% enzyme activity samples.A commercial Vivid\u2122 CYP3A4 screening kit  was employed for this assay according to the protocol provided by the manufacturer. Serial dilutions of encorafenib  or 10 \u03bcM ketoconazole (served as the positive control fully inhibiting CYP3A4) prepared in supplied buffer were added into a black 96-well plate. Then, a mixture of the CYP3A4 isoform and NADPH regeneration system in buffer was applied to the relevant wells. After pre-incubation for 10 min, the reaction was started by adding the freshly prepared solution containing NADPp values were determined using one-way ANOVA followed by Dunnett\u2019s post hoc test or two-tailed unpaired t-test as defined in figure legends. Statistical significance was considered when the values of p < 0.05 were assessed.All the experiments were independently performed at least 3 times. Experimental data were analyzed using GraphPad Prism software version 9.4.1 . The 50 = 25.1 \u03bcM  and mitoxantrone (for ABCG2). Our results showed that encorafenib can moderately increase the accumulation of daunorubicin in the MDCKII-ABCB1 cell line with IC 25.1 \u03bcM a,b. Notemax value (5\u201322 \u03bcM) monitored in the clinical trial for 450 mg dose, which is currently used in the clinical practice [Next, to investigate whether encorafenib can antagonize ABCC1-mediated MDR by its inhibitory effects, drug combination studies were conducted in the A431-par cell line and its ABCC1-overexpressing subline. A total of 10 \u03bcM encorafenib was used for the following experiments with respect to its: (1) sufficient inhibitory effects on ABCC1, (2) negligible cytotoxicity in the chosen cell lines, (3) encorafenib\u2019s Cpractice .R = 2.59) and topotecan (RR = 2.51), respectively. On the other hand, encorafenib failed to induce statistically significant shifts of IC50s of both cytostatic agents in A431 parental cells (A (fractions of cells affected)-CI plots were subsequently presented for each of the combination settings. Synergistic effects were observed for the combination of encorafenib with daunorubicin/topotecan along the major range of FA in A431-ABCC1. Nevertheless, in the parental cell line, antagonism and/or additivity were clearly defined in both combination variants  is a novel anticancer agent that has been recently approved for the clinical management of unresectable or metastatic melanoma and metastatic colorectal cancer with utations ,16. Currutations . In thismax value (ranging from 5\u201322 \u03bcM) found in clinical studies [50 values, the interacting drugs are highly variable in terms of their affinity to ABCC1. Encouragingly, the functional inhibition of ABCC1 was demonstrated to be translatable into the effective reversal of MDR with the exception of brivanib . Considering the following encorafenib-associated factors: (1) its C studies ; (2) its studies ; (3) dec studies , even th studies ,27,28. I studies ,30. In c studies . Conside studies  and colo studies . Altogetbrivanib .Subsequently, we evaluated whether encorafenib possibly could play a victim role in the ABC transporter-mediated resistance. Our in vitro comparative proliferation studies showed that encorafenib\u2019s antiproliferative activity is not diminished by the functional presence of drug efflux transporters. In contrast, it was reported that Abcb1 and Abcg2 were able to affect the brain accumulation and disposition of encorafenib in vivo . The autFurthermore, the possible regulation of the ABC transporters\u2019 expressions by encorafenib was investigated. Our qRT-PCR data showed that the short-term encorafenib treatment had a negligible effect on the mRNA levels of selected transporters. The obtained results suggest that encorafenib itself does not induce ABC transporter-mediated MDR. Notably, existing studies have indicated that the expression of ABC transporters can be positively regulated by MAPK signaling. Thus, encorafenib can bear an additional MDR-antagonizing potential originating from its primary pharmacodynamic activity, i.e., a long-term MAPK inhibition . Taken tLast but not least, drug metabolism catalyzed mainly by CYPs is another essential pharmacokinetic factor that induces MDR and is a site for DDIs . PreviouIn summary, encorafenib potently and moderately inhibits ABCC1 and ABCB1, respectively, but does not meaningfully interact with ABCG2 or CYP3A4. The tested drug synergistically enhances the cytotoxic effects of MDR-victim anticancer agents in selected ABCC1-positive models in vitro and ex vivo. Notably, the encorafenib\u2019s antiproliferative effect seems not to be hampered by the presence of ABC transporters. Moreover, the drug does not influence the gene expressions of MDR-related transporters. Thus, our findings provide significant preclinical evidence that encorafenib might act as an effective dual-activity chemosensitizer in the combined regimens, especially in those treating BRAF-positive patients co-expressing ABCC1."}
+{"text": "A) inhibition and is approved for treating postpartum depression in women. Although the antidepressant mechanism of AlloP is largely unknown, it could involve selective action at GABAA receptors containing the \u03b4 subunit. Despite previous evidence for selective effects of AlloP on \u03b14/\u03b4-containing receptors of hippocampal dentate granule cells (DGCs), other recent results failed to demonstrate selectivity at these receptors  is a neurosteroid that potentiates ionotropic GABAergic (GABAeceptors . In cont A receptors and appears to have antidepressant effects triggered faster than traditional medications. The antidepressant mechanism of AlloP is largely unknown and we tested whether inhibition of parvalbumin (PV) interneurons in mouse hippocampus could participate. Our results indicate that PV interneurons possess low sensitivity to AlloP despite favorable receptor subunit composition.Allopregnanolone (AlloP) is an endogenous positive allosteric modulator of GABAA receptors, which are ligand-gated, chloride-permeable ion channels  is an endogenous neurosteroid that functions as a positive allosteric modulator to potentiate GABAergic inhibition . AlloP, ARs to enhance tonic inhibition. The potentiating effect of neurosteroids is nearly abolished in \u03b4 knock-out DGCs  and AlloP, selectively potentiate \u03b4-containing GABAout DGCs . Furtherout DGCs . Finallyout DGCs . Here, wAR subtypes, showed that AlloP, while indeed augmenting inhibition, does not selectively potentiate classical \u03b14/\u03b4-containing receptors to mediate tonic inhibition in hippocampal DGCs compared with \u03b32-containing receptors in the same cells  in CA1 were modestly potentiated by AlloP. Overall, the results preclude a large role for hippocampal interneuron GABA receptors, especially tonic inhibition in PV interneurons, in therapeutic AlloP effects.We hypothesized that AlloP disinhibits principal cells by enhancing GABAFigshare. We also examined two female mice, whose data appeared similar to that of males and are included in the data available on Figshare. Sibling animals were group housed in zeitgeber time (ZT) 12:12 conditions, with ZT0\u2009=\u20096 A.M. PV interneurons were labeled using two approaches: viral injection of pAAV5-hSyn-DIO-EGFP  into hippocampus of PVCre animals or Ai14::PVCre reporter mice . We assessed reporter accuracy with immunostaining against PV in Ai14 mice -resistant knock-in line ]. In some experiments, general interneuron populations were identified by pAAV1-mDlx-NLS-mRuby2 30 to P60 were used. We failed to find a clear change in exogenous AlloP effect with age, as demonstrated in the data available on i14 mice . PV antii14 mice . To isole \u03b4* KI; . To elimxed mice  were brem: 92 NMDG, 2.5 KCl, 1.25 NaH2PO4, 30 NaHCO3, 20 HEPES, 25 glucose, 2 thiourea, 5 Na-ascorbate, 3 Na-pyruvate, 0.5 CaCl2, and 10 MgSO4; 300 mOsm; pH 7.3\u20137.4). After slicing, slices recovered in modified NMDG-HEPES recovery aCSF at 32\u00b0C, and a Na+-rich spike-in solution  was added to gradually increase Na+ concentration to improve the success of gigaseal formation  for at least 1 h at 25\u00b0C before experimental recording. Drugs were obtained from ThermoFisher Scientific/MilliporeSigma except where noted.Mice were anesthetized with isoflurane and decapitated according to protocols approved by the Washington University IACUC. Coronal brain slices (300-\u03bcm thickness) were cut using a Leica VT1200 vibratome. During slicing, slices were maintained in ice-cold, modified NMDG-HEPES recovery artificial CSF . IR-DIC microscopy (Nikon FN1 microscope and Photometrics Prime camera) was used to visualize and identify target cells during somatic, whole-cell recording. Borosilicate glass pipettes  with open tip resistance of 3\u20136 M\u03a9 were used for whole-cell recording. Cells were recorded with a MultiClamp 700B amplifier (Molecular Devices), Digidata 1550 16-bit A/D converter, and pClamp 10.4 software (Molecular Devices). A 5-min stabilization period followed initial break-in before recordings commenced.During recording, slices were transferred to a recording chamber with continuous perfusion  of oxygenated, regular aCSF . Step currents from \u221250\u2009pA with increments of 20\u2009pA were injected to measure membrane properties and to elicit action potentials. Maximum firing frequency and action potential half width were calculated using Clampfit. For percentage accommodation, the 13th to 14th action potential interval was divided by the 3rd to 4th action potential interval. For cells that had fewer than 14 action potentials, the last and first intervals were used instead. To calculate membrane resistance, the steady-state voltage change in response to \u221250-pA step current was measured, and resistance was calculated by Ohm\u2019s Law.To record action potentials, neurons were recorded in current-clamp mode using pipettes filled with K-gluconate internal solution (in mm NBQX (Tocris Bioscience) and 50 \u03bcm D-APV (Tocris Bioscience) were added in the regular aCSF to inhibit ionotropic glutamate receptors. Pipettes were filled with cesium chloride internal solution . Cells were patched at \u221270\u2009mV in voltage-clamp gap-free mode at 5\u2009kHz, filtered at 2\u2009kHz using eight-pole Bessel filter.To record phasic and tonic GABAergic current, 10 \u03bcTo record population spikes in CA1, a bipolar stainless-steel stimulus electrode was placed in the Shaffer collaterals, and a glass recording electrode (blunt patch electrode) containing regular aCSF was placed in stratum pyramidale. For field EPSP recordings, electrodes were placed in stratum radiatum. A pulse (80 \u03bcs wide) was applied to elicit EPSPs. A stimulus intensity (50\u2013200\u2009\u03bcA) to elicit 50\u221260% of the maximum EPSP or population spike was used for data collection. In dentate gyrus, EPSPs were measured from lateral perforant pathway stimulation by placing the stimulus electrode and recording electrode in the outer molecular layer of the dentate gyrus, which were confirmed by paired-pulse facilitation  as described . At least 50 events contributed to average sIPSC waveforms in each experimental condition. sIPSC decays were fit to the sum of two exponential functions, extrapolated to the peak IPSC. Decay time course is reported as a weighted time constant \u03c4w; . For tonescribed . Paired Because PV interneurons, aside from DGCs, represent the most \u03b4 subunit-rich cell type in the hippocampus , we enriA receptors, we characterized the impact of AlloP on inhibition in PV interneurons. Whole-cell patch clamp was performed on PV interneurons, and both phasic and tonic currents were measured  PV interneurons  with \u03b4-mediated tonic current that is sensitive to AlloP modulation . Similarly, coastline burst index, a measure previously used to monitor ketamine\u2019s effect on excitability (A2). On the other hand, measures of fEPSPs from dendritic field recordings revealed a small but variable increase of EPSPs by 50 nm AlloP .Several other candidate novel antidepressants, including ketamine and scopolamine, increase pyramidal cell disinhibition in hippocampus, likely by decreasing the activity of interneurons . We reasn spikes A1. Similtability , failed tability A2. On thnm AlloP B. SimilaPrevious studies indicated direct inhibition from AlloP on DGCs . ConsistIn this study, we investigated the effect of the neurosteroid AlloP on tonic and phasic GABAergic inhibition in mouse hippocampal PV interneurons. Our aim was to address whether AlloP at therapeutically relevant concentrations promotes activity of principal neurons through inhibition of PV interneurons. To do that, we used genetically tagged PV interneurons in mouse hippocampus and showed that AlloP promoted phasic inhibition by prolonging the decay of spontaneous IPSCs. However, AlloP promoted tonic inhibition only when co-applied with exogenous GABA, and this potentiation of tonic inhibition was not primarily through \u03b4-containing receptors. Furthermore, a modest AlloP concentration decreased the firing frequency of DGCs but not PV interneurons. Although AlloP modestly enhanced fEPSPs from CA1 pyramidal neurons, this effect did not translate into enhanced CA1 excitability. Thus, neither effects at the cellular nor population level indicate that hippocampal PV interneurons are a likely substrate for therapeutic AlloP effects.A receptors in the effects of AlloP remains of interest. A previous study showed that AlloP potentiated phasic inhibition in DGCs mainly through \u03b32-containing receptors . Overall, the results are consistent with little to no selectivity of AlloP on inhibitory interneuron populations. The difference in fEPSP sensitivity to AlloP by hippocampal subregion might be explained by the different GABAAR subunit composition in DGCs versus CA1 pyramidal cells and by the strong overall effect of AlloP on DGCs (The rapid antidepressant ketamine at subanesthetic concentrations enhances population responses in hippocampal CA1 . The proFig. 7 on DGCs  comparedThe enhanced fEPSPs in CA1 could suggest an AlloP effect on a different interneuron population, such as cholecystokinin or somatostatin interneurons, although we failed to detect a change in sIPSC frequency on CA1 pyramidal cells F. AlternARs. However, AlloP potentiated tonic inhibition only with exogenous GABA added, and this AlloP potentiation of tonic inhibition is not primarily through \u03b4-containing receptors. Furthermore, we showed AlloP had little effect on the excitability of PV interneurons. Although AlloP modestly enhanced fEPSPs from CA1 pyramidal neurons, this effect did not translate into enhanced CA1 excitability. Taken together, our work suggests that PV interneurons seem an unlikely substrate for AlloP-induced network effects through GABAA receptors, particularly those containing a \u03b4 subunit. Other mechanisms remain to be explored to account for common antidepressant benefits of AlloP.In summary, we examined the effect of AlloP on both phasic and tonic GABAergic inhibition in PV interneurons. Our results showed that AlloP potentiated phasic inhibition through GABA"}
+{"text": "Familial predisposition is a strong risk factor for different types of cancer and accounts for around 10% of the cases. In this study, we investigated cancer predisposition in a Palestinian family using whole-exome sequencing (WES) technologies. In this study, we focused more on cutaneous melanoma (CM). Our analysis identified three heterozygous rare missense variants, WRN (p.L383F and p.A995T) and TYRP1 (p.T262M) and a pathogenic homozygous missense mutation in ERCC2 (p.R683Q). Although WRN and TYRP1 genes and their variations were correlated with different types of cancer, including melanoma, the currently identified WRN and TYRP1 variants were not reported previously in melanoma cases. The pathogenic mutation was segregated with the clinical phenotypes and found in the two affected brothers, one with CM and the other with brain tumor, and was confirmed by Sanger sequencing analysis. Segregation analysis of this mutation revealed that family members are either heterozygous or wild type. Our findings confirm that the homozygous ERCC2 (p.R683Q) mutation was responsible for causing melanoma and other cancer types in the family. Our work highlights the value to decipher the mutational background of familial cancers, especially CM, in the Palestinian population to guide diagnosis, prevention, and treatment of affected patients and their families. CDKN2A, CDK4, BAP1, TERT, POT1, ACD, MITF, MC1R, and TERF2I) have been shown to effect predisposition to melanoma and account for approximately 50% of familial cases , nevi density , DNA repair , and metabolism and detoxification (GSTM1 and GSTT1)  . In addid GSTT1) . The ERCd GSTT1) . Moreoved GSTT1) . AdvanceSeven members of a Palestinian family, of which one individual is affected with melanoma (9), two with a brain tumor (3 and 6), and four unaffected individuals  were involved in the study. A family history of melanoma emerged, with two siblings diagnosed with melanoma at the ages of 29 and 17. The patient\u2019s father and two paternal uncles were diagnosed with prostate cancer. The clinical phenotypes of the patient (9) and individual (6), who had a brain tumor with no melanoma, were abnormality of skin pigmentation and hyperpigmentation of the skin. Individual (5) had normal skin pigmentation. No clinical data were available for the rest of the family members included in the study .Approximately 5 ml of whole blood was collected from the participating subjects in EDTA tubes. All subjects signed a consent form expressing their willingness to participate in this study. All methods were performed in accordance with the relevant guidelines and regulations of the AAUP ethical committee.DNA was extracted using the Promega Blood kit, catalog #A1120 according to the manufacturer\u2019s instructions. DNA concentrations and purity were assessed using the Thermo Scientific NanoDrop 2000c. WES was performed on the DNA of the patient and the two unaffected siblings, one of them previously diagnosed with a brain tumor. DNA libraries were generated using the Illumina DNA Prep with Enrichment\u2014(S) Tagmentation, 16 Samples kit, catalog # 20025523, following the manufacturer\u2019s instructions. Library yield was determined using the Qubit dsDNA HS Assay Kit, catalog # Q32850, and the mean fragment size was determined using an Agilent Technology 2100 Bioanalyzer with a High-Sensitivity DNA kit, catalog #5067-4626. Denaturation and final loading concentration of the libraries were performed according to the Denature and Dilute Libraries Guide for NextSeq 500 and NextSeq 550 Sequencing Systems. The prepared libraries were sequenced on a NextSeq 550 platform with 40 X depth. VCF files with annotations of variant effects were created using the SnpEff tool, which annotates variants with their computed impacts on known genomic characteristics. Secondary analysis was conducted using DRAGEN pipeline (Illumina).The output variant call format (VCF) file contained 36,521 variants and was filtered based on several filtering criteria, as follows. First, variants that were intronic, ncRNA_intronic, downstream, upstream, 3\u2019UTR3, 5\u2019UTR, and synonymous unknown were filtered out. Then, variants were assessed by their clinical significance from the ClinVar database. They were excluded if they have been reported as benign and likely_benign. Next, variants were filtered out if they had a general allele frequency (AF) and Greater Middle Eastern allele frequency (GME_AF) above 0.1%, based on the gnomAD database. This filter ensures that the non-filtered variants have a level of evidence for pathogenicity and are not polymorphisms. In order to limit false positives, variants with mapping by quality (MQ) scores below 60, which are low-quality scores that have a higher probability of error, were all removed. In addition, variants having quality by depth (QD) scores below 3 were removed. Then, variants were filtered out based on the exomiser, which ranks candidate variants according to the patient phenotype similarity to known disease\u2013gene phenotypes, using the human phenotype ontology terms (HPO). Variant scores were scaled from 0 to 1, and scores lower than 0.5 were filtered out. Following exomiser filtering, the genotype of the patient was evaluated, removing variants with wild-type alleles (WT), and considered either homozygous (HOM), heterozygous (HET), or low allelic balance (lowAB) genotypes. Next, all variants that are unrelated to cancer or melanoma according to OMIM and ClinVar databases were removed. After that, synonymous and ncRNA_exonic variants were filtered out. Finally, only variants that were present in both the patient and his brother with a brain tumor, but not in the control, were kept. After filtering, four variants in three genes remained for further analysis.Candidate variants shared between the patient (9) and his brother (6) diagnosed with a brain tumor were further filtered for Sanger sequencing. Only variants that are reported as pathogenic or potentially pathogenic with a genotype\u2013phenotype association based on ClinVar were selected.The identified homozygous mutation in ERCC2, p.R683Q, was confirmed by Sanger sequencing, and co-segregation analysis was performed on family members II 2, II 3, II 4, and II 10. For Sanger sequencing, polymerase chain reaction (PCR) was utilized to amplify the targeted regions using the following primers: forward primers: tca\u200bggt\u200btga\u200bggt\u200btgg\u200bcat\u200bct; reverse caa\u200bgaa\u200bcca\u200bggc\u200btgt\u200bttc\u200bcc. After purification of the PCR products, Sanger sequencing was run using the BigDye Terminator v3 kit (Applied Biosystem) according to the manufacturer\u2019s instructions. The sequences of the PCR products were viewed and analyzed against the human reference genome hg19 (UCSC Genome Browser).In silico analysis was performed to predict the functional consequences of the validated variant using several tools: SIFT, PolyPhen-2, PROVEAN, MutationTaster, and Align GVGD. The protein domains of the candidate gene were studied to locate the variant. To check the evolutionary conservation of the sites of the variants, the amino acid sequences of the candidate gene from Homo sapiens and other species were gathered from the NCBI and aligned with COBALT . Moreover, 3D structural modeling was performed to determine the site of the mutation using the Protein Data Bank (PDB) database. The candidate variants were interpreted and classified according to the ACMG guidelines. After that, the somatic mutation databases, Catalogue of Somatic Mutations in Cancer (COSMIC), and The Cancer Genome Atlas (TCGA) cBioPortal for cancer genomics were accessed to check whether the candidate variant is present in tumors of melanoma and other cancer types. The in silico tool, Phyre2 (http://www.sbg.bio.ic.ac.uk/phyre2/html/page.cgi?id=index) was used to predict the protein structure based on the homology modeling technique. On the other hand, the candidate gene was investigated for alternation frequency in melanoma and other cancer types using the TCGA cBioPortal database. Additionally, The Human Protein Atlas database was used to obtain the genotype-tissue expression (GTEx) dataset to examine the mRNA tissue expression of the genes in different tissues.ERCC2; KLC3, WRN, SMARCA4, SDHB, TYRP1, MRE11, TERT, MLH1, RELCH; PIGN, SNORD132; BUB1, MEN1, CDKN1A; DINOL, CDKN1A, and COMT; MIR4761. Synonymous mutations in COMT; MIR4761, CDKN1A; DINOL, RELCH; PIGN genes were excluded as they did not affect splicing. Additionally, the exonic ncRNA mutations in the SNORD132; BUB1 gene were excluded. The patient\u2019s brother, who had a brain tumor, was treated as an affected family member. The top final variants and their corresponding genes most relevant to hereditary cancers and melanoma and present in both the patient and the sibling with a brain tumor, but not in the control, are in WRN, TYRP1, and ERCC2, shown in  and his two brothers, one diagnosed with a brain tumor (II 6) and the other with no medical history (II 5). The 36,521 VCF WES dataset of the three siblings was filtered  was present in the patient and his brother with a brain tumor (6), while it is heterozygous in the unaffected brother (5). This mutation is classified as pathogenic in ClinVar. Moreover, it is associated with the phenotype xeroderma pigmentosum group D (XPD), characterized by cutaneous photosensitivity and predisposition to skin cancer on sun-exposed body sites, based on the OMIM description (OMIM #278730). The p.R683Q was observed in the gnomAD exome database with a low allele frequency of 0.0000159. In addition, it has been seen four times as a heterozygous mutation and never as a homozygous mutation (ID 19-45855609-C-T). The other missenses mutations in TYRP1  and WRN  were present in a heterozygous state in the patient and his brother with a brain tumor (6), while it was absent in the unaffected brother (5). The TYRP1 mutation is classified as unknown significance by multiple submitters in ClinVar. Homozygous or compound heterozygous mutations in TYRP1 are associated with oculocutaneous albinism type 3 (OCA3) (OMIM #203290), a milder form of OCA. In WRN, both of the mutations are classified as conflicting interpretations of pathogenicity based on ClinVar. They are present at an allele frequency of 0.0021 and 0.0024, respectively, in gnomAD and are associated with the autosomal recessive disorder, Werner syndrome (WRN) (OMIM #277700).All of the variants identified by WES analysis were missense mutations. The homozygous ERCC2 missense mutation was selected for segregation analysis for the following reasons: 1) the p.R683Q mutation co-segregated with the disease phenotype in the patient and his affected brother (II 5) in a homozygous state and 2) classified as pathogenic in ClinVar. The ERCC2 missense mutation was validated by Sanger sequencing, and co-segregation analysis was performed on the unaffected members in the family. The occurrence of homozygous missense mutation, p.R683Q, was confirmed in the patient (II 9) and his affected brother who has a brain tumor (II 6). Moreover, it was detected in a homozygous wild-type state in the patient\u2019s brother (II 4), one sister (II 2), and his wife (II 10). It was also detected in a heterozygous state in the patient\u2019s other sister with a brain tumor (II 3)  .in silico prediction tools. The schematic illustration of the ERCC2 protein   . MoreovePROVEAN) . To checGTEx) to evaluate the mRNA expression of the ERCC2 in different tissues. The ERCC2 was expressed in numerous tissues with similar values, including those of the testis, prostate, skin, and endometrium  on chromosome 19, leading to a substitution of arginine by a glutamine at codon 683 (p.R683Q). ERCC2 encodes an ATP-dependent DNA helicase called XPD that is important in the DNA damage repair by the NER mechanism . XP patients with mutations in ERCC2 are characterized by photosensitivity; abnormality in skin pigmentations in the UV-exposed area of the body; neurodegeneration; and an increased risk of developing skin cancers, brain tumors, and tumors in other organs  was present in a homozygous state in the patient, who was diagnosed with melanoma at the age of 30 . The patient\u2019s daughter should be heterozygous since her mother was tested to be WT for the mutation. Individuals (5) and (3) who are known to be carriers have a high risk of transmitting the mutation to the next generation. These findings confirm that the homozygous ERCC2 variant (p.R683Q) is absent in non-affected family members. Moreover, it co-segregated with the phenotype in the investigated patient and in his brother with a brain tumor. Therefore, it is the mutation responsible for predisposing the studied Palestinian family to hereditary cancer and melanoma. The Arg683Gln mutation has been previously reported at a homozygous state in patients from various ethnic backgrounds, including Italian, German, Iraqi Jewish, Japanese, and Tunisian , who has a brain tumor. Most probably, the brain tumor resulted from an increased rate of mutations due to the defective DNA repair caused by the ERCC2 mutation. This assumption is based on the fact that the p.R683Q mutation falls in the helicase domain of the ERCC2 protein, and in fact it was shown before that mutations in the helicase domain of ERCC2 confer NER deficiency  is not a common event in patients with ERCC2 mutations. Only one study has reported the presence of LOH in tumors from patients with ERCC2 germline mutations, and this has been found in bladder cancer patients carrying the p.Arg616Pro mutation in ERCC2  responsible for the development of melanoma and other cancer types in the family. This study expands the knowledge of the mutational background of familial cancers, including melanoma, in the Palestinian population, which is valuable in guiding the diagnosis, prevention, and treatment of affected patients and their families.In summary, we have successfully applied whole-exome sequencing for an unexplained molecular cause of melanoma for diagnosis of XP and identified a rare"}
+{"text": "P<0.0001) and remained almost unchanged at the end of the follow up period 26[22-34] cms (P<0.0001). Sexual performance and voiding capacity were improved in all patients, testicular vascularity was unaffected and the Glasgow Benefit Inventory (GBI) for the quality of life showed marked enhancement in the total 55.5[50\u201372], general 55.5[50\u201372], social 100[50\u2013100] and physical 16.6[16\u201333] points subscales. According to our experience, surgery remains the gold standard treatment for management of huge scrotal lymphedema, successful preservation of the genitourinary functions can be attained despite the size in most cases with excellent cosmoses.We aim to provide our surgical techniques, and outcomes of functional scrotal reduction procedures with complete preservation of the genitourinary original anatomy in a simple way without using complicated skin grafting or skin advancement flaps in Patients with huge and long-standing scrotal lymphedema 18 patients ages ranged from 14-65 with a median of 30 years. Functional scrotal and penoscrotal reduction was attained in all cases, without distortion of the genitourinary anatomy and without the need for advancement, rotational or free flaps, maximal scrotal diameter was reduced from median of 61[48-92] cms to a median of 25[21\u201329] cms ( Scrotal lymphedema, a rare entity of lymphedema, is defined as abnormal accumulation of a protein-rich fluid in the soft-tissue region of the scrotal/penoscrotal territory coupled with gross deformation of the genitaliaScrotal lymphedema produces mobility and voiding limitations, fatigue, pain, and recurrent subcutaneous infections because of the difficulty of self-hygiene. It also causes sexual limitations and social isolation and impairs quality of life.Reported methods of surgical reconstruction involve either lymphangioplasty or complete excision of lymphedematous tissue with local tissue reconstruction in case healthy skin is available. Other methods of reconstruction will include essentially advancement flaps, rotational flaps, and split- or even full-thickness free flaps, whose results in such area exposed to many commensals and uncontrollable hygiene were questionable.It has been established that surgical reduction of scrotal lymphedema achieves a significant improvement in quality of life provided the genitourinary anatomy and physiology remains unaltered.In this series of challenging cases, we aimed to share our experience with functional scrotal reduction without using advancement, rotational, or free flaps while preserving the structure and function of the penoscrotal region, and demonstrating its impact on the patient wellness.In this retrospective study, we present our experience with huge scrotal lymphedema cases that were treated with surgical reduction. All patients consented verbally and formally for photographing their pre- and postoperative conditions and their approval was submitted in the Institutional Research Board of the Faculty of Medicine, Mansoura University, under approval number R/18.12.373.Our surgical technique was previously described in our published case reports of huge scrotal lymphedema patients who underwent successful reduction scrotoplasty despite having a huge-sized scrotum; these cases were included in our case series.Our classic \u201csmilelike\u201d incision  improving self-hygiene and thorough skin care; (2) self-performed manual lymphatic drainage; (3) deep breathing exercises (it had a lymphokinetic action); and (4) self-performed manual intermittent scrotal compression. In our novel method of scrotal compression, the patient was instructed to lie down on a longitudinally folded linen, half of it underneath his back and buttocks and the rest of it passing under the patient's lap underneath the scrotum. The patient himself pulls the folded linen cranially, compressing the scrotum for 1 to 2\u2009minutes, and then releases it, repeating for 10 times.Patients had weekly follow-up visits during the first month, then every 3 months until the first year, and then annually until 3 years of follow-up, where serial circumferential measurements of the scrotum were taken  according to the appropriate test.From January 2014 until July 2018, we performed 18 successful scrotal and penoscrotal functional reduction surgeries for cases condemned to be hopeless because of the apparently huge scrotal diameter or the long-standing condition. The ages of our patients ranged from 14 to 65 years, with a median of 30 years. The maximum scrotal diameter ranged from 48 to 92\u2009cm with a median of 61\u2009cm preoperatively at the time of presentation.We had seven cases associated with lower limb lymphedema; two of these were diagnosed as lymphedema congenita, while five were considered as lymphedema praecox. One patient had trisomy 21 and was on corticosteroid therapy, one patient had giant cell nevus syndrome, one patient had Rosai\u2013Dorfman disease, and one patient had secondary lymphedema that developed postradical cystectomy 6 years before our intervention. Three patients had concomitant testicular hydrocele and two patients had penile lymphedema as well. Two patients had recurrent scrotal swelling after previous surgical excision.p\u2009<\u20090.0001) with total preservation of the genitourinary anatomy was attained immediately postoperatively. During the follow-up period, which stretched until 72 months postintervention, the size varied between slight insignificant decreases and increases . In two patients, the penile skin was grossly damaged, so we used the stretched preputial skin to cover the penis in one case and a local flap constructed from the hairless stretched penopubic junction for the second case. The median operative time was 160\u2009minutes , and the median total estimated blood loss was 200\u2009mL .Successful reduction from a median size of 61\u2009cm  to 25\u2009cm  . It showed that the physical wellbeing increased by a median of 16.6 points , the social support the patients received increased by a median of 100 points (range 50\u2013100 points), and the general wellbeing subscale also showed an increase by a median of 79  .The problem of lymphedema affecting the region of the scrotum and penis can lead to significant harm on the patients' personal hygiene, sexual capability, and desire to participate and interact with the surrounding environment. Also, faulty medical practice of treating such cases conservatively despite the absence of an obvious improvement can lead to significant despair that withholds the patient from seeking proper medical advice.We presented 18 challenging cases of scrotal lymphedema that suffered from huge diameters of the scrotal sac . The fact that we pose certain conditions to define functional scrotal reduction surgery is derived from our caution to preserve the genitourinary functions of the penis and scrotum despite the size. We were never bailed out to orchidectomy or urinary diversion in any case no matter how deep the penis was buried or the genitalia were deformed.The presence of minimal surface area of healthy scrotal skin was mandatory to reconstruct the scrotum without needing advancement, rotational, or distal split- or full-thickness skin flaps.The significant reduction in the size of the scrotum postintervention was maintained throughout the follow-up period that continued for 3 years. Slight alteration in the median size in between was insignificant and was attributed to development of postoperative edema, and its resolution over time until the follow-up period was considered complete. Our protocol, which was based on self-management discipline, gave satisfactory outcomes maintained throughout the follow-up period, avoiding slow gradual recurrence. We did not subscribe compression hosiery or garments  to any of our patients, thus avoiding the costly, painfully tight garments with its bad hygienic effect, thus allowing our patients to resume a normal life.The improvement of the physical, sexual, and voiding capacity was investigated in each postoperative visit by asking the patient to respond to four questions  and the reply was positive for all questions for all patients for the first three questions except for four patients who were sexually inactive. Patients also denied the presence of any chronic regional postoperative pain after the surgery (question 4). We went further to investigate the overall benefit from scrotal reduction surgery using the GBI, adopted by some authors in previous similar work.The physical wellbeing also improved by a median of 16.6 points , perhaps because the three questions of physical wellbeing targeted the intake of drugs, family doctor visits, and frequency of cold infections. This is why, the impact was not evident as in the social support sector, which was more detailed. The general wellbeing sensation increased as well by a median of 79 points , surpassing similar studies using GBI in assessment.The technique adopted by our lymphedema team was developed over a long period of time and thorough experience with a huge number of lymphedema cases either in the extremities or in the scrotum. For example, we adopted the smilelike incision and its butterfly modification to create flaps that would oppose without the risk of flap ischemia or necrosis such that minimal postoperative care would be required postintervention. The appropriate repositioning of the penile shaft in the exact or near-exact anatomical position is crucial for hygienic voiding. Therefore, the modified butterfly incision was used in cases where penile shaft would be extremely downward displaced after closure of the flaps. Also, V-incisions to excise excess redundancy of posterior flap were used according to the operator discretion whenever needed. The appropriate repositioning of the penis and its stretching from the surrounding tissue would ensure better voiding and intercourse functions. According to our experience, surgery remains the gold standard treatment for the management of huge scrotal lymphedema. Successful preservation of the genitourinary functions can be attained despite the size in most cases with excellent cosmesis. Our study is limited by its retrospective nature and the relatively few numbers of cases, which might have distorted the statistics. However, since we were dealing with a relatively rare entity and discussing only cases whose maximal scrotal diameter is approximately 48\u2009cm in the mildest case, such number is acceptable."}
+{"text": "Non-communicable diseases (NCDs) account for half of all deaths in South Africa, partly reflecting unmet NCDs healthcare needs. Leveraging existing HIV infrastructure is touted as a strategy to alleviate this chronic care gap. We evaluated whether HIV care platforms are associated with improved NCDs care. We conducted a community-based screening of adults in rural KwaZulu-Natal, collecting BP, HbA1c, and health services utilization data. Care cascade indicators for hypertension and diabetes mellitus were defined as: 1) aware, if previously diagnosed, 2) in care, if seeing a provider within last 6 months; 3) treated, if reporting medication use within preceding 2 weeks; and 4) controlled, if BP<140/90mmHg or HbA1c<6.5%. We fit multivariable adjusted logistic regression models to compare successful completion of each step of the care cascade for hypertension and diabetes between people with virally suppressed HIV and HIV-negative comparators. Inverse probability sampling weights were applied to derive population-level estimates. The analytic sample included 4,933 individuals . Compared to being HIV-negative, having suppressed HIV was associated with lower adjusted prevalence of being aware , in care , and in treatment  for diabetes; but higher adjusted prevalence of controlled diabetes (3.2% [0.2\u20136.2%]). In contrast, having suppressed HIV was associated with higher adjusted prevalence of being aware (7.4% [5.3\u20139.6%]), in care (8.0% [5.9\u201310.2%]), in treatment (8.4% [6.1\u201310.6%]) and controlled (9.0% [6.2\u201311.8%]), for hypertension. Overall, disease control was achieved for 40.0% (38.6\u201340.8%) and 6.8% (5.9\u20137.8%) of individuals with hypertension and diabetes, respectively. Engagement in HIV care in rural KwaZulu-Natal was generally associated with worse diabetes care and improved hypertension care. While further work should explore how success of HIV programs can be translated to NCD care, strengthening of primary healthcare will also be needed to respond to the growing NCDs epidemic. Noncommunicable diseases (NCDs) are exacting rising human and economic costs in sub-Saharan Africa (SSA) \u20133. It isBy contrast, HIV primary care programs in SSA have been enormously successful , commonlIn response, beginning in 2011, South Africa adopted a national integrated chronic diseases management policy . This poWe analyzed individual-level data from persons aged \u226515 years old participating in the Vukuzazi Population Health Study (Vukuzazi Study) and with either hypertension or diabetes mellitus. The Vukuzazi Study was a population-based clinical phenotyping survey in uMkhanyakude District, KwaZulu-Natal, South Africa, with goals of describing the burden and intersection of HIV, tuberculosis (TB), hypertension and diabetes mellitus (DM) in rural South Africa . It is nA questionnaire was administered by research nurses to collect data on socio-demographics, smoking, medical history of HIV, hypertension, tuberculosis (TB), diabetes and their respective drug treatment, and to establish current TB symptomatology. Measurements of brachial blood pressure (BP), weight, height and waist circumference were obtained according to the WHO STEPS (STEPwise Approach to Surveillance) protocol . The lasaware: a self-reported prior hypertension or diabetes diagnosis, 2) in care: seeing a health provider within the past 6 months for the relevant NCD; 3) treated: reported use of appropriate medication in the preceding 2 weeks; and 4) controlled: BP<140/90mmHg or HbA1c <6.5%, for hypertension and diabetes, respectively.We defined hypertension as systolic BP \u2265140 mmHg and/or diastolic BP \u226590\u2009mmHg or self-reported use of antihypertensive medication in the preceding 2 weeks; and diabetes mellitus (diabetes) as HbA1c \u22656.5% or self-reported use of hypoglycemic medication in the past 2 weeks. Cascade of care indicators were defined as follows: 1) Linkage to HIV care was defined as enrolment in ongoing ART for at least six preceding months based on centralized electronic patient records (TIER.net), and was further categorized as virologically suppressed (HIV/suppressed) if the current HIV-1 RNA load \u226440 copies/mL.HIV-negative with HIV/suppressed individuals overall with respect to hypertension and diabetes care indices. To construct a sample representative of the local population, we constructed sampling weights from the stabilized inverse probability of participation in the Vukuzazi Study. Weights were based on the predicted probability of participation in the Vukuzazi Study and calculated by fitting logistic regression models with study participation as the outcome of interest and predictors comprised of age and sex as derived from the 2018 DHSS census.We limited our analyses to Vukuzazi Study participants with either hypertension or diabetes (as defined above). Our primary analysis compared t-test and chi-squared tests. We categorized age as <25 years old, 25\u201344 years old, and 45\u201364, and \u226565 years old; body mass index (BMI) as underweight (<18.5), normal (18.5\u201324.9), overweight (25.0\u201329.9), and obese (\u2265 30 kg/m2); waist circumference as increased if >102cm  or 88cm ; smoking status as current, former, and never; and HbA1c as \u22656.5% (diabetic), 5.7\u20136.4% (pre-diabetic) and <6.4% (normoglycemic)  adults had participated in the Vukuzazi study, and were thus eligible for inclusion in this analysis. We excluded 78 with missing BP or HbA1c data, and 20 with implausible BP readings . We excluded an additional 4 with missing HIV test results, and if sero-positive, with missing viral load testing results, leaving 17,924 participants  with complete data. Among the 6,090 people with HIV, 1,221 (20.0%) had hypertension and 380 (6.2%) had diabetes, and among the 11,854 without HIV, 3,382 (28.5%) had hypertension and 1,352 (11.4%) diabetes. We subsequently excluded 12,744 participants who had neither hypertension nor diabetes mellitus, and a further 187 with an unsuppressed HIV viral load . The final analytical sample for our primary analysis included 4,993 participants , and wheThe unweighted analytic sample including adults \u226515 years old with either hypertension and/or diabetes, who had a median (IQR) age of 60 years (interquartile range 50\u201369) years, and of whom 77% (CI 76.2\u201378.5%) were females. HIV/suppressed persons were younger , more frequently female  and they had higher rates of formal educational attainment  and employment  than HIV negative comparators . After i2: 51% [CI 48.1\u201353.9%] vs. 56% [CI 54.0\u201357.3%]; p<0.001) and more likely to be normoglycemic  than HIV negative peers. Similarly, they had lower mean systolic BP  and less severe hypertension . Notable, HIV-negative persons were almost twice as likely as HIV/suppressed persons to have comorbid hypertension and diabetes . These observed differences were maintained in sensitivity analyses comparing HIV negative versus HIV positive in care persons  , in care , and in treatment , for diabetes . Diabetep<0.001) . Overallp<0.001) .aware: 132.5 [130.9\u2013134.2 mmHg] vs. 134.0 [133.1\u2013134.9 mmHg]; in care: 132.4 [130.8\u2013134.1 mmHg] vs. 133.6 [132.7\u2013134.5 mmHg] and treated: 131.9[130.2\u2013133.5 mmHg] vs. 132.9 [132.0\u2013133.8 mmHg]; all p>0.05)  . Overall p>0.05) .PWH with and without viral suppression had largely similar cardiometabolic profiles . The excIn this large population-based study set in rural South Africa, we found little evidence suggesting that engagement in HIV care is associated with substantial improvement in hypertension or diabetes care. Enrolment in HIV care and confirmation of virologic suppression was associated with modestly higher (7.4\u20139.0%) prevalence of hypertension awareness, diagnosis, and treatment compared to HIV-uninfected comparators. With the exception of disease control, which was improved by less than 5%, indicators for diabetes care, however, were poorer among people with HIV and virologic suppression. Even for those indicators with relative improvements, these indices did not appear to translate into a substantial clinical disadvantage for PWH, based on the observation of similar mean systolic blood pressure\u2013or lower HbA1c in the case of diabetes\u2013between the two groups. Overall, our findings call into question the successful track record of expanding HIV care platforms to address NCDs in this setting. This is particularly evident when contrasting the overall prevalence of disease control between hypertension 40%), diabetes (6.8%) and HIV (78%) control in this population , and fur%, diabetet al., (2018) Reviewers' comments:Reviewer's Responses to Questions <font color=\"black\"> Comments to the Authorpublication criteria? Is the manuscript technically sound, and do the data support the conclusions? The manuscript must describe methodologically and ethically rigorous research with conclusions that are appropriately drawn based on the data presented. </font> 1. Does this manuscript meet PLOS Global Public Health\u2019s Reviewer #1:\u00a0NoReviewer #2:\u00a0Yes********** <font color=\"black\"> 2. Has the statistical analysis been performed appropriately and rigorously? </font> Reviewer #1:\u00a0YesReviewer #2:\u00a0Yes********** <font color=\"black\"> 3. Have the authors made all data underlying the findings in their manuscript fully available (please refer to the Data Availability Statement at the start of the manuscript PDF file)?PLOS Data policy requires authors to make all data underlying the findings described in their manuscript fully available without restriction, with rare exception. The data should be provided as part of the manuscript or its supporting information, or deposited to a public repository. For example, in addition to summary statistics, the data points behind means, medians and variance measures should be available. If there are restrictions on publicly sharing data\u2014e.g. participant privacy or use of data from a third party\u2014those must be specified. </font> The Reviewer #1:\u00a0YesReviewer #2:\u00a0Yes********** <font color=\"black\"> 4. Is the manuscript presented in an intelligible fashion and written in standard English? </font> PLOS Global Public Health does not copyedit accepted manuscripts, so the language in submitted articles must be clear, correct, and unambiguous. Any typographical or grammatical errors should be corrected at revision, so please note any specific errors here.Reviewer #1:\u00a0YesReviewer #2:\u00a0Yes********** <font color=\"black\"> 5. Review Comments to the Author </font> Please use the space provided to explain your answers to the questions above. You may also include additional comments for the author, including concerns about dual publication, research ethics, or publication ethics. Reviewer #1:\u00a0I appreciate the efforts of the authors especially for choosing to study such a sensitive issue of public health importance. However, there a few issues that needs to be addressed before it can be considered for publication.Research topic: the research topic needs to be reframed. its not catchy and leaves room for varied interpretation and meanings for readers.Abstract: Line 34. This statement .....'collecting blood pressure' should be written as checking blood pressure.it will be nice if the size of the sample population is stated in the method section of the abstract.Introduction:Line 90. Please quote figures and cite reference to back your claim....'in one of the world's high HIV burden setting'.I guess there are real or perceived benefits of the HIV care programmes for NCD care to the patients, health institutions and to governments. Please elaborate on this using current literature.To help readers appreciate the strength of your claim please state the hypothesis for the study.Methods:Study design, population and setting:The study design is not well stated.Provide a brief description of the sample population. the inclusion and exclusion criteria is not well described.For readers who do not know uMkhanyakude district or rural Kwa Zulu Natal, what made this district the most appropriate for this study.how many sub-districts, towns and households were involved in this study.of the 36,314 residents that were invited for the study, how many satisfied the inclusion criteria and were involved in the study. this information needs to be captured under this sub-heading.Sampling:The manuscript does not provide details of the sampling procedure used including sampling method, sampling technique and recruitment procedures. Based on the information provided, it seems the authors used convenience sample making this study susceptible to selection bias. specifically, what sampling methods were used to select the sub-districts, towns, households and sample population.How were the participants recruited, were they recruited to enroll in the integrated HIV and NCD clinical care or participants who were already enrolled in the integrated HIV and NCD care were recruited??? please be clear on this.Ethics:Since the nature of your study involves invasive procedures and human subjects, Kindly described how you adhered to the ethical principles of the Declaration of Helsinki. Specifically, how you addressed; Anonymity, privacy, confidentiality, protection from harm, risk and injury, beneficence, voluntary participation, Disclosure of identified ill-health or unexpected test results or outcome. Was the services of a clinical psychologist sought for persons that might suffer psychological stress or pain following disclosure?Data collection:state the day, month and year this study was initiated and for how long it lasted.Results:General characteristics: could you just report on the percentage and ignore the confidence interval.Diabetes mellitus care cascade: could you elaborate on what 'diff' means. it's difficult to comprehend. Are we dealing with odds ratio. You can check this article for reporting on odds ratio; Szumilas M. Explaining odds ratios. J Can Acad Adolesc Psychiatry;2010 Aug, 19(3): 227-9.Can you elaborate on whether you dichotomized controlled hypertension and glycemic control? Should the readers assume they are categorical or continuous? please state so the method section.Fig 2a,2b,4a,4b are very faint. Make it more clearer.Discussion:Line 315: Be consistent with your intext-reference stylePart of your justification for this study was the fact that economic justification for HIV/NCD integration in SSA remains unproven. Yet, information on how your study addressed this gap is not captured neither is it extensively discussed in your study.Conclusion: Line 352. Please limit your conclusion the rural district of KwaZulu Natal.Line 354, I guess the statement beginning with 'Whereas....... shouldn't have ended the way it did. Please check and revise.Limitation: well stated but please provide a recommended focus for future studies.General comment: the supplementary material was not a readable file and so could not be reviewed.Reviewer #2:\u00a0The overall approach and topic of the paper is interesting and well thought out. The authors make good use of a large amount of data collected from a large population-based study sample. The overall approach to evaluate the cascade of care within a biologically defined hypertensive and diabetic population is a strength of the paper. There was quite a bit of detail about the breadth of data, data collection methods, comparisons between HIV+ and HIV- population; but I think in this detail some of the big picture information and clarity was lost \u2013 overall response rate to the survey and to biomarker collection, % HIV positive and % of PWH who were virally suppressed and enrolled in ART (detailed comments below).Major comments:1. The HIV+/suppressed group definition was a little unclear. \u201cLinkage to care\u201d (line 131) was defined as enrolled in ART plus virologically suppressed, and then the \u201cprimary analysis\u201d (line 136) compared HIV-negative and HIV+/suppressed individuals. I am assuming the HIV+/suppressed comparison group is not solely based on viral load but actually means the group was \u201clinked to care\u201d and suppressed? This raises several follow-up questions:TIER.net? In either case, is it possible that ART enrolment information could be missing or mis-reported, in which case it may be helpful to consider a sensitivity analysis that ignores ART enrolment entirely and solely defines the HIV+/Suppressed group on viral load result.a. Was enrolment in ongoing ART self-reported or defined through medical records with b. I was surprised to see only 187 individuals had unsuppressed HIV (line 171), especially with such a low cut-off of 40 copies/mL. Is this because you already limited the HIV sample to those enrolled in ART? It would be helpful to see or read a clearer breakdown of HIV in the population, perhaps with a table or a chart related to the entire study participation: % HIV+, among those who are positive the % with viral suppression and the % enrolled in ART (including how exactly each of these are defined).c. The HIV+/Suppressed comparison group is later written as \u201cHIV+/successful ART\u201d group (for example in Table 2). The inconsistent terminology to refer to this group added to the lack of clarity. Similarly, in line 294, PWH with and without viral suppression is mentioned with reference to Supplementary Table 4, but Supplementary Table 4 compares \u201csuccessful ART\u201d and \u201cFailing ART\u201d with no mention of those NOT on ART, which would likely be an important virally unsupressed group of people.d. The sensitivity analysis including everyone enrolled in ART regardless of viral load was important and helpful.2. Inverse probability weights for the participation in the Vukuzazi study:a. Weighting is briefly described using age and sex, but the participation rate in the study is not stated in the text. It looks like in Supplementary Table 1 that the full population invited to participate in the study was 36,314. Were all of these individuals invited to participate or was fieldwork closed early in March 2020? Given that 18,027 participated in the Vukuzazi study it appears the response rate to the survey was ~50%. It would be helpful to more directly address this as a limitation of the study.b. Age and sex were included in the IPW models \u2013 why not other characteristics ? It appears you have this data available of the full population.c. Depending on the participation rate to the blood sample collection, I would also consider weighting to account for lack of consent to blood collection.3. Response rate to venous blood collection: The paper says that venous blood HbA1c level was used to define the diabetic population, yet in many population based studies response rate to venous blood collection can be quite low. Can the authors include the response rate to blood collection and comment on how those who give blood may differ from those who did not? Assuming the response rate to blood pressure measurement is much higher than venous blood collection, does this lead to differences in the populations who have diabetes data vs. hypertension data, and could any differences observed here relate to the different findings in the diabetes care cascade vs. the hypertension care cascade? Or was giving blood required for the study participation, which would explain a response rate of ~50%?4. Given the large sample size, I would be interested to see if results differ when stratified by age group. Is there any evidence that the NCD care is better in older HIV+ populations?Minor comments:1. Conclusion of the study \u2013 I agree that overall results indicate poor diabetes and hypertension care and need for primary healthcare strengthening. Yet, does the fact that disease control was better among the HIV+/suppressed group  indicate integration of HIV and NCD care could be a promising way to improve NCD care for the HIV-positive population?2. Read through for some awkward wording and typos. For example line 64: \u201ccontinuity of care over across the lifespan\u201d and line 78-79 \u201cbeginning in 2011\u2026 in 2011\u201d.3. Line 161: Suggest deleting \u201cwith a 2-sided p value of < 0.05 considered statistically significant.\u201d Confidence intervals are used appropriately throughout the text and ok to include the p-values in tables, but it is not necessary to define a \u201cstatistically significant\u201d cut-off.********** <font color=\"black\"> 6. PLOS authors have the option to publish the peer review history of their article (what does this mean?). If published, this will include your full peer review and any attached files.Do you want your identity to be public for this peer review? If you choose \u201cno\u201d, your identity will remain anonymous but your review may still be made public.Privacy Policy. </font> For information about this choice, including consent withdrawal, please see our Yes:\u00a0Dorothy Serwaa BoakyeReviewer #1:\u00a0Reviewer #2:\u00a0No**********https://pacev2.apexcovantage.com/. PACE helps ensure that figures meet PLOS requirements. To use PACE, you must first register as a user. Registration is free. Then, login and navigate to the UPLOAD tab, where you will find detailed instructions on how to use the tool. If you encounter any issues or have any questions when using PACE, please email PLOS at figures@plos.org. Please note that Supporting Information files do not need this step.While revising your submission, please upload your figure files to the Preflight Analysis and Conversion Engine (PACE) digital diagnostic tool,  5 Oct 2022AttachmentResponse to reviewers_2Oct2022.docxSubmitted filename: Click here for additional data file. 7 Oct 2022Linkage to HIV care and hypertension and diabetes control in rural South Africa: results from the population-based Vukuzazi Study.PGPH-D-22-01159R1Dear Dr Magodoro,We are pleased to inform you that your manuscript 'Linkage to HIV care and hypertension and diabetes control in rural South Africa: results from the population-based Vukuzazi Study.' has been provisionally accepted for publication in PLOS Global Public Health.Before your manuscript can be formally accepted you will need to complete some formatting changes, which you will receive in a follow up email. A member of our team will be in touch with a set of requests.Please note that your manuscript will not be scheduled for publication until you have made the required changes, so a swift response is appreciated.IMPORTANT: The editorial review process is now complete. PLOS will only permit corrections to spelling, formatting or significant scientific errors from this point onwards. Requests for major changes, or any which affect the scientific understanding of your work, will cause delays to the publication date of your manuscript.globalpubhealth@plos.org.If your institution or institutions have a press office, please notify them about your upcoming paper to help maximize its impact. If they'll be preparing press materials, please inform our press team as soon as possible -- no later than 48 hours after receiving the formal acceptance. Your manuscript will remain under strict press embargo until 2 pm Eastern Time on the date of publication. For more information, please contact Thank you again for supporting Open Access publishing; we are looking forward to publishing your work in PLOS Global Public Health.Best regards,Anil Gumber, Ph.D.Academic EditorPLOS Global Public Health***********************************************************Thanks for revising and including suggestions from the reviewers.Reviewer Comments :"}
+{"text": "Inorder for mass spectrometry to continue to grow asa platformfor high-throughput clinical and translational research, careful considerationmust be given to quality control by ensuring that the assay performsreproducibly and accurately and precisely. In particular, the throughputrequired for large cohort clinical validation in biomarker discoveryand diagnostic screening has driven the growth of multiplexed targetedliquid chromatography coupled to tandem mass spectrometry (LC-MS/MS)assays paired with sample preparation and analysis in multiwell plates.However, large scale MS-based proteomics studies are often plaguedby batch effects: sources of technical variation in the data, whichcan arise from a diverse array of sources such as sample preparationbatches, different reagent lots, or indeed MS signal drift. Thesebatch effects can confound the detection of true signal differences,resulting in incorrect conclusions being drawn about significant biologicaleffects or lack thereof. Here, we present an intraplate batch effecttermed the edge effect arising from temperature gradients in multiwellplates, commonly reported in preclinical cell culture studies butnot yet reported in a clinical proteomics setting. We present methodsherein to ameliorate the phenomenon including proper assessment ofheating techniques for multiwell plates and incorporation of surrogatestandards, which can normalize for intraplate variation. Using LC-MS/MS, hundreds of samples with better statisticalpower may be analyzed to identify novel biomarker signatures of disease.The transfer of quantitative protein assays to the clinic representsthe bottleneck in the biomarker discovery pipeline,5 The high levelsof specificity conferred by MRM assays are due to their ability tomeasure several relevant data points for each peptide: the m/z of the precursor ion, the m/z of product ions generated by collision-induceddissociation, and the retention time of the peptide under the specifiedoperating conditions.6 The use of multiwellplates coupled with MRM enables high-throughput sample preparationand analysis amenable to automation, which has already been adoptedwidely by clinical laboratories for the analysis of small molecules,for example in the assessment of vitamin D status7 and total testosterone in serum.8The large scale requiredfor biomarker validation has thus driventhe growth of multiplexed targeted LC-MS/MS assays for clinical applications.Peptide multiple reaction monitoring (MRM) assays typically enablemore flexible assay development, better specificity, and greater multiplexingability than immunoassays.9 Randomization of sample positionas well as the use of suitable quality controls across the plate areessential, such as system suitability tests, blanks, positive controls,and negative controls. Even when these quality controls are in place,large scale MS-based proteomics studies may still be plagued by batcheffects: artifacts in the data which can introduce noise and confoundthe detection of true biological differences, resulting in Type Iand II statistical errors.10 This technicalheterogeneity may be due to sample preparation batches, differentreagent lots, different analysts or instruments, or indeed MS signaldrift.Additionally, preclinical multiomics studies coupling genomicdataspanning tens of thousands of samples to mass spectrometry measurementsrequire reliable high-throughput LC-MS/MS analysis. In order for LC-MS/MS-basedproteomics to continue to grow as a platform of choice for both preclinicalstudies and the translation of biomarker panels to the clinic, carefulconsideration must be given to the quality control challenges thatarise in such high-throughput analyses. The assay must perform acrossmultiple samples in an accurate and precise way with good preanalyticalstability.15 Much attention has been focused on data dependent (DDA) and dataindependent (DIA) acquisition discovery experiments, with less focuson the assessment of batch effects on targeted analyses for clinicalvalidation where reliable results free from technical variation areequally critical. Here we sought to investigate technical batch effectswithin multiwell plates in a high-throughput plasma protein digestionprotocol. Interplate variation has previously been characterized inLC-MS/MS and other biomarker discovery platforms such as as Olink and SomaLogic ;17 however, intraplatevariation is underreported in comparison. \u010cuklina and colleaguesevaluated intraplate variation introduced by a liquid handling systemand methods to reduce this effect in silico,11 but to our knowledge, no previous work has investigatedintraplate temperature gradients as a potential source of technicalvariation in proteomics.Many recent publications focusing on large-scale proteomicsdiscoveryexperiments highlight the value of bioinformatics approaches to assessand process data to combat these often unavoidable batch effects.20 In this work, we present a cautionarytale of the edge effect in high-throughput bottom-up proteomics resultingfrom thermal gradients which can arise when using multiwell plates,exploring the source of the effect and practical methods to ameliorateit.In particular, we report a technicalbatch effect within multiwellplates termed the \u201cedge effect\u201d, a phenomenon whichhas not yet been reported in a proteomics study. This effect has beenwidely reported in cell culture, where increased evaporation occursfrom corner and edge wells compared to interior wells due to temperaturegradients across the plate.Plasma was collectedfrom healthydonors with informed consent under Research Ethics Committee (REC)reference: 13/EM/0049. Blood was collected by venepuncture into tubescontaining ethylenediaminetetraacetic acid (EDTA) anticoagulant andstored on ice until centrifugation. The blood was centrifuged at 3200rpm for 20 min at 4 \u00b0C using a Sorvall ST 8 Small Benchtop Centrifuge. The centrifuge was allowedto come to a halt on its own and after stopping, the plasma was harvestedfrom the top of the tubes ensuring the pipet tip did not come within3 mm of the buffy coat layer of white blood cells and platelets. Theplasma was stored at \u221280 \u00b0C until analysis. Plasma fromtwo donors was defrosted at room temperature and 5 mL from each donorpooled and aliquoted for digestion.et al. with volumes adjusted for use in multiwell plates.30 The general protocol conditions are describedherein with adjustments for each experiment outlined in g for 30 min using an EppendorfCentrifuge 5810R , and the supernatant wascollected and transferred into Waters QuanRecovery 700 \u03bcL Plates for analysis by mass spectrometry.The plasma digestionprotocol was adapted from previous work in the group by Mbasu 2O + 0.1% FA. Mobile phase B was acetonitrile (MeCN)+ 0.1% FA. The seal wash was H2O + 10% methanol (MeOH),the weak needle wash was H2O + 0.1% FA, and the strongneedle wash was MeCN + 0.1% FA. The flow rate was 0.6 mL/min. Theautosampler temperature was 8 \u00b0C, and the column temperaturewas 40 \u00b0C. The Xevo TQ-XS was equipped with a Waters Zspray LockSprayin ESI positive mode. The cone voltage was set to 35 V, and the capillaryvoltage was set to 0.6 kV. The LC gradient program and transitions,collision energies, and scheduling windows for each of the 46 humanpeptides and BSA peptides measured in the multiplexed MRM assay areavailable in Supporting Tables S1 and S2. Data was acquired using MassLynx V4.2.LC-MS/MS analysiswas performed usinga Waters Acquity LC coupled to the Xevo TQ-XS mass spectrometer. TheLC was equipped with an Acquity Premier Peptide BEH C18 analyticalcolumn, 300 \u00c5, 1.7 \u03bcm, 2.1 \u00d7 50 mm. Mobile phase Awas Het al.) wasused to generate targeted MRM methods for export to MassLynx 2.4 andimport data for analysis.21 Productionof graphs and statistical analyses were performed using R version4.2.0 22 on RStudio 2022 .23 Statistical significance of differences wasdetermined using analysis of variance (ANOVA), followed by Tukey\u2019sposthoc test. A p-value <0.05 was considered statisticallysignificant.Skyline 21.2 Targeted Mass SpectrometryEnvironment from the MacCoss Lab  camera . Multiwell plates were incubated as described in \u201cMultiwellPlate Plasma Digestion\u201d, removed from the incubator, and immediatelyphotographed to determine the temperature distribution across theplate. Each incubation was performed in triplicate.25 The peak areas across the plateare shown in 6) of the corner wells (mean\u00b1 standard error) was 2.9 \u00b1 0.05, the edge wells (row 1)was 2.3 \u00b1 0.05, the second row from the outside (row 2) was 1.7\u00b1 0.06, row 3 was 1.3 \u00b1 0.06, and the center wells was 1.0\u00b1 0.01. Comparisons between the regions of the plate revealeda statistically significant difference in peak area (p < 0.01) between all regions. The full statistical analysis isshown in Supporting Table S3. This phenomenonof significantly different results in the peripheral wells is termedthe \u201cedge effect\u201d and has not yet been reported in aproteomics study. This pattern was conserved across the other peptides,which all had RSDs between 27.5\u201345.0% across the plate. Supporting Table S4 and Figure S1.Intraplate variationwas examined in experiment 1  suitable for many experiments and are usually compliantto Society for Laboratory Automation and Screening (SLAS) microplatestandards, which means they interface well with liquid handling systemsand mass spectrometer autosampler modules. However, the dimensionsof the plates can make it difficult for the common laboratory heatingequipment previously discussed to make direct contact with the individualvessels for consistent heating across the plate. Thus to amelioratethe edge effect, PCR-style plates heated in a thermal cycler wereused to allow direct, even contact with every well (experiment 5).As can be seen in Supporting Table S4 and Figure S1. To confirm that even heating was resulting in the ameliorationof the edge effect, thermal imaging analysis was performed on thePCR plates after the incubation steps, shown in Supporting Figure S4 shows a triplicate thermalimaging analysis and even heating in the reduction step.Many vendors have created plates which are marketed to reduce oreliminate the effect in cell culture; however Mansoury Rather than the plates themselves resulting inbatch effects, itis the ability to apply a thermal gradient robustly and consistentlyacross the whole plate which is of vital importance. Thus, optimumheating conditions for all plates should be assessed during protocoldevelopment. Even heating of deep well plates could likely be betterachieved using a PCR-style heater with a deep well attachment, whichwas not available in our facility, such as the C1000 Touch ThermalCycler with 96\u2013Deep Well Reaction Module  or Eppendorf ThermoMixerC with SmartBlock DWP 500 or 1000 .28 However, QconCATs are relatively expensive anddue to a lack of secondary and tertiary structure have been shownto be rapidly and completely digested within a few minutes, much fasterthan the corresponding proteins.29 ThusQconCATs may not be suitable to correct for intraplate variation resultingfrom variable proteolysis.Although the edge effect pattern was eliminated,a small amountof intraplate variation remained across wells. In targeted LC-MS/MSassays, typically a heavy-labeled synthetic peptide internal standardwill be used for quantitation and can correct for sources of variationsuch as matrix effects, ionization suppression or enhancement, andstability. They cannot, however, correct for intraplate variationarising from sample preparation and digestion inefficiencies. TheQconCAT technique uses artificial concatenated peptides, which canbe introduced prior to proteolysis and digested with the sample, thushelping to correct for variation arising from sample preparation.Supporting Table S4 and Figure S1.We investigated the use of a surrogatestandard to normalize for intraplate variation (Experiment 6). BSAwas used due to its wide availability and low cost. As an intact proteinwith higher order structure, it is physiochemically similar to humanplasma proteins but is not natively present in the matrix and doesnot contain structurally homologous peptides to the human peptidesbeing analyzed in this study, thus making it a suitable surrogatestandard. An alternative standard should be selected when analyzingpotentially homologous peptides from human serum albumin. Normalizationto the BSA peptide QTALVELLK was found to be the most globally effectivestrategy, resulting in an average reduction in RSD of \u22121.1%across the first column of the plate. The effect of normalizationon GLI[ . . .], EAT[ . . .], and YTE[ . . .] is shown in \u20133) of the corner wells (mean \u00b1standard error) was 17.0 \u00b1 0.1, the edge wells was 16.8 \u00b10.1, the second row from the outside was 17.0 \u00b1 0.2, row 3 was16.9 \u00b1 0.2, and the center wells was 17.5 \u00b1 0.3. Comparisonsbetween all regions of the plate revealed no statistically significantdifference in peak area (p > 0.01). The full statisticalanalysis is shown in Supporting Table S5. The small amount of stochastic variation across the wells whichremains is likely due to other sources of technical variation, forexample pipetting error.Theaverage RSD across the 96 wells for all peptides using surrogatepeptides (experiment 6) was 4.2 compared to 38.7 in experiment 1,an almost 10-fold reduction. The peak areas across the plate are shownin There is an opportunityfor mass spectrometryto be a dominantanalytical technique in translational and clinical arenas. It is ahigh-throughput, multiplexable technique that has been demonstratedto be highly reproducible over many hundreds of injections. However,in order for MS to continue to grow as the technique of choice inthe clinical laboratory, it is important that every aspect of theworkflow\u2014from sample preparation to analysis\u2014is adequatelyassessed for issues which may compromise the quality and reproducibilityof data. In recent years, much attention has been given to assessingand removing sources of technical variation in high-throughput MSstudies, since these can introduce noise and confound the detectionof true biological differences. Here we presented a cautionary taleof the intraplate edge effect in high-throughput bottom-up proteomicsutilizing microplates. We recommend that particular attention is paidto quality control of batch effects not just in DIA and DDA bottom-upproteomics data but also in targeted LC-MS/MS analyses in multiwellplates moving toward formats which can be feasibly adopted by clinicallaboratories in large cohort validations or diagnostic screening tests.We propose that, in addition to other study design factors suchas sample randomization across plates, laboratories give careful considerationto conditions for heating multiwell plates . It is the application of heat robustly and consistentlyacross the whole plate which is of importance, rather than the platesthemselves leading to imprecision. Thus, the potential presence oftemperature gradients should be carefully assessed for all labware,particularly if the vessels which are used cannot easily be directlyheated individually. Otherwise, technical heterogeneity may arisein the data. This applies not only to those performing proteomicsstudies but across the spectrum of clinical mass spectrometry disciplineswhich may use multiwell plates to achieve high-throughput. We presentmethods herein for protocol optimization if temperature gradientsare found, including switching to PCR-style heaters where individualwells can be easily directly heated and incorporating surrogate standardswhich can normalize for intraplate variation."
\ No newline at end of file