diff --git "a/deduped/dedup_12.jsonl" "b/deduped/dedup_12.jsonl"
deleted file mode 100644--- "a/deduped/dedup_12.jsonl"
+++ /dev/null
@@ -1,53 +0,0 @@
-{"representative": "The objectives of this report are to review the assessment of patient-focused outcomes in pediatric orthopedic surgery, to describe a framework for identifying appropriate sets of measures, and to illustrate an application of the framework to a challenging orthopedic problem.A detailed framework of study design and measurement factors is described. The factors are important for selecting appropriate instruments to measure health status and health-related quality of life (HRQL) in a particular context. A study to evaluate treatment alternatives for patients with neurofibromatosis type 1 and congenital tibial dysplasia (NF1-CTD) provides a rich illustration of the application of the framework. The application involves great variability in the instrument selection factors. Furthermore, these patients and their supportive caregivers face numerous complex health challenges with long-term implications for HRQL.Detailed summaries of important generic preference-based multi-attribute measurement systems, pediatric health profile instruments, and pediatric orthopedic-specific instruments are presented. Age-appropriate generic and specific measures are identified for study of NF1-CTD patients. Selected measures include the Activities Scale for Children, Gillette Functional Assessment Questionnaire Walking Scale, Health Utilities Index, and Pediatric Inventory of Quality of Life.Reliable and valid measures for application to pediatric orthopedics are available. There are important differences among measures. The selected measures complement each other. The framework in this report provides a guide for selecting appropriate measures. Application of appropriate sets of measures will enhance the ability to describe the morbidity of pediatric orthopedic patients and to assess the effectiveness of alternative clinical interventions. The framework for measurement of health status and HRQL from a patient perspective has relevance to many other areas of orthopedic practice. Assessments of patient-focused health status and health-related quality of life (HRQL) are being recognized increasingly by clinicians, patient advocates, regulatory authorities, administrators and policy makers as primary measures of the need, efficacy, effectiveness and efficiency associated with health care services. These types of measures are commonly reported in the published literature of many health care disciplines although there are few published reports concerning orthopedic surgery. However, the orthopedic community is becoming interested in using evidence reported by patients and patients' family members to determine what is best for patients.Patient-focused evidence  refers to results from functional health status (FHS) and HRQL studies of orthopedic outcomes with measurements obtained from the perspective of patients or their non-clinician caregivers . The field of orthopedics is concerned with all musculo-skeletal problems from the top to the bottom of the human body. This broad anatomical range is associated with a wide range of functional problems. Some orthopedic problems are highly focused in regards to anatomy and associated with highly effective therapies. However, other orthopedic problems are of a diverse nature, the etiology is often poorly understood, and effective treatment strategies are sometimes elusive.The breadth and depth of some particularly challenging orthopedic problems has stimulated an interest in patient-based perspectives of their own FHS and HRQL. These types of measures will be referred to as \"health measures\" for the purposes of this paper. Health measures can be used to assess the burden of morbidity associated with orthopedic diagnoses, and to assess the effectiveness and efficiency of therapies. The diversity of issues also led the American Academy of Orthopedic Surgeons and the Pediatric Orthopedic Society of North America to develop the Pediatric Outcomes Data Collection Instrument (PODCI), and led other researchers to develop function-specific instruments such as the Activities Scale for Kids (ASK). However, there are a large variety of potentially appropriate health measures and there are limits to the number of these measures that can be used in any given study. The most appropriate set of health measures should be selected on the basis of underlying study objectives and design criteria .a priori specification of the comprehensive measure of health and a credible assessment viewpoint for the purposes of primary analysis of study results. Secondary study objectives may involve use of data collected from other health measures or from other assessment perspectives.Objectives and designs vary greatly across orthopedic studies. In general, orthopedic procedures and programs are undertaken to improve the health of patients. The health of patients can be measured in different ways. Conventional clinical or physiological measures are generally very useful for diagnostic and therapeutic purposes. Conventional clinical measures may, however, provide an incomplete assessment of health. For example, clinical examination and gait measures have been used to describe the quality and quantity of limitations in walking ability associated with hip flexion contracture but these types of assessments provide little information about the importance of this contracture relative to that of other serious health problems. In addition, various measures may provide conflicting results: some indicating improvement while others suggest decline in patients' health. Therefore, in the interest of scientific rigor, protocols to assess the overall effectiveness of therapy should include FHS and HRQL measures are important for a variety of reasons that complement conventional clinical measures . FHS mea\"Health-related quality of life is the value assigned to duration of life as modified by the impairments, functional states, perceptions, and social opportunities that are influenced by disease, injury, treatment or policy\" .It is generally accepted that a goal of therapy is to make patients feel better  and thisA series of studies from a randomized controlled clinical trial (RCT) and prospective cohort study of elective total hip arthroplasty are illustrative of these purposes. These examples, while not from a pediatric setting, are orthopedic and demonstrate how data can be used for a variety of purposes. In the RCT, Rorabeck and colleagues  undertooThere are many factors to consider when designing studies using patient-focused health measures for orthopedic patients. Among the most important factors are the study objectives, types of patients, the dimensions and FHS constructs associated with the health problem under study, the appropriateness of the questionnaire for the age range of the patients, the viewpoint of the assessors answering the questionnaire, the method of collecting questionnaire information (self-completion or interviewer-administration), the period of time respondents are asked to consider when answering the questionnaire , and measurement properties of assessment tools. Measurement properties include content and construct validity, test-retest and inter-rater reliability, responsiveness, and practical limitations of data collection. It takes many years, and often decades, for credible and relevant evidence to be accumulated about the measurement properties of instruments. Instruments with well-established measurement properties should be used whenever possible. Two prime issues for assessments of children are the developmental stage of the subjects and the most appropriate respondent for questionnaires.The methods section of the paper presents a framework of important factors for consideration in designing studies to assess FHS and HRQL for orthopedic patients. The results were generated by applying the framework in the context of developing a proposal for a comprehensive international study of patients with neurofibromatosis type 1 (NF1) and congenital tibial dysplasia (CTD). The NF1-CTD protocol provides a rich illustration because it encompasses great variability in the instrument selection factors, and these patients with their supportive caregivers face numerous complex health status challenges with long-term implications for HRQL. Furthermore, there is little information in the published literature about the comprehensive health status and HRQL of patients with NF1-CTD. The rationale and approach to studying FHS and HRQL from a patient perspective have relevance to many other areas of orthopedics.This section identifies specific study design and measurement instrument factors that should be considered in selecting measures for use in studies, and presents some background information for illustrating the application of these factors.Study design factors are specified in detailed protocols that clearly define the study objectives and conditions. Well-defined study objectives identify the study subjects, and type and number of measurements required. Study conditions describe practical issues including data collection sites, and budgets for time and resources.A highly focused, single objective study may require relatively few instruments while a broad-based, multi-faceted study will require numerous measures. For example, a RCT of efficacy for an experimental technique to achieve union of bone compared to a conventional technique might specify patients' reports from a single well-established walking ability scale as the primary outcome measure. However, an economic evaluation of the cost-effectiveness and cost-utility of the experimental technique would require at least two instruments: the single well-established walking ability scale to estimate effectiveness for the numerator in the cost-effectiveness ratio; and a utility-based scale of overall HRQL to estimate quality-adjusted life years for the numerator in the cost-utility ratio.The age of study subjects affects the choice of measurement instruments and the method of collecting data. Each instrument is valid for a specific age range and the age range is quite small for many pediatric instruments. For example, developmental changes during childhood make it difficult for single instruments to be valid from infancy through adolescence. Many instruments are valid for one or more of the following age categories: infants, pre-school children, primary-school children, adolescents, young / middle-age adults, seniors and elderly. Inability to read well , or see well , or concentrate well  inhibits use of self-complete questions. Well-designed interviewer-administered questionnaires pose clear, short, well-focused questions with readily understood and easily remembered response options .It is becoming widely accepted in many disciplines that studies of health care programs and technologies should include measures of patients' perceptions of their FHS and HRQL . MeasureThe locations and cultural characteristics of the study population will determine the language and sometimes the choice of assessors. Relatively few instruments have been carefully translated and culturally-adapted to facilitate use in a large variety of communities. Some cultures accept a variety of assessment viewpoints  while other cultures recognize only a physician viewpoint for health assessments.The literature suggests that there may be important effects due to mode of data collection  and, theFHS questionnaires should have well-specified assessment periods to help ensure that the subjects and researchers know the period of time covered by the responses. Assessment recall period refers to the period of time the assessor is asked to consider when answering the questionnaire. The period should match the objectives of the study. For instance, if a new surgical technique is thought to reduce the peri-operative burden of morbidity then frequent assessments with a brief recall period (24 hours) might be suitable. Standard assessment periods include the past 24 hours, the past 1 week, the past 2 weeks and the past 4 weeks. Short assessment periods should be used in studies of patients whose FHS varies over time and in studies involving serial assessments to ensure that there is no overlap in assessment times. Relatively long recall assessment durations may be used when it can be assumed patients' health status is fairly stable. For example, a four-week recall assessment period was used to measure the HRQL of patients in a randomized clinical trial and economic evaluation of two alternative treatment strategies for patients with knee osteoarthritis ,16.There are limits to the number and type of measures that respondents can be expected to complete without getting tired or frustrated, and/or that the study budget can afford in regards to both data collection and analysis. The evidence about the limits of respondent burden is sparse. All else being equal, studies involving serial assessments should expect to collect fewer measurements per assessment than single-assessment cross-sectional surveys. To maximize efficiency, instruments should be selected to provide complementary rather than overlapping information.There are numerous definitions of FHS and HRQL. For the purposes of the paper, a FHS measure is defined as being descriptive in terms of functional ability and HRQL is defined as involving some form of valuation of that health status.One published taxonomy  suggestsEach multi-attribute system includes a descriptive classification scheme to describe and assess health status, and a preference-based valuation system. HRQL scores for health states defined by multi-attribute systems are calculated from models fitted from directly measured preference measurements (see below). Multi-attribute systems provide descriptive information about comprehensive health status, and interval-scale preference scores of overall HRQL from a community perspective on a scale where 0.00 is the score for being dead and 1.00 is the score for being in perfect health. Several multi-attribute systems define negative scores of overall HRQL to represent preferences for states considered worse than being dead. A few systems include single-attribute preference-based scales of morbidity. Single-attribute morbidity scales are defined such that the least desirable level within an attribute  has a score of 0.00 (blind) and the most desirable level has a score of 1.00. The community perspective is most widely recommended for technology assessment and reference case economic evaluation analyses -29. InteA valid measure is \"sound and sufficient\" . There aA measure is reliable if it is sound and dependable . ReliabiResponsiveness is also referred to as sensitivity to change. It is an important feature for determining a measure's ability to detect effects of treatments or natural changes over time . Husted and colleagues reviewed the literature and defined two major types of responsiveness: internal and external responsiveness . InternaCeiling and floor effects are undesirable properties that reduce the validity, reliability, and responsiveness of measures. A ceiling effect may occur when a large proportion of measurement observations are close to the upper bound of the measurement scale. A ceiling effect results in a positively skewed distribution of measurements, limited ability of the measure to discriminate among subjects at the upper end of the scale, and attenuated responsiveness to improvements in health in longitudinal studies. A floor effect may occur when a large proportion of measurement observations are close to the lower bound of the measurement scale. Floor effects create a negatively skewed distribution of measurements, limited ability of the measure to discriminate among subjects at the lower end of the scale, and decreased responsiveness to decrements in health in longitudinal studies. Many generic and specific measures of HRQL may be subject to ceiling effect problems in that they may not be able to describe patients or subjects with above average  health. Some measures are subject to floor effect problems. Some are subject to both. Typically floor effect problems are more serious in clinical studies (which often involve patients with disabilities) and ceiling effect problems may be more problematic in general population studies.The limits of respondent burden depend upon many factors including the number of questions presented, how the questions are presented, the complexity of questions, the sophistication of respondents, and the respondents' interest in the questions. In general, the allowable length of questionnaire is shorter for mail and phone administration than for face-to-face interviewer administration . One setApplications of FHS and HRQL measures are greatly facilitated by expert advice, detailed instructions and other services designed to support users of a measure. Supporting documentation is usually protected by copyright and should not be used without written permission of the original developers. Documentation obtained from third-party sources should be considered suspect because it is frequently invalid. Licensing fees are used to fund high quality, readily accessible service centers. Permission to use copyright materials is typically granted one study at a time. Support services may also include consultation about the most appropriate versions of questionnaires for use in a specific study. Application packages may include data collection instruments such as questionnaires, procedure manuals, coding algorithms and scoring systems, as well as background information about the conceptual and measurement properties of the instrument.Recently there has been interest in using measures of FHS and HRQL to evaluate treatment alternatives for NF1-CTD. NF1 is one of the most common genetic disorders in childhood . It is eCTD is rare in the general population, approximately 1 per 140,000 . It has Conventional clinical measures of CTD include the Crawford classification system . These mSurveys of the published literature, experts in the fields, web sites and other sources of information were conducted to determine the dimensions of health that are affected by NF1-CTD, the types of FHS and HRQL measures that have been used, which measures should be considered as potentially useful for studies of NF1-CTD, the measurement properties of potentially useful measures, and the relative merits of various measures. A review of the on-line Quality of Life Instruments Database (QOLID) developed by Dr. Marcello Tamburini and the MAPI Research Institute , and corThere are five important research objectives of an NF1-CTD study that provide a context for applying the framework described in the Methods section:1) to document long-term health outcomes associated with the disease and its treatment;2) to measure the burden of disease and treatment during active therapy;3) to investigate the hypothesis that improved HRQL is associated with initial amputation compared with multiple limb-saving procedures;4) to determine relationships of FHS and HRQL with conventional clinical variables used in diagnosis and management; and5) to assess the measurement properties  of selected FHS and HRQL measures in NF1-CTD patients.These detailed objectives require the identification and assessment of leading FHS and HRQL measures for use in both cross-sectional and prospective longitudinal surveys.The prevalence of NF1-CTD is relatively low. Patients will need to be recruited from numerous clinical centers in North America to generate precise estimates of FHS and HRQL. Questionnaires should be available in at least 3 major languages: English, French and Spanish. The survey population ranges in age from newborn into adulthood and linking results across the study objectives requires that at least some of the assessment tools be in common across the age range of study patients. To avoid potential confounding effects, data collection techniques should be consistent across subjects and measures.The patient-focus will be represented by collecting measurements from all patients old enough to provide self-assessments, and from parents acting as proxy assessors for all children and adolescents. Self-complete questionnaires requiring minimal supervision should be used to eliminate the need for interviewers at each clinical center, to facilitate use of mail-out surveys, and to avoid potential \"interviewer\" effects. The number and type of measures per assessment, and the number of serial assessments per patient, should be sufficient to address all the study objectives within the limits of study resources and assessor burden. Measures of morbidity associated with NF1-CTD should be comparable with data on norms from surveys of general populations and other patient groups, and be useful for assessing the effectiveness and efficiency of health care services.The HRQL measure should be comprehensive and preference-based, to facilitate a broad variety of comparisons. A pediatric health profile measure and other specific measures will be selected to complement the selected preference-based HRQL measure. FHS measures may be focused on one or more of the following: the population of interest ; the major underlying disease ; the major human function of most interest ; the medically-defined health problem of most interest ; the medical speciality most involved with treatment of the health problem .There are six major generic preference-based HRQL utility systems , presentThe major population-specific health profiles include the Child Health Questionnaire (CHQ), Pediatric Inventory of Quality of Life (PedsQL), Pediatric Evaluation of Disability Inventory (PEI) and TNO-AZL Pre-School Children Quality of Life questionnaire (TAPQOL). The PEI is limited to children age 0.5 \u2013 7 years of age and requires a structured parent interview or clinician observation . TAPQOL The major pediatric disease-/function-/specialty-specific instruments include the PODCI , ASK, Gillette Functional Assessment Questionnaire Walking Scale , and Wee-FIM. Wee-FIM , a populA summary of the major pediatric generic health profiles appears in Tables Table The choice of existing measures is based on a process of elimination considering the relative strengths of each instrument and the complementarities among measures. Neither the SF-36 nor the EQ-5D is valid for use in adolescent patients with orthopedic problems . A revieIn summary, there are few measures available for assessing subjects less than 5 years of age and even fewer for subjects less than 2 years of age. Most relevant measures are available in self-complete format only. Preliminary recommendations for the NF1-CTD study were that PedsQL be used as the generic health profile, HUI be the multi-attribute preference-based measure of HRQL utility scores for children age 5 years and older and that CHSCS-PS be the measure for children age 2 through 4 years, ASK be the measure of activity limitation, FAQ walking scale be the measure of walking ability, and that a small feasibility study of these instruments be completed with a convenience sample.A pilot feasibility study surveyed 8 NF1 patients using HUI and FAQ walking scale measures. Questionnaires were completed by 6 NF1 patients and 3 parents. The combined HUI and FAQ walking scale questions took respondents an average of 13 minutes  to complete. The patients were 11 to 50+ years old and had health problems ranging from mild to severe. One patient with tibial dysplasia and 2 patients with scoliosis were included.HUI data were collected from 5 patients, 2 parents and both the patient and parents in one case. Health problems were reported in 7 of the 8 HUI3 attributes . The attributes associated with the most morbidity, as assessed using HUI3 single-attribute utility scores , were paFAQ walking scale data were collected from 4 patients (1 of the 5 survey patients did not answer the question), 2 parents and both the patient and parents in one case. Five patients were reported to be at Level 10 , one patient to be at Level 8 , and one patient at Level 6 .In summary, the feasibility study showed that the HUI and FAQ walking scale questions were acceptable to patients' families and that results, especially for HUI, reflected the large variability in HRQL of the sample of patients.No single measure will provide sufficient data to address all the important study objectives. A set of measures is required. The set of measures should provide complementary data of health status and preference-based scores of HRQL. Redundancy in measurement is reduced, and efficiency of measurement is increased, by selecting the most comprehensive generic measures and then supplementing these measures with the most appropriate set of specific measures.It is recommended that HUI be selected as the comprehensive generic measure for ten reasons:a) it includes both generic health profile and preference-based scoring systems;b) the preference-based scoring systems are well-validated;c) it is the most comprehensive, compact and efficient of these types of systems;d) it includes many of the most important domains in the context of NF1-CTD;e) it is applicable for all people age 5 years and older;f) well-developed data collection questionnaires are available to match the study design criteria;g) HUI results facilitate integrating effects of morbidity and mortality, and cost-utility economic evaluations;h) it has been used successfully in a variety of studies of musculoskeletal problems;i) population norm data are available; andj) a closely-related health status system, the CHSCS-PS, is available to assess children 2 through 4 years of age.The HUI will provide a broad set of measures for comparisons with other populations and for estimating HRQL on a general scale such that dead = 0.00 and perfect health = 1.00. As a generic measure, HUI also has the ability to capture side effects and the effects of co-morbidities. However, these broad measures may not be responsive to small but important changes in health status. Therefore, HUI should be complemented by a set of instruments focused on pediatric, orthopedic and walking issues.The PedsQL 4.0, a pediatric generic health profile, should also be included in the set of measures because:a) it includes domains, social and school function, which complement HUI and CHSCS-PS domains;b) it is appropriate for children ages 2 through 18 years;c) it is not overly burdensome in terms of data collection;d) patient and parent assessment questionnaires are available; ande) it can be interviewer-administered to facilitate data collection by telephone, if necessary.Two specific measures should also be part of the set of instrumentation: the ASK and the FAQ walking scale. ASK is an orthopedic-specific instrument which has been shown to cover the most important domains in the context of musculoskeletal disorders, including the impact of limb lengthening surgery experienced by many children with tibial dysplasia. ASK is also attractive because it provides overall summary scores for both performance and capability measures, and is only moderately burdensome to complete. Walking ability is one of the most important aspects of health that is frequently compromised in NF1-CTD patients, and the FAQ walking scale is the most complete scale of functional walking ability currently available and it only requires asking one question.CHQ is not recommended because it does not add much to the set of recommended measures and it is burdensome to complete. PODCI is not recommended because it is very burdensome to complete, it has been reported to have major problems with \"missing data\", and the system for collapsing questionnaire responses into summary scores is not well validated.Children ages 2 to 5 years of age should be assessed by their parents using three questionnaires: the CHSCS-PS (12 questions), the PedsQL (23 questions); and the FAQ walking scale (1 question). It is expected that all three of these questionnaires can be completed in an average of 15 minutes.Children and adolescents ages 5 to 17 years of age should be assessed by their parents using four questionnaires: the HUI (15 questions), the PedsQL (23 questions), the FAQ walking scale (1 question), and the ASK (30 questions). These four questionnaires are expected to be completed in an average of 20 to 30 minutes.Children and adolescents older than 11 years should provide self-assessments using four questionnaires: the HUI (15 questions), the PedsQL (23 questions), the FAQ walking scale (1 question), and the ASK (30 questions). On average, it is expected that respondents will complete all four questionnaires in 20 to 30 minutes.This paper highlights reasons why patient-focused measures of FHS and HRQL should be considered important tools in the field of orthopedic surgery. It has also noted that there is increasing competition for scarce health-care resources, that allocation decisions about these resources are being informed by evidence based on patient-focused health measures, and that these measures are being under-utilized by the orthopedic surgery community.The orthopedic community faces numerous obstacles in utilizing FHS and HRQL measures. One major obstacle is that the multitude of existing measures makes it difficult to decide which measures may be appropriate for a specific application. A second obstacle is that most of the information about FHS and HRQL measures is not reported in the orthopedic literature. A third obstacle is that usually no one measure can capture all the important aspects associated with a specific orthopedic issue. The framework outlined in the paper provides guidance for selecting appropriate FHS and HRQL measures. The framework guides orthopedic investigators to combine their basic study criteria, including objectives and clinical context, with key criteria for FHS and HRQL measures from the published literature.The results in this paper identify some major sources of information about health measures, identify some of the most widely used measures of FHS and HRQL, and provide summaries of key characteristics for selected measures in three major taxonomical classes: generic preference-based multi-attribute systems; generic pediatric health profile systems; and orthopedic-specific systems. It is clear that there are many important differences among measures both within and across taxonomical classes. All measures are not equal. There are sound factors for making judgements about which measures are most appropriate for a given application. A process of appraisal and elimination was used to select one measure from each taxonomical class for inclusion in the NF1-CTD study illustrative example, and a pilot study of the most readily available selected measures confirmed the feasibility of their use in a small sample of NF1-CTD patients.The paper shows that a set of relevant, valid, reliable, responsive and practical patient-focused health measures for use in an orthopedic study can be readily identified and selected from the published literature and information available on the worldwide web. We encourage orthopedic researchers to use the framework to identify and select appropriate patient-focused health measures in their future studies.\u00ae) instrumentation and provides methodological advice on the use of HUI.W. Furlong and D. Feeny have a proprietary interest in Health Utilities Inc. which distributes copyright Health Utilities Index (HUIAll authors were involved in critical review of drafts for intellectual content and have given final approval to the version submitted for publication. W Furlong was responsible for much of the overall design, acquisition of data, and initial drafting. R Barr and D Feeny made important contributions to the analysis and interpretation of results. S Yandow conceived the idea of presenting the information in a published manuscript.", "texts": ["The objectives of this report are to review the assessment of patient-focused outcomes in pediatric orthopedic surgery, to describe a framework for identifying appropriate sets of measures, and to illustrate an application of the framework to a challenging orthopedic problem.A detailed framework of study design and measurement factors is described. The factors are important for selecting appropriate instruments to measure health status and health-related quality of life (HRQL) in a particular context. A study to evaluate treatment alternatives for patients with neurofibromatosis type 1 and congenital tibial dysplasia (NF1-CTD) provides a rich illustration of the application of the framework. The application involves great variability in the instrument selection factors. Furthermore, these patients and their supportive caregivers face numerous complex health challenges with long-term implications for HRQL.Detailed summaries of important generic preference-based multi-attribute measurement systems, pediatric health profile instruments, and pediatric orthopedic-specific instruments are presented. Age-appropriate generic and specific measures are identified for study of NF1-CTD patients. Selected measures include the Activities Scale for Children, Gillette Functional Assessment Questionnaire Walking Scale, Health Utilities Index, and Pediatric Inventory of Quality of Life.Reliable and valid measures for application to pediatric orthopedics are available. There are important differences among measures. The selected measures complement each other. The framework in this report provides a guide for selecting appropriate measures. Application of appropriate sets of measures will enhance the ability to describe the morbidity of pediatric orthopedic patients and to assess the effectiveness of alternative clinical interventions. The framework for measurement of health status and HRQL from a patient perspective has relevance to many other areas of orthopedic practice. Assessments of patient-focused health status and health-related quality of life (HRQL) are being recognized increasingly by clinicians, patient advocates, regulatory authorities, administrators and policy makers as primary measures of the need, efficacy, effectiveness and efficiency associated with health care services. These types of measures are commonly reported in the published literature of many health care disciplines although there are few published reports concerning orthopedic surgery. However, the orthopedic community is becoming interested in using evidence reported by patients and patients' family members to determine what is best for patients.Patient-focused evidence  refers to results from functional health status (FHS) and HRQL studies of orthopedic outcomes with measurements obtained from the perspective of patients or their non-clinician caregivers . The field of orthopedics is concerned with all musculo-skeletal problems from the top to the bottom of the human body. This broad anatomical range is associated with a wide range of functional problems. Some orthopedic problems are highly focused in regards to anatomy and associated with highly effective therapies. However, other orthopedic problems are of a diverse nature, the etiology is often poorly understood, and effective treatment strategies are sometimes elusive.The breadth and depth of some particularly challenging orthopedic problems has stimulated an interest in patient-based perspectives of their own FHS and HRQL. These types of measures will be referred to as \"health measures\" for the purposes of this paper. Health measures can be used to assess the burden of morbidity associated with orthopedic diagnoses, and to assess the effectiveness and efficiency of therapies. The diversity of issues also led the American Academy of Orthopedic Surgeons and the Pediatric Orthopedic Society of North America to develop the Pediatric Outcomes Data Collection Instrument (PODCI), and led other researchers to develop function-specific instruments such as the Activities Scale for Kids (ASK). However, there are a large variety of potentially appropriate health measures and there are limits to the number of these measures that can be used in any given study. The most appropriate set of health measures should be selected on the basis of underlying study objectives and design criteria .a priori specification of the comprehensive measure of health and a credible assessment viewpoint for the purposes of primary analysis of study results. Secondary study objectives may involve use of data collected from other health measures or from other assessment perspectives.Objectives and designs vary greatly across orthopedic studies. In general, orthopedic procedures and programs are undertaken to improve the health of patients. The health of patients can be measured in different ways. Conventional clinical or physiological measures are generally very useful for diagnostic and therapeutic purposes. Conventional clinical measures may, however, provide an incomplete assessment of health. For example, clinical examination and gait measures have been used to describe the quality and quantity of limitations in walking ability associated with hip flexion contracture but these types of assessments provide little information about the importance of this contracture relative to that of other serious health problems. In addition, various measures may provide conflicting results: some indicating improvement while others suggest decline in patients' health. Therefore, in the interest of scientific rigor, protocols to assess the overall effectiveness of therapy should include FHS and HRQL measures are important for a variety of reasons that complement conventional clinical measures . FHS mea\"Health-related quality of life is the value assigned to duration of life as modified by the impairments, functional states, perceptions, and social opportunities that are influenced by disease, injury, treatment or policy\" .It is generally accepted that a goal of therapy is to make patients feel better  and thisA series of studies from a randomized controlled clinical trial (RCT) and prospective cohort study of elective total hip arthroplasty are illustrative of these purposes. These examples, while not from a pediatric setting, are orthopedic and demonstrate how data can be used for a variety of purposes. In the RCT, Rorabeck and colleagues  undertooThere are many factors to consider when designing studies using patient-focused health measures for orthopedic patients. Among the most important factors are the study objectives, types of patients, the dimensions and FHS constructs associated with the health problem under study, the appropriateness of the questionnaire for the age range of the patients, the viewpoint of the assessors answering the questionnaire, the method of collecting questionnaire information (self-completion or interviewer-administration), the period of time respondents are asked to consider when answering the questionnaire , and measurement properties of assessment tools. Measurement properties include content and construct validity, test-retest and inter-rater reliability, responsiveness, and practical limitations of data collection. It takes many years, and often decades, for credible and relevant evidence to be accumulated about the measurement properties of instruments. Instruments with well-established measurement properties should be used whenever possible. Two prime issues for assessments of children are the developmental stage of the subjects and the most appropriate respondent for questionnaires.The methods section of the paper presents a framework of important factors for consideration in designing studies to assess FHS and HRQL for orthopedic patients. The results were generated by applying the framework in the context of developing a proposal for a comprehensive international study of patients with neurofibromatosis type 1 (NF1) and congenital tibial dysplasia (CTD). The NF1-CTD protocol provides a rich illustration because it encompasses great variability in the instrument selection factors, and these patients with their supportive caregivers face numerous complex health status challenges with long-term implications for HRQL. Furthermore, there is little information in the published literature about the comprehensive health status and HRQL of patients with NF1-CTD. The rationale and approach to studying FHS and HRQL from a patient perspective have relevance to many other areas of orthopedics.This section identifies specific study design and measurement instrument factors that should be considered in selecting measures for use in studies, and presents some background information for illustrating the application of these factors.Study design factors are specified in detailed protocols that clearly define the study objectives and conditions. Well-defined study objectives identify the study subjects, and type and number of measurements required. Study conditions describe practical issues including data collection sites, and budgets for time and resources.A highly focused, single objective study may require relatively few instruments while a broad-based, multi-faceted study will require numerous measures. For example, a RCT of efficacy for an experimental technique to achieve union of bone compared to a conventional technique might specify patients' reports from a single well-established walking ability scale as the primary outcome measure. However, an economic evaluation of the cost-effectiveness and cost-utility of the experimental technique would require at least two instruments: the single well-established walking ability scale to estimate effectiveness for the numerator in the cost-effectiveness ratio; and a utility-based scale of overall HRQL to estimate quality-adjusted life years for the numerator in the cost-utility ratio.The age of study subjects affects the choice of measurement instruments and the method of collecting data. Each instrument is valid for a specific age range and the age range is quite small for many pediatric instruments. For example, developmental changes during childhood make it difficult for single instruments to be valid from infancy through adolescence. Many instruments are valid for one or more of the following age categories: infants, pre-school children, primary-school children, adolescents, young / middle-age adults, seniors and elderly. Inability to read well , or see well , or concentrate well  inhibits use of self-complete questions. Well-designed interviewer-administered questionnaires pose clear, short, well-focused questions with readily understood and easily remembered response options .It is becoming widely accepted in many disciplines that studies of health care programs and technologies should include measures of patients' perceptions of their FHS and HRQL . MeasureThe locations and cultural characteristics of the study population will determine the language and sometimes the choice of assessors. Relatively few instruments have been carefully translated and culturally-adapted to facilitate use in a large variety of communities. Some cultures accept a variety of assessment viewpoints  while other cultures recognize only a physician viewpoint for health assessments.The literature suggests that there may be important effects due to mode of data collection  and, theFHS questionnaires should have well-specified assessment periods to help ensure that the subjects and researchers know the period of time covered by the responses. Assessment recall period refers to the period of time the assessor is asked to consider when answering the questionnaire. The period should match the objectives of the study. For instance, if a new surgical technique is thought to reduce the peri-operative burden of morbidity then frequent assessments with a brief recall period (24 hours) might be suitable. Standard assessment periods include the past 24 hours, the past 1 week, the past 2 weeks and the past 4 weeks. Short assessment periods should be used in studies of patients whose FHS varies over time and in studies involving serial assessments to ensure that there is no overlap in assessment times. Relatively long recall assessment durations may be used when it can be assumed patients' health status is fairly stable. For example, a four-week recall assessment period was used to measure the HRQL of patients in a randomized clinical trial and economic evaluation of two alternative treatment strategies for patients with knee osteoarthritis ,16.There are limits to the number and type of measures that respondents can be expected to complete without getting tired or frustrated, and/or that the study budget can afford in regards to both data collection and analysis. The evidence about the limits of respondent burden is sparse. All else being equal, studies involving serial assessments should expect to collect fewer measurements per assessment than single-assessment cross-sectional surveys. To maximize efficiency, instruments should be selected to provide complementary rather than overlapping information.There are numerous definitions of FHS and HRQL. For the purposes of the paper, a FHS measure is defined as being descriptive in terms of functional ability and HRQL is defined as involving some form of valuation of that health status.One published taxonomy  suggestsEach multi-attribute system includes a descriptive classification scheme to describe and assess health status, and a preference-based valuation system. HRQL scores for health states defined by multi-attribute systems are calculated from models fitted from directly measured preference measurements (see below). Multi-attribute systems provide descriptive information about comprehensive health status, and interval-scale preference scores of overall HRQL from a community perspective on a scale where 0.00 is the score for being dead and 1.00 is the score for being in perfect health. Several multi-attribute systems define negative scores of overall HRQL to represent preferences for states considered worse than being dead. A few systems include single-attribute preference-based scales of morbidity. Single-attribute morbidity scales are defined such that the least desirable level within an attribute  has a score of 0.00 (blind) and the most desirable level has a score of 1.00. The community perspective is most widely recommended for technology assessment and reference case economic evaluation analyses -29. InteA valid measure is \"sound and sufficient\" . There aA measure is reliable if it is sound and dependable . ReliabiResponsiveness is also referred to as sensitivity to change. It is an important feature for determining a measure's ability to detect effects of treatments or natural changes over time . Husted and colleagues reviewed the literature and defined two major types of responsiveness: internal and external responsiveness . InternaCeiling and floor effects are undesirable properties that reduce the validity, reliability, and responsiveness of measures. A ceiling effect may occur when a large proportion of measurement observations are close to the upper bound of the measurement scale. A ceiling effect results in a positively skewed distribution of measurements, limited ability of the measure to discriminate among subjects at the upper end of the scale, and attenuated responsiveness to improvements in health in longitudinal studies. A floor effect may occur when a large proportion of measurement observations are close to the lower bound of the measurement scale. Floor effects create a negatively skewed distribution of measurements, limited ability of the measure to discriminate among subjects at the lower end of the scale, and decreased responsiveness to decrements in health in longitudinal studies. Many generic and specific measures of HRQL may be subject to ceiling effect problems in that they may not be able to describe patients or subjects with above average  health. Some measures are subject to floor effect problems. Some are subject to both. Typically floor effect problems are more serious in clinical studies (which often involve patients with disabilities) and ceiling effect problems may be more problematic in general population studies.The limits of respondent burden depend upon many factors including the number of questions presented, how the questions are presented, the complexity of questions, the sophistication of respondents, and the respondents' interest in the questions. In general, the allowable length of questionnaire is shorter for mail and phone administration than for face-to-face interviewer administration . One setApplications of FHS and HRQL measures are greatly facilitated by expert advice, detailed instructions and other services designed to support users of a measure. Supporting documentation is usually protected by copyright and should not be used without written permission of the original developers. Documentation obtained from third-party sources should be considered suspect because it is frequently invalid. Licensing fees are used to fund high quality, readily accessible service centers. Permission to use copyright materials is typically granted one study at a time. Support services may also include consultation about the most appropriate versions of questionnaires for use in a specific study. Application packages may include data collection instruments such as questionnaires, procedure manuals, coding algorithms and scoring systems, as well as background information about the conceptual and measurement properties of the instrument.Recently there has been interest in using measures of FHS and HRQL to evaluate treatment alternatives for NF1-CTD. NF1 is one of the most common genetic disorders in childhood . It is eCTD is rare in the general population, approximately 1 per 140,000 . It has Conventional clinical measures of CTD include the Crawford classification system . These mSurveys of the published literature, experts in the fields, web sites and other sources of information were conducted to determine the dimensions of health that are affected by NF1-CTD, the types of FHS and HRQL measures that have been used, which measures should be considered as potentially useful for studies of NF1-CTD, the measurement properties of potentially useful measures, and the relative merits of various measures. A review of the on-line Quality of Life Instruments Database (QOLID) developed by Dr. Marcello Tamburini and the MAPI Research Institute , and corThere are five important research objectives of an NF1-CTD study that provide a context for applying the framework described in the Methods section:1) to document long-term health outcomes associated with the disease and its treatment;2) to measure the burden of disease and treatment during active therapy;3) to investigate the hypothesis that improved HRQL is associated with initial amputation compared with multiple limb-saving procedures;4) to determine relationships of FHS and HRQL with conventional clinical variables used in diagnosis and management; and5) to assess the measurement properties  of selected FHS and HRQL measures in NF1-CTD patients.These detailed objectives require the identification and assessment of leading FHS and HRQL measures for use in both cross-sectional and prospective longitudinal surveys.The prevalence of NF1-CTD is relatively low. Patients will need to be recruited from numerous clinical centers in North America to generate precise estimates of FHS and HRQL. Questionnaires should be available in at least 3 major languages: English, French and Spanish. The survey population ranges in age from newborn into adulthood and linking results across the study objectives requires that at least some of the assessment tools be in common across the age range of study patients. To avoid potential confounding effects, data collection techniques should be consistent across subjects and measures.The patient-focus will be represented by collecting measurements from all patients old enough to provide self-assessments, and from parents acting as proxy assessors for all children and adolescents. Self-complete questionnaires requiring minimal supervision should be used to eliminate the need for interviewers at each clinical center, to facilitate use of mail-out surveys, and to avoid potential \"interviewer\" effects. The number and type of measures per assessment, and the number of serial assessments per patient, should be sufficient to address all the study objectives within the limits of study resources and assessor burden. Measures of morbidity associated with NF1-CTD should be comparable with data on norms from surveys of general populations and other patient groups, and be useful for assessing the effectiveness and efficiency of health care services.The HRQL measure should be comprehensive and preference-based, to facilitate a broad variety of comparisons. A pediatric health profile measure and other specific measures will be selected to complement the selected preference-based HRQL measure. FHS measures may be focused on one or more of the following: the population of interest ; the major underlying disease ; the major human function of most interest ; the medically-defined health problem of most interest ; the medical speciality most involved with treatment of the health problem .There are six major generic preference-based HRQL utility systems , presentThe major population-specific health profiles include the Child Health Questionnaire (CHQ), Pediatric Inventory of Quality of Life (PedsQL), Pediatric Evaluation of Disability Inventory (PEI) and TNO-AZL Pre-School Children Quality of Life questionnaire (TAPQOL). The PEI is limited to children age 0.5 \u2013 7 years of age and requires a structured parent interview or clinician observation . TAPQOL The major pediatric disease-/function-/specialty-specific instruments include the PODCI , ASK, Gillette Functional Assessment Questionnaire Walking Scale , and Wee-FIM. Wee-FIM , a populA summary of the major pediatric generic health profiles appears in Tables Table The choice of existing measures is based on a process of elimination considering the relative strengths of each instrument and the complementarities among measures. Neither the SF-36 nor the EQ-5D is valid for use in adolescent patients with orthopedic problems . A revieIn summary, there are few measures available for assessing subjects less than 5 years of age and even fewer for subjects less than 2 years of age. Most relevant measures are available in self-complete format only. Preliminary recommendations for the NF1-CTD study were that PedsQL be used as the generic health profile, HUI be the multi-attribute preference-based measure of HRQL utility scores for children age 5 years and older and that CHSCS-PS be the measure for children age 2 through 4 years, ASK be the measure of activity limitation, FAQ walking scale be the measure of walking ability, and that a small feasibility study of these instruments be completed with a convenience sample.A pilot feasibility study surveyed 8 NF1 patients using HUI and FAQ walking scale measures. Questionnaires were completed by 6 NF1 patients and 3 parents. The combined HUI and FAQ walking scale questions took respondents an average of 13 minutes  to complete. The patients were 11 to 50+ years old and had health problems ranging from mild to severe. One patient with tibial dysplasia and 2 patients with scoliosis were included.HUI data were collected from 5 patients, 2 parents and both the patient and parents in one case. Health problems were reported in 7 of the 8 HUI3 attributes . The attributes associated with the most morbidity, as assessed using HUI3 single-attribute utility scores , were paFAQ walking scale data were collected from 4 patients (1 of the 5 survey patients did not answer the question), 2 parents and both the patient and parents in one case. Five patients were reported to be at Level 10 , one patient to be at Level 8 , and one patient at Level 6 .In summary, the feasibility study showed that the HUI and FAQ walking scale questions were acceptable to patients' families and that results, especially for HUI, reflected the large variability in HRQL of the sample of patients.No single measure will provide sufficient data to address all the important study objectives. A set of measures is required. The set of measures should provide complementary data of health status and preference-based scores of HRQL. Redundancy in measurement is reduced, and efficiency of measurement is increased, by selecting the most comprehensive generic measures and then supplementing these measures with the most appropriate set of specific measures.It is recommended that HUI be selected as the comprehensive generic measure for ten reasons:a) it includes both generic health profile and preference-based scoring systems;b) the preference-based scoring systems are well-validated;c) it is the most comprehensive, compact and efficient of these types of systems;d) it includes many of the most important domains in the context of NF1-CTD;e) it is applicable for all people age 5 years and older;f) well-developed data collection questionnaires are available to match the study design criteria;g) HUI results facilitate integrating effects of morbidity and mortality, and cost-utility economic evaluations;h) it has been used successfully in a variety of studies of musculoskeletal problems;i) population norm data are available; andj) a closely-related health status system, the CHSCS-PS, is available to assess children 2 through 4 years of age.The HUI will provide a broad set of measures for comparisons with other populations and for estimating HRQL on a general scale such that dead = 0.00 and perfect health = 1.00. As a generic measure, HUI also has the ability to capture side effects and the effects of co-morbidities. However, these broad measures may not be responsive to small but important changes in health status. Therefore, HUI should be complemented by a set of instruments focused on pediatric, orthopedic and walking issues.The PedsQL 4.0, a pediatric generic health profile, should also be included in the set of measures because:a) it includes domains, social and school function, which complement HUI and CHSCS-PS domains;b) it is appropriate for children ages 2 through 18 years;c) it is not overly burdensome in terms of data collection;d) patient and parent assessment questionnaires are available; ande) it can be interviewer-administered to facilitate data collection by telephone, if necessary.Two specific measures should also be part of the set of instrumentation: the ASK and the FAQ walking scale. ASK is an orthopedic-specific instrument which has been shown to cover the most important domains in the context of musculoskeletal disorders, including the impact of limb lengthening surgery experienced by many children with tibial dysplasia. ASK is also attractive because it provides overall summary scores for both performance and capability measures, and is only moderately burdensome to complete. Walking ability is one of the most important aspects of health that is frequently compromised in NF1-CTD patients, and the FAQ walking scale is the most complete scale of functional walking ability currently available and it only requires asking one question.CHQ is not recommended because it does not add much to the set of recommended measures and it is burdensome to complete. PODCI is not recommended because it is very burdensome to complete, it has been reported to have major problems with \"missing data\", and the system for collapsing questionnaire responses into summary scores is not well validated.Children ages 2 to 5 years of age should be assessed by their parents using three questionnaires: the CHSCS-PS (12 questions), the PedsQL (23 questions); and the FAQ walking scale (1 question). It is expected that all three of these questionnaires can be completed in an average of 15 minutes.Children and adolescents ages 5 to 17 years of age should be assessed by their parents using four questionnaires: the HUI (15 questions), the PedsQL (23 questions), the FAQ walking scale (1 question), and the ASK (30 questions). These four questionnaires are expected to be completed in an average of 20 to 30 minutes.Children and adolescents older than 11 years should provide self-assessments using four questionnaires: the HUI (15 questions), the PedsQL (23 questions), the FAQ walking scale (1 question), and the ASK (30 questions). On average, it is expected that respondents will complete all four questionnaires in 20 to 30 minutes.This paper highlights reasons why patient-focused measures of FHS and HRQL should be considered important tools in the field of orthopedic surgery. It has also noted that there is increasing competition for scarce health-care resources, that allocation decisions about these resources are being informed by evidence based on patient-focused health measures, and that these measures are being under-utilized by the orthopedic surgery community.The orthopedic community faces numerous obstacles in utilizing FHS and HRQL measures. One major obstacle is that the multitude of existing measures makes it difficult to decide which measures may be appropriate for a specific application. A second obstacle is that most of the information about FHS and HRQL measures is not reported in the orthopedic literature. A third obstacle is that usually no one measure can capture all the important aspects associated with a specific orthopedic issue. The framework outlined in the paper provides guidance for selecting appropriate FHS and HRQL measures. The framework guides orthopedic investigators to combine their basic study criteria, including objectives and clinical context, with key criteria for FHS and HRQL measures from the published literature.The results in this paper identify some major sources of information about health measures, identify some of the most widely used measures of FHS and HRQL, and provide summaries of key characteristics for selected measures in three major taxonomical classes: generic preference-based multi-attribute systems; generic pediatric health profile systems; and orthopedic-specific systems. It is clear that there are many important differences among measures both within and across taxonomical classes. All measures are not equal. There are sound factors for making judgements about which measures are most appropriate for a given application. A process of appraisal and elimination was used to select one measure from each taxonomical class for inclusion in the NF1-CTD study illustrative example, and a pilot study of the most readily available selected measures confirmed the feasibility of their use in a small sample of NF1-CTD patients.The paper shows that a set of relevant, valid, reliable, responsive and practical patient-focused health measures for use in an orthopedic study can be readily identified and selected from the published literature and information available on the worldwide web. We encourage orthopedic researchers to use the framework to identify and select appropriate patient-focused health measures in their future studies.\u00ae) instrumentation and provides methodological advice on the use of HUI.W. Furlong and D. Feeny have a proprietary interest in Health Utilities Inc. which distributes copyright Health Utilities Index (HUIAll authors were involved in critical review of drafts for intellectual content and have given final approval to the version submitted for publication. W Furlong was responsible for much of the overall design, acquisition of data, and initial drafting. R Barr and D Feeny made important contributions to the analysis and interpretation of results. S Yandow conceived the idea of presenting the information in a published manuscript."]}
-{"representative": "Since the mid eighties, responsiveness is considered to be a separate property of health status questionnaires distinct from reliability and validity. The aim of the study was to assess the strength of the relationship between internal consistency reliability, referring to an instrument's sensitivity to differences in health status among subjects at one point in time, and responsiveness referring to sensitivity to health status changes over time.We used three different datasets comprising the scores of patients on the Barthel, the SIP and the GO-QoL instruments at two points in time. The internal consistency was reduced stepwise by removing the item that contributed most to a scale's reliability. We calculated the responsiveness expressed by the Standardized Response Mean (SRM) on each set of remaining items. The strength of the relationship between the thus obtained internal consistency coefficients and SRMs was quantified by Spearman rank correlation coefficients.Strong to perfect correlations (0.90 \u2013 1.00) was found between internal consistency coefficients and SRMs for all instruments indicating, that the two can be used interchangeably.The results contradict the conviction that responsiveness is a separate psychometric property. The internal consistency coefficient adequately reflects an instrument's potential sensitivity to changes over time. Responsiveness, a concept introduced in the mid-eighties by bio-medical researchers, is considered to be an essential measurement property of health status questionnaires, distinct from reliability and validity . HoweverWe used three datasets comprising the scores of patients on three widely used health status instruments on two moments in time in order to assess health changes. The first dataset was from a randomized clinical trial investigating the effects of arm and leg rehabilitation training on the functional recovery of stroke survivors using the 10-item Barthel (basic) activities of daily living scale . PatientOnly subjects with no missing values at baseline or follow-up were included in the analysis. The Barthel dataset had no missing values, the SIP datasets had 13 % (16/120), 28% (64/227) and 0.7% (1/141) missing values respectively and the GO-QOL had 0.6% (1/164) missing values. For the SIP datasets, there was a mean deterioration in health (1 point), for the Barthel and GO-QOL scales patients were improved at follow-up  reflecting sensitivity to differences in health status among patients , and theFigures Our results contradict the conviction that responsiveness is a separate psychometric property of health scales. Internal consistency reliability, reflecting a scale's sensitivity to cross-sectional differences in health, closely coincided with the instruments' sensitivity to change as measured with the standardized response mean. Our results also reflect what is already known within the framework of classical test theory. A test score cannot correlate more highly with any other variable than its own true score . This imWe used the SRM effect size that uses the standard deviation the change scores and therefore includes all information about the changes on the selected instruments. The results can not generalized to alternative effect sizes such as Cohen's effect size or Guyatt's responsiveness statistic  because In a frequently cited paper, Guyatt et al.  made theDuring the past 20 years, clinimetric research has resulted in about 25 definitions and 30 measures of instrument responsiveness, sometimes referred to as sensitivity to change or longitudinal validity . MoreoveRobert Lindeboom conceived the idea for the manuscript, Mirjam Sprangers and Robert Lindeboom wrote the manuscript, Koos Zwinderman provided the mathematics and rewrote parts of the manuscript in earlier draftsAppendix 1: Is it possible to have one high reliable scale with low 'responsiveness', and a low reliable scale with high 'responsiveness' measuring the same construct?Click here for file", "texts": ["Since the mid eighties, responsiveness is considered to be a separate property of health status questionnaires distinct from reliability and validity. The aim of the study was to assess the strength of the relationship between internal consistency reliability, referring to an instrument's sensitivity to differences in health status among subjects at one point in time, and responsiveness referring to sensitivity to health status changes over time.We used three different datasets comprising the scores of patients on the Barthel, the SIP and the GO-QoL instruments at two points in time. The internal consistency was reduced stepwise by removing the item that contributed most to a scale's reliability. We calculated the responsiveness expressed by the Standardized Response Mean (SRM) on each set of remaining items. The strength of the relationship between the thus obtained internal consistency coefficients and SRMs was quantified by Spearman rank correlation coefficients.Strong to perfect correlations (0.90 \u2013 1.00) was found between internal consistency coefficients and SRMs for all instruments indicating, that the two can be used interchangeably.The results contradict the conviction that responsiveness is a separate psychometric property. The internal consistency coefficient adequately reflects an instrument's potential sensitivity to changes over time. Responsiveness, a concept introduced in the mid-eighties by bio-medical researchers, is considered to be an essential measurement property of health status questionnaires, distinct from reliability and validity . HoweverWe used three datasets comprising the scores of patients on three widely used health status instruments on two moments in time in order to assess health changes. The first dataset was from a randomized clinical trial investigating the effects of arm and leg rehabilitation training on the functional recovery of stroke survivors using the 10-item Barthel (basic) activities of daily living scale . PatientOnly subjects with no missing values at baseline or follow-up were included in the analysis. The Barthel dataset had no missing values, the SIP datasets had 13 % (16/120), 28% (64/227) and 0.7% (1/141) missing values respectively and the GO-QOL had 0.6% (1/164) missing values. For the SIP datasets, there was a mean deterioration in health (1 point), for the Barthel and GO-QOL scales patients were improved at follow-up  reflecting sensitivity to differences in health status among patients , and theFigures Our results contradict the conviction that responsiveness is a separate psychometric property of health scales. Internal consistency reliability, reflecting a scale's sensitivity to cross-sectional differences in health, closely coincided with the instruments' sensitivity to change as measured with the standardized response mean. Our results also reflect what is already known within the framework of classical test theory. A test score cannot correlate more highly with any other variable than its own true score . This imWe used the SRM effect size that uses the standard deviation the change scores and therefore includes all information about the changes on the selected instruments. The results can not generalized to alternative effect sizes such as Cohen's effect size or Guyatt's responsiveness statistic  because In a frequently cited paper, Guyatt et al.  made theDuring the past 20 years, clinimetric research has resulted in about 25 definitions and 30 measures of instrument responsiveness, sometimes referred to as sensitivity to change or longitudinal validity . MoreoveRobert Lindeboom conceived the idea for the manuscript, Mirjam Sprangers and Robert Lindeboom wrote the manuscript, Koos Zwinderman provided the mathematics and rewrote parts of the manuscript in earlier draftsAppendix 1: Is it possible to have one high reliable scale with low 'responsiveness', and a low reliable scale with high 'responsiveness' measuring the same construct?Click here for file"]}
-{"representative": "To investigate the interchangeability of measures of disability and health-related quality of life (HRQL) by comparing their associations patterns with disease-related impairment measures in patients with a variety of conditions.z effect size (ES(z)). Weighted averages were reported as pooled ES(z) with 95% confidence intervals (CI).A systematic literature search of MEDLINE, EMBASE, Web of Science and a hand search of reference lists through January 2006. Studies were included if they reported associations patterns between impairment and disability and between impairment and HRQL. Correlation coefficients were transformed to Fisher's z) = 0.69; 95% CI, 0.66 \u2013 0.72) than between impairment and HRQL (pooled ES(z) = 0.38; 95% CI, 0.36 \u2013 0.41). The physical component score (pooled ES(z) = 0.43; 95% CI, 0.39 \u2013 0.47) and disease-specific HRQL (pooled ES(z) = 0.46; 95% CI, 0.40 \u2013 0.51) were stronger associated with impairments than the mental component score (pooled ES(z) = 0.28; 95% CI, 0.20 \u2013 0.36) and generic HRQL (pooled ES(z) = 0.36; 95% CI, 0.33 \u2013 0.39).The relationship between impairment and disability was stronger (pooled ES(This study shows measures of disability and different HRQL domains were not equally related to impairment. Patient's impairments are better reflected in disability measures, than in HRQL instruments. There are many outcomes of interest and precisely defining them and measuring them will improve assessing the impact of new interventions. Choosing an outcome measure for use in clinical research is a complex process. If the outcomes are chosen inappropriately, a study may provide unreliable results . FrequenBesides biological measures other levels of clinical measurement can be considered in clinical studies: impairments, disability and health-related quality of life (HRQL). Impairments are the direct organic manifestations of the disease such as consciousness and paresis ,3. DisabRecently, patient-relevant outcomes in terms of disability and HRQL have become more important . AlthougImpairment or Body function (Publication date from 2001) or Body structure (Publication date from 2001) and Disability  or Activity or Disabled Persons or Activities of Daily Living and Health-related quality of life combined with Association or Evaluation Studies or Comparative Study or Validation Studies was used. Studies from English, German and French literature were included. The electronic search was supplemented by hand searching the investigators files, and retrieval of references cited in available literature. The search strategy was composed by one of the authors (NW) in consultation with a clinical librarian.We conducted a systematic literature search of MEDLINE from 1966 through January 2006, EMBASE from 1980 through January 2006 and Web of Science from 1988 through January 2006 to identify studies addressing the relation between outcome measures. A search strategy using Medical Subject Heading, text words and Publication Types A set of explicit criteria, composed by three investigators , were used for selection of the literature. Articles were included if they focused on methodological or metric aspects of patient-based outcomes .Studies were included in which both the association between impairment and disability, and between impairment and HRQL were calculated by means of correlation coefficients or other association measures, regardless of the disease with the exception of psychiatric disorders. Hence, to improve the comparability between the correlation patterns between the different health concepts, only studies were included in which the three types of health outcomes were assessed in the same patient population. The measurement instruments were questionnaires or observation lists. When a multi-scale questionnaire focuses on more than one concept we only included the sub-scale for the health domain in question. In case of double publication we selected the first publication in time. Excluded were studies which valuated HRQL in terms of utilities  or compoInternational Classification of Impairments, Disabilities, and Handicap version ; r = 0.27; r2 = 7%) [The pooled ES(2 = 12%) ,37-42,452 = 18%) ,46. Impa2 = 17%) -40,45 thp > 0.50). The fail-safe calculation by Rosenthal's method retrieved for both analyses a large number of studies (n = 27077/n = 9755) needed to be added in order to change the results of the meta-analysis.Review of normal quantile plots showed no clear indications for publication bias in both the analyses for the relationship impairment and disability and for impairment and HRQL Figure  and 3. IIn this study we investigated the impact of impairments on patients' functional health in a spectrum of diseases. The results of the meta-analysis show that impairments explain 36% of the variance of the disability scores and 13% of the variance of HRQL scores. Impairment scales account for 17% of the physical dimension of HRQL, but can explain no more than 7% of the psychological aspects of HRQL .Due to the great variability in disease-related impairment scales and disability and HRQL instruments used in patient groups with a wide range of disorders, we expected heterogeneous data sets. Interestingly, after removal of one study which deviated from normality, homogeneity could be demonstrated in all analyses, except when we investigated the relationship between impairment and the mental component of HRQL. Possibly, this type of HRQL is less clearly defined compared to the other types of functional outcomes.Treatments, such as new drugs or new surgical or radiological interventions, are aimed at reducing mortality and morbidity. If these treatments reduce impairments, the beneficial effects on functional health will be far more better detectable in the patient's level of disability than in his or her level of HRQL. Moreover, if the outcome is assessed in terms of HRQL, treatment effects will be more visible in the physical component than in the mental components, and will be better reflected in the disease-specific measures than in the generic HRQL measures. Therefore, outcome measures at the level of functioning of patients should be selected carefully when clinical studies are designed. It clearly does matter on which level the functional outcome measurement is chosen.No doubt, HRQL scales represent an important measure from a patient's point of view, but have serious disadvantages in many clinical efficacy studies. The extent to which patients fulfill social roles and participate in their environment cannot be observed directly and depends not only on their functional ability, but also on personal traits, social circumstances and societal barriers. In particular, HRQL scores, which reflect the patient's perception of the consequences of disease, depend on numerous additional, usually psychosocial, factors other than the disease itself. This explains why the correlation between impairments and HRQL scores is weak, especially when emphasis is laid on subjective psychological scores of these scales. The subjective HRQL scores therefore are often beyond the influence of the physician. In the primary assessment of new drugs or new surgical procedures, there are many outcomes of interest and precisely defining them and measuring them will improve assessing the impact of new interventions. In contrast, disability  seem to be a more appropriate primary end point for assessing the functional health status of patients. The ability to perform basic and complex activities of daily life is, as we showed, not only better related to the disease process itself, but is also observable and predictive of dependence , and forA shortcoming of this meta-analysis might be that there are probably more studies than the 31 we found. Our search strategy was based on the ICIDH and ICF terms and few researchers distinguish between the terms impairment, disability and HRQL. If they distinguished between these terms correlations between impairment and disability or between impairment and HRQL were given rarely for all three domains together. Another point of discussion may be the concern for publication bias. However, the normal quantile plots, Spearman's rank correlation coefficient method and fail-safe calculation method do not give an indication for this type of bias. Finally and unfortunately, we were not able to perform subgroup analysis based on the methodological quality of the studies. This because the psychometric and clinimetric articles analyzed used a hotchpotch of research designs which made it impossible to formulate unequivocal methodological criteria in terms of, for example, appropriateness of the design chosen, sample size consideration, blind assessment of outcome parameters, statistical adjustment for confounders, or loss to follow-up .New drugs or new surgical or radiological treatments are developed from a pathophysiologic perspective and are primarily directed at reducing impairments. Traditionally, biological and impairment measures are preferred. Increasingly, it becomes evident that this type of outcome is not always relevant for patients ,51. Our The author(s) declare that they have no competing interests.NW, RdH and MV initiated the project. NW and RdH screened, extracted and analysed the data. All authors participated in the discussion of the results, in the writing of the paper, and read and approved the final manuscript.The pre-publication history for this paper can be accessed here:", "texts": ["To investigate the interchangeability of measures of disability and health-related quality of life (HRQL) by comparing their associations patterns with disease-related impairment measures in patients with a variety of conditions.z effect size (ES(z)). Weighted averages were reported as pooled ES(z) with 95% confidence intervals (CI).A systematic literature search of MEDLINE, EMBASE, Web of Science and a hand search of reference lists through January 2006. Studies were included if they reported associations patterns between impairment and disability and between impairment and HRQL. Correlation coefficients were transformed to Fisher's z) = 0.69; 95% CI, 0.66 \u2013 0.72) than between impairment and HRQL (pooled ES(z) = 0.38; 95% CI, 0.36 \u2013 0.41). The physical component score (pooled ES(z) = 0.43; 95% CI, 0.39 \u2013 0.47) and disease-specific HRQL (pooled ES(z) = 0.46; 95% CI, 0.40 \u2013 0.51) were stronger associated with impairments than the mental component score (pooled ES(z) = 0.28; 95% CI, 0.20 \u2013 0.36) and generic HRQL (pooled ES(z) = 0.36; 95% CI, 0.33 \u2013 0.39).The relationship between impairment and disability was stronger (pooled ES(This study shows measures of disability and different HRQL domains were not equally related to impairment. Patient's impairments are better reflected in disability measures, than in HRQL instruments. There are many outcomes of interest and precisely defining them and measuring them will improve assessing the impact of new interventions. Choosing an outcome measure for use in clinical research is a complex process. If the outcomes are chosen inappropriately, a study may provide unreliable results . FrequenBesides biological measures other levels of clinical measurement can be considered in clinical studies: impairments, disability and health-related quality of life (HRQL). Impairments are the direct organic manifestations of the disease such as consciousness and paresis ,3. DisabRecently, patient-relevant outcomes in terms of disability and HRQL have become more important . AlthougImpairment or Body function (Publication date from 2001) or Body structure (Publication date from 2001) and Disability  or Activity or Disabled Persons or Activities of Daily Living and Health-related quality of life combined with Association or Evaluation Studies or Comparative Study or Validation Studies was used. Studies from English, German and French literature were included. The electronic search was supplemented by hand searching the investigators files, and retrieval of references cited in available literature. The search strategy was composed by one of the authors (NW) in consultation with a clinical librarian.We conducted a systematic literature search of MEDLINE from 1966 through January 2006, EMBASE from 1980 through January 2006 and Web of Science from 1988 through January 2006 to identify studies addressing the relation between outcome measures. A search strategy using Medical Subject Heading, text words and Publication Types A set of explicit criteria, composed by three investigators , were used for selection of the literature. Articles were included if they focused on methodological or metric aspects of patient-based outcomes .Studies were included in which both the association between impairment and disability, and between impairment and HRQL were calculated by means of correlation coefficients or other association measures, regardless of the disease with the exception of psychiatric disorders. Hence, to improve the comparability between the correlation patterns between the different health concepts, only studies were included in which the three types of health outcomes were assessed in the same patient population. The measurement instruments were questionnaires or observation lists. When a multi-scale questionnaire focuses on more than one concept we only included the sub-scale for the health domain in question. In case of double publication we selected the first publication in time. Excluded were studies which valuated HRQL in terms of utilities  or compoInternational Classification of Impairments, Disabilities, and Handicap version ; r = 0.27; r2 = 7%) [The pooled ES(2 = 12%) ,37-42,452 = 18%) ,46. Impa2 = 17%) -40,45 thp > 0.50). The fail-safe calculation by Rosenthal's method retrieved for both analyses a large number of studies (n = 27077/n = 9755) needed to be added in order to change the results of the meta-analysis.Review of normal quantile plots showed no clear indications for publication bias in both the analyses for the relationship impairment and disability and for impairment and HRQL Figure  and 3. IIn this study we investigated the impact of impairments on patients' functional health in a spectrum of diseases. The results of the meta-analysis show that impairments explain 36% of the variance of the disability scores and 13% of the variance of HRQL scores. Impairment scales account for 17% of the physical dimension of HRQL, but can explain no more than 7% of the psychological aspects of HRQL .Due to the great variability in disease-related impairment scales and disability and HRQL instruments used in patient groups with a wide range of disorders, we expected heterogeneous data sets. Interestingly, after removal of one study which deviated from normality, homogeneity could be demonstrated in all analyses, except when we investigated the relationship between impairment and the mental component of HRQL. Possibly, this type of HRQL is less clearly defined compared to the other types of functional outcomes.Treatments, such as new drugs or new surgical or radiological interventions, are aimed at reducing mortality and morbidity. If these treatments reduce impairments, the beneficial effects on functional health will be far more better detectable in the patient's level of disability than in his or her level of HRQL. Moreover, if the outcome is assessed in terms of HRQL, treatment effects will be more visible in the physical component than in the mental components, and will be better reflected in the disease-specific measures than in the generic HRQL measures. Therefore, outcome measures at the level of functioning of patients should be selected carefully when clinical studies are designed. It clearly does matter on which level the functional outcome measurement is chosen.No doubt, HRQL scales represent an important measure from a patient's point of view, but have serious disadvantages in many clinical efficacy studies. The extent to which patients fulfill social roles and participate in their environment cannot be observed directly and depends not only on their functional ability, but also on personal traits, social circumstances and societal barriers. In particular, HRQL scores, which reflect the patient's perception of the consequences of disease, depend on numerous additional, usually psychosocial, factors other than the disease itself. This explains why the correlation between impairments and HRQL scores is weak, especially when emphasis is laid on subjective psychological scores of these scales. The subjective HRQL scores therefore are often beyond the influence of the physician. In the primary assessment of new drugs or new surgical procedures, there are many outcomes of interest and precisely defining them and measuring them will improve assessing the impact of new interventions. In contrast, disability  seem to be a more appropriate primary end point for assessing the functional health status of patients. The ability to perform basic and complex activities of daily life is, as we showed, not only better related to the disease process itself, but is also observable and predictive of dependence , and forA shortcoming of this meta-analysis might be that there are probably more studies than the 31 we found. Our search strategy was based on the ICIDH and ICF terms and few researchers distinguish between the terms impairment, disability and HRQL. If they distinguished between these terms correlations between impairment and disability or between impairment and HRQL were given rarely for all three domains together. Another point of discussion may be the concern for publication bias. However, the normal quantile plots, Spearman's rank correlation coefficient method and fail-safe calculation method do not give an indication for this type of bias. Finally and unfortunately, we were not able to perform subgroup analysis based on the methodological quality of the studies. This because the psychometric and clinimetric articles analyzed used a hotchpotch of research designs which made it impossible to formulate unequivocal methodological criteria in terms of, for example, appropriateness of the design chosen, sample size consideration, blind assessment of outcome parameters, statistical adjustment for confounders, or loss to follow-up .New drugs or new surgical or radiological treatments are developed from a pathophysiologic perspective and are primarily directed at reducing impairments. Traditionally, biological and impairment measures are preferred. Increasingly, it becomes evident that this type of outcome is not always relevant for patients ,51. Our The author(s) declare that they have no competing interests.NW, RdH and MV initiated the project. NW and RdH screened, extracted and analysed the data. All authors participated in the discussion of the results, in the writing of the paper, and read and approved the final manuscript.The pre-publication history for this paper can be accessed here:"]}
-{"representative": "Responsiveness, or sensitivity to clinical change, is an important consideration in selection of a health-related quality of life (HRQL) measure for trials or clinical applications. Many approaches can be used to assess responsiveness, which may affect the interpretation of study results. We compared the relative responsiveness of generic and heart failure specific HRQL instruments, as measured both by common psychometric indices and by external clinical criteria.We analyzed data collected at baseline and 6-weeks in 298 subjects with heart failure on the following HRQL measures: EQ-5D , Kansas City Cardiomyopathy Questionnaire (KCCQ) , and RAND12 . Three external indicators of clinical change were used to classify subjects as improved, deteriorated, or unchanged: 6-minute walk test, New York Heart Association (NYHA) class, and physician global rating of change. Four responsiveness statistics  were used to evaluate the responsiveness of the select measures. The median rank of each HRQL measure across responsiveness indices and clinical criteria was then determined.Average age of subjects was 60 years, 75 percent were male, and had moderate to severe heart failure symptoms. Overall, the KCCQ Summary Scores had the highest relative ranking, irrespective of the responsiveness index or external criterion used. Importantly, we observed that the relative ranking of responsiveness of the generic measures  was influenced by both the responsive indices and external criterion used.The disease specific KCCQ was the most responsive HRQL measure assessing change over a 6-week period, although generic measures provide information for which the KCCQ is not suitable. The responsiveness of generic HRQL measures may be affected by the index used, as well as the external criterion to classify patients who have clinically change or remained stable. In chronic medical conditions, small changes in clinical status must be readily identifiable to monitor patients' progress and to modify treatment strategies, if necessary . In hearHRQL measures have been commonly used in the clinical trial setting in the evaluation of new treatment strategies, and more recently are even used as the primary outcome assessment for clinical trials ,8. When true underlying change in the patients' health status over time [Several disease and generic measures of HRQL have been used in both clinical practice and in clinical trials of patients with heart failure. To accurately capture these changes in health status over time, the HRQL measure must have evidence of longitudinal validity or 'responsiveness' . Responsver time . Two appSeveral factors may therefore influence the responsiveness of a HRQL measure, including, but not limited to, the content of the measure , the validity of the measure, the error associated with the HRQL scores, the indices used to determine the responsiveness  and the external criterion or 'gold standard' used to identify subjects as changed or not changed. When considering evidence of responsiveness, it is important to consider the extent to which these factors affect reported estimates of responsiveness .To provide empirical evidence to support this issue, and to assist in the selection and interpretation of health status measures for heart failure, we analyzed longitudinal HRQL data in patients with heart failure to evaluate the relative responsiveness of selected disease-specific and generic HRQL measures. We explicitly compared their relative performance as measured by common responsiveness indices and by different external clinical criteria for change.Patients with heart failure were recruited through the Cardiovascular Outcomes Research Consortium across 14 medical center outpatient departments in the United States and Canada . All subPatients completed several HRQL questionnaires at baseline, including the RAND12, EQ-5D, and the Kansas City Cardiomyopathy Questionnaire (KCCQ).The RAND12 is a short, well-validated, generic measure of health status -12. The The EQ-5D is a 5-item self-administered utility measure . In addiThe KCCQ is a 23-item heart failure specific questionnaire. The KCCQ has domains on physical limitations, heart failure specific symptoms , quality of life, social impact of the disease, and patients' assessments of their disease knowledge or self-efficacy . The psyIn addition to the HRQL questionnaires, several clinical assessments were also completed by the residing cardiologist at baseline. Specifically, the patients baseline New York Heart Association (NYHA) classification was assessed and patients completed a six-minute walk (6 MW) test according to a standardized protocol . All patThere is no universally accepted gold standard for identification of clinical change in patients with heart failure. As a result, change in the patients' clinical status was assessed using several criteria. First, cardiologist's assessment of the patients' NYHA classification at baseline and at the 6-week follow-up was used. Subjects were classified as improving two NYHA classes , improving one NYHA class, no change in NYHA class, and deteriorating one NYHA class from the baseline to 6-week follow-up. No subjects deteriorated by two NYHA classes during the 6-week period.Second, the resident cardiologist, blinded to the subjects self-reported HRQL and the 6 MW test results, completed a previously validated global rating of change assessment from the baseline to the 6-week follow-up visit ,18. ThisFinally, the difference from baseline to 6-weeks in distanced traveled in the 6 MW test was recorded. This difference was categorized into 7 mutually exclusive categories of clinical change according to previous research : substanMean change scores in the HRQL measures were calculated by subtracting the baseline score from the 6-week follow-up data. Responsiveness indices, including T-statistic , effect size (ES) (mean change divided by the standard deviation of the baseline score), the Guyatt's responsiveness statistic (GRS) (mean change divided by the standard deviation of change in subjects who remained unchanged), and the standardized response mean (SRM) (mean change divided by the standard deviation of the change score) , were caTo facilitate comparison, the median rank of each HRQL measure was determined across each of the four responsiveness indices . In ordeA total of 476 subjects were enrolled in the study and provided baseline and 6-week follow-up . Of thesUpon follow-up (average 6 \u00b1 2 weeks), 52 (17%) subjects were classified as improved according to the NYHA class Table , 60 20%, and 101Overall, the magnitude of change in the HRQL scores were larger for subjects who improved compared to subjects who deteriorated over the 6-week period, with the exception of the 6 MW data, which showed the opposite trend Table . ImportaSimilar to the raw HRQL change scores, the magnitude of the responsiveness indices were influenced by the direction of clinical change Tables , 7, 8. OIn general, the relative ranking of the HRQL measure within each responsiveness index was similar, regardless of the responsiveness indices used Tables , 7, 8. IAlthough small differences existed, the relative ranking of the generic HRQL measures across the responsiveness indices were similar and generally differed by only one rank position. For example, the EQ-5D\u2013US Scoring system for subjects who improved +2 NYHA classes had a relative ranking of '3' using the T-statistic, ES and GRS and a rank of '4' using the SRM. Thus, the relative responsiveness of a disease-specific versus generic HRQL measure was not substantively influenced by the choice of responsiveness index. Differences did exist, however, in the relative ranking of generic HRQL measures according to the external clinical criterion of change used Tables , 2, 3. Ttrue underlying change can have a major influence on the perceived responsiveness of a HRQL measure [In this study, we found that the disease specific KCCQ measure was more responsive to underlying clinical change than either the generic EQ-5D or RAND12 measures. The greater responsiveness of the KCCQ was consistent across all four responsiveness indices used and across the three external clinical criteria of change. Importantly, we also found that the methods and definitions used to define  measure ,20, part measure .true underlying change in patients with heart failure. Clinicians are interested in determining if the difference in HRQL scores over time signifies a trivial, small but clinically important, moderate, or a large change in HRQL [It is important to understand and interpret how changes in the HRQL scores over time reflect  in HRQL ,21. ThisThe high responsiveness of the KCCQ may have been expected as specific measures, by design, typically have very strong content validity for a specific disease or population. It is generally accepted that when true change occurs in the setting of a clinical trial, disease-specific measures are more responsive to this change as compared to generic measures of HRQL . They arThe KCCQ, for example, specifically focuses on the impact of dyspnea, a prominent complaint for people with heart failure. In the RAND12, dyspnea could be captured, but only in much broader terms under the domain of physical functioning. Thus, disease-specific measures may be more sensitive and responsive to within-patient change as compared to generic measures . This chWhile our data would suggest that the use of a disease-specific measure, like the KCCQ, may provide the best opportunity to capture small but highly relevant clinical changes in heart failure patients, not all changes in HRQL may be captured with the use of a disease-specific measure, as often the overall effects of a new treatment may not be fully known. For example, we were intrigued by the relative performance of the physical and mental health summary scores of the RAND12. Although heart failure is often perceived largely as a physical disease, the RAND12 PCS Score performed very poorly compared to the other HRQL measures. The reason for the lower responsiveness of the RAND12 PCS is not known but may be related to the underlying health status of the study population. RAND12 PCS scores were, on average, 1.5 standard deviations below the standardized US population mean at baseline indicating that the subjects had significant physical deficits (Table Also of note was that the relative responsiveness of the HRQL measures depended on the direction of clinical change. Overall, the HRQL measures were more responsive to improved clinical status as compared to deteriorating clinical status. This may be related to the fact that heart failure patients in this study were quite severely affected by their disease and had substantial deficits in their HRQL. As a result, HRQL measures may be susceptible to 'floor effects' in this population, which may limit their ability to capture deterioration in clinical status. The observation that no patient deteriorated by 2 NYHA classes further supports this hypothesis. Thus, not only can the responsiveness indices and external criterion standards influence instrument responsiveness, but also it is important to consider the population studied.Irrespective of the scope of the HRQL measure or the direction of clinical change, the responsiveness of a particular measure may also be influenced by the responsiveness index used. Although the responsiveness indices used in this study provided similar rankings, differences did exist among the responsiveness indices when the generic HRQL measures were concerned. In this study, four commonly utilized responsiveness indices were used ,27. TerwAlthough most indices use the mean change in HRQL over time, there are significant differences in how the standard deviations or variability in the data is used in the calculation. For example, the GRS was calculated using the standard deviation of the change scores among subjects who are clinically stable, whereas the SRM uses the standard deviation of the change scores. It is therefore possible that significant differences could exist in the variability in the selected subgroups, resulting in differences in the perceived responsiveness of the HRQL measure depending upon the responsiveness index chosen.true clinical change in this population [Our results and interpretation should be considered in light of several potential limitations. First, as discussed, the ability to identify patients who truly changed during the follow-up period was subjective, as no 'gold standard' exists for patients with heart failure. We did apply, however, the NYHA classification system, physician global rating of change assessment, and 6 MW tests, which are well validated and common methods to identify change in clinical status in patients with heart failure ,17,18. Fpulation . Second,pulation .With these limitations in mind, we believe this study highlights the importance of considering the measurement properties and instrument content in selecting HRQL measures for clinical trials. It is important to have a measure capable of detecting small but highly relevant and important changes in HRQL, especially when the HRQL outcome of interest represents the primary outcome or main secondary outcome of the trial. Furthermore, in the design of a clinical trial, researchers must be confident that the HRQL measure is responsive to the minimal importance difference that was hypothesized during the study design. The sample size required and power of the study will be directly related to the minimal importance difference that the researchers wish to detect. However, while disease specific measure may be considered as the first choice for a primary HRQL outcome, a combination with a generic HRQL measure may still be desirable to fully assess HRQL outcomes in clinical trial settings. Further, if the therapy under consideration will be evaluated under a cost-effectiveness framework, it would be desirable to include a measure compatible with that framework, such as a utility-based measure .We found the disease specific measure, the KCCQ, was the most responsive HRQL measure assessing change over a 6-week period, although generic measures provide information for which the KCCQ is not suitable. We noted that the responsiveness of generic HRQL measure may be affected by the responsiveness index used, as well as the selection of the external criterion to identify patients who have clinically change or remained stable.Dr. Spertus owns the copyright to the KCCQ. While he assisted in the review of the manuscript and was responsible for the original study, he did not design these analyses nor dictate the interpretation of the results. Otherwise, the authors have no conflicts of interest, including specific financial interests, non-financial interests, relationships, and affiliations relevant to the subject matter or materials discussed in the manuscript.DTE and JAJ participated in the conception and design of the study, analysis, and interpretation of the data, drafting of the manuscript, and revising it critically for important intellectual content. KJL participated in the analysis and interpretation of the data and revising the manuscript for critically important intellectual content. JAS participated in the conception and design of the study, acquisition of data, interpretation of the data, and revising the manuscript for critically important intellectual content. All authors read and approved the final manuscript.", "texts": ["Responsiveness, or sensitivity to clinical change, is an important consideration in selection of a health-related quality of life (HRQL) measure for trials or clinical applications. Many approaches can be used to assess responsiveness, which may affect the interpretation of study results. We compared the relative responsiveness of generic and heart failure specific HRQL instruments, as measured both by common psychometric indices and by external clinical criteria.We analyzed data collected at baseline and 6-weeks in 298 subjects with heart failure on the following HRQL measures: EQ-5D , Kansas City Cardiomyopathy Questionnaire (KCCQ) , and RAND12 . Three external indicators of clinical change were used to classify subjects as improved, deteriorated, or unchanged: 6-minute walk test, New York Heart Association (NYHA) class, and physician global rating of change. Four responsiveness statistics  were used to evaluate the responsiveness of the select measures. The median rank of each HRQL measure across responsiveness indices and clinical criteria was then determined.Average age of subjects was 60 years, 75 percent were male, and had moderate to severe heart failure symptoms. Overall, the KCCQ Summary Scores had the highest relative ranking, irrespective of the responsiveness index or external criterion used. Importantly, we observed that the relative ranking of responsiveness of the generic measures  was influenced by both the responsive indices and external criterion used.The disease specific KCCQ was the most responsive HRQL measure assessing change over a 6-week period, although generic measures provide information for which the KCCQ is not suitable. The responsiveness of generic HRQL measures may be affected by the index used, as well as the external criterion to classify patients who have clinically change or remained stable. In chronic medical conditions, small changes in clinical status must be readily identifiable to monitor patients' progress and to modify treatment strategies, if necessary . In hearHRQL measures have been commonly used in the clinical trial setting in the evaluation of new treatment strategies, and more recently are even used as the primary outcome assessment for clinical trials ,8. When true underlying change in the patients' health status over time [Several disease and generic measures of HRQL have been used in both clinical practice and in clinical trials of patients with heart failure. To accurately capture these changes in health status over time, the HRQL measure must have evidence of longitudinal validity or 'responsiveness' . Responsver time . Two appSeveral factors may therefore influence the responsiveness of a HRQL measure, including, but not limited to, the content of the measure , the validity of the measure, the error associated with the HRQL scores, the indices used to determine the responsiveness  and the external criterion or 'gold standard' used to identify subjects as changed or not changed. When considering evidence of responsiveness, it is important to consider the extent to which these factors affect reported estimates of responsiveness .To provide empirical evidence to support this issue, and to assist in the selection and interpretation of health status measures for heart failure, we analyzed longitudinal HRQL data in patients with heart failure to evaluate the relative responsiveness of selected disease-specific and generic HRQL measures. We explicitly compared their relative performance as measured by common responsiveness indices and by different external clinical criteria for change.Patients with heart failure were recruited through the Cardiovascular Outcomes Research Consortium across 14 medical center outpatient departments in the United States and Canada . All subPatients completed several HRQL questionnaires at baseline, including the RAND12, EQ-5D, and the Kansas City Cardiomyopathy Questionnaire (KCCQ).The RAND12 is a short, well-validated, generic measure of health status -12. The The EQ-5D is a 5-item self-administered utility measure . In addiThe KCCQ is a 23-item heart failure specific questionnaire. The KCCQ has domains on physical limitations, heart failure specific symptoms , quality of life, social impact of the disease, and patients' assessments of their disease knowledge or self-efficacy . The psyIn addition to the HRQL questionnaires, several clinical assessments were also completed by the residing cardiologist at baseline. Specifically, the patients baseline New York Heart Association (NYHA) classification was assessed and patients completed a six-minute walk (6 MW) test according to a standardized protocol . All patThere is no universally accepted gold standard for identification of clinical change in patients with heart failure. As a result, change in the patients' clinical status was assessed using several criteria. First, cardiologist's assessment of the patients' NYHA classification at baseline and at the 6-week follow-up was used. Subjects were classified as improving two NYHA classes , improving one NYHA class, no change in NYHA class, and deteriorating one NYHA class from the baseline to 6-week follow-up. No subjects deteriorated by two NYHA classes during the 6-week period.Second, the resident cardiologist, blinded to the subjects self-reported HRQL and the 6 MW test results, completed a previously validated global rating of change assessment from the baseline to the 6-week follow-up visit ,18. ThisFinally, the difference from baseline to 6-weeks in distanced traveled in the 6 MW test was recorded. This difference was categorized into 7 mutually exclusive categories of clinical change according to previous research : substanMean change scores in the HRQL measures were calculated by subtracting the baseline score from the 6-week follow-up data. Responsiveness indices, including T-statistic , effect size (ES) (mean change divided by the standard deviation of the baseline score), the Guyatt's responsiveness statistic (GRS) (mean change divided by the standard deviation of change in subjects who remained unchanged), and the standardized response mean (SRM) (mean change divided by the standard deviation of the change score) , were caTo facilitate comparison, the median rank of each HRQL measure was determined across each of the four responsiveness indices . In ordeA total of 476 subjects were enrolled in the study and provided baseline and 6-week follow-up . Of thesUpon follow-up (average 6 \u00b1 2 weeks), 52 (17%) subjects were classified as improved according to the NYHA class Table , 60 20%, and 101Overall, the magnitude of change in the HRQL scores were larger for subjects who improved compared to subjects who deteriorated over the 6-week period, with the exception of the 6 MW data, which showed the opposite trend Table . ImportaSimilar to the raw HRQL change scores, the magnitude of the responsiveness indices were influenced by the direction of clinical change Tables , 7, 8. OIn general, the relative ranking of the HRQL measure within each responsiveness index was similar, regardless of the responsiveness indices used Tables , 7, 8. IAlthough small differences existed, the relative ranking of the generic HRQL measures across the responsiveness indices were similar and generally differed by only one rank position. For example, the EQ-5D\u2013US Scoring system for subjects who improved +2 NYHA classes had a relative ranking of '3' using the T-statistic, ES and GRS and a rank of '4' using the SRM. Thus, the relative responsiveness of a disease-specific versus generic HRQL measure was not substantively influenced by the choice of responsiveness index. Differences did exist, however, in the relative ranking of generic HRQL measures according to the external clinical criterion of change used Tables , 2, 3. Ttrue underlying change can have a major influence on the perceived responsiveness of a HRQL measure [In this study, we found that the disease specific KCCQ measure was more responsive to underlying clinical change than either the generic EQ-5D or RAND12 measures. The greater responsiveness of the KCCQ was consistent across all four responsiveness indices used and across the three external clinical criteria of change. Importantly, we also found that the methods and definitions used to define  measure ,20, part measure .true underlying change in patients with heart failure. Clinicians are interested in determining if the difference in HRQL scores over time signifies a trivial, small but clinically important, moderate, or a large change in HRQL [It is important to understand and interpret how changes in the HRQL scores over time reflect  in HRQL ,21. ThisThe high responsiveness of the KCCQ may have been expected as specific measures, by design, typically have very strong content validity for a specific disease or population. It is generally accepted that when true change occurs in the setting of a clinical trial, disease-specific measures are more responsive to this change as compared to generic measures of HRQL . They arThe KCCQ, for example, specifically focuses on the impact of dyspnea, a prominent complaint for people with heart failure. In the RAND12, dyspnea could be captured, but only in much broader terms under the domain of physical functioning. Thus, disease-specific measures may be more sensitive and responsive to within-patient change as compared to generic measures . This chWhile our data would suggest that the use of a disease-specific measure, like the KCCQ, may provide the best opportunity to capture small but highly relevant clinical changes in heart failure patients, not all changes in HRQL may be captured with the use of a disease-specific measure, as often the overall effects of a new treatment may not be fully known. For example, we were intrigued by the relative performance of the physical and mental health summary scores of the RAND12. Although heart failure is often perceived largely as a physical disease, the RAND12 PCS Score performed very poorly compared to the other HRQL measures. The reason for the lower responsiveness of the RAND12 PCS is not known but may be related to the underlying health status of the study population. RAND12 PCS scores were, on average, 1.5 standard deviations below the standardized US population mean at baseline indicating that the subjects had significant physical deficits (Table Also of note was that the relative responsiveness of the HRQL measures depended on the direction of clinical change. Overall, the HRQL measures were more responsive to improved clinical status as compared to deteriorating clinical status. This may be related to the fact that heart failure patients in this study were quite severely affected by their disease and had substantial deficits in their HRQL. As a result, HRQL measures may be susceptible to 'floor effects' in this population, which may limit their ability to capture deterioration in clinical status. The observation that no patient deteriorated by 2 NYHA classes further supports this hypothesis. Thus, not only can the responsiveness indices and external criterion standards influence instrument responsiveness, but also it is important to consider the population studied.Irrespective of the scope of the HRQL measure or the direction of clinical change, the responsiveness of a particular measure may also be influenced by the responsiveness index used. Although the responsiveness indices used in this study provided similar rankings, differences did exist among the responsiveness indices when the generic HRQL measures were concerned. In this study, four commonly utilized responsiveness indices were used ,27. TerwAlthough most indices use the mean change in HRQL over time, there are significant differences in how the standard deviations or variability in the data is used in the calculation. For example, the GRS was calculated using the standard deviation of the change scores among subjects who are clinically stable, whereas the SRM uses the standard deviation of the change scores. It is therefore possible that significant differences could exist in the variability in the selected subgroups, resulting in differences in the perceived responsiveness of the HRQL measure depending upon the responsiveness index chosen.true clinical change in this population [Our results and interpretation should be considered in light of several potential limitations. First, as discussed, the ability to identify patients who truly changed during the follow-up period was subjective, as no 'gold standard' exists for patients with heart failure. We did apply, however, the NYHA classification system, physician global rating of change assessment, and 6 MW tests, which are well validated and common methods to identify change in clinical status in patients with heart failure ,17,18. Fpulation . Second,pulation .With these limitations in mind, we believe this study highlights the importance of considering the measurement properties and instrument content in selecting HRQL measures for clinical trials. It is important to have a measure capable of detecting small but highly relevant and important changes in HRQL, especially when the HRQL outcome of interest represents the primary outcome or main secondary outcome of the trial. Furthermore, in the design of a clinical trial, researchers must be confident that the HRQL measure is responsive to the minimal importance difference that was hypothesized during the study design. The sample size required and power of the study will be directly related to the minimal importance difference that the researchers wish to detect. However, while disease specific measure may be considered as the first choice for a primary HRQL outcome, a combination with a generic HRQL measure may still be desirable to fully assess HRQL outcomes in clinical trial settings. Further, if the therapy under consideration will be evaluated under a cost-effectiveness framework, it would be desirable to include a measure compatible with that framework, such as a utility-based measure .We found the disease specific measure, the KCCQ, was the most responsive HRQL measure assessing change over a 6-week period, although generic measures provide information for which the KCCQ is not suitable. We noted that the responsiveness of generic HRQL measure may be affected by the responsiveness index used, as well as the selection of the external criterion to identify patients who have clinically change or remained stable.Dr. Spertus owns the copyright to the KCCQ. While he assisted in the review of the manuscript and was responsible for the original study, he did not design these analyses nor dictate the interpretation of the results. Otherwise, the authors have no conflicts of interest, including specific financial interests, non-financial interests, relationships, and affiliations relevant to the subject matter or materials discussed in the manuscript.DTE and JAJ participated in the conception and design of the study, analysis, and interpretation of the data, drafting of the manuscript, and revising it critically for important intellectual content. KJL participated in the analysis and interpretation of the data and revising the manuscript for critically important intellectual content. JAS participated in the conception and design of the study, acquisition of data, interpretation of the data, and revising the manuscript for critically important intellectual content. All authors read and approved the final manuscript."]}
-{"representative": "Whether responsiveness represents a measurement property of health-related quality of life (HRQL) instruments that is distinct from reliability and validity is an issue of debate. We addressed the claims of a recent study, which suggested that investigators could rely on internal consistency to reflect instrument responsiveness.516 patients with chronic obstructive pulmonary disease or knee injury participating in four longitudinal studies completed generic and disease-specific HRQL questionnaires before and after an intervention that impacted on HRQL. We used Pearson correlation coefficients and linear regression to assess the relationship between internal consistency reliability , instrument type (generic and disease-specific) and responsiveness .2 = 0.01) whereas the type of instrument was a strong predictor of the SRM . In multivariable models applied to individual studies Cronbach's alpha consistently failed to predict SRMs  whereas the type of instrument did predict SRMs .Mean Cronbach's alpha was 0.83 (SD 0.08) and mean SRM was 0.59 (SD 0.33). The correlation between Cronbach's alpha and SRMs was 0.10 (95% CI -0.12 to 0.32) across all studies. Cronbach's alpha alone did not explain variability in SRMs (p = 0.59, rInvestigators must look to data other than internal consistency reliability to select a responsive instrument for use as an outcome in clinical trials. Health-related quality of life (HRQL) instruments should demonstrate adequate test-retest reliability, cross-sectional and longitudinal validity before investigators use them to assess outcomes in research studies. Whether responsiveness, the ability of an instrument to detect change in HRQL when change occurs, is a measurement property distinct from reliability and validity remains, however, controversial -4.Lindeboom et al. purportedly tested the assumption that responsiveness is not a distinct measurement property, but is embodied in internal consistency reliability . To inveThe first conceptual problem with the approach Lindeboom et al. chose is that they looked at the correlation of internal consistency reliability and responsiveness within single studies and instruments only. However, this approach does not take into account that responsiveness depends on the type of an intervention while internal consistency reliability does not. Most HRQL measures may be very reliable, but internal consistency reliability has nothing to do with the therapy that is producing the change. In contrast, if an intervention targets aspects of HRQL that are specifically covered by a disease-specific instrument, for example, responsiveness is likely to be high. If the effect of another intervention targeting aspects other than those covered by the instrument, responsiveness will be lower. Thus the within study approach does not take into account that responsiveness is not a fixed measurement property.Another important issue to consider is the influence of other determinants of an instrument's responsiveness such as the type of instrument, generic or disease-specific. There is ample evidence that responsiveness depends on the type of instrument. -9 LindebFinally, if the within instrument approach with step-wise deconstruction of domains is used, one would expect step-wise decreases of internal consistency reliability, responsiveness and other measurement properties such as cross-sectional validity for the following reasons. Internal consistency reliability is reduced when the items contributing most to internal consistency reliability are removed because the error term in the denominator increases. For the same reason, responsiveness deteriorates if the number of items is decreased. Thus itHaving considered the methodological challenges and constraints above, we analysed the relationship between internal consistency reliability and responsiveness of entire domains across different instruments and studies using data from several of our previous studies.A priori we defined the following eligibility criteria to ensure an unbiased selection of datasets as possible and to ensure that it was theoretically possible to detect a correlation between internal consistency reliability and responsiveness if one existed. We applied the following criteria:1. Studies must have longitudinal follow-up with a baseline assessment and at least one follow-up assessment completed by the CLARITY research group  within the last five years.2. Studies must have investigated an intervention of established effectiveness that induces changes in HRQL.3. Studies must include \u2265 2 multi-item HRQL instruments that allow calculation of Cronbach's alpha and instruments within a study must have different degrees of responsiveness (e.g. generic versus disease-specific) to ensure variability in responsiveness. We expected variability in Cronbach's alpha to be limited to values \u2265 0.60 because only those are generally accepted to represent sufficient internal consistency reliability [We calculated Cronbach's alpha using baseline scores for each domain of each HRQL instrument or for the total instrument if domains did not exist. Similarly, for each domain or for a total score we calculated SRMs (change score divided by standard deviation of change score).We calculated the correlation between Cronbach's alpha and the corresponding SRM using Pearson correlation coefficients across all studies and for each study separately. We then built linear regression models with the SRM as the dependent variable and Cronbach's alpha as the independent variable. Since the type of instrument (generic or disease-specific) affects the SRM -9, we inThe following four studies met the eligibility criteria:This prospective study measured HRQL in 85 patients with chronic obstructive pulmonary disease (COPD) before and after participation in Canadian inpatient respiratory rehabilitation programs similar to many inpatient programs worldwide . All patThis was a prospective randomised study of 177 patients with COPD before and after respiratory rehabilitation in Canada and the United States. We randomised patients to complete either the interviewer or self-administered CRQ ,15. All This prospective study enrolled 71 patients with COPD following a respiratory rehabilitation program at four cites in Switzerland, Germany and Austria. We also randomised patients to complete either the interviewer or self-administered CRQ as in study 2 ,15 and aThis prospective study enrolled patients undergoing anterior crucial ligament reconstruction  and knee arthroscopy  to determine their ability to recall pre-operative quality of life and functional status. Patients completed the disease-specific Anterior Crucial Ligament Quality Of Life questionnaire (ACL-QOL)  . In contrast, an analysis that included the type of instrument showed that the generic versus specific categorisation predicted responsiveness . Analysing the studies separately showed similar results  and the consistency of results across these studies and populations enhances the generalizability of our study. Replication in other populations would further strengthen our conclusions.Our study demonstrates that internal consistency reliability is a poor predictor of responsiveness and that both conceptual and statistical evidence exists to support the argument that they are distinct measurement properties of evaluative instruments.MAP, DB, GHG and HJS designed the study and wrote the study protocol. MAP, GHG, HJS and DB collected the data. MAP, DB and DHA performed the statistical analysis. MAP drafted and DB, GHG, DHA and HJS critically revised the manuscript. All authors read and approved the final manuscript.", "texts": ["Whether responsiveness represents a measurement property of health-related quality of life (HRQL) instruments that is distinct from reliability and validity is an issue of debate. We addressed the claims of a recent study, which suggested that investigators could rely on internal consistency to reflect instrument responsiveness.516 patients with chronic obstructive pulmonary disease or knee injury participating in four longitudinal studies completed generic and disease-specific HRQL questionnaires before and after an intervention that impacted on HRQL. We used Pearson correlation coefficients and linear regression to assess the relationship between internal consistency reliability , instrument type (generic and disease-specific) and responsiveness .2 = 0.01) whereas the type of instrument was a strong predictor of the SRM . In multivariable models applied to individual studies Cronbach's alpha consistently failed to predict SRMs  whereas the type of instrument did predict SRMs .Mean Cronbach's alpha was 0.83 (SD 0.08) and mean SRM was 0.59 (SD 0.33). The correlation between Cronbach's alpha and SRMs was 0.10 (95% CI -0.12 to 0.32) across all studies. Cronbach's alpha alone did not explain variability in SRMs (p = 0.59, rInvestigators must look to data other than internal consistency reliability to select a responsive instrument for use as an outcome in clinical trials. Health-related quality of life (HRQL) instruments should demonstrate adequate test-retest reliability, cross-sectional and longitudinal validity before investigators use them to assess outcomes in research studies. Whether responsiveness, the ability of an instrument to detect change in HRQL when change occurs, is a measurement property distinct from reliability and validity remains, however, controversial -4.Lindeboom et al. purportedly tested the assumption that responsiveness is not a distinct measurement property, but is embodied in internal consistency reliability . To inveThe first conceptual problem with the approach Lindeboom et al. chose is that they looked at the correlation of internal consistency reliability and responsiveness within single studies and instruments only. However, this approach does not take into account that responsiveness depends on the type of an intervention while internal consistency reliability does not. Most HRQL measures may be very reliable, but internal consistency reliability has nothing to do with the therapy that is producing the change. In contrast, if an intervention targets aspects of HRQL that are specifically covered by a disease-specific instrument, for example, responsiveness is likely to be high. If the effect of another intervention targeting aspects other than those covered by the instrument, responsiveness will be lower. Thus the within study approach does not take into account that responsiveness is not a fixed measurement property.Another important issue to consider is the influence of other determinants of an instrument's responsiveness such as the type of instrument, generic or disease-specific. There is ample evidence that responsiveness depends on the type of instrument. -9 LindebFinally, if the within instrument approach with step-wise deconstruction of domains is used, one would expect step-wise decreases of internal consistency reliability, responsiveness and other measurement properties such as cross-sectional validity for the following reasons. Internal consistency reliability is reduced when the items contributing most to internal consistency reliability are removed because the error term in the denominator increases. For the same reason, responsiveness deteriorates if the number of items is decreased. Thus itHaving considered the methodological challenges and constraints above, we analysed the relationship between internal consistency reliability and responsiveness of entire domains across different instruments and studies using data from several of our previous studies.A priori we defined the following eligibility criteria to ensure an unbiased selection of datasets as possible and to ensure that it was theoretically possible to detect a correlation between internal consistency reliability and responsiveness if one existed. We applied the following criteria:1. Studies must have longitudinal follow-up with a baseline assessment and at least one follow-up assessment completed by the CLARITY research group  within the last five years.2. Studies must have investigated an intervention of established effectiveness that induces changes in HRQL.3. Studies must include \u2265 2 multi-item HRQL instruments that allow calculation of Cronbach's alpha and instruments within a study must have different degrees of responsiveness (e.g. generic versus disease-specific) to ensure variability in responsiveness. We expected variability in Cronbach's alpha to be limited to values \u2265 0.60 because only those are generally accepted to represent sufficient internal consistency reliability [We calculated Cronbach's alpha using baseline scores for each domain of each HRQL instrument or for the total instrument if domains did not exist. Similarly, for each domain or for a total score we calculated SRMs (change score divided by standard deviation of change score).We calculated the correlation between Cronbach's alpha and the corresponding SRM using Pearson correlation coefficients across all studies and for each study separately. We then built linear regression models with the SRM as the dependent variable and Cronbach's alpha as the independent variable. Since the type of instrument (generic or disease-specific) affects the SRM -9, we inThe following four studies met the eligibility criteria:This prospective study measured HRQL in 85 patients with chronic obstructive pulmonary disease (COPD) before and after participation in Canadian inpatient respiratory rehabilitation programs similar to many inpatient programs worldwide . All patThis was a prospective randomised study of 177 patients with COPD before and after respiratory rehabilitation in Canada and the United States. We randomised patients to complete either the interviewer or self-administered CRQ ,15. All This prospective study enrolled 71 patients with COPD following a respiratory rehabilitation program at four cites in Switzerland, Germany and Austria. We also randomised patients to complete either the interviewer or self-administered CRQ as in study 2 ,15 and aThis prospective study enrolled patients undergoing anterior crucial ligament reconstruction  and knee arthroscopy  to determine their ability to recall pre-operative quality of life and functional status. Patients completed the disease-specific Anterior Crucial Ligament Quality Of Life questionnaire (ACL-QOL)  . In contrast, an analysis that included the type of instrument showed that the generic versus specific categorisation predicted responsiveness . Analysing the studies separately showed similar results  and the consistency of results across these studies and populations enhances the generalizability of our study. Replication in other populations would further strengthen our conclusions.Our study demonstrates that internal consistency reliability is a poor predictor of responsiveness and that both conceptual and statistical evidence exists to support the argument that they are distinct measurement properties of evaluative instruments.MAP, DB, GHG and HJS designed the study and wrote the study protocol. MAP, GHG, HJS and DB collected the data. MAP, DB and DHA performed the statistical analysis. MAP drafted and DB, GHG, DHA and HJS critically revised the manuscript. All authors read and approved the final manuscript."]}
-{"representative": "This article deals with the problem of interpreting health-related quality of life (HRQL) outcomes in clinical trials. First, we will briefly describe how dichotomization and item response theory can facilitate interpretation. Based on examples from the medical literature for the interpretation of HRQL scores we will show that dichotomies may help clinicians understand information provided by HRQL instruments in RCTs. They can choose thresholds to calculate proportions of patients benefiting based on absolute scores or change scores. For example, clinicians interpreting clinical trial results could consider the difference in the proportion of patients who achieve a mean score of 50 before and after an intervention on a scale from 1 to 100. For the change score approach, they could consider the proportion of patients who have changed by a score of 5 or more. Finally, they can calculate the proportion of patients benefiting and transform these numbers into a number needed to treat or natural frequencies. Second, we will describe in more detail an approach to the interpretation of HRQL scores based on the minimal important difference (MID) and proportions. The MID is the smallest difference in score in the outcome of interest that informed patients or informed proxies perceive as important, either beneficial or harmful, and that would lead the patient or clinician to consider a change in the management. Any change in management will depend on the downsides, including cost and inconvenience, associated with the intervention. Investigators can help with the interpretation of HRQL scores by determining the MID of an HRQL instrument and provide mean differences in relation to the MID. For instance, for an MID of 0.5 on a seven point scale investigators could provide the mean change on the instrument as well as the proportion of patients with scores greater than the MID. Thus, there are several steps investigators can take to facilitate this process to help bringing HRQL information closer to the bedside. This article deals with the problem of interpreting health-related quality of life (HRQL) outcomes from clinical trials. The alternative titles that we had in mind for this paper exemplify the problem: \"The great merit of simple-minded dichotomies for clinicians\" or even more provocative, \"The great merit of dichotomies for simple-minded clinicians.\" These possible titles reflect the fact that clinicians have difficulties understanding quality-of-life measures because of the numerous available instruments and their diversity in items, response options, lack of familiar units, and approaches to aggregation. We propose that dichotomies can help with understanding HRQL instruments.In this article we will offer some possible strategies based on examples. First, we will briefly describe how dichotomization and Rasch analysis, a particular form of analysis according to item response theory (IRT), can facilitate interpretation ,2. We wiSecond, we will suggest an approach to the interpretation of HRQL scores based on the minimal important difference (MID) -6. The MTo highlight the problem, we describe an example of the failure to present HRQL in a transparent and understandable way to clinicians. In a trial including 553 patients with psoriasis, a group of investigators evaluated the impact on HRQL of alefacept, a fusion protein that inhibits T-cell activation and promotes apoptosis of CD2+ T cells that play a role in psoriasis, on HRQL . They usIn the authors' opinion, the data from the SF-36 survey confirmed that alefacept had no negative impact on general quality of life, because the SF-36 did not show important changes. The authors then reached the conclusion that alefacept improved quality of life in patients with chronic plaque psoriasis and maintained this benefit for at least 12 weeks following cessation of treatment. This presentation of HRQL information is quite typical for trials of this sort . Unfortunately, most clinicians will have difficulty understanding what an improvement of 4.4 vs 1.8 or 3.4 vs 1.4 means to their patients. Does it mean that patients do feel substantially better or have noticed an important change, or does it mean that the improvement was small, not noticeable for patients, and statistically significant only because of the large sample size? The answer to this question is not clear because the authors do not provide satisfactory guidance as to how important these score changes are. However, the example should clarify one of the fundamental problems of HRQL data: the failure to present the data in interpretable and transparent manner. In the following paragraphs we will present possible solutions to these problems.Possible solutions to the problem of clinicians' lack of familiarity with HRQL scores exist. To focus on what is called the content-based interpretation of results proposed by Ware and Keller, let us take a look at the distribution of the SF-36 scores of the Physical Function scale based on the Medical Outcomes Study, a large study in the U.S. . Figure Figure Another example of the use of content-based interpretation of HRQL measures is the use of the visual function 14 index (VF14) . This inFigure Thus, the important contribution of IRT to the interpretation of HRQL scores is that it provides clinicians and patients with guidance what they can expect from respondents based on the entire score on a multi-item instrument. However, the IRT approach is restricted to instruments with a clear gradient of the level of difficulty across the instruments' items. It cannot be applied to situations when the response options there is no clear gradient in the severity of limitation or impairment associated with the items. The VF-14 works well in this regard because each item is more challenging than all lower items. Being able to drive at night, for instance, requires much better visual acuity than recognizing people even when they are close. The IRT approach to interpretability would not work for instruments in which this clear ordering does not exist.Different methods to determine the MID exist. Anchor-based methods rely on examining the associations between scores on the instrument that is under investigation and an anchor, an independent measure of HRQL that clinicians can easily interpret ,12. For However, two questions come to mind. First, does a group mean change of 0.6 in response to a treatment on the 7-point scale for the CRQ, AQLQ, or CHQ mean that all patients benefit? Second, does a group mean change of 0.3 mean that no patient benefits? In the following sections we will provide examples that will help answer these questions.Let us examine the Rankin stroke scale, an instrument widely used to measure dysfunction in patients who experienced a stroke . The RanAnother example is that of the use of neurolytic coeliac-plexus block (NCPB) versus systemic analgesic therapy (SAT) alone in unresectable pancreatic cancer . The autWe will now examine examples of how clinicians can interpret change score differences. Figure Figure The vertical line shows the hypothetical MID for patients participating in this trial. A certain proportion of patients in the control group [labeled P(Imp|C)] show improvement greater than the MID. In the treatment group, a larger proportion [P(Imp|T)] of patients show improvement greater than the MID. The difference between these two proportions [P(Imp|T) - P(Imp|C)] is the proportion of patients who improved above the MID after accounting for placebo or control group effects.From this proportion one can easily calculate a risk differences or NNT. Norman et al showed a consistent relation between effect size and NNTs across a wide range of plausible specifications of the MID . Table 1Figure As we described above, the MID for the CRQ on each of the four HRQL domains is 0.5. This example shows results from a randomized controlled trial comparing intensive respiratory rehabilitation to conventional care in patients with moderate to severe chronic respiratory disease (COPD) . The linThese examples of the interpretation of HRQL scores demonstrate that dichotomies may help the understanding of information provided by HRQL instruments in RCTs. There are several steps investigators can take to facilitate this process. They can choose thresholds and dichotomize responses on HRQL based on absolute scores or change scores to facilitate interpretation. Second, they can determine the MID of an HRQL instrument and provide mean differences and relate these to the MID. Finally, they can use the dichotomized responses and the MID to calculate the proportion of patients benefiting and transform these numbers into NNTs and natural frequencies. Simple dichotomies may bring HRQL information closer to the bedside.HJS and GG are authors of the CRQ. McMaster University and a research account used by HJS and GG receive licensing fees from the use of the CRQ.HJS prepared the first draft of this manuscript, and GG and EAA revised it critically and made suggestions for improvements. GG had the idea for the presentation on which this manuscript is based, HS made suggestions for improving the presentation.", "texts": ["This article deals with the problem of interpreting health-related quality of life (HRQL) outcomes in clinical trials. First, we will briefly describe how dichotomization and item response theory can facilitate interpretation. Based on examples from the medical literature for the interpretation of HRQL scores we will show that dichotomies may help clinicians understand information provided by HRQL instruments in RCTs. They can choose thresholds to calculate proportions of patients benefiting based on absolute scores or change scores. For example, clinicians interpreting clinical trial results could consider the difference in the proportion of patients who achieve a mean score of 50 before and after an intervention on a scale from 1 to 100. For the change score approach, they could consider the proportion of patients who have changed by a score of 5 or more. Finally, they can calculate the proportion of patients benefiting and transform these numbers into a number needed to treat or natural frequencies. Second, we will describe in more detail an approach to the interpretation of HRQL scores based on the minimal important difference (MID) and proportions. The MID is the smallest difference in score in the outcome of interest that informed patients or informed proxies perceive as important, either beneficial or harmful, and that would lead the patient or clinician to consider a change in the management. Any change in management will depend on the downsides, including cost and inconvenience, associated with the intervention. Investigators can help with the interpretation of HRQL scores by determining the MID of an HRQL instrument and provide mean differences in relation to the MID. For instance, for an MID of 0.5 on a seven point scale investigators could provide the mean change on the instrument as well as the proportion of patients with scores greater than the MID. Thus, there are several steps investigators can take to facilitate this process to help bringing HRQL information closer to the bedside. This article deals with the problem of interpreting health-related quality of life (HRQL) outcomes from clinical trials. The alternative titles that we had in mind for this paper exemplify the problem: \"The great merit of simple-minded dichotomies for clinicians\" or even more provocative, \"The great merit of dichotomies for simple-minded clinicians.\" These possible titles reflect the fact that clinicians have difficulties understanding quality-of-life measures because of the numerous available instruments and their diversity in items, response options, lack of familiar units, and approaches to aggregation. We propose that dichotomies can help with understanding HRQL instruments.In this article we will offer some possible strategies based on examples. First, we will briefly describe how dichotomization and Rasch analysis, a particular form of analysis according to item response theory (IRT), can facilitate interpretation ,2. We wiSecond, we will suggest an approach to the interpretation of HRQL scores based on the minimal important difference (MID) -6. The MTo highlight the problem, we describe an example of the failure to present HRQL in a transparent and understandable way to clinicians. In a trial including 553 patients with psoriasis, a group of investigators evaluated the impact on HRQL of alefacept, a fusion protein that inhibits T-cell activation and promotes apoptosis of CD2+ T cells that play a role in psoriasis, on HRQL . They usIn the authors' opinion, the data from the SF-36 survey confirmed that alefacept had no negative impact on general quality of life, because the SF-36 did not show important changes. The authors then reached the conclusion that alefacept improved quality of life in patients with chronic plaque psoriasis and maintained this benefit for at least 12 weeks following cessation of treatment. This presentation of HRQL information is quite typical for trials of this sort . Unfortunately, most clinicians will have difficulty understanding what an improvement of 4.4 vs 1.8 or 3.4 vs 1.4 means to their patients. Does it mean that patients do feel substantially better or have noticed an important change, or does it mean that the improvement was small, not noticeable for patients, and statistically significant only because of the large sample size? The answer to this question is not clear because the authors do not provide satisfactory guidance as to how important these score changes are. However, the example should clarify one of the fundamental problems of HRQL data: the failure to present the data in interpretable and transparent manner. In the following paragraphs we will present possible solutions to these problems.Possible solutions to the problem of clinicians' lack of familiarity with HRQL scores exist. To focus on what is called the content-based interpretation of results proposed by Ware and Keller, let us take a look at the distribution of the SF-36 scores of the Physical Function scale based on the Medical Outcomes Study, a large study in the U.S. . Figure Figure Another example of the use of content-based interpretation of HRQL measures is the use of the visual function 14 index (VF14) . This inFigure Thus, the important contribution of IRT to the interpretation of HRQL scores is that it provides clinicians and patients with guidance what they can expect from respondents based on the entire score on a multi-item instrument. However, the IRT approach is restricted to instruments with a clear gradient of the level of difficulty across the instruments' items. It cannot be applied to situations when the response options there is no clear gradient in the severity of limitation or impairment associated with the items. The VF-14 works well in this regard because each item is more challenging than all lower items. Being able to drive at night, for instance, requires much better visual acuity than recognizing people even when they are close. The IRT approach to interpretability would not work for instruments in which this clear ordering does not exist.Different methods to determine the MID exist. Anchor-based methods rely on examining the associations between scores on the instrument that is under investigation and an anchor, an independent measure of HRQL that clinicians can easily interpret ,12. For However, two questions come to mind. First, does a group mean change of 0.6 in response to a treatment on the 7-point scale for the CRQ, AQLQ, or CHQ mean that all patients benefit? Second, does a group mean change of 0.3 mean that no patient benefits? In the following sections we will provide examples that will help answer these questions.Let us examine the Rankin stroke scale, an instrument widely used to measure dysfunction in patients who experienced a stroke . The RanAnother example is that of the use of neurolytic coeliac-plexus block (NCPB) versus systemic analgesic therapy (SAT) alone in unresectable pancreatic cancer . The autWe will now examine examples of how clinicians can interpret change score differences. Figure Figure The vertical line shows the hypothetical MID for patients participating in this trial. A certain proportion of patients in the control group [labeled P(Imp|C)] show improvement greater than the MID. In the treatment group, a larger proportion [P(Imp|T)] of patients show improvement greater than the MID. The difference between these two proportions [P(Imp|T) - P(Imp|C)] is the proportion of patients who improved above the MID after accounting for placebo or control group effects.From this proportion one can easily calculate a risk differences or NNT. Norman et al showed a consistent relation between effect size and NNTs across a wide range of plausible specifications of the MID . Table 1Figure As we described above, the MID for the CRQ on each of the four HRQL domains is 0.5. This example shows results from a randomized controlled trial comparing intensive respiratory rehabilitation to conventional care in patients with moderate to severe chronic respiratory disease (COPD) . The linThese examples of the interpretation of HRQL scores demonstrate that dichotomies may help the understanding of information provided by HRQL instruments in RCTs. There are several steps investigators can take to facilitate this process. They can choose thresholds and dichotomize responses on HRQL based on absolute scores or change scores to facilitate interpretation. Second, they can determine the MID of an HRQL instrument and provide mean differences and relate these to the MID. Finally, they can use the dichotomized responses and the MID to calculate the proportion of patients benefiting and transform these numbers into NNTs and natural frequencies. Simple dichotomies may bring HRQL information closer to the bedside.HJS and GG are authors of the CRQ. McMaster University and a research account used by HJS and GG receive licensing fees from the use of the CRQ.HJS prepared the first draft of this manuscript, and GG and EAA revised it critically and made suggestions for improvements. GG had the idea for the presentation on which this manuscript is based, HS made suggestions for improving the presentation."]}
-{"representative": "There is at present a lack of knowledge of time trends in health related quality of life (HRQL) in common patients with coronary artery disease (CAD) treated in ordinary care. The objective of this study is to assess and compare time trends of health related quality of life (HRQL) and chest pain in patients with coronary artery disease.253 consecutive CAD patients in Stockholm County, Sweden \u2013 197 males/56 females; 60 \u00b1 8 years \u2013 were followed during two years. Perceived chest pain symptoms and three global assessments of HRQL were assessed at baseline, after one and after two years. EuroQol-5 dimension (EQ-5D) with a predefined focus on function and symptoms; the broader tapping global estimates of HRQL; EuroQol VAS (EQ-VAS) and Cardiac Health Profile (CHP) were used. Chest pain was ranked according to Canadian Cardiovascular Society (CCS). Change in HRQL was analysed by a repeated measurements ANOVA and chest pain symptoms were analysed by Friedman non-parametric ANOVA.Perceived chest pain decreased during the two years (p < 0.00022); CCS 0: 41\u201351%; CCS 1: 19\u201315%; CCS 2: 31\u201327%; CCS 3: 5\u20134% and CCS 4: 4\u20132%. By contrast, HRQL did not change: EQ-5D: 0.76 (CI 0.73\u20130.79) -0.78 (CI 0.75\u20130.81), EQ-VAS: 0.68 (CI 0.66\u20130.71)-0.68 (CI 0.65\u20130.71) and CHP: 0.66 (CI 0.64\u20130.69) -0.66 (CI 0.64\u20130.69).HRQL did not increase despite a reduction in the severity of chest pain during two years. This implies that the major part of HRQL in these consecutive ordinary patients with CAD is unresponsive to change in chest pain symptoms. Disease specific and all-cause mortality in patients with coronary artery disease (CAD) have declined during the last decades . PatientWe identified a cohort of consecutive patients with CAD and assessed chest pain symptoms and perceived quality of life during two years. This was done in connection with a randomised study showing that participatory learning of secondary prevention for general practitioners decreased cholesterol levels in their patients with coronary artery disease .The Department of Medicine at S\u00f6dert\u00e4lje Hospital, located in the southernmost part of Stockholm County, Sweden, provides planned and emergency health care for acute and elective cardiac patients in a catchments area of approximately 95 000 habitants. All in- and outpatients with an age less or equal to 70 years who had visited the department during the preceding year, due to symptoms and signs of CAD (ICD-9 code 410\u2013414) were identified (1995). The age limit was chosen due to lack of secondary preventive studies in older patients at time of recruitment. 429 patient records were investigated. 106 patients were excluded, the majority because they did not fulfil the criteria of CAD and a few because of other life threatening disease or because they lived outside the catchments area. 68 of the remaining 323 patients fulfilling the criteria for inclusion refused to participate.Criteria for a confirmed diagnosis of CAD in the patient record were:I: A diagnosis of angina pectoris, either by objective criteria based on coronary angiography, or a pathologic exercise- or stress-test, or a clinical assessment based on typical angina symptoms at exercise with or without ECG-evidence of possible or definite ischemia.II: A diagnosis of myocardial infarction based on either WHO-criteria  or on unHypertension was considered to be present if systolic blood pressure was > 140 mm Hg, if diastolic blood pressure was > 90 mm Hg or if antihypertensive medication was used. Diabetes mellitus was defined as fasting plasma glucose of \u2265 7.0 mmol/l, a self-reported history of diabetes mellitus or treatment for diabetes.The patients were examined and they answered questionnaires including symptoms of angina pectoris and HRQL assessments at inclusion, after one respectively after two years. Baseline characteristics are given in Table The HRQL-questionnaires were self-completed. The Swedish versions of the CHP- and EQ-instruments were used. One research nurse performed all interviews and physical examinations at the department. She also handled all case report forms. All participating patients gave written informed consent. The study complies with the Declaration of Helsinki and was approved by the ethics committee of Karolinska Institutet at Huddinge University Hospital.The patients ranked existence and degree of current angina symptoms according to the Canadian Cardiovascular Society classification (CCS) 0\u20134  at baselThe definition of HRQL in this study is that 'quality of life' in clinical medicine represents the functional effect of an illness and its consequent therapy upon a patient, as perceived by the patient .The Cardiac health profile questionnaire (CHP) is a disease-specific HRQL questionnaire specially designed for respondents with CAD. CHP assesses the HRQL in a broad perspective. The questionnaire includes questions about physical function/general health, emotional, social and cognitive function. The 16 items in the CHP questionnaire (English version) are shown in Table Multivariate explorative factor analytical methods were used to identify the underlying structure as described in a previous publication . Four inThe generic HRQL questionnaires EuroQol-5 Dimensions (EQ-5D) self-classifier and EuroQol-VAS (EQ-VAS) were used to test the robustness of the analysis of time trends of HRQL as measured by the CHP questionnaire. In the EQ-5D self classifier the respondents classified their own health status in five aspects \u2013 mobility, self-care, usual activities, pain/discomfort and anxiety/depression into one of three levels \u2013 no problems, moderate problems and severe problems ,15. EachIn the EQ-VAS method the respondent marks present HRQL on a 20 cm vertical measurement scale with labelled anchors 'dead' (0) and 'full health' (100). The individual numbers marked on the scale were divided by 100 in order to obtain EQ-VAS scores between 0 and 1. Both EQ5D methods are easy and rapid generic instruments, well validated and found to be reliable in different cultures and in different diseases including a new validation study in patients after myocardial infarction ,20.The main outcome variable in the present study is change in HRQL and chest pain (CCS) over time. HRQL was analysed by a repeated measurements ANOVA and chest pain symptoms were analysed by Friedman non-parametric ANOVA. The underlying structure of HRQL as assessed by CHP was explored by the factor analytic multivariate technique, principal component (PC) analysis. The 16 item variables were reduced into principal components, i.e. to avoid an influence of multicollinearities and to find orthogonal (independent) factors explaining the variance in the sample ,22. AnotThe characteristics of the study population at baseline are described in Table The prevalence and severity of chest pain symptoms \u2013 according to CCS grade \u2013 decreased during the two study years as shown in Table An analysis of co-variation between chest pain symptoms and HRQL showed significant correlations between CCS and all three global assessments of HRQL at all three time points, Table A similar analysis of the four independent sub-domains \u2013 principal components \u2013 showed a correlation between chest pain symptoms and the physical/general health domain at all three time points (p = 0.000000). By contrast, there was no correlation between cognitive function respectively social function domains and chest pain symptoms at any of the time points Table . Figure The prevalence and severity of chest pain symptoms decreased during two years of follow-up as assessed by CCS grade in this unselected cohort of patients with CAD. However, no change was found in global HRQL as assessed by three different HRQL instruments despite the symptom reduction. This indicates that an important part of HRQL in such patients is unresponsive to change in the existence or degree of chest pain. Several explanations to this could be discussed. One possible confounder could be a change in non-cardiac morbidity. However, a separate analysis excluding patients contracting co-morbidity during the study did not change the results. The reason for the unresponsiveness could be the multidimensional construct of HRQL. As shown in table We have in a previous paper found that perceived cognitive function explains the major part of HRQL in this cohort . HoweverA limitation of our study is that that we just assessed perceived function. However, the main aim was to evaluate time trends in illness \u2013 both in terms of HRQL and chest pain symptoms \u2013 and not primarily to address a comparison between objective function and subjective perception. Furthermore it is known that the correlation is weak between objectively measured cognitive function and perceived cognitive function .Strength of our study is that HRQL was assessed both by three different global instruments and by the independent sub-domains. The response rate was also high. This should increase the robustness of our analysis and conclusions. Another strength is that this large sample of patients were followed over a good [2-year] period. Furthermore, the cohort was unselected and included both patients with and without present physical symptoms. This should increase the ability to understand the comprehensiveness of different assessment instruments and to analyse a putative co variation of change in HRQL and other estimates over time.The comprehensiveness differs between the three HRQL instruments. EQ-VAS is an individually defined global estimate. The 16 items of the CHP questionnaire taps \u2013 as compared to other frequently used instruments \u2013 a broad perspective of aspects on HRQL. It includes e g questions concerning the ability to select relevant information, and to understand, retain, express and apply knowledge in specific contexts of life. In a previous analysis we showed that questions representing cognitive function explained 43% of the HRQL variation . EQ-5D iThere was a slight but insignificant improvement of HRQL as assessed by EQ-5D . However, the power analysis showed that we could exclude a more clinically relevant improvement in HRQL by 5% or more even in the symptom driven EQ-5D. EQ-5D also showed a better global HRQL by 0.1 (p = 0.0000) than CHP and EQ-VAS. An explanation might be the more narrow scope of EQ-5D tapping mainly physical and emotional aspects of HRQL.It is known that physicians tend to underestimate or fail to recognise functional disabilities that are reported by their patients, especially disabilities related to social activities . The phyA limitation and strength of the present study is of course the unselected sample in concert with the fact that the patients are included from a single geographic area. The study addresses an important issue about responsiveness of HRQL instruments. Our findings of a low sensitivity of the HRQL instruments to change in symptom burden is interesting and challenging both from a clinical and societal perspective. The results should stimulate future research on the complex relations between objectively measured disease and subjectively perceived illness for patients with CAD.The major part of assessed health related quality of life is unresponsive to a decrease in severity of chest pain symptoms in a consecutive cohort of ordinary patients with coronary artery disease. This indicates that a reduction of chest pain symptoms is not sufficient; to improve health related quality of life in patients with coronary artery disease. The dominating dimension of health related quality of life \u2013 cognitive function \u2013 does not differ between patients with or without chest pain symptoms. The low responsiveness of assessed health related quality of life outcome to a change in symptom burden is interesting and challenging both from a clinical and a public health perspective.The author(s) declare that they have no competing interests.PH and AK shared the conception and analysis of the study. AK was responsible for the statistical analysis, drafting and revising of the article. PH and AK shared the hypothesis and design. PH and AK are both guarantators.", "texts": ["There is at present a lack of knowledge of time trends in health related quality of life (HRQL) in common patients with coronary artery disease (CAD) treated in ordinary care. The objective of this study is to assess and compare time trends of health related quality of life (HRQL) and chest pain in patients with coronary artery disease.253 consecutive CAD patients in Stockholm County, Sweden \u2013 197 males/56 females; 60 \u00b1 8 years \u2013 were followed during two years. Perceived chest pain symptoms and three global assessments of HRQL were assessed at baseline, after one and after two years. EuroQol-5 dimension (EQ-5D) with a predefined focus on function and symptoms; the broader tapping global estimates of HRQL; EuroQol VAS (EQ-VAS) and Cardiac Health Profile (CHP) were used. Chest pain was ranked according to Canadian Cardiovascular Society (CCS). Change in HRQL was analysed by a repeated measurements ANOVA and chest pain symptoms were analysed by Friedman non-parametric ANOVA.Perceived chest pain decreased during the two years (p < 0.00022); CCS 0: 41\u201351%; CCS 1: 19\u201315%; CCS 2: 31\u201327%; CCS 3: 5\u20134% and CCS 4: 4\u20132%. By contrast, HRQL did not change: EQ-5D: 0.76 (CI 0.73\u20130.79) -0.78 (CI 0.75\u20130.81), EQ-VAS: 0.68 (CI 0.66\u20130.71)-0.68 (CI 0.65\u20130.71) and CHP: 0.66 (CI 0.64\u20130.69) -0.66 (CI 0.64\u20130.69).HRQL did not increase despite a reduction in the severity of chest pain during two years. This implies that the major part of HRQL in these consecutive ordinary patients with CAD is unresponsive to change in chest pain symptoms. Disease specific and all-cause mortality in patients with coronary artery disease (CAD) have declined during the last decades . PatientWe identified a cohort of consecutive patients with CAD and assessed chest pain symptoms and perceived quality of life during two years. This was done in connection with a randomised study showing that participatory learning of secondary prevention for general practitioners decreased cholesterol levels in their patients with coronary artery disease .The Department of Medicine at S\u00f6dert\u00e4lje Hospital, located in the southernmost part of Stockholm County, Sweden, provides planned and emergency health care for acute and elective cardiac patients in a catchments area of approximately 95 000 habitants. All in- and outpatients with an age less or equal to 70 years who had visited the department during the preceding year, due to symptoms and signs of CAD (ICD-9 code 410\u2013414) were identified (1995). The age limit was chosen due to lack of secondary preventive studies in older patients at time of recruitment. 429 patient records were investigated. 106 patients were excluded, the majority because they did not fulfil the criteria of CAD and a few because of other life threatening disease or because they lived outside the catchments area. 68 of the remaining 323 patients fulfilling the criteria for inclusion refused to participate.Criteria for a confirmed diagnosis of CAD in the patient record were:I: A diagnosis of angina pectoris, either by objective criteria based on coronary angiography, or a pathologic exercise- or stress-test, or a clinical assessment based on typical angina symptoms at exercise with or without ECG-evidence of possible or definite ischemia.II: A diagnosis of myocardial infarction based on either WHO-criteria  or on unHypertension was considered to be present if systolic blood pressure was > 140 mm Hg, if diastolic blood pressure was > 90 mm Hg or if antihypertensive medication was used. Diabetes mellitus was defined as fasting plasma glucose of \u2265 7.0 mmol/l, a self-reported history of diabetes mellitus or treatment for diabetes.The patients were examined and they answered questionnaires including symptoms of angina pectoris and HRQL assessments at inclusion, after one respectively after two years. Baseline characteristics are given in Table The HRQL-questionnaires were self-completed. The Swedish versions of the CHP- and EQ-instruments were used. One research nurse performed all interviews and physical examinations at the department. She also handled all case report forms. All participating patients gave written informed consent. The study complies with the Declaration of Helsinki and was approved by the ethics committee of Karolinska Institutet at Huddinge University Hospital.The patients ranked existence and degree of current angina symptoms according to the Canadian Cardiovascular Society classification (CCS) 0\u20134  at baselThe definition of HRQL in this study is that 'quality of life' in clinical medicine represents the functional effect of an illness and its consequent therapy upon a patient, as perceived by the patient .The Cardiac health profile questionnaire (CHP) is a disease-specific HRQL questionnaire specially designed for respondents with CAD. CHP assesses the HRQL in a broad perspective. The questionnaire includes questions about physical function/general health, emotional, social and cognitive function. The 16 items in the CHP questionnaire (English version) are shown in Table Multivariate explorative factor analytical methods were used to identify the underlying structure as described in a previous publication . Four inThe generic HRQL questionnaires EuroQol-5 Dimensions (EQ-5D) self-classifier and EuroQol-VAS (EQ-VAS) were used to test the robustness of the analysis of time trends of HRQL as measured by the CHP questionnaire. In the EQ-5D self classifier the respondents classified their own health status in five aspects \u2013 mobility, self-care, usual activities, pain/discomfort and anxiety/depression into one of three levels \u2013 no problems, moderate problems and severe problems ,15. EachIn the EQ-VAS method the respondent marks present HRQL on a 20 cm vertical measurement scale with labelled anchors 'dead' (0) and 'full health' (100). The individual numbers marked on the scale were divided by 100 in order to obtain EQ-VAS scores between 0 and 1. Both EQ5D methods are easy and rapid generic instruments, well validated and found to be reliable in different cultures and in different diseases including a new validation study in patients after myocardial infarction ,20.The main outcome variable in the present study is change in HRQL and chest pain (CCS) over time. HRQL was analysed by a repeated measurements ANOVA and chest pain symptoms were analysed by Friedman non-parametric ANOVA. The underlying structure of HRQL as assessed by CHP was explored by the factor analytic multivariate technique, principal component (PC) analysis. The 16 item variables were reduced into principal components, i.e. to avoid an influence of multicollinearities and to find orthogonal (independent) factors explaining the variance in the sample ,22. AnotThe characteristics of the study population at baseline are described in Table The prevalence and severity of chest pain symptoms \u2013 according to CCS grade \u2013 decreased during the two study years as shown in Table An analysis of co-variation between chest pain symptoms and HRQL showed significant correlations between CCS and all three global assessments of HRQL at all three time points, Table A similar analysis of the four independent sub-domains \u2013 principal components \u2013 showed a correlation between chest pain symptoms and the physical/general health domain at all three time points (p = 0.000000). By contrast, there was no correlation between cognitive function respectively social function domains and chest pain symptoms at any of the time points Table . Figure The prevalence and severity of chest pain symptoms decreased during two years of follow-up as assessed by CCS grade in this unselected cohort of patients with CAD. However, no change was found in global HRQL as assessed by three different HRQL instruments despite the symptom reduction. This indicates that an important part of HRQL in such patients is unresponsive to change in the existence or degree of chest pain. Several explanations to this could be discussed. One possible confounder could be a change in non-cardiac morbidity. However, a separate analysis excluding patients contracting co-morbidity during the study did not change the results. The reason for the unresponsiveness could be the multidimensional construct of HRQL. As shown in table We have in a previous paper found that perceived cognitive function explains the major part of HRQL in this cohort . HoweverA limitation of our study is that that we just assessed perceived function. However, the main aim was to evaluate time trends in illness \u2013 both in terms of HRQL and chest pain symptoms \u2013 and not primarily to address a comparison between objective function and subjective perception. Furthermore it is known that the correlation is weak between objectively measured cognitive function and perceived cognitive function .Strength of our study is that HRQL was assessed both by three different global instruments and by the independent sub-domains. The response rate was also high. This should increase the robustness of our analysis and conclusions. Another strength is that this large sample of patients were followed over a good [2-year] period. Furthermore, the cohort was unselected and included both patients with and without present physical symptoms. This should increase the ability to understand the comprehensiveness of different assessment instruments and to analyse a putative co variation of change in HRQL and other estimates over time.The comprehensiveness differs between the three HRQL instruments. EQ-VAS is an individually defined global estimate. The 16 items of the CHP questionnaire taps \u2013 as compared to other frequently used instruments \u2013 a broad perspective of aspects on HRQL. It includes e g questions concerning the ability to select relevant information, and to understand, retain, express and apply knowledge in specific contexts of life. In a previous analysis we showed that questions representing cognitive function explained 43% of the HRQL variation . EQ-5D iThere was a slight but insignificant improvement of HRQL as assessed by EQ-5D . However, the power analysis showed that we could exclude a more clinically relevant improvement in HRQL by 5% or more even in the symptom driven EQ-5D. EQ-5D also showed a better global HRQL by 0.1 (p = 0.0000) than CHP and EQ-VAS. An explanation might be the more narrow scope of EQ-5D tapping mainly physical and emotional aspects of HRQL.It is known that physicians tend to underestimate or fail to recognise functional disabilities that are reported by their patients, especially disabilities related to social activities . The phyA limitation and strength of the present study is of course the unselected sample in concert with the fact that the patients are included from a single geographic area. The study addresses an important issue about responsiveness of HRQL instruments. Our findings of a low sensitivity of the HRQL instruments to change in symptom burden is interesting and challenging both from a clinical and societal perspective. The results should stimulate future research on the complex relations between objectively measured disease and subjectively perceived illness for patients with CAD.The major part of assessed health related quality of life is unresponsive to a decrease in severity of chest pain symptoms in a consecutive cohort of ordinary patients with coronary artery disease. This indicates that a reduction of chest pain symptoms is not sufficient; to improve health related quality of life in patients with coronary artery disease. The dominating dimension of health related quality of life \u2013 cognitive function \u2013 does not differ between patients with or without chest pain symptoms. The low responsiveness of assessed health related quality of life outcome to a change in symptom burden is interesting and challenging both from a clinical and a public health perspective.The author(s) declare that they have no competing interests.PH and AK shared the conception and analysis of the study. AK was responsible for the statistical analysis, drafting and revising of the article. PH and AK shared the hypothesis and design. PH and AK are both guarantators."]}
-{"representative": "Breast hypertrophy is associated with clinically important morbidity. A prospective study was conducted to assess the change in health-related quality of life (HRQL) following breast reduction mammoplasty. This paper describes the measurement properties of each of the HRQL questionnaires used.The reliability, responsiveness, and the construct validity of each HRQL instrument  and Mark 3 (HUI3) and the Breast Reduction Assessment Value and Outcomes (BRAVO) instruments) were assessed. The BRAVO instruments are a set of separate instruments including the Short Form-36 (SF-36), the Multidimensional Body Self Relations Questionnaire Appearance Assessment (MBSRQ-AS), and the Breast Related Symptoms Questionnaire (BRSQ).The HUI2, the HUI3, the MBSRQ-AS, and the breast severity symptom (BSS) score from the BRSQ all demonstrated good test-retest reliability. The SF-36 physical component summary, the MBSRQ-AS, and the BSS score demonstrated high responsiveness. The SF-36 mental component summary and the HUI3 had a moderate effect size and the HUI2 had a small effect size. All of the changes in scales are correlated in the same direction except for the SF-36 physical component summary and the SF-36 mental component summary.All four instruments were found to be reliable and responsive. These instruments can be used in similar clinical settings to evaluate the change in patients' HRQL. Within the last decade the plastic surgical community has been encouraged to use health-related quality of life (HRQL) assessment instruments to report on the efficacy of surgical interventions -5. ThereBreast hypertrophy has been reported by patients to be associated with important burdens in pain and discomfort as well as emotion . EarlierIn a recent Canadian prospective study of patients with a body mass index (BMI) below 27, pre-surgery mammoplasty patients scored lower on the SF-36 compared to normative data and post-surgery these patients achieved scores similar to normative data . AlthougA number of different instruments have been used in previous studies to measure HRQL in patients with breast hypertrophy. In terms of the hierarchy of evidence in surgical studies, the studies which provide the higher strength of evidence are prospective cohort studies which address important patient outcomes. These studies have shown an improvement from pre-operative to post-operative, which have been statistically significant. Our study is similar to the design of some of the earlier prospective cohort studies measuring HRQL in patients with breast hypertrophy ,13-15,18The primary objective of this study is to look at the measurement properties, including the reliability and responsiveness, of each of the four HRQL instruments used. The secondary objective was to assess the concurrent validity of each of the four HRQL instruments.Consecutive patients seen by the senior author (AT) over a period of one-year, with the diagnosis of breast hypertrophy and who obtained government approval for reduction mammoplasty were invited to participate in this prospective study. After signing an informed consent form, patients were asked to complete several questionnaires at each assessment time: (one week (time one) and one day before surgery (time two) and at one month (time three), six months (time four), and 12 months after surgery (time five)). The questionnaires were the HUI -28, and The patients were provided with the questionnaires at their clinic visits and they either completed them while at the clinic or they completed them at home and returned them to the clinic by mail. The patients completed the questionnaires at one week before surgery and at one day before surgery to assess the test-retest reliability of each instrument. The questionnaires were completed at three post-operative time-points to measure change and to assess the stability of change over one-year of follow-up. The Research Ethics Board of McMaster University and St. Joseph's Hospital approved this study.2). Other baseline information collected included self-reported bra cup size, diabetes, history of depression, smoking history, shoulder grooving, shoulder pain, back pain, neck pain, breast pain, intertrigo, and history of headaches.In addition to completing the quality of life instruments (described in detail below), each patient underwent a physical examination and the baseline information was recorded. Demographic information including age, height, and weight was obtained which permitted the calculation of BMI  in clinical trials and other studies -28. The The HUI2 and HUI3 health status classification systems are complementary. Together they provide descriptive measures of ability or disability for health-state attributes, and descriptions of comprehensive health status . The HUIUtilities derived from responses to HUI questionnaires may be used to calculate quality adjusted life years (QALYs). QALYs are the measure of effectiveness in cost-utility analysis, a special type of cost-effectiveness analysis for comparing alternative surgical interventions -28,31.The SF-36 is a multi-purpose, short-form health survey with 36 questions . It is aThe SF-36 contains multi-function item scales to measure eight domains: physical function (10 items); role physical (4 items); bodily pain (2 items); general health (5 items); vitality (4 items); social functioning (2 items); role emotional (4 items); and mental health (5 items) . The twoThe MBSRQ is a well-validated self-report inventory for the assessment of body image . Body imIn this study, the shorter version of the MBSRQ-AS was used and only the appearance evaluation subscale was used, because we were concerned with measuring body image. Scores vary from one to five. A high score indicates emphasis on one's looks, attention to one's appearance, and engaging in extensive grooming behaviours. A low score indicates apathy about one's appearance, one's looks are not especially important, and not expending much effort to \"look good\". High scorers feel mostly positive and satisfied with their appearance; low scorers have a general unhappiness with their physical appearance .The BRSQ lists 13 breast related symptoms and the respondent indicates how much of the time she has the symptoms ,24. From\u00ae Health Survey Manual & Interpretation Guide, [Scores for the HUI2, the HUI3, and the SF-36 were generated according to algorithms from the developers  and the n Guide,  respectin Guide, ,24,30.A measure is reliable if it is sound and dependable. Reliability is assessed by tests of repeatability or reproducibility. Reliability is often assessed in terms of agreement between intra-subject test-retest measurements and inter-assessor measurements . There aTo estimate test-retest reliability, the same HRQL instrument is completed by the same patient on two different occasions. The assumption is that there would be no change in the scorers if there is no substantial change in health status of the patient being measured between the two occasions. The test-retest reliability of patients' responses is extremely important as we were most interested in determining that the difference in scores, between pre- and post-operative times reflected a real change in the patient's health is a result of the surgical intervention. If patient reporting is not reliable then one cannot truly capture the change in health status in patients using HRQL questionnaires.The reliability of a test is indicated by the reliability coefficient. Reliability is expressed as a number ranging between zero and one; as it approaches zero there is lower reliability and a reliability coefficient close to one indicates higher reliability. In other words, the larger a reliability coefficient is, the more repeatable or reliable the test scores. General guidelines exist for interpreting reliability coefficients. A reliability coefficient value of 0.90 and greater is said to be excellent; a reliability coefficient value of 0.80 to 0.89 is good; a reliability coefficient value of 0.70 to 0.79 is adequate; and a reliability coefficient value below 0.70 may have limited applicability .The validity and reliability of the HUI2, HUI3, and the SF-36 instruments have been demonstrated in various populations -29. The In this study we assessed the test-retest reliability of the HUI2, the HUI3, the MBSRQ-AS, and the BRSQ in patients diagnosed with breast hypertrophy prior to undergoing breast reduction mammoplasty. We did not assess the test-retest reliability of the SF-36 because we had used the four-week recall period for the SF-36. This study also provides some evidence about the concurrent validity of the BRSQ.We used two generic and two disease (condition) specific instruments in this prospective study. Generic health status measures seek a broad perspective that is not specifically related to the restricted score of the HRQL of a specific disease or condition. Using a generic instrument has the advantage of allowing comparisons of health status to be made across different diseases and health states . DiseaseThe effect size index is a statistical measure that can be used as an indicator of internal responsiveness. The mathematical formula for the effect size is the difference (\u0394) of mean follow-up assessment scores minus mean baseline assessment score divided by the standard deviation of the baseline scores . Our basThe minimum important difference is a measure of clinically important or relevant change in health . In otheThere is no rule for determining what constitutes the minimum clinically important difference on the SF-36 subscales . A 10-poCorrelation analysis will provide information about the degree of redundancy from measurements using various instruments and evidence about the concurrent validity of the BSS score. Concurrent validity is a form of construct validity . With coIn the current study, the change score of each questionnaire was correlated with the change score of the other questionnaires to assess the degree of redundancy among measures and to assess the concurrent validity of the BSS score. We expected all of the change scores to be positively correlated with each other because they are all scored in a positive direction, measuring improvement.The patient characteristics were described using frequency distributions and means. The ICC of test-retest reliability was computed using data from one week prior to surgery (time one) and one day prior to surgery (time two) for each HRQL instrument named above. To measure responsiveness, effect size, and standardized response means  were calFifty-two consecutive patients initially consented to participate in the study. The first patient was enrolled in April 2001 and the last patient was enrolled in May 2002. Of the 52 patients who had initially agreed to participate, 49 patients completed the baseline assessment. Patients did not complete the study for various reasons. One patient could not sufficiently understand English to complete the questionnaires, another patient cancelled her surgery after it had been booked, and one patient decided not to participate. Although 49 patients completed the baseline assessment, some patients did not return their HRQL questionnaires at all time-points despite several telephone calls and mailings . Self-reported bra cup sizes ranged from D to H, with 65 percent of the patients having a cup size of DD. Eighteen percent of patients had a history of depression, eight percent experienced frequent headaches, and 12 percent were smokers. Prior to surgery, all of the patients experienced neck pain, 94 percent experienced back pain, 53 percent experienced shoulder grooving, 45 percent experienced shoulder pain, 14 percent had breast pain, and 39 percent had intertrigo. The mean tissue resection weight for the left breast was 757.8 grams and the mean tissue resection weight for the right breast was 822.6 grams.The mean age of the patients was 38 years . The mean BMI was 30.9 kg/mThe computed ICC for the HUI2 was 0.86, the HUI3 was 0.84, the MBSRQ-AS was 0.85, and BSS score was 0.87. The HUI2, the HUI3, the BMSRQ-AS, and the BSS score all demonstrated good test-retest reliability.The responsiveness of each instrument is shown in Table In the current study, the difference identified between the baseline (the day before surgery) and at six-months after surgery was 0.06 for the HUI2 which is twice the minimal important difference identified by Horseman et al  , in contrast to other jurisdictions, for example, Nova Scotia, Canada  and the A number of previous studies have reported that women who suffer from breast hypertrophy frequently present with heightened body image dissatisfaction -48. In CPatients completed the HUI2, the HUI3, and the BRAVO instruments  at one week and one day before surgery to measure the test-retest reliability of each instrument and at one, six, and 12 months after surgery to measure change in HRQL following breast reduction mammoplasty. The methodology used in this prospective study may interest those who wish to sponsor, design, or implement future HRQL studies in breast reduction surgery or other areas of plastic surgery.Of the 52 patients who had initially agreed to participate, 49 patients completed the baseline assessment. Despite multiple reminders, 30 patients completed all of the HRQL questionnaires at the 12-month follow up. This equates to a compliance rate of 57.7 percent. The response rate in this study is comparable to response rates obtained in previous studies on HRQL in patients with breast hypertrophy. For instance, several authors have reported response rates ranging from 32.5 percent to 80 percent ,12,14,16To measure the test-retest reliability of each instrument, scores were obtained for each instrument using the recommended algorithms and the ICC was computed from these scores. We found that all HRQL instruments demonstrated good reliability, which reinforces previous reliability testing of the HUI2, HUI3, SF-36, MBSRQ-AS, and BSS score.It is extremely important that there is low within-patient variability in stable patients, relative to the magnitude of change that is predicted following the intervention, while answering the various questions on quality of life questionnaires in surgical outcome studies. Absence of reliable reporting will reduce the ability of measures to assess the effectiveness of surgery. For the present study, the one-week interval (time one and time two) was chosen to assess patient reporting as it was not long enough for other adverse events to intervene and change the health status but appropriate to avoid recall bias.Marx et al noted that if multiple questionnaires were administered, each consisting of numerous items, the effect of memory may be minimized and the effect of memory may be greater if only a single questionnaire was used . In the The SF-36 physical component summary, the MBSRQ-AS, and the BSS score showed high responsiveness. The SF-36 mental component summary, the HUI2, and the HUI3 had a lower responsiveness summary statistics than the other HRQL instruments used in this study but all three instruments were able to detect clinically important changes in overall HRQL scores. The HUI3 showed a moderate effect size and detected a clinically important reduction in pain scores. All of the statistically significant correlations are positive except for the SF-36 physical component summary with the SF-36 mental component summary. The negative correlation may be a function of the problem with the algorithms for calculating SF-36 physical and mental component summary scores described in the published literature including reports by Simon et al  and CunnThis study demonstrates that patient reporting using the HUI2, the HUI3, the MBSRQ-AS, and the BSS score are reliable in a sample of patients diagnosed with breast hypertrophy who had breast reduction mammoplasty. All instruments were equally reliable. The HUI is the only preference-based instrument and it was shown to be responsive. The two disease (condition) specific instruments were the most responsive of all the HRQL instruments usedHaving established the reliability and responsiveness of two generic (HUI and SF-36) instruments and two disease (condition) specific (MBSRQ-AS and BSS score) instruments, and the concurrent validity of BSS score, the focus moves onto the clinical and policy implications of the prospective study by addressing the following question: Can the improvement in HRQL derived from breast reduction surgery be measured quantitatively? Research is underway to address four specific issues: 1) identifying health attributes affected most frequently in breast hypertrophy patients and describing the extent of the observed morbidity; 2) assessing the health status and HRQL of patients in short, intermediate, and long time periods after reduction mammoplasty ; 3) determining if there is a relationship between tissue resection weight and changes in health status and HRQL; and 4) determining if there is a relationship BMI and changes in health status and HRQL to address the ongoing BMI discrimination by third party payers.BRAVO Breast Reduction Assessment Value and OutcomesBRSQ Breast Related Symptoms QuestionnaireBSS Score Breast Symptom Summary ScoreHRQL Health-Related Quality of LifeHUI Health Utilities IndexHUI2 Health Utilities Index Mark 2HUI3 Health Utilities Index Mark 3ICC Intraclass Correlation CoefficientMBSRQ-AS Multidimensional Body Self Relations Questionnaire Appearance AssessmentMID Minimally Important DifferencesSF-36 Short Form-36SRM Standardized Response MeanAT: Conception of the study, design of the study, acquisition of data, drafting of the manuscript. SS: Drafting of the manuscript. KV: Study coordination, acquisition of data, critical review of the manuscript. ED: Design of the study, statistical analysis, critical review of the manuscript. BF: Study design, critical review of the manuscript. All authors have read and approved the final manuscript.", "texts": ["Breast hypertrophy is associated with clinically important morbidity. A prospective study was conducted to assess the change in health-related quality of life (HRQL) following breast reduction mammoplasty. This paper describes the measurement properties of each of the HRQL questionnaires used.The reliability, responsiveness, and the construct validity of each HRQL instrument  and Mark 3 (HUI3) and the Breast Reduction Assessment Value and Outcomes (BRAVO) instruments) were assessed. The BRAVO instruments are a set of separate instruments including the Short Form-36 (SF-36), the Multidimensional Body Self Relations Questionnaire Appearance Assessment (MBSRQ-AS), and the Breast Related Symptoms Questionnaire (BRSQ).The HUI2, the HUI3, the MBSRQ-AS, and the breast severity symptom (BSS) score from the BRSQ all demonstrated good test-retest reliability. The SF-36 physical component summary, the MBSRQ-AS, and the BSS score demonstrated high responsiveness. The SF-36 mental component summary and the HUI3 had a moderate effect size and the HUI2 had a small effect size. All of the changes in scales are correlated in the same direction except for the SF-36 physical component summary and the SF-36 mental component summary.All four instruments were found to be reliable and responsive. These instruments can be used in similar clinical settings to evaluate the change in patients' HRQL. Within the last decade the plastic surgical community has been encouraged to use health-related quality of life (HRQL) assessment instruments to report on the efficacy of surgical interventions -5. ThereBreast hypertrophy has been reported by patients to be associated with important burdens in pain and discomfort as well as emotion . EarlierIn a recent Canadian prospective study of patients with a body mass index (BMI) below 27, pre-surgery mammoplasty patients scored lower on the SF-36 compared to normative data and post-surgery these patients achieved scores similar to normative data . AlthougA number of different instruments have been used in previous studies to measure HRQL in patients with breast hypertrophy. In terms of the hierarchy of evidence in surgical studies, the studies which provide the higher strength of evidence are prospective cohort studies which address important patient outcomes. These studies have shown an improvement from pre-operative to post-operative, which have been statistically significant. Our study is similar to the design of some of the earlier prospective cohort studies measuring HRQL in patients with breast hypertrophy ,13-15,18The primary objective of this study is to look at the measurement properties, including the reliability and responsiveness, of each of the four HRQL instruments used. The secondary objective was to assess the concurrent validity of each of the four HRQL instruments.Consecutive patients seen by the senior author (AT) over a period of one-year, with the diagnosis of breast hypertrophy and who obtained government approval for reduction mammoplasty were invited to participate in this prospective study. After signing an informed consent form, patients were asked to complete several questionnaires at each assessment time: (one week (time one) and one day before surgery (time two) and at one month (time three), six months (time four), and 12 months after surgery (time five)). The questionnaires were the HUI -28, and The patients were provided with the questionnaires at their clinic visits and they either completed them while at the clinic or they completed them at home and returned them to the clinic by mail. The patients completed the questionnaires at one week before surgery and at one day before surgery to assess the test-retest reliability of each instrument. The questionnaires were completed at three post-operative time-points to measure change and to assess the stability of change over one-year of follow-up. The Research Ethics Board of McMaster University and St. Joseph's Hospital approved this study.2). Other baseline information collected included self-reported bra cup size, diabetes, history of depression, smoking history, shoulder grooving, shoulder pain, back pain, neck pain, breast pain, intertrigo, and history of headaches.In addition to completing the quality of life instruments (described in detail below), each patient underwent a physical examination and the baseline information was recorded. Demographic information including age, height, and weight was obtained which permitted the calculation of BMI  in clinical trials and other studies -28. The The HUI2 and HUI3 health status classification systems are complementary. Together they provide descriptive measures of ability or disability for health-state attributes, and descriptions of comprehensive health status . The HUIUtilities derived from responses to HUI questionnaires may be used to calculate quality adjusted life years (QALYs). QALYs are the measure of effectiveness in cost-utility analysis, a special type of cost-effectiveness analysis for comparing alternative surgical interventions -28,31.The SF-36 is a multi-purpose, short-form health survey with 36 questions . It is aThe SF-36 contains multi-function item scales to measure eight domains: physical function (10 items); role physical (4 items); bodily pain (2 items); general health (5 items); vitality (4 items); social functioning (2 items); role emotional (4 items); and mental health (5 items) . The twoThe MBSRQ is a well-validated self-report inventory for the assessment of body image . Body imIn this study, the shorter version of the MBSRQ-AS was used and only the appearance evaluation subscale was used, because we were concerned with measuring body image. Scores vary from one to five. A high score indicates emphasis on one's looks, attention to one's appearance, and engaging in extensive grooming behaviours. A low score indicates apathy about one's appearance, one's looks are not especially important, and not expending much effort to \"look good\". High scorers feel mostly positive and satisfied with their appearance; low scorers have a general unhappiness with their physical appearance .The BRSQ lists 13 breast related symptoms and the respondent indicates how much of the time she has the symptoms ,24. From\u00ae Health Survey Manual & Interpretation Guide, [Scores for the HUI2, the HUI3, and the SF-36 were generated according to algorithms from the developers  and the n Guide,  respectin Guide, ,24,30.A measure is reliable if it is sound and dependable. Reliability is assessed by tests of repeatability or reproducibility. Reliability is often assessed in terms of agreement between intra-subject test-retest measurements and inter-assessor measurements . There aTo estimate test-retest reliability, the same HRQL instrument is completed by the same patient on two different occasions. The assumption is that there would be no change in the scorers if there is no substantial change in health status of the patient being measured between the two occasions. The test-retest reliability of patients' responses is extremely important as we were most interested in determining that the difference in scores, between pre- and post-operative times reflected a real change in the patient's health is a result of the surgical intervention. If patient reporting is not reliable then one cannot truly capture the change in health status in patients using HRQL questionnaires.The reliability of a test is indicated by the reliability coefficient. Reliability is expressed as a number ranging between zero and one; as it approaches zero there is lower reliability and a reliability coefficient close to one indicates higher reliability. In other words, the larger a reliability coefficient is, the more repeatable or reliable the test scores. General guidelines exist for interpreting reliability coefficients. A reliability coefficient value of 0.90 and greater is said to be excellent; a reliability coefficient value of 0.80 to 0.89 is good; a reliability coefficient value of 0.70 to 0.79 is adequate; and a reliability coefficient value below 0.70 may have limited applicability .The validity and reliability of the HUI2, HUI3, and the SF-36 instruments have been demonstrated in various populations -29. The In this study we assessed the test-retest reliability of the HUI2, the HUI3, the MBSRQ-AS, and the BRSQ in patients diagnosed with breast hypertrophy prior to undergoing breast reduction mammoplasty. We did not assess the test-retest reliability of the SF-36 because we had used the four-week recall period for the SF-36. This study also provides some evidence about the concurrent validity of the BRSQ.We used two generic and two disease (condition) specific instruments in this prospective study. Generic health status measures seek a broad perspective that is not specifically related to the restricted score of the HRQL of a specific disease or condition. Using a generic instrument has the advantage of allowing comparisons of health status to be made across different diseases and health states . DiseaseThe effect size index is a statistical measure that can be used as an indicator of internal responsiveness. The mathematical formula for the effect size is the difference (\u0394) of mean follow-up assessment scores minus mean baseline assessment score divided by the standard deviation of the baseline scores . Our basThe minimum important difference is a measure of clinically important or relevant change in health . In otheThere is no rule for determining what constitutes the minimum clinically important difference on the SF-36 subscales . A 10-poCorrelation analysis will provide information about the degree of redundancy from measurements using various instruments and evidence about the concurrent validity of the BSS score. Concurrent validity is a form of construct validity . With coIn the current study, the change score of each questionnaire was correlated with the change score of the other questionnaires to assess the degree of redundancy among measures and to assess the concurrent validity of the BSS score. We expected all of the change scores to be positively correlated with each other because they are all scored in a positive direction, measuring improvement.The patient characteristics were described using frequency distributions and means. The ICC of test-retest reliability was computed using data from one week prior to surgery (time one) and one day prior to surgery (time two) for each HRQL instrument named above. To measure responsiveness, effect size, and standardized response means  were calFifty-two consecutive patients initially consented to participate in the study. The first patient was enrolled in April 2001 and the last patient was enrolled in May 2002. Of the 52 patients who had initially agreed to participate, 49 patients completed the baseline assessment. Patients did not complete the study for various reasons. One patient could not sufficiently understand English to complete the questionnaires, another patient cancelled her surgery after it had been booked, and one patient decided not to participate. Although 49 patients completed the baseline assessment, some patients did not return their HRQL questionnaires at all time-points despite several telephone calls and mailings . Self-reported bra cup sizes ranged from D to H, with 65 percent of the patients having a cup size of DD. Eighteen percent of patients had a history of depression, eight percent experienced frequent headaches, and 12 percent were smokers. Prior to surgery, all of the patients experienced neck pain, 94 percent experienced back pain, 53 percent experienced shoulder grooving, 45 percent experienced shoulder pain, 14 percent had breast pain, and 39 percent had intertrigo. The mean tissue resection weight for the left breast was 757.8 grams and the mean tissue resection weight for the right breast was 822.6 grams.The mean age of the patients was 38 years . The mean BMI was 30.9 kg/mThe computed ICC for the HUI2 was 0.86, the HUI3 was 0.84, the MBSRQ-AS was 0.85, and BSS score was 0.87. The HUI2, the HUI3, the BMSRQ-AS, and the BSS score all demonstrated good test-retest reliability.The responsiveness of each instrument is shown in Table In the current study, the difference identified between the baseline (the day before surgery) and at six-months after surgery was 0.06 for the HUI2 which is twice the minimal important difference identified by Horseman et al  , in contrast to other jurisdictions, for example, Nova Scotia, Canada  and the A number of previous studies have reported that women who suffer from breast hypertrophy frequently present with heightened body image dissatisfaction -48. In CPatients completed the HUI2, the HUI3, and the BRAVO instruments  at one week and one day before surgery to measure the test-retest reliability of each instrument and at one, six, and 12 months after surgery to measure change in HRQL following breast reduction mammoplasty. The methodology used in this prospective study may interest those who wish to sponsor, design, or implement future HRQL studies in breast reduction surgery or other areas of plastic surgery.Of the 52 patients who had initially agreed to participate, 49 patients completed the baseline assessment. Despite multiple reminders, 30 patients completed all of the HRQL questionnaires at the 12-month follow up. This equates to a compliance rate of 57.7 percent. The response rate in this study is comparable to response rates obtained in previous studies on HRQL in patients with breast hypertrophy. For instance, several authors have reported response rates ranging from 32.5 percent to 80 percent ,12,14,16To measure the test-retest reliability of each instrument, scores were obtained for each instrument using the recommended algorithms and the ICC was computed from these scores. We found that all HRQL instruments demonstrated good reliability, which reinforces previous reliability testing of the HUI2, HUI3, SF-36, MBSRQ-AS, and BSS score.It is extremely important that there is low within-patient variability in stable patients, relative to the magnitude of change that is predicted following the intervention, while answering the various questions on quality of life questionnaires in surgical outcome studies. Absence of reliable reporting will reduce the ability of measures to assess the effectiveness of surgery. For the present study, the one-week interval (time one and time two) was chosen to assess patient reporting as it was not long enough for other adverse events to intervene and change the health status but appropriate to avoid recall bias.Marx et al noted that if multiple questionnaires were administered, each consisting of numerous items, the effect of memory may be minimized and the effect of memory may be greater if only a single questionnaire was used . In the The SF-36 physical component summary, the MBSRQ-AS, and the BSS score showed high responsiveness. The SF-36 mental component summary, the HUI2, and the HUI3 had a lower responsiveness summary statistics than the other HRQL instruments used in this study but all three instruments were able to detect clinically important changes in overall HRQL scores. The HUI3 showed a moderate effect size and detected a clinically important reduction in pain scores. All of the statistically significant correlations are positive except for the SF-36 physical component summary with the SF-36 mental component summary. The negative correlation may be a function of the problem with the algorithms for calculating SF-36 physical and mental component summary scores described in the published literature including reports by Simon et al  and CunnThis study demonstrates that patient reporting using the HUI2, the HUI3, the MBSRQ-AS, and the BSS score are reliable in a sample of patients diagnosed with breast hypertrophy who had breast reduction mammoplasty. All instruments were equally reliable. The HUI is the only preference-based instrument and it was shown to be responsive. The two disease (condition) specific instruments were the most responsive of all the HRQL instruments usedHaving established the reliability and responsiveness of two generic (HUI and SF-36) instruments and two disease (condition) specific (MBSRQ-AS and BSS score) instruments, and the concurrent validity of BSS score, the focus moves onto the clinical and policy implications of the prospective study by addressing the following question: Can the improvement in HRQL derived from breast reduction surgery be measured quantitatively? Research is underway to address four specific issues: 1) identifying health attributes affected most frequently in breast hypertrophy patients and describing the extent of the observed morbidity; 2) assessing the health status and HRQL of patients in short, intermediate, and long time periods after reduction mammoplasty ; 3) determining if there is a relationship between tissue resection weight and changes in health status and HRQL; and 4) determining if there is a relationship BMI and changes in health status and HRQL to address the ongoing BMI discrimination by third party payers.BRAVO Breast Reduction Assessment Value and OutcomesBRSQ Breast Related Symptoms QuestionnaireBSS Score Breast Symptom Summary ScoreHRQL Health-Related Quality of LifeHUI Health Utilities IndexHUI2 Health Utilities Index Mark 2HUI3 Health Utilities Index Mark 3ICC Intraclass Correlation CoefficientMBSRQ-AS Multidimensional Body Self Relations Questionnaire Appearance AssessmentMID Minimally Important DifferencesSF-36 Short Form-36SRM Standardized Response MeanAT: Conception of the study, design of the study, acquisition of data, drafting of the manuscript. SS: Drafting of the manuscript. KV: Study coordination, acquisition of data, critical review of the manuscript. ED: Design of the study, statistical analysis, critical review of the manuscript. BF: Study design, critical review of the manuscript. All authors have read and approved the final manuscript."]}
-{"representative": "Tuberculosis remains a major public health problem worldwide. In recent years, increasing efforts have been dedicated to assessing the health-related quality of life experienced by people infected with tuberculosis. The objectives of this study were to better understand the impact of tuberculosis and its treatment on people's quality of life, and to review quality of life instruments used in current tuberculosis research.A systematic literature search from 1981 to 2008 was performed through a number of electronic databases as well as a manual search. Eligible studies assessed multi-dimensional quality of life in people with tuberculosis disease or infection using standardized instruments. Results of the included studies were summarized qualitatively.Twelve original studies met our criteria for inclusion. A wide range of quality of life instruments were involved, and the Short-Form 36 was most commonly used. A validated tuberculosis-specific quality of life instrument was not located. The findings showed that tuberculosis had a substantial and encompassing impact on patients' quality of life. Overall, the anti-tuberculosis treatment had a positive effect of improving patients' quality of life; their physical health tended to recover more quickly than the mental well-being. However, after the patients successfully completed treatment and were microbiologically 'cured', their quality of life remained significantly worse than the general population.Tuberculosis has substantially adverse impacts on patients' quality of life, which persist after microbiological 'cure'. A variety of instruments were used to assess quality of life in tuberculosis and there has been no well-established tuberculosis-specific instrument, making it difficult to fully understand the impact of the illness. The assessment of patient reported outcomes (PROs) has become more accepted and valued in the disease management and outcome evaluation. Health-related quality of life (HRQL) is a complex type of PRO that evaluates health status. HRQL broadly describes how well individuals function in daily lives and their own perception of well-being in physical, psychological, and social aspects ,2. AlthoAlthough effective therapy has long been available, TB remains a major public health threat globally, with one third of the world's population infected ,6. Many The objectives of this review were: (1) to identify HRQL instruments used in TB research; (2) to better understand the impact of TB disease or infection and the associated treatment on patients' HRQL; and (3) to examine demographic, socio-economic, and clinical factors associated with HRQL outcomes in TB patients.tuberculosis (TB), Quality of Life (QoL), Quality Adjusted Life Years (QALY), health utility, health status, life quality, and well-being. The limit feature was used to select human studies published between 1981 and 2008 written in English or Chinese . The last time electronic database search was conducted during July 22, 2008. The reference sections of the following key journals were manually searched for relevant articles: International Journal of Tuberculosis and Lung Disease, Chest, Quality of Life Research, and Health and Quality of Life Outcomes. Reference lists of included studies, review articles, letters, and comments were checked afterwards. We did not contact the authors of identified studies or relevant experts to locate unpublished studies. Each stage of the literature searching process is illustrated in Figure A systematic literature search was performed using the following electronic databases: Medline (1950-present), EMBASE (1980-present), Cochrane Register of Controlled Trials (CENTRAL), CINAHL, PsycINFO, and HaPI (1985-present). Key word searching and/or subject searching were performed, if applicable. The following keywords were used: All clinical trials and observational studies where multi-dimensional HRQL was evaluated, either as a primary or secondary outcome, using structured HRQL instruments were considered in this review. Participants were those diagnosed with active TB disease or latent TB infection (LTBI), regardless of the site and stage of the disease and the treatment status. There were no limitations on age, gender, race, the origin of birth, and other socio-economic status.For the purpose of this review, HRQL was defined as patients' self-evaluations of the impact of either active TB disease or LTBI and the associated treatments on their physical, mental, and social well-being and functioning. The following requirements for HRQL measurement were set a priori for studies to be included in this review: (1) one multi-dimensional HRQL instrument or a combination of single-dimensional instruments had to be used to capture the broad framework of HRQL; (2) the HRQL instruments could be either generic or disease (or condition) -specific; (3) the origin of the applied instruments had to be identifiable and traceable; (4) the HRQL instruments had to have psychometric properties such as reliability and validity reported from previous studies or were assessed in the specific study being reviewed; (5) HRQL outcomes had to be self-reported by the specific participant, but HRQL measurement that were completed with help from proper proxies, such as family members and caregivers, were also accepted.Studies were excluded if (1) HRQL was evaluated using qualitative methodologies, such as focus groups; or (2) only one single dimension of HRQL  was assessed; or (3) HRQL was assessed using instruments designed for the specific study without psychometric properties evaluated and reported; or (4) a modified version of a previously validated instruments  was used as the psychometric properties of the original instrument could be changed by the modification.If the study was included in this review, the following information was collected: study design, inclusion and exclusion criteria of subjects, included subjects' socio-demographic characteristics and clinical features, HRQL instrument(s) used, the origin and structure of HRQL instrument(s), administration of HRQL instrument(s), and HRQL outcomes and validation results.The literature search identified 2540 articles which were narrowed to 26 -14,16-35Of the 12 included studies, one was published in 1998  and the To measure multiple-dimensional HRQL, a variety of instruments were involved in the included studies  and Social Support Rating Scale (SSRS) . The SCLIn the USA study, a series of instruments or questions were used to assess TB-infected homeless individuals' self-perceived physical health, psychological profile, emotional well-being, social support, and health care access and use . ExampleHealth utility, one generic measure of HRQL, reflects subjective preferences for health states and also provides quantitative estimates of HRQL under certain health states . The twoHUI currently consists of HUI-2 and HUI-3 . HUI-2 aThe SG is a classic technique to obtain individual preferences for health outcomes, based on the theory of von Neumann and Morgenstern . In the The SF-36 was used in 6 studies, and overall it showed acceptable validity and reliability. Chamla  validateValidity of the SF-36 was evaluated by examining the correlations between SF-36 outcomes with other external variables, including clinical criteria, responses from other HRQL measures, and physician's evaluations. It was reported that SF-36 scores were able to discriminate between TB patients with different severity levels ,26 and bThe structural validity of SF-36 was tested in two studies, but the results were not consistent. In Chamala , factor The application of SF-36 among TB patients also revealed some problems. In the study by Dion et. al. ,24, SF-3Ceiling and floor effects are a common problem for the application of health utility instruments in TB. In Dion et. al. ,24, 42\u20135Pasipanodya et. al.  administDhingra and Rajpal  applied Overall, active TB disease had significant and encompassing impacts on patients' HRQL. Using the SF-36, Chamla  found thIn the study by Marra et. al. , Beck-DIThe impaired HRQL experienced by TB patients may be a reflection of socio-demographic status  and other underlying co-morbid conditions, besides TB and its treatment. A few included studies explored the relationship between socio-demographic features and clinical factors and HRQL in TB patients. In general, the findings were consistent, but some discrepancies existed. Yang et. al.  and NyamChamla , DhingraAlthough anti-TB treatment improved HRQL overall, active TB patients still had poorer HRQL at the end of the treatment compared to the general population or people with LTBI, especially in psychological well-being and social functioning. Chamla  observedMuniyandi et. al.  assessedHRQL has been appreciated as an important health outcome measure in clinical research. We identified 12 original studies where multi-dimensional HRQL was assessed among people with TB disease or infection using structured instruments around the world. We found that TB and its treatment have a significant impact on patients' quality of life from various aspects and this impact tends to persist for a long time even after the successful completion of treatment and the microbiological 'cure' of the disease.The results suggest that TB disease has a negative and encompassing impact on active TB patients' self-perceived health status in physical, psychological, and social aspects. Overall, the anti-TB treatment showed positive effect on improving patients' HRQL. It appeared that physical health seemed to be more affected by the disease but improved more quickly after the treatment, while the impairment on mental well-being tended to persist for a longer term ,28. HoweMost studies have focused on assessing HRQL in active TB patients. Although people with LTBI do not present with clinical disease or symptoms, they are likely to be subjected to the same social and psychological impacts as active TB patients. The knowledge of a deadly and stigmatized disease lying dormant in his/her body may also induce anxiety and fear. As Marra et. al.  observedHRQL assessment in TB research is still a new area, and a valid and reliable TB-specific instrument is much needed. Currently, a wide range of HRQL instruments were utilized in the literature. The SF-36 was the most frequently used instrument and it appeared to be a valid and reliable tool to be used in TB. Although the SF-36 has been used extensively to assess both population health and specific health conditions for various medical conditions, as a generic health assessment instrument, it offers little information to help understand the unique experiences among TB patients, such as social stigma and anti-TB treatment related ADRs.Our review identified one TB-specific HRQL instrument, DR-12, which was developed in India ,21. UnfoIt should be also noted that most TB patients have very different cultural and socio-demographic backgrounds compared with the population in which many of these instruments were originally developed. Also, in the studies done in Canada and the USA -26,32,34Particular attention should be given to some methodological issues on assessing HRQL among people with active TB disease or LTBI. To comprehensively examine the impact of TB and its treatment on patients' HRQL, it is very important to include a proper comparison group from a similar demographic and socio-economic background. When conducting the study, researchers are recommended to seek statistical consultation regarding proper sample size estimating, missing data handling, and adjusting for potential confounders, such as socio-demographic status and presence of co-morbidities. Another concern is the lack of interpretation of HRQL outcomes in terms of clinical meaningfulness. Statistical significance is a useful way to interpret the result, but it fails to relate the HRQL outcome with clinical relevance. As such, more work needs to be done to relate changes in HRQL assessment in TB to concepts such as the minimal clinical difference ,49.Our review of the literature shows that TB diminishes patients' HRQL, as measured by various instruments. However, due to the heterogeneity of HRQL measurements, it was difficult to assimilate results across studies. A few studies used the SF-36 which appeared to be a valid instrument in the measurement of HRQL in TB. Other instruments require further psychometric testing to determine their suitability in measurement in this context. Our review suggests that HRQL assessment in people with TB is a growing research area and a psychometrically sound TB-specific HRQL instrument is lacking. A critical step in the future would be to design an applicable, reliable, and valid TB-specific HRQL instrument. Particular attention should be given to address the methodological issues when conducting a HRQL assessment study in TB patients.The authors declare that they have no competing interests.All authors contributed to the conception and design of the review. NG acquired and analyzed the data and drafted the manuscript. CAM and FM contributed to the analysis and interpretation of the data and finalizing the manuscript. All authors read and gave approval of the final manuscript.Table 1. Overview of included studiesClick here for fileTable 2. HRQL instruments used by included studiesClick here for file", "texts": ["Tuberculosis remains a major public health problem worldwide. In recent years, increasing efforts have been dedicated to assessing the health-related quality of life experienced by people infected with tuberculosis. The objectives of this study were to better understand the impact of tuberculosis and its treatment on people's quality of life, and to review quality of life instruments used in current tuberculosis research.A systematic literature search from 1981 to 2008 was performed through a number of electronic databases as well as a manual search. Eligible studies assessed multi-dimensional quality of life in people with tuberculosis disease or infection using standardized instruments. Results of the included studies were summarized qualitatively.Twelve original studies met our criteria for inclusion. A wide range of quality of life instruments were involved, and the Short-Form 36 was most commonly used. A validated tuberculosis-specific quality of life instrument was not located. The findings showed that tuberculosis had a substantial and encompassing impact on patients' quality of life. Overall, the anti-tuberculosis treatment had a positive effect of improving patients' quality of life; their physical health tended to recover more quickly than the mental well-being. However, after the patients successfully completed treatment and were microbiologically 'cured', their quality of life remained significantly worse than the general population.Tuberculosis has substantially adverse impacts on patients' quality of life, which persist after microbiological 'cure'. A variety of instruments were used to assess quality of life in tuberculosis and there has been no well-established tuberculosis-specific instrument, making it difficult to fully understand the impact of the illness. The assessment of patient reported outcomes (PROs) has become more accepted and valued in the disease management and outcome evaluation. Health-related quality of life (HRQL) is a complex type of PRO that evaluates health status. HRQL broadly describes how well individuals function in daily lives and their own perception of well-being in physical, psychological, and social aspects ,2. AlthoAlthough effective therapy has long been available, TB remains a major public health threat globally, with one third of the world's population infected ,6. Many The objectives of this review were: (1) to identify HRQL instruments used in TB research; (2) to better understand the impact of TB disease or infection and the associated treatment on patients' HRQL; and (3) to examine demographic, socio-economic, and clinical factors associated with HRQL outcomes in TB patients.tuberculosis (TB), Quality of Life (QoL), Quality Adjusted Life Years (QALY), health utility, health status, life quality, and well-being. The limit feature was used to select human studies published between 1981 and 2008 written in English or Chinese . The last time electronic database search was conducted during July 22, 2008. The reference sections of the following key journals were manually searched for relevant articles: International Journal of Tuberculosis and Lung Disease, Chest, Quality of Life Research, and Health and Quality of Life Outcomes. Reference lists of included studies, review articles, letters, and comments were checked afterwards. We did not contact the authors of identified studies or relevant experts to locate unpublished studies. Each stage of the literature searching process is illustrated in Figure A systematic literature search was performed using the following electronic databases: Medline (1950-present), EMBASE (1980-present), Cochrane Register of Controlled Trials (CENTRAL), CINAHL, PsycINFO, and HaPI (1985-present). Key word searching and/or subject searching were performed, if applicable. The following keywords were used: All clinical trials and observational studies where multi-dimensional HRQL was evaluated, either as a primary or secondary outcome, using structured HRQL instruments were considered in this review. Participants were those diagnosed with active TB disease or latent TB infection (LTBI), regardless of the site and stage of the disease and the treatment status. There were no limitations on age, gender, race, the origin of birth, and other socio-economic status.For the purpose of this review, HRQL was defined as patients' self-evaluations of the impact of either active TB disease or LTBI and the associated treatments on their physical, mental, and social well-being and functioning. The following requirements for HRQL measurement were set a priori for studies to be included in this review: (1) one multi-dimensional HRQL instrument or a combination of single-dimensional instruments had to be used to capture the broad framework of HRQL; (2) the HRQL instruments could be either generic or disease (or condition) -specific; (3) the origin of the applied instruments had to be identifiable and traceable; (4) the HRQL instruments had to have psychometric properties such as reliability and validity reported from previous studies or were assessed in the specific study being reviewed; (5) HRQL outcomes had to be self-reported by the specific participant, but HRQL measurement that were completed with help from proper proxies, such as family members and caregivers, were also accepted.Studies were excluded if (1) HRQL was evaluated using qualitative methodologies, such as focus groups; or (2) only one single dimension of HRQL  was assessed; or (3) HRQL was assessed using instruments designed for the specific study without psychometric properties evaluated and reported; or (4) a modified version of a previously validated instruments  was used as the psychometric properties of the original instrument could be changed by the modification.If the study was included in this review, the following information was collected: study design, inclusion and exclusion criteria of subjects, included subjects' socio-demographic characteristics and clinical features, HRQL instrument(s) used, the origin and structure of HRQL instrument(s), administration of HRQL instrument(s), and HRQL outcomes and validation results.The literature search identified 2540 articles which were narrowed to 26 -14,16-35Of the 12 included studies, one was published in 1998  and the To measure multiple-dimensional HRQL, a variety of instruments were involved in the included studies  and Social Support Rating Scale (SSRS) . The SCLIn the USA study, a series of instruments or questions were used to assess TB-infected homeless individuals' self-perceived physical health, psychological profile, emotional well-being, social support, and health care access and use . ExampleHealth utility, one generic measure of HRQL, reflects subjective preferences for health states and also provides quantitative estimates of HRQL under certain health states . The twoHUI currently consists of HUI-2 and HUI-3 . HUI-2 aThe SG is a classic technique to obtain individual preferences for health outcomes, based on the theory of von Neumann and Morgenstern . In the The SF-36 was used in 6 studies, and overall it showed acceptable validity and reliability. Chamla  validateValidity of the SF-36 was evaluated by examining the correlations between SF-36 outcomes with other external variables, including clinical criteria, responses from other HRQL measures, and physician's evaluations. It was reported that SF-36 scores were able to discriminate between TB patients with different severity levels ,26 and bThe structural validity of SF-36 was tested in two studies, but the results were not consistent. In Chamala , factor The application of SF-36 among TB patients also revealed some problems. In the study by Dion et. al. ,24, SF-3Ceiling and floor effects are a common problem for the application of health utility instruments in TB. In Dion et. al. ,24, 42\u20135Pasipanodya et. al.  administDhingra and Rajpal  applied Overall, active TB disease had significant and encompassing impacts on patients' HRQL. Using the SF-36, Chamla  found thIn the study by Marra et. al. , Beck-DIThe impaired HRQL experienced by TB patients may be a reflection of socio-demographic status  and other underlying co-morbid conditions, besides TB and its treatment. A few included studies explored the relationship between socio-demographic features and clinical factors and HRQL in TB patients. In general, the findings were consistent, but some discrepancies existed. Yang et. al.  and NyamChamla , DhingraAlthough anti-TB treatment improved HRQL overall, active TB patients still had poorer HRQL at the end of the treatment compared to the general population or people with LTBI, especially in psychological well-being and social functioning. Chamla  observedMuniyandi et. al.  assessedHRQL has been appreciated as an important health outcome measure in clinical research. We identified 12 original studies where multi-dimensional HRQL was assessed among people with TB disease or infection using structured instruments around the world. We found that TB and its treatment have a significant impact on patients' quality of life from various aspects and this impact tends to persist for a long time even after the successful completion of treatment and the microbiological 'cure' of the disease.The results suggest that TB disease has a negative and encompassing impact on active TB patients' self-perceived health status in physical, psychological, and social aspects. Overall, the anti-TB treatment showed positive effect on improving patients' HRQL. It appeared that physical health seemed to be more affected by the disease but improved more quickly after the treatment, while the impairment on mental well-being tended to persist for a longer term ,28. HoweMost studies have focused on assessing HRQL in active TB patients. Although people with LTBI do not present with clinical disease or symptoms, they are likely to be subjected to the same social and psychological impacts as active TB patients. The knowledge of a deadly and stigmatized disease lying dormant in his/her body may also induce anxiety and fear. As Marra et. al.  observedHRQL assessment in TB research is still a new area, and a valid and reliable TB-specific instrument is much needed. Currently, a wide range of HRQL instruments were utilized in the literature. The SF-36 was the most frequently used instrument and it appeared to be a valid and reliable tool to be used in TB. Although the SF-36 has been used extensively to assess both population health and specific health conditions for various medical conditions, as a generic health assessment instrument, it offers little information to help understand the unique experiences among TB patients, such as social stigma and anti-TB treatment related ADRs.Our review identified one TB-specific HRQL instrument, DR-12, which was developed in India ,21. UnfoIt should be also noted that most TB patients have very different cultural and socio-demographic backgrounds compared with the population in which many of these instruments were originally developed. Also, in the studies done in Canada and the USA -26,32,34Particular attention should be given to some methodological issues on assessing HRQL among people with active TB disease or LTBI. To comprehensively examine the impact of TB and its treatment on patients' HRQL, it is very important to include a proper comparison group from a similar demographic and socio-economic background. When conducting the study, researchers are recommended to seek statistical consultation regarding proper sample size estimating, missing data handling, and adjusting for potential confounders, such as socio-demographic status and presence of co-morbidities. Another concern is the lack of interpretation of HRQL outcomes in terms of clinical meaningfulness. Statistical significance is a useful way to interpret the result, but it fails to relate the HRQL outcome with clinical relevance. As such, more work needs to be done to relate changes in HRQL assessment in TB to concepts such as the minimal clinical difference ,49.Our review of the literature shows that TB diminishes patients' HRQL, as measured by various instruments. However, due to the heterogeneity of HRQL measurements, it was difficult to assimilate results across studies. A few studies used the SF-36 which appeared to be a valid instrument in the measurement of HRQL in TB. Other instruments require further psychometric testing to determine their suitability in measurement in this context. Our review suggests that HRQL assessment in people with TB is a growing research area and a psychometrically sound TB-specific HRQL instrument is lacking. A critical step in the future would be to design an applicable, reliable, and valid TB-specific HRQL instrument. Particular attention should be given to address the methodological issues when conducting a HRQL assessment study in TB patients.The authors declare that they have no competing interests.All authors contributed to the conception and design of the review. NG acquired and analyzed the data and drafted the manuscript. CAM and FM contributed to the analysis and interpretation of the data and finalizing the manuscript. All authors read and gave approval of the final manuscript.Table 1. Overview of included studiesClick here for fileTable 2. HRQL instruments used by included studiesClick here for file"]}
-{"representative": "The health-related quality of life (HRQL) is an important indicator of the burden of musculoskeletal disease. The Medical Outcome Study Short-Term 36 (SF-36) is the most used tool that evaluates HRQL as a subjective perception about psychological and physical limitations due to an underlying illness. The purpose of this study was to compare the HRQL scores among patients with rheumatoid arthritis (RA), psoriatic arthritis (PsA) and ankylosing spondylitis (AS) and a selected sample of health people and determine their relationship with measures of clinical condition.799 patients  accepted the invitation to participate. 1579 healthy controls were used for the comparison. We calculated scores for the eight SF-36 subscales, the Physical Component Summary (PCS) score, and the Mental Component Summary (MCS) score, according to published algorithms. Disease-related characteristics included disease duration, comorbidity, a measure for disease activity and for radiographic damage. The presence of comorbidity was ascertained through patient's self-reports by the Self-Administered Comorbidity Questionnaire (SCQ). Comparison were performed with respect to sex and age, and s-scores were calculated for comparison with the norm. Multivariate analyses were used to assess the relationship between HRQL and radiographic damage, disease activity, and socio-demographic data.The four inflammatory rheumatic diseases (IRD), compared to controls, significantly impaired all eight health concepts of the SF-36 (p < 0.0001) in both component PCS and MCS scores (p < 0.0001). Overall, the dimensions typically affected were physical functioning, limitations due to physical function, and bodily pain. The disease with the worst HRQL for those dimensions was RA. The multivariate analyses revealed that the physical component was influenced by a high disease activity and comorbidity. The severity of psoriatic lesions was associated with poor mental functioning in patients with PsA.Chronic IRD have a clearly detrimental effect on the HRQL in both sex and in age groups, and physical domain is more impaired than mental and social ones. Rheumatoid arthritis (RA), ankylosing spondylitis (AS), and psoriatic arthritis (PsA) are three common types of inflammatory rheumatic diseases (IRD) associated with deformities and joint destruction. RA is the most frequent IRD, with a prevalence of 0.5% . PatientTraditional methods of evaluation, with a focus on the locomotor system and measures of impairment, may fail to describe the extensive multi-dimensional issues associated with chronic rheumatic conditions. Consideration of HRQL has become increasingly important in decisions regarding resource allocation, intervention design, and pharmacological treatment with biologic agents of individuals with chronic inflammatory disabling conditions -16. Two The main objective of this study was to examine the self-reported health status in patients with RA, AS and PsA, compared with a selected sample of health people. Furthermore, we wanted to explore the associations between health status and age, sex of the patients, and educational level in these IRD and to estimate the burden of the disease by controlling for the normal variations in health status in the general population.Participants at this study are part of an ongoing longitudinal project measuring rheumatic disease outcomes, approved by the local Ethical Committee for Medical Research. Consecutive adult rheumatic disease patients from the Rheumatology Clinic of the Universit\u00e0 Politecnica delle Marche, who agreed to participate in the study, completed an informed consent form. The study population includes patients examined by two rheumatologists and fulfilling the American College of Rheumatology (ACR) classification criteria for RA , the modx-ray findings in patients with AS and with axial PsA. The mSASSS offers advantages in measurement properties and is the most appropriate method by which assessing progression of structural damage in AS [A comprehensive questionnaire package including socio-demographic data, quality of life items, and disease-related variables was administered to the patients. The socio-demographic variables were age, sex, and highest attained level of education . Disease-related characteristics included disease duration (years since fulfilment of the classification criteria of the IRD), comorbidity, a measure for disease activity and for radiographic damage. The Disease Activity Score (DAS)  was usedge in AS . The sevge in AS . The PASge in AS . The PASge in AS , an effige in AS .\u00ae, version 9.2 for Windows XP. Descriptive statistics are given as means and standard deviations (SD) for continuous data or as percentages for counts. Comparisons between groups were performed with chi-square tests for categorial variables and analysis of variance (ANOVA) for continuous variables. Standardized difference scores  were also calculated by subtracting the mean scores of the patients from the mean scores of the general population, followed by the division of these deviations by each scale's standard deviation in the general population. The standardized s-score is a rescaled score with a population average of 0 and a standard deviation of 1. The values of the s-scores were interpreted according to Cohen's effect size index, in which 0.2 refers to a small difference, 0.5 to a moderate difference, and 0.8 or more to a large difference [a priori included sex ; age (as a continuous variable); disease duration (years from disease onset as a continuous variable); educational level (years of education as a continuous variable); and the average score of the SCQ questionnaire (SCQ score as a continuous variable). All these factors were then introduced as covariates in multiple regression models in which PCS and MCS SF-36 scores were dependent variables. All variables were entered simultaneously. Owing to multiple comparisons with increasing risk of type 1 errors, the level of statistical significance was set at 0.01.The data were analysed using the SPSS version 11.0 , and MedCalcfference . A set oDemographics and disease characteristics of patients and healthy controls enrolled in the study are shown in Table Scores for respondents with IRD significantly impaired all eight health concepts of the SF-36 p < 0.0001) and in both component summary scores (PCS and MCS) (p < 0.0001), compared with their non-arthritic counterparts Table . General and in ba priori included the demographic variables, disease related characteristics and the and average score of the SCQ questionnaire. All these factors were introduced as covariates in multiple regression models in which PCS and MCS SF-36 summary scores  were dependent variables. The physical component of the SF-36 was influenced by a high disease activity (measured by DAS) and chronic comorbidity (both at a p level < 0.0001), and by radiographic damage (p = 0.004) in RA. A similar association of chronic comorbidity and high disease activity with AS, peripheral PsA, and axial PsA were also found. Concerning the mental component, an association was found in RA with the disease activity (p < 0.0001), and in AS and axial PsA with the low educational level . The severity of psoriatic lesions (assessed using PASI) was significantly associated with poor mental functioning in patients with peripheral and axial PsA .Multiple regression models were constructed to adjust for factors potentially associated with poor HRQL in the four IRD groups. Covariates chosen Patient-reported outcomes (PRO) are an attractive option in a busy medical practice, as the time burden is transferred from the clinician to the patient . The valThe results of this study show that adults with IRD have poorer self-reported health status than those without arthritis in all domains of living, but particularly with respect to scales measuring aspects of physical functioning or mobility, role limitation due to physical health problems and usual activities, and bodily pain. The disease with the worst HRQL for physical dimensions of SF-36 was RA. The mean PCS score for RA patients was 32.5, approximately two standard deviations below the mean observed in the Italian general population ,38. BaseThe findings of the multivariate analysis suggests that the SF-36 PCS scores may reflect both functional limitations due to current disease activity due to processes that do not respond to aggressive treatment with anti-rheumatic drugs and limitations due to the radiographic damage and coexisting conditions. Kirwin , similarThe outcomes of a chronic condition may be also affected by coexisting chronic conditions. It is important to incorporate assessment of comorbidity into studies involving HRQL outcomes for persons with multiple chronic medical conditions, as coexisting conditions may substantially affect outcomes of interest such as physical functioning, overall health status, depression and response rates in randomized controlled trials -55. Our Of the demographic factors studied, education level had the most important association with negative impact on patients' mental HRQL among patients with chronic pain-associated disability. Despite its recognized importance in health outcomes, education level and other measures of socioeconomic status have been infrequently examined as predictors of quality of life in IRD. Lower levels of formal education have been reported to be a risk factor for presence of chronic musculoskeletal pain and physical function in the community and has been associated with a higher prevalence of work disability and greater disease activity in patients with AS and RA ,38. The This study has several limitations that should be taken into account in interpreting the results. First, it is based in a tertiary referral Centre and patients with more severe IRD may be overrepresented. These results may, therefore, not be generalizable to all patients with IRD in the community. In addition, recall periods for the various measures differed. This discrepancy in recall time is common when using multiple self-report measures and is inherent in the measures. However self-report data are a valuable resource, and the problems encountered with self-report data are similar to those encountered in other forms of data collection. Second, the cross-sectional design limits the analysis about the associated factors with physical function and HRQL and does not allow to draw final conclusions about the strengths of the cause-effect relationships. The most of the literature on this issue are cross-sectional studies and not suited for statement or implications. Further, selection bias cannot be excluded. However, the relatively large group of patients was aged between 20 and 82 years, and the whole range of disease activity, physical functioning, and radiographic damage scores was represented, indicating a representative group of IRD patients.Despite to the limitations discussed above, our study confirms that the physical aspects of health seem to be most severely affected in patients with IRD although all dimensions of health were significantly affected, and in the PsA group of patients, the disease impact on mental health was considerable. A management programme for patients with IRD and the planning of the healthcare services should take these findings into account by maintaining the focus on impairment and physical function, but also focusing on the mental and social consequences of the disease. Longitudinal studies are, also, needed to examine how these quality of life measures change over time and respond to clinical and public health interventions.AS: Ankylosing Spondylitis; BASDAI: Bath Ankylosing Spondylitis Disease Activity index; BP: Bodily Pain; CI: Confidence Interval; DAS: Disease Activity Score; DMARDs: Disease Modyifing Anti-Rheumatic Drugs; GH: General Health; HRQOL: Health-Related Quality of Life; IRD: Inflammatory Rheumatic Diseases; MAPPING: MArche Pain Prevalence INvestigation Group; MCS: Mental Component Summary; MH: Mental Health; mSASSS: Modified Stoke Ankylosing Spondylitis Spine Score; PASI: Psoriasis Area and Severity Index; PCS: Physical Component Summary; PF: Physical Functioning; PRO: Patient-Reported Outcomes; PsA: Psoriatic Arthritis (PsA); RA: Rheumatoid Arthritis; RE: Role limitations due to emotional health; RP: Role limitations due to physical function; SCQ: Self-Administered Comorbidity Questionnaire; SD: Standard Deviation; SF: Social Functioning; SF-36: Short Form 36-item Health Survey; s-Score: Standardized difference scores; VT: Vitality.The authors would like to make the following statements with regard to their conflicts of interest/financial disclosures: MI was a full-time employee of Bristol-Myers Squibb's Italy, at the time of study completion. WG is a consultant for Bristol-Myers Squibb, Abbott Immunology, General Electric, Esaote and Shering-Plough, has received honorarium from Bristol-Myers Squibb, Abbott Immunology, General Electric, Schering-Plough and Wyeth, and has received research support from Abbott Immunology and Wyeth. The rest of the authors have any financial or other competing interests.FS was the primary researcher, was responsible for co-ordinating and managing the study on a day-to-day basis, for data collection, data analysis and input into writing the manuscript. MC provided radiological support for the study, was involved in designing the study and helped draft the manuscript. SG provided clinical support and was involved in designing the study. MI contributed to revising the manuscript. WG helped in the design and the interpretation and was involved in critically revising the important intellectual content of the document. All authors have read and approved the final manuscript.", "texts": ["The health-related quality of life (HRQL) is an important indicator of the burden of musculoskeletal disease. The Medical Outcome Study Short-Term 36 (SF-36) is the most used tool that evaluates HRQL as a subjective perception about psychological and physical limitations due to an underlying illness. The purpose of this study was to compare the HRQL scores among patients with rheumatoid arthritis (RA), psoriatic arthritis (PsA) and ankylosing spondylitis (AS) and a selected sample of health people and determine their relationship with measures of clinical condition.799 patients  accepted the invitation to participate. 1579 healthy controls were used for the comparison. We calculated scores for the eight SF-36 subscales, the Physical Component Summary (PCS) score, and the Mental Component Summary (MCS) score, according to published algorithms. Disease-related characteristics included disease duration, comorbidity, a measure for disease activity and for radiographic damage. The presence of comorbidity was ascertained through patient's self-reports by the Self-Administered Comorbidity Questionnaire (SCQ). Comparison were performed with respect to sex and age, and s-scores were calculated for comparison with the norm. Multivariate analyses were used to assess the relationship between HRQL and radiographic damage, disease activity, and socio-demographic data.The four inflammatory rheumatic diseases (IRD), compared to controls, significantly impaired all eight health concepts of the SF-36 (p < 0.0001) in both component PCS and MCS scores (p < 0.0001). Overall, the dimensions typically affected were physical functioning, limitations due to physical function, and bodily pain. The disease with the worst HRQL for those dimensions was RA. The multivariate analyses revealed that the physical component was influenced by a high disease activity and comorbidity. The severity of psoriatic lesions was associated with poor mental functioning in patients with PsA.Chronic IRD have a clearly detrimental effect on the HRQL in both sex and in age groups, and physical domain is more impaired than mental and social ones. Rheumatoid arthritis (RA), ankylosing spondylitis (AS), and psoriatic arthritis (PsA) are three common types of inflammatory rheumatic diseases (IRD) associated with deformities and joint destruction. RA is the most frequent IRD, with a prevalence of 0.5% . PatientTraditional methods of evaluation, with a focus on the locomotor system and measures of impairment, may fail to describe the extensive multi-dimensional issues associated with chronic rheumatic conditions. Consideration of HRQL has become increasingly important in decisions regarding resource allocation, intervention design, and pharmacological treatment with biologic agents of individuals with chronic inflammatory disabling conditions -16. Two The main objective of this study was to examine the self-reported health status in patients with RA, AS and PsA, compared with a selected sample of health people. Furthermore, we wanted to explore the associations between health status and age, sex of the patients, and educational level in these IRD and to estimate the burden of the disease by controlling for the normal variations in health status in the general population.Participants at this study are part of an ongoing longitudinal project measuring rheumatic disease outcomes, approved by the local Ethical Committee for Medical Research. Consecutive adult rheumatic disease patients from the Rheumatology Clinic of the Universit\u00e0 Politecnica delle Marche, who agreed to participate in the study, completed an informed consent form. The study population includes patients examined by two rheumatologists and fulfilling the American College of Rheumatology (ACR) classification criteria for RA , the modx-ray findings in patients with AS and with axial PsA. The mSASSS offers advantages in measurement properties and is the most appropriate method by which assessing progression of structural damage in AS [A comprehensive questionnaire package including socio-demographic data, quality of life items, and disease-related variables was administered to the patients. The socio-demographic variables were age, sex, and highest attained level of education . Disease-related characteristics included disease duration (years since fulfilment of the classification criteria of the IRD), comorbidity, a measure for disease activity and for radiographic damage. The Disease Activity Score (DAS)  was usedge in AS . The sevge in AS . The PASge in AS . The PASge in AS , an effige in AS .\u00ae, version 9.2 for Windows XP. Descriptive statistics are given as means and standard deviations (SD) for continuous data or as percentages for counts. Comparisons between groups were performed with chi-square tests for categorial variables and analysis of variance (ANOVA) for continuous variables. Standardized difference scores  were also calculated by subtracting the mean scores of the patients from the mean scores of the general population, followed by the division of these deviations by each scale's standard deviation in the general population. The standardized s-score is a rescaled score with a population average of 0 and a standard deviation of 1. The values of the s-scores were interpreted according to Cohen's effect size index, in which 0.2 refers to a small difference, 0.5 to a moderate difference, and 0.8 or more to a large difference [a priori included sex ; age (as a continuous variable); disease duration (years from disease onset as a continuous variable); educational level (years of education as a continuous variable); and the average score of the SCQ questionnaire (SCQ score as a continuous variable). All these factors were then introduced as covariates in multiple regression models in which PCS and MCS SF-36 scores were dependent variables. All variables were entered simultaneously. Owing to multiple comparisons with increasing risk of type 1 errors, the level of statistical significance was set at 0.01.The data were analysed using the SPSS version 11.0 , and MedCalcfference . A set oDemographics and disease characteristics of patients and healthy controls enrolled in the study are shown in Table Scores for respondents with IRD significantly impaired all eight health concepts of the SF-36 p < 0.0001) and in both component summary scores (PCS and MCS) (p < 0.0001), compared with their non-arthritic counterparts Table . General and in ba priori included the demographic variables, disease related characteristics and the and average score of the SCQ questionnaire. All these factors were introduced as covariates in multiple regression models in which PCS and MCS SF-36 summary scores  were dependent variables. The physical component of the SF-36 was influenced by a high disease activity (measured by DAS) and chronic comorbidity (both at a p level < 0.0001), and by radiographic damage (p = 0.004) in RA. A similar association of chronic comorbidity and high disease activity with AS, peripheral PsA, and axial PsA were also found. Concerning the mental component, an association was found in RA with the disease activity (p < 0.0001), and in AS and axial PsA with the low educational level . The severity of psoriatic lesions (assessed using PASI) was significantly associated with poor mental functioning in patients with peripheral and axial PsA .Multiple regression models were constructed to adjust for factors potentially associated with poor HRQL in the four IRD groups. Covariates chosen Patient-reported outcomes (PRO) are an attractive option in a busy medical practice, as the time burden is transferred from the clinician to the patient . The valThe results of this study show that adults with IRD have poorer self-reported health status than those without arthritis in all domains of living, but particularly with respect to scales measuring aspects of physical functioning or mobility, role limitation due to physical health problems and usual activities, and bodily pain. The disease with the worst HRQL for physical dimensions of SF-36 was RA. The mean PCS score for RA patients was 32.5, approximately two standard deviations below the mean observed in the Italian general population ,38. BaseThe findings of the multivariate analysis suggests that the SF-36 PCS scores may reflect both functional limitations due to current disease activity due to processes that do not respond to aggressive treatment with anti-rheumatic drugs and limitations due to the radiographic damage and coexisting conditions. Kirwin , similarThe outcomes of a chronic condition may be also affected by coexisting chronic conditions. It is important to incorporate assessment of comorbidity into studies involving HRQL outcomes for persons with multiple chronic medical conditions, as coexisting conditions may substantially affect outcomes of interest such as physical functioning, overall health status, depression and response rates in randomized controlled trials -55. Our Of the demographic factors studied, education level had the most important association with negative impact on patients' mental HRQL among patients with chronic pain-associated disability. Despite its recognized importance in health outcomes, education level and other measures of socioeconomic status have been infrequently examined as predictors of quality of life in IRD. Lower levels of formal education have been reported to be a risk factor for presence of chronic musculoskeletal pain and physical function in the community and has been associated with a higher prevalence of work disability and greater disease activity in patients with AS and RA ,38. The This study has several limitations that should be taken into account in interpreting the results. First, it is based in a tertiary referral Centre and patients with more severe IRD may be overrepresented. These results may, therefore, not be generalizable to all patients with IRD in the community. In addition, recall periods for the various measures differed. This discrepancy in recall time is common when using multiple self-report measures and is inherent in the measures. However self-report data are a valuable resource, and the problems encountered with self-report data are similar to those encountered in other forms of data collection. Second, the cross-sectional design limits the analysis about the associated factors with physical function and HRQL and does not allow to draw final conclusions about the strengths of the cause-effect relationships. The most of the literature on this issue are cross-sectional studies and not suited for statement or implications. Further, selection bias cannot be excluded. However, the relatively large group of patients was aged between 20 and 82 years, and the whole range of disease activity, physical functioning, and radiographic damage scores was represented, indicating a representative group of IRD patients.Despite to the limitations discussed above, our study confirms that the physical aspects of health seem to be most severely affected in patients with IRD although all dimensions of health were significantly affected, and in the PsA group of patients, the disease impact on mental health was considerable. A management programme for patients with IRD and the planning of the healthcare services should take these findings into account by maintaining the focus on impairment and physical function, but also focusing on the mental and social consequences of the disease. Longitudinal studies are, also, needed to examine how these quality of life measures change over time and respond to clinical and public health interventions.AS: Ankylosing Spondylitis; BASDAI: Bath Ankylosing Spondylitis Disease Activity index; BP: Bodily Pain; CI: Confidence Interval; DAS: Disease Activity Score; DMARDs: Disease Modyifing Anti-Rheumatic Drugs; GH: General Health; HRQOL: Health-Related Quality of Life; IRD: Inflammatory Rheumatic Diseases; MAPPING: MArche Pain Prevalence INvestigation Group; MCS: Mental Component Summary; MH: Mental Health; mSASSS: Modified Stoke Ankylosing Spondylitis Spine Score; PASI: Psoriasis Area and Severity Index; PCS: Physical Component Summary; PF: Physical Functioning; PRO: Patient-Reported Outcomes; PsA: Psoriatic Arthritis (PsA); RA: Rheumatoid Arthritis; RE: Role limitations due to emotional health; RP: Role limitations due to physical function; SCQ: Self-Administered Comorbidity Questionnaire; SD: Standard Deviation; SF: Social Functioning; SF-36: Short Form 36-item Health Survey; s-Score: Standardized difference scores; VT: Vitality.The authors would like to make the following statements with regard to their conflicts of interest/financial disclosures: MI was a full-time employee of Bristol-Myers Squibb's Italy, at the time of study completion. WG is a consultant for Bristol-Myers Squibb, Abbott Immunology, General Electric, Esaote and Shering-Plough, has received honorarium from Bristol-Myers Squibb, Abbott Immunology, General Electric, Schering-Plough and Wyeth, and has received research support from Abbott Immunology and Wyeth. The rest of the authors have any financial or other competing interests.FS was the primary researcher, was responsible for co-ordinating and managing the study on a day-to-day basis, for data collection, data analysis and input into writing the manuscript. MC provided radiological support for the study, was involved in designing the study and helped draft the manuscript. SG provided clinical support and was involved in designing the study. MI contributed to revising the manuscript. WG helped in the design and the interpretation and was involved in critically revising the important intellectual content of the document. All authors have read and approved the final manuscript."]}
-{"representative": "In 2005 a collaboration between public health and local government authorities performed an HIA on the Christchurch Urban Development Strategy Options paper in New Zealand. The findings of this were incorporated into the Greater Christchurch Urban Development Strategy;using multiple qualitative methodologies including key informant interviews, focus groups and questionnaires, this study performs process and impact evaluations of the Christchurch HIA including evaluation of costs and resource use;the evaluation found that the HIA had demonstrable direct impacts on planning and implementation of the final Urban Development Strategy as well as indirect impacts on understandings and ways of working within and between organisations. It also points out future directions and ways of working in this successful collaboration between public health and local government authorities. It summarises the modest resource use and discusses the important role HIA can play in urban planning with intersectoral collaboration and enhanced relationships as both catalysts and outcomes of the HIA process;as one of the few evaluations of HIA that have been published to date, this paper makes a substantial contribution to the literature on the impact, utility and effectiveness of HIA. Health impact assessment (HIA) has been promoted for over twenty years as a way to enhance the potential effects of a policy or strategy \"on the health of a population, and the distribution of those effects within the population \" . HIA useAlthough the term 'health inequalities' is relatively new, the effect of urbanisation to disadvantage the poor was noted over one hundred and fifty years ago. Urban planning plays an important role in shaping the environmental, social and economic health determinants in cities -9.Evaluations of Health Impact Assessments have been infrequently performed, and rarely published. Evaluation of HIA has been identified as the field of HIA research most urgently requiring attention ,10-15. WThe Greater Christchurch Urban Development Strategy HIA (UDS HIA) provided an opportunity for both a process and an impact evaluation. Process and impact evaluations allowed review of the HIA itself and its impacts on policy over a medium term time frame (two to three years). While outcome evaluation to determine validity of HIA predictions and changes in health and health determinants is the most desirable measure of success of an HIA, in reality the 20 \u2013 30 year time frame required and numerous factors that impact on health outcomes make it difficult if not impossible to perform. The process evaluation was undertaken concurrently with the HIA being conducted in 2005, while the impact evaluation was undertaken in 2008.This report adds to the limited existing literature on evaluation of HIA. The process evaluation sought to answer whether this HIA achieved its objectives, identify success factors and to quantify resources use. The impact evaluation's objectives were to describe the impacts of the HIA on the final UDS, including possible reasons for inclusion, describe unintended impacts of the HIA and evaluate the effectiveness of HIA in policy. Points are discussed in detail and several conclusions made for future evaluations of HIAs.In New Zealand central, regional and local government each have a role in urban development and planning in New Zealand. The Regional Council has responsibility for preparing the Regional Policy Statement under the Resource Management Act. This sets the direction for managing the region's natural resources and outlines the settlement pattern for a region. Local councils must give effect to the Regional Policy Statement through their District Plans which provide the framework for the management of land use and subdivision.Incorporation of Treaty of Waitangi principles is implicit in HIA in New Zealand . HIA speThe Greater Christchurch UDS is an initiative in the Canterbury region of New Zealand, involving local government authorities (Christchurch City Council (CCC), Waimakariri and Selwyn District Councils, and Environment Canterbury  and Transit New Zealand . The Strategy seeks to guide urban growth in the Greater Christchurch region over the next forty years with predictions that the region's current population of 380000 will have grown to 500000 .In April 2005, a public consultation document on options for growth and development in the greater Christchurch region was made public. It summarised key issues and presented three options for managing growth as: concentration, consolidation and dispersal versus the 'business as usual' option (where urban growth is less regulated and driven by private developer demand). Of 3250 feedback forms received, 62% supported the Concentration option. This focussed 60% of new housing in urban renewal and 40% in new land release subdivisions.In June 2005 Community and Public Health, a division of the Canterbury District Health Board (CDHB) proposed to CCC staff that they perform a Health Impact Assessment on the options document of the Greater Christchurch UDS . The CCCThe specific aims and objectives of the HIA were:I. To provide evidence about the links between urban development and health for decision-making;II. To assess the positive and negative health impacts of the UDS and provide recommendations to increase positive and decrease negative inputs;III. To strengthen partnerships working between sectors and ensure appropriate participation of the community including those that are vulnerable due to social exclusion;IV. To involve M\u0101ori in all levels of the HIA process; andV. To build capacity and knowledge of HIAs in Christchurch and New Zealand.Interestingly the HIA did not explicitly include any aims and objectives relating to maximising the extent and distribution of positive health impacts and mitigating negative health impacts, though this may be because these objectives were regarded as axiomatic of all HIAs. The HIA followed the standard HIA process of screening, scoping, appraising and evaluation . An init\u2022 Screening the UDS to determine if it was suitable for an HIA to be conducted;\u2022 Scoping the HIA;\u2022 Eight rapid appraisal workshops in technical areas (two to four hours each);\u2022 Literature reviews and summaries\u2022 Report-back to workshop participants via the Internet and a summary meeting;\u2022 Circulating the draft HIA report to key stakeholders, then presenting it to the UDS Management Team and Forum \u2022 Concurrent process evaluation.Scoping led to a focus on six determinants of health: air, waste, water, social connectedness, housing and transport. Waste was subsequently omitted due to resource constraints. A further working group was developed around engaging with local M\u0101ori who were significantly under-represented in the UDS consultation process. Only 1.5% of the 3250 respondents to the UDS Options document were M\u0101ori, yet M\u0101ori make up 7.3% of the population of Canterbury and have the poorest health status of any ethnic group in New Zealand . The UDSThe process and impact evaluations followed published evaluation methodologies ,15,24. AProcess and impact evaluations used multiple qualitative research methodologies  as primary methods of data gathering to maximise data richness and understanding. Findings were analysed thematically and triangulated using different methods to examine the same issue, to increase the reliability of findings. Greater detail on methods and all aspects of the evaluations is available in the original evaluation reports ,26.Objectives of the process evaluation were to assess whether this HIA achieved its stated objectives, to identify critical success factors and opportunities for improvements in the process, and to quantify resource use.Four of the eight HIA workshops were evaluated by participant observation, a review of the workshop report and HIA outputs including reports and other documentation, and surveys completed by workshop participants. A single focus group was held. The surveys of workshop participants used open-ended questions and Likert scales. The documentary analysis was undertaken on working group minutes, key reports and background documents. Resource-use was measured and hours estimated by a questionnaire filled in by project and human resources staff of CDHB. Hourly rates were based on salaries in 2005 and all comparisons with international HIA costings use US Dollars at December, 2005 exchange rates.The objectives of the impact evaluation were to assess what changes to decision-making and implementation had occurred as a result of doing the HIA, and what other indirect impacts had eventuated, such as changes to cross-sectoral relationships, engagement with M\u0101ori, and knowledge and understanding of HIA. Key informant interviews used a semi-structured format. The interview schedule included in Table Stakeholders from the original key informant sample, as well as a local government politician from that time, and members of the Urban Forum and local government staff involved in implementation of the UDS were provided with a briefing report summarising findings from key informant interviews and the document analysis, and invited to a full-day HIA impact evaluation workshop in April 2008. Fourteen people attended the workshop. Data was thematically analysed to identify emerging patterns. Both evaluations specifically sought to identify unintended impacts of the HIA as well as to describe aspired impacts that had not been achieved.The document review included the final UDS , HIA repResults for both the process and impact evaluation will be presented in an integrated format which synthesises findings rather than separate reporting of each qualitative methodology used. Roman numerals used in reporting results relate to relevant HIA objectives.Findings of the process evaluation are described against the HIA objectives (listed earlier) as it sought to evaluate whether these had been fulfilled, and in a table summarising resources used Table .hui  and presentation of the UDSHIA report at the Urban Forum [Key stakeholders reported during the process evaluation that the HIA had fulfilled all five of its objectives. The HIA report was regarded as having provided a comprehensive literature review of evidence to support decision making. Each working group was supported by a literature review summarising the key health impacts of different urban development approaches which included literature search strategies and search terms used, and multiple citations of peer-reviewed literature . The recan Forum . The UDSMost participants were very positive about involvement in the HIA and felt it facilitated new cross-sectoral relationships, was enjoyable, and met its objectives. They described the HIA as important and groundbreaking in both Canterbury and New Zealand and commented on its importance in relationship-building, particularly in the M\u0101ori working group. There was strong support for the cross-sectoral workshops with several participants in both waste and water workshops  \u2013 a Crown Research Institute) describing workshops as a first ever occasion where all the people working on that issue were seated together in one room, and considered this led to opportunities for working together. Two participants in technical workshops felt the HIA added little new information and was a poor use of their time.Questionnaire respondents described the social connectedness workshops as particularly effective at ensuring a participatory process for the community. Three social connectedness workshops were held with many high-needs groups such as new immigrants, mental health consumers, Pacific people, and beneficiaries represented. A disabled group and representative of the Chinese association particularly described value in this workshop and felt it had increased their 'voice' for being heard in the UDS consultation process.The primary issues identified restricting the conduct of the HIA was the time limitation (only four months) and limited human resource .Most of the costs in Table This section details whether HIA objectives were met, impacts on policy, impacts of individual HIA objectives, indirect and aspired impacts and ideas for future directions of HIA in Canterbury.The final HIA report was presented to the Greater Christchurch Urban Forum in November 2005 and published in April 2006 . CCC's cThe final UDS Strategy  includesThe UDS document is nearly 200 pages long with an initial background and context section. It describes the Top Twenty Priority Actions for the next three years to ensure necessary governance structures and implementation frameworks (p34\u201336) . This is\u2022 Explanation (why an action is being undertaken);\u2022 Growth issues (summary of issues identified in consultation process);\u2022 Key approaches (policy approaches to be taken that will guide action implementation);\u2022 Actions \u2013 which use a tabular format and cover Action, Lead agency, Support agencies, Cost implications, Implementation tools, Links to strategy and Timing.The process of assessing and incorporating HIA recommendations into the UDS was described by key informants as informal. Responsibility for decision-making rested with planning and policy making staff at CCC responsible for the UDS. They described having read and considered the HIA report while preparing the policy document. In some sections the HIA recommendations were directly translated into UDS 'policy approaches' but not necessarily into the action tables. For example, in the transport section the HIA recommended \"Minimise adverse effects on communities when constructing and developing arterial roads (p 50) . The UDSA key impact of the HIA within the final UDS was the inclusion of a new section in the final Strategy titled \"Health and Well-being\" authored by the HIA project leader. This section includes an explanation of Health's inclusion in the strategy. Health indicators, however, were not mentioned in Priority Action Number Thirteen where other similar indicators were located.Of four general recommendations, only the one recommending that HIA is incorporated into the development and analysis of UDS policy was included in the final UDS.four of six recommendations were included in the UDS, but only two translated into action points. A recommendation on the need for cross-sectoral collaborative working groups was not included.four of five recommendations, with two related action points, were included in the UDS. The HIA recommendation advocating for a cross-sectoral steering group for water resource management in the region, with Ng\u0101i Tahu (the M\u0101ori tribe or 'iwi' who are 'tangata whenua' (people of the land) in Canterbury) representation, was not included in the UDS.all six HIA recommendations with five linked action points were included in the UDS. The Top Twenty Priority Actions also included two generic actions around social connectedness (Numbers Sixteen and Nineteen).three of four HIA recommendations with two action points were included.five of seven HIA recommendations were included in the UDS with four action points linked to these.the single HIA recommendation, with a linked action point was included in the UDS. None of the Top Twenty Priority Actions deals explicitly with M\u0101ori development/concerns.Other impacts of the HIA on local government policy were also described by key informants and workshop attendees. A key informant described that the HIA catalysed partnerships that contributed to amendments made to the Natural Resources Regional Plan (NRRP) .Some policies were described to have had a direct and attributable link to the HIA  . Other pSeveral key informants described the HIA and its process as leading to a deeper consideration of health and inequalities in City Council policies. They described the HIA as giving permission for social and health principles to be included to a greater extent in CCC strategies and programmes.\"We realised there was another whole sector that could swing in support of the UDS... to have health people there mucking in behind in support of densification and consolidated urban design option was really fantastic.\" Senior Policy Maker, Environment CanterburyImpact evaluation workshop participants and key informants described ongoing frequent contact between the key organisations which had been facilitated by relationships developed during the HIA. Local government and health board key informants described the HIA as facilitating different sectors in learning a new vocabulary and language. For example, where local government have talked of 'social development' and 'equity', health people would use the terms 'health outcomes' and 'health inequalities'.Key informants described relationships built during the HIA as contributing to the launching of the electronic network, the South Island Public Health Analysis Information Base. This provides an interactive bulletin board, archive, and e-discussion for public health and local government throughout the South Island, with administration resting with Environment Canterbury and CDHB. Analysis of use of the SIPHAN information base on 8 April, 2008 showed there were 71 registered users and 152 posts, viewed a total of 1793 times.Key informants in both local government and CDHB described the creation of a new public health physician post within local government as an impact attributable to the HIA. The HIA was considered to have given local government a new perspective on the skills and knowledge a public health person could provide as well as a clear track record that illustrated the benefits of input from a public health trained person. Serendipitous factors at play in particular included the support of a local government manager with core training in health as well as experience in management in the health sector and strong interest expressed in filling this role by the HIA project manager.\"It was not so much the event but the process of the HIA which has cemented relationships\" M\u0101ori consultation stream leader, CDHBNg\u0101i Tahu had been invited to be part of the UDS Forum but their contribution and role prior to the process of the HIA was limited. The HIA M\u0101ori working group was led by a M\u0101ori public health physician who used the opportunity of the HIA to build relationships between the CDHB and M\u0101ori in Canterbury through meetings, hui and particularly through facilitating the visit of a M\u0101ori urban design specialist. Several key informants described the HIA's strong focus on M\u0101ori and felt this facilitated the subsequent re-engagement of M\u0101ori in the UDS Forum and final policy.This engagement was illustrated with the participation of Ng\u0101i Tahu in the Urban Forum, subsequent to the HIA, as well as the endorsement of the UDS by Mark Solomon, Kaiwhakahaere of Te Runanga o Ng\u0101i Tahu (CEO of the Governing body of the Ng\u0101i Tahu tribe) .\"This has been the most ambitious HIA done in New Zealand to date \u2013 and what's more, the ambitious size and scope of it were matched by its delivery.\"HIA consultant, CanterburyDissemination of the HIA results and process followed resulted in publications and presentations with national and international recognition of the HIA. Many of the key informants felt that this HIA had given credibility to the approach of HIA among local government policy makers both regionally and nationally. Key informants described this HIA as high profile and successful.Key informants as well as workshop participants described what they saw as the success factors coming out of this HIA. The factors most frequently identified were strong leadership of the project and the creation of a public health physician position in the CCC and CDHB, jointly funded by both organisations. Several key informants reported that this nurtured many of the impacts of the HIA. This is the first joint appointment by a health board and local authority in New Zealand, and was described as a good example of the goodwill and effective relationships between health and local government developed through the HIA.A third success factor described was strong cross-sectoral relationships. The entire HIA used collaborative process between CDHB, CCC and Environment Canterbury. Working and steering groups included members of different organisations and successful cross-sectoral relationships such as the CCC guide for Health Promotion and Sustainability  jointly A fourth success factor described was the thorough documentation and dissemination of the HIA \u2013 which included writing up of the HIA in peer-reviewed journals ,23 as weIt 'feels' like we're bringing health into our planning more consistently and organically \u2013 especially at the CCC office level \u2013 but there's lots more to do at an executive and political level.\" Programme Manager \u2013 CCCKey informants described a change in ways of working attributable to the HIA. In the CDHB, HIAs are described as now being formally part of core business for the Division of Community and Public Health within CDHB. This HIA was felt to have catalysed a new focus on sustainability issues and for the CDHB Risk Management Committee to work on higher level policies. The HIA was considered to have led to further HIAs including the Central Plains Water Scheme (CPWS) HIA  and the Within the CCC, the HIA was described as a tool that has synergised well with the Local Government Act 2002 which provides the general framework and powers under which New Zealand's 85 democratically elected and accountable local authorities operate . The LocMany of those involved in policy making described increased understanding of health impacts. Examples of this include the use of the Healthy Housing Index on Council housing stock , in the Several key informants and workshop participants described a strategic plan like the UDS as limited by regulatory mechanisms within New Zealand's Resource Management Act 1991 . This liUniversally, workshop attendees felt that greater dedicated human and financial resourcing for the HIA could have allowed the identification and appraisal of a broader range of determinants of health. For example, the 'waste' health determinant stream was withdrawn due to resource constraints. This would have provided a more comprehensive assessment of potential positive and negative, intended and unintended health impacts.Several key informants felt that HIA as a practice has achieved minimal integration into the larger CDHB's core business. This theme recurred within the CCC, where HIA was considered to be useful and part of practice in some areas yet unheard of in others. Concern around lack of diffusion of HIA within organisations is repeated at the national level where disappointment was expressed that HIA has been used minimally by central government in New Zealand.One key informant described inequalities as inadequately explored by the HIA process, with examples such as the differential equity impacts of urban densification on private outdoor space, and increased storm water run-off possibly leading to damp housing. A concern expressed at the workshop was that using a participatory HIA approach can increase the time required for policy formation, limiting potential responsiveness and agility of policy development processes.A final section of the HIA impact evaluation workshop focussed on what should be done differently by partner organisations to achieve significant changes in health determinants in the future. Ideas arising from the workshop included:\u2022 Requiring public organisations, such as local government and DHBs, to engage with strategic partner organisations before writing Long Term Council Community Plans (LTCCP) and District Annual Plans so that policy impacts on health determinants are considered routinely. This would embed HIA in these processes at an early stage, which it is not required for the end product;\u2022 Leaders of key partner organisations invite other leaders to share in formation of strategic vision and planning. This could expand to make collaborative work requisite, such as a percentage of each employees time is allocated to work in another organisation to achieve mutual shared objectives, secondments, and the development of common public information portals e.g. linked Intranet for all public agencies.The paper sets out the process and impact evaluations of the UDS HIA providing a valuable addition to the sparse area of HIA research. Evaluation indicates the HIA was carried out with an effective process, requiring moderate resources to achieve significant direct and indirect impacts. These impacts are related to: policy change and organisational culture change among organisations involved in the HIA; improved cross-sectoral relationships; and increasing recognition of the HIA tool more widely in Canterbury and New Zealand. There are a number of important issues arising from these evaluations including the cost-effectiveness of HIAs, the role of HIAs in cross-sectoral work, enabling factors to increase uptake of HIA recommendations by decision makers, possible factors limiting further HIA impacts as well as methodological issues with these evaluations.Resource use is rarely described, but has been summarised in three papers -45. Othe. This would be one method to standardise cost calculation and allow legitimate comparison between HIAs. The method used for cost calculation in the UDS HIA was very similar to that used in this online calculator. A summary of costs of HIAs in Europe in the last decade ranged from $US 5720 to $US180325 depending on the level and type of HIA but excluding desktop HIAs [Costs for HIAs are calculated in diverse ways and these are infrequently described, however attempts to summarise costing have been performed -45,48. Ttop HIAs . Other Htop HIAs  to $US15top HIAs . As detaDetails of cost are included in this paper to provide transparent information about the resources investment and to assist future cost utility analyses of completed HIAs.The sums in Table The importance of cross-sectoral collaboration described in key informant interviews and by workshop attendees is one of the key impacts of this HIA. It has facilitated further shared work, a joint position funded by health and local government and multiple examples of collaborative work. Cross-sectoral collaboration is a key indirect impact identified in other HIA papers -52. HowePossible reasons for non-inclusion of the cross-sectoral recommendations are: the time and energy required for such groups to be representative and function well; feared loss of control by local government; regulatory restriction on cross-sectoral work ; and individual organisations' reporting constraints and tight timelines for projects meaning low priority for cross-sectoral work. These omissions in the UDS could lead to negative health impacts over time.In New Zealand legislation (as elsewhere) there is a lack of clarity about which agencies have overall responsibility for determinants of health as they are intrinsically cross-sectoral in nature. Yet individual legislation such as the Land Transport Act 2003, the Building Act 2004 and the Local Government Act 2002 do include public health objectives . These pThe potential for HIA as a bridge to increase cross-sectoral work has been increasingly recognised internationally and by the key players in this HIA. An analysis of a container port development that used a cross-sectoral approach  found beOver two thirds (24 of 33) of the HIA recommendations were included in the final UDS policy. This HIA included all the enablers related to decision makers and policy process described by Davenport et al in their review of enablers in 88 HIAs . These iThe absence of a health determinants focus in the Twenty Priority Actions of the UDS suggests that monitoring health determinants and outcomes is not considered a key responsibility of local authorities. Some local government planners argue health indicators are a sub-set of social indicators, yet explicit inclusion of health indicators could increase focus on health outcomes.HIA has been described as particularly effective at increasing understanding of health determinants in local government settings in Australia  and New This paper finds that the UDS HIA was an important tool which has supported changes in planning and policy among partner organisations, but also describes that impacts have been less than hoped for. Lack of diffusion of HIA within and across larger organisations was reported by CCC and CDHB, yet other informants suggest significant gains were achieved with this single HIA and subsequent HIAs in the region promise to build on this base. Others have described HIA uptake in \"silos\" in local government but suggest that effective HIAs lead to wider dissemination within organisations .The concern expressed at the impact evaluation workshop that HIA can reduce responsiveness of policy making and increase time-frames for policy development has been described elsewhere ,52,57. YWorking party members described that while the HIA itself had strong leadership , leaders of the HIA's partner organisations also needed conviction and enthusiasm for the HIA to achieve greater adoption. A review of ways that HIA can be made most useful to local government in New South Wales (NSW) echoes this. The author suggests selecting the best HIA steering committee and overcoming 'silos' in councils as two factors for HIA success in local government . This reThis evaluation used a multi-method qualitative methodology to gather information on the impacts of the HIA. The depth and breadth of the analysis was potentially limited by the unavailability of three identified key informants for interview and competing work priorities limiting participation at workshops. The evaluator was an employee of CDHB at the time of the process evaluation, which may have influenced the candour of participants and therefore influenced the analysis.The HIA of the Draft Greater Christchurch UDS was broadly successful and effective with significant direct and indirect impacts. It strengthened cross-sectoral partnerships which have led onto further initiatives, including a new position created for a Public Health Physician in the Christchurch City Council, and work commenced by CDHB and CCC on a City Health Plan and subsequent HIAs.This HIA has contributed to a more prominent role for health on the local government agenda and improved knowledge of a social determinants model of health by non-health professionals and the public. Significantly, the majority of the HIA recommendations have been adopted by the policy body \u2013 the Greater Christchurch Urban Development Forum. The HIA process has also contributed to policy implementation such as amendments to the NRRP . There hPermeation of a health determinants approach (as provided by the HIA tool) into the tissue of the larger UDS partner organisations is yet to happen. Currently 'health' organisations continue to be dominated by health services provision with little focus on changing health determinants. Ongoing and even greater commitment to changing health determinants by health and local government is essential to achieve long-term health outcomes.The inclusion of the health determinants defined in this HIA into the long-term Greater Christchurch UDS increases opportunity for a healthy urban environment, and therefore healthy citizens of the Greater Christchurch area. This paper adds to the limited literature that evaluates HIAs. It evaluates the UDS HIA as a generally highly successful process, with significant impacts that achieved its purposes. This in turn can increase the confidence of policy makers and funders in the value HIA as a tool that can lead to improved health for the community.CCC: Christchurch City Council; CDHB: Canterbury District Health Board; HIA: Health Impact Assessment; UDS: Urban Development Strategy.The authors declare that they have no competing interests.KM responsible for methods, primary research and first draft of paper and revision of subsequent drafts. BHR supported with literature review, drafting of the paper and revision of subsequent drafts.The pre-publication history for this paper can be accessed here:", "texts": ["In 2005 a collaboration between public health and local government authorities performed an HIA on the Christchurch Urban Development Strategy Options paper in New Zealand. The findings of this were incorporated into the Greater Christchurch Urban Development Strategy;using multiple qualitative methodologies including key informant interviews, focus groups and questionnaires, this study performs process and impact evaluations of the Christchurch HIA including evaluation of costs and resource use;the evaluation found that the HIA had demonstrable direct impacts on planning and implementation of the final Urban Development Strategy as well as indirect impacts on understandings and ways of working within and between organisations. It also points out future directions and ways of working in this successful collaboration between public health and local government authorities. It summarises the modest resource use and discusses the important role HIA can play in urban planning with intersectoral collaboration and enhanced relationships as both catalysts and outcomes of the HIA process;as one of the few evaluations of HIA that have been published to date, this paper makes a substantial contribution to the literature on the impact, utility and effectiveness of HIA. Health impact assessment (HIA) has been promoted for over twenty years as a way to enhance the potential effects of a policy or strategy \"on the health of a population, and the distribution of those effects within the population \" . HIA useAlthough the term 'health inequalities' is relatively new, the effect of urbanisation to disadvantage the poor was noted over one hundred and fifty years ago. Urban planning plays an important role in shaping the environmental, social and economic health determinants in cities -9.Evaluations of Health Impact Assessments have been infrequently performed, and rarely published. Evaluation of HIA has been identified as the field of HIA research most urgently requiring attention ,10-15. WThe Greater Christchurch Urban Development Strategy HIA (UDS HIA) provided an opportunity for both a process and an impact evaluation. Process and impact evaluations allowed review of the HIA itself and its impacts on policy over a medium term time frame (two to three years). While outcome evaluation to determine validity of HIA predictions and changes in health and health determinants is the most desirable measure of success of an HIA, in reality the 20 \u2013 30 year time frame required and numerous factors that impact on health outcomes make it difficult if not impossible to perform. The process evaluation was undertaken concurrently with the HIA being conducted in 2005, while the impact evaluation was undertaken in 2008.This report adds to the limited existing literature on evaluation of HIA. The process evaluation sought to answer whether this HIA achieved its objectives, identify success factors and to quantify resources use. The impact evaluation's objectives were to describe the impacts of the HIA on the final UDS, including possible reasons for inclusion, describe unintended impacts of the HIA and evaluate the effectiveness of HIA in policy. Points are discussed in detail and several conclusions made for future evaluations of HIAs.In New Zealand central, regional and local government each have a role in urban development and planning in New Zealand. The Regional Council has responsibility for preparing the Regional Policy Statement under the Resource Management Act. This sets the direction for managing the region's natural resources and outlines the settlement pattern for a region. Local councils must give effect to the Regional Policy Statement through their District Plans which provide the framework for the management of land use and subdivision.Incorporation of Treaty of Waitangi principles is implicit in HIA in New Zealand . HIA speThe Greater Christchurch UDS is an initiative in the Canterbury region of New Zealand, involving local government authorities (Christchurch City Council (CCC), Waimakariri and Selwyn District Councils, and Environment Canterbury  and Transit New Zealand . The Strategy seeks to guide urban growth in the Greater Christchurch region over the next forty years with predictions that the region's current population of 380000 will have grown to 500000 .In April 2005, a public consultation document on options for growth and development in the greater Christchurch region was made public. It summarised key issues and presented three options for managing growth as: concentration, consolidation and dispersal versus the 'business as usual' option (where urban growth is less regulated and driven by private developer demand). Of 3250 feedback forms received, 62% supported the Concentration option. This focussed 60% of new housing in urban renewal and 40% in new land release subdivisions.In June 2005 Community and Public Health, a division of the Canterbury District Health Board (CDHB) proposed to CCC staff that they perform a Health Impact Assessment on the options document of the Greater Christchurch UDS . The CCCThe specific aims and objectives of the HIA were:I. To provide evidence about the links between urban development and health for decision-making;II. To assess the positive and negative health impacts of the UDS and provide recommendations to increase positive and decrease negative inputs;III. To strengthen partnerships working between sectors and ensure appropriate participation of the community including those that are vulnerable due to social exclusion;IV. To involve M\u0101ori in all levels of the HIA process; andV. To build capacity and knowledge of HIAs in Christchurch and New Zealand.Interestingly the HIA did not explicitly include any aims and objectives relating to maximising the extent and distribution of positive health impacts and mitigating negative health impacts, though this may be because these objectives were regarded as axiomatic of all HIAs. The HIA followed the standard HIA process of screening, scoping, appraising and evaluation . An init\u2022 Screening the UDS to determine if it was suitable for an HIA to be conducted;\u2022 Scoping the HIA;\u2022 Eight rapid appraisal workshops in technical areas (two to four hours each);\u2022 Literature reviews and summaries\u2022 Report-back to workshop participants via the Internet and a summary meeting;\u2022 Circulating the draft HIA report to key stakeholders, then presenting it to the UDS Management Team and Forum \u2022 Concurrent process evaluation.Scoping led to a focus on six determinants of health: air, waste, water, social connectedness, housing and transport. Waste was subsequently omitted due to resource constraints. A further working group was developed around engaging with local M\u0101ori who were significantly under-represented in the UDS consultation process. Only 1.5% of the 3250 respondents to the UDS Options document were M\u0101ori, yet M\u0101ori make up 7.3% of the population of Canterbury and have the poorest health status of any ethnic group in New Zealand . The UDSThe process and impact evaluations followed published evaluation methodologies ,15,24. AProcess and impact evaluations used multiple qualitative research methodologies  as primary methods of data gathering to maximise data richness and understanding. Findings were analysed thematically and triangulated using different methods to examine the same issue, to increase the reliability of findings. Greater detail on methods and all aspects of the evaluations is available in the original evaluation reports ,26.Objectives of the process evaluation were to assess whether this HIA achieved its stated objectives, to identify critical success factors and opportunities for improvements in the process, and to quantify resource use.Four of the eight HIA workshops were evaluated by participant observation, a review of the workshop report and HIA outputs including reports and other documentation, and surveys completed by workshop participants. A single focus group was held. The surveys of workshop participants used open-ended questions and Likert scales. The documentary analysis was undertaken on working group minutes, key reports and background documents. Resource-use was measured and hours estimated by a questionnaire filled in by project and human resources staff of CDHB. Hourly rates were based on salaries in 2005 and all comparisons with international HIA costings use US Dollars at December, 2005 exchange rates.The objectives of the impact evaluation were to assess what changes to decision-making and implementation had occurred as a result of doing the HIA, and what other indirect impacts had eventuated, such as changes to cross-sectoral relationships, engagement with M\u0101ori, and knowledge and understanding of HIA. Key informant interviews used a semi-structured format. The interview schedule included in Table Stakeholders from the original key informant sample, as well as a local government politician from that time, and members of the Urban Forum and local government staff involved in implementation of the UDS were provided with a briefing report summarising findings from key informant interviews and the document analysis, and invited to a full-day HIA impact evaluation workshop in April 2008. Fourteen people attended the workshop. Data was thematically analysed to identify emerging patterns. Both evaluations specifically sought to identify unintended impacts of the HIA as well as to describe aspired impacts that had not been achieved.The document review included the final UDS , HIA repResults for both the process and impact evaluation will be presented in an integrated format which synthesises findings rather than separate reporting of each qualitative methodology used. Roman numerals used in reporting results relate to relevant HIA objectives.Findings of the process evaluation are described against the HIA objectives (listed earlier) as it sought to evaluate whether these had been fulfilled, and in a table summarising resources used Table .hui  and presentation of the UDSHIA report at the Urban Forum [Key stakeholders reported during the process evaluation that the HIA had fulfilled all five of its objectives. The HIA report was regarded as having provided a comprehensive literature review of evidence to support decision making. Each working group was supported by a literature review summarising the key health impacts of different urban development approaches which included literature search strategies and search terms used, and multiple citations of peer-reviewed literature . The recan Forum . The UDSMost participants were very positive about involvement in the HIA and felt it facilitated new cross-sectoral relationships, was enjoyable, and met its objectives. They described the HIA as important and groundbreaking in both Canterbury and New Zealand and commented on its importance in relationship-building, particularly in the M\u0101ori working group. There was strong support for the cross-sectoral workshops with several participants in both waste and water workshops  \u2013 a Crown Research Institute) describing workshops as a first ever occasion where all the people working on that issue were seated together in one room, and considered this led to opportunities for working together. Two participants in technical workshops felt the HIA added little new information and was a poor use of their time.Questionnaire respondents described the social connectedness workshops as particularly effective at ensuring a participatory process for the community. Three social connectedness workshops were held with many high-needs groups such as new immigrants, mental health consumers, Pacific people, and beneficiaries represented. A disabled group and representative of the Chinese association particularly described value in this workshop and felt it had increased their 'voice' for being heard in the UDS consultation process.The primary issues identified restricting the conduct of the HIA was the time limitation (only four months) and limited human resource .Most of the costs in Table This section details whether HIA objectives were met, impacts on policy, impacts of individual HIA objectives, indirect and aspired impacts and ideas for future directions of HIA in Canterbury.The final HIA report was presented to the Greater Christchurch Urban Forum in November 2005 and published in April 2006 . CCC's cThe final UDS Strategy  includesThe UDS document is nearly 200 pages long with an initial background and context section. It describes the Top Twenty Priority Actions for the next three years to ensure necessary governance structures and implementation frameworks (p34\u201336) . This is\u2022 Explanation (why an action is being undertaken);\u2022 Growth issues (summary of issues identified in consultation process);\u2022 Key approaches (policy approaches to be taken that will guide action implementation);\u2022 Actions \u2013 which use a tabular format and cover Action, Lead agency, Support agencies, Cost implications, Implementation tools, Links to strategy and Timing.The process of assessing and incorporating HIA recommendations into the UDS was described by key informants as informal. Responsibility for decision-making rested with planning and policy making staff at CCC responsible for the UDS. They described having read and considered the HIA report while preparing the policy document. In some sections the HIA recommendations were directly translated into UDS 'policy approaches' but not necessarily into the action tables. For example, in the transport section the HIA recommended \"Minimise adverse effects on communities when constructing and developing arterial roads (p 50) . The UDSA key impact of the HIA within the final UDS was the inclusion of a new section in the final Strategy titled \"Health and Well-being\" authored by the HIA project leader. This section includes an explanation of Health's inclusion in the strategy. Health indicators, however, were not mentioned in Priority Action Number Thirteen where other similar indicators were located.Of four general recommendations, only the one recommending that HIA is incorporated into the development and analysis of UDS policy was included in the final UDS.four of six recommendations were included in the UDS, but only two translated into action points. A recommendation on the need for cross-sectoral collaborative working groups was not included.four of five recommendations, with two related action points, were included in the UDS. The HIA recommendation advocating for a cross-sectoral steering group for water resource management in the region, with Ng\u0101i Tahu (the M\u0101ori tribe or 'iwi' who are 'tangata whenua' (people of the land) in Canterbury) representation, was not included in the UDS.all six HIA recommendations with five linked action points were included in the UDS. The Top Twenty Priority Actions also included two generic actions around social connectedness (Numbers Sixteen and Nineteen).three of four HIA recommendations with two action points were included.five of seven HIA recommendations were included in the UDS with four action points linked to these.the single HIA recommendation, with a linked action point was included in the UDS. None of the Top Twenty Priority Actions deals explicitly with M\u0101ori development/concerns.Other impacts of the HIA on local government policy were also described by key informants and workshop attendees. A key informant described that the HIA catalysed partnerships that contributed to amendments made to the Natural Resources Regional Plan (NRRP) .Some policies were described to have had a direct and attributable link to the HIA  . Other pSeveral key informants described the HIA and its process as leading to a deeper consideration of health and inequalities in City Council policies. They described the HIA as giving permission for social and health principles to be included to a greater extent in CCC strategies and programmes.\"We realised there was another whole sector that could swing in support of the UDS... to have health people there mucking in behind in support of densification and consolidated urban design option was really fantastic.\" Senior Policy Maker, Environment CanterburyImpact evaluation workshop participants and key informants described ongoing frequent contact between the key organisations which had been facilitated by relationships developed during the HIA. Local government and health board key informants described the HIA as facilitating different sectors in learning a new vocabulary and language. For example, where local government have talked of 'social development' and 'equity', health people would use the terms 'health outcomes' and 'health inequalities'.Key informants described relationships built during the HIA as contributing to the launching of the electronic network, the South Island Public Health Analysis Information Base. This provides an interactive bulletin board, archive, and e-discussion for public health and local government throughout the South Island, with administration resting with Environment Canterbury and CDHB. Analysis of use of the SIPHAN information base on 8 April, 2008 showed there were 71 registered users and 152 posts, viewed a total of 1793 times.Key informants in both local government and CDHB described the creation of a new public health physician post within local government as an impact attributable to the HIA. The HIA was considered to have given local government a new perspective on the skills and knowledge a public health person could provide as well as a clear track record that illustrated the benefits of input from a public health trained person. Serendipitous factors at play in particular included the support of a local government manager with core training in health as well as experience in management in the health sector and strong interest expressed in filling this role by the HIA project manager.\"It was not so much the event but the process of the HIA which has cemented relationships\" M\u0101ori consultation stream leader, CDHBNg\u0101i Tahu had been invited to be part of the UDS Forum but their contribution and role prior to the process of the HIA was limited. The HIA M\u0101ori working group was led by a M\u0101ori public health physician who used the opportunity of the HIA to build relationships between the CDHB and M\u0101ori in Canterbury through meetings, hui and particularly through facilitating the visit of a M\u0101ori urban design specialist. Several key informants described the HIA's strong focus on M\u0101ori and felt this facilitated the subsequent re-engagement of M\u0101ori in the UDS Forum and final policy.This engagement was illustrated with the participation of Ng\u0101i Tahu in the Urban Forum, subsequent to the HIA, as well as the endorsement of the UDS by Mark Solomon, Kaiwhakahaere of Te Runanga o Ng\u0101i Tahu (CEO of the Governing body of the Ng\u0101i Tahu tribe) .\"This has been the most ambitious HIA done in New Zealand to date \u2013 and what's more, the ambitious size and scope of it were matched by its delivery.\"HIA consultant, CanterburyDissemination of the HIA results and process followed resulted in publications and presentations with national and international recognition of the HIA. Many of the key informants felt that this HIA had given credibility to the approach of HIA among local government policy makers both regionally and nationally. Key informants described this HIA as high profile and successful.Key informants as well as workshop participants described what they saw as the success factors coming out of this HIA. The factors most frequently identified were strong leadership of the project and the creation of a public health physician position in the CCC and CDHB, jointly funded by both organisations. Several key informants reported that this nurtured many of the impacts of the HIA. This is the first joint appointment by a health board and local authority in New Zealand, and was described as a good example of the goodwill and effective relationships between health and local government developed through the HIA.A third success factor described was strong cross-sectoral relationships. The entire HIA used collaborative process between CDHB, CCC and Environment Canterbury. Working and steering groups included members of different organisations and successful cross-sectoral relationships such as the CCC guide for Health Promotion and Sustainability  jointly A fourth success factor described was the thorough documentation and dissemination of the HIA \u2013 which included writing up of the HIA in peer-reviewed journals ,23 as weIt 'feels' like we're bringing health into our planning more consistently and organically \u2013 especially at the CCC office level \u2013 but there's lots more to do at an executive and political level.\" Programme Manager \u2013 CCCKey informants described a change in ways of working attributable to the HIA. In the CDHB, HIAs are described as now being formally part of core business for the Division of Community and Public Health within CDHB. This HIA was felt to have catalysed a new focus on sustainability issues and for the CDHB Risk Management Committee to work on higher level policies. The HIA was considered to have led to further HIAs including the Central Plains Water Scheme (CPWS) HIA  and the Within the CCC, the HIA was described as a tool that has synergised well with the Local Government Act 2002 which provides the general framework and powers under which New Zealand's 85 democratically elected and accountable local authorities operate . The LocMany of those involved in policy making described increased understanding of health impacts. Examples of this include the use of the Healthy Housing Index on Council housing stock , in the Several key informants and workshop participants described a strategic plan like the UDS as limited by regulatory mechanisms within New Zealand's Resource Management Act 1991 . This liUniversally, workshop attendees felt that greater dedicated human and financial resourcing for the HIA could have allowed the identification and appraisal of a broader range of determinants of health. For example, the 'waste' health determinant stream was withdrawn due to resource constraints. This would have provided a more comprehensive assessment of potential positive and negative, intended and unintended health impacts.Several key informants felt that HIA as a practice has achieved minimal integration into the larger CDHB's core business. This theme recurred within the CCC, where HIA was considered to be useful and part of practice in some areas yet unheard of in others. Concern around lack of diffusion of HIA within organisations is repeated at the national level where disappointment was expressed that HIA has been used minimally by central government in New Zealand.One key informant described inequalities as inadequately explored by the HIA process, with examples such as the differential equity impacts of urban densification on private outdoor space, and increased storm water run-off possibly leading to damp housing. A concern expressed at the workshop was that using a participatory HIA approach can increase the time required for policy formation, limiting potential responsiveness and agility of policy development processes.A final section of the HIA impact evaluation workshop focussed on what should be done differently by partner organisations to achieve significant changes in health determinants in the future. Ideas arising from the workshop included:\u2022 Requiring public organisations, such as local government and DHBs, to engage with strategic partner organisations before writing Long Term Council Community Plans (LTCCP) and District Annual Plans so that policy impacts on health determinants are considered routinely. This would embed HIA in these processes at an early stage, which it is not required for the end product;\u2022 Leaders of key partner organisations invite other leaders to share in formation of strategic vision and planning. This could expand to make collaborative work requisite, such as a percentage of each employees time is allocated to work in another organisation to achieve mutual shared objectives, secondments, and the development of common public information portals e.g. linked Intranet for all public agencies.The paper sets out the process and impact evaluations of the UDS HIA providing a valuable addition to the sparse area of HIA research. Evaluation indicates the HIA was carried out with an effective process, requiring moderate resources to achieve significant direct and indirect impacts. These impacts are related to: policy change and organisational culture change among organisations involved in the HIA; improved cross-sectoral relationships; and increasing recognition of the HIA tool more widely in Canterbury and New Zealand. There are a number of important issues arising from these evaluations including the cost-effectiveness of HIAs, the role of HIAs in cross-sectoral work, enabling factors to increase uptake of HIA recommendations by decision makers, possible factors limiting further HIA impacts as well as methodological issues with these evaluations.Resource use is rarely described, but has been summarised in three papers -45. Othe. This would be one method to standardise cost calculation and allow legitimate comparison between HIAs. The method used for cost calculation in the UDS HIA was very similar to that used in this online calculator. A summary of costs of HIAs in Europe in the last decade ranged from $US 5720 to $US180325 depending on the level and type of HIA but excluding desktop HIAs [Costs for HIAs are calculated in diverse ways and these are infrequently described, however attempts to summarise costing have been performed -45,48. Ttop HIAs . Other Htop HIAs  to $US15top HIAs . As detaDetails of cost are included in this paper to provide transparent information about the resources investment and to assist future cost utility analyses of completed HIAs.The sums in Table The importance of cross-sectoral collaboration described in key informant interviews and by workshop attendees is one of the key impacts of this HIA. It has facilitated further shared work, a joint position funded by health and local government and multiple examples of collaborative work. Cross-sectoral collaboration is a key indirect impact identified in other HIA papers -52. HowePossible reasons for non-inclusion of the cross-sectoral recommendations are: the time and energy required for such groups to be representative and function well; feared loss of control by local government; regulatory restriction on cross-sectoral work ; and individual organisations' reporting constraints and tight timelines for projects meaning low priority for cross-sectoral work. These omissions in the UDS could lead to negative health impacts over time.In New Zealand legislation (as elsewhere) there is a lack of clarity about which agencies have overall responsibility for determinants of health as they are intrinsically cross-sectoral in nature. Yet individual legislation such as the Land Transport Act 2003, the Building Act 2004 and the Local Government Act 2002 do include public health objectives . These pThe potential for HIA as a bridge to increase cross-sectoral work has been increasingly recognised internationally and by the key players in this HIA. An analysis of a container port development that used a cross-sectoral approach  found beOver two thirds (24 of 33) of the HIA recommendations were included in the final UDS policy. This HIA included all the enablers related to decision makers and policy process described by Davenport et al in their review of enablers in 88 HIAs . These iThe absence of a health determinants focus in the Twenty Priority Actions of the UDS suggests that monitoring health determinants and outcomes is not considered a key responsibility of local authorities. Some local government planners argue health indicators are a sub-set of social indicators, yet explicit inclusion of health indicators could increase focus on health outcomes.HIA has been described as particularly effective at increasing understanding of health determinants in local government settings in Australia  and New This paper finds that the UDS HIA was an important tool which has supported changes in planning and policy among partner organisations, but also describes that impacts have been less than hoped for. Lack of diffusion of HIA within and across larger organisations was reported by CCC and CDHB, yet other informants suggest significant gains were achieved with this single HIA and subsequent HIAs in the region promise to build on this base. Others have described HIA uptake in \"silos\" in local government but suggest that effective HIAs lead to wider dissemination within organisations .The concern expressed at the impact evaluation workshop that HIA can reduce responsiveness of policy making and increase time-frames for policy development has been described elsewhere ,52,57. YWorking party members described that while the HIA itself had strong leadership , leaders of the HIA's partner organisations also needed conviction and enthusiasm for the HIA to achieve greater adoption. A review of ways that HIA can be made most useful to local government in New South Wales (NSW) echoes this. The author suggests selecting the best HIA steering committee and overcoming 'silos' in councils as two factors for HIA success in local government . This reThis evaluation used a multi-method qualitative methodology to gather information on the impacts of the HIA. The depth and breadth of the analysis was potentially limited by the unavailability of three identified key informants for interview and competing work priorities limiting participation at workshops. The evaluator was an employee of CDHB at the time of the process evaluation, which may have influenced the candour of participants and therefore influenced the analysis.The HIA of the Draft Greater Christchurch UDS was broadly successful and effective with significant direct and indirect impacts. It strengthened cross-sectoral partnerships which have led onto further initiatives, including a new position created for a Public Health Physician in the Christchurch City Council, and work commenced by CDHB and CCC on a City Health Plan and subsequent HIAs.This HIA has contributed to a more prominent role for health on the local government agenda and improved knowledge of a social determinants model of health by non-health professionals and the public. Significantly, the majority of the HIA recommendations have been adopted by the policy body \u2013 the Greater Christchurch Urban Development Forum. The HIA process has also contributed to policy implementation such as amendments to the NRRP . There hPermeation of a health determinants approach (as provided by the HIA tool) into the tissue of the larger UDS partner organisations is yet to happen. Currently 'health' organisations continue to be dominated by health services provision with little focus on changing health determinants. Ongoing and even greater commitment to changing health determinants by health and local government is essential to achieve long-term health outcomes.The inclusion of the health determinants defined in this HIA into the long-term Greater Christchurch UDS increases opportunity for a healthy urban environment, and therefore healthy citizens of the Greater Christchurch area. This paper adds to the limited literature that evaluates HIAs. It evaluates the UDS HIA as a generally highly successful process, with significant impacts that achieved its purposes. This in turn can increase the confidence of policy makers and funders in the value HIA as a tool that can lead to improved health for the community.CCC: Christchurch City Council; CDHB: Canterbury District Health Board; HIA: Health Impact Assessment; UDS: Urban Development Strategy.The authors declare that they have no competing interests.KM responsible for methods, primary research and first draft of paper and revision of subsequent drafts. BHR supported with literature review, drafting of the paper and revision of subsequent drafts.The pre-publication history for this paper can be accessed here:"]}
-{"representative": "Health-related quality of life (HRQL) is poor in obese subjects and is a relevant outcome in intervention studies. We aimed to determine factors associated with poor HRQL in obese patients seeking weight loss in medical units, outside specific research projects.2) patients aged 20-65 years attending 25 medical units scattered throughout Italy. The clinics provide weight loss treatment using different programs. General psychopathology (SCL-90 questionnaire), the presence of binge eating , previous weight cycling and somatic comorbidity (Charlson's index) were also determined. Scores on SF-36 and PGWB were compared with Italian population norms, and their association with putative determinants of HRQL after adjustment for confounders was assessed through logistic regression analysis.HRQL, together with a number of demographic and clinical parameters, was studied with generic  and disease-specific (ORWELL-97) questionnaires in an unselected sample of 1,886  obese  was associated with lower HRQL scores on both psychosocial and somatic domains; somatic diseases and higher BMI, after adjustment for confounders, were associated with impairment of physical domains, while binge eating and weight cycling appeared to affect psychosocial domains only.Psychopathological disturbances are the most relevant factors associated with poor HRQL in obese patients, affecting not only psychosocial, but also physical domains, largely independent of the severity of obesity. Psychological/psychiatric interventions are essential for a comprehensive treatment of obesity, and to improve treatment outcome and to reduce the burden of disease. Obesity is associated with impairment of health-related quality of life (HRQL) in psychological, social, and physical domains ,2. ImproThe QUOVADIS Study  is a mulWe aimed to identify the factors associated with poor HRQL in obese subjects, with special reference to the possible role of psychological distress and psychiatric comorbidity which might make psychological support essential to improve treatment outcome.The philosophy of the QUOVADIS study and the general characteristics of the population have been partly published in a previous report . BrieflyThe weight history was checked according to a pre-defined structured interview . PatientTo facilitate handling of data, the Case Report Forms were implemented in an extranet database provided by CINECA , an Interuniversity Consortium of 15 Italian Universities, using the AMR (Advanced Multicenter Research) methodology, which allows the management of the whole research using standard web-browsers.All subjects signed an informed consent to take part in the study, which was approved by the ethical committees of the individual centers, after approval by the committee of the coordinating center (University of Bologna)Quality of life was measured using 3 different tools. The Obesity-Related Well-Being questionnaire (ORWELL-97), an obesity-specific tool, was used with the specific aim to collect data useful in a longitudinal evaluation of HRQL following treatment . It measA score in the ORWELL-97 questionnaire \u2265 70, corresponding to the 75\u00b0 percentile of the population, was considered indicative of a clinically significant burden of obesity on HRQL.The Medical Outcome Survey Short-Form 36 (SF-36) was used as a generic measure of HRQL, with the specific aim to measure the extent of the defect in HRQL in both physical and mental domains . The queThe Psychological General Well-Being (PGWB) questionnaire was used to score psychological distress . The resFor both SF-36 and PGWB, the values of individual domains of each patient were compared to the age- and sex-matched Italian population norms ,19 usingThe Binge Eating Scale was used to detect binging ; values The Symptom Check List-90 questionnaire was used to identify subjects with a psychopathological profile . A valueThe presence of somatic diseases was used to calculate a composite score, according to Charlson et al , with moWeight history was defined at interview on the basis of body weight at the age of 20 years, age at first dieting and the number of times patients had lost weight as an effect of dietary programs, and scored according to previously-published cut-offs . One poiA first descriptive analysis was carried out on all tested variables. Scores of HRQL (and their relative Z-scores) were grouped according to sex, age, clinical status, complications of disease and eating behavior disorders, and the means and 95% confidence intervals for each patient group and for each domain were calculated.2 test.Differences between obese classes were tested using unpaired t test or Mann-Whitney or Kruskall-Wallis test, due to non-gaussian distribution of data, as appropriate. Differences in the prevalence of categorical data were tested by R \u00d7 C \u03c7Multivariate logistic regression analyses were run using dichotomized Z-scores on individual domains of SF-36 and PGWB as dependent variables. The cut-off value vas set at -1.0, but a sensitivity analysis, using the cut-offs of -0.5 and -1.5 was also performed, and the results were qualitatively confirmed (not reported in details). In the ORWELL-97 model, the dependent variable was an ORWELL score >70. Independent variables were BMI classes, the scores of somatic and mental diseases, the BES grade, and the score of weight history. All models were adjusted for age, gender and BMI.The Variance Inflation Factor was calculated to assess correlation between independent variables and to exclude multicolinearity.Of the 1,886 patients  included in the analysis, 723, 529, and 634 had obesity class I, II and III, respectively. Their age ranged from 20 to 65 years . Subjects in Class I were characterized by a higher educational status  compared with Class II  and Class III . No differences were observed in civil status (single/divorced vs. married/cohabitating or widowed). A larger proportion of subjects in Class III were either housewives (26%) or unemployed (4.4%) compared with Class II (19 and 3.5%) or Class I . Patients in higher classes of obesity showed a significantly greater prevalence of several concurrent illnesses, such as diabetes, hypertension, biliary diseases, and osteoarticular problems, but not of hyperlipidemia, coronary heart and peripheral vascular disease, thyroid disorders, or previously diagnosed psychopathological distress , all other domains being in the moderate range  or in the small range . The Z-scores on all domains of PGWB, except Vitality (-0.51), were indicative of a small defect .SF-36 and PGWB Z-scores in women and men are summarized in Figure Z-scores on SF-36 and PGWB in relation to obesity class are summarized in Figure Logistic regression analysis was applied to identify factors associated with poor HRQL Table . For botBMI class was systematically associated with poor HRQL in the ORWELL-97 score and in the physical domains of SF-36, namely in Physical functioning, but it had almost no effect on PGWB domains with the exception of General health. This association was confirmed at multivariate analysis, after adjustment for concurrent somatic and psychiatric diseases. In correlation analysis, the highest value was observed between BMI and the Z-score of Physical functioning (r = -0.405).A BES score above the selected cut-offs was associated with poor HRQL in nearly all domains of HRQL measures, whereas a history of weight cycling was associated with poor HRQL only in a few domains of SF-36, namely in Role-Physical, General Health and Social Functioning.In all models the Variance Inflation Factor was < 5, indicating the absence of multicolinearity.In our study sample, obesity was associated with a relevant impairment of HRQL, in comparison with population norms, standardized for age and sex. This result is in keeping with previous reports of overweight-induced deterioration of HRQL across a wide age range ,25-27. TThe study has several strengths. It was based on a very large sample of obese men and women in different centers, thus being representative of the \"real world\" of treatment-seeking obesity, outside specific research centers where a selection bias may be expected. As expected, obese women experienced a greater impairment of HRQL than their male counterparts. This confirms previous reports in clinic-based samples ,15,25, aNot surprisingly, subjects with higher BMI reported a greater impairment of HRQL, as previously reported ,8. This vs. medical weight loss programs in the majority of centers of the present survey). In addition, the present study included obese subjects belonging to the whole spectrum of obesity classes, including a large group of subjects with obesity class III. These individuals are scarcely represented in medical settings, and may have a different psychopathological profile [Somatic comorbidities, assessed through a score derived from Charlson's index , were as profile . FinallyBinge eating disorder was previously reported to be associated with poor scores on disease-specific HRQL questionnaires ,15. ThisFinally, weight cycling is known to be associated with binge eating  and psycThe broad spectrum of questionnaires used in the study may also help identify which instruments should be preferred to detect impairment in HRQL in different settings. It is noteworthy that scores on both generic  and disease-specific (ORWELL-97) questionnaires appeared to be affected by the very same factors and in a similar manner. As expected, PGWB appeared to be more sensitive to psychological disturbances, while SF-36 and ORWELL-97 could detect to a greater extent the impact of physical conditions on HRQL. The choice of questionnaires in different settings should take into consideration the domains of greater interest  in individual studies. The choice of instruments for the assessment of the effects of treatment on HRQL should also consider reliability, which is assumed to be greater for generic questionnaires, and sensitivity to change, which is thought to be superior for disease-specific questionnaires; these characteristics were not assessed in the present study.Our study has relevant clues to obesity treatment. HRQL is now considered a priority in the treatment of chronic diseases, and may be selected as clinical-relevant outcome in treatment programs . The finThe authors declare that they have no competing interests.EM drafted the manuscript and participated in study design; MLP drafted the manuscript and participated in study coordination; NV contributed to study discussion and performed the statistical analysis; CR conceived the study and participated in study design and coordination; GA conceived and designed the study; GM participated in study design and coordination, contributed to the statistical analysis, and wrote the manuscript; all the participants of the QUOVADIS Study Group collected the data. All authors read and approved the final manuscript.16:115-124).A complete list of the participants in the QUOVADIS study has been previously published (Diab Nutr Metab 2003,", "texts": ["Health-related quality of life (HRQL) is poor in obese subjects and is a relevant outcome in intervention studies. We aimed to determine factors associated with poor HRQL in obese patients seeking weight loss in medical units, outside specific research projects.2) patients aged 20-65 years attending 25 medical units scattered throughout Italy. The clinics provide weight loss treatment using different programs. General psychopathology (SCL-90 questionnaire), the presence of binge eating , previous weight cycling and somatic comorbidity (Charlson's index) were also determined. Scores on SF-36 and PGWB were compared with Italian population norms, and their association with putative determinants of HRQL after adjustment for confounders was assessed through logistic regression analysis.HRQL, together with a number of demographic and clinical parameters, was studied with generic  and disease-specific (ORWELL-97) questionnaires in an unselected sample of 1,886  obese  was associated with lower HRQL scores on both psychosocial and somatic domains; somatic diseases and higher BMI, after adjustment for confounders, were associated with impairment of physical domains, while binge eating and weight cycling appeared to affect psychosocial domains only.Psychopathological disturbances are the most relevant factors associated with poor HRQL in obese patients, affecting not only psychosocial, but also physical domains, largely independent of the severity of obesity. Psychological/psychiatric interventions are essential for a comprehensive treatment of obesity, and to improve treatment outcome and to reduce the burden of disease. Obesity is associated with impairment of health-related quality of life (HRQL) in psychological, social, and physical domains ,2. ImproThe QUOVADIS Study  is a mulWe aimed to identify the factors associated with poor HRQL in obese subjects, with special reference to the possible role of psychological distress and psychiatric comorbidity which might make psychological support essential to improve treatment outcome.The philosophy of the QUOVADIS study and the general characteristics of the population have been partly published in a previous report . BrieflyThe weight history was checked according to a pre-defined structured interview . PatientTo facilitate handling of data, the Case Report Forms were implemented in an extranet database provided by CINECA , an Interuniversity Consortium of 15 Italian Universities, using the AMR (Advanced Multicenter Research) methodology, which allows the management of the whole research using standard web-browsers.All subjects signed an informed consent to take part in the study, which was approved by the ethical committees of the individual centers, after approval by the committee of the coordinating center (University of Bologna)Quality of life was measured using 3 different tools. The Obesity-Related Well-Being questionnaire (ORWELL-97), an obesity-specific tool, was used with the specific aim to collect data useful in a longitudinal evaluation of HRQL following treatment . It measA score in the ORWELL-97 questionnaire \u2265 70, corresponding to the 75\u00b0 percentile of the population, was considered indicative of a clinically significant burden of obesity on HRQL.The Medical Outcome Survey Short-Form 36 (SF-36) was used as a generic measure of HRQL, with the specific aim to measure the extent of the defect in HRQL in both physical and mental domains . The queThe Psychological General Well-Being (PGWB) questionnaire was used to score psychological distress . The resFor both SF-36 and PGWB, the values of individual domains of each patient were compared to the age- and sex-matched Italian population norms ,19 usingThe Binge Eating Scale was used to detect binging ; values The Symptom Check List-90 questionnaire was used to identify subjects with a psychopathological profile . A valueThe presence of somatic diseases was used to calculate a composite score, according to Charlson et al , with moWeight history was defined at interview on the basis of body weight at the age of 20 years, age at first dieting and the number of times patients had lost weight as an effect of dietary programs, and scored according to previously-published cut-offs . One poiA first descriptive analysis was carried out on all tested variables. Scores of HRQL (and their relative Z-scores) were grouped according to sex, age, clinical status, complications of disease and eating behavior disorders, and the means and 95% confidence intervals for each patient group and for each domain were calculated.2 test.Differences between obese classes were tested using unpaired t test or Mann-Whitney or Kruskall-Wallis test, due to non-gaussian distribution of data, as appropriate. Differences in the prevalence of categorical data were tested by R \u00d7 C \u03c7Multivariate logistic regression analyses were run using dichotomized Z-scores on individual domains of SF-36 and PGWB as dependent variables. The cut-off value vas set at -1.0, but a sensitivity analysis, using the cut-offs of -0.5 and -1.5 was also performed, and the results were qualitatively confirmed (not reported in details). In the ORWELL-97 model, the dependent variable was an ORWELL score >70. Independent variables were BMI classes, the scores of somatic and mental diseases, the BES grade, and the score of weight history. All models were adjusted for age, gender and BMI.The Variance Inflation Factor was calculated to assess correlation between independent variables and to exclude multicolinearity.Of the 1,886 patients  included in the analysis, 723, 529, and 634 had obesity class I, II and III, respectively. Their age ranged from 20 to 65 years . Subjects in Class I were characterized by a higher educational status  compared with Class II  and Class III . No differences were observed in civil status (single/divorced vs. married/cohabitating or widowed). A larger proportion of subjects in Class III were either housewives (26%) or unemployed (4.4%) compared with Class II (19 and 3.5%) or Class I . Patients in higher classes of obesity showed a significantly greater prevalence of several concurrent illnesses, such as diabetes, hypertension, biliary diseases, and osteoarticular problems, but not of hyperlipidemia, coronary heart and peripheral vascular disease, thyroid disorders, or previously diagnosed psychopathological distress , all other domains being in the moderate range  or in the small range . The Z-scores on all domains of PGWB, except Vitality (-0.51), were indicative of a small defect .SF-36 and PGWB Z-scores in women and men are summarized in Figure Z-scores on SF-36 and PGWB in relation to obesity class are summarized in Figure Logistic regression analysis was applied to identify factors associated with poor HRQL Table . For botBMI class was systematically associated with poor HRQL in the ORWELL-97 score and in the physical domains of SF-36, namely in Physical functioning, but it had almost no effect on PGWB domains with the exception of General health. This association was confirmed at multivariate analysis, after adjustment for concurrent somatic and psychiatric diseases. In correlation analysis, the highest value was observed between BMI and the Z-score of Physical functioning (r = -0.405).A BES score above the selected cut-offs was associated with poor HRQL in nearly all domains of HRQL measures, whereas a history of weight cycling was associated with poor HRQL only in a few domains of SF-36, namely in Role-Physical, General Health and Social Functioning.In all models the Variance Inflation Factor was < 5, indicating the absence of multicolinearity.In our study sample, obesity was associated with a relevant impairment of HRQL, in comparison with population norms, standardized for age and sex. This result is in keeping with previous reports of overweight-induced deterioration of HRQL across a wide age range ,25-27. TThe study has several strengths. It was based on a very large sample of obese men and women in different centers, thus being representative of the \"real world\" of treatment-seeking obesity, outside specific research centers where a selection bias may be expected. As expected, obese women experienced a greater impairment of HRQL than their male counterparts. This confirms previous reports in clinic-based samples ,15,25, aNot surprisingly, subjects with higher BMI reported a greater impairment of HRQL, as previously reported ,8. This vs. medical weight loss programs in the majority of centers of the present survey). In addition, the present study included obese subjects belonging to the whole spectrum of obesity classes, including a large group of subjects with obesity class III. These individuals are scarcely represented in medical settings, and may have a different psychopathological profile [Somatic comorbidities, assessed through a score derived from Charlson's index , were as profile . FinallyBinge eating disorder was previously reported to be associated with poor scores on disease-specific HRQL questionnaires ,15. ThisFinally, weight cycling is known to be associated with binge eating  and psycThe broad spectrum of questionnaires used in the study may also help identify which instruments should be preferred to detect impairment in HRQL in different settings. It is noteworthy that scores on both generic  and disease-specific (ORWELL-97) questionnaires appeared to be affected by the very same factors and in a similar manner. As expected, PGWB appeared to be more sensitive to psychological disturbances, while SF-36 and ORWELL-97 could detect to a greater extent the impact of physical conditions on HRQL. The choice of questionnaires in different settings should take into consideration the domains of greater interest  in individual studies. The choice of instruments for the assessment of the effects of treatment on HRQL should also consider reliability, which is assumed to be greater for generic questionnaires, and sensitivity to change, which is thought to be superior for disease-specific questionnaires; these characteristics were not assessed in the present study.Our study has relevant clues to obesity treatment. HRQL is now considered a priority in the treatment of chronic diseases, and may be selected as clinical-relevant outcome in treatment programs . The finThe authors declare that they have no competing interests.EM drafted the manuscript and participated in study design; MLP drafted the manuscript and participated in study coordination; NV contributed to study discussion and performed the statistical analysis; CR conceived the study and participated in study design and coordination; GA conceived and designed the study; GM participated in study design and coordination, contributed to the statistical analysis, and wrote the manuscript; all the participants of the QUOVADIS Study Group collected the data. All authors read and approved the final manuscript.16:115-124).A complete list of the participants in the QUOVADIS study has been previously published (Diab Nutr Metab 2003,"]}
-{"representative": "Health-related quality of life (HRQL) outcome measures are complex and for further application in clinical practice and health service research the meaning of their scorings should be studied in depth. The aim of this study was to increase the interpretability of the Spanish VSP-A and KINDL-R scores.A representative sample of adolescents aged 12 to 18 years old was selected in Spain. The Spanish VSP-A and KINDL-R, two generic HRQL measures (range: 0\u2013100), were self-administered along with other external anchor measures  and sent by post. Percentiles of both HRQL questionnaires were obtained by gender, and age group and effect sizes (ES) were calculated. Receiver Operating Characteristic curves and related sensitivity (SE) and specificity (SP) values were also computed.The Spanish VSP-A and KINDL-R were completed by 555 adolescents. A moderate ES was shown in Psychological well-being between younger and older girls (ES: 0.77) in the VSP-A and small ES in the KINDL (ES: 0.41) between these groups. A SE and SP value close to 0.70 was associated to a global HRQL score of 65 in the VSP-A and 70 in the KINDL-R, when compared to anchors measuring mental and psychosocial health. Adolescents with scores bellow these cut-off points showed a moderate probability of presenting more impairment in their HRQL.The results of this study will be of help to interpret the VSP-A AND KINDL-R questionnaires by comparing with the general population and also provide cut-off points to define adolescents with health problems. Measurement of health related quality of life (HRQL) started in the 70's as a complement to traditional clinical outcomes. As a consequence of the increase in the survival of chronic conditions and life expectancy, healthcare has gone beyond the cure of illness. These facts and also a greater implication of patients in clinical decision making, have lead to the use of more subjective outcomes to measure the effectiveness of treatments such as HRQL . The mosSeveral authors have argued ,4, that Vec\u00fa Sant\u00e9 Per\u00e7ue de l'Adolescent (VSP-A) and the German Questionnaire for measuring health-related quality of life in children and adolescents (KINDL), two generic HRQL questionnaires, were adapted in parallel and were included in the Kidscreen project as validation instruments [Finally, the simultaneous comparison of questionnaires also has proved to be of use in gaining interpretation of their scorings . Issues truments . As partThis study was based on a cross-sectional descriptive telephone and postal survey carried out simultaneously in 13 European countries in the context of the Kidscreen project. The first stage of sample selection was carried out by telephone using the random digital dialling technique. A sample size of 1800 children and adolescents per country was considered necessary to detect a minimally important difference of half a standard deviation (SD) in HRQL scores, and it has been described in more detail elsewhere . The samThe Spanish versions of the VSP-A and KINDL-R were administered together with other demographic and health status variables.The VSP-A and the KINDL-R are two generic HRQL measures that were developed in France and Germany respectively ,14. The Socio-demographic variables were also collected from adolescents such as sex and age  and perceived socio-economic status using the Family Affluence Scale (FAS) ,17. The Descriptive statistics of the Spanish VSP-A and KINDL-R domain scores were computed.Reference values of the Spanish VSP-A and KINDL-R were described in a sample of adolescents after stratification by gender and two age groups (12\u201315 and 16\u201318 years old) as differences were expected based on finding of the original versions and existing literature ,14,20. MIn this study, 3 external anchors were used: the SDQ , the self-declaration of a chronic condition (yes versus no); and the Oslo Social Support Scale (categorized as poor versus moderate-high). To incorporate the information from these external anchors to the Spanish VSP-A and KINDL-R, their frequencies were computed for each of the 10 points of global HRQL scores in each questionnaire. Receiver Operating Characteristics (ROC) curves and the Area under the Curve (AUC) were computed to assess the discrimination ability of selected VSP-A and KINDL-R scores in relation to these external anchors .Sensitivity (SE) and specificity (SP) values related to an \"optimal\" HRQL cut-off-point were also described. These values are used in epidemiological studies, and especially in diagnostic tests . A SE vaMost adolescents were 12\u201315 years old (63.5%) and half of the sample were girls (50.8%), while most declared being from a middle socio-economic background (51.6%), measured by the FAS  scores in all domains of HRQL for both girls and boys  it provides with information on the amount of HRQL impairment of an individual or a group by comparing the score obtained, with the distribution of scores of the corresponding population; 2) differences in percentile position may help to determine the size of score differences, observed either in a child over time or between two groups or individuals. On the other hand, reference norms could also help to fix therapeutic objectives taking into account that the maximum theoretical score of a questionnaire would not be considered the maximum attainable. In fact, although the VSP-A and the KINDL-R have scores ranging from 0 to 100 (the best HRQL), very few teenagers score this maximum. When interpreting longitudinal changes ,27, thesDifferences in age and gender should be taken into account when assessing the meaning of \"healthy\" or \"ill\" HRQL scores. Girls in this study have reported lower vitality, physical and psychological well-being and lower scores in general, compared to boys. These results are consistent with the original version results and other studies that have applied HRQL measures in adolescents and also imply that the same score could have different meaning according to the individual or group evaluated. Consistent findings in the literature have presented a gender pattern in favour of boys and younger teens in several international studies ,29. ThesThe use of cut-off points also help in the interpretation of HRQL scores together with the use of norm values ,5. The cLimitations of this study should be mentioned. Even if the sample design aimed to obtain a representative, non-institutionalised sample of adolescents in Spain, the sampling method based on a telephone interview and postal survey caused a lower response rate than other administration methods (ex. school based) in the Spanish context. More detail of the representativeness of this sample can be found in another published study of the Kidscreen project . A shortThe applicability of HRQL measures for children and adolescents are similar for those in adult ages such as the identification of health needs, studies to determine risk factors, assessment of effectiveness and efficacy of health services, monitoring of health at population and clinical level, health planning or priority setting ,3,31. NeThe results of this study will be of use for future users of the Spanish VSP-A and KINDL-R questionnaires, especially to assess how close or not scores are from those considered as \"healthy\" HRQL. Moreover, the increase in the use of HRQL in the evaluation of health-care makes it necessary not only to assess if scores improve after an intervention, but also if they reach similar population reference values.VSP-A: Vec\u00fa Sant\u00e9 Per\u00e7ue de l'Adolescent;KINDL: Questionnaire for measuring health-related quality of life in children and adolescents; HRQL: Health-Related Quality of Life; CBCL: Child Behaviour Checklist; SDQ: Strength and Difficulties Questionnaire; SD: Standard Deviation; ES: Effect Size; ROC: Receiver Operating Characteristic; AUC: Area under the Curve; SE: Sensitivity; SP: Specificity; CI95%: Confidence interval 95%; WB: Well-BeingThe authors declare that they have no competing interests.VSS, MF contributed to the design of this study, analysed data and co-wrote this paper. LR is the Principal Investigator, contributed to the design of this study and commented on this paper.CT, MCS and URS commented on this paper. MCS and URS are the original authors of the VSP-A and KINDL-R respectively. URS is also the coordinator of the Kidscreen project.Population reference values of the Spanish VSP-A by age and gender (P: Percentiles. Spain n = 555). Additional tableClick here for filePopulation reference values of the Spanish KINDL-R by age and gender (P: Percentiles. Spain n = 555). Additional tableClick here for file", "texts": ["Health-related quality of life (HRQL) outcome measures are complex and for further application in clinical practice and health service research the meaning of their scorings should be studied in depth. The aim of this study was to increase the interpretability of the Spanish VSP-A and KINDL-R scores.A representative sample of adolescents aged 12 to 18 years old was selected in Spain. The Spanish VSP-A and KINDL-R, two generic HRQL measures (range: 0\u2013100), were self-administered along with other external anchor measures  and sent by post. Percentiles of both HRQL questionnaires were obtained by gender, and age group and effect sizes (ES) were calculated. Receiver Operating Characteristic curves and related sensitivity (SE) and specificity (SP) values were also computed.The Spanish VSP-A and KINDL-R were completed by 555 adolescents. A moderate ES was shown in Psychological well-being between younger and older girls (ES: 0.77) in the VSP-A and small ES in the KINDL (ES: 0.41) between these groups. A SE and SP value close to 0.70 was associated to a global HRQL score of 65 in the VSP-A and 70 in the KINDL-R, when compared to anchors measuring mental and psychosocial health. Adolescents with scores bellow these cut-off points showed a moderate probability of presenting more impairment in their HRQL.The results of this study will be of help to interpret the VSP-A AND KINDL-R questionnaires by comparing with the general population and also provide cut-off points to define adolescents with health problems. Measurement of health related quality of life (HRQL) started in the 70's as a complement to traditional clinical outcomes. As a consequence of the increase in the survival of chronic conditions and life expectancy, healthcare has gone beyond the cure of illness. These facts and also a greater implication of patients in clinical decision making, have lead to the use of more subjective outcomes to measure the effectiveness of treatments such as HRQL . The mosSeveral authors have argued ,4, that Vec\u00fa Sant\u00e9 Per\u00e7ue de l'Adolescent (VSP-A) and the German Questionnaire for measuring health-related quality of life in children and adolescents (KINDL), two generic HRQL questionnaires, were adapted in parallel and were included in the Kidscreen project as validation instruments [Finally, the simultaneous comparison of questionnaires also has proved to be of use in gaining interpretation of their scorings . Issues truments . As partThis study was based on a cross-sectional descriptive telephone and postal survey carried out simultaneously in 13 European countries in the context of the Kidscreen project. The first stage of sample selection was carried out by telephone using the random digital dialling technique. A sample size of 1800 children and adolescents per country was considered necessary to detect a minimally important difference of half a standard deviation (SD) in HRQL scores, and it has been described in more detail elsewhere . The samThe Spanish versions of the VSP-A and KINDL-R were administered together with other demographic and health status variables.The VSP-A and the KINDL-R are two generic HRQL measures that were developed in France and Germany respectively ,14. The Socio-demographic variables were also collected from adolescents such as sex and age  and perceived socio-economic status using the Family Affluence Scale (FAS) ,17. The Descriptive statistics of the Spanish VSP-A and KINDL-R domain scores were computed.Reference values of the Spanish VSP-A and KINDL-R were described in a sample of adolescents after stratification by gender and two age groups (12\u201315 and 16\u201318 years old) as differences were expected based on finding of the original versions and existing literature ,14,20. MIn this study, 3 external anchors were used: the SDQ , the self-declaration of a chronic condition (yes versus no); and the Oslo Social Support Scale (categorized as poor versus moderate-high). To incorporate the information from these external anchors to the Spanish VSP-A and KINDL-R, their frequencies were computed for each of the 10 points of global HRQL scores in each questionnaire. Receiver Operating Characteristics (ROC) curves and the Area under the Curve (AUC) were computed to assess the discrimination ability of selected VSP-A and KINDL-R scores in relation to these external anchors .Sensitivity (SE) and specificity (SP) values related to an \"optimal\" HRQL cut-off-point were also described. These values are used in epidemiological studies, and especially in diagnostic tests . A SE vaMost adolescents were 12\u201315 years old (63.5%) and half of the sample were girls (50.8%), while most declared being from a middle socio-economic background (51.6%), measured by the FAS  scores in all domains of HRQL for both girls and boys  it provides with information on the amount of HRQL impairment of an individual or a group by comparing the score obtained, with the distribution of scores of the corresponding population; 2) differences in percentile position may help to determine the size of score differences, observed either in a child over time or between two groups or individuals. On the other hand, reference norms could also help to fix therapeutic objectives taking into account that the maximum theoretical score of a questionnaire would not be considered the maximum attainable. In fact, although the VSP-A and the KINDL-R have scores ranging from 0 to 100 (the best HRQL), very few teenagers score this maximum. When interpreting longitudinal changes ,27, thesDifferences in age and gender should be taken into account when assessing the meaning of \"healthy\" or \"ill\" HRQL scores. Girls in this study have reported lower vitality, physical and psychological well-being and lower scores in general, compared to boys. These results are consistent with the original version results and other studies that have applied HRQL measures in adolescents and also imply that the same score could have different meaning according to the individual or group evaluated. Consistent findings in the literature have presented a gender pattern in favour of boys and younger teens in several international studies ,29. ThesThe use of cut-off points also help in the interpretation of HRQL scores together with the use of norm values ,5. The cLimitations of this study should be mentioned. Even if the sample design aimed to obtain a representative, non-institutionalised sample of adolescents in Spain, the sampling method based on a telephone interview and postal survey caused a lower response rate than other administration methods (ex. school based) in the Spanish context. More detail of the representativeness of this sample can be found in another published study of the Kidscreen project . A shortThe applicability of HRQL measures for children and adolescents are similar for those in adult ages such as the identification of health needs, studies to determine risk factors, assessment of effectiveness and efficacy of health services, monitoring of health at population and clinical level, health planning or priority setting ,3,31. NeThe results of this study will be of use for future users of the Spanish VSP-A and KINDL-R questionnaires, especially to assess how close or not scores are from those considered as \"healthy\" HRQL. Moreover, the increase in the use of HRQL in the evaluation of health-care makes it necessary not only to assess if scores improve after an intervention, but also if they reach similar population reference values.VSP-A: Vec\u00fa Sant\u00e9 Per\u00e7ue de l'Adolescent;KINDL: Questionnaire for measuring health-related quality of life in children and adolescents; HRQL: Health-Related Quality of Life; CBCL: Child Behaviour Checklist; SDQ: Strength and Difficulties Questionnaire; SD: Standard Deviation; ES: Effect Size; ROC: Receiver Operating Characteristic; AUC: Area under the Curve; SE: Sensitivity; SP: Specificity; CI95%: Confidence interval 95%; WB: Well-BeingThe authors declare that they have no competing interests.VSS, MF contributed to the design of this study, analysed data and co-wrote this paper. LR is the Principal Investigator, contributed to the design of this study and commented on this paper.CT, MCS and URS commented on this paper. MCS and URS are the original authors of the VSP-A and KINDL-R respectively. URS is also the coordinator of the Kidscreen project.Population reference values of the Spanish VSP-A by age and gender (P: Percentiles. Spain n = 555). Additional tableClick here for filePopulation reference values of the Spanish KINDL-R by age and gender (P: Percentiles. Spain n = 555). Additional tableClick here for file"]}
-{"representative": "Key stakeholders regard generic utility instruments as suitable tools to inform health technology assessment decision-making regarding allocation of resources across competing interventions. These instruments require a 'descriptor', a 'valuation' and a 'perspective' of the economic evaluation. There are various approaches that can be taken for each of these, offering a potential lack of consistency between instruments (a basic requirement for comparisons across diseases). The 'reference method' has been proposed as a way to address the limitations of the Quality-Adjusted Life Year (QALY). However, the degree to which generic measures can assess patients' specific experiences with their disease would remain unresolved. This has been neglected in the discussions on methods development and its impact on the QALY values obtained and resulting cost per QALY estimate underestimated. This study explored the content of utility instruments relevant to type 2 diabetes and Alzheimer's disease (AD) as examples, and the role of qualitative research in informing the trade-off between content coverage and consistency.A literature review was performed to identify qualitative and quantitative studies regarding patients' experiences with type 2 diabetes or AD, and associated treatments. Conceptual models for each indication were developed. Generic- and disease-specific instruments were mapped to the conceptual models.Findings showed that published descriptions of relevant concepts important to patients with type 2 diabetes or AD are available for consideration in deciding on the most comprehensive approach to utility assessment. While the 15-dimensional health related quality of life measure (15D) seemed the most comprehensive measure for both diseases, the Health Utilities Index 3 (HUI 3) seemed to have the least coverage for type 2 diabetes and the EuroQol-5 Dimensions (EQ-5D) for AD. Furthermore, some of the utility instruments contained items that could not be mapped onto either of the proposed conceptual models.Content of the utility measure has a significant impact on the treatment effects that can be observed. This varies from one disease to the next and as such contributes to lack of consistency in observable utility effects and incremental utility scores. This observation appears to have been omitted from the method development considerations such as reference methods. As a result, we recommend that patients' perspectives obtained via qualitative methods are taken into consideration in the ongoing methods development in health state descriptions for generic utility instruments. Also, as a more immediate contribution to improving decision making, we propose that a content map of the chosen utility measure with patient-reported domains be provided as standard reporting in utility measurement in order to improve the transparency of the trade-offs in relation to patient relevance and consistency. National, regional and local decision makers have to determine how best to allocate scarce resource so as to obtain optimum benefit . The QuaIn the United Kingdom, The National Institute for Health and Clinical Excellence (NICE) guidance clearly states that for cost effectiveness analysis, the value of health effects should be expressed in terms of QALYs and the measurement of changes in health-related quality of life (HRQoL) should be reported directly from patients. Although the NICE guidelines state the use of disease-specific preference based measures may be considered if they are justified, the value of changes in patients' HRQoL  should be based on public preferences using a choice-based method .The equivalent body for Scotland, Scottish Medicine Consortium (SMC), also prefer the QALY and consider it to be the most appropriate generic assessment of health benefit that reflects both mortality and HRQoL effects, and which allows comparisons between interventions . LikewisQALYs are calculated by estimating the total life years gained from a treatment and then weighting each year with a score. This score ranges from 0 to 1 (or 100) representing 'worst imaginable health' and 'best health' respectively. The utility is considered reflective of HRQoL in that year. The fundamental idea is that an extra year in good health does not have the same value to patients as a year in poor health . The numThis process requires a descriptor, a valuation, and a perspective for the utility measurement. There are various approaches that can be taken for each of these. For example, a descriptor method is a description of health and its impact on HRQoL and can be developed using clinicians, patients, or people from the general population (or even a combination of these). The descriptor method can also be presented in different ways such as using a vignette or the EuroQol-5 Dimensions (EQ-5D) items. A valuation method refers to a value given to a health state description such as using a visual analogue scale or standard gamble, and a perspective can range from for example the healthcare provider or a societal perspective. The diverse approaches for descriptors, valuations and perspectives may contribute to a lack of consistency and diversity in scores, making consistent decision making more difficult.Utility instruments incorporate preferences or values attached to individual health states and express health states as a single index. They can be classified as generic and therefore suitable for use in various populations and disease-specific populations, allowing decision makers to make comparisons. Examples of generic utility measures include the EQ-5D, the Health Utilities Index (HUI) , the 15-Disease-specific instruments are developed to measure the patients' perceptions and HRQoL impact of a specific disease or health problem. The main advantages of disease-specific measures are that they tend to be relevant to the impact of a specific disease on patients, and clinicians find them useful . In addiRegulatory authorities such as the FDA and EMA have endorsed patient-reported outcomes and emphasised the need to take the patient perspective into account when developing an instrument, particularly aspects of HRQoL ,17.The recent special issue of the Value in Health summarising the ISPOR Consensus Development Workshop focuses on \"moving the QALY forward\" with emphasis on \"how to define and refine the QALY\" as a standard metric . It is gIt was recently highlighted at the QALY development workshop that the absence of a better alternative makes the QALY an indispensable tool . These gOne possible solution to developing a preferred approach is a 'reference method'  where a The broad objective of this study was to assess how qualitative methods can improve knowledge about which current utility instruments assess concepts of relevance from the patients' perspective. Alzheimer's disease and type 2 diabetes were used as examples of diseases that are prevalent and represented in the general population.A literature review was performed in two parts. The aim of part one was to identify patient qualitative research in the two diseases of interest (type 2 diabetes and AD). The focus was to gain an understanding of the symptoms and subjective experiences of patients with type 2 diabetes and those with AD. Part two aimed to identify generic and disease-specific utility instruments used in type 2 diabetes and AD. The analysis then compared the relevant domains for the diseases with the construction and validation of the instruments.A search strategy was implemented using electronic databases  to identify relevant qualitative studies from January 2003 to October 2008, using the search terms presented in Table On completion of the search all titles and abstracts were screened for possible inclusion in the study by two independent researchers. Disagreements were resolved by subsequent discussion with another researcher who performed an independent review and made a final decision.To satisfy the inclusion criteria, selected abstracts had to include an appropriate clinical term related to one of the relevant indications , at least one patient-reported outcome term , and at least one methodological term  in the title or abstract.Abstracts were excluded if they were primarily clinical, economic or quantitative in focus, the perspective was not patient focused , or the abstract did not refer to a journal article .Following pre-testing, data extraction tables were finalised to accurately extract information on the symptoms and subjective experiences of patients including patient quotes where relevant. A thematic analysis was performed on the patient quotes . Each daOR utility OR QALY [MeSH Terms]. To satisfy the inclusion criteria, papers had to include an appropriate clinical term and reference to a utility measure in the title or abstract. Limits and exclusions were similar to part one of the literature review. The extent to which patients and healthy people were involved in their development was considered. The utility instruments were then assessed for their relevance to the diabetes and AD populations.To identify utility studies, an additional search strategy was implemented from August 2006 to October 2008 using PUBMED, utilising the same indications as in Table Each item (question) of utility instruments identified from part two of the literature review was then mapped on to the conceptual models. Each item was mapped where it was considered to reflect the concept, meaning that items could be mapped to more than one concept if deemed appropriate. Partial coverage was also considered, and items that partly covered concepts were mapped and indicated in brackets.The study selection process for part one of the literature review is presented in Figure Review of these studies revealed that aches and pains -25, hungSymptoms experienced by patients were mainly related to short term memory loss -63 and iA review of the concepts of relevance to both patients with type 2 diabetes and AD indicate that there are a number of concepts that the two disease areas have in common such as activities of daily living, role functioning, emotional functioning, mental health, relationships, social functioning, and self image. However there are concepts that are relevant to type 2 diabetes such as sexual functioning that were not highlighted as relevant to AD patients, conversely patients with AD were greatly impacted by the loss of their independence where type 2 diabetes patients did not mention this. Finally the key symptoms of each disease were also quite different (fatigue in type 2 diabetes vs. memory loss in AD). Thus, this evidence highlights that while some disease areas do have common concepts there are also important concepts that may differ highlighting a potential lack of sensitivity when measuring utilities using a generic instrument.The additional literature search generated 160 abstracts. The titles and abstracts were reviewed and a total of 145 were excluded due to the search terms not being in the title or abstract, due to duplication between databases or the search terms were not the main focus of the article. A total of 15 articles were reviewed in full. Although no disease-specific utilities were identified, the following generic measures were used in both indications: EQ-5D, 15D, SF-6D, and the HUI (versions 2 and 3). A comparison of the content and measurement properties of these measures is described below.The EQ-5D was developed as a generic, HRQoL instrument designed to assess health outcome states across a wide variety of interventions on a common scale . While hThe 15D was developed to measure HRQoL and its utility, and to evaluate the efficacy and effectiveness of interventions . It was The SF-6D was developed as a simplified health state classification from the SF-36/SF-12 . It is aThe HUI consists of three systems: HUI Mark 1 (HUI 1), Mark 2 (HUI 2) and Mark 3 (HUI 3) . HUI 2 aBased on the qualitative results, Figure Further, some of the utility instruments contained items that could not be mapped onto either of the proposed conceptual models. For example, the 'hearing,' 'breathing' and 'sleeping' items from the 15D did not appear to be relevant to either indication which could lead to potential problems such as missing data or lack of sensitivity for these measures when included in a clinical trial.In general, the findings from our study have demonstrated there was incomplete and varied coverage of relevant concepts across specific disease areas, with disparities varying depending on the disease in question. There were also differences in the concepts covered within the generic utility measures discussed. Both findings point to a potential lack of consistency between measures.An evaluation of the utility instruments needs to take into account three issues: relevance of concepts to the general population, such as whether a concept specific to a disease would resonate and be relevant to a healthy individual, relevance of concepts to the patient population being assessed and comprehensiveness of the concepts included in the questionnaire from the patient and general population perspective.To our knowledge, the general population did not rate or rank which concepts were the most important to include in the four utility instruments assessed. All of the concepts included in the utility instruments were based on literature and instrument reviews, rather than using input from patients or the general population. The four instruments also differed in the concepts that were covered. It would be unrealistic to expect that a generic instrument cover each and every concept that is of importance to the general population. However, some concepts that are important to patients may also be important to the population at large. Our results for the diabetes population suggest that tiredness, sexual functioning, social or family impact, and work impact are key concepts that are not covered by many of the utility scales but are likely to be important to the general population. Similarly, cognition and independence are important concepts to AD patients and are likely to be important to the general population. Brazier et al have already demonstrated in some diseases that leaving out concepts considered relevant to patients can result in under representation of relevant health impact in the QALY and over estimation of the cost per QALY . FurtherA detailed calibration of these instruments  in AD and diabetes was beyond the scope of this study. However, the concept mapping illustrates the challenges in representing the diseases optimally and in a way that allows comparison with other diseases. It also raises some philosophical questions about how the content of utility measures should be decided upon. Some instruments may be weighted toward concepts that are of no relevance to the patient population being studied. For example, in our review, patients with AD reported being physically healthy, but the EQ-5D has a preponderance of items that cover physical health . This leaves only one item (depression) that may be relevant to AD patients and completely omits the key AD concepts of memory and independence. Thus, it is likely that in any economic analysis of current AD drugs that use the EQ-5D as the primary utility measure, the results will only allow assessment of the impact of treatment on depression thereby under representing the full utility of treatment. One could argue that the concepts covered are relevant to the general population and therefore allow for more accurate economic analyses. Yet, it could also be argued that cognition and independence are important concepts to the general population as well as to AD patients, so those concepts perhaps should have been included in a generic utility measure (as indeed they are represented in the 15D and HUI).It can also be questioned whether it is possible to measure healthy people and people with a relevant disease using the same measure. Qualitative research such as focus groups or in-depth interviews with members of the public that represent typical diseases in the general population should be conducted to ascertain the concepts that are most relevant to include in a HRQL utility measure. This could be considered in the development of reference utility measures. This is in line with recent guidance from reimbursement bodies who suggest that qualitative evidence is also important when valuing utilities. Qualitative evidence provides unique insight into the disease from the patient who has experienced the symptoms and impacts of the disease first hand. This is supported by NICE who state 'Patients and carers are a unique source of expert information about the personal impact of a disease and its treatment' .These findings are consistent with previous research. For example, one study compared three generic utility based measures  in age-related macular degeneration (ARMD) . ResultsOther studies also provide evidence to support how the choice of method for utility elicitation may lead to difference in utility assessments. For example; one study compared the SF-6D with the EQ-5D and found that there was agreement between both utility instruments demonstrating evidence of validity. However on closer reflection utility results varied, with EQ-5D scores being significantly higher in healthy populations, and SF-6D scores being significantly higher in disease samples, thus pointing to differences in scaling and a lack of calibration between utility measures .Further, a literature review of studies in a variety of disease areas  that compared preference based systems found that the EQ-5D showed larger change scores and more favorable cost-effectiveness ratios compared to the HUI 2 and HUI 3  and the The results from these studies and supporting evidence are pertinent given that generic utility measures are documented as the preferred option in reimbursement guidance documents -6 and thOur study has a number of possible limitations that deserve comment. This study was based on published literature, most of which the purpose was not to assess impact on HRQoL. In addition, the literature search was restricted to English language studies and MeSH terms were used when available. MeSH terms were not available for all search terms. Therefore valuable information could have been missed and there may still remain some concepts of importance.The proposed conceptual models of impact were developed based on existing qualitative research that had been carried out and was from the patient perspective. Consequently, they have not been supplemented with patient interviews to confirm that the proposed areas of impact are indeed important and relevant to patients and put in the context of a specific treatment of study. Having said that, the volume of available information was encouraging as a resource. Additionally, we have limited this study to two indications and the relevant concepts may be very different for others. Further research could explore the relevance of utility instruments in other indications and in the general population.Also the very nature of AD means that less patient reported information is available, and many studies rely on caregiver reports. The patient reported information that is available is primarily from mild to moderate AD patients and so the proposed models may be reflective of this. Thus the proposed model may be a reflection of the earlier stages of the condition and not the disease in its entirety.There were other disease associated factors which may influence patients' experiences with their disease. Some studies commented on the added impact of being diagnosed with and the management of diabetes if in an ethnic minority. Diabetes management itself emerged as a seemingly relevant associated factor. Coping strategies appeared to weigh heavily in AD and these included very practical adaptive techniques like using aide memoirs and writing things down, and the use of humour and laughing to cope with the emotional strain associated with the daily hassles of forgetting. Other external factors included age, gender, culture and environment. These other factors may influence the patients' experience with a condition and may have an interactive role in the proposed conceptual models that have been developed from the literature; however such factors would also be controlled for, and taken into account in a clinical trial setting.A further aspect of the development of future utility instruments is that the dominance of the QALY in the use of HTA and economic evaluation could be reduced by the use of alternative instruments or methods of measurement. Agencies such as the Institute for Quality and Efficiency in Health Care (IQWiG) in Germany and discussions at recent HTA conferences have been considering the use of alternative methods for decision making. Therefore if the QALY is to retain its place as a key method for the use of cost-effectiveness for decision making across countries generic measures need to be constantly improved. Including the patient perspective in development of future instruments and the further development of existing instruments could be a first step aiding the continual improvement of such instruments.Despite the limitations of this study, the findings illustrate the potential value of considering qualitative information in the interpretation of cost utility estimates and the need to include more qualitative research in the design of not only the next wave of utility instruments, but also in the further development of existing instruments such as the EQ-5D.Content of the utility measures has a significant impact on the treatment effects that can be observed and currently in choosing a generic utility measure there appears to be a tradeoff of content in order to achieve consistency. The amount of patient relevant information missing from the chosen generic measures varies from one indication to another, which provides, and could continue to provide a source of inconsistency between the measures. Likewise, the variability in concepts across the generic measures suggests lack of consistency even for general population research, suggesting that the potential impact and importance of content is presently under represented. With current reporting standards, we cannot know the size of this tradeoff between content and consistency and its contribution to the variance in utility findings. This issue would remain if the proposed solution of a \"reference method\"  for all Patient's perspectives using qualitative methods should be adopted and feature in the decision-making methods used by reimbursement bodies so that there are clearly defined criteria. This movement has the attraction of reducing the scope for controversial decisions based on utility estimates. It could also serve as a bridge to the methods endorsed by regulatory authorities such as the Food and Drug Administration (FDA) and European Medicines Agency (EMA) ,17 and aAD: Alzheimer's disease; ARMD: Age-related macular degeneration; EM: European Medicines Agency; EQ 5D: EuroQol-5 Dimensions; FDA: Food and Drug Administration; HRQoL: Health-related quality of life; HUI 1: Health Utilities Index Mark 1; HUI 2: Health Utilities Index Mark 2; HUI 3: Health Utilities Index Mark 3; MOS SF-6D: Medical Outcomes Study Health Survey; NICE: National Institute for Health and Clinical Excellence; QALY: Quality-Adjusted Life Year; SMC: Scottish Medicine Consortium; 15D: 15-dimensional health related quality of life measurePlease note that the data, models and methodology used in the research are not proprietary. With regard to corporate-sponsored research, Pfizer has commissioned Mapi Values, a health outcomes agency, to carry out research on their behalf. The contact of the sponsoring organisation is Clare McGrath.Diana Rofail works as an Associate Research Director in the Questionnaire and Validation unit of Mapi Values. She has acted as an advisor for various pharmaceutical companies regarding their clinical trials and patient reported outcomes. Diana Rofail does not have ownerships intents (including stock options) in a start up company, the stock of which in not publicly traded or in a publicly traded company. Furthermore, she is not a member of an advisory board or board of directors.Linda Abetz works as a Director of the Questionnaire and Validation unit of Mapi Values. She has acted as an advisor for various pharmaceutical companies regarding their clinical trials and patient reported outcomes. Linda Abetz does not have ownerships intents (including stock options) in a start up company, the stock of which in not publicly traded or in a publicly traded company. Furthermore, she is not a member of an advisory board or board of directors.Elizabeth Gargon worked as a Research Associate at Mapi Values. She provided support to Diana Rofail on this project in terms of the presentation and interpretation of results. Elizabeth Gargon does not have ownerships intents (including stock options) in a start up company, the stock of which in not publicly traded or in a publicly traded company. Furthermore, she is not a member of an advisory board or board of directors.Clare McGrath is Senior Director of HTA Policy at Pfizer and owns stocks and/or stock options. She has had oversight of the HE/OR contributions to licensing and HTA submissions for the past decade and previously specialized in outcomes assessment and clinical studies.Mapi Values and Pfizer would like to and intend to publish the data irrespective of the review process outcome/comments.CM conceived of the study, participated in its design and was involved in developing and critically revising the manuscript. DR participated in the design of the study and coordination, analysis and interpretation of the literature review, and developed the manuscript. EG helped to conduct the literature review, participated in the analysis and presentation of results and helped draft the manuscript. LA made contributions to design and interpretation and was involved in the revision of the manuscript. All authors read and approved the final manuscript.", "texts": ["Key stakeholders regard generic utility instruments as suitable tools to inform health technology assessment decision-making regarding allocation of resources across competing interventions. These instruments require a 'descriptor', a 'valuation' and a 'perspective' of the economic evaluation. There are various approaches that can be taken for each of these, offering a potential lack of consistency between instruments (a basic requirement for comparisons across diseases). The 'reference method' has been proposed as a way to address the limitations of the Quality-Adjusted Life Year (QALY). However, the degree to which generic measures can assess patients' specific experiences with their disease would remain unresolved. This has been neglected in the discussions on methods development and its impact on the QALY values obtained and resulting cost per QALY estimate underestimated. This study explored the content of utility instruments relevant to type 2 diabetes and Alzheimer's disease (AD) as examples, and the role of qualitative research in informing the trade-off between content coverage and consistency.A literature review was performed to identify qualitative and quantitative studies regarding patients' experiences with type 2 diabetes or AD, and associated treatments. Conceptual models for each indication were developed. Generic- and disease-specific instruments were mapped to the conceptual models.Findings showed that published descriptions of relevant concepts important to patients with type 2 diabetes or AD are available for consideration in deciding on the most comprehensive approach to utility assessment. While the 15-dimensional health related quality of life measure (15D) seemed the most comprehensive measure for both diseases, the Health Utilities Index 3 (HUI 3) seemed to have the least coverage for type 2 diabetes and the EuroQol-5 Dimensions (EQ-5D) for AD. Furthermore, some of the utility instruments contained items that could not be mapped onto either of the proposed conceptual models.Content of the utility measure has a significant impact on the treatment effects that can be observed. This varies from one disease to the next and as such contributes to lack of consistency in observable utility effects and incremental utility scores. This observation appears to have been omitted from the method development considerations such as reference methods. As a result, we recommend that patients' perspectives obtained via qualitative methods are taken into consideration in the ongoing methods development in health state descriptions for generic utility instruments. Also, as a more immediate contribution to improving decision making, we propose that a content map of the chosen utility measure with patient-reported domains be provided as standard reporting in utility measurement in order to improve the transparency of the trade-offs in relation to patient relevance and consistency. National, regional and local decision makers have to determine how best to allocate scarce resource so as to obtain optimum benefit . The QuaIn the United Kingdom, The National Institute for Health and Clinical Excellence (NICE) guidance clearly states that for cost effectiveness analysis, the value of health effects should be expressed in terms of QALYs and the measurement of changes in health-related quality of life (HRQoL) should be reported directly from patients. Although the NICE guidelines state the use of disease-specific preference based measures may be considered if they are justified, the value of changes in patients' HRQoL  should be based on public preferences using a choice-based method .The equivalent body for Scotland, Scottish Medicine Consortium (SMC), also prefer the QALY and consider it to be the most appropriate generic assessment of health benefit that reflects both mortality and HRQoL effects, and which allows comparisons between interventions . LikewisQALYs are calculated by estimating the total life years gained from a treatment and then weighting each year with a score. This score ranges from 0 to 1 (or 100) representing 'worst imaginable health' and 'best health' respectively. The utility is considered reflective of HRQoL in that year. The fundamental idea is that an extra year in good health does not have the same value to patients as a year in poor health . The numThis process requires a descriptor, a valuation, and a perspective for the utility measurement. There are various approaches that can be taken for each of these. For example, a descriptor method is a description of health and its impact on HRQoL and can be developed using clinicians, patients, or people from the general population (or even a combination of these). The descriptor method can also be presented in different ways such as using a vignette or the EuroQol-5 Dimensions (EQ-5D) items. A valuation method refers to a value given to a health state description such as using a visual analogue scale or standard gamble, and a perspective can range from for example the healthcare provider or a societal perspective. The diverse approaches for descriptors, valuations and perspectives may contribute to a lack of consistency and diversity in scores, making consistent decision making more difficult.Utility instruments incorporate preferences or values attached to individual health states and express health states as a single index. They can be classified as generic and therefore suitable for use in various populations and disease-specific populations, allowing decision makers to make comparisons. Examples of generic utility measures include the EQ-5D, the Health Utilities Index (HUI) , the 15-Disease-specific instruments are developed to measure the patients' perceptions and HRQoL impact of a specific disease or health problem. The main advantages of disease-specific measures are that they tend to be relevant to the impact of a specific disease on patients, and clinicians find them useful . In addiRegulatory authorities such as the FDA and EMA have endorsed patient-reported outcomes and emphasised the need to take the patient perspective into account when developing an instrument, particularly aspects of HRQoL ,17.The recent special issue of the Value in Health summarising the ISPOR Consensus Development Workshop focuses on \"moving the QALY forward\" with emphasis on \"how to define and refine the QALY\" as a standard metric . It is gIt was recently highlighted at the QALY development workshop that the absence of a better alternative makes the QALY an indispensable tool . These gOne possible solution to developing a preferred approach is a 'reference method'  where a The broad objective of this study was to assess how qualitative methods can improve knowledge about which current utility instruments assess concepts of relevance from the patients' perspective. Alzheimer's disease and type 2 diabetes were used as examples of diseases that are prevalent and represented in the general population.A literature review was performed in two parts. The aim of part one was to identify patient qualitative research in the two diseases of interest (type 2 diabetes and AD). The focus was to gain an understanding of the symptoms and subjective experiences of patients with type 2 diabetes and those with AD. Part two aimed to identify generic and disease-specific utility instruments used in type 2 diabetes and AD. The analysis then compared the relevant domains for the diseases with the construction and validation of the instruments.A search strategy was implemented using electronic databases  to identify relevant qualitative studies from January 2003 to October 2008, using the search terms presented in Table On completion of the search all titles and abstracts were screened for possible inclusion in the study by two independent researchers. Disagreements were resolved by subsequent discussion with another researcher who performed an independent review and made a final decision.To satisfy the inclusion criteria, selected abstracts had to include an appropriate clinical term related to one of the relevant indications , at least one patient-reported outcome term , and at least one methodological term  in the title or abstract.Abstracts were excluded if they were primarily clinical, economic or quantitative in focus, the perspective was not patient focused , or the abstract did not refer to a journal article .Following pre-testing, data extraction tables were finalised to accurately extract information on the symptoms and subjective experiences of patients including patient quotes where relevant. A thematic analysis was performed on the patient quotes . Each daOR utility OR QALY [MeSH Terms]. To satisfy the inclusion criteria, papers had to include an appropriate clinical term and reference to a utility measure in the title or abstract. Limits and exclusions were similar to part one of the literature review. The extent to which patients and healthy people were involved in their development was considered. The utility instruments were then assessed for their relevance to the diabetes and AD populations.To identify utility studies, an additional search strategy was implemented from August 2006 to October 2008 using PUBMED, utilising the same indications as in Table Each item (question) of utility instruments identified from part two of the literature review was then mapped on to the conceptual models. Each item was mapped where it was considered to reflect the concept, meaning that items could be mapped to more than one concept if deemed appropriate. Partial coverage was also considered, and items that partly covered concepts were mapped and indicated in brackets.The study selection process for part one of the literature review is presented in Figure Review of these studies revealed that aches and pains -25, hungSymptoms experienced by patients were mainly related to short term memory loss -63 and iA review of the concepts of relevance to both patients with type 2 diabetes and AD indicate that there are a number of concepts that the two disease areas have in common such as activities of daily living, role functioning, emotional functioning, mental health, relationships, social functioning, and self image. However there are concepts that are relevant to type 2 diabetes such as sexual functioning that were not highlighted as relevant to AD patients, conversely patients with AD were greatly impacted by the loss of their independence where type 2 diabetes patients did not mention this. Finally the key symptoms of each disease were also quite different (fatigue in type 2 diabetes vs. memory loss in AD). Thus, this evidence highlights that while some disease areas do have common concepts there are also important concepts that may differ highlighting a potential lack of sensitivity when measuring utilities using a generic instrument.The additional literature search generated 160 abstracts. The titles and abstracts were reviewed and a total of 145 were excluded due to the search terms not being in the title or abstract, due to duplication between databases or the search terms were not the main focus of the article. A total of 15 articles were reviewed in full. Although no disease-specific utilities were identified, the following generic measures were used in both indications: EQ-5D, 15D, SF-6D, and the HUI (versions 2 and 3). A comparison of the content and measurement properties of these measures is described below.The EQ-5D was developed as a generic, HRQoL instrument designed to assess health outcome states across a wide variety of interventions on a common scale . While hThe 15D was developed to measure HRQoL and its utility, and to evaluate the efficacy and effectiveness of interventions . It was The SF-6D was developed as a simplified health state classification from the SF-36/SF-12 . It is aThe HUI consists of three systems: HUI Mark 1 (HUI 1), Mark 2 (HUI 2) and Mark 3 (HUI 3) . HUI 2 aBased on the qualitative results, Figure Further, some of the utility instruments contained items that could not be mapped onto either of the proposed conceptual models. For example, the 'hearing,' 'breathing' and 'sleeping' items from the 15D did not appear to be relevant to either indication which could lead to potential problems such as missing data or lack of sensitivity for these measures when included in a clinical trial.In general, the findings from our study have demonstrated there was incomplete and varied coverage of relevant concepts across specific disease areas, with disparities varying depending on the disease in question. There were also differences in the concepts covered within the generic utility measures discussed. Both findings point to a potential lack of consistency between measures.An evaluation of the utility instruments needs to take into account three issues: relevance of concepts to the general population, such as whether a concept specific to a disease would resonate and be relevant to a healthy individual, relevance of concepts to the patient population being assessed and comprehensiveness of the concepts included in the questionnaire from the patient and general population perspective.To our knowledge, the general population did not rate or rank which concepts were the most important to include in the four utility instruments assessed. All of the concepts included in the utility instruments were based on literature and instrument reviews, rather than using input from patients or the general population. The four instruments also differed in the concepts that were covered. It would be unrealistic to expect that a generic instrument cover each and every concept that is of importance to the general population. However, some concepts that are important to patients may also be important to the population at large. Our results for the diabetes population suggest that tiredness, sexual functioning, social or family impact, and work impact are key concepts that are not covered by many of the utility scales but are likely to be important to the general population. Similarly, cognition and independence are important concepts to AD patients and are likely to be important to the general population. Brazier et al have already demonstrated in some diseases that leaving out concepts considered relevant to patients can result in under representation of relevant health impact in the QALY and over estimation of the cost per QALY . FurtherA detailed calibration of these instruments  in AD and diabetes was beyond the scope of this study. However, the concept mapping illustrates the challenges in representing the diseases optimally and in a way that allows comparison with other diseases. It also raises some philosophical questions about how the content of utility measures should be decided upon. Some instruments may be weighted toward concepts that are of no relevance to the patient population being studied. For example, in our review, patients with AD reported being physically healthy, but the EQ-5D has a preponderance of items that cover physical health . This leaves only one item (depression) that may be relevant to AD patients and completely omits the key AD concepts of memory and independence. Thus, it is likely that in any economic analysis of current AD drugs that use the EQ-5D as the primary utility measure, the results will only allow assessment of the impact of treatment on depression thereby under representing the full utility of treatment. One could argue that the concepts covered are relevant to the general population and therefore allow for more accurate economic analyses. Yet, it could also be argued that cognition and independence are important concepts to the general population as well as to AD patients, so those concepts perhaps should have been included in a generic utility measure (as indeed they are represented in the 15D and HUI).It can also be questioned whether it is possible to measure healthy people and people with a relevant disease using the same measure. Qualitative research such as focus groups or in-depth interviews with members of the public that represent typical diseases in the general population should be conducted to ascertain the concepts that are most relevant to include in a HRQL utility measure. This could be considered in the development of reference utility measures. This is in line with recent guidance from reimbursement bodies who suggest that qualitative evidence is also important when valuing utilities. Qualitative evidence provides unique insight into the disease from the patient who has experienced the symptoms and impacts of the disease first hand. This is supported by NICE who state 'Patients and carers are a unique source of expert information about the personal impact of a disease and its treatment' .These findings are consistent with previous research. For example, one study compared three generic utility based measures  in age-related macular degeneration (ARMD) . ResultsOther studies also provide evidence to support how the choice of method for utility elicitation may lead to difference in utility assessments. For example; one study compared the SF-6D with the EQ-5D and found that there was agreement between both utility instruments demonstrating evidence of validity. However on closer reflection utility results varied, with EQ-5D scores being significantly higher in healthy populations, and SF-6D scores being significantly higher in disease samples, thus pointing to differences in scaling and a lack of calibration between utility measures .Further, a literature review of studies in a variety of disease areas  that compared preference based systems found that the EQ-5D showed larger change scores and more favorable cost-effectiveness ratios compared to the HUI 2 and HUI 3  and the The results from these studies and supporting evidence are pertinent given that generic utility measures are documented as the preferred option in reimbursement guidance documents -6 and thOur study has a number of possible limitations that deserve comment. This study was based on published literature, most of which the purpose was not to assess impact on HRQoL. In addition, the literature search was restricted to English language studies and MeSH terms were used when available. MeSH terms were not available for all search terms. Therefore valuable information could have been missed and there may still remain some concepts of importance.The proposed conceptual models of impact were developed based on existing qualitative research that had been carried out and was from the patient perspective. Consequently, they have not been supplemented with patient interviews to confirm that the proposed areas of impact are indeed important and relevant to patients and put in the context of a specific treatment of study. Having said that, the volume of available information was encouraging as a resource. Additionally, we have limited this study to two indications and the relevant concepts may be very different for others. Further research could explore the relevance of utility instruments in other indications and in the general population.Also the very nature of AD means that less patient reported information is available, and many studies rely on caregiver reports. The patient reported information that is available is primarily from mild to moderate AD patients and so the proposed models may be reflective of this. Thus the proposed model may be a reflection of the earlier stages of the condition and not the disease in its entirety.There were other disease associated factors which may influence patients' experiences with their disease. Some studies commented on the added impact of being diagnosed with and the management of diabetes if in an ethnic minority. Diabetes management itself emerged as a seemingly relevant associated factor. Coping strategies appeared to weigh heavily in AD and these included very practical adaptive techniques like using aide memoirs and writing things down, and the use of humour and laughing to cope with the emotional strain associated with the daily hassles of forgetting. Other external factors included age, gender, culture and environment. These other factors may influence the patients' experience with a condition and may have an interactive role in the proposed conceptual models that have been developed from the literature; however such factors would also be controlled for, and taken into account in a clinical trial setting.A further aspect of the development of future utility instruments is that the dominance of the QALY in the use of HTA and economic evaluation could be reduced by the use of alternative instruments or methods of measurement. Agencies such as the Institute for Quality and Efficiency in Health Care (IQWiG) in Germany and discussions at recent HTA conferences have been considering the use of alternative methods for decision making. Therefore if the QALY is to retain its place as a key method for the use of cost-effectiveness for decision making across countries generic measures need to be constantly improved. Including the patient perspective in development of future instruments and the further development of existing instruments could be a first step aiding the continual improvement of such instruments.Despite the limitations of this study, the findings illustrate the potential value of considering qualitative information in the interpretation of cost utility estimates and the need to include more qualitative research in the design of not only the next wave of utility instruments, but also in the further development of existing instruments such as the EQ-5D.Content of the utility measures has a significant impact on the treatment effects that can be observed and currently in choosing a generic utility measure there appears to be a tradeoff of content in order to achieve consistency. The amount of patient relevant information missing from the chosen generic measures varies from one indication to another, which provides, and could continue to provide a source of inconsistency between the measures. Likewise, the variability in concepts across the generic measures suggests lack of consistency even for general population research, suggesting that the potential impact and importance of content is presently under represented. With current reporting standards, we cannot know the size of this tradeoff between content and consistency and its contribution to the variance in utility findings. This issue would remain if the proposed solution of a \"reference method\"  for all Patient's perspectives using qualitative methods should be adopted and feature in the decision-making methods used by reimbursement bodies so that there are clearly defined criteria. This movement has the attraction of reducing the scope for controversial decisions based on utility estimates. It could also serve as a bridge to the methods endorsed by regulatory authorities such as the Food and Drug Administration (FDA) and European Medicines Agency (EMA) ,17 and aAD: Alzheimer's disease; ARMD: Age-related macular degeneration; EM: European Medicines Agency; EQ 5D: EuroQol-5 Dimensions; FDA: Food and Drug Administration; HRQoL: Health-related quality of life; HUI 1: Health Utilities Index Mark 1; HUI 2: Health Utilities Index Mark 2; HUI 3: Health Utilities Index Mark 3; MOS SF-6D: Medical Outcomes Study Health Survey; NICE: National Institute for Health and Clinical Excellence; QALY: Quality-Adjusted Life Year; SMC: Scottish Medicine Consortium; 15D: 15-dimensional health related quality of life measurePlease note that the data, models and methodology used in the research are not proprietary. With regard to corporate-sponsored research, Pfizer has commissioned Mapi Values, a health outcomes agency, to carry out research on their behalf. The contact of the sponsoring organisation is Clare McGrath.Diana Rofail works as an Associate Research Director in the Questionnaire and Validation unit of Mapi Values. She has acted as an advisor for various pharmaceutical companies regarding their clinical trials and patient reported outcomes. Diana Rofail does not have ownerships intents (including stock options) in a start up company, the stock of which in not publicly traded or in a publicly traded company. Furthermore, she is not a member of an advisory board or board of directors.Linda Abetz works as a Director of the Questionnaire and Validation unit of Mapi Values. She has acted as an advisor for various pharmaceutical companies regarding their clinical trials and patient reported outcomes. Linda Abetz does not have ownerships intents (including stock options) in a start up company, the stock of which in not publicly traded or in a publicly traded company. Furthermore, she is not a member of an advisory board or board of directors.Elizabeth Gargon worked as a Research Associate at Mapi Values. She provided support to Diana Rofail on this project in terms of the presentation and interpretation of results. Elizabeth Gargon does not have ownerships intents (including stock options) in a start up company, the stock of which in not publicly traded or in a publicly traded company. Furthermore, she is not a member of an advisory board or board of directors.Clare McGrath is Senior Director of HTA Policy at Pfizer and owns stocks and/or stock options. She has had oversight of the HE/OR contributions to licensing and HTA submissions for the past decade and previously specialized in outcomes assessment and clinical studies.Mapi Values and Pfizer would like to and intend to publish the data irrespective of the review process outcome/comments.CM conceived of the study, participated in its design and was involved in developing and critically revising the manuscript. DR participated in the design of the study and coordination, analysis and interpretation of the literature review, and developed the manuscript. EG helped to conduct the literature review, participated in the analysis and presentation of results and helped draft the manuscript. LA made contributions to design and interpretation and was involved in the revision of the manuscript. All authors read and approved the final manuscript."]}
-{"representative": "Inhibitors of these original interactions are certainly the next generation of highly innovative drugs that will reach the market in the next decade. However, DB, a hand-curated database dedicated to the structure of PPIs with known inhibitors. We have analyzed protein/protein and protein/inhibitor interfaces in terms of geometrical parameters, atom and residue properties, buried accessible surface area and other biophysical parameters. The interfaces found in 2P2IDB were then compared to those of representative datasets of heterodimeric complexes. We propose a new classification of PPIs with known inhibitors into two classes depending on the number of segments present at the interface and corresponding to either a single secondary structure element or to a more globular interacting domain. 2P2IDB complexes share global shape properties with standard transient heterodimer complexes, but their accessible surface areas are significantly smaller. No major conformational changes are seen between the different states of the proteins. The interfaces are more hydrophobic than general PPI's interfaces, with less charged residues and more non-polar atoms. Finally, fifty percent of the complexes in the 2P2IDB dataset possess more hydrogen bonds than typical protein-protein complexes. Potential areas of study for the future are proposed, which include a new classification system consisting of specific families and the identification of PPI targets with high druggability potential based on key descriptors of the interaction.Here we describe this particular PPI chemical space through the presentation of 2P2Ihttp://2p2idb.cnrs-mrs.fr.2P2I database stores structural information about PPIs with known inhibitors and provides a useful tool for biologists to assess the potential druggability of their interfaces. The database can be accessed at  In the last decade, the inhibition of protein-protein interactions (PPIs) has emerged from both academic and private research as a new way to modulate the activity of proteins  are certainly the next generation of highly innovative drugs that will reach the market in the next decade.et al. analyzed the atomic interactions and profile of small molecules disrupting PPIs in the TIMBAL database, focusing on small molecules properties and comparing these results to drug-like databases As a consequence of this enthusiasm, the exponential increase of published biomedical literature on PPIs and their inhibition has prompted the development of internet services and databases that help scientists to manage the available information. There is now a growing number of structural databases dedicated to protein-protein interactions DB, which is a hand-curated database dedicated to the structure of Protein-Protein complexes with known inhibitors thereby offering complementary information to these previous analyses (2P2IDB is available at http://2p2idb.cnrs-mrs.fr). We have analyzed the protein/protein and protein/inhibitor interfaces in terms of geometrical parameters, atom and residue properties, buried accessible surface area and other biophysical parameters, such as the protein-protein dissociation constant (Kd) of a complex. The interfaces found in 2P2IDB were then compared to those of representative datasets of heterodimeric complexes from Bahadur and Zacharias http://www.bioinformatics.sussex.ac.uk/protorp/ and We describe here a chemical space, 2P2IDB present globally the same shape (planarity or eccentricity) than standard heterodimeric complexes, but their accessible surface areas are significantly smaller. More strikingly, no major conformational changes are observed between the different states of the proteins . The interfaces are also more hydrophobic than general PPIs' interfaces, with less charged residues and more non-polar atoms. Moreover, fifty percent of the complexes in the 2P2IDB dataset possess more hydrogen bonds than typical protein-protein complexes. A set of key descriptors were identified to distinguish between PPIs with known inhibitors and representative transient complexes in the protein databank. Transient protein-protein complexes are defined as protomers that, in vivo, can exist either on their own or in complex and also undergo an exchange between the free and complexed form The architecture present at the interface generally involves a globular interacting domain, a single secondary structure element  of a globular protein, or a short peptide. Complexes in 2P2IA new classification based on these parameters is proposed with potential aims for the future to identify potential new druggable PPI targets.DB) that was used to further analyze the general properties of protein/protein interfaces (PPIs) with a known inhibitor. The 2P2IDB (http://2p2idb.cnrs-mrs.fr) contains a total of 17 protein/protein complexes corresponding to 14 families and 56 small molecule inhibitors bound to the corresponding target .There are a limited number of targets in the 2P2I database at this stage due to the structural prerequisites that were used. However, it is inevitable that high throughput structural genomic programs will generate a high level of data. In addition, the development of improved methodologies for the development of small molecule inhibitors will rapidly lead to the discovery and structural characterization of disruptors of new PPI families. These new targets and their corresponding ligands will be incorporated into the database as they appear in the literature and the Protein Data Bank  was not significantly different than the natural conformational dynamics of the free target protein and was in the same range as the resolution of the crystal structures. Some local rearrangements could be observed at the binding site; however, these rearrangements do not impair the possibility to design potent inhibitors with high affinity. The fact that there is no main rearrangement between the different forms in the 2P2IDB dataset could mean that these types of complexes are easier to target. Other strategies with small molecule inhibitors binding at different sites, such as an allosteric pocket away from the interface, would be necessary to disrupt PPIs with large conformational rearrangements. These classes of inhibitors are not present in the 2P2IDB, as we only kept those ligands that are present at the interface.The formation of heterodimeric complexes can lead to large rearrangements of the two protein partners We analyzed the general characteristics of the protein/protein interfaces (PPIs) using online servers A more detailed analysis revealed that complexes from class I contained a higher proportion of secondary structure elements at the interface. Four out of 6 complexes involved mainly an alpha helix at the interface, and the other two a beta strand  or inhibitory (Ki) constants of the protein/protein complexes were compared  was significantly smaller than the standard average values of approximately 1000 \u00c52 observed for heterodimeric protein-protein complexes, as described in the literature by Bahadur and Zacharias 2 and 769\u00b1150 \u00c52 were observed for class I  was not significantly distinguishable (0.72\u00b10.12 vs. 0.70\u00b10.12). Similar values were observed for the two classes defined above. The Gap volume index (GVi) provides a measure of the tightness of a protein-protein complex The average planarity of interfaces in our dataset was 2.8\u00b10.4 \u00c5, which is a value equivalent to that of overall heterodimeric complexes (2.7\u00b11.2 \u00c5). Similarly, eccentricity  than standard transient heterodimers (27.0\u00b112.5%). This result indicates that PPIs with known inhibitors are more hydrophobic than typical heterodimers, which can be correlated to the observation that small molecule PPI modulators are hydrophobic DB dataset and transient heterodimers for the four selected parameters corresponded to probabilities higher than 90% confidence according to the t-distribution table of significance.We used a student's t-test to compare the main descriptors of PPIs in our dataset to standard heterodimers in an attempt to extract the most discriminating parameters that govern the druggability of a PPI. The number of interfacial segments, accessible surface area (ASA), Gap volume, hydrogen bonds and the percentage of charged residues were selected as the key parameters that typify PPIs with known inhibitors . The difDB dataset into different families. Pockets volumes were not incorporated in the t-test study because statistics were not available to compare to the transient protein-protein dataset. However, they were used in the PCA analysis because they are known to play an important role in protein-protein specific interaction In addition to the five parameters defined above , the combined pocket volumes at the interface were used in a principal component analysis (PCA) to separate the 2P2IL/Bak complex (PDB code: 1bxl), the high values for ASA and the number of segments and low hydrogen bond content led to its classification next to the FKBP12/TGFR complex (PDB code: 1b6c). Subtilisin/Eglin C and trypsin/trypsin, which formed a separated cluster when considering the whole interface, were grouped together when considering the part of the interface that interacts with the ligand.A similar PCA analysis was performed with parameters derived from the subset of the interface that is in direct contact with the inhibitor in the protein/ligand structure . The samA web server was developed to facilitate the access to the data calculated for the different PPIs. It allows the user to search for specific complexes using different query procedures based on families, pdb codes, Uniprot numbers, cluster family or ligand properties . For eacDB dataset using the six key descriptors that were selected for the PCA analyses  is also provided. Finally, individual scores for each parameter are calculated. Lower values are indicative of complexes with high potential to become druggable targets whereas higher scores are likely to correspond to poorly druggable complexes.An interactive menu allows the user to compare the properties of a given PPI to the 2P2Ianalyses . The paranalyses  and entePPIs interfaces have long been considered to be poorly druggable because of their general properties. However, in the last few years, a growing number of PPI inhibitors have been discovered, and some of these inhibitors have even reached the preclinical stage of investigation \u201cWhat makes a PPI an attractive target for the discovery and development of small molecules?\u201d we can portray the good PPI candidates in a few points, which are summarized from existing published data, as follows: i) The target should be validated at least biologically  or, even more importantly, clinically, and the inhibition of the PPI should not be associated with toxicity; ii) Key residues involved in the interaction and defining hot spots should be characterized through mutagenesis analyses, alanine scanning or by server prediction; iii) Structural information on the PPI complex and/or unbound forms should be available to accelerate the process; bridging water molecules should be taken into account when available and because the best conformation to target for PPI inhibition is not necessarily the one found in the complex, the natural conformational dynamics of the target should be investigated through molecular dynamic simulations 3To this critical question A recent study concluded that small molecule PPI modulators are larger (average molecular weight >400 Da), more hydrophobic , with more aromatic rings (\u223c4 in average) and make fewer hydrogen bonds with the protein than average drugs We have gathered information available for 17 PPIs with known inhibitors whose three dimensional structural had been characterized. The interfaces were analyzed in terms of geometrical parameters, shape and chemical properties. The protein/protein complexes could be divided into two classes according to different parameters, such as the number of segments at the interface. Class I PPIs correspond to those that interact with peptide-like partners and show more secondary structure elements at the interface, whereas the class II group comprises more globular protein/protein complexes with more unstructured elements at the interface.The different PPIs were further classified by PCA analysis using descriptors that were selected based on t-test evaluations and general analyses of the interfaces. Six interfacial parameters were selected corresponding to ASA, Gap volume, percentage of charged residues, number of segments, hydrogen bonds and total volume pockets. Three clusters were defined as a result of the PCA analysis; cluster 1 corresponded to class I PPIs, while class II PPIs were subdivided into two clusters.Analysis of the part of the PPI that corresponds to the region directly in contact with the inhibitor led to similar results. However, minor differences could be observed, which suggests that parameters that define the druggability of a target are probably different from the parameters that define the chemical space of PPI inhibitors. The descriptors were selected for their ability to discriminate between whole PPIs with known inhibitors and transient dimers; additional parameters would have to be selected to predict the chemical space of the ligands that are likely to disrupt a given PPI.DB because of the limited amount of data currently available. However, the definition of what makes a PPI a potentially druggable target will become more and more reliable as the number of 3D structures increases.The number of structurally characterized complexes with known inhibitors is small. Therefore, the chemical space of PPIs is not completely covered in the 2P2IThe ZipA example, in which the ligand is lying on the protein surface in an unconventional way .The results of our study serve to expand current knowledge with new data and focuses at the interface of protein/protein complexes with prior structural knowledge. The proposed classification should lead to a better definition of potentially successful PPI targets and will accelerate the process of designing new PPI drugs. As successes in discovering PPI inhibitors accumulate, the parameters will be refined and the classification scheme updated.http://2p2idb.cnrs-mrs.fr).The whole 2P2I dataset was organized as a relational database and can be accessed through a publicly available web server  were not found in the PDB search either because the interacting partner was a peptide or because of the x-ray resolution (>2 \u00c5).Eight protein/protein and 31 protein/ligand were retrieved by an exhaustive search of the literature ; 1z1m, 1ttv (MDM2/p53); 1tfq, 1tft (XIAP_BIR3/CASPASE_9); 1f9x (XIAP_BIR3/SMAC); 1oo9 (MMP3/TIMP1) corresponds to solution NMR structures. All other PDB codes correspond to x-ray structures.The two lists were combined to form the final dataset, which can be downloaded at The protein-protein interaction inhibition relational database was developed with MySqL. It stores information about the 17 PPIs described in this study. Scripts for interaction with the DB have been developed in PhP with the software MyAdmin.DB database can be accessed through a web-based user interface (http://2p2idb.cnrs-mrs.fr). This platform allows users to query the database to get structural information about interfaces of stored complexes. The whole database can be searched by protein family, PDB codes of the free proteins, protein-protein or protein-ligand complexes, UniProt numbers, ligand three letter codes or by cluster number.The 2P2IThe user can also provide key parameters calculated from other web resources to compare the property of a given PPI to the 2P2I dataset.http://www.ebi.ac.uk/Tools/dalilite/index.html) and are summarized into The root mean square deviations (rmsd) between free and bound states of different proteins were computed over CA atoms using DaliLite server (http://www.bioinformatics.sussex.ac.uk/protorp/). Continuous interface segment have been defined in the literature as a stretch of residues that starts and ends with interface residues and may contain intervening non-interface residues. While considering the length of the segment, only interface residues are counted Planarity, eccentricity, secondary structure in interface, Gap volume, Gap volume index, number of atoms in interface, % polar atoms in interface, % non polar atoms in interface, % neutral atoms in interface, number of residues in interface, % polar residues in interface and % non polar residues at the interfaces were calculated with the ProtorP server using default parameters (Accessible surface area (ASA) and percentage of charged residues were computed with the Naccess program with a probe radius of 1.4 \u00c5. The size of the interface corresponded to the difference in ASA between the protein without its partner and in the complex.http://www.bioinformatics.leeds.ac.uk/qsitefinder) on the protein-protein, protein-inhibitor complexes and the equivalent free proteins Pockets at the interface were computed with the Q-SiteFinder server  using a 3.2 \u00c5 distance cutoff between the hydrogen atom and the acceptor atom and were checked manually.Hydrogen bonds were computed with the Pymol software (http://www.ks.uiuc.edu/Research/vmd/).A salt bridge was considered when an acidic residue (Asp or Glu) on one side of the interface and a basic residue  on the other side were less than 4.0 \u00c5 apart. Each putative salt bridge was then validated manually using VMD , values higher than 1.34 correspond to probabilities of more than 90% confidence. On the one hand, if t-value is positive and greater than 1.34, then the mean of the studied parameter is significantly greater in the 2P2IDB dataset than in the RCSB transient dimers dataset at 90% or higher confidence level. On the other hand, if the t-value is negative and less than \u22121.34, then the mean of the studied parameter is significantly less in the 2P2IDB dataset than in the RCSB transient dimers dataset.Where Varhttp://www.R-project.org) and the ade4 package Six parameters  were selected for the multivariate analysis performed according to the principal component analysis. Data were analyzed with the R software . The IQZ inhibitor ZipA surface is shown as a stick representation. .(0.11 MB PDF)Click here for additional data file.Figure S22 of accessible surface area. The X-axis represents the number of hydrogen bonds per 100 \u00c52. The Y-axis illustrates the number of complexes present in 2P2IDB having this number of hydrogen bonds (within \u00b10.1), i.e. y value at x\u200a=\u200a0.6 indicates that there are 3 complexes having 0.3 to 0.5 hydrogen bonds per 100 \u00c52.Hydrogen bonds per 100 \u00c5(0.09 MB PDF)Click here for additional data file.Figure S3Advanced query search of the protein databank. This table lists the different parameters used to parse the protein databank to search for proteins bound to a small molecule inhibitor.(0.08 MB PDF)Click here for additional data file.Table S1Root mean square deviations for the complexes in 2P2I database. The rms are computed between the unbound protein and its equivalent in the protein/protein complex; the unbound protein and its homologous in complex with the inhibitor; the protein in complex with its partner and the homologous in complex with the inhibitor. When several structures are compared, the average is shown. All RMSD were performed over CA atoms with the DaliLite web server.(0.15 MB PDF)Click here for additional data file.Table S2Secondary structure at interface. This table lists secondary structures at interface (as defined in M&M) for each complex present in 2P2IDB. Information is detailed for both the target protein and its partner.(0.16 MB PDF)Click here for additional data file.Table S3Geometrical and chemical parameters for the subset of the interface at 4.5 \u00c5 around the inhibitor. The parameters are detailed for each complex of 2P2IDB and mean and standard deviations are shown for class I, class II and the whole database.(0.16 MB PDF)Click here for additional data file.", "texts": ["Inhibitors of these original interactions are certainly the next generation of highly innovative drugs that will reach the market in the next decade. However, DB, a hand-curated database dedicated to the structure of PPIs with known inhibitors. We have analyzed protein/protein and protein/inhibitor interfaces in terms of geometrical parameters, atom and residue properties, buried accessible surface area and other biophysical parameters. The interfaces found in 2P2IDB were then compared to those of representative datasets of heterodimeric complexes. We propose a new classification of PPIs with known inhibitors into two classes depending on the number of segments present at the interface and corresponding to either a single secondary structure element or to a more globular interacting domain. 2P2IDB complexes share global shape properties with standard transient heterodimer complexes, but their accessible surface areas are significantly smaller. No major conformational changes are seen between the different states of the proteins. The interfaces are more hydrophobic than general PPI's interfaces, with less charged residues and more non-polar atoms. Finally, fifty percent of the complexes in the 2P2IDB dataset possess more hydrogen bonds than typical protein-protein complexes. Potential areas of study for the future are proposed, which include a new classification system consisting of specific families and the identification of PPI targets with high druggability potential based on key descriptors of the interaction.Here we describe this particular PPI chemical space through the presentation of 2P2Ihttp://2p2idb.cnrs-mrs.fr.2P2I database stores structural information about PPIs with known inhibitors and provides a useful tool for biologists to assess the potential druggability of their interfaces. The database can be accessed at  In the last decade, the inhibition of protein-protein interactions (PPIs) has emerged from both academic and private research as a new way to modulate the activity of proteins  are certainly the next generation of highly innovative drugs that will reach the market in the next decade.et al. analyzed the atomic interactions and profile of small molecules disrupting PPIs in the TIMBAL database, focusing on small molecules properties and comparing these results to drug-like databases As a consequence of this enthusiasm, the exponential increase of published biomedical literature on PPIs and their inhibition has prompted the development of internet services and databases that help scientists to manage the available information. There is now a growing number of structural databases dedicated to protein-protein interactions DB, which is a hand-curated database dedicated to the structure of Protein-Protein complexes with known inhibitors thereby offering complementary information to these previous analyses (2P2IDB is available at http://2p2idb.cnrs-mrs.fr). We have analyzed the protein/protein and protein/inhibitor interfaces in terms of geometrical parameters, atom and residue properties, buried accessible surface area and other biophysical parameters, such as the protein-protein dissociation constant (Kd) of a complex. The interfaces found in 2P2IDB were then compared to those of representative datasets of heterodimeric complexes from Bahadur and Zacharias http://www.bioinformatics.sussex.ac.uk/protorp/ and We describe here a chemical space, 2P2IDB present globally the same shape (planarity or eccentricity) than standard heterodimeric complexes, but their accessible surface areas are significantly smaller. More strikingly, no major conformational changes are observed between the different states of the proteins . The interfaces are also more hydrophobic than general PPIs' interfaces, with less charged residues and more non-polar atoms. Moreover, fifty percent of the complexes in the 2P2IDB dataset possess more hydrogen bonds than typical protein-protein complexes. A set of key descriptors were identified to distinguish between PPIs with known inhibitors and representative transient complexes in the protein databank. Transient protein-protein complexes are defined as protomers that, in vivo, can exist either on their own or in complex and also undergo an exchange between the free and complexed form The architecture present at the interface generally involves a globular interacting domain, a single secondary structure element  of a globular protein, or a short peptide. Complexes in 2P2IA new classification based on these parameters is proposed with potential aims for the future to identify potential new druggable PPI targets.DB) that was used to further analyze the general properties of protein/protein interfaces (PPIs) with a known inhibitor. The 2P2IDB (http://2p2idb.cnrs-mrs.fr) contains a total of 17 protein/protein complexes corresponding to 14 families and 56 small molecule inhibitors bound to the corresponding target .There are a limited number of targets in the 2P2I database at this stage due to the structural prerequisites that were used. However, it is inevitable that high throughput structural genomic programs will generate a high level of data. In addition, the development of improved methodologies for the development of small molecule inhibitors will rapidly lead to the discovery and structural characterization of disruptors of new PPI families. These new targets and their corresponding ligands will be incorporated into the database as they appear in the literature and the Protein Data Bank  was not significantly different than the natural conformational dynamics of the free target protein and was in the same range as the resolution of the crystal structures. Some local rearrangements could be observed at the binding site; however, these rearrangements do not impair the possibility to design potent inhibitors with high affinity. The fact that there is no main rearrangement between the different forms in the 2P2IDB dataset could mean that these types of complexes are easier to target. Other strategies with small molecule inhibitors binding at different sites, such as an allosteric pocket away from the interface, would be necessary to disrupt PPIs with large conformational rearrangements. These classes of inhibitors are not present in the 2P2IDB, as we only kept those ligands that are present at the interface.The formation of heterodimeric complexes can lead to large rearrangements of the two protein partners We analyzed the general characteristics of the protein/protein interfaces (PPIs) using online servers A more detailed analysis revealed that complexes from class I contained a higher proportion of secondary structure elements at the interface. Four out of 6 complexes involved mainly an alpha helix at the interface, and the other two a beta strand  or inhibitory (Ki) constants of the protein/protein complexes were compared  was significantly smaller than the standard average values of approximately 1000 \u00c52 observed for heterodimeric protein-protein complexes, as described in the literature by Bahadur and Zacharias 2 and 769\u00b1150 \u00c52 were observed for class I  was not significantly distinguishable (0.72\u00b10.12 vs. 0.70\u00b10.12). Similar values were observed for the two classes defined above. The Gap volume index (GVi) provides a measure of the tightness of a protein-protein complex The average planarity of interfaces in our dataset was 2.8\u00b10.4 \u00c5, which is a value equivalent to that of overall heterodimeric complexes (2.7\u00b11.2 \u00c5). Similarly, eccentricity  than standard transient heterodimers (27.0\u00b112.5%). This result indicates that PPIs with known inhibitors are more hydrophobic than typical heterodimers, which can be correlated to the observation that small molecule PPI modulators are hydrophobic DB dataset and transient heterodimers for the four selected parameters corresponded to probabilities higher than 90% confidence according to the t-distribution table of significance.We used a student's t-test to compare the main descriptors of PPIs in our dataset to standard heterodimers in an attempt to extract the most discriminating parameters that govern the druggability of a PPI. The number of interfacial segments, accessible surface area (ASA), Gap volume, hydrogen bonds and the percentage of charged residues were selected as the key parameters that typify PPIs with known inhibitors . The difDB dataset into different families. Pockets volumes were not incorporated in the t-test study because statistics were not available to compare to the transient protein-protein dataset. However, they were used in the PCA analysis because they are known to play an important role in protein-protein specific interaction In addition to the five parameters defined above , the combined pocket volumes at the interface were used in a principal component analysis (PCA) to separate the 2P2IL/Bak complex (PDB code: 1bxl), the high values for ASA and the number of segments and low hydrogen bond content led to its classification next to the FKBP12/TGFR complex (PDB code: 1b6c). Subtilisin/Eglin C and trypsin/trypsin, which formed a separated cluster when considering the whole interface, were grouped together when considering the part of the interface that interacts with the ligand.A similar PCA analysis was performed with parameters derived from the subset of the interface that is in direct contact with the inhibitor in the protein/ligand structure . The samA web server was developed to facilitate the access to the data calculated for the different PPIs. It allows the user to search for specific complexes using different query procedures based on families, pdb codes, Uniprot numbers, cluster family or ligand properties . For eacDB dataset using the six key descriptors that were selected for the PCA analyses  is also provided. Finally, individual scores for each parameter are calculated. Lower values are indicative of complexes with high potential to become druggable targets whereas higher scores are likely to correspond to poorly druggable complexes.An interactive menu allows the user to compare the properties of a given PPI to the 2P2Ianalyses . The paranalyses  and entePPIs interfaces have long been considered to be poorly druggable because of their general properties. However, in the last few years, a growing number of PPI inhibitors have been discovered, and some of these inhibitors have even reached the preclinical stage of investigation \u201cWhat makes a PPI an attractive target for the discovery and development of small molecules?\u201d we can portray the good PPI candidates in a few points, which are summarized from existing published data, as follows: i) The target should be validated at least biologically  or, even more importantly, clinically, and the inhibition of the PPI should not be associated with toxicity; ii) Key residues involved in the interaction and defining hot spots should be characterized through mutagenesis analyses, alanine scanning or by server prediction; iii) Structural information on the PPI complex and/or unbound forms should be available to accelerate the process; bridging water molecules should be taken into account when available and because the best conformation to target for PPI inhibition is not necessarily the one found in the complex, the natural conformational dynamics of the target should be investigated through molecular dynamic simulations 3To this critical question A recent study concluded that small molecule PPI modulators are larger (average molecular weight >400 Da), more hydrophobic , with more aromatic rings (\u223c4 in average) and make fewer hydrogen bonds with the protein than average drugs We have gathered information available for 17 PPIs with known inhibitors whose three dimensional structural had been characterized. The interfaces were analyzed in terms of geometrical parameters, shape and chemical properties. The protein/protein complexes could be divided into two classes according to different parameters, such as the number of segments at the interface. Class I PPIs correspond to those that interact with peptide-like partners and show more secondary structure elements at the interface, whereas the class II group comprises more globular protein/protein complexes with more unstructured elements at the interface.The different PPIs were further classified by PCA analysis using descriptors that were selected based on t-test evaluations and general analyses of the interfaces. Six interfacial parameters were selected corresponding to ASA, Gap volume, percentage of charged residues, number of segments, hydrogen bonds and total volume pockets. Three clusters were defined as a result of the PCA analysis; cluster 1 corresponded to class I PPIs, while class II PPIs were subdivided into two clusters.Analysis of the part of the PPI that corresponds to the region directly in contact with the inhibitor led to similar results. However, minor differences could be observed, which suggests that parameters that define the druggability of a target are probably different from the parameters that define the chemical space of PPI inhibitors. The descriptors were selected for their ability to discriminate between whole PPIs with known inhibitors and transient dimers; additional parameters would have to be selected to predict the chemical space of the ligands that are likely to disrupt a given PPI.DB because of the limited amount of data currently available. However, the definition of what makes a PPI a potentially druggable target will become more and more reliable as the number of 3D structures increases.The number of structurally characterized complexes with known inhibitors is small. Therefore, the chemical space of PPIs is not completely covered in the 2P2IThe ZipA example, in which the ligand is lying on the protein surface in an unconventional way .The results of our study serve to expand current knowledge with new data and focuses at the interface of protein/protein complexes with prior structural knowledge. The proposed classification should lead to a better definition of potentially successful PPI targets and will accelerate the process of designing new PPI drugs. As successes in discovering PPI inhibitors accumulate, the parameters will be refined and the classification scheme updated.http://2p2idb.cnrs-mrs.fr).The whole 2P2I dataset was organized as a relational database and can be accessed through a publicly available web server  were not found in the PDB search either because the interacting partner was a peptide or because of the x-ray resolution (>2 \u00c5).Eight protein/protein and 31 protein/ligand were retrieved by an exhaustive search of the literature ; 1z1m, 1ttv (MDM2/p53); 1tfq, 1tft (XIAP_BIR3/CASPASE_9); 1f9x (XIAP_BIR3/SMAC); 1oo9 (MMP3/TIMP1) corresponds to solution NMR structures. All other PDB codes correspond to x-ray structures.The two lists were combined to form the final dataset, which can be downloaded at The protein-protein interaction inhibition relational database was developed with MySqL. It stores information about the 17 PPIs described in this study. Scripts for interaction with the DB have been developed in PhP with the software MyAdmin.DB database can be accessed through a web-based user interface (http://2p2idb.cnrs-mrs.fr). This platform allows users to query the database to get structural information about interfaces of stored complexes. The whole database can be searched by protein family, PDB codes of the free proteins, protein-protein or protein-ligand complexes, UniProt numbers, ligand three letter codes or by cluster number.The 2P2IThe user can also provide key parameters calculated from other web resources to compare the property of a given PPI to the 2P2I dataset.http://www.ebi.ac.uk/Tools/dalilite/index.html) and are summarized into The root mean square deviations (rmsd) between free and bound states of different proteins were computed over CA atoms using DaliLite server (http://www.bioinformatics.sussex.ac.uk/protorp/). Continuous interface segment have been defined in the literature as a stretch of residues that starts and ends with interface residues and may contain intervening non-interface residues. While considering the length of the segment, only interface residues are counted Planarity, eccentricity, secondary structure in interface, Gap volume, Gap volume index, number of atoms in interface, % polar atoms in interface, % non polar atoms in interface, % neutral atoms in interface, number of residues in interface, % polar residues in interface and % non polar residues at the interfaces were calculated with the ProtorP server using default parameters (Accessible surface area (ASA) and percentage of charged residues were computed with the Naccess program with a probe radius of 1.4 \u00c5. The size of the interface corresponded to the difference in ASA between the protein without its partner and in the complex.http://www.bioinformatics.leeds.ac.uk/qsitefinder) on the protein-protein, protein-inhibitor complexes and the equivalent free proteins Pockets at the interface were computed with the Q-SiteFinder server  using a 3.2 \u00c5 distance cutoff between the hydrogen atom and the acceptor atom and were checked manually.Hydrogen bonds were computed with the Pymol software (http://www.ks.uiuc.edu/Research/vmd/).A salt bridge was considered when an acidic residue (Asp or Glu) on one side of the interface and a basic residue  on the other side were less than 4.0 \u00c5 apart. Each putative salt bridge was then validated manually using VMD , values higher than 1.34 correspond to probabilities of more than 90% confidence. On the one hand, if t-value is positive and greater than 1.34, then the mean of the studied parameter is significantly greater in the 2P2IDB dataset than in the RCSB transient dimers dataset at 90% or higher confidence level. On the other hand, if the t-value is negative and less than \u22121.34, then the mean of the studied parameter is significantly less in the 2P2IDB dataset than in the RCSB transient dimers dataset.Where Varhttp://www.R-project.org) and the ade4 package Six parameters  were selected for the multivariate analysis performed according to the principal component analysis. Data were analyzed with the R software . The IQZ inhibitor ZipA surface is shown as a stick representation. .(0.11 MB PDF)Click here for additional data file.Figure S22 of accessible surface area. The X-axis represents the number of hydrogen bonds per 100 \u00c52. The Y-axis illustrates the number of complexes present in 2P2IDB having this number of hydrogen bonds (within \u00b10.1), i.e. y value at x\u200a=\u200a0.6 indicates that there are 3 complexes having 0.3 to 0.5 hydrogen bonds per 100 \u00c52.Hydrogen bonds per 100 \u00c5(0.09 MB PDF)Click here for additional data file.Figure S3Advanced query search of the protein databank. This table lists the different parameters used to parse the protein databank to search for proteins bound to a small molecule inhibitor.(0.08 MB PDF)Click here for additional data file.Table S1Root mean square deviations for the complexes in 2P2I database. The rms are computed between the unbound protein and its equivalent in the protein/protein complex; the unbound protein and its homologous in complex with the inhibitor; the protein in complex with its partner and the homologous in complex with the inhibitor. When several structures are compared, the average is shown. All RMSD were performed over CA atoms with the DaliLite web server.(0.15 MB PDF)Click here for additional data file.Table S2Secondary structure at interface. This table lists secondary structures at interface (as defined in M&M) for each complex present in 2P2IDB. Information is detailed for both the target protein and its partner.(0.16 MB PDF)Click here for additional data file.Table S3Geometrical and chemical parameters for the subset of the interface at 4.5 \u00c5 around the inhibitor. The parameters are detailed for each complex of 2P2IDB and mean and standard deviations are shown for class I, class II and the whole database.(0.16 MB PDF)Click here for additional data file."]}
-{"representative": "Drosophila genetics dating back to the Morgan School. While considerable attention has been placed on the genetic novelties that duplicates are capable of introducing, and the role that positive selection plays in their early stages of duplicate evolution, much less attention has been given to the potential consequences of ectopic  gene conversion on these evolutionary processes. In this paper we consider the historical origins of ectopic gene conversion models and present a synthesis of the current Drosophila data in light of several primary questions in the field.The evolutionary impact of gene duplication events has been a theme of  Gene family expansions have jointly contributed to genome size , and to Though most duplicate alleles will eventually be lost from a population, a complex interaction between genetic drift, mutation and selection can occasionally lead to duplicate fixation and preservation . Unlike Drosophila. After summarizing commonly used methods for detecting EGC, the paper is structured into two main sections. In the first, we briefly outline the historical context in which EGC came to be studied in Drosophila, and describe how EGC research emerged from a more general analysis of repetitive DNA and concerted evolution. The second section provides an up-to-date analysis of the Drosophila empirical literature concerning duplication and EGC. We anchor the synthesis around several broad and unresolved questions:What is the relative contribution of EGC to patterns of concerted evolution?How does genomic context  affect EGC?How do selection and EGC interact to influence adaptation?Does gene conversion between duplicates bias estimates of the gene duplication rate and the tempo of paralog differentiation?A large body of theoretical work illustrates that EGC can greatly influence the evolutionary dynamics of duplicates ,19, yet Drosophila duplications. However, the empirical limitations of jointly testing for interactions between conversion, selection, linkage, and gene family size preclude a strong conclusion about the temporal duration of conversion between duplicates, or its role in promoting or constraining adaptation. We describe future analyses that may shed light on these unresolved issues.Our general conclusion is that EGC, at minimum, plays a consequential role during the early evolution of physically linked 2.Methods for detecting EGC have been developed for both divergence-  and polymorphism-based sequence data sets . Though the scope of this review does not include a detailed discussion of the methods used, it is helpful to introduce and highlight the most commonly used approaches for detecting EGC . ThroughDrosophila literature, the two most cited divergence-based approaches utilize the GENCONV software package [Within the  package  or test  package .Tests of incongruity between species trees and gene trees are based on the following logic. If phylogenetic information suggests that a given duplication event preceded speciation between two or more species, but DNA sequence data for paralogs within species demonstrate greater sequence identity than orthologs between species, then the datasets are identified as \u201cirreconcilable\u201d. In these cases, EGC can be invoked to explain the disagreement between phylogenetic dating of duplication events and the relative sequence identity between paralogs and orthologs . Such rA third divergence-based method is based on analysis of two types of nucleotide substitutions between paralogous and orthologous sequence alignments: 1) substitutions between orthologs that are shared between paralogs; and 2) substitutions between paralogs that are shared between orthologs. The former pattern supports a conversion model, while the latter is indicative of evolutionary independence between paralogs . ThroughThe least widely used (but most powerful) method relies on polymorphism data within a species. Alignments of the set of paralogs can be used to identify shared polymorphism. Given a low point mutation rate (as expected), parallel mutations and shared polymorphism will be rare without EGC. The actual amount of shared polymorphism between paralogs can be used to identify recent conversion events, and to estimate the rate of conversion between the paralogs . We refe3.3.1.Current debates about EGC can be traced to earlier ones over concerted evolution from the mid 1960s to the 1970s. These debates, in turn, were intertwined with emerging interest in the evolution of genome size and the underlying importance of repetitive DNA.Bar locus duplication, discovered by members of the Morgan lab [Bar duplication and the first evidence of concerted evolution in 1972 [The first empirical evidence for genome size plasticity traces back to the rgan lab \u201325. Duri in 1972 , advance in 1972 \u201328. Alon in 1972 ,29\u201332, w in 1972 ,33. In aFrom this earlier research on genomic content, the model most relevant to ectopic conversion is the master-slave model ,34. WorkLater modifications to the \u201crectifying\u201d model attest to its appeal during this time. For example, the original master\u2013slave model assumed that each master gene was separated by intervals comprised of repetitive slave copies, yet subsequent data indicated that unique genes (rather than copies) were likely to be physically linked . Thus, tBy the start of the 1970s, much emphasis had been placed on understanding the origins and implications of repetitive DNA, which raised questions about the evolutionary maintenance of repeats, conversion biases, interactions between selection and conversion, and the importance of chromosomal context in mediating concerted evolution. These questions remain important today.3.2.Drosophila.To improve understanding of the evolutionary dynamics of repetitive DNA, the pre-molecular biology world needed a more tractable model system. rDNA was well suited for this role ,39, and et al. [Xenopus species. They showed that individual rDNA array units exhibited very high sequence identity within compared to between species. This suggested that a \u201ccorrection mechanism\u201d between repeats resulted in \u201chorizontal evolution\u201d within species. Though Brown et al. [The abundant transcriptional products of rDNA loci, together with hybridization and denaturation methods of the time, provided an opportunity to estimate copy number differences and sequence divergence of repetitive units within and between species. Detailed evolutionary studies of rDNA arrays across diverse taxa gained momentum starting in the mid 1960s . Most noet al. , which pn et al.  did not Xenopus DNA data [With evolutionary models for repetitive DNA already developed, the field was situated to integrate empirical patterns of concerted evolution. One explanation for the pattern invoked the already popular model of unequal crossing over. High rates of unequal crossing over could permit the stochastic spread of identical copies throughout a given array, leading to a pattern of high sequence identity between individual copies. The alternative explanation harkened back to models of homogenization between duplicates, such as the master\u2013slave model. Though not conclusive, initial support for unequal crossing over was provided by DNA data ,40, and DNA data ,42.Drosophila had large rDNA arrays on both the X and Y chromosome. A role for unequal crossing over during the evolution of these arrays had been suggested from studies of the bobbed mutant, which was associated with deficiencies of X-linked rDNA genes [bobbed phenotype led to the discovery of \u201cDNA magnification\u201d, where male germlines deficient for both X- and Y-linked rDNA could revert to the wild-type rDNA gene number [D. melanogaster species subgroup and D. hydei [Xenopus, high sequence identity between repeats was found for the nontranscribed regions . In the D. melanogaster species group, there are two pairs of HSP genes (Hsp70Aa/Hsp70Ab and Hsp70Ba/Hsp70Bb), with each pair tightly linked in a \u201cpalindromic\u201d  orientation on the Muller E chromosome (chromosome 3R of D. melanogaster). This type of orientation has an interesting property with respect to ectopic recombination. A double-strand break in one of the paralogs can become resolved by gene conversion . HIP/HIP-R genes are X-linked, non-inverted duplicates that are confined to the D. melanogaster lineage. Like HSP genes, extensive shared polymorphisms indicate that these cofactor duplicates are undergoing conversion.As an ancient and evolutionarily conserved gene family, HSPs are good Drosophila EGC is the amylase gene clusters. The D. melanogaster species group includes a conserved set of linked paralogs (Amy-p and Amy-d) in palindromic orientation (similar to Hsp70 genes). Early work based on restriction site analysis [Another classic study system for analysis  showed tanalysis ,60, withanalysis ,62).D. melanogaster, and one or more additional clusters [D. pseudoobscura inversion karyotypes were once again limited to coding regions [Drosophila kikkawai and close relatives have two highly-divergent clusters of linked, palindromic amylase genes (Amy1/Amy2 and Amy3/Amy4), with each cluster showing high sequence identity [Amy3/Amy4 may indicate EGC or a duplication event. The Amy1/Amy2 pair, which appears to be orthologous to the melanogaster cluster, shows evidence of coding (but no noncoding) concerted evolution, which supports a model of continuous EGC [Subsequent work was extended to species outside of the melanogaster group, which carried an amylase cluster orthologous to clusters . Concert regions ,65. Drosidentity . Homogenuous EGC ,68.Idgf genes [In many ways, these classical studies are representative of the case study approach to concerted evolution. Evidence for EGC is typically associated with the analysis of small gene families that are physically linked and/or evolving under purifying selection , yet thparalogs \u201378, polyparalogs .On the other hand, a focus on small gene families will likely minimize the effect of gene turnover. Larger gene families are expected to be more permissive to the fixation of duplicates relative to smaller gene families because their sensitivity to deleterious dosage effects might be relatively low and their rate of copy number mutations might be relatively high. Consequently, the importance of birth/death gene turnover will likely be greatest for large gene families. Though EGC is expected to occur in such cases, disentangling EGC and gene turnover requires information about the age of individual members of a gene family, and polymorphism data to estimate the rate of EGC. Such data sets are difficult to obtain for large, repetitive gene clusters where individual copies cannot easily be distinguished ,81.4.2.Drosophila. These studies utilize different methodologies, yield different results, and emphasize EGC between gene families of different ages and degrees of sequence divergence. The perspectives of these studies seemingly reflect different evolutionary questions regarding the interplay between duplication and EGC. One perspective is geared towards understanding how EGC might govern the evolutionary fates of young duplicates. The other emphasizes broad patterns of EGC and is less concerned with the relative age or size of the gene families. Despite their differences, these studies utilize partially overlapping distributions of gene family ages, and it is within this region of overlap where some of the more puzzling differences emerge.It is currently unclear how prevalent EGC is at a genomic scale. To date, there have only been three genome-wide studies that directly addressed this question in et al. [et al. [Drosophila species . Hahn et al. applied maximum likelihood methods to infer rates of gene gain and loss along each branch of the species tree and then compared these results with those from a gene-tree/species-tree reconciliation analysis. If EGC has played a major role genome-wide, they expected that their reconciliation methods would infer multiple, parallel duplications across lineage. They estimated that approximately 17 genes were gained or lost every million years, with few signatures of EGC inferred by reconciliation analysis. The authors concluded that EGC leaves, at most, a minor genomic signature.Analysis of the long-term effects of EGC was carried out by Hahn et al.  and Caso [et al. , using gspecies  and 14.15% (in D. grimshawi). Peak conversion activity was observed for paralogs with silent divergence between dS = 0.1 and dS = 0.3. Phylogenetic reconciliation methods were also consistent with low amounts of EGC, with 1% to 3% of gene trees within the D. melanogster subgroup, and up to 15% of gene trees within deeper branches of the Drosophila tree, showing signs of EGC. The authors concluded that EGC was relevant for relatively young duplicates having silent divergence ranging between 0.1 and 0.3. Casola et al. also reapplied the likelihood-reconciliation methods used by Hahn et al. [Casola n et al. , and agaD. melanogaster, D. simulans, D. sechellia, D. yakuba, and D. erecta, to identify duplication events immediately prior to or following divergence between D. melanogaster, D. simulans, and D. sechellia. The motivation of this approach was based on the expectation that EGC should be more active and more easily estimated in young gene families. EGC was estimated with reconciliation (tree-based) methods , and site-specific tests (see above). Of 28 post-speciation blocks available for the tree-based analysis, 24 provided evidence of EGC in the D. melanogaster lineage, the D. simulans lineage, or in both. The sliding window approach identified at least one signature of EGC in every block. Likewise, the site-based test identified a signal of EGC in 29/30 pre-speciation blocks.Osada and Innan  focused et al. note that additional differences might result from the failure of Osada and Innan to account for parallel duplications between species (rapid birth-and-death rate), which potentially generate gene trees mimicking those predicted under a conversion model. They highlight estimates of high copy number variation  as suppn  as well as complex factors, such as the three-dimensional conformation of chromosomes . While tD. melanogaster and more distantly related species: e.g., [The growing availability of genomic data has shed some light on features correlated with EGC. One tractable question is how the physical distance between duplicates correlates with EGC. Several studies indicate a negative correlation between physical distance and conversion between paralogs . s: e.g., . This reDrosophila duplicates is generally higher within conversion tracts relative to sequences that flank each tract, which suggests that the underlying conditions favoring conversion biases may commonly be present in paralogs [Another question is whether EGC is biased. To date, there is no compelling evidence for this, yet the subject warrants future study. GC-biased conversion is often observed in cases of allelic (non-ectopic) conversion in mammals . GC contparalogs . Interesparalogs .6.The interaction between EGC and natural selection is central to interpretations of concerted evolution patterns, as well as inferences about the rate of ongoing EGC. The likelihood of conversion between non-allelic sequences is, in part, a function of their degree of sequence identity. For gene family members evolving under strong purifying selection, relatively high sequence identity is expected in the absence of EGC. EGC will further reduce divergence between paralogs by homogenizing (putatively) neutrally evolving synonymous sites, introns and intergenic DNA, and by promoting parallel adaptation in functionally relevant sites . For example, the interaction between EGC and natural selection may prevent the accumulation of deleterious mutations ,94\u201396, oWhile EGC can promote adaptation among functionally redundant genes, it may also constrain adaptive differentiation between paralogs\u2014a process that might impact the evolution of new gene functions ,98\u2013100. Drosophila supports both reinforcing and antagonistic interactions between selection and EGC. Positive selection between paralogs has been observed in several general contexts [Some evidence from contexts ,104,105.contexts ,75,79. TDrosophila: e.g., [versus between chromosomes. Thornton & Long [D. melanogaster genome, and found a pattern of increased divergence (Ka/Ks) when both duplicates resided on the X chromosome, but otherwise no consistent effect of intra- vs. inter-chromosome paralog orientation. To the extent that amino acid divergence has been driven by positive selection, the pattern does not indicate any constraint imposed by EGC.Conflict between EGC and disruptive selection might potentially be examined by comparing patterns of divergence between paralog pairs experiencing markedly different rates of EGC. For example, if paralogs on different chromosomes experience reduced EGC compared to closely linked paralogs , one min & Long  comparedD. melanogaster should enhance statistical power to identify and estimate the rate of EGC, particularly in small gene families or other low-copy repeat sequences. Polymorphism data will also permit discrimination between evolutionary models of genetic drift and positive selection ; these ancient duplication events may represent a filtered (and therefore biased) set of duplicates. Osada and Innan  have emprthologs ,107, ratThe second caveat concerns the potential relationship between selection and degree of dispersion between duplicates. While a negative relationship between EGC rate and distance is expected (see above), it is also possible that disruptive selection between duplicates might also covary with distance. If, for example, unlinked paralogs are exposed to different local chromatin states, or are influenced by distinct local promoter sequences, then the opportunity for disruptive selection might increase with greater dispersion between paralogs. Creative statistical and bioinformatic approaches will be required to control for possible spurious correlations between distance and adaptive differentiation.7.i.e., their ages and the distribution of inter-paralog divergence) will critically depend on whether or not EGC occurs between paralogs, as well as the long-term covariance between selection, EGC, and paralog divergence. Our understanding of the actual dynamics of EGC can have a major impact on our interpretation of: (1) the rates of duplicate birth and death, and the age distribution of duplicate genes and (2) the temporal patterns of selection during the course of duplicate evolution.EGC can influence both the temporal patterns of duplicate gene evolution, and interpretations of these patterns within the context of evolutionary theory. The inference of selection and genetic drift from empirical properties of duplicate genes  should be clock-like, and proportional to the relative age of the duplication event. EGC will downwardly bias the distribution of dS, and lead to an overestimation of the duplicate \u201cbirth\u201d and \u201cdeath\u201d rates . However, since birth-and-death and EGC rates are largely unknown, the distribution of dS is insufficient for inferring the evolutionary rate and maintenance of gene duplicates. Exploiting genome sequence data from closely related species can circumvent this methodological limitation. Osada and Innan's [D. melanogaster/D. simulans last common ancestor (about 2.3 million years ago) suggests a duplication rate of approximately 10\u22129, per gene, per year, which is approximately ten-fold lower than earlier estimates based entirely on dS. Given the relatively short time interval separating these species , this estimate may differ from the true duplication rate in Drosophila, yet it should characterize the rate to an order of magnitude.The inferred rate of gene duplication is sensitive to assumptions about the degree of evolutionary independence between paralogs. Without EGC, neutral sequence divergence between duplications  and the silent substitution rate  stronger for ancient relative to young duplicates , and the correlation between dN/dS and dS may become more strongly negative.Another common observation is a negative relationship between the ratio of nonsynonymous to synonymous divergence between paralogs . dN/dS sophila; ,109): yo8.Drosophila, evidence for EGC is particularly strong in small gene families  with high sequence identity between paralogs . For larger gene families, and/or ancient paralog pairs, evidence for EGC is weaker, and is often difficult to distinguish from birth-and-death models.EGC can profoundly influence the evolutionary fates of young duplicates, as well as the patterns of concerted evolution within gene families of varying size and age. In Methodological limitations preclude a precise estimate for the rate of EGC, and are expected to cause a statistical bias towards type II error . The growing feasibility of collecting and analyzing whole-genome polymorphism datasets  will soDrosophila genomes and beyond) for calculating the ages of gene family members\u2014should soon favor an increasingly sophisticated analysis and interpretation of the evolutionary consequences of EGC, including its interaction with mutation, selection, and linkage.The confluence of three sources of data\u2014improved EGC estimates, rapidly accumulating CNV data that can be used to infer mutational processes for duplicates, and multispecies phylogenies (e.g., the 12", "texts": ["Drosophila genetics dating back to the Morgan School. While considerable attention has been placed on the genetic novelties that duplicates are capable of introducing, and the role that positive selection plays in their early stages of duplicate evolution, much less attention has been given to the potential consequences of ectopic  gene conversion on these evolutionary processes. In this paper we consider the historical origins of ectopic gene conversion models and present a synthesis of the current Drosophila data in light of several primary questions in the field.The evolutionary impact of gene duplication events has been a theme of  Gene family expansions have jointly contributed to genome size , and to Though most duplicate alleles will eventually be lost from a population, a complex interaction between genetic drift, mutation and selection can occasionally lead to duplicate fixation and preservation . Unlike Drosophila. After summarizing commonly used methods for detecting EGC, the paper is structured into two main sections. In the first, we briefly outline the historical context in which EGC came to be studied in Drosophila, and describe how EGC research emerged from a more general analysis of repetitive DNA and concerted evolution. The second section provides an up-to-date analysis of the Drosophila empirical literature concerning duplication and EGC. We anchor the synthesis around several broad and unresolved questions:What is the relative contribution of EGC to patterns of concerted evolution?How does genomic context  affect EGC?How do selection and EGC interact to influence adaptation?Does gene conversion between duplicates bias estimates of the gene duplication rate and the tempo of paralog differentiation?A large body of theoretical work illustrates that EGC can greatly influence the evolutionary dynamics of duplicates ,19, yet Drosophila duplications. However, the empirical limitations of jointly testing for interactions between conversion, selection, linkage, and gene family size preclude a strong conclusion about the temporal duration of conversion between duplicates, or its role in promoting or constraining adaptation. We describe future analyses that may shed light on these unresolved issues.Our general conclusion is that EGC, at minimum, plays a consequential role during the early evolution of physically linked 2.Methods for detecting EGC have been developed for both divergence-  and polymorphism-based sequence data sets . Though the scope of this review does not include a detailed discussion of the methods used, it is helpful to introduce and highlight the most commonly used approaches for detecting EGC . ThroughDrosophila literature, the two most cited divergence-based approaches utilize the GENCONV software package [Within the  package  or test  package .Tests of incongruity between species trees and gene trees are based on the following logic. If phylogenetic information suggests that a given duplication event preceded speciation between two or more species, but DNA sequence data for paralogs within species demonstrate greater sequence identity than orthologs between species, then the datasets are identified as \u201cirreconcilable\u201d. In these cases, EGC can be invoked to explain the disagreement between phylogenetic dating of duplication events and the relative sequence identity between paralogs and orthologs . Such rA third divergence-based method is based on analysis of two types of nucleotide substitutions between paralogous and orthologous sequence alignments: 1) substitutions between orthologs that are shared between paralogs; and 2) substitutions between paralogs that are shared between orthologs. The former pattern supports a conversion model, while the latter is indicative of evolutionary independence between paralogs . ThroughThe least widely used (but most powerful) method relies on polymorphism data within a species. Alignments of the set of paralogs can be used to identify shared polymorphism. Given a low point mutation rate (as expected), parallel mutations and shared polymorphism will be rare without EGC. The actual amount of shared polymorphism between paralogs can be used to identify recent conversion events, and to estimate the rate of conversion between the paralogs . We refe3.3.1.Current debates about EGC can be traced to earlier ones over concerted evolution from the mid 1960s to the 1970s. These debates, in turn, were intertwined with emerging interest in the evolution of genome size and the underlying importance of repetitive DNA.Bar locus duplication, discovered by members of the Morgan lab [Bar duplication and the first evidence of concerted evolution in 1972 [The first empirical evidence for genome size plasticity traces back to the rgan lab \u201325. Duri in 1972 , advance in 1972 \u201328. Alon in 1972 ,29\u201332, w in 1972 ,33. In aFrom this earlier research on genomic content, the model most relevant to ectopic conversion is the master-slave model ,34. WorkLater modifications to the \u201crectifying\u201d model attest to its appeal during this time. For example, the original master\u2013slave model assumed that each master gene was separated by intervals comprised of repetitive slave copies, yet subsequent data indicated that unique genes (rather than copies) were likely to be physically linked . Thus, tBy the start of the 1970s, much emphasis had been placed on understanding the origins and implications of repetitive DNA, which raised questions about the evolutionary maintenance of repeats, conversion biases, interactions between selection and conversion, and the importance of chromosomal context in mediating concerted evolution. These questions remain important today.3.2.Drosophila.To improve understanding of the evolutionary dynamics of repetitive DNA, the pre-molecular biology world needed a more tractable model system. rDNA was well suited for this role ,39, and et al. [Xenopus species. They showed that individual rDNA array units exhibited very high sequence identity within compared to between species. This suggested that a \u201ccorrection mechanism\u201d between repeats resulted in \u201chorizontal evolution\u201d within species. Though Brown et al. [The abundant transcriptional products of rDNA loci, together with hybridization and denaturation methods of the time, provided an opportunity to estimate copy number differences and sequence divergence of repetitive units within and between species. Detailed evolutionary studies of rDNA arrays across diverse taxa gained momentum starting in the mid 1960s . Most noet al. , which pn et al.  did not Xenopus DNA data [With evolutionary models for repetitive DNA already developed, the field was situated to integrate empirical patterns of concerted evolution. One explanation for the pattern invoked the already popular model of unequal crossing over. High rates of unequal crossing over could permit the stochastic spread of identical copies throughout a given array, leading to a pattern of high sequence identity between individual copies. The alternative explanation harkened back to models of homogenization between duplicates, such as the master\u2013slave model. Though not conclusive, initial support for unequal crossing over was provided by DNA data ,40, and DNA data ,42.Drosophila had large rDNA arrays on both the X and Y chromosome. A role for unequal crossing over during the evolution of these arrays had been suggested from studies of the bobbed mutant, which was associated with deficiencies of X-linked rDNA genes [bobbed phenotype led to the discovery of \u201cDNA magnification\u201d, where male germlines deficient for both X- and Y-linked rDNA could revert to the wild-type rDNA gene number [D. melanogaster species subgroup and D. hydei [Xenopus, high sequence identity between repeats was found for the nontranscribed regions . In the D. melanogaster species group, there are two pairs of HSP genes (Hsp70Aa/Hsp70Ab and Hsp70Ba/Hsp70Bb), with each pair tightly linked in a \u201cpalindromic\u201d  orientation on the Muller E chromosome (chromosome 3R of D. melanogaster). This type of orientation has an interesting property with respect to ectopic recombination. A double-strand break in one of the paralogs can become resolved by gene conversion . HIP/HIP-R genes are X-linked, non-inverted duplicates that are confined to the D. melanogaster lineage. Like HSP genes, extensive shared polymorphisms indicate that these cofactor duplicates are undergoing conversion.As an ancient and evolutionarily conserved gene family, HSPs are good Drosophila EGC is the amylase gene clusters. The D. melanogaster species group includes a conserved set of linked paralogs (Amy-p and Amy-d) in palindromic orientation (similar to Hsp70 genes). Early work based on restriction site analysis [Another classic study system for analysis  showed tanalysis ,60, withanalysis ,62).D. melanogaster, and one or more additional clusters [D. pseudoobscura inversion karyotypes were once again limited to coding regions [Drosophila kikkawai and close relatives have two highly-divergent clusters of linked, palindromic amylase genes (Amy1/Amy2 and Amy3/Amy4), with each cluster showing high sequence identity [Amy3/Amy4 may indicate EGC or a duplication event. The Amy1/Amy2 pair, which appears to be orthologous to the melanogaster cluster, shows evidence of coding (but no noncoding) concerted evolution, which supports a model of continuous EGC [Subsequent work was extended to species outside of the melanogaster group, which carried an amylase cluster orthologous to clusters . Concert regions ,65. Drosidentity . Homogenuous EGC ,68.Idgf genes [In many ways, these classical studies are representative of the case study approach to concerted evolution. Evidence for EGC is typically associated with the analysis of small gene families that are physically linked and/or evolving under purifying selection , yet thparalogs \u201378, polyparalogs .On the other hand, a focus on small gene families will likely minimize the effect of gene turnover. Larger gene families are expected to be more permissive to the fixation of duplicates relative to smaller gene families because their sensitivity to deleterious dosage effects might be relatively low and their rate of copy number mutations might be relatively high. Consequently, the importance of birth/death gene turnover will likely be greatest for large gene families. Though EGC is expected to occur in such cases, disentangling EGC and gene turnover requires information about the age of individual members of a gene family, and polymorphism data to estimate the rate of EGC. Such data sets are difficult to obtain for large, repetitive gene clusters where individual copies cannot easily be distinguished ,81.4.2.Drosophila. These studies utilize different methodologies, yield different results, and emphasize EGC between gene families of different ages and degrees of sequence divergence. The perspectives of these studies seemingly reflect different evolutionary questions regarding the interplay between duplication and EGC. One perspective is geared towards understanding how EGC might govern the evolutionary fates of young duplicates. The other emphasizes broad patterns of EGC and is less concerned with the relative age or size of the gene families. Despite their differences, these studies utilize partially overlapping distributions of gene family ages, and it is within this region of overlap where some of the more puzzling differences emerge.It is currently unclear how prevalent EGC is at a genomic scale. To date, there have only been three genome-wide studies that directly addressed this question in et al. [et al. [Drosophila species . Hahn et al. applied maximum likelihood methods to infer rates of gene gain and loss along each branch of the species tree and then compared these results with those from a gene-tree/species-tree reconciliation analysis. If EGC has played a major role genome-wide, they expected that their reconciliation methods would infer multiple, parallel duplications across lineage. They estimated that approximately 17 genes were gained or lost every million years, with few signatures of EGC inferred by reconciliation analysis. The authors concluded that EGC leaves, at most, a minor genomic signature.Analysis of the long-term effects of EGC was carried out by Hahn et al.  and Caso [et al. , using gspecies  and 14.15% (in D. grimshawi). Peak conversion activity was observed for paralogs with silent divergence between dS = 0.1 and dS = 0.3. Phylogenetic reconciliation methods were also consistent with low amounts of EGC, with 1% to 3% of gene trees within the D. melanogster subgroup, and up to 15% of gene trees within deeper branches of the Drosophila tree, showing signs of EGC. The authors concluded that EGC was relevant for relatively young duplicates having silent divergence ranging between 0.1 and 0.3. Casola et al. also reapplied the likelihood-reconciliation methods used by Hahn et al. [Casola n et al. , and agaD. melanogaster, D. simulans, D. sechellia, D. yakuba, and D. erecta, to identify duplication events immediately prior to or following divergence between D. melanogaster, D. simulans, and D. sechellia. The motivation of this approach was based on the expectation that EGC should be more active and more easily estimated in young gene families. EGC was estimated with reconciliation (tree-based) methods , and site-specific tests (see above). Of 28 post-speciation blocks available for the tree-based analysis, 24 provided evidence of EGC in the D. melanogaster lineage, the D. simulans lineage, or in both. The sliding window approach identified at least one signature of EGC in every block. Likewise, the site-based test identified a signal of EGC in 29/30 pre-speciation blocks.Osada and Innan  focused et al. note that additional differences might result from the failure of Osada and Innan to account for parallel duplications between species (rapid birth-and-death rate), which potentially generate gene trees mimicking those predicted under a conversion model. They highlight estimates of high copy number variation  as suppn  as well as complex factors, such as the three-dimensional conformation of chromosomes . While tD. melanogaster and more distantly related species: e.g., [The growing availability of genomic data has shed some light on features correlated with EGC. One tractable question is how the physical distance between duplicates correlates with EGC. Several studies indicate a negative correlation between physical distance and conversion between paralogs . s: e.g., . This reDrosophila duplicates is generally higher within conversion tracts relative to sequences that flank each tract, which suggests that the underlying conditions favoring conversion biases may commonly be present in paralogs [Another question is whether EGC is biased. To date, there is no compelling evidence for this, yet the subject warrants future study. GC-biased conversion is often observed in cases of allelic (non-ectopic) conversion in mammals . GC contparalogs . Interesparalogs .6.The interaction between EGC and natural selection is central to interpretations of concerted evolution patterns, as well as inferences about the rate of ongoing EGC. The likelihood of conversion between non-allelic sequences is, in part, a function of their degree of sequence identity. For gene family members evolving under strong purifying selection, relatively high sequence identity is expected in the absence of EGC. EGC will further reduce divergence between paralogs by homogenizing (putatively) neutrally evolving synonymous sites, introns and intergenic DNA, and by promoting parallel adaptation in functionally relevant sites . For example, the interaction between EGC and natural selection may prevent the accumulation of deleterious mutations ,94\u201396, oWhile EGC can promote adaptation among functionally redundant genes, it may also constrain adaptive differentiation between paralogs\u2014a process that might impact the evolution of new gene functions ,98\u2013100. Drosophila supports both reinforcing and antagonistic interactions between selection and EGC. Positive selection between paralogs has been observed in several general contexts [Some evidence from contexts ,104,105.contexts ,75,79. TDrosophila: e.g., [versus between chromosomes. Thornton & Long [D. melanogaster genome, and found a pattern of increased divergence (Ka/Ks) when both duplicates resided on the X chromosome, but otherwise no consistent effect of intra- vs. inter-chromosome paralog orientation. To the extent that amino acid divergence has been driven by positive selection, the pattern does not indicate any constraint imposed by EGC.Conflict between EGC and disruptive selection might potentially be examined by comparing patterns of divergence between paralog pairs experiencing markedly different rates of EGC. For example, if paralogs on different chromosomes experience reduced EGC compared to closely linked paralogs , one min & Long  comparedD. melanogaster should enhance statistical power to identify and estimate the rate of EGC, particularly in small gene families or other low-copy repeat sequences. Polymorphism data will also permit discrimination between evolutionary models of genetic drift and positive selection ; these ancient duplication events may represent a filtered (and therefore biased) set of duplicates. Osada and Innan  have emprthologs ,107, ratThe second caveat concerns the potential relationship between selection and degree of dispersion between duplicates. While a negative relationship between EGC rate and distance is expected (see above), it is also possible that disruptive selection between duplicates might also covary with distance. If, for example, unlinked paralogs are exposed to different local chromatin states, or are influenced by distinct local promoter sequences, then the opportunity for disruptive selection might increase with greater dispersion between paralogs. Creative statistical and bioinformatic approaches will be required to control for possible spurious correlations between distance and adaptive differentiation.7.i.e., their ages and the distribution of inter-paralog divergence) will critically depend on whether or not EGC occurs between paralogs, as well as the long-term covariance between selection, EGC, and paralog divergence. Our understanding of the actual dynamics of EGC can have a major impact on our interpretation of: (1) the rates of duplicate birth and death, and the age distribution of duplicate genes and (2) the temporal patterns of selection during the course of duplicate evolution.EGC can influence both the temporal patterns of duplicate gene evolution, and interpretations of these patterns within the context of evolutionary theory. The inference of selection and genetic drift from empirical properties of duplicate genes  should be clock-like, and proportional to the relative age of the duplication event. EGC will downwardly bias the distribution of dS, and lead to an overestimation of the duplicate \u201cbirth\u201d and \u201cdeath\u201d rates . However, since birth-and-death and EGC rates are largely unknown, the distribution of dS is insufficient for inferring the evolutionary rate and maintenance of gene duplicates. Exploiting genome sequence data from closely related species can circumvent this methodological limitation. Osada and Innan's [D. melanogaster/D. simulans last common ancestor (about 2.3 million years ago) suggests a duplication rate of approximately 10\u22129, per gene, per year, which is approximately ten-fold lower than earlier estimates based entirely on dS. Given the relatively short time interval separating these species , this estimate may differ from the true duplication rate in Drosophila, yet it should characterize the rate to an order of magnitude.The inferred rate of gene duplication is sensitive to assumptions about the degree of evolutionary independence between paralogs. Without EGC, neutral sequence divergence between duplications  and the silent substitution rate  stronger for ancient relative to young duplicates , and the correlation between dN/dS and dS may become more strongly negative.Another common observation is a negative relationship between the ratio of nonsynonymous to synonymous divergence between paralogs . dN/dS sophila; ,109): yo8.Drosophila, evidence for EGC is particularly strong in small gene families  with high sequence identity between paralogs . For larger gene families, and/or ancient paralog pairs, evidence for EGC is weaker, and is often difficult to distinguish from birth-and-death models.EGC can profoundly influence the evolutionary fates of young duplicates, as well as the patterns of concerted evolution within gene families of varying size and age. In Methodological limitations preclude a precise estimate for the rate of EGC, and are expected to cause a statistical bias towards type II error . The growing feasibility of collecting and analyzing whole-genome polymorphism datasets  will soDrosophila genomes and beyond) for calculating the ages of gene family members\u2014should soon favor an increasingly sophisticated analysis and interpretation of the evolutionary consequences of EGC, including its interaction with mutation, selection, and linkage.The confluence of three sources of data\u2014improved EGC estimates, rapidly accumulating CNV data that can be used to infer mutational processes for duplicates, and multispecies phylogenies (e.g., the 12"]}
-{"representative": "Visceral pain is the most common reason for physician visits in US. Glutamate is the major excitatory neurotransmitter and mediates visceral nociceptive neuro-transmission and hypersensitivity. Removal of extracellular glutamate is predominantly mediated by glial glutamate transporter-1 (GLT-1). The pharmacological approach to up-regulate GLT-1 by 1 week administration of ceftriaxone (CTX) has been successful to mitigate visceral nociception. The present study shows that intrathecal delivery of selective GLT-1 antagonist dihydrokainate reversed CTX-blunted visceral nociceptive response, suggesting a spinal site of action. The role of GLT-1 up-regulation in animal models of colitis was studied. CTX treatment reversed TNBS-induced visceral hypersensitivity. In addition, CTX treatment initiated one week after the onset of DSS-induced visceral inflammation also attenuated visceral hypersensitivity, revealing a potential therapeutic effect. Cephalothin, a cephalosporin antibiotic lacking GLT-1 induction activity, failed to attenuate visceral nociception. CTX-induced changes in fecal microbiota do not support a role of probiotic effects in mitigating visceral nociception/hypersensitivity. Finally, adeno-associated virus serotype 9-mediated GLT-1 over-expression was effective to mitigate visceromotor response to 60\u2009mmHg colo-rectal distension. These studies indicate that GLT-1 over-expression is a novel and effective method to attenuate visceral nociception, and is deserving of further study as a translationally relevant approach to treat visceral pain. Visceral pain, defined as pain associated with the internal organs, is a major clinical problem affecting up to 25% of the general US population and is the most common reason for physician visits in the USA. Lower pain thresholds to aversive stimuli are common, due to visceral organ primary afferent sensitization, hyperexcitability of second-order pain-transmitting neurons, or dysregulation of descending modulation of nociception . These p\u03b2-lactam antibiotic ceftriaxone (CTX) [http://clinicaltrials.gov/ct2/show/NCT00349622?term=Ceftriaxone&rank=4, and is being explored for other CNS disorders [A series of exciting recent findings in the subclinical study of visceral pain shows that a novel strategy to decrease synaptic glutamate by upregulating the physiologically dominant glutamate transporter GLT-1 is effective to mitigate visceral nociception \u20136. Evidene (CTX) , 8. Regane (CTX) , http://isorders . In thisTwo-to-three-month old FVB/N mice of both genders were used for the behavioral studies. CR57/BL mice were used for the adenoassociated virus (AAV9) studies. Mice were maintained on a twelve-hour day\u2013twelve-hour night cycle and were housed in groups of five with water and food. All protocols were approved by the Institutional Animal Care and Use Committee in the Ohio State University and adhered to the guidelines of the Committee for Research and Ethical Issues of the International Association for the Study of Pain.\u03bcmoles)/Kg/day in a 10\u2009ml/kg volume for one week. Cephalothin (CLT) was administered in an equimolar dose, and in the same route and duration as CTX. Normal saline was used as control injections for these experiments. Ceftriaxone  was prepared in saline and was administrated intraperitoneally 200\u2009mg . The Kaspar Laboratory routinely achieves >1013 viral particles from AAV preparations . For neoAmong the pseudoaffective responses commonly employed in rodents as an index for nociception is the visceromotor response to colorectal distension (CRD). CRD was performed as described previously . Briefly\u03bcl Hamilton syringe was inserted through the L5-L6 vertebra to reach the dura at the lumbosacral spinal level. A characteristic tail flick occurred after correct placement of the needle. 5\u2009\u03bcl of vehicle or dihydrokainate (DHK) at different concentrations  was delivered into the intrathecal space over one minute, and the animals were prepared for colorectal distension. In some experiments, one hour before colorectal distention, animals were lightly anesthetized by isoflurane. The hair in the midline of the back was shaven, and the locus of the cauda equina was determined as described previously . A 30-ga\u03bcl Hamilton syringe was carefully advanced to penetrate the allantoin-occipital membrane to access the cisterna magna. Vehicle, 0.3 or 3.0\u2009mM dihydrokainate (DHK), was then delivered in a 5\u2009\u03bcl volume into the cistern magna, and the animals were prepared for colorectal distension. In some experiments, one hour before colorectal distention, animals were lightly anesthetized by isoflurane. Hair was shaven on the dorsal aspect of the neck and was removed, and a 0.5\u2009cm diameter steel bar was put underneath the neck. A 30-gauge needle connected to a 50\u2009\u03bcl volume. After instillation (day 0), mice were held head-down by lifting up the tail for 1 min to ensure exposure of distal colon to injectate. CTX 200\u2009mg/Kg/day or vehicle injections were administered intraperitoneally at 10\u2009:\u200900 am days 0\u20136. Mice were utilized on day 7 for behavioral tests, myeloperoxidase (MPO) assay, and immunoblot analysis.Two groups of animals were treated with intracolonic TNBS (7\u2009mg/ml) and another two cohorts treated with intracolonic vehicle prepared in 50% ethanol and delivered through a syringe attached to a lubricated polyethylene catheter (PE20) two centimeters proximal to the anus in a 100\u2009Two groups of animals were administered five mililliters daily of normal drinking water and another two groups administered 4% dextran sodium sulfate (DSS) dissolved in the drinking water daily for 1 week (days 0 to 6). Mice receiving 4% DSS typically develop colitis by day 7 . All ani\u03bcl of 50\u2009mM potassium phosphate (pH 6.0) containing 0.167\u2009mg/ml O-dianisidine dihydrochloride (Sigma) and 0.0005% hydrogen peroxide was loaded as reaction buffer in a 96-well plate. 20\u2009\u03bcl of supernatant sample was then mixed with reaction buffer. Two minutes later, absorbance was read at 460\u2009nm by a spectrometer . Protein concentration was accessed by adding the 1\u2009\u03bcl sample into 200\u2009\u03bcl coomassie blue buffer (Pierce) in the same 96-well plate, and absorbance was read at 595\u2009nm. The unit of MPO was defined by the change in 460\u2009nm absorbance per mg of protein sample in two minutes.As a measure of colonic inflammation, 1\u2009cm of the distal colon was dissected from animals and samples were minced and homogenized 30 strokes by a motor-driven grinder in 1\u2009ml ice-cold 50\u2009mM potassium phosphate buffer (pH 6.0) with 0.5% hexadecyltrimethylammonium bromide (Sigma). Samples subsequently underwent 30\u2009s sonication and three freeze-thaw cycles in liquid nitrogen. After brief sonication, samples were centrifuged at 10,000\u2009rpm for 10\u2009min at 4\u00b0C. Supernatant was collected to measure MPO activity. 200\u2009\u03bcg of protein sample dissected from mice lumbosacral spinal cord was sonicated, loaded in 8% SDS-PAGE gel, and transferred to nitrocellular membranes. After one-hour blocking, the membranes underwent over-night primary antibody  and one-hour secondary antibody  incubation, followed by X-film exposure with Enhanced Chemiluminescent Substrate (Pierce).Briefly, 20\u2009t-test. Mice were trained on an accelerating rotarod  3 times per day for 3 days. The cylinder of the rotarod was 71\u2009cm long, and its diameter was 3.2\u2009cm. Mice were allowed to explore the rotarod for 2\u2009min without rotation. The velocity of the rod was set to increase from 0 to 40\u2009rpm in 5\u2009min. Mice with stable 300\u2009s performance on the 3rd day were used later. At the end of baseline testing, animals were divided into two groups and one group treated with CTX 200\u2009mg/Kg/day and the other cohort administered vehicle i.p. After this one-week treatment, mice were tested three times per day for 3 days with 1-hour interval, following the same protocol. The latency to fall off the apparatus in the three trials was recorded, and the 3-day data from individual mouse was averaged. Significant difference was assessed by using Student's Multiple group differences were analyzed by ANOVA followed by post-hoc LSD analysis.\u03bcl, 3\u2009mM) was injected into the intrathecal space (it) one hour before the graded visceromotor response to colorectal distension was elicited. In animals with GLT-1 overexpression produced by 1-week CTX, intrathecal DHK (1-week CTX + it DHK 3\u2009mM) reversed the blunted visceromotor response produced by GLT-1 overexpression , compared to animals treated with 1-week vehicle + it vehicle Figures . To asseNotably, the 1-week vehicle + it DHK 3\u2009mM group  produced Given the putative role of hindbrain glutamate receptors to modulate pain transmission , the rolColonic inflammation causes visceral hyperalgesia  and thisP < 0.005). 1-week CTX treatment inhibited the enhanced MPO activity produced by colonic TNBS administration (P < 0.005). These data suggest that pharmacologic GLT-1 overexpression was able to attenuate both the intracolonic TNBS-elevated visceromotor response to colorectal distension  126\u2009mg/Kg/day) did not increase the GLT-1 protein level in the spinal cord, compared to vehicle-treated mice , a cephalosporin antibiotic not effective to enhance GLT-1 expression  was utilted mice . In contted mice , but sigted mice , These dA key question related to potential therapeutic utility of antinociceptive strategies to overexpress GLT-1 is its effectiveness after the initiation of algesia. This study utilized the DSS-induced colitis model, where 5\u2009ml of 4% DSS in the drinking water was provided daily to two groups of mice for one week. Comparison cohorts of two groups of mice were administered normal drinking water for week one. All animals were returned to normal drinking water for week 2, and GLT-1 overexpression was produced by 1-week CTX  from day 7 through day 13 in two groups of mice , and two groups  were treated with ip vehicle daily for 1 week. In response to colorectal distension performed at day 14, DSS treated animals displayed a significantly increased (36\u201360%) visceromotor response to 45 and 60\u2009mmHg colorectal distension, compared to control animals . At day An important question related to possible clinical utility of CTX treatment is to evaluate possible untoward effects caused by GLT-1 overexpression. Previous reports show a lack of effect on acute nociceptive and selective behavioral tests in rodents , 7. To aEmerging evidence suggests that changes in intestinal microflora can mediate alterations in gastrointestinal function, including visceral hypersensitivity . To asse\u221211\u2009dps of AAV9-GLT or vehicle at 19\u201326\u2009d, and the visceromotor response (VMR) to 60\u2009mmHg colorectal distension (CRD) was measured in these animals at 8 weeks of age. The data show a 62% reduction in the nociceptive response to 60\u2009mmHg pressure after transfection with AAV9-GLT-1 (n = 10) compared to animals injected with PBS (n = 10) (P < 0.05). This is correlated with a 111% enhanced glutamate uptake seen in AAV9-GLT-injected animals compared to controls  a spinal site of action of GLT-1 overexpression to attenuate visceral nociception, (2) effectiveness of GLT-1 overexpression to attenuate inflammogen-enhanced visceral nociception via both a preemptive and therapeutic approach, (3) CTX-mediated GLT-1 overexpression but not its anti-inflammatory effects mediates its antinociceptive effects, (4) translationally superior adenoassociated virus 9-mediated GLT-1 transfection attenuates visceral nociception to 60\u2009mmHg colorectal distension, and (5) alterations in locomotor function were not produced by 1-week CTX treatment.Clear evidence by our laboratory and others demonstrates the effectiveness of 1-week CTX to enhance spinal GLT-1 expression and glutamate uptake activity , 6, 12. Intracisternal injection of doses of DHK effective after intrathecal administration (3.0 and 0.3\u2009mM) was ineffective to reverse the reduced visceromotor response to colorectal distension produced by 1-week CTX treatment. This suggests that antagonizing brainstem glutamate transporters does not alter CTX-blunted visceral nociception. Although the volume of the fourth ventricle is larger than the intrathecal space, the concentrations of DHK given intracisternally was 1-2 orders of magnitude greater than the IC 50 of DHK (0.045\u2009mM). These experiments support the exclusion of a role of brainstem glutamate transporters in mediating the antinociceptive effects of CTX. However, a role of midbrain, forebrain, or cerebral glutamate transporters in mediating antinociceptive effects of 1-week systemic CTX cannot be ruled out.2O2 to form hypochlorous acid, a powerful antimicrobial reagent. This unique property is widely used to detect the amount of MPO in tissue samples by measuring absorbance at 460\u2009nm. These experiments show that GLT-1 upregulation by one-week CTX treatment effectively reduced visceral hypersensitivity in two animal models of colitis. The myeloperoxidase (MPO) assay is a well-accepted tool to measure tissue inflammatory damage in animal models of colitis. MPO is a peroxidase enzyme abundant in neutrophils and is released upon neutrophil activation by inflammatory pathogens . During To study potential effectiveness of the intervention of GLT-1 upregulation during an active inflammatory process, the use of DSS was employed due to the published unreliability of TNBS to produce consistent long-term inflammation in murine models . In bothProbiotics are emerging as potential treatments of visceral hypersensitivity . Recent Potential clinical utility of the approach to augment glutamate transporter activity depends on the lack of potential untoward effects. The rotarod test demonstrated that GLT-1 upregulation by one-week CTX treatment did not alter motor function, which is consistent with previous studies showing that CTX treatment did not change performance in the plus-maze test and open-field test, in normal mice .The adenoassociated viral vector (sc AAV9) utilized in our proposal produces long-term gene expression, thus is effective after one-time injection . This faThus, the data taken together suggests that the antinociceptive effect of one-week CTX treatment is independent of its anti-inflammatory or probiotic effects and indicates the importance of GLT-1 upregulation in reducing visceral nociception. Beneficial effects are likely related to reduced extracellular glutamate tone; thus, less activation of glutamate receptors mediating nociception, and/or second messenger events downstream are attenuated  , 26, 27.These results support consideration of novel approach of glutamate transporter upregulation in pain therapeutics. Further investigation of ceftriaxone and analogues with increased and more specific therapeutic effects seem warranted.", "texts": ["Visceral pain is the most common reason for physician visits in US. Glutamate is the major excitatory neurotransmitter and mediates visceral nociceptive neuro-transmission and hypersensitivity. Removal of extracellular glutamate is predominantly mediated by glial glutamate transporter-1 (GLT-1). The pharmacological approach to up-regulate GLT-1 by 1 week administration of ceftriaxone (CTX) has been successful to mitigate visceral nociception. The present study shows that intrathecal delivery of selective GLT-1 antagonist dihydrokainate reversed CTX-blunted visceral nociceptive response, suggesting a spinal site of action. The role of GLT-1 up-regulation in animal models of colitis was studied. CTX treatment reversed TNBS-induced visceral hypersensitivity. In addition, CTX treatment initiated one week after the onset of DSS-induced visceral inflammation also attenuated visceral hypersensitivity, revealing a potential therapeutic effect. Cephalothin, a cephalosporin antibiotic lacking GLT-1 induction activity, failed to attenuate visceral nociception. CTX-induced changes in fecal microbiota do not support a role of probiotic effects in mitigating visceral nociception/hypersensitivity. Finally, adeno-associated virus serotype 9-mediated GLT-1 over-expression was effective to mitigate visceromotor response to 60\u2009mmHg colo-rectal distension. These studies indicate that GLT-1 over-expression is a novel and effective method to attenuate visceral nociception, and is deserving of further study as a translationally relevant approach to treat visceral pain. Visceral pain, defined as pain associated with the internal organs, is a major clinical problem affecting up to 25% of the general US population and is the most common reason for physician visits in the USA. Lower pain thresholds to aversive stimuli are common, due to visceral organ primary afferent sensitization, hyperexcitability of second-order pain-transmitting neurons, or dysregulation of descending modulation of nociception . These p\u03b2-lactam antibiotic ceftriaxone (CTX) [http://clinicaltrials.gov/ct2/show/NCT00349622?term=Ceftriaxone&rank=4, and is being explored for other CNS disorders [A series of exciting recent findings in the subclinical study of visceral pain shows that a novel strategy to decrease synaptic glutamate by upregulating the physiologically dominant glutamate transporter GLT-1 is effective to mitigate visceral nociception \u20136. Evidene (CTX) , 8. Regane (CTX) , http://isorders . In thisTwo-to-three-month old FVB/N mice of both genders were used for the behavioral studies. CR57/BL mice were used for the adenoassociated virus (AAV9) studies. Mice were maintained on a twelve-hour day\u2013twelve-hour night cycle and were housed in groups of five with water and food. All protocols were approved by the Institutional Animal Care and Use Committee in the Ohio State University and adhered to the guidelines of the Committee for Research and Ethical Issues of the International Association for the Study of Pain.\u03bcmoles)/Kg/day in a 10\u2009ml/kg volume for one week. Cephalothin (CLT) was administered in an equimolar dose, and in the same route and duration as CTX. Normal saline was used as control injections for these experiments. Ceftriaxone  was prepared in saline and was administrated intraperitoneally 200\u2009mg . The Kaspar Laboratory routinely achieves >1013 viral particles from AAV preparations . For neoAmong the pseudoaffective responses commonly employed in rodents as an index for nociception is the visceromotor response to colorectal distension (CRD). CRD was performed as described previously . Briefly\u03bcl Hamilton syringe was inserted through the L5-L6 vertebra to reach the dura at the lumbosacral spinal level. A characteristic tail flick occurred after correct placement of the needle. 5\u2009\u03bcl of vehicle or dihydrokainate (DHK) at different concentrations  was delivered into the intrathecal space over one minute, and the animals were prepared for colorectal distension. In some experiments, one hour before colorectal distention, animals were lightly anesthetized by isoflurane. The hair in the midline of the back was shaven, and the locus of the cauda equina was determined as described previously . A 30-ga\u03bcl Hamilton syringe was carefully advanced to penetrate the allantoin-occipital membrane to access the cisterna magna. Vehicle, 0.3 or 3.0\u2009mM dihydrokainate (DHK), was then delivered in a 5\u2009\u03bcl volume into the cistern magna, and the animals were prepared for colorectal distension. In some experiments, one hour before colorectal distention, animals were lightly anesthetized by isoflurane. Hair was shaven on the dorsal aspect of the neck and was removed, and a 0.5\u2009cm diameter steel bar was put underneath the neck. A 30-gauge needle connected to a 50\u2009\u03bcl volume. After instillation (day 0), mice were held head-down by lifting up the tail for 1 min to ensure exposure of distal colon to injectate. CTX 200\u2009mg/Kg/day or vehicle injections were administered intraperitoneally at 10\u2009:\u200900 am days 0\u20136. Mice were utilized on day 7 for behavioral tests, myeloperoxidase (MPO) assay, and immunoblot analysis.Two groups of animals were treated with intracolonic TNBS (7\u2009mg/ml) and another two cohorts treated with intracolonic vehicle prepared in 50% ethanol and delivered through a syringe attached to a lubricated polyethylene catheter (PE20) two centimeters proximal to the anus in a 100\u2009Two groups of animals were administered five mililliters daily of normal drinking water and another two groups administered 4% dextran sodium sulfate (DSS) dissolved in the drinking water daily for 1 week (days 0 to 6). Mice receiving 4% DSS typically develop colitis by day 7 . All ani\u03bcl of 50\u2009mM potassium phosphate (pH 6.0) containing 0.167\u2009mg/ml O-dianisidine dihydrochloride (Sigma) and 0.0005% hydrogen peroxide was loaded as reaction buffer in a 96-well plate. 20\u2009\u03bcl of supernatant sample was then mixed with reaction buffer. Two minutes later, absorbance was read at 460\u2009nm by a spectrometer . Protein concentration was accessed by adding the 1\u2009\u03bcl sample into 200\u2009\u03bcl coomassie blue buffer (Pierce) in the same 96-well plate, and absorbance was read at 595\u2009nm. The unit of MPO was defined by the change in 460\u2009nm absorbance per mg of protein sample in two minutes.As a measure of colonic inflammation, 1\u2009cm of the distal colon was dissected from animals and samples were minced and homogenized 30 strokes by a motor-driven grinder in 1\u2009ml ice-cold 50\u2009mM potassium phosphate buffer (pH 6.0) with 0.5% hexadecyltrimethylammonium bromide (Sigma). Samples subsequently underwent 30\u2009s sonication and three freeze-thaw cycles in liquid nitrogen. After brief sonication, samples were centrifuged at 10,000\u2009rpm for 10\u2009min at 4\u00b0C. Supernatant was collected to measure MPO activity. 200\u2009\u03bcg of protein sample dissected from mice lumbosacral spinal cord was sonicated, loaded in 8% SDS-PAGE gel, and transferred to nitrocellular membranes. After one-hour blocking, the membranes underwent over-night primary antibody  and one-hour secondary antibody  incubation, followed by X-film exposure with Enhanced Chemiluminescent Substrate (Pierce).Briefly, 20\u2009t-test. Mice were trained on an accelerating rotarod  3 times per day for 3 days. The cylinder of the rotarod was 71\u2009cm long, and its diameter was 3.2\u2009cm. Mice were allowed to explore the rotarod for 2\u2009min without rotation. The velocity of the rod was set to increase from 0 to 40\u2009rpm in 5\u2009min. Mice with stable 300\u2009s performance on the 3rd day were used later. At the end of baseline testing, animals were divided into two groups and one group treated with CTX 200\u2009mg/Kg/day and the other cohort administered vehicle i.p. After this one-week treatment, mice were tested three times per day for 3 days with 1-hour interval, following the same protocol. The latency to fall off the apparatus in the three trials was recorded, and the 3-day data from individual mouse was averaged. Significant difference was assessed by using Student's Multiple group differences were analyzed by ANOVA followed by post-hoc LSD analysis.\u03bcl, 3\u2009mM) was injected into the intrathecal space (it) one hour before the graded visceromotor response to colorectal distension was elicited. In animals with GLT-1 overexpression produced by 1-week CTX, intrathecal DHK (1-week CTX + it DHK 3\u2009mM) reversed the blunted visceromotor response produced by GLT-1 overexpression , compared to animals treated with 1-week vehicle + it vehicle Figures . To asseNotably, the 1-week vehicle + it DHK 3\u2009mM group  produced Given the putative role of hindbrain glutamate receptors to modulate pain transmission , the rolColonic inflammation causes visceral hyperalgesia  and thisP < 0.005). 1-week CTX treatment inhibited the enhanced MPO activity produced by colonic TNBS administration (P < 0.005). These data suggest that pharmacologic GLT-1 overexpression was able to attenuate both the intracolonic TNBS-elevated visceromotor response to colorectal distension  126\u2009mg/Kg/day) did not increase the GLT-1 protein level in the spinal cord, compared to vehicle-treated mice , a cephalosporin antibiotic not effective to enhance GLT-1 expression  was utilted mice . In contted mice , but sigted mice , These dA key question related to potential therapeutic utility of antinociceptive strategies to overexpress GLT-1 is its effectiveness after the initiation of algesia. This study utilized the DSS-induced colitis model, where 5\u2009ml of 4% DSS in the drinking water was provided daily to two groups of mice for one week. Comparison cohorts of two groups of mice were administered normal drinking water for week one. All animals were returned to normal drinking water for week 2, and GLT-1 overexpression was produced by 1-week CTX  from day 7 through day 13 in two groups of mice , and two groups  were treated with ip vehicle daily for 1 week. In response to colorectal distension performed at day 14, DSS treated animals displayed a significantly increased (36\u201360%) visceromotor response to 45 and 60\u2009mmHg colorectal distension, compared to control animals . At day An important question related to possible clinical utility of CTX treatment is to evaluate possible untoward effects caused by GLT-1 overexpression. Previous reports show a lack of effect on acute nociceptive and selective behavioral tests in rodents , 7. To aEmerging evidence suggests that changes in intestinal microflora can mediate alterations in gastrointestinal function, including visceral hypersensitivity . To asse\u221211\u2009dps of AAV9-GLT or vehicle at 19\u201326\u2009d, and the visceromotor response (VMR) to 60\u2009mmHg colorectal distension (CRD) was measured in these animals at 8 weeks of age. The data show a 62% reduction in the nociceptive response to 60\u2009mmHg pressure after transfection with AAV9-GLT-1 (n = 10) compared to animals injected with PBS (n = 10) (P < 0.05). This is correlated with a 111% enhanced glutamate uptake seen in AAV9-GLT-injected animals compared to controls  a spinal site of action of GLT-1 overexpression to attenuate visceral nociception, (2) effectiveness of GLT-1 overexpression to attenuate inflammogen-enhanced visceral nociception via both a preemptive and therapeutic approach, (3) CTX-mediated GLT-1 overexpression but not its anti-inflammatory effects mediates its antinociceptive effects, (4) translationally superior adenoassociated virus 9-mediated GLT-1 transfection attenuates visceral nociception to 60\u2009mmHg colorectal distension, and (5) alterations in locomotor function were not produced by 1-week CTX treatment.Clear evidence by our laboratory and others demonstrates the effectiveness of 1-week CTX to enhance spinal GLT-1 expression and glutamate uptake activity , 6, 12. Intracisternal injection of doses of DHK effective after intrathecal administration (3.0 and 0.3\u2009mM) was ineffective to reverse the reduced visceromotor response to colorectal distension produced by 1-week CTX treatment. This suggests that antagonizing brainstem glutamate transporters does not alter CTX-blunted visceral nociception. Although the volume of the fourth ventricle is larger than the intrathecal space, the concentrations of DHK given intracisternally was 1-2 orders of magnitude greater than the IC 50 of DHK (0.045\u2009mM). These experiments support the exclusion of a role of brainstem glutamate transporters in mediating the antinociceptive effects of CTX. However, a role of midbrain, forebrain, or cerebral glutamate transporters in mediating antinociceptive effects of 1-week systemic CTX cannot be ruled out.2O2 to form hypochlorous acid, a powerful antimicrobial reagent. This unique property is widely used to detect the amount of MPO in tissue samples by measuring absorbance at 460\u2009nm. These experiments show that GLT-1 upregulation by one-week CTX treatment effectively reduced visceral hypersensitivity in two animal models of colitis. The myeloperoxidase (MPO) assay is a well-accepted tool to measure tissue inflammatory damage in animal models of colitis. MPO is a peroxidase enzyme abundant in neutrophils and is released upon neutrophil activation by inflammatory pathogens . During To study potential effectiveness of the intervention of GLT-1 upregulation during an active inflammatory process, the use of DSS was employed due to the published unreliability of TNBS to produce consistent long-term inflammation in murine models . In bothProbiotics are emerging as potential treatments of visceral hypersensitivity . Recent Potential clinical utility of the approach to augment glutamate transporter activity depends on the lack of potential untoward effects. The rotarod test demonstrated that GLT-1 upregulation by one-week CTX treatment did not alter motor function, which is consistent with previous studies showing that CTX treatment did not change performance in the plus-maze test and open-field test, in normal mice .The adenoassociated viral vector (sc AAV9) utilized in our proposal produces long-term gene expression, thus is effective after one-time injection . This faThus, the data taken together suggests that the antinociceptive effect of one-week CTX treatment is independent of its anti-inflammatory or probiotic effects and indicates the importance of GLT-1 upregulation in reducing visceral nociception. Beneficial effects are likely related to reduced extracellular glutamate tone; thus, less activation of glutamate receptors mediating nociception, and/or second messenger events downstream are attenuated  , 26, 27.These results support consideration of novel approach of glutamate transporter upregulation in pain therapeutics. Further investigation of ceftriaxone and analogues with increased and more specific therapeutic effects seem warranted."]}
-{"representative": "Chemotherapy has made an essential contribution to cancer treatment in recent decades despite its adverse effects. As cancer survivors have increased, concern about ex-patient lifespan has become more important too. Doxorubicin is an effective anti-neoplastic drug that produces a cardiotoxic effect. Cancer survivors who received doxorubicin became more vulnerable to cardiac disease than the normal population did. Many efforts have been made to prevent cardiac toxicity in patients with cancer. However, current therapies cannot guarantee permanent cardiac protection. One of their main limitations is that they do not promote myocardium regeneration. In this review, we summarize and discuss the promising use of mesenchymal stem cells for cardio-protection or cardio-regeneration therapies and consider their regenerative potential without leaving aside their controversial effects on tumor progression. Globally, cancer is the leading cause of death. There were 14.1 million new cases of cancer in 2012, and an increase of up to 22.2 million new cases by 2030 is predicted [Chemotherapy is an essential tool in cancer treatment. However, the use of anti-neoplastic agents has several adverse effects. Doxorubicin, which belongs to the anthracycline family, has been proven to be effective in different tissue-derived cancer diseases, including cancer of the breast, lung, stomach, bladder, and skin. Despite the anti-tumoral properties of doxorubicin, myelosuppression and particularly cardiotoxicity restrict its clinical use .Doxorubicin has been used in oncology treatment since the 1970s. So far, the following risk factors for doxorubicin-induced cardiotoxicity have been reported: female gender, pre-existing cardiac diseases, mediastinal radiation, cumulative anthracycline doses, and co-treatments with 5-fluorouracil, cyclophosphamide, or taxanes .Cardiomyopathy induced by doxorubicin was described at an early stage  with an incidence of 1\u00a0% to 2\u00a0% and also several years after the end of drug administration . This loIn this review, we describe the doxorubicin cardiomyopathy at molecular, histological, and functional levels and the strategies to prevent and monitor cardiac damage. Currently, the cardioprotective treatments based on medical guidelines have limitations, which drive researchers to find new ways to solve them. We discuss the potential of mesenchymal stem cell (MSC) therapy to prevent the cardiotoxicity induced by doxorubicin, its incipient and promising results, and the uncertainty about its use in patients with cancer.Pharmacokinetics studies have demonstrated that doxorubicin has a triphasic plasma clearance after intravenous injection, suggesting that doxorubicin uptake is faster than its elimination from the tissues. For this reason, the risk of toxicity depends directly on the steady-state distribution of the drug . Doxorub2+ [2+ signaling in mitochondria and sarcoplasmatic reticulum, altering the contraction cycle in cardiomyocytes, producing lipid peroxidation in cell membranes, and inhibiting transcription processes. These effects downregulate the expression of cardiac muscle-specific proteins  and mitochondrial proteins , leading the cardiomyocyte to a loss of contraction force by mechanical and energetic causes [Doxorubicin passes through cell membranes by passive diffusion. Inside the cells, doxorubicin accumulates principally in the nucleus and mitochondria (two orders of magnitude) in comparison with the cytoplasmic concentration . The dox2+ . The heac causes .+) and their progeny, reducing regenerative capacity of the heart. On the other hand, De Angelis and colleagues [Huang and colleagues , using alleagues  reportedIn vitro studies using H9c2 myoblast have shown that oxidative stress induced by doxorubicin activates AMPK (a protein kinase considered to be an intracellular sensor of the energy status) that interacts with p53, leading to bax/bad translocation from cytosol to mitochondria and promoting the release of cytochrome c and caspases activation [In regard to the mechanism of apoptosis induced by doxorubicin, there is a consensus on the main role of oxidative stress to activate cell death signal pathways. tivation ,18. On ttivation ,20. Oxidtivation .Doxorubicin also produces oxidative stress in endothelial cells, leading to an increase in endothelial permeability by reduction of nitric oxide production, pro-inflammatory cytokine secretion, and the expression of adhesion molecules . Leukocy2, or PGE2) [In this way, doxorubicin triggers a cardiac inflammatory response, in which several mechanisms of innate immune response are activated. To find the key molecules involved in doxorubicin-induced inflammation, researchers have used several strategies, including neutralizing antibodies to specific receptors  , knockouor PGE2) . The resCurrently, under a myocardium cell death process in an inflammatory microenvironment, collagen fiber synthesis is promoted, constituting the whole picture of histological markers in doxorubicin cardiotoxicity: loss of muscle fiber, sarcoplasmatic distention, vacuolization of cardiomyocytes, and fibrosis .In adult patients, the structural and functional changes induced by doxorubicin toxicity progress mainly to dilated cardiomyopathy, which is defined as an increase in left ventricle (LV) dimension, thinness of LV walls, and a severe loss of contractility. However, in pediatric patients, a restrictive cardiomyopathy described by normal dimension and wall thickness of LV and an enlargement of auricle and hardening of cardiac muscle generating diastolic dysfunction is more frequent .According to current medical guidelines, monitoring of cardiotoxicity for doxorubicin dose (in milligrams per square meter) is performed with echocardiography and multiple gated acquisition scan. A reduction of 10\u00a0% in left ventricular ejection fraction (LVEF) from 50\u00a0%  is sufficient to suspend the oncologic treatment . However2 for adults and 200 to 250\u00a0mg/m2 for children [Prevention of cardiotoxicity is managed mainly by monitoring the maximum cumulative dose  and by children . An altechildren ,35.Doxorubicin cardiotoxicity is frequently refractory to conventional pharmacologic therapies for cardiac ischemic diseases. \u0392eta-blockers  and angiotensin-converting enzyme inhibitors  are useful to attenuate doxorubicin-induced cardiomyopathy; however, long-term administration should be balanced with their adverse effects such as hypotension, fatigue, and dizziness since their beneficial effects are only transient .in vitro differentiation of iPSCs, improved the cardiac function in an animal model of infarcted heart, suggesting a promising future for iPSC-based therapy. iPSC therapy has the advantage of being free of ethical restrictions; however, owing to their ESC-like properties, they could be tumorigenic [ex vivo, allowing their use in cell-based therapy protocols [Cell-based therapies have a huge potential to treat cardiovascular diseases because of their regenerative properties and safety. Until 2013, approximately 2,000 patients had been enrolled in clinical trials around the world to evaluate different kinds of stem cell therapies showing promising results . In regaorigenic . As a reorigenic  reportedrotocols . The regrotocols . At presrotocols \u201347. Finain vivo and in vitro models, MSCs can express specific cardiomyocyte markers  [MSCs have many characteristics that make them a suitable tool for preventive or regenerative myocardium therapies (or both), including prevention of doxorubicin cardiomyopathy. MSCs are self-renewal cells with the potential to differentiate into cells of the adipogenic, osteogenic, and condrogenic lineages. Moreover, in adherin) ,49. Howeadherin) . On the adherin) , leadingMSCs secrete paracrine factors such as insulin-like growth factor, hepatocyte growth factor, endothelin-1, and basic fibroblast growth factor (with proliferative and anti-apoptotic properties), vascular endothelial growth factor and platelet-derived growth factor (with angiogenic properties), and matrix metallopeptidase-9 (with anti-fibrotic properties) ,52; all MSCs have been defined as hypoimmunogenic cells because they are not rejected by the recipient\u2019s immune system, even if they come from a non-histocompatible individual , allowin2, and indoleamine 2,3-dioxygenase [MSCs also have anti-inflammatory properties through the activation, suppression, migration, or differentiation of specific immune system cells, including T cells, natural killer cells, B cells, macrophages, dendritic cells, and neutrophils, by the secretion of several immune regulators, including transforming growth factor-beta, IL-4, IL-6, IL-10, PGExygenase . The rolxygenase .ex vivo expansion are quite simple and secure from external contamination [In regard to oxidative stress, the main cause of doxorubicin-induced cardiotoxicity, it was reported that MSCs could manage elevated tissue oxidative stress by reducing ROS-induced apoptosis and modifying the redox microenvironment . Finallymination .In regard to the development of cell-based therapies to prevent doxorubicin cardiotoxicity or to induce the regeneration of the damaged heart, the investigation is still at pre-clinical stages. Under a regenerative therapy hypothesis, MSCs are administered after an established dilated cardiomyopathy, whereas under a preventive therapy hypothesis, MSCs are transplanted before or during doxorubicin treatment Table\u00a0. It was Doxorubicin also has a toxic effect in endogenous MSCs. Oliveira and colleagues  reportedThe systemic administration of MSCs could have integral beneficial effects in patients with cancer. Zoja and colleagues  demonstrIn regard to the use of MSC therapy to prevent or revert the cardiotoxicity effect of anti-cancer drugs such as daunomycin, idarubicin, mitoxantrone (anthracyclines), 5-fluorouracil (anti-metabolite), or cyclophosphamide , we also expect a beneficial effect in cardiac function because these drugs have a common mechanism of toxicity in cardiomyocytes , which is also described in doxorubicin toxicological studies \u201373.in vitro [It has been postulated that the regenerative potential of MSCs may be a negative feature in patients with cancer. In fact, there is a controversial point of view about the role of MSCs in cancer. Pre-clinical studies reported that MSCs could promote or inhibit tumor growth . Many mein vitro  and incrin vitro . BMMSC-din vitro . Howeverin vitro . On the in vitro . In summex vivo-expanded , no tumoral transformation has been reported. Indeed, no association between autologous or allogeneic MSC administration and tumor formation was found in 36 clinical studies (phase I and II) reported by the Canadian Critical Care Trials Group [in vivo. Thus, a longer follow-up is required to draw a final conclusion.When human MSCs are properly ls Group . Howeverls Group , in a stThe quality of life of cancer survivors is an emergent topic in the scientific community for the consequences of the adverse events induced by chemotherapy. Therefore, doxorubicin-induced cardiotoxicity is still a relevant issue for oncologic treatment, particularly in pediatric patients. The use of cardiovascular disease therapies based on MSCs is safe, and the myocardium regeneration achieved has a promising impact on the recovery of cardiac function. In animal models, MSC administration could prevent myocardium injury induced by doxorubicin and regenerate the damaged tissue. In addition, owing to the pleiotropic effects of MSCs, their administration could have beneficial effects on extra-cardiac organs. However, in cancer applications, the use of MSCs is still controversial. More pre-clinical studies are needed to better predict the final outcome of the reciprocal influence of cancer cells and MSCs, which is dependent on the source and route of MSC administration and the state and grade of tumor growth. Additionally, clinical trials using MSC therapy may be considered in patients after surgical tumor removal, in order to prevent a heart vulnerability to cardiac diseases in cancer survivors.", "texts": ["Chemotherapy has made an essential contribution to cancer treatment in recent decades despite its adverse effects. As cancer survivors have increased, concern about ex-patient lifespan has become more important too. Doxorubicin is an effective anti-neoplastic drug that produces a cardiotoxic effect. Cancer survivors who received doxorubicin became more vulnerable to cardiac disease than the normal population did. Many efforts have been made to prevent cardiac toxicity in patients with cancer. However, current therapies cannot guarantee permanent cardiac protection. One of their main limitations is that they do not promote myocardium regeneration. In this review, we summarize and discuss the promising use of mesenchymal stem cells for cardio-protection or cardio-regeneration therapies and consider their regenerative potential without leaving aside their controversial effects on tumor progression. Globally, cancer is the leading cause of death. There were 14.1 million new cases of cancer in 2012, and an increase of up to 22.2 million new cases by 2030 is predicted [Chemotherapy is an essential tool in cancer treatment. However, the use of anti-neoplastic agents has several adverse effects. Doxorubicin, which belongs to the anthracycline family, has been proven to be effective in different tissue-derived cancer diseases, including cancer of the breast, lung, stomach, bladder, and skin. Despite the anti-tumoral properties of doxorubicin, myelosuppression and particularly cardiotoxicity restrict its clinical use .Doxorubicin has been used in oncology treatment since the 1970s. So far, the following risk factors for doxorubicin-induced cardiotoxicity have been reported: female gender, pre-existing cardiac diseases, mediastinal radiation, cumulative anthracycline doses, and co-treatments with 5-fluorouracil, cyclophosphamide, or taxanes .Cardiomyopathy induced by doxorubicin was described at an early stage  with an incidence of 1\u00a0% to 2\u00a0% and also several years after the end of drug administration . This loIn this review, we describe the doxorubicin cardiomyopathy at molecular, histological, and functional levels and the strategies to prevent and monitor cardiac damage. Currently, the cardioprotective treatments based on medical guidelines have limitations, which drive researchers to find new ways to solve them. We discuss the potential of mesenchymal stem cell (MSC) therapy to prevent the cardiotoxicity induced by doxorubicin, its incipient and promising results, and the uncertainty about its use in patients with cancer.Pharmacokinetics studies have demonstrated that doxorubicin has a triphasic plasma clearance after intravenous injection, suggesting that doxorubicin uptake is faster than its elimination from the tissues. For this reason, the risk of toxicity depends directly on the steady-state distribution of the drug . Doxorub2+ [2+ signaling in mitochondria and sarcoplasmatic reticulum, altering the contraction cycle in cardiomyocytes, producing lipid peroxidation in cell membranes, and inhibiting transcription processes. These effects downregulate the expression of cardiac muscle-specific proteins  and mitochondrial proteins , leading the cardiomyocyte to a loss of contraction force by mechanical and energetic causes [Doxorubicin passes through cell membranes by passive diffusion. Inside the cells, doxorubicin accumulates principally in the nucleus and mitochondria (two orders of magnitude) in comparison with the cytoplasmic concentration . The dox2+ . The heac causes .+) and their progeny, reducing regenerative capacity of the heart. On the other hand, De Angelis and colleagues [Huang and colleagues , using alleagues  reportedIn vitro studies using H9c2 myoblast have shown that oxidative stress induced by doxorubicin activates AMPK (a protein kinase considered to be an intracellular sensor of the energy status) that interacts with p53, leading to bax/bad translocation from cytosol to mitochondria and promoting the release of cytochrome c and caspases activation [In regard to the mechanism of apoptosis induced by doxorubicin, there is a consensus on the main role of oxidative stress to activate cell death signal pathways. tivation ,18. On ttivation ,20. Oxidtivation .Doxorubicin also produces oxidative stress in endothelial cells, leading to an increase in endothelial permeability by reduction of nitric oxide production, pro-inflammatory cytokine secretion, and the expression of adhesion molecules . Leukocy2, or PGE2) [In this way, doxorubicin triggers a cardiac inflammatory response, in which several mechanisms of innate immune response are activated. To find the key molecules involved in doxorubicin-induced inflammation, researchers have used several strategies, including neutralizing antibodies to specific receptors  , knockouor PGE2) . The resCurrently, under a myocardium cell death process in an inflammatory microenvironment, collagen fiber synthesis is promoted, constituting the whole picture of histological markers in doxorubicin cardiotoxicity: loss of muscle fiber, sarcoplasmatic distention, vacuolization of cardiomyocytes, and fibrosis .In adult patients, the structural and functional changes induced by doxorubicin toxicity progress mainly to dilated cardiomyopathy, which is defined as an increase in left ventricle (LV) dimension, thinness of LV walls, and a severe loss of contractility. However, in pediatric patients, a restrictive cardiomyopathy described by normal dimension and wall thickness of LV and an enlargement of auricle and hardening of cardiac muscle generating diastolic dysfunction is more frequent .According to current medical guidelines, monitoring of cardiotoxicity for doxorubicin dose (in milligrams per square meter) is performed with echocardiography and multiple gated acquisition scan. A reduction of 10\u00a0% in left ventricular ejection fraction (LVEF) from 50\u00a0%  is sufficient to suspend the oncologic treatment . However2 for adults and 200 to 250\u00a0mg/m2 for children [Prevention of cardiotoxicity is managed mainly by monitoring the maximum cumulative dose  and by children . An altechildren ,35.Doxorubicin cardiotoxicity is frequently refractory to conventional pharmacologic therapies for cardiac ischemic diseases. \u0392eta-blockers  and angiotensin-converting enzyme inhibitors  are useful to attenuate doxorubicin-induced cardiomyopathy; however, long-term administration should be balanced with their adverse effects such as hypotension, fatigue, and dizziness since their beneficial effects are only transient .in vitro differentiation of iPSCs, improved the cardiac function in an animal model of infarcted heart, suggesting a promising future for iPSC-based therapy. iPSC therapy has the advantage of being free of ethical restrictions; however, owing to their ESC-like properties, they could be tumorigenic [ex vivo, allowing their use in cell-based therapy protocols [Cell-based therapies have a huge potential to treat cardiovascular diseases because of their regenerative properties and safety. Until 2013, approximately 2,000 patients had been enrolled in clinical trials around the world to evaluate different kinds of stem cell therapies showing promising results . In regaorigenic . As a reorigenic  reportedrotocols . The regrotocols . At presrotocols \u201347. Finain vivo and in vitro models, MSCs can express specific cardiomyocyte markers  [MSCs have many characteristics that make them a suitable tool for preventive or regenerative myocardium therapies (or both), including prevention of doxorubicin cardiomyopathy. MSCs are self-renewal cells with the potential to differentiate into cells of the adipogenic, osteogenic, and condrogenic lineages. Moreover, in adherin) ,49. Howeadherin) . On the adherin) , leadingMSCs secrete paracrine factors such as insulin-like growth factor, hepatocyte growth factor, endothelin-1, and basic fibroblast growth factor (with proliferative and anti-apoptotic properties), vascular endothelial growth factor and platelet-derived growth factor (with angiogenic properties), and matrix metallopeptidase-9 (with anti-fibrotic properties) ,52; all MSCs have been defined as hypoimmunogenic cells because they are not rejected by the recipient\u2019s immune system, even if they come from a non-histocompatible individual , allowin2, and indoleamine 2,3-dioxygenase [MSCs also have anti-inflammatory properties through the activation, suppression, migration, or differentiation of specific immune system cells, including T cells, natural killer cells, B cells, macrophages, dendritic cells, and neutrophils, by the secretion of several immune regulators, including transforming growth factor-beta, IL-4, IL-6, IL-10, PGExygenase . The rolxygenase .ex vivo expansion are quite simple and secure from external contamination [In regard to oxidative stress, the main cause of doxorubicin-induced cardiotoxicity, it was reported that MSCs could manage elevated tissue oxidative stress by reducing ROS-induced apoptosis and modifying the redox microenvironment . Finallymination .In regard to the development of cell-based therapies to prevent doxorubicin cardiotoxicity or to induce the regeneration of the damaged heart, the investigation is still at pre-clinical stages. Under a regenerative therapy hypothesis, MSCs are administered after an established dilated cardiomyopathy, whereas under a preventive therapy hypothesis, MSCs are transplanted before or during doxorubicin treatment Table\u00a0. It was Doxorubicin also has a toxic effect in endogenous MSCs. Oliveira and colleagues  reportedThe systemic administration of MSCs could have integral beneficial effects in patients with cancer. Zoja and colleagues  demonstrIn regard to the use of MSC therapy to prevent or revert the cardiotoxicity effect of anti-cancer drugs such as daunomycin, idarubicin, mitoxantrone (anthracyclines), 5-fluorouracil (anti-metabolite), or cyclophosphamide , we also expect a beneficial effect in cardiac function because these drugs have a common mechanism of toxicity in cardiomyocytes , which is also described in doxorubicin toxicological studies \u201373.in vitro [It has been postulated that the regenerative potential of MSCs may be a negative feature in patients with cancer. In fact, there is a controversial point of view about the role of MSCs in cancer. Pre-clinical studies reported that MSCs could promote or inhibit tumor growth . Many mein vitro  and incrin vitro . BMMSC-din vitro . Howeverin vitro . On the in vitro . In summex vivo-expanded , no tumoral transformation has been reported. Indeed, no association between autologous or allogeneic MSC administration and tumor formation was found in 36 clinical studies (phase I and II) reported by the Canadian Critical Care Trials Group [in vivo. Thus, a longer follow-up is required to draw a final conclusion.When human MSCs are properly ls Group . Howeverls Group , in a stThe quality of life of cancer survivors is an emergent topic in the scientific community for the consequences of the adverse events induced by chemotherapy. Therefore, doxorubicin-induced cardiotoxicity is still a relevant issue for oncologic treatment, particularly in pediatric patients. The use of cardiovascular disease therapies based on MSCs is safe, and the myocardium regeneration achieved has a promising impact on the recovery of cardiac function. In animal models, MSC administration could prevent myocardium injury induced by doxorubicin and regenerate the damaged tissue. In addition, owing to the pleiotropic effects of MSCs, their administration could have beneficial effects on extra-cardiac organs. However, in cancer applications, the use of MSCs is still controversial. More pre-clinical studies are needed to better predict the final outcome of the reciprocal influence of cancer cells and MSCs, which is dependent on the source and route of MSC administration and the state and grade of tumor growth. Additionally, clinical trials using MSC therapy may be considered in patients after surgical tumor removal, in order to prevent a heart vulnerability to cardiac diseases in cancer survivors."]}
-{"representative": "Perspective traces the evolution of certain central notions in the theory of Generative Grammar (GG). The founding documents of the field suggested a relation between the grammar, construed as recursively enumerating an infinite set of sentences, and the idealized native speaker that was essentially equivalent to the relation between a formal language (a set of well-formed formulas) and an automaton that recognizes strings as belonging to the language or not. But this early view was later abandoned, when the focus of the field shifted to the grammar's strong generative capacity as recursive generation of hierarchically structured objects as opposed to strings. The grammar is now no longer seen as specifying a set of well-formed expressions and in fact necessarily constructs expressions of any degree of intuitive \u201cacceptability.\u201d The field of GG, however, has not sufficiently acknowledged the significance of this shift in perspective, as evidenced by the fact that  observations about string acceptability continue to be treated as bona fide data and generalizations for the theory of GG. The focus on strong generative capacity, it is argued, requires a new discussion of what constitutes valid empirical evidence for GG beyond observations pertaining to weak generation.This  While linguists agree on this focus, they nevertheless tend to uncritically assume that judgments of the acceptability of strings constitute data for GG. But this assumption is baseless, and a renewed discussion of GG's empirical basis is in order.There exists a contradiction between the near-universal acceptance of acceptability judgments as a source of data for Generative Grammar (GG) on the one hand and the theory's express focus on LSLT) defined as the \u201cprimary concern\u201d of syntactic theory \u201cto determine the grammatical sentences of any given language [\u2026]\u201d (57). Chomsky (SS) elaborates:Chomsky , LSLT de Chomsky , SS elabL is to separate the grammatical sequences which are sentences of L from the ungrammatical sequences which are not sentences of L [\u2026]. The grammar of L will thus be a device that generates all of the grammatical sequences of L and none of the ungrammatical ones.\u201d .\u201cThe fundamental aim in the linguistic analysis of a language LSLT, 95); hence, \u201cthe sequences generated by the grammar as grammatical sentences must be acceptable, in some sense, to the native speaker [\u2026]\u201d . The adequacy of a grammar can be assessed by \u201c[determining] whether or not the sequences that it generates are actually grammatical, i.e., acceptable to a native speaker\u201d . Consequently, \u201cthe linguist's task [is] that of producing [\u2026] a grammar [that generates] all and only the sentences of a language [\u2026]\u201d .The set of sequences so determined \u201ccorresponds to the \u2018intuitive sense of grammaticalness\u2019 of the native speaker\u201d (Early View (EV), the idealized native speaker is the human equivalent of an automaton in the theory of formal languages, which accepts (recognizes) or rejects a given string depending on whether or not it is part of the set of legal sequences. While the importance of hierarchical structures underlying the sequences was recognized to be of central importance, the formal systems used at the time\u2014Post-style rewrite rules plus transformational rules\u2014ultimately enumerated strings .Later works of Chomsky's are explicit in rejecting the EV and its view of the idealized native speaker as a human automaton. Perhaps the first clear articulation of this shift appears in Chomsky , where wlanguage as a set of sentences is a corollary of the shift of the focus of attention from sentences to structures:This dismissal of the view of a \u201cFor each sentence, the grammar determines aspects of its phonetic form, its meaning and perhaps more. [\u2026] [It] is said to \u2018weakly generate\u2019 the sentences of the language and to \u2018strongly generate\u2019 the structural descriptions of these sentences\u201d Chomsky, , p. 220.strongly generates structural descriptions (SDs), not strings; the latter can at best be said to be generated in some weak sense, in that the \u201cphonetic form\u201d associated by the grammar with any SD has sequential properties  in fact \u201c[A] GG will not generate the set of sentences that a speaker-hearer will regard as acceptable; indeed, it is virtually a criterion of adequacy that it should not, since so many different factors enter into such judgments\u201d  one way or another\u201d  cannot be interpreted in this way.Chomsky ((I know) [who [John [kissed _]]]x is such that John kissed x\u201d)(\u201cwhich person (I know) [who [John [kissed Mary]]]wh-operator has no variable to bind, and consequently cannot be assigned an interpretation. Importantly, we cannot simply \u201cneglect\u201d the fronted wh-phrase and interpret (2) as meaning (I know) John kissed Mary, a fact that Chomsky attributes to the principle of Full Interpretation\u2014an interface condition, in current parlance. Does this mean that we want to block generation of (2), while allowing generation of (1)? Chomsky explicitly denies this, arguing that such a move would redundantly replicate the effect of Full Interpretation. Consequently, both SDs in (1) and (2) are grammatical (generated by the grammar); the \u201cdeviance\u201d of (2) is due to an extraneous principle of interpretation. But the fact that the string deriving from (2) is \u201cdeviant\u201d per se is of no immediate concern to the theory of grammar.In (2), the LSLT (145), the goal of the theory is not to construct a grammar that generates a set of well-formed formulas including Colorless green ideas sleep furiously but excluding Furiously sleep ideas green colorless, but to explain why the SD assigned to the latter cannot be mapped onto an analogous interpretation. The naturalness of the typographical or acoustic object is of no immediate relevance to the theorist , the empirical success of GG depends on its ability to correctly model the speaker's knowledge of sound-meaning relations, not the intuitive acceptability of strings:On this \u201cLinguistic expressions may be \u2018deviant\u2019 along all sorts of incommensurable dimensions, and we have no notion of \u2018well-formed sentence\u2019 [\u2026]. Expressions have the interpretations assigned to them by the performance systems in which the language is embedded: period\u201d Chomsky, , p. 27.In later works, Chomsky entertains the idea that generation of SDs proceeds freely via the operation Merge, with constraints imposed only by external systems. For instance, Chomsky , p. 111 \u201cMerge can apply freely, yielding expressions interpreted at the interface in many different kinds of ways. They are sometimes called \u2018deviant,\u2019 but that is only an informal notion. [\u2026] The only empirical requirement is that [the interfacing systems] assign the interpretations that the expression actually has, including many varieties of \u2018deviance\u201d\u2019 Chomsky, , p. 144.Chomsky , p. 3f. On this RV, there exists no notion of well-formedness that is given independently of whatever is strongly generated by the I-language. The grammar does not specify a set of legal strings but an infinity of SDs; the only empirical success criterion is that the SDs postulated by the theorist have the properties in interpretation and externalization they do.While the field ostensibly embraced the focus on SGC and SDs championed by Chomsky, the EV remains widely adopted in actual practice. Grammaticality and acceptability are standardly equated, and I-languages taken to determine sets of well-formed strings/sentences. The following quotes, randomly culled from popular textbooks, are representative:grammatical if native speakers judge it to be a possible sentence of their language\u201d , marginally well-formed, or ill-formed \u201d Carnie, , p. 14.\u201c[A] sequence of words is called a string. Putting a star at the start of a string is a claim that it isn't a grammatical sentence of the language in question\u201d Adger, , p. 4.sic] is to obtain a form of information that scarcely exists within normal language use at all\u2014namely, negative information, in the form of strings that are not part of the language\u201d  adherence to the EV, acceptability judgments continue to take center stage in GG, and a good deal of the literature on experimental syntax has been devoted to refining their elicitation Sprouse, . Sprousemodulo performance-related factors). This view is most explicitly espoused by Frampton and Gutmann , ignoring the fact that this notion has no obvious relevance on the RV. A direct outgrowth of this ideology is the extensive reliance on highly stipulative features as licensors of structure-building Chomsky, , p. 6, lHeilikes Johni is \u201cunacceptable,\u201d or that it lacks the intended reading; we can say that (2) above is \u201cdeviant,\u201d with an implicit understanding that we're referring to the absence of an interpretation analogous to (1). This innocent informal usage aside, however, the \u201c(un)acceptable\u201d status of sentences remains the de-facto empirical benchmark for theoretical proposals within GG, and informal observations about weak generative capacity, clad in technical terms, are standardly elevated to the status of generalizations to be accounted for (cf. the case of islands mentioned above). The field must overcome these limitations and move on to a theoretical characterization of possible SDs  and their interface properties . Despite this shift, the field has retained a methodological obsession with the intuitive well-formedness of strings and associated notions such as \u201covergeneration\u201d (E-language).Chomsky , p. 63 nThe author confirms being the sole contributor of this work and approved it for publication.The author declares that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest.", "texts": ["Perspective traces the evolution of certain central notions in the theory of Generative Grammar (GG). The founding documents of the field suggested a relation between the grammar, construed as recursively enumerating an infinite set of sentences, and the idealized native speaker that was essentially equivalent to the relation between a formal language (a set of well-formed formulas) and an automaton that recognizes strings as belonging to the language or not. But this early view was later abandoned, when the focus of the field shifted to the grammar's strong generative capacity as recursive generation of hierarchically structured objects as opposed to strings. The grammar is now no longer seen as specifying a set of well-formed expressions and in fact necessarily constructs expressions of any degree of intuitive \u201cacceptability.\u201d The field of GG, however, has not sufficiently acknowledged the significance of this shift in perspective, as evidenced by the fact that  observations about string acceptability continue to be treated as bona fide data and generalizations for the theory of GG. The focus on strong generative capacity, it is argued, requires a new discussion of what constitutes valid empirical evidence for GG beyond observations pertaining to weak generation.This  While linguists agree on this focus, they nevertheless tend to uncritically assume that judgments of the acceptability of strings constitute data for GG. But this assumption is baseless, and a renewed discussion of GG's empirical basis is in order.There exists a contradiction between the near-universal acceptance of acceptability judgments as a source of data for Generative Grammar (GG) on the one hand and the theory's express focus on LSLT) defined as the \u201cprimary concern\u201d of syntactic theory \u201cto determine the grammatical sentences of any given language [\u2026]\u201d (57). Chomsky (SS) elaborates:Chomsky , LSLT de Chomsky , SS elabL is to separate the grammatical sequences which are sentences of L from the ungrammatical sequences which are not sentences of L [\u2026]. The grammar of L will thus be a device that generates all of the grammatical sequences of L and none of the ungrammatical ones.\u201d .\u201cThe fundamental aim in the linguistic analysis of a language LSLT, 95); hence, \u201cthe sequences generated by the grammar as grammatical sentences must be acceptable, in some sense, to the native speaker [\u2026]\u201d . The adequacy of a grammar can be assessed by \u201c[determining] whether or not the sequences that it generates are actually grammatical, i.e., acceptable to a native speaker\u201d . Consequently, \u201cthe linguist's task [is] that of producing [\u2026] a grammar [that generates] all and only the sentences of a language [\u2026]\u201d .The set of sequences so determined \u201ccorresponds to the \u2018intuitive sense of grammaticalness\u2019 of the native speaker\u201d (Early View (EV), the idealized native speaker is the human equivalent of an automaton in the theory of formal languages, which accepts (recognizes) or rejects a given string depending on whether or not it is part of the set of legal sequences. While the importance of hierarchical structures underlying the sequences was recognized to be of central importance, the formal systems used at the time\u2014Post-style rewrite rules plus transformational rules\u2014ultimately enumerated strings .Later works of Chomsky's are explicit in rejecting the EV and its view of the idealized native speaker as a human automaton. Perhaps the first clear articulation of this shift appears in Chomsky , where wlanguage as a set of sentences is a corollary of the shift of the focus of attention from sentences to structures:This dismissal of the view of a \u201cFor each sentence, the grammar determines aspects of its phonetic form, its meaning and perhaps more. [\u2026] [It] is said to \u2018weakly generate\u2019 the sentences of the language and to \u2018strongly generate\u2019 the structural descriptions of these sentences\u201d Chomsky, , p. 220.strongly generates structural descriptions (SDs), not strings; the latter can at best be said to be generated in some weak sense, in that the \u201cphonetic form\u201d associated by the grammar with any SD has sequential properties  in fact \u201c[A] GG will not generate the set of sentences that a speaker-hearer will regard as acceptable; indeed, it is virtually a criterion of adequacy that it should not, since so many different factors enter into such judgments\u201d  one way or another\u201d  cannot be interpreted in this way.Chomsky ((I know) [who [John [kissed _]]]x is such that John kissed x\u201d)(\u201cwhich person (I know) [who [John [kissed Mary]]]wh-operator has no variable to bind, and consequently cannot be assigned an interpretation. Importantly, we cannot simply \u201cneglect\u201d the fronted wh-phrase and interpret (2) as meaning (I know) John kissed Mary, a fact that Chomsky attributes to the principle of Full Interpretation\u2014an interface condition, in current parlance. Does this mean that we want to block generation of (2), while allowing generation of (1)? Chomsky explicitly denies this, arguing that such a move would redundantly replicate the effect of Full Interpretation. Consequently, both SDs in (1) and (2) are grammatical (generated by the grammar); the \u201cdeviance\u201d of (2) is due to an extraneous principle of interpretation. But the fact that the string deriving from (2) is \u201cdeviant\u201d per se is of no immediate concern to the theory of grammar.In (2), the LSLT (145), the goal of the theory is not to construct a grammar that generates a set of well-formed formulas including Colorless green ideas sleep furiously but excluding Furiously sleep ideas green colorless, but to explain why the SD assigned to the latter cannot be mapped onto an analogous interpretation. The naturalness of the typographical or acoustic object is of no immediate relevance to the theorist , the empirical success of GG depends on its ability to correctly model the speaker's knowledge of sound-meaning relations, not the intuitive acceptability of strings:On this \u201cLinguistic expressions may be \u2018deviant\u2019 along all sorts of incommensurable dimensions, and we have no notion of \u2018well-formed sentence\u2019 [\u2026]. Expressions have the interpretations assigned to them by the performance systems in which the language is embedded: period\u201d Chomsky, , p. 27.In later works, Chomsky entertains the idea that generation of SDs proceeds freely via the operation Merge, with constraints imposed only by external systems. For instance, Chomsky , p. 111 \u201cMerge can apply freely, yielding expressions interpreted at the interface in many different kinds of ways. They are sometimes called \u2018deviant,\u2019 but that is only an informal notion. [\u2026] The only empirical requirement is that [the interfacing systems] assign the interpretations that the expression actually has, including many varieties of \u2018deviance\u201d\u2019 Chomsky, , p. 144.Chomsky , p. 3f. On this RV, there exists no notion of well-formedness that is given independently of whatever is strongly generated by the I-language. The grammar does not specify a set of legal strings but an infinity of SDs; the only empirical success criterion is that the SDs postulated by the theorist have the properties in interpretation and externalization they do.While the field ostensibly embraced the focus on SGC and SDs championed by Chomsky, the EV remains widely adopted in actual practice. Grammaticality and acceptability are standardly equated, and I-languages taken to determine sets of well-formed strings/sentences. The following quotes, randomly culled from popular textbooks, are representative:grammatical if native speakers judge it to be a possible sentence of their language\u201d , marginally well-formed, or ill-formed \u201d Carnie, , p. 14.\u201c[A] sequence of words is called a string. Putting a star at the start of a string is a claim that it isn't a grammatical sentence of the language in question\u201d Adger, , p. 4.sic] is to obtain a form of information that scarcely exists within normal language use at all\u2014namely, negative information, in the form of strings that are not part of the language\u201d  adherence to the EV, acceptability judgments continue to take center stage in GG, and a good deal of the literature on experimental syntax has been devoted to refining their elicitation Sprouse, . Sprousemodulo performance-related factors). This view is most explicitly espoused by Frampton and Gutmann , ignoring the fact that this notion has no obvious relevance on the RV. A direct outgrowth of this ideology is the extensive reliance on highly stipulative features as licensors of structure-building Chomsky, , p. 6, lHeilikes Johni is \u201cunacceptable,\u201d or that it lacks the intended reading; we can say that (2) above is \u201cdeviant,\u201d with an implicit understanding that we're referring to the absence of an interpretation analogous to (1). This innocent informal usage aside, however, the \u201c(un)acceptable\u201d status of sentences remains the de-facto empirical benchmark for theoretical proposals within GG, and informal observations about weak generative capacity, clad in technical terms, are standardly elevated to the status of generalizations to be accounted for (cf. the case of islands mentioned above). The field must overcome these limitations and move on to a theoretical characterization of possible SDs  and their interface properties . Despite this shift, the field has retained a methodological obsession with the intuitive well-formedness of strings and associated notions such as \u201covergeneration\u201d (E-language).Chomsky , p. 63 nThe author confirms being the sole contributor of this work and approved it for publication.The author declares that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest."]}
-{"representative": "Rothia and Haemophilus compared to the HC group, and significantly decreased Haemophilus and increased Oribacterium compared to the UC group. By combining the genera selected by the random forest algorithm in machine learning, followed by confirmation with 10-fold cross-validation, we were able to distinguish the PSC group from the HC group with the area under the curve (AUC) of 0.7423, and from the UC group with the AUC of 0.8756. Our results indicate the potential of salivary microbiota as biomarkers for a noninvasive diagnosis of PSC.Primary sclerosing cholangitis (PSC) is a liver disease known for its frequent concurrence with inflammatory bowel disease. Dysbiosis of the gut microbiota in PSC was reported in several studies, but the microbiological features of the salivary microbiota in PSC have not been established. Here we compared the salivary microbial communities of 24 pediatric-onset PSC patients, 16 age-matched ulcerative colitis (UC) patients, and 24 healthy controls (HCs) by analyzing the bacterial 16S rRNA gene sequence data. The species-richness (\u03b1-diversity) showed no significant between-group differences, whereas the overall salivary microbiota structure (\u03b2-diversity) showed significant differences among the three groups. Taxonomic assignment revealed that the PSC salivary microbiota were characterized by significant decreases in the abundance of  PSC is also known for its high association with inflammatory bowel disease (IBD), mainly ulcerative colitis (UC), with a prevalence of 70\u201380% in adults1, and with the same proportion or an even higher proportion in children4. Conversely, as many as 8.1% of IBD patients develop PSC5. It was also reported that PSC-like bile duct lesions occur frequently even with normal biochemical profiles in children with IBD6.Primary sclerosing cholangitis (PSC) is a liver disease characterized by multiple stenoses due to chronic inflammation and fibrosis in the intrahepatic and extrahepatic biliary system. The disease eventually progresses to end-stage liver disease, resulting in poor prognoses7. However, ERCP is associated with complications such as pancreatitis. To avoid complications, magnetic resonance cholangiopancreatography (MRCP) has been proposed as an alternative method for the diagnosis of PSC, but its sensitivity is approximately 81\u201386% in children, with a lower resolution in younger patients and the need for sedation in some cases9. Thus, additional noninvasive diagnostic biomarkers are desirable for the evaluation of the presence of PSC.In light of this frequent concurrence of PSC and IBD, the diagnosis of either of these diseases should consider the concurrence of the other disease. Cholangiography is mandatory for the diagnosis of PSC, and endoscopic retrograde cholangiopancreatography (ERCP) has been used for the diagnosis of PSC in adults and children14, implying that gastrointestinal inflammation and indigenous microbes are associated with the pathogenesis and prognosis of PSC, and that early intervention may also produce better prognoses. The gut microbiota of adult PSC patients were recently intensively evaluated by using 16S rRNA gene sequences23. Those studies indicated the enrichment of particular bacterial genera including Veillonella23, Enterococcus23, Lactobacillus20, Ruminococcus22, Streptococcus23, Rothia23, and Fusobacterium22 in the feces of PSC patients. We also reported the enrichment of several species, some belonging to these genera, in a Japanese pediatric-onset PSC cohort2.In pediatric and adult PSC patients, the oral administration of antibiotics was reported to decrease the serum levels of alanine aminotransferase (ALT) and \u03b3-glutamyltranspeptidase (GGT), with histological improvement24, several studies have described alterations of salivary microbiota in patients with various diseases. These include cirrhosis25, IBD27, pancreatic cancer29, lung cancer30, colorectal cancer31, IgA nephropathy32, celiac disease33, Behcet\u2019s disease34, and rheumatoid arthritis35. The involvement of salivary microbes in these diseases is unclear, but a correlation between the gut and oral microbiota was suggested36. In addition, changes in the salivary microbiota in systemic diseases may be a resource of microbial biomarkers specific to the diseases, which could contribute to the development of simple and noninvasive diagnoses based on microbial profiling with saliva samples.In addition to close associations between dysbiosis of the gut microbiota and diseasesTo date, there has been no report on the salivary microbiota of PSC patients. As the initial step in the exploration of potential biomarkers for the noninvasive diagnosis of PSC, we performed a bacterial 16S rRNA gene sequence analysis to characterize the salivary microbiota of pediatric-onset PSC patients in a comparison of their microbiota with those of pediatric-onset UC patients and healthy controls (HCs).We recruited 24 PSC and 16 UC patients without PSC whose age of onset was <18 years from Saiseikai Yokohamashi Tobu Hospital  between May 2013 and October 2015, and healthy volunteers without any symptoms  also confirmed no significant difference between the PSC samples with and without SASP treatment, or between the PSC patients treated and untreated with ursodeoxycholic acid (UDCA), mesalazine, and probiotics respectively  plot based on the weighted UniFrac distance metric showed that many of the PSC and UC samples segregated from the HC samples, suggesting that the salivary microbiota structure of both the PSC and UC groups differed from that of the HC group Fig.\u00a0. The PERStreptococcaceae, Pasteurellaceae, and Lachnospiraceae showed significant differences among the three groups. Of these three families, a lower Pasteurellaceae abundance and a higher Lachnospiraceae abundance were observed in the PSC group compared to both the UC and HC groups . Moreover, the abundance of Haemophilus was also significantly lower in the PSC group than that in the UC group (p\u2009=\u20090.0007). Conversely, the abundance of Oribacterium was significantly higher in the PSC group compared to the UC group (p\u2009=\u20090.0036). Additionally, the abundance of Streptococcus was significantly lower in the UC group compared to the HC group (p\u2009=\u20090.0159).The taxonomic assignment at the genus level identified a total of 114 bacterial genera, of which we further evaluated the major 16 genera with the relative mean abundances of >0.5%, accounting for 92.2% of the total abundance  curves were based on the out-of-bag (OOB) error rates in the RF models. We used the area under the curve (AUC) of these ROC curves to find the combination of multiple taxa contributing most to the discrimination of the three groups from the 29 abundant genera with relative mean abundances of >0.1%. The best model was selected according to the best OOB-AUC, which was observed for eight and six genera between the PSC and HC groups, and the PSC and UC groups, respectively  models using the AUC-RF packageely Fig.\u00a0.Figure 3Haemophilus, Streptococcus, Aggregatibacter and Oribacterium) were the common contributors to distinguish the PSC from both the HC and UC groups  contributed to distinguishing the PSC from the HC group  using the RF-selected genera more clearly distinguished the PSC from the HC and UC groups than the PCA using the 29 genera with the mean abundance >0.1%  were the species distinguishing the PSC group from the HC group  were the species distinguishing the PSC group from the UC group  were markedly enriched in the present pediatric-onset PSC group compared to the UC and healthy control groups, and were shown to be the species contributing to the discrimination of the two groups. Similar to the pediatric-onset PSC patients analyzed here, the family Lachnospiraceae was increased in the salivary microbiota of children with celiac disease33. On the other hand, Streptococcus sanguinis was concurrently enriched in celiac disease patients33, whereas this species was significantly decreased in our PSC group  and then transported on ice to the laboratory within 24\u2009hr. At the laboratory, the saliva samples were suspended in 20% glycerol and phosphate-buffered saline (PBS), and then immediately frozen in liquid nitrogen and stored at \u221280\u2009\u00b0C until further analysis26. The 16S rRNA gene V1\u2013V2 region was amplified by polymerase chain reaction (PCR) using the forward primer 27Fmod (5\u2032-CCATCTCATCCCTGCGTGTCTCCGACTCAGNNNNNNNNNNagrgtttgatymtggctcag-3\u2032), containing the 454 primer A and a unique 10-bp barcode sequence for each sample (indicated by Ns), and the reverse primer 338\u2009R (5\u2032-CCTATCCCCTGTGTGCCTTGGCAGTCTCAGtgctgcctcccgtaggagt-3\u2032) containing the 454 primer B38. The PCR was performed using 50\u2009\u03bcL of 1\u00d7 Ex Taq PCR buffer composed of 10\u2009mM Tris-HCl (pH 8.3), 50\u2009mM KCl, and 1.5\u2009mM MgCl2 in the presence of 250\u2009\u03bcM dNTPs, 1 U Ex Taq polymerase , forward and reverse primers (0.2\u2009\u03bcM), and approximately 20 ng of template DNA.The isolation of bacterial DNA from the salivary samples was performed as describedThermal cycling was performed in a 9700 PCR System  with the following cycling conditions: initial denaturation at 96\u2009\u00b0C for 2\u2009min, followed by 25 cycles of denaturation at 96\u2009\u00b0C for 30\u2009sec, annealing at 55\u2009\u00b0C for 45\u2009sec, and extension at 72\u2009\u00b0C for 1\u2009min; and final extension at 72\u2009\u00b0C. PCR amplicons were purified using AMPure XP magnetic purification beads  and quantified using the Quant-iT PicoGreen dsDNA Assay Kit (Life Technologies Japan). An equal amount of each PCR amplicon was mixed and subjected to sequencing with the 454 GS FLX Titanium platform  according to the manufacturer\u2019s instructions.38. Briefly, after multiplexed sequencing of the 16S amplicons, sequences were assigned to samples on the basis of their barcode sequences. Reads with an average quality value <25, inexact matches to both universal primers, and possible chimeric reads, totally accounting for 43\u201344% of all reads, were removed  and NCBI genome databases using the GLSEARCH program. For assignment at the phylum, family, genus, and species levels, the sequence similarity thresholds of 70%, 90%, 94% and 96% were respectively applied. All of the high-quality 16S V1\u2013V2 sequences analyzed in this study were deposited into the DDBJ/GenBank/EMBL database (accession no. DRA005698).We then sorted the selected reads with the average quality value and grouped them into OTUs by clustering using the UCLUST algorithm with a 96% identity threshold50. We performed a principal coordinate analysis (PCoA) to visualize the similarities or dissimilarities in the microbiome structure in the UniFrac analysis. We conducted a PERMANOVA to compare the overall microbiome structure, and the p-values were adjusted for multiple testing by the Benjamin-Hochberg procedure. We used the observed and Chao 1-estimated OTU numbers and Shannon\u2019s index to evaluate the richness and diversity of the overall microbial community. The similarity of the relative abundance at the phylum, family, genus, and species levels was assessed using the Kruskal-Wallis test followed by the Steel-Dwass test for multiple comparisons.Comparisons of the categorical variables were done using the Chi-squared test, Fisher\u2019s exact test, Mann-Whitney U-test, and Kruskal-Wallis test where appropriate. The UniFrac distance was used for the assessment of the dissimilarity (distance) between any pair of samples41 package. All receiver operating characteristic (ROC) curves presented for RF models were based on the out-of-bag (OOB) error rates. The area under the curve (AUC) of these ROC curves was used to find the most discriminatory variables (genera or species). The first RF was build, using all the variables, which provides the initial ranking of the variables according to its importance according to the mean decrease Gini. In the subsequent steps, 5% of the less important variables according to the initial ranking were eliminated. The RF was built with the remaining variables, and the AUC based on OOB predictions (OOB-AUC) of the RF was computed in each model. The best model was selected with the best OOB-AUC value. The best RF model was further confirmed by evaluating the mean AUC of a 10-fold cross-validation repeated 20 times using the AUC-RF41 package. All of these analyses were performed using the R software program (v3.3.1). All methods were carried out in accordance with relevant guidelines and regulations.Random forest (RF) models were generated using the AUC-RFSupplementary Files", "texts": ["Rothia and Haemophilus compared to the HC group, and significantly decreased Haemophilus and increased Oribacterium compared to the UC group. By combining the genera selected by the random forest algorithm in machine learning, followed by confirmation with 10-fold cross-validation, we were able to distinguish the PSC group from the HC group with the area under the curve (AUC) of 0.7423, and from the UC group with the AUC of 0.8756. Our results indicate the potential of salivary microbiota as biomarkers for a noninvasive diagnosis of PSC.Primary sclerosing cholangitis (PSC) is a liver disease known for its frequent concurrence with inflammatory bowel disease. Dysbiosis of the gut microbiota in PSC was reported in several studies, but the microbiological features of the salivary microbiota in PSC have not been established. Here we compared the salivary microbial communities of 24 pediatric-onset PSC patients, 16 age-matched ulcerative colitis (UC) patients, and 24 healthy controls (HCs) by analyzing the bacterial 16S rRNA gene sequence data. The species-richness (\u03b1-diversity) showed no significant between-group differences, whereas the overall salivary microbiota structure (\u03b2-diversity) showed significant differences among the three groups. Taxonomic assignment revealed that the PSC salivary microbiota were characterized by significant decreases in the abundance of  PSC is also known for its high association with inflammatory bowel disease (IBD), mainly ulcerative colitis (UC), with a prevalence of 70\u201380% in adults1, and with the same proportion or an even higher proportion in children4. Conversely, as many as 8.1% of IBD patients develop PSC5. It was also reported that PSC-like bile duct lesions occur frequently even with normal biochemical profiles in children with IBD6.Primary sclerosing cholangitis (PSC) is a liver disease characterized by multiple stenoses due to chronic inflammation and fibrosis in the intrahepatic and extrahepatic biliary system. The disease eventually progresses to end-stage liver disease, resulting in poor prognoses7. However, ERCP is associated with complications such as pancreatitis. To avoid complications, magnetic resonance cholangiopancreatography (MRCP) has been proposed as an alternative method for the diagnosis of PSC, but its sensitivity is approximately 81\u201386% in children, with a lower resolution in younger patients and the need for sedation in some cases9. Thus, additional noninvasive diagnostic biomarkers are desirable for the evaluation of the presence of PSC.In light of this frequent concurrence of PSC and IBD, the diagnosis of either of these diseases should consider the concurrence of the other disease. Cholangiography is mandatory for the diagnosis of PSC, and endoscopic retrograde cholangiopancreatography (ERCP) has been used for the diagnosis of PSC in adults and children14, implying that gastrointestinal inflammation and indigenous microbes are associated with the pathogenesis and prognosis of PSC, and that early intervention may also produce better prognoses. The gut microbiota of adult PSC patients were recently intensively evaluated by using 16S rRNA gene sequences23. Those studies indicated the enrichment of particular bacterial genera including Veillonella23, Enterococcus23, Lactobacillus20, Ruminococcus22, Streptococcus23, Rothia23, and Fusobacterium22 in the feces of PSC patients. We also reported the enrichment of several species, some belonging to these genera, in a Japanese pediatric-onset PSC cohort2.In pediatric and adult PSC patients, the oral administration of antibiotics was reported to decrease the serum levels of alanine aminotransferase (ALT) and \u03b3-glutamyltranspeptidase (GGT), with histological improvement24, several studies have described alterations of salivary microbiota in patients with various diseases. These include cirrhosis25, IBD27, pancreatic cancer29, lung cancer30, colorectal cancer31, IgA nephropathy32, celiac disease33, Behcet\u2019s disease34, and rheumatoid arthritis35. The involvement of salivary microbes in these diseases is unclear, but a correlation between the gut and oral microbiota was suggested36. In addition, changes in the salivary microbiota in systemic diseases may be a resource of microbial biomarkers specific to the diseases, which could contribute to the development of simple and noninvasive diagnoses based on microbial profiling with saliva samples.In addition to close associations between dysbiosis of the gut microbiota and diseasesTo date, there has been no report on the salivary microbiota of PSC patients. As the initial step in the exploration of potential biomarkers for the noninvasive diagnosis of PSC, we performed a bacterial 16S rRNA gene sequence analysis to characterize the salivary microbiota of pediatric-onset PSC patients in a comparison of their microbiota with those of pediatric-onset UC patients and healthy controls (HCs).We recruited 24 PSC and 16 UC patients without PSC whose age of onset was <18 years from Saiseikai Yokohamashi Tobu Hospital  between May 2013 and October 2015, and healthy volunteers without any symptoms  also confirmed no significant difference between the PSC samples with and without SASP treatment, or between the PSC patients treated and untreated with ursodeoxycholic acid (UDCA), mesalazine, and probiotics respectively  plot based on the weighted UniFrac distance metric showed that many of the PSC and UC samples segregated from the HC samples, suggesting that the salivary microbiota structure of both the PSC and UC groups differed from that of the HC group Fig.\u00a0. The PERStreptococcaceae, Pasteurellaceae, and Lachnospiraceae showed significant differences among the three groups. Of these three families, a lower Pasteurellaceae abundance and a higher Lachnospiraceae abundance were observed in the PSC group compared to both the UC and HC groups . Moreover, the abundance of Haemophilus was also significantly lower in the PSC group than that in the UC group (p\u2009=\u20090.0007). Conversely, the abundance of Oribacterium was significantly higher in the PSC group compared to the UC group (p\u2009=\u20090.0036). Additionally, the abundance of Streptococcus was significantly lower in the UC group compared to the HC group (p\u2009=\u20090.0159).The taxonomic assignment at the genus level identified a total of 114 bacterial genera, of which we further evaluated the major 16 genera with the relative mean abundances of >0.5%, accounting for 92.2% of the total abundance  curves were based on the out-of-bag (OOB) error rates in the RF models. We used the area under the curve (AUC) of these ROC curves to find the combination of multiple taxa contributing most to the discrimination of the three groups from the 29 abundant genera with relative mean abundances of >0.1%. The best model was selected according to the best OOB-AUC, which was observed for eight and six genera between the PSC and HC groups, and the PSC and UC groups, respectively  models using the AUC-RF packageely Fig.\u00a0.Figure 3Haemophilus, Streptococcus, Aggregatibacter and Oribacterium) were the common contributors to distinguish the PSC from both the HC and UC groups  contributed to distinguishing the PSC from the HC group  using the RF-selected genera more clearly distinguished the PSC from the HC and UC groups than the PCA using the 29 genera with the mean abundance >0.1%  were the species distinguishing the PSC group from the HC group  were the species distinguishing the PSC group from the UC group  were markedly enriched in the present pediatric-onset PSC group compared to the UC and healthy control groups, and were shown to be the species contributing to the discrimination of the two groups. Similar to the pediatric-onset PSC patients analyzed here, the family Lachnospiraceae was increased in the salivary microbiota of children with celiac disease33. On the other hand, Streptococcus sanguinis was concurrently enriched in celiac disease patients33, whereas this species was significantly decreased in our PSC group  and then transported on ice to the laboratory within 24\u2009hr. At the laboratory, the saliva samples were suspended in 20% glycerol and phosphate-buffered saline (PBS), and then immediately frozen in liquid nitrogen and stored at \u221280\u2009\u00b0C until further analysis26. The 16S rRNA gene V1\u2013V2 region was amplified by polymerase chain reaction (PCR) using the forward primer 27Fmod (5\u2032-CCATCTCATCCCTGCGTGTCTCCGACTCAGNNNNNNNNNNagrgtttgatymtggctcag-3\u2032), containing the 454 primer A and a unique 10-bp barcode sequence for each sample (indicated by Ns), and the reverse primer 338\u2009R (5\u2032-CCTATCCCCTGTGTGCCTTGGCAGTCTCAGtgctgcctcccgtaggagt-3\u2032) containing the 454 primer B38. The PCR was performed using 50\u2009\u03bcL of 1\u00d7 Ex Taq PCR buffer composed of 10\u2009mM Tris-HCl (pH 8.3), 50\u2009mM KCl, and 1.5\u2009mM MgCl2 in the presence of 250\u2009\u03bcM dNTPs, 1 U Ex Taq polymerase , forward and reverse primers (0.2\u2009\u03bcM), and approximately 20 ng of template DNA.The isolation of bacterial DNA from the salivary samples was performed as describedThermal cycling was performed in a 9700 PCR System  with the following cycling conditions: initial denaturation at 96\u2009\u00b0C for 2\u2009min, followed by 25 cycles of denaturation at 96\u2009\u00b0C for 30\u2009sec, annealing at 55\u2009\u00b0C for 45\u2009sec, and extension at 72\u2009\u00b0C for 1\u2009min; and final extension at 72\u2009\u00b0C. PCR amplicons were purified using AMPure XP magnetic purification beads  and quantified using the Quant-iT PicoGreen dsDNA Assay Kit (Life Technologies Japan). An equal amount of each PCR amplicon was mixed and subjected to sequencing with the 454 GS FLX Titanium platform  according to the manufacturer\u2019s instructions.38. Briefly, after multiplexed sequencing of the 16S amplicons, sequences were assigned to samples on the basis of their barcode sequences. Reads with an average quality value <25, inexact matches to both universal primers, and possible chimeric reads, totally accounting for 43\u201344% of all reads, were removed  and NCBI genome databases using the GLSEARCH program. For assignment at the phylum, family, genus, and species levels, the sequence similarity thresholds of 70%, 90%, 94% and 96% were respectively applied. All of the high-quality 16S V1\u2013V2 sequences analyzed in this study were deposited into the DDBJ/GenBank/EMBL database (accession no. DRA005698).We then sorted the selected reads with the average quality value and grouped them into OTUs by clustering using the UCLUST algorithm with a 96% identity threshold50. We performed a principal coordinate analysis (PCoA) to visualize the similarities or dissimilarities in the microbiome structure in the UniFrac analysis. We conducted a PERMANOVA to compare the overall microbiome structure, and the p-values were adjusted for multiple testing by the Benjamin-Hochberg procedure. We used the observed and Chao 1-estimated OTU numbers and Shannon\u2019s index to evaluate the richness and diversity of the overall microbial community. The similarity of the relative abundance at the phylum, family, genus, and species levels was assessed using the Kruskal-Wallis test followed by the Steel-Dwass test for multiple comparisons.Comparisons of the categorical variables were done using the Chi-squared test, Fisher\u2019s exact test, Mann-Whitney U-test, and Kruskal-Wallis test where appropriate. The UniFrac distance was used for the assessment of the dissimilarity (distance) between any pair of samples41 package. All receiver operating characteristic (ROC) curves presented for RF models were based on the out-of-bag (OOB) error rates. The area under the curve (AUC) of these ROC curves was used to find the most discriminatory variables (genera or species). The first RF was build, using all the variables, which provides the initial ranking of the variables according to its importance according to the mean decrease Gini. In the subsequent steps, 5% of the less important variables according to the initial ranking were eliminated. The RF was built with the remaining variables, and the AUC based on OOB predictions (OOB-AUC) of the RF was computed in each model. The best model was selected with the best OOB-AUC value. The best RF model was further confirmed by evaluating the mean AUC of a 10-fold cross-validation repeated 20 times using the AUC-RF41 package. All of these analyses were performed using the R software program (v3.3.1). All methods were carried out in accordance with relevant guidelines and regulations.Random forest (RF) models were generated using the AUC-RFSupplementary Files"]}
-{"representative": "Vascular endothelial growth factors (VEGFs) and their receptors play crucial roles in the formation of blood and lymphatic vessels during embryogenesis, and also under pathologic conditions in the adult. Despite intensive efforts over the last decades to elucidate the precise functions of VEGFs, transcriptional responses to VEGF receptor stimulation are still not fully characterized. To investigate the specific transcriptional effects of VEGFR-2 and VEGFR-3 activation, we performed a correlation analysis of previously published CAGE sequencing and microarray data of human lymphatic endothelial cells (LECs) stimulated with distinct VEGFs acting through either VEGFR-2 or VEGFR-3. We identified that specific activation of VEGFR-3 by VEGF-C156S results in the downregulation of many genes involved in immune regulation and inflammation, suggesting that VEGFR-3 stimulation has direct anti-inflammatory effects. Comparing CAGE and microarray data sets, we furthermore identified a small number of genes that showed a receptor-dependent response in LECs, demonstrating that these receptors, despite activating very similar signaling pathways, fulfill overlapping but not identical functions within the same cell type (LECs). VEGFs exert their function by binding to the three known VEGFRs, VEGFR-1, VEGFR-2 or VEGFR-3, which are expressed by blood vessel endothelial cells (BECs) in case of VEGFR-1 and -2, and lymphatic vessel endothelial cells (LECs) in case of VEGFR-2 and -3. Some expression of VEGFR-3 in angiogenic blood vessels has been described as well2. In addition, VEGFs bind to co-receptors such as neuropilins (NRP) 1 and 2 as well as heparan sulfate proteoglycans, that do not signal directly but modulate the interaction between VEGFs and VEGFRs and thereby affect VEGF signaling indirectly1.The vascular system, consisting of blood and lymphatic vessels, is crucially dependent on vascular endothelial growth factors (VEGFs) and their receptors (VEGFRs), which regulate the proliferation and function of endothelial cells. In humans, the VEGF family comprises five ligands, placenta growth factor (PLGF), VEGF-A, VEGF-B, VEGF-C and VEGF-D, that are structurally related and predominantly present as homodimers in their mature form3. Of note, a mutated form of VEGF-C, in which Cys156 is replaced by a Ser residue (VEGF-C156S), displays reduced affinity for VEGFR-2, and has thus been regarded as a selective VEGFR-3 stimulator4.The individual members of the VEGF family display selective binding affinities for one or several VEGFRs. PLGF and VEGF-B exclusively interact with VEGFR-1. VEGF-A, the most potent inducer of endothelial responses within the family, binds to both VEGFR-1 and VEGFR-2. Although the affinity of VEGF-A is higher for VEGFR-1 than for VEGFR-2, the latter receptor has a much higher kinase activity and is thus regarded as the most important receptor for transmitting the effects of VEGF-A. VEGF-C and VEGF-D differ from the other ligands of the family in that they are produced as immature precursor proteins, requiring proteolytic maturation in order to gain their full activity, and preferentially bind to VEGFR-3. In their fully mature form, however, both ligands also act as VEGFR-2 agonists5. This in turn leads to the phosphorylation of specific Tyr residues in the cytoplasmic tail of the receptor, which serve as docking sites for adapter proteins needed to initiate multiple downstream signaling cascades such as the PI3K-AKT, PLC-\u03b3 and Ras-Raf-ERK signaling pathways. The biochemical processes immediately downstream of receptor activation have been investigated to considerable detail  and identified several TFs involved in this response. The majority of these TFs are well known \u2018immediate early\u2019 TFs that are induced upon signaling through various receptor tyrosine kinases such as EGR, FOS and JUN. Importantly, we also identified TFs with LEC-specific functions during VEGFR-3 signaling. For example, the homeobox TF HOXD10 that is constitutively present in LECs but not in BECs, is required for the induction of a second, downstream TF, namely NR4A1 . We identified multiple downregulated genes that were frequently associated with pro-inflammatory functions. Furthermore, we performed a combined analysis of the CAGE sequencing data and our previously published microarray-based gene expression data of primary human LECs treated with VEGF-A or fully mature VEGF-C, resulting in activation of either VEGFR-2 or of both VEGFR-2 and VEGFR-3, respectively10. We found that even though the majority of target genes are comparably regulated by VEGFR-2 and VEGFR-3 activation in human LECs, a small number of distinct genes showed receptor-specific responses within the same cell type.Our previous analysis of the CAGE RNA sequencing data only revealed upregulated but not downregulated genes after VEGF-C156S treatment of LECsn to the preceding time point tn-1 using the EdgeR method11. Since this analysis likely failed to identify genes with small, gradual changes in gene expression, we re-analyzed the data set comparing each time point tn to the baseline time point t0 using paired DESeq2 >0.6) and 1012 downregulated  peaks  to 480 min ref.  Fig. 1aFig. 1a. eq2 ref. . Among 86) peaks . Activat6) peaks .9. Among the 158 overlapping genes, we found several important lymphatic TFs such us KLF4, SOX18, and MAFB  CAGE peaks corresponded to 501 upregulated and 772 downregulated genes, according to the current CAGE peak annotation . Furtherand MAFB . Interes9, the upregulated genes were enriched for GO terms related to chromatin organization, mRNA expression, and protein translation and localization , middle phase genes (150 to 240\u2009min) and late phase genes (300 to 480\u2009min) . Then, wlization . We founlization . Similar10, 60\u2009min, 240\u2009min, 480\u2009min and 24\u2009h after stimulation. We decided to use the VEGF-A data to identify genes regulated by either VEGFR-2 or VEGFR-3 stimulation, comparing them to the VEGF-C156S stimulation time course at the three overlapping time points 60\u2009min, 240\u2009min, and 480\u2009min , and that showed at least a 4-fold difference in their log2FC induced by VEGF-A and VEGF-C156S. We identified 108 differentially regulated (DR) genes at the 60\u2009min time point, 232 at the 240\u2009min time point, and 194 at the 480\u2009min time point , wildtype VEGF-C (500\u2009ngml\u22121) and VEGF-C156S (1.5\u2009\u03bcgml\u22121) incubation at 60, 240 and 480\u2009min, using qPCR. Consistent with our in silico results, RCAN1 was selectively induced at the 60\u2009min time point  are lower26. This suggests that the increased number of DE genes identified here is not simply due to false positives. Secondly, we used a different scheme to calculate the contrasts, comparing each time point tn of the stimulation with the baseline t0 (0\u2009min), whereas previously, tn was compared to tn-1, which probably resulted in type II errors  in case of genes with small and/or gradual changes in expression. Finally, using a multi-factorial design, we now adjusted for differences between the 3 individual LEC donors, which conceivably increased the statistical power of our analysis.Activation of VEGFR-3 results in various cellular responses in lymphatic endothelial cells, including cell migration, proliferation and changes in the intercellular junctions, which affects monolayer permeabilityeq2 ref. , as comp9, the new analysis confirmed that the genes upregulated during the first hours after VEGFR-3 stimulation are to a large extent associated with transcription-related processes, including chromatin organization, RNA synthesis and stability. In addition to our previous analysis, we identified further TFs induced by VEGF-C156S, including FOXC2, ELK1, and NFATC1, which have been reported to regulate vascular development and angiogenesis before13\u201315. Importantly, our data also indicate that VEGFR-3 activation exerts direct anti-inflammatory effects on LEC, by downregulation of several immune- and cytokine-response associated genes. This is in line with the reported anti-inflammatory effects of VEGF-C on macrophages29 and indicates that VEGF-C, that has previously been found to reduce inflammation when applied in vivo30\u201332, not only acts via an increase of the lymphatic drainage, but also by inhibiting inflammatory signaling in LEC. Interestingly, these anti-inflammatory effects of VEGF-C are reminiscent of the effects of VEGF-A signaling in BEC34.In agreement with our previous analysis1. Nonetheless, VEGF-A and VEGF-C have been described to elicit different effects on lymphatic vessels in vivo, although the literature is not entirely consistent in this regard. For example, adenoviral delivery of VEGF-A into the ear of mice has been reported to induce massive dilation of lymphatic vessels35, whereas others found lymphatic dilation and formation of new lymphatic vessels only after delivery of VEGF-C, but not of VEGF-A36\u201338. This prompted us to attempt to identify genes differentially regulated by VEGFR-2 and VEGFR-3 within the same cell type, namely primary human LECs, by comparing our CAGE RNA sequencing data set of VEGF-C156S stimulated LECs with a microarray study of VEGF-A and wildtype VEGF-C stimulated LECs previously published by our group10. Naturally, cross-platform comparison of gene expression is problematic, due to inherent technical biases. Many studies have described a relatively good correlation between conventional RNA sequencing and microarray results obtained from the same starting material39\u201341. Similarly, CAGE RNA sequencing, in which only short (ca. 20 nt) 5\u2019 fragments of mature, capped RNAs are analyzed, has been found to correlate well with conventional RNA sequencing42. Nonetheless, CAGE RNA sequencing is different from microarray and conventional RNA sequencing methods in that it does not assess the abundance of entire transcripts, but rather measures the activity of transcriptional start sites. Perhaps not surprisingly, a study comparing CAGE RNA sequencing directly with microarray and qPCR data found a rather low correlation between the data obtained by these techniques43. In our case, we additionally performed a cross-study comparison that likely introduced further bias due to biological differences in the starting material as well as experimental procedures and handling. Additionally, the data sets differed regarding the dosage of the growth factors applied: 1.5\u2009\u03bcgml\u22121 in case of VEGF-C156S, 500\u2009ngml\u22121 of wildtype VEGF-C, and 20\u2009ng\u2009ml\u22121 VEGF-A. However, these doses reflect the differences in affinity and activity of the VEGFs, and are well within the range of what is commonly used by our lab and others45.VEGFR-2 and VEGFR-3 are structurally related and considered to activate similar intracellular signaling cascadesDespite these challenges, we observed the expected upregulation of an overlapping gene set after VEGFR-2 and VEGFR-3 stimulation with our approach, at least early after stimulation (60\u2009min) when the induction of many downstream genes peaked. Furthermore, we identified several genes that were selectively regulated by stimulation of VEGFR-2 or VEGFR-3 only. These differentially regulated genes included the selective VEGF-A target genes RCAN1, ESM1 and ANGPT2. The specific induction of these genes by VEGF-A could also be validated experimentally, supporting the overall validity of our analysis. Selective upregulation of genes by VEGFR-2 might be explained simply by a difference in signal \u2018strength\u2019, e.g. due to higher ligand-receptor affinity, or higher kinase activity of the receptor, which are hard to control or manipulate experimentally. However, the fact that we also found a few genes regulated selectively by VEGFR-3 suggests that the quality of the signal downstream of the two receptors differs to some extent, e.g. by activating different kinases which in turn activate different TFs. Interestingly, stimulation with wildtype VEGF-C resulted in a \u2018mixed\u2019 response, with some genes being regulated as by VEGF-C156S and others as by VEGF-A.20. KLF4 is a direct transcriptional target of MAFB, a TF activated by VEGFR-3 signaling9, and may be involved in LEC differentiation by regulating the \u2018master\u2019 TF of LEC, PROX1  + 0.2% bovine serum albumine (BSA) over night and were subsequently incubated with 1.5\u2009\u03bcgml\u22121 VEGF-C156S. RNA was extracted at 16 different timepoints  using TRIzol (Thermo Fisher) and subjected to CAGE RNA sequencing by the Fantom5 consortium at the RIKEN Institute  as described9. Raw counts were downloaded from the freely available Fantom5 data repository (http://fantom.gsc.riken.jp/5). CAGE peak expression analysis over the entire time course was done in R, using Bioconductor\u2019s DESeq2 package . MA plots showing the log2FC compared to the average expression of the time point-specific CAGE peaks were done using the DESeq2 package. The corresponding genes  are provided in \u2018Upregulated Genes after VEGFC156S stimulation\u2019, \u2018Downregulated Genes after VEGFC156S stimulation\u2019, Data Citation 1. Heat maps and hierarchical clustering of the up- and downregulated genes were performed using Genesis .CAGE RNA sequencing data of primary human LECs stimulated with VEGF-C156S have been published previouslyhttp://geneontology.org, release 22.8.2016). GO biological process (BP) terms and molecular function (MF) terms with an adjusted P-value<0.01 were considered significantly enriched. The top 25 enriched GO terms (by fold enrichment) from each category were clustered manually into biologically related themes and are listed in \u2018GO_BP analysis\u2019 and \u2018GO_MF analysis\u2019, Data Citation 1.The DE genes were grouped into early (0 to 120\u2009min), middle (150 to 240\u2009min) and late (300 to 480\u2009min) phase genes. Gene ontology (GO) enrichment analysis for each of these phases was performed using the Gene Ontology Consortium Database . RNA was extracted after 0\u2009min (control), 60\u2009min, 240\u2009min, 480\u2009min and 24\u2009h, and subjected to microarray-based gene expression analysis using the Human Genome Survey V2.0 (Applied Biosystems) as described10. This data set has been deposited in the gene expression omnibus (GEO) repository under the accession number GSE11228 (Data Citation 2). Normalized data were retrieved and analyzed using the GEOquery package in Bioconductor, comparing the gene expression at the time points 60, 240 and 480\u2009min to the 0\u2009min (control) time point.Generation of gene expression data of primary human LECs treated with VEGF-A and wildtype VEGF-C has been published before2FC values at the matching time points 60, 240 and 480\u2009min. To this end, we first removed all ambiguous CAGE peaks and probe sets. In the case of multiple peaks or probe sets associated with one gene, only the peak or probe set with the highest average expression was considered. Next, we used Entrez Gene IDs derived from corresponding annotation tables  to match the genes in the three data sets. Genes without available Entrez Gene ID in the corresponding annotation tables were additionally annotated using Bioconductor and the org.Hs.eg.db package (version 3.2.3) based on their gene symbol. The final matching of genes in the three data sets based on the Entrez Gene ID was done using R. From 16639 genes represented on the microarray, 10952 (at 60\u2009min), 10951 (at 240\u2009min), and 10989 (at 480\u2009min) could be matched to the CAGE RNA sequencing data in this way. Log2FC values of all matched genes were plotted, and linear regression and correlation coefficients (Pearson) were calculated using GraphPad Prism V5. For the 3 time points, we selected genes differentially regulated by VEGF-C156S and VEGF-A if they were strongly regulated by either VEGF-A or VEGF-C156S (P<0.05 and log2FC>1 or <\u22121) and if there was at least a four-fold difference in the log2FC value after VEGF-C156S stimulation compared to the log2FC after VEGF-A stimulation .Comparison of the VEGF-C156S stimulation time course and the VEGF-A and VEGF-C stimulation time courses was done based on the log\u22121 VEGF-A (Cell Sciences), 500\u2009ngml\u22121 mature wildtype VEGF-C (R&D Systems) or 1.5\u2009\u03bcgml\u22121 recombinant VEGF-C156S . Total RNA was isolated using Genezol reagent (Geneaid) and extracted following the manufacturer\u2019s protocol. The concentration of RNA was measured using a NanoDrop. Equal amounts of RNA were reverse transcribed using the High-Capacity cDNA Reverse Transcription Kit (Applied Biosystems). Gene expression of selected genes was quantified by qPCR using FastStart Universal SYBR Green Master (ROX) on a QuantStudio 7 Flex Real-Time PCR System (Applied Biosystems). RPLP0 was used as housekeeping control to normalize Ct values. Relative expression was calculated according to the comparative Ct method. Primer sequences are listed in 24\u2009h before stimulation, 70000 primary LECs were seeded on collagen type-I coated 12-well plates. Next, LECs were starved over night in EBM + 0.2% BSA and were subsequently treated for 60, 240 or 480\u2009min with 20\u2009ngmlHow to cite this article: Dieterich, L. C. et al. Distinct transcriptional responses of lymphatic endothelial cells to VEGFR-3 and VEGFR-2 stimulation. Sci. Data 4:170106 doi: 10.1038/sdata.2017.106 (2017).Publisher\u2019s note: Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.", "texts": ["Vascular endothelial growth factors (VEGFs) and their receptors play crucial roles in the formation of blood and lymphatic vessels during embryogenesis, and also under pathologic conditions in the adult. Despite intensive efforts over the last decades to elucidate the precise functions of VEGFs, transcriptional responses to VEGF receptor stimulation are still not fully characterized. To investigate the specific transcriptional effects of VEGFR-2 and VEGFR-3 activation, we performed a correlation analysis of previously published CAGE sequencing and microarray data of human lymphatic endothelial cells (LECs) stimulated with distinct VEGFs acting through either VEGFR-2 or VEGFR-3. We identified that specific activation of VEGFR-3 by VEGF-C156S results in the downregulation of many genes involved in immune regulation and inflammation, suggesting that VEGFR-3 stimulation has direct anti-inflammatory effects. Comparing CAGE and microarray data sets, we furthermore identified a small number of genes that showed a receptor-dependent response in LECs, demonstrating that these receptors, despite activating very similar signaling pathways, fulfill overlapping but not identical functions within the same cell type (LECs). VEGFs exert their function by binding to the three known VEGFRs, VEGFR-1, VEGFR-2 or VEGFR-3, which are expressed by blood vessel endothelial cells (BECs) in case of VEGFR-1 and -2, and lymphatic vessel endothelial cells (LECs) in case of VEGFR-2 and -3. Some expression of VEGFR-3 in angiogenic blood vessels has been described as well2. In addition, VEGFs bind to co-receptors such as neuropilins (NRP) 1 and 2 as well as heparan sulfate proteoglycans, that do not signal directly but modulate the interaction between VEGFs and VEGFRs and thereby affect VEGF signaling indirectly1.The vascular system, consisting of blood and lymphatic vessels, is crucially dependent on vascular endothelial growth factors (VEGFs) and their receptors (VEGFRs), which regulate the proliferation and function of endothelial cells. In humans, the VEGF family comprises five ligands, placenta growth factor (PLGF), VEGF-A, VEGF-B, VEGF-C and VEGF-D, that are structurally related and predominantly present as homodimers in their mature form3. Of note, a mutated form of VEGF-C, in which Cys156 is replaced by a Ser residue (VEGF-C156S), displays reduced affinity for VEGFR-2, and has thus been regarded as a selective VEGFR-3 stimulator4.The individual members of the VEGF family display selective binding affinities for one or several VEGFRs. PLGF and VEGF-B exclusively interact with VEGFR-1. VEGF-A, the most potent inducer of endothelial responses within the family, binds to both VEGFR-1 and VEGFR-2. Although the affinity of VEGF-A is higher for VEGFR-1 than for VEGFR-2, the latter receptor has a much higher kinase activity and is thus regarded as the most important receptor for transmitting the effects of VEGF-A. VEGF-C and VEGF-D differ from the other ligands of the family in that they are produced as immature precursor proteins, requiring proteolytic maturation in order to gain their full activity, and preferentially bind to VEGFR-3. In their fully mature form, however, both ligands also act as VEGFR-2 agonists5. This in turn leads to the phosphorylation of specific Tyr residues in the cytoplasmic tail of the receptor, which serve as docking sites for adapter proteins needed to initiate multiple downstream signaling cascades such as the PI3K-AKT, PLC-\u03b3 and Ras-Raf-ERK signaling pathways. The biochemical processes immediately downstream of receptor activation have been investigated to considerable detail  and identified several TFs involved in this response. The majority of these TFs are well known \u2018immediate early\u2019 TFs that are induced upon signaling through various receptor tyrosine kinases such as EGR, FOS and JUN. Importantly, we also identified TFs with LEC-specific functions during VEGFR-3 signaling. For example, the homeobox TF HOXD10 that is constitutively present in LECs but not in BECs, is required for the induction of a second, downstream TF, namely NR4A1 . We identified multiple downregulated genes that were frequently associated with pro-inflammatory functions. Furthermore, we performed a combined analysis of the CAGE sequencing data and our previously published microarray-based gene expression data of primary human LECs treated with VEGF-A or fully mature VEGF-C, resulting in activation of either VEGFR-2 or of both VEGFR-2 and VEGFR-3, respectively10. We found that even though the majority of target genes are comparably regulated by VEGFR-2 and VEGFR-3 activation in human LECs, a small number of distinct genes showed receptor-specific responses within the same cell type.Our previous analysis of the CAGE RNA sequencing data only revealed upregulated but not downregulated genes after VEGF-C156S treatment of LECsn to the preceding time point tn-1 using the EdgeR method11. Since this analysis likely failed to identify genes with small, gradual changes in gene expression, we re-analyzed the data set comparing each time point tn to the baseline time point t0 using paired DESeq2 >0.6) and 1012 downregulated  peaks  to 480 min ref.  Fig. 1aFig. 1a. eq2 ref. . Among 86) peaks . Activat6) peaks .9. Among the 158 overlapping genes, we found several important lymphatic TFs such us KLF4, SOX18, and MAFB  CAGE peaks corresponded to 501 upregulated and 772 downregulated genes, according to the current CAGE peak annotation . Furtherand MAFB . Interes9, the upregulated genes were enriched for GO terms related to chromatin organization, mRNA expression, and protein translation and localization , middle phase genes (150 to 240\u2009min) and late phase genes (300 to 480\u2009min) . Then, wlization . We founlization . Similar10, 60\u2009min, 240\u2009min, 480\u2009min and 24\u2009h after stimulation. We decided to use the VEGF-A data to identify genes regulated by either VEGFR-2 or VEGFR-3 stimulation, comparing them to the VEGF-C156S stimulation time course at the three overlapping time points 60\u2009min, 240\u2009min, and 480\u2009min , and that showed at least a 4-fold difference in their log2FC induced by VEGF-A and VEGF-C156S. We identified 108 differentially regulated (DR) genes at the 60\u2009min time point, 232 at the 240\u2009min time point, and 194 at the 480\u2009min time point , wildtype VEGF-C (500\u2009ngml\u22121) and VEGF-C156S (1.5\u2009\u03bcgml\u22121) incubation at 60, 240 and 480\u2009min, using qPCR. Consistent with our in silico results, RCAN1 was selectively induced at the 60\u2009min time point  are lower26. This suggests that the increased number of DE genes identified here is not simply due to false positives. Secondly, we used a different scheme to calculate the contrasts, comparing each time point tn of the stimulation with the baseline t0 (0\u2009min), whereas previously, tn was compared to tn-1, which probably resulted in type II errors  in case of genes with small and/or gradual changes in expression. Finally, using a multi-factorial design, we now adjusted for differences between the 3 individual LEC donors, which conceivably increased the statistical power of our analysis.Activation of VEGFR-3 results in various cellular responses in lymphatic endothelial cells, including cell migration, proliferation and changes in the intercellular junctions, which affects monolayer permeabilityeq2 ref. , as comp9, the new analysis confirmed that the genes upregulated during the first hours after VEGFR-3 stimulation are to a large extent associated with transcription-related processes, including chromatin organization, RNA synthesis and stability. In addition to our previous analysis, we identified further TFs induced by VEGF-C156S, including FOXC2, ELK1, and NFATC1, which have been reported to regulate vascular development and angiogenesis before13\u201315. Importantly, our data also indicate that VEGFR-3 activation exerts direct anti-inflammatory effects on LEC, by downregulation of several immune- and cytokine-response associated genes. This is in line with the reported anti-inflammatory effects of VEGF-C on macrophages29 and indicates that VEGF-C, that has previously been found to reduce inflammation when applied in vivo30\u201332, not only acts via an increase of the lymphatic drainage, but also by inhibiting inflammatory signaling in LEC. Interestingly, these anti-inflammatory effects of VEGF-C are reminiscent of the effects of VEGF-A signaling in BEC34.In agreement with our previous analysis1. Nonetheless, VEGF-A and VEGF-C have been described to elicit different effects on lymphatic vessels in vivo, although the literature is not entirely consistent in this regard. For example, adenoviral delivery of VEGF-A into the ear of mice has been reported to induce massive dilation of lymphatic vessels35, whereas others found lymphatic dilation and formation of new lymphatic vessels only after delivery of VEGF-C, but not of VEGF-A36\u201338. This prompted us to attempt to identify genes differentially regulated by VEGFR-2 and VEGFR-3 within the same cell type, namely primary human LECs, by comparing our CAGE RNA sequencing data set of VEGF-C156S stimulated LECs with a microarray study of VEGF-A and wildtype VEGF-C stimulated LECs previously published by our group10. Naturally, cross-platform comparison of gene expression is problematic, due to inherent technical biases. Many studies have described a relatively good correlation between conventional RNA sequencing and microarray results obtained from the same starting material39\u201341. Similarly, CAGE RNA sequencing, in which only short (ca. 20 nt) 5\u2019 fragments of mature, capped RNAs are analyzed, has been found to correlate well with conventional RNA sequencing42. Nonetheless, CAGE RNA sequencing is different from microarray and conventional RNA sequencing methods in that it does not assess the abundance of entire transcripts, but rather measures the activity of transcriptional start sites. Perhaps not surprisingly, a study comparing CAGE RNA sequencing directly with microarray and qPCR data found a rather low correlation between the data obtained by these techniques43. In our case, we additionally performed a cross-study comparison that likely introduced further bias due to biological differences in the starting material as well as experimental procedures and handling. Additionally, the data sets differed regarding the dosage of the growth factors applied: 1.5\u2009\u03bcgml\u22121 in case of VEGF-C156S, 500\u2009ngml\u22121 of wildtype VEGF-C, and 20\u2009ng\u2009ml\u22121 VEGF-A. However, these doses reflect the differences in affinity and activity of the VEGFs, and are well within the range of what is commonly used by our lab and others45.VEGFR-2 and VEGFR-3 are structurally related and considered to activate similar intracellular signaling cascadesDespite these challenges, we observed the expected upregulation of an overlapping gene set after VEGFR-2 and VEGFR-3 stimulation with our approach, at least early after stimulation (60\u2009min) when the induction of many downstream genes peaked. Furthermore, we identified several genes that were selectively regulated by stimulation of VEGFR-2 or VEGFR-3 only. These differentially regulated genes included the selective VEGF-A target genes RCAN1, ESM1 and ANGPT2. The specific induction of these genes by VEGF-A could also be validated experimentally, supporting the overall validity of our analysis. Selective upregulation of genes by VEGFR-2 might be explained simply by a difference in signal \u2018strength\u2019, e.g. due to higher ligand-receptor affinity, or higher kinase activity of the receptor, which are hard to control or manipulate experimentally. However, the fact that we also found a few genes regulated selectively by VEGFR-3 suggests that the quality of the signal downstream of the two receptors differs to some extent, e.g. by activating different kinases which in turn activate different TFs. Interestingly, stimulation with wildtype VEGF-C resulted in a \u2018mixed\u2019 response, with some genes being regulated as by VEGF-C156S and others as by VEGF-A.20. KLF4 is a direct transcriptional target of MAFB, a TF activated by VEGFR-3 signaling9, and may be involved in LEC differentiation by regulating the \u2018master\u2019 TF of LEC, PROX1  + 0.2% bovine serum albumine (BSA) over night and were subsequently incubated with 1.5\u2009\u03bcgml\u22121 VEGF-C156S. RNA was extracted at 16 different timepoints  using TRIzol (Thermo Fisher) and subjected to CAGE RNA sequencing by the Fantom5 consortium at the RIKEN Institute  as described9. Raw counts were downloaded from the freely available Fantom5 data repository (http://fantom.gsc.riken.jp/5). CAGE peak expression analysis over the entire time course was done in R, using Bioconductor\u2019s DESeq2 package . MA plots showing the log2FC compared to the average expression of the time point-specific CAGE peaks were done using the DESeq2 package. The corresponding genes  are provided in \u2018Upregulated Genes after VEGFC156S stimulation\u2019, \u2018Downregulated Genes after VEGFC156S stimulation\u2019, Data Citation 1. Heat maps and hierarchical clustering of the up- and downregulated genes were performed using Genesis .CAGE RNA sequencing data of primary human LECs stimulated with VEGF-C156S have been published previouslyhttp://geneontology.org, release 22.8.2016). GO biological process (BP) terms and molecular function (MF) terms with an adjusted P-value<0.01 were considered significantly enriched. The top 25 enriched GO terms (by fold enrichment) from each category were clustered manually into biologically related themes and are listed in \u2018GO_BP analysis\u2019 and \u2018GO_MF analysis\u2019, Data Citation 1.The DE genes were grouped into early (0 to 120\u2009min), middle (150 to 240\u2009min) and late (300 to 480\u2009min) phase genes. Gene ontology (GO) enrichment analysis for each of these phases was performed using the Gene Ontology Consortium Database . RNA was extracted after 0\u2009min (control), 60\u2009min, 240\u2009min, 480\u2009min and 24\u2009h, and subjected to microarray-based gene expression analysis using the Human Genome Survey V2.0 (Applied Biosystems) as described10. This data set has been deposited in the gene expression omnibus (GEO) repository under the accession number GSE11228 (Data Citation 2). Normalized data were retrieved and analyzed using the GEOquery package in Bioconductor, comparing the gene expression at the time points 60, 240 and 480\u2009min to the 0\u2009min (control) time point.Generation of gene expression data of primary human LECs treated with VEGF-A and wildtype VEGF-C has been published before2FC values at the matching time points 60, 240 and 480\u2009min. To this end, we first removed all ambiguous CAGE peaks and probe sets. In the case of multiple peaks or probe sets associated with one gene, only the peak or probe set with the highest average expression was considered. Next, we used Entrez Gene IDs derived from corresponding annotation tables  to match the genes in the three data sets. Genes without available Entrez Gene ID in the corresponding annotation tables were additionally annotated using Bioconductor and the org.Hs.eg.db package (version 3.2.3) based on their gene symbol. The final matching of genes in the three data sets based on the Entrez Gene ID was done using R. From 16639 genes represented on the microarray, 10952 (at 60\u2009min), 10951 (at 240\u2009min), and 10989 (at 480\u2009min) could be matched to the CAGE RNA sequencing data in this way. Log2FC values of all matched genes were plotted, and linear regression and correlation coefficients (Pearson) were calculated using GraphPad Prism V5. For the 3 time points, we selected genes differentially regulated by VEGF-C156S and VEGF-A if they were strongly regulated by either VEGF-A or VEGF-C156S (P<0.05 and log2FC>1 or <\u22121) and if there was at least a four-fold difference in the log2FC value after VEGF-C156S stimulation compared to the log2FC after VEGF-A stimulation .Comparison of the VEGF-C156S stimulation time course and the VEGF-A and VEGF-C stimulation time courses was done based on the log\u22121 VEGF-A (Cell Sciences), 500\u2009ngml\u22121 mature wildtype VEGF-C (R&D Systems) or 1.5\u2009\u03bcgml\u22121 recombinant VEGF-C156S . Total RNA was isolated using Genezol reagent (Geneaid) and extracted following the manufacturer\u2019s protocol. The concentration of RNA was measured using a NanoDrop. Equal amounts of RNA were reverse transcribed using the High-Capacity cDNA Reverse Transcription Kit (Applied Biosystems). Gene expression of selected genes was quantified by qPCR using FastStart Universal SYBR Green Master (ROX) on a QuantStudio 7 Flex Real-Time PCR System (Applied Biosystems). RPLP0 was used as housekeeping control to normalize Ct values. Relative expression was calculated according to the comparative Ct method. Primer sequences are listed in 24\u2009h before stimulation, 70000 primary LECs were seeded on collagen type-I coated 12-well plates. Next, LECs were starved over night in EBM + 0.2% BSA and were subsequently treated for 60, 240 or 480\u2009min with 20\u2009ngmlHow to cite this article: Dieterich, L. C. et al. Distinct transcriptional responses of lymphatic endothelial cells to VEGFR-3 and VEGFR-2 stimulation. Sci. Data 4:170106 doi: 10.1038/sdata.2017.106 (2017).Publisher\u2019s note: Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations."]}
-{"representative": "However, this metric failed in overall survival (OS) prediction. In the present proof of concept study, we aimed to explore the prognostic value of intratumoral textural features (TF) as well as volumetric parameters  derived by pre-therapeutic 18F-FDG PET.The metabolically most active lesion in 2-deoxy-2- mutational status) for prediction of both PFS and OS were evaluated.Eighteen patients with progressive MTC underwent baseline P\u2009=\u20090.03). Baseline TLG designated 11/18 patients to the high-risk group . The Hazard Ratio for cancer-related death was 6.1 for Complexity . Among investigated clinical parameters, the age at initiation of TKI treatment reached significance for PFS prediction .The TF Complexity and the volumetric parameter TLG obtained at baseline prior to TKI initiation successfully differentiated between low- and high-risk patients. Complexity allocated 10/18 patients to the high-risk group with an OS of 3.3\u2009y (vs. low-risk group, OS\u2009=\u20095.3\u2009y, 8/18, AUC\u2009=\u20090.78, The TF Complexity and the volumetric parameter TLG are both independent parameters for OS prediction. The tyrosine kinase inhibitor (TKI) vandetanib, a selective inhibitor of wild-type rearranged during transfection (RET) kinase as well as of vascular endothelial growth factor receptor (VEGFR) signaling \u20133, has d18F)fluoro-D-glucose (18F-FDG) positron emission tomography (PET) has been demonstrated as a useful tool for outcome prediction in various tumor entities, including salivary gland carcinoma, pancreatic cancer, and colorectal cancer   , 25. Allimmediate next voxel. Higher-order parameters are calculated from 3-dimensional neighborhood gray-tone (intensity) difference matrices (NGTDM) to describe local features. These parameters are based from differences between each voxel and the neighboring voxels in adjacent image planes: The NGTDM (M4) contains entire homogeneous areas of a certain intensity and size [The following TF, which had been investigated in a previous study for outcome prediction in non-small cell lung cancer (NSCLC) patients under TKI treatment , were inand size . Higher-and size .To assess the entire baseline tumor burden, 109 metastases  were initially segmented. After treatment initiation with vandetanib, 56 metastases  at follow-up were still available for segmentation. Details on segmented VOI for both baseline and follow-up PET are given in Supplementary Table Serum levels of carcinoembryonic antigen  and calcitonin  were measured (prior to baseline imaging with a median of 6 determinations) . Tumor mP value\u2009<\u20090.05.Statistical analysis was performed using Medcalc (Vers. 17.4.4). The cutoff values of each parameter for PFS and OS prediction were determined by receiver operating characteristic (ROC) analysis (with the Youden-Index for maximization of specificity and sensitivity) (23). Kaplan\u2013Meier analysis  was performed using thresholds established by ROC analysis in cases in which ROC showed statistically significant results. A multivariate Cox hazard analysis was conducted to determine independent prognostic parameters . Additionally, Hazard Ratios (HR) were obtained. Statistical significance was considered with a 18F-FDG PET was positive in the entire cohort, with 17/18 (94.4%) patients presenting with lymph node involvement and 10/18 (55.6%) with lung metastases. 9/18 (50.0%) patients had liver lesions, 9/18 (50.0%) had bone lesions, 2/18 (11.1%) had soft tissue metastases, and a single subject  suffered from infiltration of the pancreas . Median follow-up was 6.4 years . 12/18 (66.7%) patients experienced progressive disease after a median of 2.6\u2009y , whereas the remaining 6 patients remained stable. Nine out of 12 progressive disease patients died of their disease  after a median of 4.1\u2009y .18F-FDG PET, follow-up PET and change in % between both scans). Besides for Homogeneity, all investigated parameters demonstrated a decline between succeeding scans.The mean (range) values for all investigated PET parameters are given in Table P\u2009=\u20090.03; PFS, P\u2009=\u20090.07). Moreover, Contrast of >11.2 at baseline  was also correlated with significantly reduced PFS of 0.8\u2009y .Complexity of\u2009>\u200959 at baseline  correlated with significantly reduced OS of 3.3\u2009y , AUC\u2009=\u20090.78, P\u2009=\u20090.005; PFS, P\u2009=\u20090.11).Among the analyzed volumetric parameters, TLG\u2009>\u20092694 at baseline  was correlated with significantly reduced OS of 3.5\u2009y (vs. <2694 in 7/18 (38.9%), OS\u2009=\u20095\u2009y, AUC\u2009=\u20090.83, None of the investigated delta parameters reached significance in ROC analysis. Table p\u2009=\u20090.04). For OS, baseline TF Complexity and baseline TLG reached significance .To determine independent prognosticators, a subsequent multivariate Cox analysis was performed: for PFS, baseline TF Contrast was found to be significant .For those subjects above the ROC-derived threshold, the HR for Complexity was 6.1 for OS . Similar results could be obtained for the TF Contrast for patients above the threshold: HR was 3.7 (1.1\u201312.2) in terms of PFS . For the volumetric parameter TLG, the HR was 9.5  for OS . Among investigated clinical parameters, the age at initiation of TKI treatment demonstrated significance for PFS prediction (p\u2009=\u20090.02). For OS, baseline TF Complexity (p\u2009=\u20090.006) and baseline TLG (p\u2009=\u20090.008) reached significance. Respective Kaplan\u2013Meier Plots for selected parameters  are displayed in Fig. Using ROC-derived cutoffs, Kaplan\u2013Meier analysis found a significant separation between high- and low-risk groups for baseline TF Contrast . These findings were further corroborated by obtaining an HR\u2009>\u20096 for cancer-related death for those subjects above the ROC-derived threshold. Similar results were observed for the volumetric parameter TLG: a higher glucose consumption by the tumor volume at baseline was also independently associated with shortened OS  have been investigated for outcome prediction, e.g., in NSCLC treated with the TKI erlotinib [max [max at baseline, 3.4\u201319.9 vs. SUVmax at baseline in the study of Cook et al., 1.2\u201330.1 [Changes in PET features for TKI response assessment and survival prediction have been evaluated in numerous previous studies. However, primarily SUV parameters automatic lesion detection software: this might pave the way for a cost-effective and time-saving implementation of TF assessment in clinical routine in the long run . Future The TF Complexity and the volumetric parameter TLG, obtained from baseline PET, are both independent parameters for OS prediction in MTC patients scheduled for TKI treatment. Further investigations using intra-tumoral heterogeneity for risk stratification and prognostication are warranted, particularly in patients suffering from tumor entities treated with TKI.Supplementary Material", "texts": ["However, this metric failed in overall survival (OS) prediction. In the present proof of concept study, we aimed to explore the prognostic value of intratumoral textural features (TF) as well as volumetric parameters  derived by pre-therapeutic 18F-FDG PET.The metabolically most active lesion in 2-deoxy-2- mutational status) for prediction of both PFS and OS were evaluated.Eighteen patients with progressive MTC underwent baseline P\u2009=\u20090.03). Baseline TLG designated 11/18 patients to the high-risk group . The Hazard Ratio for cancer-related death was 6.1 for Complexity . Among investigated clinical parameters, the age at initiation of TKI treatment reached significance for PFS prediction .The TF Complexity and the volumetric parameter TLG obtained at baseline prior to TKI initiation successfully differentiated between low- and high-risk patients. Complexity allocated 10/18 patients to the high-risk group with an OS of 3.3\u2009y (vs. low-risk group, OS\u2009=\u20095.3\u2009y, 8/18, AUC\u2009=\u20090.78, The TF Complexity and the volumetric parameter TLG are both independent parameters for OS prediction. The tyrosine kinase inhibitor (TKI) vandetanib, a selective inhibitor of wild-type rearranged during transfection (RET) kinase as well as of vascular endothelial growth factor receptor (VEGFR) signaling \u20133, has d18F)fluoro-D-glucose (18F-FDG) positron emission tomography (PET) has been demonstrated as a useful tool for outcome prediction in various tumor entities, including salivary gland carcinoma, pancreatic cancer, and colorectal cancer   , 25. Allimmediate next voxel. Higher-order parameters are calculated from 3-dimensional neighborhood gray-tone (intensity) difference matrices (NGTDM) to describe local features. These parameters are based from differences between each voxel and the neighboring voxels in adjacent image planes: The NGTDM (M4) contains entire homogeneous areas of a certain intensity and size [The following TF, which had been investigated in a previous study for outcome prediction in non-small cell lung cancer (NSCLC) patients under TKI treatment , were inand size . Higher-and size .To assess the entire baseline tumor burden, 109 metastases  were initially segmented. After treatment initiation with vandetanib, 56 metastases  at follow-up were still available for segmentation. Details on segmented VOI for both baseline and follow-up PET are given in Supplementary Table Serum levels of carcinoembryonic antigen  and calcitonin  were measured (prior to baseline imaging with a median of 6 determinations) . Tumor mP value\u2009<\u20090.05.Statistical analysis was performed using Medcalc (Vers. 17.4.4). The cutoff values of each parameter for PFS and OS prediction were determined by receiver operating characteristic (ROC) analysis (with the Youden-Index for maximization of specificity and sensitivity) (23). Kaplan\u2013Meier analysis  was performed using thresholds established by ROC analysis in cases in which ROC showed statistically significant results. A multivariate Cox hazard analysis was conducted to determine independent prognostic parameters . Additionally, Hazard Ratios (HR) were obtained. Statistical significance was considered with a 18F-FDG PET was positive in the entire cohort, with 17/18 (94.4%) patients presenting with lymph node involvement and 10/18 (55.6%) with lung metastases. 9/18 (50.0%) patients had liver lesions, 9/18 (50.0%) had bone lesions, 2/18 (11.1%) had soft tissue metastases, and a single subject  suffered from infiltration of the pancreas . Median follow-up was 6.4 years . 12/18 (66.7%) patients experienced progressive disease after a median of 2.6\u2009y , whereas the remaining 6 patients remained stable. Nine out of 12 progressive disease patients died of their disease  after a median of 4.1\u2009y .18F-FDG PET, follow-up PET and change in % between both scans). Besides for Homogeneity, all investigated parameters demonstrated a decline between succeeding scans.The mean (range) values for all investigated PET parameters are given in Table P\u2009=\u20090.03; PFS, P\u2009=\u20090.07). Moreover, Contrast of >11.2 at baseline  was also correlated with significantly reduced PFS of 0.8\u2009y .Complexity of\u2009>\u200959 at baseline  correlated with significantly reduced OS of 3.3\u2009y , AUC\u2009=\u20090.78, P\u2009=\u20090.005; PFS, P\u2009=\u20090.11).Among the analyzed volumetric parameters, TLG\u2009>\u20092694 at baseline  was correlated with significantly reduced OS of 3.5\u2009y (vs. <2694 in 7/18 (38.9%), OS\u2009=\u20095\u2009y, AUC\u2009=\u20090.83, None of the investigated delta parameters reached significance in ROC analysis. Table p\u2009=\u20090.04). For OS, baseline TF Complexity and baseline TLG reached significance .To determine independent prognosticators, a subsequent multivariate Cox analysis was performed: for PFS, baseline TF Contrast was found to be significant .For those subjects above the ROC-derived threshold, the HR for Complexity was 6.1 for OS . Similar results could be obtained for the TF Contrast for patients above the threshold: HR was 3.7 (1.1\u201312.2) in terms of PFS . For the volumetric parameter TLG, the HR was 9.5  for OS . Among investigated clinical parameters, the age at initiation of TKI treatment demonstrated significance for PFS prediction (p\u2009=\u20090.02). For OS, baseline TF Complexity (p\u2009=\u20090.006) and baseline TLG (p\u2009=\u20090.008) reached significance. Respective Kaplan\u2013Meier Plots for selected parameters  are displayed in Fig. Using ROC-derived cutoffs, Kaplan\u2013Meier analysis found a significant separation between high- and low-risk groups for baseline TF Contrast . These findings were further corroborated by obtaining an HR\u2009>\u20096 for cancer-related death for those subjects above the ROC-derived threshold. Similar results were observed for the volumetric parameter TLG: a higher glucose consumption by the tumor volume at baseline was also independently associated with shortened OS  have been investigated for outcome prediction, e.g., in NSCLC treated with the TKI erlotinib [max [max at baseline, 3.4\u201319.9 vs. SUVmax at baseline in the study of Cook et al., 1.2\u201330.1 [Changes in PET features for TKI response assessment and survival prediction have been evaluated in numerous previous studies. However, primarily SUV parameters automatic lesion detection software: this might pave the way for a cost-effective and time-saving implementation of TF assessment in clinical routine in the long run . Future The TF Complexity and the volumetric parameter TLG, obtained from baseline PET, are both independent parameters for OS prediction in MTC patients scheduled for TKI treatment. Further investigations using intra-tumoral heterogeneity for risk stratification and prognostication are warranted, particularly in patients suffering from tumor entities treated with TKI.Supplementary Material"]}
-{"representative": "Behavioral responses to novel situations often vary and can belong to a suite of correlated behaviors. Characteristic behaviors of different personality types (e.g. stress coping styles) are generally consistent across contexts and time. Here, we compare the repeatability and reliability of exploratory behaviors between zebrafish strains selectively bred to display contrasting behavioral responses to stressors that represent the proactive-reactive axis. Specifically, we measure exploratory behavior of individual fish in an open field test over five weeks. We quantified the stationary time, average swimming speed and time spent by a fish in the center area. We found a number of strain differences for each behavioral measure. Stationary time was the most repeatable and reliable measure for assessing proactive-reactive behavioral differences. Reactive zebrafish generally showed the highest reliability and repeatability of exploratory behavior compared to proactive zebrafish and a separate wild caught strain. Given the increased interest in the evolutionary consequences and proximate mechanisms of consistent individual differences, it will be important to continue to investigate how different selective pressures may influence expression of stress coping styles and their effects on the consistency of an animal\u2019s behavior. In response to stressors, many studies document consistent differences between individuals across contexts in behaviors like aggression, boldness and sociability but the temporal component within the same context has not been thoroughly examined8.Animals are frequently faced with a variety of stressors to their survival and reproductive efforts and typically employ behavioral and physiological responses to overcome them. While an individual\u2019s behavioral response has been thought to be labile in variable environments, studies show that it can be consistent. Consistency of behavioral and physiological responses have both a between and within-individual component where the response in one context is often predictive of the animal\u2019s response in a disparate context and across time10. Proactive individuals are characterized by actively engaging stressors, having a feed-forward memory process, low glucocorticoid stress response, and low behavioral flexibility. In contrast, reactive individuals are more sensitive to environmental cues with reduced exploration of novel environments, a higher glucocorticoid stress response, and higher behavioral flexibility10. Both coping styles represent adaptive responses to environmental challenges and are maintained within a population due to fitness trade-offs in a variable environment13. Selective pressures such as predation and immune challenge can constrain behavioral variation within a population and strengthen correlations between traits, thereby facilitating correlated behaviors and physiology16.Across many taxa there are two alternative correlated suites of behavioral and physiological responses to stressors known as proactive and reactive stress coping styles17. Few studies have investigated repeatability  and reliability  of behaviors in stress coping styles across multiple time points. Studies looking at aggressive behavior of selectively bred mice (Mus musculus) suggest that proactive individuals with low behavioral flexibility show greater reliability across trials than reactive individuals19. Similarly, proactive great tits (Parus major) establish more rigid routines during an open field test (OFT) and novel object test while reactive birds showed a higher degree of behavioral plasticity and lower reliability20. While some studies report conflicting results in teleosts22, selectively bred reactive trout (Oncorhynchus mykiss) display higher behavioral flexibility when a novel object was introduced during a feeding task23. Despite these observations, the repeatability and reliability of stress coping styles across time has not been well-established. Further, it is also not well understood how artificial selection may affect repeatability and reliability of behavior.Selectively bred strains of proactive and reactive behavioral phenotypes are often used to investigate the proximate mechanisms of stress coping styles and estimate heritability26. Within-individual variation of exploratory and other behaviors over time are influenced by factors such as prior experience, age, and motivation8. To investigate within-individual consistency across time, studies have used the reliability estimate, which measures the predictability of an animal\u2019s performance on a measured variable over time relative to others within a population . In human and animal personality studies, reliability estimates tend to range between 0.7\u20130.8527. A frequently used estimate to measure consistent differences between individuals is repeatability. The repeatability of a behavior is defined as the intraclass correlation coefficient and is calculated as the ratio of between-individual variance and the sum of between- and within-individual variance. Overall, exploratory behavior in a novel environment is repeatable in many avian, rodent, and teleost species with repeatability values ranging from 0.2\u20130.530. In addition to exploratory behavior, other behaviors such as thigmotaxis and movement speed have been commonly used to assess the magnitude of behavioral stress response and could also be indicative of an individual\u2019s stress coping style32. Thigmotaxis and movement speed are generally repeatable like exploratory behavior33. It is unknown which behavior  is most suitable for use as an indicator of an individual\u2019s stress coping style.Exploratory behavior in a novel environment can be used to assess the magnitude of a stress response and categorize an individual into a stress coping style. Variation in exploratory behavior is widely studied and often utilizes the well-established OFTDanio rerio) are a promising teleost system to understand the causes and consequences of correlated behavioral variation35. Both wild and laboratory strains of zebrafish display the proactive and reactive stress coping styles, and have distinct and heritable genetic architectures42. Proactive zebrafish are typically dominant and have higher reproductive success44. We have previously shown that selectively bred proactive and reactive zebrafish strains show consistent behavioral differences across a variety of contexts between the strains41. Additionally, artificial selection of exploratory behavior will constrain morphological evolution and glucocorticoid responses45. While the consistency of exploratory behavior has not been extensively studied in individual strains of proactive and reactive zebrafish, several studies have suggested that other boldness, aggression, and locomotor behaviors are generally consistent across contexts and time, and are influenced by selective pressures48. Thus, zebrafish can provide unique insights into underlying mechanisms of behavioral variation in coping with stress and subsequently how variation can be constrained by selective forces acting on populations.Zebrafish  exploratory behavior is stable across time, (ii) repeatability and reliability measures differ between the stress coping style strains, and (iii) selectively bred strains are more repeatable or reliable than a separate wild caught population. By measuring variation of behavior within and between individuals, we can gain insight into factors contributing to the emergence and maintenance of stress coping styles in different populationsDanio rerio) strains: wild caught (WC), high stationary behavior (HSB), and low stationary behavior (LSB). Wild caught fish were imported from North Bengal, India through a commercial supplier  and housed in the laboratory for 21 months before testing. The HSB and LSB strains were selected for stationary behavior (i.e. exploratory behavior) in an open field test and were 10 generations removed from a wild caught population from Gaighata in West Bengal, India41. The HSB and LSB strains display behaviors across multiple different behavioral assays, glucocorticoid responses, and morphology consistent with the reactive and proactive stress coping styles, respectively54. Additionally, HSB and LSB strains differ in neurotranscriptome profiles55. Females of both strains exhibit higher stationary time than males in an open field test56. We tested 28 individuals from LSB  and 27 each from HSB  and WC strains . LSB and HSB individuals were 13 months post-fertilization when testing began. Fish were individually housed in 3-liter tanks throughout the period of experiments on a recirculating water system (Pentair Aquatic Eco-Systems) using UV and solid filtration. Water temperature was set at 27\u2009\u00b0C. Fish were kept on a 14:10\u2009L/D cycle and fed twice a day with Tetramin Tropical Flakes . Morning feedings were prior to experiments on testing days.We used three different zebrafish  was filled with 4\u2009L of system water. Animals were individually placed in the arena and video-recorded for 5\u2009min. Each fish was tested once a week for five consecutive weeks between 8 and 10\u2009h in the morning. The video recordings were analyzed with Noldus EthoVision XT . For each fish, we quantified three estimates of exploratory behavior: stationary time, average swimming speed and time spent in the center. The subject was considered stationary if it was moving less than 0.5\u2009cm/s and the center zone was defined as the 15\u2009\u00d7\u200915\u2009cm zone in the center of the chamber. We digitally measured standard length of each fish at end of the five weeks. There was a significant effect of strain on standard length . The WC strain (3.27\u2009\u00b1\u20090.05\u2009cm) was significantly larger than the HSB  and LSB lines . HSB and LSB lines did not significantly differ in standard length (p\u2009=\u20090.42). Females (3.03\u2009\u00b1\u20090.04\u2009cm) were significantly larger than males . All testing experiments were approved by the Institutional Animal Care and Use Committee of University of Nebraska at Omaha/University of Nebraska Medical Center  and were performed in accordance with the relevant guidelines and regulations.To test the repeatability and reliability of exploratory behavior, we used the open field test following established procedures57.Reliability of exploratory behavior across time and between-strain differences were tested using a repeated measures general linear model (GLM) in SPSS (Version 24). Sex and strain were included as between-subjects variables and standard length was controlled for by including it as a covariate. Since the assumption of sphericity was violated for each of the three exploratory behaviors we applied the Greenhouse-geisser correction. This did not change any statistical conclusions, therefore we only reported the uncorrected model. For the post-hoc comparisons of the estimated marginal means of the three estimates of exploratory behavior, we applied a Benjamini-Hochberg correction to reduce the likelihood of type I errors58. This allowed us to control for shared associations between the behaviors in a single model, and more importantly test for differences in the variability within- and between-individuals across strains. First, we began with an unconditional model to assess the variability at each level . Next, the covariances between all the behaviors were included at each level. Then, we split the models by strain  and constrained every part of the model in a step-wise fashion to ascertain which sources of variability were significantly different across the strains . A constraint was considered to have worsened the model based on a significant chi-square test (p\u2009<\u20090.05). Any significantly worsening constraint reflects a difference in the estimates between strains.To assess behavioral variation among strains, we used multilevel structural equation modeling in M-plus statistical analysis software59. We calculated R based on variance components estimated from the multilevel structural equation model. Based on several literature meta-analyses61 we describe repeatability values as follows: low repeatability R\u2009\u2264\u20090.2; moderate repeatability 0.2\u2009<\u2009R\u2009<\u20090.4; and high repeatability R\u2009\u2265\u20090.4. Reliability measures were estimated as the inter-trial reliability measure in SPSS (Version 24). Values\u2009>\u20090.8 were considered highly reliable and indicate that individuals maintained rank order across the five weeks of testing. Of note, repeatability and reliability values are deemed significantly different from a comparison value if they do not fall within that comparison value\u2019s 95% confidence interval. All statistical tests were two-tailed, and were conducted with an alpha level of 0.05.Repeatability was defined as the intraclass correlation coefficient (R), which was calculated as the ratio of between-individual variance and the sum of between- and within-individual variance2,79\u2009=\u200915.75 p\u2009<\u20090.01, Table\u00a02,79\u2009=\u20093.37 p\u2009=\u20090.04, Table\u00a02,79\u2009=\u200940.73 p\u2009<\u20090.01, Table\u00a0There was a significant between-subjects effect of strain for stationary time  and week*standard length  for time spent in the center . The resulting model provided adequate fit (\u03c72(3)\u2009=\u20091.15, p\u2009>\u20090.05, CFI\u2009=\u20091.00, RMSEA\u2009<\u20090.01, SRMR(within)\u2009<\u20090.01, SRMR(between)\u2009=\u20090.10). After constraining the variability at the within-individual level, a number of differences emerged , both of the LSB (R\u2009=\u20090.56) and HSB (R\u2009=\u20090.71) strains showed high repeatability values for stationary time (Table\u00a015. Field crickets (Gryllus integer) exposed to a common bacterial pathogen showed increased repeatability in their tendency to explore a novel environment15. Similarly, boldness and aggression behaviors were correlated in wild sticklebacks (Gasterosteus aculeatus) only after exposing the population to predation14. In great tits, correlation between exploratory behavior and stress physiology emerged through selectively bred proactive and reactive birds but not wild individuals62. These studies suggest that selection can influence expression of repeatability and reliability by potentially placing survival costs on individuals. Predation has frequently been identified as one of the strongest ecological pressures that can influence the repeatability and reliability of animal behavior47. We speculate that by selecting for an ecologically relevant behavioral response to a stressor in the HSB and LSB lines within the lab, it may have been simulating selection of behavioral responses to predation in the wild. Low exploratory behavior may be adaptive and directly selected for in environments with high predation. This could explain why the HSB fish showed the highest repeatability and reliability values for a majority of the behavioral estimates. Altogether, this indicates that artificial selection may act similarly to natural selection and increase the repeatability and reliability of behavior.High exploratory behavior in a novel environment is characteristic of the proactive stress coping stylele R\u2009=\u20090.9, both ome Table\u00a0. Further64. Despite being a measure of stress and type of exploratory behavior, thigmotaxis has not been commonly used to predict an animal\u2019s stress coping style. We observed that the repeatability of time in the center in the HSB, WC, and LSB strains was high, low, and not repeatable, respectively . Behavioral correlations appeared and disappeared across years that coincided with changes in the density and age composition of the bird population, which could reflect changes in resource availability65. Our results suggest that the ecological pressures acting on the WC population shaped different behavioral patterns compared to those resulting from artificial selection.It should be noted that the WC individuals were imported from North Bengal, India, which is a different location than the founding animals used to generate the HSB and LSB strains . The local ecological factors that might have contributed to shaping the WC animals\u2019 behavior are not known. It is possible that some population differences or behavioral correlations may only emerge under certain local environmental conditions66. There were no significant differences between the HSB and LSB strains in standard length or mean swimming speed. Although a previous study showed that the LSB strain swims faster and has a larger caudal region compared to the HSB strain, this was examined using morphometrics and within a startle-response paradigm31. Measuring standard length does not allow for inferring size of specific body areas . In our study we also measured average swim speed over a five minute period within the open field test and did note evoke a startle-response. All three strains were highly repeatable for average swimming speed 33. There was no effect of time across weeks  and selectively bred traits .Previous studies suggest that proactive individuals with low behavioral flexibility and rigid behavior patterns are more consistent than reactive individualsks Table\u00a0. Furtherks Table\u00a0. It is p7. In studies examining repeatability and reliability within a social context such as aggressive behaviors19 and predator inspection68, it is difficult to ensure consistency of behaviors and motivation of live stimulus animal across trials. Thus, the context the focal animal experiences may subtly vary across testing periods and make it difficult to understand if results are due to stimulus animal behavioral state or within-individual variation over time. In using the OFT we removed potential confounds of varying contexts over time and therefore are confident we measured within-individual variation. Even when these changing contexts are taken into account, other internal developmental factors can also influence the repeatability and reliability of behavior. Despite using a similar methodology as the current study, selectively bred proactive great tit birds were more consistent over time in exploratory behavior relative to the reactive birds20. It is noteworthy that the two assay time points were across developmentally distinct periods (once in juveniles and once in adults), which has been shown to influence repeatability60. In the current study, all zebrafish were sexually mature adults at the time of testing and were assayed over five weeks, which could explain the inconsistency of our findings.It is also important to be able to separate out changes in consistency across time from those that could be due to changes in contexts between assay time points69. This is especially important given that a central assumption of stress coping styles is that a behavioral phenotype is maintained over time, despite the observation that animal behavior can be very labile over small durations61. Here, we found that stationary time was the most repeatable and reliable estimate of exploratory behavior over five repeated observations. Additionally, the artificially selected proactive and reactive strains showed higher repeatability and reliability values compared to the wild caught population. This suggests that in populations under high levels of selection, a single to a few measurements for the examined behaviors can be a sufficient representation of that individual\u2019s behavior. While increasing the number of repeated trials allow for more robust repeatability estimates, short inter-trial intervals can lead to habituation or other forms of associative learning. These types of learning can have confounding effects on estimates of repeatability and reliability70. If animals habituate during repeated measurements, there is weaker construct validity of assessing consistency of stress coping behaviors. We found no evidence of habituation in our study with a one week intertrial interval (Fig.\u00a0There are many key considerations when estimating repeatability and reliability of animal behavior. Often studies have estimated repeatability by using two measurements for each individual, which can overlook any behavioral changes that may occur over longer periods of time or multiple observationsDataset 1", "texts": ["Behavioral responses to novel situations often vary and can belong to a suite of correlated behaviors. Characteristic behaviors of different personality types (e.g. stress coping styles) are generally consistent across contexts and time. Here, we compare the repeatability and reliability of exploratory behaviors between zebrafish strains selectively bred to display contrasting behavioral responses to stressors that represent the proactive-reactive axis. Specifically, we measure exploratory behavior of individual fish in an open field test over five weeks. We quantified the stationary time, average swimming speed and time spent by a fish in the center area. We found a number of strain differences for each behavioral measure. Stationary time was the most repeatable and reliable measure for assessing proactive-reactive behavioral differences. Reactive zebrafish generally showed the highest reliability and repeatability of exploratory behavior compared to proactive zebrafish and a separate wild caught strain. Given the increased interest in the evolutionary consequences and proximate mechanisms of consistent individual differences, it will be important to continue to investigate how different selective pressures may influence expression of stress coping styles and their effects on the consistency of an animal\u2019s behavior. In response to stressors, many studies document consistent differences between individuals across contexts in behaviors like aggression, boldness and sociability but the temporal component within the same context has not been thoroughly examined8.Animals are frequently faced with a variety of stressors to their survival and reproductive efforts and typically employ behavioral and physiological responses to overcome them. While an individual\u2019s behavioral response has been thought to be labile in variable environments, studies show that it can be consistent. Consistency of behavioral and physiological responses have both a between and within-individual component where the response in one context is often predictive of the animal\u2019s response in a disparate context and across time10. Proactive individuals are characterized by actively engaging stressors, having a feed-forward memory process, low glucocorticoid stress response, and low behavioral flexibility. In contrast, reactive individuals are more sensitive to environmental cues with reduced exploration of novel environments, a higher glucocorticoid stress response, and higher behavioral flexibility10. Both coping styles represent adaptive responses to environmental challenges and are maintained within a population due to fitness trade-offs in a variable environment13. Selective pressures such as predation and immune challenge can constrain behavioral variation within a population and strengthen correlations between traits, thereby facilitating correlated behaviors and physiology16.Across many taxa there are two alternative correlated suites of behavioral and physiological responses to stressors known as proactive and reactive stress coping styles17. Few studies have investigated repeatability  and reliability  of behaviors in stress coping styles across multiple time points. Studies looking at aggressive behavior of selectively bred mice (Mus musculus) suggest that proactive individuals with low behavioral flexibility show greater reliability across trials than reactive individuals19. Similarly, proactive great tits (Parus major) establish more rigid routines during an open field test (OFT) and novel object test while reactive birds showed a higher degree of behavioral plasticity and lower reliability20. While some studies report conflicting results in teleosts22, selectively bred reactive trout (Oncorhynchus mykiss) display higher behavioral flexibility when a novel object was introduced during a feeding task23. Despite these observations, the repeatability and reliability of stress coping styles across time has not been well-established. Further, it is also not well understood how artificial selection may affect repeatability and reliability of behavior.Selectively bred strains of proactive and reactive behavioral phenotypes are often used to investigate the proximate mechanisms of stress coping styles and estimate heritability26. Within-individual variation of exploratory and other behaviors over time are influenced by factors such as prior experience, age, and motivation8. To investigate within-individual consistency across time, studies have used the reliability estimate, which measures the predictability of an animal\u2019s performance on a measured variable over time relative to others within a population . In human and animal personality studies, reliability estimates tend to range between 0.7\u20130.8527. A frequently used estimate to measure consistent differences between individuals is repeatability. The repeatability of a behavior is defined as the intraclass correlation coefficient and is calculated as the ratio of between-individual variance and the sum of between- and within-individual variance. Overall, exploratory behavior in a novel environment is repeatable in many avian, rodent, and teleost species with repeatability values ranging from 0.2\u20130.530. In addition to exploratory behavior, other behaviors such as thigmotaxis and movement speed have been commonly used to assess the magnitude of behavioral stress response and could also be indicative of an individual\u2019s stress coping style32. Thigmotaxis and movement speed are generally repeatable like exploratory behavior33. It is unknown which behavior  is most suitable for use as an indicator of an individual\u2019s stress coping style.Exploratory behavior in a novel environment can be used to assess the magnitude of a stress response and categorize an individual into a stress coping style. Variation in exploratory behavior is widely studied and often utilizes the well-established OFTDanio rerio) are a promising teleost system to understand the causes and consequences of correlated behavioral variation35. Both wild and laboratory strains of zebrafish display the proactive and reactive stress coping styles, and have distinct and heritable genetic architectures42. Proactive zebrafish are typically dominant and have higher reproductive success44. We have previously shown that selectively bred proactive and reactive zebrafish strains show consistent behavioral differences across a variety of contexts between the strains41. Additionally, artificial selection of exploratory behavior will constrain morphological evolution and glucocorticoid responses45. While the consistency of exploratory behavior has not been extensively studied in individual strains of proactive and reactive zebrafish, several studies have suggested that other boldness, aggression, and locomotor behaviors are generally consistent across contexts and time, and are influenced by selective pressures48. Thus, zebrafish can provide unique insights into underlying mechanisms of behavioral variation in coping with stress and subsequently how variation can be constrained by selective forces acting on populations.Zebrafish  exploratory behavior is stable across time, (ii) repeatability and reliability measures differ between the stress coping style strains, and (iii) selectively bred strains are more repeatable or reliable than a separate wild caught population. By measuring variation of behavior within and between individuals, we can gain insight into factors contributing to the emergence and maintenance of stress coping styles in different populationsDanio rerio) strains: wild caught (WC), high stationary behavior (HSB), and low stationary behavior (LSB). Wild caught fish were imported from North Bengal, India through a commercial supplier  and housed in the laboratory for 21 months before testing. The HSB and LSB strains were selected for stationary behavior (i.e. exploratory behavior) in an open field test and were 10 generations removed from a wild caught population from Gaighata in West Bengal, India41. The HSB and LSB strains display behaviors across multiple different behavioral assays, glucocorticoid responses, and morphology consistent with the reactive and proactive stress coping styles, respectively54. Additionally, HSB and LSB strains differ in neurotranscriptome profiles55. Females of both strains exhibit higher stationary time than males in an open field test56. We tested 28 individuals from LSB  and 27 each from HSB  and WC strains . LSB and HSB individuals were 13 months post-fertilization when testing began. Fish were individually housed in 3-liter tanks throughout the period of experiments on a recirculating water system (Pentair Aquatic Eco-Systems) using UV and solid filtration. Water temperature was set at 27\u2009\u00b0C. Fish were kept on a 14:10\u2009L/D cycle and fed twice a day with Tetramin Tropical Flakes . Morning feedings were prior to experiments on testing days.We used three different zebrafish  was filled with 4\u2009L of system water. Animals were individually placed in the arena and video-recorded for 5\u2009min. Each fish was tested once a week for five consecutive weeks between 8 and 10\u2009h in the morning. The video recordings were analyzed with Noldus EthoVision XT . For each fish, we quantified three estimates of exploratory behavior: stationary time, average swimming speed and time spent in the center. The subject was considered stationary if it was moving less than 0.5\u2009cm/s and the center zone was defined as the 15\u2009\u00d7\u200915\u2009cm zone in the center of the chamber. We digitally measured standard length of each fish at end of the five weeks. There was a significant effect of strain on standard length . The WC strain (3.27\u2009\u00b1\u20090.05\u2009cm) was significantly larger than the HSB  and LSB lines . HSB and LSB lines did not significantly differ in standard length (p\u2009=\u20090.42). Females (3.03\u2009\u00b1\u20090.04\u2009cm) were significantly larger than males . All testing experiments were approved by the Institutional Animal Care and Use Committee of University of Nebraska at Omaha/University of Nebraska Medical Center  and were performed in accordance with the relevant guidelines and regulations.To test the repeatability and reliability of exploratory behavior, we used the open field test following established procedures57.Reliability of exploratory behavior across time and between-strain differences were tested using a repeated measures general linear model (GLM) in SPSS (Version 24). Sex and strain were included as between-subjects variables and standard length was controlled for by including it as a covariate. Since the assumption of sphericity was violated for each of the three exploratory behaviors we applied the Greenhouse-geisser correction. This did not change any statistical conclusions, therefore we only reported the uncorrected model. For the post-hoc comparisons of the estimated marginal means of the three estimates of exploratory behavior, we applied a Benjamini-Hochberg correction to reduce the likelihood of type I errors58. This allowed us to control for shared associations between the behaviors in a single model, and more importantly test for differences in the variability within- and between-individuals across strains. First, we began with an unconditional model to assess the variability at each level . Next, the covariances between all the behaviors were included at each level. Then, we split the models by strain  and constrained every part of the model in a step-wise fashion to ascertain which sources of variability were significantly different across the strains . A constraint was considered to have worsened the model based on a significant chi-square test (p\u2009<\u20090.05). Any significantly worsening constraint reflects a difference in the estimates between strains.To assess behavioral variation among strains, we used multilevel structural equation modeling in M-plus statistical analysis software59. We calculated R based on variance components estimated from the multilevel structural equation model. Based on several literature meta-analyses61 we describe repeatability values as follows: low repeatability R\u2009\u2264\u20090.2; moderate repeatability 0.2\u2009<\u2009R\u2009<\u20090.4; and high repeatability R\u2009\u2265\u20090.4. Reliability measures were estimated as the inter-trial reliability measure in SPSS (Version 24). Values\u2009>\u20090.8 were considered highly reliable and indicate that individuals maintained rank order across the five weeks of testing. Of note, repeatability and reliability values are deemed significantly different from a comparison value if they do not fall within that comparison value\u2019s 95% confidence interval. All statistical tests were two-tailed, and were conducted with an alpha level of 0.05.Repeatability was defined as the intraclass correlation coefficient (R), which was calculated as the ratio of between-individual variance and the sum of between- and within-individual variance2,79\u2009=\u200915.75 p\u2009<\u20090.01, Table\u00a02,79\u2009=\u20093.37 p\u2009=\u20090.04, Table\u00a02,79\u2009=\u200940.73 p\u2009<\u20090.01, Table\u00a0There was a significant between-subjects effect of strain for stationary time  and week*standard length  for time spent in the center . The resulting model provided adequate fit (\u03c72(3)\u2009=\u20091.15, p\u2009>\u20090.05, CFI\u2009=\u20091.00, RMSEA\u2009<\u20090.01, SRMR(within)\u2009<\u20090.01, SRMR(between)\u2009=\u20090.10). After constraining the variability at the within-individual level, a number of differences emerged , both of the LSB (R\u2009=\u20090.56) and HSB (R\u2009=\u20090.71) strains showed high repeatability values for stationary time (Table\u00a015. Field crickets (Gryllus integer) exposed to a common bacterial pathogen showed increased repeatability in their tendency to explore a novel environment15. Similarly, boldness and aggression behaviors were correlated in wild sticklebacks (Gasterosteus aculeatus) only after exposing the population to predation14. In great tits, correlation between exploratory behavior and stress physiology emerged through selectively bred proactive and reactive birds but not wild individuals62. These studies suggest that selection can influence expression of repeatability and reliability by potentially placing survival costs on individuals. Predation has frequently been identified as one of the strongest ecological pressures that can influence the repeatability and reliability of animal behavior47. We speculate that by selecting for an ecologically relevant behavioral response to a stressor in the HSB and LSB lines within the lab, it may have been simulating selection of behavioral responses to predation in the wild. Low exploratory behavior may be adaptive and directly selected for in environments with high predation. This could explain why the HSB fish showed the highest repeatability and reliability values for a majority of the behavioral estimates. Altogether, this indicates that artificial selection may act similarly to natural selection and increase the repeatability and reliability of behavior.High exploratory behavior in a novel environment is characteristic of the proactive stress coping stylele R\u2009=\u20090.9, both ome Table\u00a0. Further64. Despite being a measure of stress and type of exploratory behavior, thigmotaxis has not been commonly used to predict an animal\u2019s stress coping style. We observed that the repeatability of time in the center in the HSB, WC, and LSB strains was high, low, and not repeatable, respectively . Behavioral correlations appeared and disappeared across years that coincided with changes in the density and age composition of the bird population, which could reflect changes in resource availability65. Our results suggest that the ecological pressures acting on the WC population shaped different behavioral patterns compared to those resulting from artificial selection.It should be noted that the WC individuals were imported from North Bengal, India, which is a different location than the founding animals used to generate the HSB and LSB strains . The local ecological factors that might have contributed to shaping the WC animals\u2019 behavior are not known. It is possible that some population differences or behavioral correlations may only emerge under certain local environmental conditions66. There were no significant differences between the HSB and LSB strains in standard length or mean swimming speed. Although a previous study showed that the LSB strain swims faster and has a larger caudal region compared to the HSB strain, this was examined using morphometrics and within a startle-response paradigm31. Measuring standard length does not allow for inferring size of specific body areas . In our study we also measured average swim speed over a five minute period within the open field test and did note evoke a startle-response. All three strains were highly repeatable for average swimming speed 33. There was no effect of time across weeks  and selectively bred traits .Previous studies suggest that proactive individuals with low behavioral flexibility and rigid behavior patterns are more consistent than reactive individualsks Table\u00a0. Furtherks Table\u00a0. It is p7. In studies examining repeatability and reliability within a social context such as aggressive behaviors19 and predator inspection68, it is difficult to ensure consistency of behaviors and motivation of live stimulus animal across trials. Thus, the context the focal animal experiences may subtly vary across testing periods and make it difficult to understand if results are due to stimulus animal behavioral state or within-individual variation over time. In using the OFT we removed potential confounds of varying contexts over time and therefore are confident we measured within-individual variation. Even when these changing contexts are taken into account, other internal developmental factors can also influence the repeatability and reliability of behavior. Despite using a similar methodology as the current study, selectively bred proactive great tit birds were more consistent over time in exploratory behavior relative to the reactive birds20. It is noteworthy that the two assay time points were across developmentally distinct periods (once in juveniles and once in adults), which has been shown to influence repeatability60. In the current study, all zebrafish were sexually mature adults at the time of testing and were assayed over five weeks, which could explain the inconsistency of our findings.It is also important to be able to separate out changes in consistency across time from those that could be due to changes in contexts between assay time points69. This is especially important given that a central assumption of stress coping styles is that a behavioral phenotype is maintained over time, despite the observation that animal behavior can be very labile over small durations61. Here, we found that stationary time was the most repeatable and reliable estimate of exploratory behavior over five repeated observations. Additionally, the artificially selected proactive and reactive strains showed higher repeatability and reliability values compared to the wild caught population. This suggests that in populations under high levels of selection, a single to a few measurements for the examined behaviors can be a sufficient representation of that individual\u2019s behavior. While increasing the number of repeated trials allow for more robust repeatability estimates, short inter-trial intervals can lead to habituation or other forms of associative learning. These types of learning can have confounding effects on estimates of repeatability and reliability70. If animals habituate during repeated measurements, there is weaker construct validity of assessing consistency of stress coping behaviors. We found no evidence of habituation in our study with a one week intertrial interval (Fig.\u00a0There are many key considerations when estimating repeatability and reliability of animal behavior. Often studies have estimated repeatability by using two measurements for each individual, which can overlook any behavioral changes that may occur over longer periods of time or multiple observationsDataset 1"]}
-{"representative": "The aim of this study was to explore the relationship between compliance with preoperative posturing advice and progression of macula-on retinal detachment (RD) and to evaluate whether head positioning or head motility contributes most to RD progression.Sixteen patients with macula-on RD were enrolled, admitted to the ward, and instructed to posture preoperatively. The primary outcome parameter was compliance, which was defined as the average head orientation deviation from advised positioning. Secondary outcome parameters included the average rotational and linear head acceleration. The head orientation and acceleration were measured with a head-mounted inertial measurement unit (IMU). Optical coherence tomography (OCT) imaging was performed at baseline and during natural interruptions of posturing for meals and toilet visits to measure RD progression toward the fovea.P = 0.001, rs2 = 0.13) for compliance, 0.52  for rotational acceleration, and 0.49  for linear acceleration. The correlation coefficient between RD progression and rotational acceleration was statistically significantly higher than the correlation coefficient between RD progression and compliance (P = 0.034).The Spearman correlation coefficient with RD progression was 0.37 (The strength of the correlation between RD progression and compliance was moderate. However, the correlation between RD progression and rotational and linear acceleration was much stronger. Preoperative posturing is effective by reducing head movements rather than enforcing head positioning.Monitoring the efficacy of preoperative posturing in macula-on RD using OCT and IMU measurements shows that a new and combined application of these technologies leads to clinically relevant insights. Retinal detachment (RD) is a progressive separation of the retina from the underlying retinal pigment epithelium that occurs in 12 to 18 per 100,000 people per year.36Compliance with positioning advice has been quantified previously using gravity- and tilt-compensated sensors after macular hole surgery.15The primary aim of this study was to explore the relationship between compliance with the preoperative posturing advice and the progression of macula-on RD. The secondary objective was to evaluate whether head positioning or head motility contributes most to the progression of RD.www.trialregister.nl identifier, NTR4884). The study evaluated a small cohort that was enrolled in addition to a larger prospective trial evaluating preoperative posturing.This study was designed as an explorative cohort study with recordings of head orientation, head motility, and the distance between the RD border and fovea during preoperative posturing of patients with macula-on RD. The study was approved by the local internal review board of the Rotterdam Eye Hospital and the medical ethical committee of the Erasmus Medical Center, Rotterdam, The Netherlands  and within the range of the OCT system (estimated range was up to 10\u201312 mm from the fovea); sufficiently clear media to obtain an OCT scan; sufficient quality of the OCT scan; and OCT performed within an hour after admission of the patient to the ward. No exclusion criteria were specified. The safety border of 1250 \u03bcm from the foveola was defined by the traditional size of the fovea centralis (with a radius of approximately 750 \u03bcm) and parafovea (ring of 500 \u03bcm around the fovea) combined.19Within 1 hour after arrival on the ward, a baseline volume OCT scan  was performed, and eligibility was determined. The distance between RD border and fovea was measured according to our previously described method.Measuring eye saccades over longer periods of time is not possible without invasive measures. However, measuring head orientation and motion is possible in a noninvasive manner by using a head-mounted electronic sensor, the Shimmer3 inertial measurement unit (IMU) . This IMU is small, lightweight, commercially available, and CE-marked, which indicates conformity with several health and safety regulations within the European Economic Area. After eligibility of a patient was determined, the IMU was fixed on the forehead of the patient with hypoallergenic, waterproof, and strongly adhesive plasters.X-axis points toward the north, the Y-axis toward the west, and the Z-axis up, perpendicular to the earth's surface. To prevent gimbal lock, quaternions were used instead of Euler angles to describe the three-dimensional rotations. The quaternions were calculated using the Shimmer Matlab Instrument Driver software (Shimmer Sensing), which estimates orientation data using magnetic angular rate and gravity (MARG) filtering. MARG filtering is reported to achieve orientation accuracy levels with less than 0.8\u00b0 static error and less than 1.7\u00b0 dynamic error.19We configured the IMU to use three individual sensors: a low-noise accelerometer, a gyroscope, and a magnetometer at a 512-Hz sampling rate. The IMU was calibrated according to the north-west-up coordination system, which means that the The primary outcome parameter of the IMU was defined as the orientation deviation from the advised positioning. We considered three secondary outcome parameters: the orientation deviation from the (presumed) optimal positioning, the rotational acceleration, and the linear acceleration.To obtain the deviation from the advised positioning, we used the relative (inverse) direction of gravity measured by the IMU at each time point. At the beginning of the first posturing interval, when the patient was positioned according to the advice, we determined the reference orientation of gravity . SubsequPositioning is mostly prescribed in four categories: supine, temporal side, nasal side, and upright. This advice does not account for the distance between the fovea and the RD border or the precise location of the closest point on the RD border. For instance, positioning on the temporal side might be optimal for peripheral temporal RD, but a temporal RD that already has progressed close to the fovea might be better positioned supine to support reattachment of the retina closest to the fovea. Patients with inferior temporal RD might be better positioned with half-upright on the temporal side instead of a choice between temporal side or upright. We hypothesize that in optimal positioning the gravitation forces are directed perpendicular to detached retina that is closest to the fovea to facilitate reattachment of this part of the retina see . DetermiAccelerations around the X-, Y-, and Z-axes, both clockwise and counterclockwise, were all assumed to be equally relevant and included in the analysis. To obtain the rotational acceleration, the rotational velocity of two consecutive time points were subtracted from each other and divided by the time difference for all gyroscope axes separately. The total rotational acceleration was then defined by the root mean square of the rotational acceleration of the three axes.To obtain the residual linear acceleration, we first corrected the measured linear acceleration for gravity. The total linear acceleration was then estimated by the root mean square of the residual linear accelerations obtained with the three accelerometer axes.Because of the various durations of posturing and interruption intervals, the average of IMU parameter per interval was expected to provide the most consistent comparison to the average RD progression velocity per interval. The measured signal was corrected for the noise floor levels as seen during static test measurements and during the posturing intervals of the patient measurements.2 at increments of 250\u00b0/s2 and the linear acceleration thresholds between 0.25 and 10 m/s2 at increments of 0.25 m/s2.We additionally wanted to determine whether head movements in general should be avoided by patients or whether sudden head movements with fast accelerations in particular should be avoided to prevent RD progression. Therefore, we determined the number of rotational and linear accelerations per interval per hour above a specific threshold and calculated the correlation with RD progression. We varied the threshold levels to evaluate whether higher thresholds would result in stronger correlation coefficients than the correlation coefficients between RD progression and the noise-corrected averages of IMU parameters. We varied the rotational acceleration thresholds between 250\u00b0 and 10,000\u00b0/sU test) was used to compare RD progression and IMU parameters between posturing and interruption intervals. We expected a monotonic but possibly nonlinear relationship between RD progression and the IMU parameters. Therefore, Spearman's correlation coefficient was calculated to describe the relationship between RD progression and average IMU parameters. The correlation analysis was performed for all measured intervals as well as for the progression from baseline. For all IMU parameters, a positive correlation demonstrates an association with RD regression and a negative correlation an association with RD progression. Statistical significant differences between correlation coefficients were tested according to the methods of Meng et al.Due to the exploratory nature of this study, 16 patients with continuous measurements between admission to the ward and surgery were assumed to be sufficient to show general trends. We did not assume normally distributed data, and therefore nonparametric testing . All patients provided a written informed consent. Patients' characteristics are summarized in P = 0.003). The median RD border displacement velocity during posturing intervals was \u22121 \u03bcm/h (IQR: \u22129 to 34 \u03bcm/h) and during interruptions \u2212202 \u03bcm/h (IQR: \u2212491 to 0 \u03bcm/h), which was statistically significantly different as well (P < 0.001).A summary of the RD progression measurements is provided in 2 for rotational acceleration, and 0.8 m/s2 for linear acceleration. The difference between posturing intervals and interruptions was statistically significant for all four IMU parameters (P < 0.001).The average IMU parameters for all posturing and interruption intervals, as well as the intervals from baseline, are described in rs) between RD progression and the IMU parameters were found for rotational acceleration (rs = 0.52) and linear acceleration (rs = 0.49). The rs2 can be interpreted as a proportion of explained variance if the IMU parameters and the RD progression are presented as ranked variables. The higher this proportion, the more variance is explained by a specific variable. The rs2 was 0.13 for orientation deviation from the advised positioning, 0.13 for the orientation deviation from optimal positioning, 0.27 for the rotational acceleration, and 0.24 for the linear acceleration. This means that rotational acceleration as well as linear acceleration seems to explain twice as much of the variance of RD progression than orientation deviation from advised or optimal positioning. The correlation coefficient between RD progression and rotational acceleration was statistically significantly higher than the correlation coefficient between RD progression and compliance  for orientation deviation from optimal positioning, 0.68 (rs2 = 0.46) for rotational acceleration, and 0.72 (rs2 = 0.49) for linear acceleration. This means that the secondary IMU parameters are codependent with the primary IMU parameter (orientation deviation from advised positioning), but they are not the same.The Spearman's correlation coefficient between orientation deviation from advised positioning with the other three IMU parameters was 0.52 .The average head orientation deviation was not significantly correlated with RD progression from baseline see , row 2. P = 0.76).The correlation between the duration of follow-up and the change of RD-fovea distance from baseline to the last OCT measurement was 0.08  to minimize the amount of head and eye movements. Previous research showed that a reduction of eye movements (saccades) by double patching the eyes or suturing the eye muscles to the bulbus resulted in a reduction of subretinal fluid.6Several other factors may affect RD progression. Most importantly, we measured head movements, whereas saccades are traditionally expected to be able to overcome the forces of retinal adhesion.23There are at least four other factors that may play a role in RD progression. Firstly, the retinal adhesion strength differs between retinal locations and is especially higher at the macula. It is a common observation among surgeons that the peripheral retina detaches much more easily than does the posterior retina when creating a RD for macular rotation or retinal pigment epithelium\u2013choroid graft, suggesting a difference in adhesion.33Evaluation of the orientation deviation from optimal positioning did not reveal a stronger correlation with RD progression than did the orientation deviation from advised positioning. This suggests that the optimization of positioning would not significantly reduce RD progression. It also suggests that the role of gravity is limited, which is expected because the density difference between the retina and subretinal fluid is small.18Evaluation of the number of accelerations per interval above various thresholds did not reveal a substantially higher correlation with RD progression than did the average of IMU parameters per interval. This might indicate that relatively slow head accelerations are also able to induce RD progression, or it might be that patients did not frequently perform sudden head movements during their hospitalization and the number of fast head accelerations was too low to reveal a stronger relationship. We cannot conclude that only strong or sudden head movements should be avoided. Evaluation of the relationship between the duration of follow-up and the change of RD-fovea distance from baseline did not reveal a statistically significant relationship. As pointed out above, RD progression can be explained by other factors only than the duration of follow-up.Our method by which we measured head orientation might be used, in combination with OCT distance measurements, to evaluate the effect of delayed surgery for 1 day with preoperative posturing at home. This alternative policy might be cost saving for both clinics that aim to provide 7 days per week surgery service and clinics that hospitalize patients preoperatively. However, such a study should take into account the expected differences in characteristics and behavior between hospitalized patients and patients who are asked to stay quiet at home. IMU devices might also be used for other areas of ophthalmology where the effect of posturing regimes warrants validation, such as postoperative positioning after macular hole surgery,15Strengths of this study include the objective measurements of head orientation, head movements, and RD progression and the reasonable amount of 78 monitored intervals. Limitations include the small number of patients, the variation in RD localization and subsequent positioning advice, and the differences in follow-up duration. In addition, the patient might have touched the device causing false rotational and linear accelerations. Since this would result only in short acceleration peaks, we think that the influence on the averages and number of accelerations per interval is small.In conclusion, preoperative posturing advice should emphasize a reduction of head movements, although positioning might be beneficial to prevent RD progression as well. This study may be an important step toward an evidence-based policy for optimal preoperative posturing in patients with macula-on RD.Supplement 1Click here for additional data file.Supplement 2Click here for additional data file.", "texts": ["The aim of this study was to explore the relationship between compliance with preoperative posturing advice and progression of macula-on retinal detachment (RD) and to evaluate whether head positioning or head motility contributes most to RD progression.Sixteen patients with macula-on RD were enrolled, admitted to the ward, and instructed to posture preoperatively. The primary outcome parameter was compliance, which was defined as the average head orientation deviation from advised positioning. Secondary outcome parameters included the average rotational and linear head acceleration. The head orientation and acceleration were measured with a head-mounted inertial measurement unit (IMU). Optical coherence tomography (OCT) imaging was performed at baseline and during natural interruptions of posturing for meals and toilet visits to measure RD progression toward the fovea.P = 0.001, rs2 = 0.13) for compliance, 0.52  for rotational acceleration, and 0.49  for linear acceleration. The correlation coefficient between RD progression and rotational acceleration was statistically significantly higher than the correlation coefficient between RD progression and compliance (P = 0.034).The Spearman correlation coefficient with RD progression was 0.37 (The strength of the correlation between RD progression and compliance was moderate. However, the correlation between RD progression and rotational and linear acceleration was much stronger. Preoperative posturing is effective by reducing head movements rather than enforcing head positioning.Monitoring the efficacy of preoperative posturing in macula-on RD using OCT and IMU measurements shows that a new and combined application of these technologies leads to clinically relevant insights. Retinal detachment (RD) is a progressive separation of the retina from the underlying retinal pigment epithelium that occurs in 12 to 18 per 100,000 people per year.36Compliance with positioning advice has been quantified previously using gravity- and tilt-compensated sensors after macular hole surgery.15The primary aim of this study was to explore the relationship between compliance with the preoperative posturing advice and the progression of macula-on RD. The secondary objective was to evaluate whether head positioning or head motility contributes most to the progression of RD.www.trialregister.nl identifier, NTR4884). The study evaluated a small cohort that was enrolled in addition to a larger prospective trial evaluating preoperative posturing.This study was designed as an explorative cohort study with recordings of head orientation, head motility, and the distance between the RD border and fovea during preoperative posturing of patients with macula-on RD. The study was approved by the local internal review board of the Rotterdam Eye Hospital and the medical ethical committee of the Erasmus Medical Center, Rotterdam, The Netherlands  and within the range of the OCT system (estimated range was up to 10\u201312 mm from the fovea); sufficiently clear media to obtain an OCT scan; sufficient quality of the OCT scan; and OCT performed within an hour after admission of the patient to the ward. No exclusion criteria were specified. The safety border of 1250 \u03bcm from the foveola was defined by the traditional size of the fovea centralis (with a radius of approximately 750 \u03bcm) and parafovea (ring of 500 \u03bcm around the fovea) combined.19Within 1 hour after arrival on the ward, a baseline volume OCT scan  was performed, and eligibility was determined. The distance between RD border and fovea was measured according to our previously described method.Measuring eye saccades over longer periods of time is not possible without invasive measures. However, measuring head orientation and motion is possible in a noninvasive manner by using a head-mounted electronic sensor, the Shimmer3 inertial measurement unit (IMU) . This IMU is small, lightweight, commercially available, and CE-marked, which indicates conformity with several health and safety regulations within the European Economic Area. After eligibility of a patient was determined, the IMU was fixed on the forehead of the patient with hypoallergenic, waterproof, and strongly adhesive plasters.X-axis points toward the north, the Y-axis toward the west, and the Z-axis up, perpendicular to the earth's surface. To prevent gimbal lock, quaternions were used instead of Euler angles to describe the three-dimensional rotations. The quaternions were calculated using the Shimmer Matlab Instrument Driver software (Shimmer Sensing), which estimates orientation data using magnetic angular rate and gravity (MARG) filtering. MARG filtering is reported to achieve orientation accuracy levels with less than 0.8\u00b0 static error and less than 1.7\u00b0 dynamic error.19We configured the IMU to use three individual sensors: a low-noise accelerometer, a gyroscope, and a magnetometer at a 512-Hz sampling rate. The IMU was calibrated according to the north-west-up coordination system, which means that the The primary outcome parameter of the IMU was defined as the orientation deviation from the advised positioning. We considered three secondary outcome parameters: the orientation deviation from the (presumed) optimal positioning, the rotational acceleration, and the linear acceleration.To obtain the deviation from the advised positioning, we used the relative (inverse) direction of gravity measured by the IMU at each time point. At the beginning of the first posturing interval, when the patient was positioned according to the advice, we determined the reference orientation of gravity . SubsequPositioning is mostly prescribed in four categories: supine, temporal side, nasal side, and upright. This advice does not account for the distance between the fovea and the RD border or the precise location of the closest point on the RD border. For instance, positioning on the temporal side might be optimal for peripheral temporal RD, but a temporal RD that already has progressed close to the fovea might be better positioned supine to support reattachment of the retina closest to the fovea. Patients with inferior temporal RD might be better positioned with half-upright on the temporal side instead of a choice between temporal side or upright. We hypothesize that in optimal positioning the gravitation forces are directed perpendicular to detached retina that is closest to the fovea to facilitate reattachment of this part of the retina see . DetermiAccelerations around the X-, Y-, and Z-axes, both clockwise and counterclockwise, were all assumed to be equally relevant and included in the analysis. To obtain the rotational acceleration, the rotational velocity of two consecutive time points were subtracted from each other and divided by the time difference for all gyroscope axes separately. The total rotational acceleration was then defined by the root mean square of the rotational acceleration of the three axes.To obtain the residual linear acceleration, we first corrected the measured linear acceleration for gravity. The total linear acceleration was then estimated by the root mean square of the residual linear accelerations obtained with the three accelerometer axes.Because of the various durations of posturing and interruption intervals, the average of IMU parameter per interval was expected to provide the most consistent comparison to the average RD progression velocity per interval. The measured signal was corrected for the noise floor levels as seen during static test measurements and during the posturing intervals of the patient measurements.2 at increments of 250\u00b0/s2 and the linear acceleration thresholds between 0.25 and 10 m/s2 at increments of 0.25 m/s2.We additionally wanted to determine whether head movements in general should be avoided by patients or whether sudden head movements with fast accelerations in particular should be avoided to prevent RD progression. Therefore, we determined the number of rotational and linear accelerations per interval per hour above a specific threshold and calculated the correlation with RD progression. We varied the threshold levels to evaluate whether higher thresholds would result in stronger correlation coefficients than the correlation coefficients between RD progression and the noise-corrected averages of IMU parameters. We varied the rotational acceleration thresholds between 250\u00b0 and 10,000\u00b0/sU test) was used to compare RD progression and IMU parameters between posturing and interruption intervals. We expected a monotonic but possibly nonlinear relationship between RD progression and the IMU parameters. Therefore, Spearman's correlation coefficient was calculated to describe the relationship between RD progression and average IMU parameters. The correlation analysis was performed for all measured intervals as well as for the progression from baseline. For all IMU parameters, a positive correlation demonstrates an association with RD regression and a negative correlation an association with RD progression. Statistical significant differences between correlation coefficients were tested according to the methods of Meng et al.Due to the exploratory nature of this study, 16 patients with continuous measurements between admission to the ward and surgery were assumed to be sufficient to show general trends. We did not assume normally distributed data, and therefore nonparametric testing . All patients provided a written informed consent. Patients' characteristics are summarized in P = 0.003). The median RD border displacement velocity during posturing intervals was \u22121 \u03bcm/h (IQR: \u22129 to 34 \u03bcm/h) and during interruptions \u2212202 \u03bcm/h (IQR: \u2212491 to 0 \u03bcm/h), which was statistically significantly different as well (P < 0.001).A summary of the RD progression measurements is provided in 2 for rotational acceleration, and 0.8 m/s2 for linear acceleration. The difference between posturing intervals and interruptions was statistically significant for all four IMU parameters (P < 0.001).The average IMU parameters for all posturing and interruption intervals, as well as the intervals from baseline, are described in rs) between RD progression and the IMU parameters were found for rotational acceleration (rs = 0.52) and linear acceleration (rs = 0.49). The rs2 can be interpreted as a proportion of explained variance if the IMU parameters and the RD progression are presented as ranked variables. The higher this proportion, the more variance is explained by a specific variable. The rs2 was 0.13 for orientation deviation from the advised positioning, 0.13 for the orientation deviation from optimal positioning, 0.27 for the rotational acceleration, and 0.24 for the linear acceleration. This means that rotational acceleration as well as linear acceleration seems to explain twice as much of the variance of RD progression than orientation deviation from advised or optimal positioning. The correlation coefficient between RD progression and rotational acceleration was statistically significantly higher than the correlation coefficient between RD progression and compliance  for orientation deviation from optimal positioning, 0.68 (rs2 = 0.46) for rotational acceleration, and 0.72 (rs2 = 0.49) for linear acceleration. This means that the secondary IMU parameters are codependent with the primary IMU parameter (orientation deviation from advised positioning), but they are not the same.The Spearman's correlation coefficient between orientation deviation from advised positioning with the other three IMU parameters was 0.52 .The average head orientation deviation was not significantly correlated with RD progression from baseline see , row 2. P = 0.76).The correlation between the duration of follow-up and the change of RD-fovea distance from baseline to the last OCT measurement was 0.08  to minimize the amount of head and eye movements. Previous research showed that a reduction of eye movements (saccades) by double patching the eyes or suturing the eye muscles to the bulbus resulted in a reduction of subretinal fluid.6Several other factors may affect RD progression. Most importantly, we measured head movements, whereas saccades are traditionally expected to be able to overcome the forces of retinal adhesion.23There are at least four other factors that may play a role in RD progression. Firstly, the retinal adhesion strength differs between retinal locations and is especially higher at the macula. It is a common observation among surgeons that the peripheral retina detaches much more easily than does the posterior retina when creating a RD for macular rotation or retinal pigment epithelium\u2013choroid graft, suggesting a difference in adhesion.33Evaluation of the orientation deviation from optimal positioning did not reveal a stronger correlation with RD progression than did the orientation deviation from advised positioning. This suggests that the optimization of positioning would not significantly reduce RD progression. It also suggests that the role of gravity is limited, which is expected because the density difference between the retina and subretinal fluid is small.18Evaluation of the number of accelerations per interval above various thresholds did not reveal a substantially higher correlation with RD progression than did the average of IMU parameters per interval. This might indicate that relatively slow head accelerations are also able to induce RD progression, or it might be that patients did not frequently perform sudden head movements during their hospitalization and the number of fast head accelerations was too low to reveal a stronger relationship. We cannot conclude that only strong or sudden head movements should be avoided. Evaluation of the relationship between the duration of follow-up and the change of RD-fovea distance from baseline did not reveal a statistically significant relationship. As pointed out above, RD progression can be explained by other factors only than the duration of follow-up.Our method by which we measured head orientation might be used, in combination with OCT distance measurements, to evaluate the effect of delayed surgery for 1 day with preoperative posturing at home. This alternative policy might be cost saving for both clinics that aim to provide 7 days per week surgery service and clinics that hospitalize patients preoperatively. However, such a study should take into account the expected differences in characteristics and behavior between hospitalized patients and patients who are asked to stay quiet at home. IMU devices might also be used for other areas of ophthalmology where the effect of posturing regimes warrants validation, such as postoperative positioning after macular hole surgery,15Strengths of this study include the objective measurements of head orientation, head movements, and RD progression and the reasonable amount of 78 monitored intervals. Limitations include the small number of patients, the variation in RD localization and subsequent positioning advice, and the differences in follow-up duration. In addition, the patient might have touched the device causing false rotational and linear accelerations. Since this would result only in short acceleration peaks, we think that the influence on the averages and number of accelerations per interval is small.In conclusion, preoperative posturing advice should emphasize a reduction of head movements, although positioning might be beneficial to prevent RD progression as well. This study may be an important step toward an evidence-based policy for optimal preoperative posturing in patients with macula-on RD.Supplement 1Click here for additional data file.Supplement 2Click here for additional data file."]}
-{"representative": "With the increase of Qatar\u2019s total population, primarily due to the influx of healthy male migrant labor, worldwide attention has been focused on deaths among these migrant workers.To describe adult mortality trends in Qataris  and non-Qataris (migrants) from all causes, cardiovascular and circulatory disease, neoplasms, and injuries, 1989\u20132015.We retrieved Qatar\u2019s vital registration data by nationality, sex, age group, year, and codes of the World Health Organization\u2019s International Classification of Diseases, Ninth and Tenth Revisions. We assessed age-standardized mortality rate (ASMR) trends in Qatar\u2019s total population, in Qataris and non-Qataris using Joinpoint regression.During the study period, 26,673 deaths were recorded. In 2015, we estimated 60,716 years of life lost  in the overall population. In Qataris (both sexes) and in non-Qatari females, all-cause rate decreased significantly and steadily between 1989\u20132015. In non-Qatari males, it decreased significantly between 1998\u20132010 probably attributed to a massive influx of healthy migrants. Yearly rates were significantly lower in non-Qataris over 27 years. Reduction in Qatar\u2019s total population rates for all causes and for neoplasms can be partially attributed to the healthy migrant effect. For injuries in males, it was lower in non-Qatari. Remarkably, for falls, cause-specific ASMR in non-Qatari males decreased significantly reaching 2.6/100,000 in 2014, suggesting improved safety in the work environment. However, while young adult males in Qatar die predominantly from injuries, young adult females die from neoplasms.Our study demonstrates that premature death in young adult males and females in Qatar is predominantly due to injuries and neoplasms respectively. These identified causes of death are for a large part preventable and should be addressed appropriately to lower premature mortality among young adults in Qatar. The major contributor to Qatar\u2019s total population growth has been the influx of healthy male migrant labor  to buildParallel to the demographic challenges, Qatar is grappling with high rates of diabetes and obesity. Qatar is among the top ten countries with the highest diabetes prevalence worldwide , at 17% For assessing the impact of demographic changes, socioeconomic and healthcare system development, and health-based interventions, measuring the magnitude of deaths by population is necessary. Therefore, we evaluated trends over 27 years of all-cause mortality and cause-specific mortality for the three commonest causes of death, namely cardiovascular and circulatory disease, neoplasms, and injuries, in Qataris and non-Qataris . Additio20\u201329, 30\u201339, 40\u201349, \u226550), year (from 1989 to 2015), nationality (Qatari/non-Qatari), and codes of the World Health Organization\u2019s (WHO) International Classification of Diseases, Ninth and Tenth Revisions (ICD-9 and ICD-10) were retrieved [In order to estimate mortality rates in Qatar\u2019s total population, in Qataris and non-Qataris between 1989\u20132015, we retrieved vital registration data from the Qatar Vital Statistics Annual Bulletins of the Ministry of Development Planning and Statistics (MDPS). Grouped secondary data, which are publicly available on the Ministry\u2019s website  were useetrieved , 24. We etrieved , which aPublicly available data on Qatar\u2019s yearly population size by sex, five-year-age group (from 15 year old to over 75 year old), and nationality were retrieved from MDPS\u2019s Census, Population, Housing, and Establishments annual reports for the years 2006\u20132014 . Annual Age-standardized mortality rates  and corresponding standard errors were estimated using the direct method  and the p)-value threshold = 0.05). We provided contextual information that could explain all-cause mortality trends in Qataris and non-Qataris by reporting pertinent dates that marked Qatar\u2019s socioeconomic and healthcare system development [Estimated ASMRs and their standard errors were imported into the United States Surveillance, Epidemiology, and End Results Joinpoint Trend Analysis Software (version 4.4.0.0) . Using Jelopment , 32.In order to identify significant differences in all-cause mortality between Qataris and non-Qataris, we estimated Comparative Mortality Figures (CMFs), which correspond to the ratio of ASMR in Qataris divided by the ASMR in non-Qataris . We alsoDuring the study period, 26,673 deaths in over-20-year-old adults were recorded . Deaths in males were 2.7 times more frequent than in females . The annual average number of all-cause deaths was 1,159 deaths ranging from 632 (1989) to -2,070 (2014). In non-Qataris, annual total number of deaths increased about four-times, from 296 deaths (1989) to 1,438 deaths (2015). In Qataris, annual total number of deaths also increased but at a lower magnitude as compared to non-Qataris (from 336 deaths in1989 to 560 in 2015). In 2014, in Qatar\u2019s total population, injuries were responsible for 19.7% of deaths , followed by cardiovascular and circulatory disease 17.8% , and neoplasms 15.8% .In 2015, we estimated 60,716 YLL  in Qatar\u2019s total population . In 2014p-values<0.05). Even if ASMR decreased two-times faster in Qataris than in non-Qataris, all-cause ASMRs in Qataris were always significantly higher than in non-Qataris . However, the magnitude of the ratio decreased over time (both sexes). Thus, all-cause ASMR in Qatar\u2019s total population was always lower than in Qataris because of the mortality rates in non-Qataris, which includes mainly migrant workers. Overall, healthy worker effect seems to influence ASMR trends in Qatar\u2019s total population.Between 1989\u20132015, all-cause ASMR  significantly decreased in non-Qataris ; and in Qataris . In non-Qatari females, the decreasing trend was steady since 1989 but at a slower pace . This decrease in mortality appears to follow Qatar\u2019s gradual healthcare system and socioeconomic development. Remarkably, this steady decrease in mortality in non-Qatari females occurred while population growth in this population did not fluctuate in the same magnitude as in non-Qatari males. In non-Qatari males, all-cause ASMR trend decreased significantly between 1998\u20132010  and reached a plateau thereafter. This significant decrease in mortality appears to have occurred after massive labor migration started. Between 2005\u20132010, population growth reached a peak at 28% in males. Interestingly, within the same period the decrease in mortality in non-Qatari males was the highest . When population growth in males was below 5% in 1990\u20131995, 1995\u20132000, and 2010\u20132015, AAPCs for the same periods were not significant. The large increase in non-Qatari population within a short span of time could partially explain decreased ASMRs. Of note, ASMR is a weighted average of age-specific rates [In Qatari males and females, all-cause ASMR trends have been steadily decreasing since 1989 . However, mortality in non-Qataris males decreased significantly between 1998\u20132009 .Between 1991\u20132014, cause-specific ASMR for cardiovascular and circulatory disease was higher in Qataris than in non-Qataris (both sexes), which resulted in higher ASMRs in Qataris compared to ASMRs in Qatar\u2019s total population Tables . During For cerebrovascular disease, cause-specific ASMR was lower in non-Qataris than in Qataris until 2011 in females and males, which resulted in lower ASMRs in Qatar\u2019s total population compared to ASMRs in Qataris. Mortality in non-Qatari males decreased significantly between 1998\u20132014 (APC = -12.7%), while in Qataris it decreased significantly between 1991\u20132001 (APC = -10.8%). In females, mortality was higher in Qataris than in non-Qataris  in 2014. Mortality rates in females were higher than in males .p-value<0.05), while in Qataris (both sexes) and in non-Qatari females, decreased ASMRs were observed a decade earlier .For ischemic heart disease, cause-specific ASMR was lower in non-Qataris than in Qataris (both sexes), which resulted in lower ASMRs in Qatar\u2019s total population compared to ASMRs in Qataris. ASMRs decreased significantly in non-Qatari males since 2001 . In non-Qatari males the trend was constant until 2001 and a significant decrease in mortality was observed thereafter .For hypertensive disease, cause-specific ASMR was lower in non-Qataris than in Qataris (both sexes) between 1990\u20132014, which resulted in lower ASMRs for Qatar\u2019s total population compared to ASMRs in Qataris. Similar decreasing and significant trends were observed in Qatari females and males and in non-Qatari females . In non-Qataris females, ASMRs were constant.For neoplasms, cause-specific ASMR was lower in non-Qataris than in Qataris (both sexes), which resulted in lower ASMRs in Qatar\u2019s total population compared to ASMRs in Qataris. A significant decrease was observed in non-Qatari males and in Qataris females and males since 1991 , in 2014, ASMRs in non-Qataris and Qataris were similar at 22.5 and 23.7/100,000, respectively. These trends resulted in a constant mortality rate trend for Qatar\u2019s female population.For female breast cancer, cause-specific ASMR was lower in non-Qataris than in Qataris, which resulted in lower ASMRs in Qatar\u2019s total population compared to ASMRs in Qataris. As mortality trends were constant in non-Qataris and significantly declining in Qataris .For prostate cancer, cause-specific ASMR was lower in non-Qataris than in Qataris, which resulted in lower ASMRs in Qatar\u2019s total population compared to ASMRs in Qataris. Mortality in non-Qataris, of which the vast majority is constituted of young people, remained stable. However, in Qataris, mortality trend declined significantly since 2000 . Between 2000\u20132014, in non-Qatari females and males, mortality trends were constant; except for males between 2005\u20132010 .For injuries, cause-specific ASMR was lower in non-Qataris than in Qataris (both sexes), which resulted in lower ASMRs in Qatar\u2019s total population compared to ASMRs in Qataris. Qatari males had the highest ASMRs during the study period comparing to Qatari-females and non-Qatari males and females. Mortality decreased significantly in Qatari females and males since 2000 .For all falls, cause-specific ASMR in males was higher in non-Qataris than in Qataris, which resulted in higher ASMRs in Qatar\u2019s total population compared to ASMRs in Qataris. Deaths from falls were recorded for Qatari females only in 2005 . In non-Qatari females, deaths were recorded between 2007 and 2014; and ASMRs  ranged from 0.4 in 2014 and 2.5 in 2010 (modeled trend was constant). In Qatari males, deaths from falls have not been recorded since 2009 . In non-Qataris, mortality decreased significantly in males between 2001\u20132014 from 5.1 to 2.6/100,000 , while it was constant in non-Qatari males. In 2014, in males, ASMR was 13.4 and 53.8/100,000 in non-Qataris and Qataris, respectively. In females, it was 3.7 and 11.3/100,000 respectively.For transport injuries, cause-specific ASMR was lower in non-Qataris than in Qataris (both sexes), which resulted in lower ASMRs in Qatar\u2019s total population compared to ASMRs in Qataris. Mortality trends decreased significantly in non-Qatari females and in Qatari females and males . As reported elsewhere , 11, numThe healthy migrant effect has been described in other countries such as Australia , FinlandFor injuries, mortality in non-Qatari males and females was lower than in Qatari males during the study period. In 2014, mortality due to falls was 0.4/100,000 in females and 2.6/100,000 in males. Remarkably, mortality due to falls in non-Qatari males decreased significantly suggesting safety improvement in the work environment. Non-Qatari males\u2019 work environment seems to have improved over time. In 2010\u20132013, yearly fatal occupational rate was 1.6/100,000 in the only designated hospital for major injury treatment in Qatar , 43. ThiThe influx of migrants has enabled Qatar to address the labor shortfall in the country. This migration emphasizes the substantial levels of economic growth observed in the country in the last decades . MortaliOur study demonstrated that while young adult males in Qatar die predominantly from injuries, young adult females die from neoplasms. These identified causes of death are for a large part preventable and should be addressed appropriately to lower premature mortality among young adults in Qatar. In 2013, a law was enacted to ensure the implementation of a mandatory health insurance system of basic health services to all residents of Qatar . As treaRegarding Qatari citizens, the access to free healthcare, housing grants, and subsidized education that accompanied the socioeconomic development of the country  has likeThe strength of our study is that we emphasize demographic specificities in Qatar that should be taken into consideration when developing, implementing, and monitoring public health programs. Policy makers may use the estimated mortality rates and be able to distinguish between nationals (Qataris) and migrants (non-Qataris) when developing strategies to address premature mortality causes. Our analysis is relatively exhaustive unlike previous reports like GBD 2015 , which dThe use of these secondary mortality data has several limitations such as missing data for several years and causes of death. Data validity is also difficult to assess because all data are retrieved from the same source (MDPS) . NeverthQatar\u2019s overall mortality trends appear to be partially attributed to the healthy migrant effect, as migrants have lower mortality rates. Nevertheless, Qatar\u2019s socioeconomic development does also appear to drive mortality decline in both Qataris  and non-Qataris (migrants). Yet, premature mortality remains and might be addressed by scaling-up screening programs and encouraging healthy lifestyle and road safety.S1 FigData source: MDPS\u2019s Census, Population, Housing, and Establishments annual report for the year 2014 .(TIF)Click here for additional data file.S1 Table(XLSX)Click here for additional data file.S2 Table(XLSX)Click here for additional data file.", "texts": ["With the increase of Qatar\u2019s total population, primarily due to the influx of healthy male migrant labor, worldwide attention has been focused on deaths among these migrant workers.To describe adult mortality trends in Qataris  and non-Qataris (migrants) from all causes, cardiovascular and circulatory disease, neoplasms, and injuries, 1989\u20132015.We retrieved Qatar\u2019s vital registration data by nationality, sex, age group, year, and codes of the World Health Organization\u2019s International Classification of Diseases, Ninth and Tenth Revisions. We assessed age-standardized mortality rate (ASMR) trends in Qatar\u2019s total population, in Qataris and non-Qataris using Joinpoint regression.During the study period, 26,673 deaths were recorded. In 2015, we estimated 60,716 years of life lost  in the overall population. In Qataris (both sexes) and in non-Qatari females, all-cause rate decreased significantly and steadily between 1989\u20132015. In non-Qatari males, it decreased significantly between 1998\u20132010 probably attributed to a massive influx of healthy migrants. Yearly rates were significantly lower in non-Qataris over 27 years. Reduction in Qatar\u2019s total population rates for all causes and for neoplasms can be partially attributed to the healthy migrant effect. For injuries in males, it was lower in non-Qatari. Remarkably, for falls, cause-specific ASMR in non-Qatari males decreased significantly reaching 2.6/100,000 in 2014, suggesting improved safety in the work environment. However, while young adult males in Qatar die predominantly from injuries, young adult females die from neoplasms.Our study demonstrates that premature death in young adult males and females in Qatar is predominantly due to injuries and neoplasms respectively. These identified causes of death are for a large part preventable and should be addressed appropriately to lower premature mortality among young adults in Qatar. The major contributor to Qatar\u2019s total population growth has been the influx of healthy male migrant labor  to buildParallel to the demographic challenges, Qatar is grappling with high rates of diabetes and obesity. Qatar is among the top ten countries with the highest diabetes prevalence worldwide , at 17% For assessing the impact of demographic changes, socioeconomic and healthcare system development, and health-based interventions, measuring the magnitude of deaths by population is necessary. Therefore, we evaluated trends over 27 years of all-cause mortality and cause-specific mortality for the three commonest causes of death, namely cardiovascular and circulatory disease, neoplasms, and injuries, in Qataris and non-Qataris . Additio20\u201329, 30\u201339, 40\u201349, \u226550), year (from 1989 to 2015), nationality (Qatari/non-Qatari), and codes of the World Health Organization\u2019s (WHO) International Classification of Diseases, Ninth and Tenth Revisions (ICD-9 and ICD-10) were retrieved [In order to estimate mortality rates in Qatar\u2019s total population, in Qataris and non-Qataris between 1989\u20132015, we retrieved vital registration data from the Qatar Vital Statistics Annual Bulletins of the Ministry of Development Planning and Statistics (MDPS). Grouped secondary data, which are publicly available on the Ministry\u2019s website  were useetrieved , 24. We etrieved , which aPublicly available data on Qatar\u2019s yearly population size by sex, five-year-age group (from 15 year old to over 75 year old), and nationality were retrieved from MDPS\u2019s Census, Population, Housing, and Establishments annual reports for the years 2006\u20132014 . Annual Age-standardized mortality rates  and corresponding standard errors were estimated using the direct method  and the p)-value threshold = 0.05). We provided contextual information that could explain all-cause mortality trends in Qataris and non-Qataris by reporting pertinent dates that marked Qatar\u2019s socioeconomic and healthcare system development [Estimated ASMRs and their standard errors were imported into the United States Surveillance, Epidemiology, and End Results Joinpoint Trend Analysis Software (version 4.4.0.0) . Using Jelopment , 32.In order to identify significant differences in all-cause mortality between Qataris and non-Qataris, we estimated Comparative Mortality Figures (CMFs), which correspond to the ratio of ASMR in Qataris divided by the ASMR in non-Qataris . We alsoDuring the study period, 26,673 deaths in over-20-year-old adults were recorded . Deaths in males were 2.7 times more frequent than in females . The annual average number of all-cause deaths was 1,159 deaths ranging from 632 (1989) to -2,070 (2014). In non-Qataris, annual total number of deaths increased about four-times, from 296 deaths (1989) to 1,438 deaths (2015). In Qataris, annual total number of deaths also increased but at a lower magnitude as compared to non-Qataris (from 336 deaths in1989 to 560 in 2015). In 2014, in Qatar\u2019s total population, injuries were responsible for 19.7% of deaths , followed by cardiovascular and circulatory disease 17.8% , and neoplasms 15.8% .In 2015, we estimated 60,716 YLL  in Qatar\u2019s total population . In 2014p-values<0.05). Even if ASMR decreased two-times faster in Qataris than in non-Qataris, all-cause ASMRs in Qataris were always significantly higher than in non-Qataris . However, the magnitude of the ratio decreased over time (both sexes). Thus, all-cause ASMR in Qatar\u2019s total population was always lower than in Qataris because of the mortality rates in non-Qataris, which includes mainly migrant workers. Overall, healthy worker effect seems to influence ASMR trends in Qatar\u2019s total population.Between 1989\u20132015, all-cause ASMR  significantly decreased in non-Qataris ; and in Qataris . In non-Qatari females, the decreasing trend was steady since 1989 but at a slower pace . This decrease in mortality appears to follow Qatar\u2019s gradual healthcare system and socioeconomic development. Remarkably, this steady decrease in mortality in non-Qatari females occurred while population growth in this population did not fluctuate in the same magnitude as in non-Qatari males. In non-Qatari males, all-cause ASMR trend decreased significantly between 1998\u20132010  and reached a plateau thereafter. This significant decrease in mortality appears to have occurred after massive labor migration started. Between 2005\u20132010, population growth reached a peak at 28% in males. Interestingly, within the same period the decrease in mortality in non-Qatari males was the highest . When population growth in males was below 5% in 1990\u20131995, 1995\u20132000, and 2010\u20132015, AAPCs for the same periods were not significant. The large increase in non-Qatari population within a short span of time could partially explain decreased ASMRs. Of note, ASMR is a weighted average of age-specific rates [In Qatari males and females, all-cause ASMR trends have been steadily decreasing since 1989 . However, mortality in non-Qataris males decreased significantly between 1998\u20132009 .Between 1991\u20132014, cause-specific ASMR for cardiovascular and circulatory disease was higher in Qataris than in non-Qataris (both sexes), which resulted in higher ASMRs in Qataris compared to ASMRs in Qatar\u2019s total population Tables . During For cerebrovascular disease, cause-specific ASMR was lower in non-Qataris than in Qataris until 2011 in females and males, which resulted in lower ASMRs in Qatar\u2019s total population compared to ASMRs in Qataris. Mortality in non-Qatari males decreased significantly between 1998\u20132014 (APC = -12.7%), while in Qataris it decreased significantly between 1991\u20132001 (APC = -10.8%). In females, mortality was higher in Qataris than in non-Qataris  in 2014. Mortality rates in females were higher than in males .p-value<0.05), while in Qataris (both sexes) and in non-Qatari females, decreased ASMRs were observed a decade earlier .For ischemic heart disease, cause-specific ASMR was lower in non-Qataris than in Qataris (both sexes), which resulted in lower ASMRs in Qatar\u2019s total population compared to ASMRs in Qataris. ASMRs decreased significantly in non-Qatari males since 2001 . In non-Qatari males the trend was constant until 2001 and a significant decrease in mortality was observed thereafter .For hypertensive disease, cause-specific ASMR was lower in non-Qataris than in Qataris (both sexes) between 1990\u20132014, which resulted in lower ASMRs for Qatar\u2019s total population compared to ASMRs in Qataris. Similar decreasing and significant trends were observed in Qatari females and males and in non-Qatari females . In non-Qataris females, ASMRs were constant.For neoplasms, cause-specific ASMR was lower in non-Qataris than in Qataris (both sexes), which resulted in lower ASMRs in Qatar\u2019s total population compared to ASMRs in Qataris. A significant decrease was observed in non-Qatari males and in Qataris females and males since 1991 , in 2014, ASMRs in non-Qataris and Qataris were similar at 22.5 and 23.7/100,000, respectively. These trends resulted in a constant mortality rate trend for Qatar\u2019s female population.For female breast cancer, cause-specific ASMR was lower in non-Qataris than in Qataris, which resulted in lower ASMRs in Qatar\u2019s total population compared to ASMRs in Qataris. As mortality trends were constant in non-Qataris and significantly declining in Qataris .For prostate cancer, cause-specific ASMR was lower in non-Qataris than in Qataris, which resulted in lower ASMRs in Qatar\u2019s total population compared to ASMRs in Qataris. Mortality in non-Qataris, of which the vast majority is constituted of young people, remained stable. However, in Qataris, mortality trend declined significantly since 2000 . Between 2000\u20132014, in non-Qatari females and males, mortality trends were constant; except for males between 2005\u20132010 .For injuries, cause-specific ASMR was lower in non-Qataris than in Qataris (both sexes), which resulted in lower ASMRs in Qatar\u2019s total population compared to ASMRs in Qataris. Qatari males had the highest ASMRs during the study period comparing to Qatari-females and non-Qatari males and females. Mortality decreased significantly in Qatari females and males since 2000 .For all falls, cause-specific ASMR in males was higher in non-Qataris than in Qataris, which resulted in higher ASMRs in Qatar\u2019s total population compared to ASMRs in Qataris. Deaths from falls were recorded for Qatari females only in 2005 . In non-Qatari females, deaths were recorded between 2007 and 2014; and ASMRs  ranged from 0.4 in 2014 and 2.5 in 2010 (modeled trend was constant). In Qatari males, deaths from falls have not been recorded since 2009 . In non-Qataris, mortality decreased significantly in males between 2001\u20132014 from 5.1 to 2.6/100,000 , while it was constant in non-Qatari males. In 2014, in males, ASMR was 13.4 and 53.8/100,000 in non-Qataris and Qataris, respectively. In females, it was 3.7 and 11.3/100,000 respectively.For transport injuries, cause-specific ASMR was lower in non-Qataris than in Qataris (both sexes), which resulted in lower ASMRs in Qatar\u2019s total population compared to ASMRs in Qataris. Mortality trends decreased significantly in non-Qatari females and in Qatari females and males . As reported elsewhere , 11, numThe healthy migrant effect has been described in other countries such as Australia , FinlandFor injuries, mortality in non-Qatari males and females was lower than in Qatari males during the study period. In 2014, mortality due to falls was 0.4/100,000 in females and 2.6/100,000 in males. Remarkably, mortality due to falls in non-Qatari males decreased significantly suggesting safety improvement in the work environment. Non-Qatari males\u2019 work environment seems to have improved over time. In 2010\u20132013, yearly fatal occupational rate was 1.6/100,000 in the only designated hospital for major injury treatment in Qatar , 43. ThiThe influx of migrants has enabled Qatar to address the labor shortfall in the country. This migration emphasizes the substantial levels of economic growth observed in the country in the last decades . MortaliOur study demonstrated that while young adult males in Qatar die predominantly from injuries, young adult females die from neoplasms. These identified causes of death are for a large part preventable and should be addressed appropriately to lower premature mortality among young adults in Qatar. In 2013, a law was enacted to ensure the implementation of a mandatory health insurance system of basic health services to all residents of Qatar . As treaRegarding Qatari citizens, the access to free healthcare, housing grants, and subsidized education that accompanied the socioeconomic development of the country  has likeThe strength of our study is that we emphasize demographic specificities in Qatar that should be taken into consideration when developing, implementing, and monitoring public health programs. Policy makers may use the estimated mortality rates and be able to distinguish between nationals (Qataris) and migrants (non-Qataris) when developing strategies to address premature mortality causes. Our analysis is relatively exhaustive unlike previous reports like GBD 2015 , which dThe use of these secondary mortality data has several limitations such as missing data for several years and causes of death. Data validity is also difficult to assess because all data are retrieved from the same source (MDPS) . NeverthQatar\u2019s overall mortality trends appear to be partially attributed to the healthy migrant effect, as migrants have lower mortality rates. Nevertheless, Qatar\u2019s socioeconomic development does also appear to drive mortality decline in both Qataris  and non-Qataris (migrants). Yet, premature mortality remains and might be addressed by scaling-up screening programs and encouraging healthy lifestyle and road safety.S1 FigData source: MDPS\u2019s Census, Population, Housing, and Establishments annual report for the year 2014 .(TIF)Click here for additional data file.S1 Table(XLSX)Click here for additional data file.S2 Table(XLSX)Click here for additional data file."]}
-{"representative": "Sex differences in behavioral and neural characteristics can be caused by cultural influences but also by sex-based differences in neurophysiological and sensorimotor features. Since signal-response systems influence decision-making, cooperative and collaborative behaviors, the anatomical or physiological bases for any sex-based difference in sensory mechanisms are important to explore. Here, we use uniform scaling and nonparametric representations of the human cochlea, the main organ of hearing that imprints its adult-like morphology within the petrosal bone from birth. We observe a sex-differentiated torsion along the 3D cochlear curve in samples of 94 adults and 22 juvenile skeletons from cross-cultural contexts. The cochlear sexual dimorphism measured in our study allows sex assessment from the human skeleton with a mean accuracy ranging from 0.91 to 0.93 throughout life. We conclude that the human cochlea is sex-typed from an early post-natal age. This, for the first time, allows nondestructive sex determination of juveniles\u2019 skeletal remains in which the biomolecules are too degraded for study but in which the petrosal is preserved, one of the most common bone within archaeological assemblages. Our observed sex-typed cochlear shape from birth is likely associated with complex evolutionary processes in modern humans for reasons not yet fully understood. Therefore, complex evolutionary processes likely fine-tuned sex-differentiated neurophysiological and sensorimotor features involved in signaling among humans6. For instance, the human voice and hearing sensitivity are known as secondary sexual features10 but with yet unknown possible translations into the morphology of the main organ of hearing, the cochlea. The anatomical basis for sex-based differences in human hearing are therefore important to explore for any biologist and behaviorist interested to track its evolution in the fossil record and, in particular, the origin of the human uniquely \u201creceiver-centered\u201d hearing system that tailors speech content to needs of listeners12. Here, we investigated the shape in three dimensions (3D) of the human cochlea housed in a spiral-shaped cavity within the petrosal part of the temporal. Indeed, from birth, the cochlea is the organ that makes a more crucial contribution than the middle ear in setting the hearing range13. The cochlea also imprints details of its overall adult-like structure within the petrosal, the hardest and most dense bone in the mammal body that is most often preserved in fossil assemblages. Since the inner ear is not notably influenced by postnatal growth and development15, both juveniles and adults can be sampled and compared directly. We used a total of 94 X-ray medical computed-tomographies (CTs) representing adult individuals of African and European descent sampled in France and South Africa. Additional cochlear data were also taken from micro-CTs of 22 dry skulls representing juveniles ranging in age from birth to 10 years .Signaling within a species influences decision-making, maximizes cooperative  and collaborative  behaviors involved in sexual or other forms of social selection18. This was likely caused by the fact that none of these studies18 attempted to measure the allometric effect of the human sex-differentiated body mass on cochlear features. Moreover, previous analyses of cochlear variations among human populations did not filter out the scale and rotational effects to investigate potential differences in pure shape, as defined in detail by Kendall (1984) in his \u201ctheory of shape\u201d19. All previously proposed approaches to cochlear morphology used finite-dimensional spaces represented either by a vector of features21 or parametric functions  based on angles and lengths22, leading to strong restrictions when performing statistical studies. As a first step, in order to overcome the drawbacks of the previously proposed approaches of cochlear morphology, we used a uniform scaling, a nonlinear registration and a statistical framework with a nonparametric representation of the 3D cochlear curve. As a second step, we further tested the applicability of our results for sex determination by measuring the accuracy of a method based on our observed sex-differentiated cochlear shapes. Indeed, sex determination from the human juvenile skeleton is an absolute prerequisite in most forensic, bioarchaeological and palaeoanthropological contexts. In the absence of sufficient biomolecule (DNA or peptides) survival, especially when fossil specimens are too old or degraded, this task is cumbersome because of the low degree of prepubertal skeletal sexual dimorphism among humans23, a limiting factor for successful sex determination. In forensic medicine, a minimal and arbitrary value of 0.95 is usually expected24 for accuracy . While some morphological methods show a relatively high accuracy of sex determination on adult skeletons25, this is not the case for the many methods that have been proposed for application to juvenile skeletons, especially for females28. Although some slight sexual dimorphism has been observed from an early post-natal age among humans30, there is still an important uncertainty about the age at which the human skeleton  is quantifiably dimorphic. It is therefore well established that the juvenile skeleton cannot be sexed with any degree of accuracy from morphological observations alone32 without sex-typing from DNA33 or from peptides34. Indeed, any method for sex determination from the juvenile skeleton should be not only based on the description of purported sex-differentiated skeletal features but should also provide repeatable accuracy.Previous studies investigated human sexual dimorphism in cochlear size and gave contradictory results35. We then reduced the dimensionality of the 3D cochlear shape variables through unsupervised learning (clustering) and principal component analysis on the tangent space of shapes  (Methods). We observed a clear separation between the curves representing adult males and females along the first Principal component (PC1) only, independently of the country of origin (France or South Africa) or the continent of origin (Europe or Africa)  representing adult individuals and collected in France  and South Africa . We first tested the presence of sexual dimorphism in the 3D cochlear shapes in this sample of 94 adults by modeling mathematically the 3D cochlear shape by an open curve located along its outer periphery38, we computed the adult female and male Fr\u00e9chet means for the observed cochlear curves sampled in this study  along the Fr\u00e9chet means  locations along the normalized cochlear spiral curve, the most significant differences in torsion between the female and male Fr\u00e9chet means were located between the 8th and 10th deciles and the highest sexual dimorphism appeared between the 8th and 9th deciles  for training while the remaining individuals (n\u2009=\u200954) were retained for sex assessment. In each trial, we computed the female and male Fr\u00e9chet means. We learned the regression model from the training sample. We then applied it for sex assessment in the test sample. Overall, we obtained an accuracy of 0.93. When we considered the 20 trials of randomly selected text samples, the reliability ranged from 1 to 0.96  for males, and from 1 to 0.66  for females.Finally, in a fourth step, in order to further test our method and determine its applicability to juveniles, we carried out the sex determination of a new sample comprising 22 juvenile skeletons of known sex  ranging in age from birth to 10 years  that optimizes the deformation (transformation from one to another). We also visualize the shape means and covariances enabling a full statistical analysis. We observe that sex is the most dominant source of variation in 3D cochlear shape even when we consider separately each adult sample subset   and for which sex-typing from DNA or from peptides is not (yet) possible. In contrast, the possible absence of sex-typed cochlear shape in other species of great apes would suggest that social structure, mating systems and communication in these species did not affect the morphology of this organ during evolution. Moreover, in the absence of pre-existing knowledge , yet unknown patterns of variation in cochlear shapes within fossil hominin species could be still investigated. In this case, unsupervised learning techniques could use cochlear shapes directly measured in fossil hominin samples for sex assessment of particular specimens.Our approach investigates for the first time 3D cochlear curves directly by their real  shapes with two important advantages over previous methodsca) Fig.\u00a0. Therefo30. Distinct parts of the human skeleton, especially the cranium, not only display differential degrees of sexual dimorphism at a given stage of growth and development, but also independent growth patterns in size and shape that may also vary with sex39. Little is known about the potential sexual dimorphism of the morphology of the human hearing system. Therefore, we focused our attention on the cochlea because it represents the only sensory system organ that imprints details of its overall adult-like structure within bone by term birth15. It is better amenable to evolutionary studies of communication systems for three main reasons. First, this organ acts as a frequency analyzer of incoming sounds into high and low frequencies along its spiral canal from basal to apical locations respectively40. Second, extensive studies in placental mammals (including primates) demonstrate the possibility to estimate hearing capacities for gross dimensions and shape of the cochlear cavity within bone41. Finally, the cochlear overall structure is also accessible in juvenile and adult fossil hominins42. Given the sexual differences in the human fundamental and resonance frequencies8, the unique human sexual dimorphism caused by a male disproportionate glottal-size43 , it was important to investigate whether these secondary sexual features translated into the morphology of the cochlea. Little emphasis has been laid on human sexually selected communication systems, their relationships with signal reliability (\u201chonesty\u201d) and sociocultural behaviors, particularly on how women and men perceive others in gendered societies through signals emitted to represent the sender\u2019s characteristics46. In non-human primates, male vocal signals mediate mate choice48 and voice pitch is perceived as an indicator of mate quality49 while vocal attractiveness is correlated with both body and facial attractiveness in humans51. In multilingual and cross-cultural contexts, women find men with a more masculine voice more attractive49. Our results may suggest that sexual selection has played an as yet unrealized role in the evolution of a sex-differentiated human hearing system from birth.The ontogeny of the human skeletal sexual dimorphism in size, structure and shape is still the subject of ongoing debate52 and structure-function relationships within the cochlea should be considered with caution. When compared to other extant and extinct apes, humans have a longer cochlea than expected for their body mass, a proxy indicating a major auditory change that likely occurred in early representatives of the genus Homo approximately 2 million years ago20. This finding is consistent with the unique human sensitivity at low-frequencies53. If we posit a sender-receiver co-evolution, the hearing organ may reveal important evolutionary trends in the human sound communication system, including speech. Should our proposed evidence for a sex-differentiated cochlea among humans be associated with neurobiological and social underpinnings of our unique sexual dimorphism in the production and the reception of sounds, it would facilitate the understanding of key features of human communication systems.The differences highlighted in our study may induce sex-based hearing properties. However, cochlear mechanics in humans are still debatedOur sampling strategy aimed to investigate potential differences in 3D cochlear shapes caused by (i) sex, (ii) country of sampling (France or South Africa) and (iii) continent of origin (African and European descent) for the sample from South Africa only. For both samples (France and South Africa), all the patients were adults  and their identity was made anonymous to remain strictly confidential. Given the legal frameworks relating to medical data protection issues in France and in South Africa, no information about \u201cethnicity\u201d was available for either samples. \u201cEthnicity\u201d is a self-ascribed category by which individuals seek to assert their identity. It is here considered as highly imprecise, inconsistent and defined differently in different places and at different times. However, in South Africa, the public and private registrations require South Africans to indicate their \u201crace\u201d  by ticking one of four boxes . Since this information was available, we could consider the \u201ccontinent of origin\u201d (either Europe for \u201cWhites\u201d or Africa for \u201cBlacks\u201d) as a third additional stratification variable (in addition to sex and country of sampling) for the sample from South Africa only . We nevertheless considered this information with caution since it was self-ascribed by the patient. Moreover, the language(s) spoken by the patients were not known because the medical data were collected retrospectively. However, the sample from South Africa was collected from the Steve Biko Academic Hospital in Pretoria by one of us (AO), one of its faculty members at the time of sampling. This hospital is a public health and training institution that provides tertiary healthcare to the multicultural population living in Pretoria. It is therefore representative of the pattern of diverse linguistic groupings in this city. Indeed, the official languages in South Africa include English and Afrikaans (derived from Dutch) and nine Southern Bantu languages; Zulu being the most spoken as a first language, followed by Xhosa. Afrikaans and English are respectively the third and fourth most common first language in South Africa. South Africa, children usually learn in their mother-tongue at school for the first three years (a Southern Bantu language more than 60% of children). They then switch to either English or Afrikaans and continue with that language for the rest of their schooling career.https://www.cnil.fr/sites/default/files/atoms/files/mr-003.pdf). For this study, we complied with the reference methodology MR-003. In South Africa, we obtained ethical clearance in 2017 from the Research Ethics committee of the Faculty of Health Sciences, University of Pretoria. Ethics Reference No: 465/2017.All the steps of the present study were performed in accordance with relevant guidelines and regulations. No data used in this study involved experimentation, intervention, risk or constraint added by the research. For both samples (France and South Africa), the information regarding sex and continent of origin was tabulated and used for statistical purposes only. Our research was non-interventional and was based on anonymous medical data collected retrospectively. In France, the processing of personal data in the healthcare sector for research must be authorized by the National Commission of Informatics and Civil Liberties (CNIL). Moreover, since our data were only digital, anonymized and collected retrospectively, the approval of the committee for the protection of persons (a French ethics committee) was not necessary. In order to simplify the authorization procedure, the CNIL has adopted the reference methodology MR-003 for data collections of healthrelated data for non-interventional research purposes , and the Steve Biko Academic Hospital . For the sample from France, the CT scans were performed between 2012 and 2014, mainly to visualize the maxillary sinuses. For the sample from South Africa, the CT scans were performed in 2016. The pixel size ranged from 0.46 to 0.52\u2009mm with a maximum slice thickness of 2\u2009mm.Institut d\u2019Anatomie Normale et Pathologique \u00bb of the University of Strasbourg. These skeletons correspond to individuals of known sex and age at death  and G Schwalbe (1844\u20131916) before 191854 (Rampont 1994). We obtained permissions to access these skeletons that have already been used in several published studies16. The micro-ct scans (pixel size of 0.041\u2009mm) were obtained from the XtremeCT  system at the Institut de M\u00e9decine et de Physiologie Spatiales, Toulouse, France (http://www.medes.fr/).The juvenile sample is represented by micro-ct scans of crania curated in the \u00ab www.vsg3d.com/avizo) for the segmentation and the 3D reconstruction of the air-filled cochlea. We decided arbitrarily to only use the left cochlea and we assumed that sexual dimorphism also occurred on the right side. We used a threshold of 550\u2013650 Hounsfield Units to extract the bone structures and for further reconstructions. The cochlear size and shape were modelled following a method previously used in Braga et al.20 by a series of landmarks placed at small intervals along the outer periphery of the cochlea, between the apex and the point marking the origin of the basal turn (where there is a saddle between the cochlear part and the vestibule) very close to the inferior margin of the round window. We subsequently analyzed the cochlear 3D shape by imposing appropriate geometric invariances including rigid motions, uniform scaling, and re-parametrization. Here, we point out that there is a difference between methods that perform registration based on features vectors and those that perform intrinsic statistical shape analysis. For both registration methods, the main goal is to establish correspondences between pairs of observations. Comparisons in a Euclidean space for methods based on features vectors lead to statistical analyses where the template is either selected as a predetermined observation from the sample, or constructed using Euclidean averages. In this case, a major drawback consists in ignoring the intrinsic complexity and nonlinearity caused by the structure of the data. The aim of the intrinsic shape analysis conducted in our study was to (i) achieve accurate registration with uniform scaling and correspondences between shapes, (ii) focus on the representation of the shape, (iii) analyze shape on a nonlinear manifold. Thus, the objectives of such intrinsic shape analysis encompassed correspondence-based registration methods while simultaneously integrating the tools for statistical analysis into a nonlinear registration framework.We first imported the CT scans into the Avizo software package  from the 94 adult cochlear curves sampled in this study. We evaluated the classification performance depending on the average estimates. We repeated these experiments 20 times to avoid a biased sampling (and we reported the mean and the standard deviation of these repeated experiments). In the Supplementary Figure Fig.\u00a0, we giveThe dimensionality reduction of the population shape variables through tangent principal component analysis (TPCA) allowed local geometric shape analysis to characterize infinitesimal changes along the cochlear curve, but also highlighted global changes in shape covariates using the dominant modes of variation. The key advantage of this approach was that it allowed the use of 3D cochlear shape as a geometric phenotype in more sophisticated multivariate analyses. While the choice of TPCA for representing the tangent space was made for computational convenience, it is important to note that PCA yields a basis that maximizes the feature variance in the sample along each projection. The study of shape variance shows discriminatory rules that help in classifying groups. Additionally, even if the 3D shape analysis was performed locally on the curves, the principal projections captured global shape properties in the data, and hence helped to interpret appropriately the variability in 3D cochlear shapes. The application of our analysis to samples of 3D shapes demonstrated both global and local effects of sex for 3D cochlear shape variation.37 was then used to capture the characteristic of the 3D cochlear curves for a given sample. It was also used as a common reference template for registering the individual shapes to perform a group analysis. Instead of being a subject-specific template, the Fr\u00e9chet mean represents a statistical template that minimizes the shape variance. The main advantage of this approach is that it also allowed us to explore the covariance structure of the 3D cochlear shapes in an intrinsic manner. All the computations were made using programs written in C/C++ and Matlab 2016a. We used a regression model on the shape space. It is known that these models depend on unknown re-parametrization functions (or domain deformations)55 which remain a challenging task. For instance, in a regression case where the shape is available as a finite number of observed data, we are interested in studying their re-parametrizations for describing the underlying shape of any newly observed input. For shape regression, each of the observed shapes comes with its own reparametrization. We were interested in computing the Fr\u00e9chet mean of re-parametrization and in learning a Gaussian process on the space of cumulative distributions as a subspace of the unit sphere. Furthermore, we used a Bayesian inference for tuning the regression model, one among the most effective existing solutions particularly for regression and classification of shapes.The Fr\u00e9chet mean Example of misclassified males and females during one trial.", "texts": ["Sex differences in behavioral and neural characteristics can be caused by cultural influences but also by sex-based differences in neurophysiological and sensorimotor features. Since signal-response systems influence decision-making, cooperative and collaborative behaviors, the anatomical or physiological bases for any sex-based difference in sensory mechanisms are important to explore. Here, we use uniform scaling and nonparametric representations of the human cochlea, the main organ of hearing that imprints its adult-like morphology within the petrosal bone from birth. We observe a sex-differentiated torsion along the 3D cochlear curve in samples of 94 adults and 22 juvenile skeletons from cross-cultural contexts. The cochlear sexual dimorphism measured in our study allows sex assessment from the human skeleton with a mean accuracy ranging from 0.91 to 0.93 throughout life. We conclude that the human cochlea is sex-typed from an early post-natal age. This, for the first time, allows nondestructive sex determination of juveniles\u2019 skeletal remains in which the biomolecules are too degraded for study but in which the petrosal is preserved, one of the most common bone within archaeological assemblages. Our observed sex-typed cochlear shape from birth is likely associated with complex evolutionary processes in modern humans for reasons not yet fully understood. Therefore, complex evolutionary processes likely fine-tuned sex-differentiated neurophysiological and sensorimotor features involved in signaling among humans6. For instance, the human voice and hearing sensitivity are known as secondary sexual features10 but with yet unknown possible translations into the morphology of the main organ of hearing, the cochlea. The anatomical basis for sex-based differences in human hearing are therefore important to explore for any biologist and behaviorist interested to track its evolution in the fossil record and, in particular, the origin of the human uniquely \u201creceiver-centered\u201d hearing system that tailors speech content to needs of listeners12. Here, we investigated the shape in three dimensions (3D) of the human cochlea housed in a spiral-shaped cavity within the petrosal part of the temporal. Indeed, from birth, the cochlea is the organ that makes a more crucial contribution than the middle ear in setting the hearing range13. The cochlea also imprints details of its overall adult-like structure within the petrosal, the hardest and most dense bone in the mammal body that is most often preserved in fossil assemblages. Since the inner ear is not notably influenced by postnatal growth and development15, both juveniles and adults can be sampled and compared directly. We used a total of 94 X-ray medical computed-tomographies (CTs) representing adult individuals of African and European descent sampled in France and South Africa. Additional cochlear data were also taken from micro-CTs of 22 dry skulls representing juveniles ranging in age from birth to 10 years .Signaling within a species influences decision-making, maximizes cooperative  and collaborative  behaviors involved in sexual or other forms of social selection18. This was likely caused by the fact that none of these studies18 attempted to measure the allometric effect of the human sex-differentiated body mass on cochlear features. Moreover, previous analyses of cochlear variations among human populations did not filter out the scale and rotational effects to investigate potential differences in pure shape, as defined in detail by Kendall (1984) in his \u201ctheory of shape\u201d19. All previously proposed approaches to cochlear morphology used finite-dimensional spaces represented either by a vector of features21 or parametric functions  based on angles and lengths22, leading to strong restrictions when performing statistical studies. As a first step, in order to overcome the drawbacks of the previously proposed approaches of cochlear morphology, we used a uniform scaling, a nonlinear registration and a statistical framework with a nonparametric representation of the 3D cochlear curve. As a second step, we further tested the applicability of our results for sex determination by measuring the accuracy of a method based on our observed sex-differentiated cochlear shapes. Indeed, sex determination from the human juvenile skeleton is an absolute prerequisite in most forensic, bioarchaeological and palaeoanthropological contexts. In the absence of sufficient biomolecule (DNA or peptides) survival, especially when fossil specimens are too old or degraded, this task is cumbersome because of the low degree of prepubertal skeletal sexual dimorphism among humans23, a limiting factor for successful sex determination. In forensic medicine, a minimal and arbitrary value of 0.95 is usually expected24 for accuracy . While some morphological methods show a relatively high accuracy of sex determination on adult skeletons25, this is not the case for the many methods that have been proposed for application to juvenile skeletons, especially for females28. Although some slight sexual dimorphism has been observed from an early post-natal age among humans30, there is still an important uncertainty about the age at which the human skeleton  is quantifiably dimorphic. It is therefore well established that the juvenile skeleton cannot be sexed with any degree of accuracy from morphological observations alone32 without sex-typing from DNA33 or from peptides34. Indeed, any method for sex determination from the juvenile skeleton should be not only based on the description of purported sex-differentiated skeletal features but should also provide repeatable accuracy.Previous studies investigated human sexual dimorphism in cochlear size and gave contradictory results35. We then reduced the dimensionality of the 3D cochlear shape variables through unsupervised learning (clustering) and principal component analysis on the tangent space of shapes  (Methods). We observed a clear separation between the curves representing adult males and females along the first Principal component (PC1) only, independently of the country of origin (France or South Africa) or the continent of origin (Europe or Africa)  representing adult individuals and collected in France  and South Africa . We first tested the presence of sexual dimorphism in the 3D cochlear shapes in this sample of 94 adults by modeling mathematically the 3D cochlear shape by an open curve located along its outer periphery38, we computed the adult female and male Fr\u00e9chet means for the observed cochlear curves sampled in this study  along the Fr\u00e9chet means  locations along the normalized cochlear spiral curve, the most significant differences in torsion between the female and male Fr\u00e9chet means were located between the 8th and 10th deciles and the highest sexual dimorphism appeared between the 8th and 9th deciles  for training while the remaining individuals (n\u2009=\u200954) were retained for sex assessment. In each trial, we computed the female and male Fr\u00e9chet means. We learned the regression model from the training sample. We then applied it for sex assessment in the test sample. Overall, we obtained an accuracy of 0.93. When we considered the 20 trials of randomly selected text samples, the reliability ranged from 1 to 0.96  for males, and from 1 to 0.66  for females.Finally, in a fourth step, in order to further test our method and determine its applicability to juveniles, we carried out the sex determination of a new sample comprising 22 juvenile skeletons of known sex  ranging in age from birth to 10 years  that optimizes the deformation (transformation from one to another). We also visualize the shape means and covariances enabling a full statistical analysis. We observe that sex is the most dominant source of variation in 3D cochlear shape even when we consider separately each adult sample subset   and for which sex-typing from DNA or from peptides is not (yet) possible. In contrast, the possible absence of sex-typed cochlear shape in other species of great apes would suggest that social structure, mating systems and communication in these species did not affect the morphology of this organ during evolution. Moreover, in the absence of pre-existing knowledge , yet unknown patterns of variation in cochlear shapes within fossil hominin species could be still investigated. In this case, unsupervised learning techniques could use cochlear shapes directly measured in fossil hominin samples for sex assessment of particular specimens.Our approach investigates for the first time 3D cochlear curves directly by their real  shapes with two important advantages over previous methodsca) Fig.\u00a0. Therefo30. Distinct parts of the human skeleton, especially the cranium, not only display differential degrees of sexual dimorphism at a given stage of growth and development, but also independent growth patterns in size and shape that may also vary with sex39. Little is known about the potential sexual dimorphism of the morphology of the human hearing system. Therefore, we focused our attention on the cochlea because it represents the only sensory system organ that imprints details of its overall adult-like structure within bone by term birth15. It is better amenable to evolutionary studies of communication systems for three main reasons. First, this organ acts as a frequency analyzer of incoming sounds into high and low frequencies along its spiral canal from basal to apical locations respectively40. Second, extensive studies in placental mammals (including primates) demonstrate the possibility to estimate hearing capacities for gross dimensions and shape of the cochlear cavity within bone41. Finally, the cochlear overall structure is also accessible in juvenile and adult fossil hominins42. Given the sexual differences in the human fundamental and resonance frequencies8, the unique human sexual dimorphism caused by a male disproportionate glottal-size43 , it was important to investigate whether these secondary sexual features translated into the morphology of the cochlea. Little emphasis has been laid on human sexually selected communication systems, their relationships with signal reliability (\u201chonesty\u201d) and sociocultural behaviors, particularly on how women and men perceive others in gendered societies through signals emitted to represent the sender\u2019s characteristics46. In non-human primates, male vocal signals mediate mate choice48 and voice pitch is perceived as an indicator of mate quality49 while vocal attractiveness is correlated with both body and facial attractiveness in humans51. In multilingual and cross-cultural contexts, women find men with a more masculine voice more attractive49. Our results may suggest that sexual selection has played an as yet unrealized role in the evolution of a sex-differentiated human hearing system from birth.The ontogeny of the human skeletal sexual dimorphism in size, structure and shape is still the subject of ongoing debate52 and structure-function relationships within the cochlea should be considered with caution. When compared to other extant and extinct apes, humans have a longer cochlea than expected for their body mass, a proxy indicating a major auditory change that likely occurred in early representatives of the genus Homo approximately 2 million years ago20. This finding is consistent with the unique human sensitivity at low-frequencies53. If we posit a sender-receiver co-evolution, the hearing organ may reveal important evolutionary trends in the human sound communication system, including speech. Should our proposed evidence for a sex-differentiated cochlea among humans be associated with neurobiological and social underpinnings of our unique sexual dimorphism in the production and the reception of sounds, it would facilitate the understanding of key features of human communication systems.The differences highlighted in our study may induce sex-based hearing properties. However, cochlear mechanics in humans are still debatedOur sampling strategy aimed to investigate potential differences in 3D cochlear shapes caused by (i) sex, (ii) country of sampling (France or South Africa) and (iii) continent of origin (African and European descent) for the sample from South Africa only. For both samples (France and South Africa), all the patients were adults  and their identity was made anonymous to remain strictly confidential. Given the legal frameworks relating to medical data protection issues in France and in South Africa, no information about \u201cethnicity\u201d was available for either samples. \u201cEthnicity\u201d is a self-ascribed category by which individuals seek to assert their identity. It is here considered as highly imprecise, inconsistent and defined differently in different places and at different times. However, in South Africa, the public and private registrations require South Africans to indicate their \u201crace\u201d  by ticking one of four boxes . Since this information was available, we could consider the \u201ccontinent of origin\u201d (either Europe for \u201cWhites\u201d or Africa for \u201cBlacks\u201d) as a third additional stratification variable (in addition to sex and country of sampling) for the sample from South Africa only . We nevertheless considered this information with caution since it was self-ascribed by the patient. Moreover, the language(s) spoken by the patients were not known because the medical data were collected retrospectively. However, the sample from South Africa was collected from the Steve Biko Academic Hospital in Pretoria by one of us (AO), one of its faculty members at the time of sampling. This hospital is a public health and training institution that provides tertiary healthcare to the multicultural population living in Pretoria. It is therefore representative of the pattern of diverse linguistic groupings in this city. Indeed, the official languages in South Africa include English and Afrikaans (derived from Dutch) and nine Southern Bantu languages; Zulu being the most spoken as a first language, followed by Xhosa. Afrikaans and English are respectively the third and fourth most common first language in South Africa. South Africa, children usually learn in their mother-tongue at school for the first three years (a Southern Bantu language more than 60% of children). They then switch to either English or Afrikaans and continue with that language for the rest of their schooling career.https://www.cnil.fr/sites/default/files/atoms/files/mr-003.pdf). For this study, we complied with the reference methodology MR-003. In South Africa, we obtained ethical clearance in 2017 from the Research Ethics committee of the Faculty of Health Sciences, University of Pretoria. Ethics Reference No: 465/2017.All the steps of the present study were performed in accordance with relevant guidelines and regulations. No data used in this study involved experimentation, intervention, risk or constraint added by the research. For both samples (France and South Africa), the information regarding sex and continent of origin was tabulated and used for statistical purposes only. Our research was non-interventional and was based on anonymous medical data collected retrospectively. In France, the processing of personal data in the healthcare sector for research must be authorized by the National Commission of Informatics and Civil Liberties (CNIL). Moreover, since our data were only digital, anonymized and collected retrospectively, the approval of the committee for the protection of persons (a French ethics committee) was not necessary. In order to simplify the authorization procedure, the CNIL has adopted the reference methodology MR-003 for data collections of healthrelated data for non-interventional research purposes , and the Steve Biko Academic Hospital . For the sample from France, the CT scans were performed between 2012 and 2014, mainly to visualize the maxillary sinuses. For the sample from South Africa, the CT scans were performed in 2016. The pixel size ranged from 0.46 to 0.52\u2009mm with a maximum slice thickness of 2\u2009mm.Institut d\u2019Anatomie Normale et Pathologique \u00bb of the University of Strasbourg. These skeletons correspond to individuals of known sex and age at death  and G Schwalbe (1844\u20131916) before 191854 (Rampont 1994). We obtained permissions to access these skeletons that have already been used in several published studies16. The micro-ct scans (pixel size of 0.041\u2009mm) were obtained from the XtremeCT  system at the Institut de M\u00e9decine et de Physiologie Spatiales, Toulouse, France (http://www.medes.fr/).The juvenile sample is represented by micro-ct scans of crania curated in the \u00ab www.vsg3d.com/avizo) for the segmentation and the 3D reconstruction of the air-filled cochlea. We decided arbitrarily to only use the left cochlea and we assumed that sexual dimorphism also occurred on the right side. We used a threshold of 550\u2013650 Hounsfield Units to extract the bone structures and for further reconstructions. The cochlear size and shape were modelled following a method previously used in Braga et al.20 by a series of landmarks placed at small intervals along the outer periphery of the cochlea, between the apex and the point marking the origin of the basal turn (where there is a saddle between the cochlear part and the vestibule) very close to the inferior margin of the round window. We subsequently analyzed the cochlear 3D shape by imposing appropriate geometric invariances including rigid motions, uniform scaling, and re-parametrization. Here, we point out that there is a difference between methods that perform registration based on features vectors and those that perform intrinsic statistical shape analysis. For both registration methods, the main goal is to establish correspondences between pairs of observations. Comparisons in a Euclidean space for methods based on features vectors lead to statistical analyses where the template is either selected as a predetermined observation from the sample, or constructed using Euclidean averages. In this case, a major drawback consists in ignoring the intrinsic complexity and nonlinearity caused by the structure of the data. The aim of the intrinsic shape analysis conducted in our study was to (i) achieve accurate registration with uniform scaling and correspondences between shapes, (ii) focus on the representation of the shape, (iii) analyze shape on a nonlinear manifold. Thus, the objectives of such intrinsic shape analysis encompassed correspondence-based registration methods while simultaneously integrating the tools for statistical analysis into a nonlinear registration framework.We first imported the CT scans into the Avizo software package  from the 94 adult cochlear curves sampled in this study. We evaluated the classification performance depending on the average estimates. We repeated these experiments 20 times to avoid a biased sampling (and we reported the mean and the standard deviation of these repeated experiments). In the Supplementary Figure Fig.\u00a0, we giveThe dimensionality reduction of the population shape variables through tangent principal component analysis (TPCA) allowed local geometric shape analysis to characterize infinitesimal changes along the cochlear curve, but also highlighted global changes in shape covariates using the dominant modes of variation. The key advantage of this approach was that it allowed the use of 3D cochlear shape as a geometric phenotype in more sophisticated multivariate analyses. While the choice of TPCA for representing the tangent space was made for computational convenience, it is important to note that PCA yields a basis that maximizes the feature variance in the sample along each projection. The study of shape variance shows discriminatory rules that help in classifying groups. Additionally, even if the 3D shape analysis was performed locally on the curves, the principal projections captured global shape properties in the data, and hence helped to interpret appropriately the variability in 3D cochlear shapes. The application of our analysis to samples of 3D shapes demonstrated both global and local effects of sex for 3D cochlear shape variation.37 was then used to capture the characteristic of the 3D cochlear curves for a given sample. It was also used as a common reference template for registering the individual shapes to perform a group analysis. Instead of being a subject-specific template, the Fr\u00e9chet mean represents a statistical template that minimizes the shape variance. The main advantage of this approach is that it also allowed us to explore the covariance structure of the 3D cochlear shapes in an intrinsic manner. All the computations were made using programs written in C/C++ and Matlab 2016a. We used a regression model on the shape space. It is known that these models depend on unknown re-parametrization functions (or domain deformations)55 which remain a challenging task. For instance, in a regression case where the shape is available as a finite number of observed data, we are interested in studying their re-parametrizations for describing the underlying shape of any newly observed input. For shape regression, each of the observed shapes comes with its own reparametrization. We were interested in computing the Fr\u00e9chet mean of re-parametrization and in learning a Gaussian process on the space of cumulative distributions as a subspace of the unit sphere. Furthermore, we used a Bayesian inference for tuning the regression model, one among the most effective existing solutions particularly for regression and classification of shapes.The Fr\u00e9chet mean Example of misclassified males and females during one trial."]}
-{"representative": "Staphylococcus aureus and Bacillus subtilis) and two Gram-negative bacteria . The best activity was displayed by compound 19 against E. coli with an inhibition zone of 16.0\u2009\u00b1\u20090.82\u2009mm and 14.67\u2009\u00b1\u20090.94\u2009mm at 500 and 250\u2009\u03bcg/mL, respectively. This is close to ciprofloxacin which is used as a positive control. The results of in silico molecular docking evaluation of the compounds against E. coli DNA gyraseB were in good agreement with the in vitro antibacterial analysis. Compounds 19  and 24  showed the maximum binding affinity close to ciprofloxacin  used as positive control. Therefore, the antibacterial activity displayed by these compounds is encouraging for further investigation to improve the activities of quinoline-stilbenes by incorporating various bioisosteric groups in one or more positions of the phenyl nuclei for their potential pharmacological use. Findings of the DPPH radical scavenging assay indicated that some of the quinolone stilbenes and pinacol possess moderate antioxidant properties compared to ascorbic acid used as a natural antioxidant.Emergence of antimicrobial resistance to standard commercial drugs has become a critical public health concern worldwide. Hence, novel antimicrobials with improved biological activities are urgently needed. In this regard, a series of quinoline-stilbene derivatives were synthesized from substituted quinoline and benzyltriphenylphosphonium chloride using Wittig reaction. Furthermore, a novel pinacol of quinoline was synthesized by pinacolinazation of 2-methoxyquinoline-3-carbaldehyde which was achieved by aluminum powder-potassium hydroxide reagent combination at ambient temperature in methanol. The structures of the synthesized compounds were established based on their spectral data. The antibacterial activities of the synthesized compounds were evaluated in vitro by the paper disc diffusion method against two Gram-positive bacteria ( Staphylococcus aureus (MRSA), vancomycin- resistant Staphylococcus aureus (VRSA), vancomycin-resistant enterococcus (VRE), and fluconazol-resistant Candida have become a serious medical problem worldwide . Re. Retranstilbenes . StilbenSeveral studies have shown that the introduction of different functional groups into quinolines and stilbenes can improve their biological activities. Thus, due to their useful applications in various fields, scientists pay much attention to the modification of quinolines and stilbenes. Especially noteworthy in this regard is the emergence of new drugs with hybrid molecular architectures possessing better pharmacological properties than small molecules. Hence, in the present work, the synthesis of quinoline-stilbene conjugates and pinacols of quinoline was reported. The result of the synthesis of novel pinacols of quinoline was also reported here for the first time. Herein, we also report the results of the antibacterial and radical scavenging activities of synthetic derivatives of quinoline-stilbenes and pinacols of quinoline. It is rational to anticipate better bioactivity from a bigger scaffold developed by conjugating the phenyl ring to the quinoline nucleus which has wider sites for suspending different bioisosteres.3 as a solvent, and chemical shifts (\u03b4) were reported in ppm and the coupling constants (J) are reported in Hertz. The infrared spectra of the compounds were recorded using KBr pellets on a PerkinElmer BX IR Spectrometer (400\u20134000\u2009cm\u22121) at Addis Ababa University. UV-Vis spectra were determined using a double beam UV-VIS Spectrophotometer (SM-1600 Spectrophotometer)) using methanol as a solvent. Analytical thin-layer chromatography was conducted on a 0.2\u2009mm-thick layer of silicagel GF254 (Merck) on an aluminum plate, and the spots were visualized with 254\u2009nm and 366\u2009nm wavelength UV light. Silica gel gravity column chromatography was carried out using 100-mesh silica gel.All solvents and organic reagents were purchased from LOVA CHEMIE PVT LTD. Melting points were determined using capillary tubes with the Japson analytical melting point apparatus and are uncorrected. The NMR spectra of the compounds were obtained using the NMR Bruker Avance 400 spectrometer operating at 400\u2009MHz using DMSO-d6 and CDCl2-Chloroquinoline-3-carbaldehyde and 2-chloro-8-methylquinoline-3-carbaldehyde were prepared according to the literature report . The var1The structures of the synthetic compounds synthesized by the procedure have been established using spectroscopic methods including UV-Vis, FT-IR, and NMR, and the result is summarized below.Rf\u2009=\u20090.22 (n-hexane\u2009:\u2009EtOAc\u2009=\u20099\u2009:\u20091). UV-Vis (MeOH) \u03bbmax\u2009=\u2009280\u2009nm; IR : 3035 (CH-arom.), 1693 , 1621 (quinoline C=N str.), and 599 (aromatic C=C str.); 1H NMR : \u03b4H 7.65 , 7.88 , 7.97 , 8.07 , 8.74 , and 10.54 ; 13C NMR : \u03b4C 126.3 (C-1), 126.5 (C-8), 128.2 (C-6), 128.6 (C-4a), 129.7 (C-5), 133.6 (C-7), 140.3 (C-4), 149.6 (C-8a), 150.1 (C-2), and 189.1 (C-9).The crude product of 4 was purified by recrystallization from ethyl acetate. It was yellow crystal; mp 146\u2013148\u00b0C; yield 49%; Rf\u2009=\u20090.63 (n-hexane\u2009:\u2009EtOAc\u2009=\u20099\u2009:\u20091). UV-Vis \u03bbmax (MeOH)\u2009=\u2009375\u2009nm; IR : 3035 (CH-arom.), 1635 , 1621 (quinoline C=N str.), and 599 : \u03b4H 6.72 , 6.91 , 7.16 , 7.44 , 7.56 , 7.66 , 7.78 , 7.94 , and 8.14 ; 13C NMR : \u03b4C 125.7 (C-9), 127.2 (C-4), 127.4 (C-5), 127.9 (C-6), 128.0 (C-3), 128.3 (C-4\u2032), 128.4 (C-8), 129.0 , 129.1 , 131.2 (C-10), 133.7 (C-4), 135.9 (C-7), 138.9 (C-11), 146.6 (C-2), and 149.9 (C-8a).The crude product of 5 was purified by silica gel column chromatography using n-hexane\u2009:\u2009acetate (9\u2009:\u20091) as an eluent. The yield was 35.5%, a white powder; mp 58\u201360\u00b0C; n-hexane\u2009:\u2009ethyl acetate (8\u2009:\u20091) as an eluent. The yield was 40.5%, a dull yellow powder; mp 178\u2013180\u00b0C; Rf\u2009=\u20090.29 (n-hexane\u2009:\u2009EtOAc\u2009=\u20096\u2009:\u20091). UV-Vis \u03bbmax (MeOH)\u2009=\u2009400\u2009nm; IR : 3429 (N-H str.), 3023 (aromatic C-H), 1673 , 1610 (quinoline C=N str.), and 1558 and 1465 (aromatic C=C str.); 1H NMR : \u03b4H 6.56 , 6.75 , 7.09 , 7.23 , 7.32 , 7.44 , 7.59 . 7.66 , and 11.97 ; 13C NMR : \u03b4C 115.3 (C-8), 119.3 (C-4a), 122.4 (C-3), 125.4 (C-4), 127.0 (C-6), 127.9 (C-9), 128.9 , 129.0 , 129.3 (C-4\u2032), 130.6 (C-7), 132.2 (C-5), 136.9 (C-1\u2032), 137.5 (C-10), 138.7 (C-8a), and 161.8 (C-2).The crude product of 7 was purified by silica gel column chromatography using Rf\u2009=\u20090.32 (n-hexane\u2009:\u2009EtOAc\u2009=\u20099\u2009:\u20091). UV-Vis \u03bbmax (MeOH)\u2009=\u2009295\u2009nm; IR : 3065.4 (aromatic C-H str.), 2919.3 , 2847 , 1673 , 1620 (quinoline C=N str.), and 1599 and 1579 (aromatic C=C str.); 1H NMR : \u03b4H 4.22 , 7.45 , 7.76 , 7.85 , 8.60 , and 10.49 ; 13C NMR : \u03b4C 55.9 (C-10), 120.0 (C-3), 124.4 (C-6), 125.1 (C-4a), 127.1 (C-8), 129.8 (C-5), 132.6 (C-7), 140.0 (C-3), 149.0 (C-8a), 161.2 (C-2), and 189.4 (C-9).Compound 8 was a gray powder; the yield was 90%; mp 106\u2013108\u00b0C; n-hexane\u2009:\u2009ethylacetate (9\u2009:\u20091) as an eluent. The yield was 28.3%; it was a gray powder; mp 138\u2013140\u00b0C; Rf\u2009=\u20090.52 (n-hexane\u2009:\u2009EtOAc\u2009=\u20099\u2009:\u20091). UV-Vis \u03bbmax (MeOH)\u2009=\u2009322\u2009nm; IR : 3065.4 (aromatic C-H str.), 2919.3 , 2847 , 1630 , 1620 (quinoline C=N str.), and 1599 and 1579 (aromatic C=C str.); 1H NMR : \u03b4H 3.97 , 6.65 , 6.78 , 7.21 , 7.34 , 7.42 , 7.61 , 7.78 , and 7.91 ; 13C NMR : \u03b4C 54.1 (-OCH3), 122.1 (C-3), 124.6 (C-4a), 124.7 (C-9), 126.9 (C-2\u2032), 127.1 (C-8), 127.9 (C-5), 128.0 (C-6\u2032), 128.8 , 129.29 (C-4\u2032), 130.0 (C-10), 132.7 (C-4), 136.7 (C-7), 137.7 (C-1\u2032), 145.6 (C-8a), and 160.2 (C-2).The crude product of 9 was purified by silica gel column chromatography using Rf\u2009=\u20090.25 (n-hexane\u2009:\u2009Methanol\u2009=\u20097\u2009:\u20093). UV-Vis \u03bbmax (MeOH)\u2009=\u2009390\u2009nm; IR : 3525\u20133510 (O-H and N-H), 3065.4 (aromatic C-H str.), 2919.3 , 2847 , 1623 (imine C=N str.), 1620 (quinoline C=N str.), and 1599 and 1579 (aromatic C=C str.) 1H NMR : \u03b4H 3.65 , 4.72 , 4.92 , 7.19 , 7.55 , 7.72 , 8.21 , 8.5 , and 9.55 ; 13C NMR : \u03b4C 43.4 (C-14), 60.5 (C-12), 61.2 (C-15), 63.7 (C-11), 117.2 (C-3), 121.9 (C-8), 122.4 (C-4a), 125.7 (C-5), 128.9 (C-6), 131.5 (C-7), 143.0 (C-4), 148.3 (C-8a), 155.4 (C-2), and 163.8 (C-9); Dept-135 \u03b4C 43.4 (C-14 down), 60.5 (C-12 down), 61.2 (C-15 down), 63.7 ( C-11 down), 121.9 (C-8), 125.7 (C-5), 128.9 (C-6), 131.5 (C-7), 143.0 (C-4), and 163.8 (C-9).Compound 10 was a yellow powder, and the overall yield was 84%; mp 80\u201382\u00b0C; Rf\u2009=\u20090.30 (n-hexane\u2009:\u2009EtOAc\u2009=\u20099\u2009:\u20091). UV-Vis \u03bbmax (MeOH)\u2009=\u2009295\u2009nm; IR  3223, 3025 (arom-C-H.), 2956 , 2837 , 1683.3 (C=O str.), 1621 (quinoline C=N str.), and 1579 (aromatic C=C str.); 1H NMR : \u03b4H 2.80 , 7.53 , 7.70 , 7.78 , 8.70 , and 10.6 ; 13C NMR : \u03b4C 17.8 (C-10), 126.0 (C-3), 126.5 (C-6), 127.5 (C-5), 127.8 (C-4a), 133.6 (C-7), 136.9 (C-8), 140.4 (C-4), 148.7 (C-2), 149.4 (C-8a), and 189.5 (C-1).The crude product 14 was recrystallized from EtOAc. Yield after recrystallization was 38.75%, pale yellow crystal; mp 139 140\u00b0C; n-hexane\u2009:\u2009ethyl acetate 9\u2009:\u20091). The yield was a yellow gum; Rf\u2009=\u20090.7 (n-hexane\u2009:\u2009EtOAc\u2009=\u20099\u2009:\u20091). UV-Vis \u03bbmax (MeOH)\u2009=\u2009375\u2009nm; IR  3025 (arom-C-H.), 2956 , 2837 , 1630 , 1621 (quinoline C=N str.), and 1579 (aromatic C=C str.); 1H NMR : \u03b4H 7.36 , 7.44 , 7.52 , 7.61 , 7.66 , 7.85 , and 7 and 8.78 ; 13C NMR : \u03b4C 17.5 (C-11), 123.1 (C-6), 126.4 (C-6), 126.4 (C-9), 127.4 , 127.7 (C-9), 127.8 (C-4\u2032), 128.1 (C-6\u2032), 129.4 , 129.7 (C-4a), 131.1 (C-2\u2032), 133.9 (C-7), 135.4 (C-4), 135.8 (C-8), 136.8 (C-1\u2032), 145.7 (C-2), and 148.7 (C-8a).The crude product of 14 was purified by silica gel column chromatography (solvent Rf\u2009=\u20090.41 (n-hexane\u2009:\u2009EtOAc\u2009=\u20091\u2009:\u20091). UV-Vis \u03bbmax (MeOH)\u2009=\u2009375\u2009nm, IR  3429 (O-H str.), 3179.5 (NH str.), 3023 (aromatic C-H), 2919.8 , 2837.2  1673 (C=O str.), 1610 (quinoline C=N str.), and 1558 and 1465 (aromatic C=C str.); 1H NMR : \u03b4H 2.56 , 7.23 , 7.51 , 7.61 , 8.49 , and 10.48 ; 13C NMR : \u03b4C 16.7 (C-10), 117.9 (C-6), 123.3 , 129.1 , 135.0 (C-5), 139.1 (C-8a), 144.2 (C-4), 162.7 (C-2), 190.00 (C-9).Compound 15 was yellow powder; mp 176\u2013178\u00b0C; 16 was purified by column chromatography with solvent n-hexane: ethylacetate (8\u2009:\u20091). The pure product was a dull yellow powder; mp 60\u201362\u00b0C; Rf\u2009=\u20090.38 (n-hexane\u2009:\u2009EtOAc\u2009=\u20096\u2009:\u20091).The crude product of \u03bbmax (MeOH)\u2009=\u2009375\u2009nm; IR : 3429 (N-H str.), 3023 (aromatic C-H), 2919.8 , 2837.2 , 1630 , 1610 (quinoline C=N str.), and 1558 and 1465 (aromatic C=C str.); 1H NMR : \u03b4H 2.56 , 7.11 , 7.24\u20137.42 , 7.69 , 8.23 , and 11.10 ; 13C NMR : \u03b4C 17.7 (C-11), 119.9 (C-8), 122.37 (C-6), 123.4 (C-4), 123.6 (C-5), 123.7 (C-9), 126.5 (C-4\u2032), 127.0 , 128.3 (C-4a), 128.4 , 131.3 (C-7), 133.7 (C-3), 136.1 (C-10), 137.7 (C-1\u2032), 136.7 (C-8a), and 162.1 (C-2).UV-Vis n-hexane\u2009:\u2009ethylacetate (7\u2009:\u20091). The pure product was a pink powder; mp 150\u2013152\u00b0C; Rf\u2009=\u20090.61 (n-hexane\u2009:\u2009EtOAc\u2009=\u20097\u2009:\u20093). UV-Vis \u03bbmax (MeOH) 315\u2009nm, 319\u2009nm; IR : 3055 (aromatic C-H str.), 1620 , 1615 (quinoline C=N str.), 1577 (aromatic C=C str.), and 1512 and 1340 (O=N-O str.); 1H NMR : \u03b4H 2.36 , 6.78 , 6.88 , 7-21-7.78 , 8.14 , 8.26 , 8.33 , and 8.72 , 13C NMR : \u03b4C 17.4 (-CH3), 121.1 (C-9), 122.3 , 122.7 (C-6), 123.6 (C-5), 127.3 , 128.1 (C-14), 128.8 , 129.3 , 130.5 (C-10), 133.8 (C-7), 135.0 , 136.9 , 137.1 (C-20), 140.0 (C-4), 143.6 (C-17), 157.2 (C-2), and 159.2 (C-8a), and peaks due to their stereoisomers were also seen.The crude product of 19 was purified by silica gel column chromatography using Rf\u2009=\u20090.42 (n-hexane\u2009:\u2009EtOAc\u2009=\u20097\u2009:\u20095). UV-Vis \u03bbmax (MeOH); IR  3281.8 (N-H str), 3055 (aromatic C-H str.), 1645.7 (NHC=O) 1620 , 1615 (quinoline C=N str.), and 1577 (aromatic C=C str.); 1H NMR : \u03b4H 2.3 , 2.33 , 6.81 , 6.89 , 7.08 , 7.25 , 7.42 , 7.63 , 7.68 , 8.06 , and 8.66 (NH); 13C NMR : \u03b4C 17.4 (C-25), 24.4 (C-24), 120.0 , 122.3 , 124.2 (C-6), 125.1 (C-5), 125.5 , 127.2 (C-9), 128.0 (C-28), 128.9 , 129.3 (C-13), 130.3 (C-15), 133.3 (C-7), 134.7 (C-20) 136.4 (C-8), 137.0 (C-11), 139.2 (C-10), 143.9 (C-17), 148.9 (C-8a), 158.6 (C-23), and 168.6 (C-2).The crude product 22 was purified by silica gel column chromatography with n-hexane\u2009:\u2009ethyl acetate (7\u2009:\u20094) as eluent. mp 178\u2013180\u00b0C; Rf\u2009=\u20090.4 (n-hexane\u2009:\u2009EtOAc\u2009=\u20097\u2009:\u20093); UV-Vis \u03bbmax (MeOH) 325\u2009nm; IR : 3470 , 3013 (aromatic C-H str.), 2930.9 , 1625 (quinoline C=N str.), 1620 , and 1589.6 and 1475.5 (aromatic C=C str.); 1H NMR : \u03b4H 2.65 , 3.99 , 5.20 , 5.25 , 7.31 , 7.51 , 7.72 , and 8.28 ; 13C NMR : \u03b4C 17.3 (C-10), 52.9 (C-11), 69.2 (C-9), 117.2 (C-6), 124.79 (C-3), 125.33 (C-5), 127.1 (C-4a), 128.9 (C-7), 133.8 (C-8), 136.7 (C-4), 143.6 (C-8a), and 158.26 (C-2).Compound 24 was purified by silica gel column chromatography using solvent n-hexane\u2009:\u2009ethyl acetate (8\u2009:\u20091). The final product was a white powder; mp 202\u2013204\u00b0C; Staphylococcus aureus (ATCC25923) and Bacillus subtilis (ATCC6633)), and two Gram-negative bacteria  and Salmonella typhimurium (ATCC 13311)) were obtained from the Adama Public Health Research & Referral Laboratory Center to evaluate the antibacterial activity of the synthetic compounds. The identity of the bacterial strains were recognized and confirmed by morphology of colony and Gram staining and by standard biochemical tests following the methods of Bergey's Manual of Determinative Bacteriology (1994) [\u03bcg/mL. Sterile filter paper discs of 6\u2009mm diameter were soaked in 1\u2009mL DMSO solution of the compounds at 250 and 500\u2009\u03bcg/mL concentrations. Then, the saturated paper discs were placed on the centre of each MHA plate. Ciprofloxacin was the standard drug used as positive control, and DMSO was used as negative control. The plates were then inverted and incubated for 24 hours at 37\u00b0C, and the zone of inhibition was recorded. The results were expressed as the mean of three measurements . The DPPH radical scavenging rate of each sample was calculated as follows [Ao is the absorbance of the control reaction and A1 is the absorbance in the presence of the test or standard sample.DPPH radical scavenging activity was used to evaluate the antioxidant activity of the synthetic compounds and compared with ascorbic acid . All syn follows , 22:(1)%The control DPPH solution was prepared by mixing 2\u2009mL 0.004% DPPH with 2\u2009mL methanol to afford 0.002% DPPH methanolic solution. The results were presented in percent radical scavenging activity , and theE. coli gyrase A and synthetic compounds in a 3D fashion, the compounds were docked within the binding site of the protein. AutoDock Vina with our previously reported protocol was used to dock the proteins  and compounds (5\u201324) into the active site of proteins [E. coli DNA gyrase A (PDB ID 1ZI0) and S. aureus Gyrase complex with ciprofloxacin and DNA (PDB ID: 2XCT) was downloaded from protein data bank. The protein preparation was carried out using the reported [To investigate the mode of interaction between the proteins , 23. Theproteins , 23. Thepounds 5\u2013 into thepounds 5\u2013 into thehttp://www.graphpad.com). Groups were analyzed for significant differences using a linear model of variance analysis (ANOVA) test for comparisons, with significance accepted for p < 0.05.Experiments were conducted in triplicates. The data presented are mean\u2009\u00b1\u2009SD of the three independent experiments. GraphPad Prism version 5.00 for Windows was used to perform the Analysis  and 2-methylacetanilide (11) were synthesized by acetylation of aniline and o-toluidine in acetic anhydride-acetic acid mixtures (3) and 2-chloro-8-methylquinoline-3-carbaldehyde (13) were developed by the application of Vilsmeier\u2013Haack reaction  as a solvent and K2CO3 as a base. The latter was selected due to its weak basicity and poor nucleophilic character which does not interfere with nucleophiles in most nucleophilic substitution reactions. The attractive features of DMF including high dielectric constant, its aprotic nature, wide liquid range, low volatility, dissolving all reactants, and supplying sufficient activation energy for the reactions allow us to use this reagent as a solvent. Furthermore, it is also miscible in water which eases the isolation of the desired product by adding the reaction mixture into cold ice water which causes the water-insoluble product to precipitate out [The hybridization of biologically active molecules is a nice tool for drug development used to treat a variety of diseases. It provides a means to improve the bioactivity of bioactive molecules through synergetic effect. Hybrid drugs can provide combination therapies in a single multifunctional agent , 24, 25.mixtures  and 2. Treaction  and 2 us3 in DMF , 24. Subtate out . Compouncis isomers which were confirmed by the coupling constant of the olefinic double bonds in the stilbenes. This agreed very well with previous products of Wittig reactions carried out at ambient temperature in DMF/KOH which gives the cis-stilbenes in good yield [cis and trans stereoisomers. A further attempt to purify 19 using silica gel column chromatography was unsuccessful since the spots of the two stereoisomers overlapped in its TLC profile. Pinacolization of carbonyls has been conducted by using a number of reagents such as Mg-MgI2 [2, transition metals, actinides, and lanthanides [II and TiIII reagents have also received considerable attention, although olefination is a competing reaction with these reagents [After securing crucial intermediates 3 and 13, attention was given to the synthesis of a series of stilbenes quinolines and their substituted analogs using Wittig reaction. In this regard, the desired products were made by reacting derivatives of compounds 3 and 13 with benzyltriphenylphosphonium chloride using DMF as a solvent and KOH as a base. The products produced are mainly od yield . However Mg-MgI2 , Zn-ZnC1thanides . TiII anreagents . Among treagents \u201328. In treagents . Methanoreagents  (Scheme S.aureus (ATCC25923), B.subtilis (ATCC6633), E. coli , and S. typhimurium (ATCC 13311)) using the paper disc diffusion method. The results of this evaluation are presented in Tables E. coli varies from 8.0\u2009\u00b1\u20090.82 to 16.0\u2009\u00b1\u20090.82\u2009mm, whereas for standard drug (ciprofloxacin) at the same concentration, it was 18.67\u2009\u00b1\u20090.47 diameter. Compounds 14 (with a mean inhibition zone of 12.67\u2009\u00b1\u20090.82\u2009mm) and 19 (with a mean inhibition zone of 16.0\u2009\u00b1\u20090.82\u2009mm) were the ones with maximum activity against E. coli.Quinolines and stilbenes and their analogs have been associated with various biological activities. Compounds containing the quinoline moiety have shown good amoebicidal, bactericidal, fungicidal, and antimalarial activities , 32. ExpZ-factor is a reflective of both the assay signal dynamic range and the data variation associated with signal measurements and, therefore, is suitable for assay quality assessment [Z-factor provides a useful tool for comparison and evaluation of the quality of assay and can be utilized in assay optimization and validation [Z-factor is defined in terms of four parameters: the means (\u03bc) and standard deviations (\u03c3) of the sample and the positive and negative controls as shown below [\u03c3s and \u03c3c are the standard deviation of the sample and control and \u03bcs and \u03bcc are the mean of the sample and control.sessment . Z-factolidation . The Z-fwn below , 31.(2)ZZ\u2032-factor can be calculated using only control data as follows:\u03c3c+ and \u03c3c\u2212 are the standard deviation of the positive and negative and \u03bcc+ and \u03bcc\u2212 are the mean of the positive and negative control, respectively.A Z-factor of the synthetic compounds and standards was calculated, and the results are presented in Z\u2032-factor for the controls ranges from 0.82 to 0.92, a reflective of excellent quality assay. It was also found out that the Z-factor for six samples was greater than 0.5, while for another six samples, the Z-value was between 0.0 to 0.5. For four and two samples, the values were between \u22120.5 to 0 and between \u22120.5 to \u22121.0, respectively. Hence, the data obtained showed a good overall assay.The S. typhimurium. Within the series, compound 16 with a mean inhibition zone of 9.67\u2009\u00b1\u20090.47\u2009mm diameter was the maximum while a 13.56\u2009\u00b1\u20090.82\u2009mm mean inhibition zone was observed for the standard drug at the same concentration. In addition, 24 showed the strongest activity against S. aureus with a 16.0\u2009\u00b1\u20091.63\u2009mm mean inhibition zone compared to 11.67\u2009\u00b1\u20090.47\u2009mm for the standard drug. However, none of the compounds showed activity against B. subtilis. Overall, among the compounds reported herein, only five of them displayed potent bioactivity.Compounds 5, 16, and 24 have moderate activity against ortho position relative to the amino group) to afford sufficient yields. However, most important bioisosters such as F, Cl, carbonyl, carboxylic acid, and sulfonyl group are electron withdrawers and deactivators and cannot be incorporated in the quinoline nucleus. But, the current hybrid scaffold overcomes this limitation since the phenyl nucleus can bear various types of functional groups (electron withdrawer or donors) in one or more of the five positions. Thus, the current strategy provides a manageable way to optimize the bioactivity through structural modification. Owing to Wittig reaction tolerance of various functional groups, phenyl ring can comprise one or more bioisosters which would be used to improve the bioactivity of quinoline-stilbenes. Regarding compound 24, which was generated by pinacolization of 2-chloro-8-methylquinoline-3-carbaldehyde, a huge improvement in the bacterial activity was observed relative to the monoalcohol  methanol of the same reactant. Previously, we reported [E. coli (with mean inhibition zone of 9.33\u2009\u00b1\u20090.89\u2009mm diameter), whereas the correspondent diol (24) was active against both S. aureus (with a mean inhibition zone of 16.0\u2009\u00b1\u20091.63\u2009mm diameter) and S. typhimurium (with a mean inhibition zone of 8.67\u2009\u00b1\u20090.47\u2009mm diameter), respectively. Furthermore, the study revealed that there is an opportunity of developing stronger bioactive molecules by pinacolization of quionoline-3-carbaldehyde derivatives bearing various bioisosteric substituents.In the current synthetic compound, the phenyl nucleus did not bear any substituents and the substituents in the quinoline nucleus were limited to the second and eight position. As a limitation, quinoline analogs synthesized by application of Vilsmeier\u2013Hack reaction require activated aniline derivatives  used as a natural antioxidant. This indicates that the activities shown by the synthetic compounds are moderate in antioxidant activity. This is in good agreement with the literature reported for closely related compounds [Most of the synthetic quinolone stilbenes and their analogs possess moderate antioxidant activity relative to ascorbic acid . Compounompounds , 33.Z-factors for the radical scavenging activity of the synthetic compounds lie between 0.88 and 0.99 . The compounds (5\u201324) were displayed a minimum binding energy ranging from \u22125.6 to \u22127.1\u2009kcal/mol , 14 , and 22  have shown hydrogen bond interaction with different amino-acid residues. The in silico interaction results are agreeing with in vitro antimicrobial analysis of the synthesized compounds against E.coli.DNA gyrase is an enzyme belonging to a member of bacterial topoisomerase which controls the topology of DNA \u201337. Henckcal/mol , with thE.coli, and among them, compound 24 revealed better activity [5 and 9 do not show any hydrogen bond interaction with any amino-acid residues within the active site. Compounds 5, 7, 9, 10, and 22 docking results were partially matching the clinical drug ciprofloxacin interactions with amino-acid residues. Based on the in silico molecular docking analysis result, compound 24  showed the highest binding affinity compared to ciprofloxacin . Therefore, compound 24 might be a better antibacterial agent than the other synthesized compounds reported herein. The binding affinity, H-bond, and residual interaction of nine compounds are summarized in E.coli DNA gyrase A are depicted in Figures Compounds 14 , 16 , 19 , and 24  showed good activities against activity . CompounE. coli with an inhibition zone of 16.0\u2009\u00b1\u20090.82\u2009mm and 14.67\u2009\u00b1\u20090.94\u2009mm at 500 and 250\u2009\u03bcg/mL, respectively. This is close to ciprofloxacin which is used as a positive control. The results of in silico molecular docking evaluation of the compounds against E. coli DNA gyrase A were also in good agreement with in vitro antibacterial analysis. Two of the compounds, 19 and 24, exhibited the highest binding affinity comparable to ciprofloxacin. Some of these compounds  possess potent antibacterial properties. The antioxidant properties of these compounds revealed that they were active only to a half extent of ascorbic acid at the same concentration. Finally, we recommended that both the antibacterial and antioxidant activities can be further optimized by incorporating active bioisostere groups on the phenyl ring of the hybrid scaffold.In conclusion, quinolone-stilbenes-merged hybrid molecules were reported by utilizing Wittig reaction between 2-chloroquinoline-3-carbaldehyde derivatives and benzyltriphenylphosphonium chloride. The 2-chloroquinoline-3- carbldehyde derivatives were synthesized by Vilsmeier\u2013Haack reaction, and the chlorine atom was replaced by various nucleophiles via a nucleophilic substitution reaction. A novel pinacol of quinoline was also synthesized by pinacolization of 2-methoxyquinoline-3-carbaldehyde with Al/KOH reagent system. The antibacterial activities of the compounds were evaluated with paper-disc diffusion against two Gram-negative and two Gram- positive bacterial strains with the best activity displayed by compound 19 against", "texts": ["Staphylococcus aureus and Bacillus subtilis) and two Gram-negative bacteria . The best activity was displayed by compound 19 against E. coli with an inhibition zone of 16.0\u2009\u00b1\u20090.82\u2009mm and 14.67\u2009\u00b1\u20090.94\u2009mm at 500 and 250\u2009\u03bcg/mL, respectively. This is close to ciprofloxacin which is used as a positive control. The results of in silico molecular docking evaluation of the compounds against E. coli DNA gyraseB were in good agreement with the in vitro antibacterial analysis. Compounds 19  and 24  showed the maximum binding affinity close to ciprofloxacin  used as positive control. Therefore, the antibacterial activity displayed by these compounds is encouraging for further investigation to improve the activities of quinoline-stilbenes by incorporating various bioisosteric groups in one or more positions of the phenyl nuclei for their potential pharmacological use. Findings of the DPPH radical scavenging assay indicated that some of the quinolone stilbenes and pinacol possess moderate antioxidant properties compared to ascorbic acid used as a natural antioxidant.Emergence of antimicrobial resistance to standard commercial drugs has become a critical public health concern worldwide. Hence, novel antimicrobials with improved biological activities are urgently needed. In this regard, a series of quinoline-stilbene derivatives were synthesized from substituted quinoline and benzyltriphenylphosphonium chloride using Wittig reaction. Furthermore, a novel pinacol of quinoline was synthesized by pinacolinazation of 2-methoxyquinoline-3-carbaldehyde which was achieved by aluminum powder-potassium hydroxide reagent combination at ambient temperature in methanol. The structures of the synthesized compounds were established based on their spectral data. The antibacterial activities of the synthesized compounds were evaluated in vitro by the paper disc diffusion method against two Gram-positive bacteria ( Staphylococcus aureus (MRSA), vancomycin- resistant Staphylococcus aureus (VRSA), vancomycin-resistant enterococcus (VRE), and fluconazol-resistant Candida have become a serious medical problem worldwide . Re. Retranstilbenes . StilbenSeveral studies have shown that the introduction of different functional groups into quinolines and stilbenes can improve their biological activities. Thus, due to their useful applications in various fields, scientists pay much attention to the modification of quinolines and stilbenes. Especially noteworthy in this regard is the emergence of new drugs with hybrid molecular architectures possessing better pharmacological properties than small molecules. Hence, in the present work, the synthesis of quinoline-stilbene conjugates and pinacols of quinoline was reported. The result of the synthesis of novel pinacols of quinoline was also reported here for the first time. Herein, we also report the results of the antibacterial and radical scavenging activities of synthetic derivatives of quinoline-stilbenes and pinacols of quinoline. It is rational to anticipate better bioactivity from a bigger scaffold developed by conjugating the phenyl ring to the quinoline nucleus which has wider sites for suspending different bioisosteres.3 as a solvent, and chemical shifts (\u03b4) were reported in ppm and the coupling constants (J) are reported in Hertz. The infrared spectra of the compounds were recorded using KBr pellets on a PerkinElmer BX IR Spectrometer (400\u20134000\u2009cm\u22121) at Addis Ababa University. UV-Vis spectra were determined using a double beam UV-VIS Spectrophotometer (SM-1600 Spectrophotometer)) using methanol as a solvent. Analytical thin-layer chromatography was conducted on a 0.2\u2009mm-thick layer of silicagel GF254 (Merck) on an aluminum plate, and the spots were visualized with 254\u2009nm and 366\u2009nm wavelength UV light. Silica gel gravity column chromatography was carried out using 100-mesh silica gel.All solvents and organic reagents were purchased from LOVA CHEMIE PVT LTD. Melting points were determined using capillary tubes with the Japson analytical melting point apparatus and are uncorrected. The NMR spectra of the compounds were obtained using the NMR Bruker Avance 400 spectrometer operating at 400\u2009MHz using DMSO-d6 and CDCl2-Chloroquinoline-3-carbaldehyde and 2-chloro-8-methylquinoline-3-carbaldehyde were prepared according to the literature report . The var1The structures of the synthetic compounds synthesized by the procedure have been established using spectroscopic methods including UV-Vis, FT-IR, and NMR, and the result is summarized below.Rf\u2009=\u20090.22 (n-hexane\u2009:\u2009EtOAc\u2009=\u20099\u2009:\u20091). UV-Vis (MeOH) \u03bbmax\u2009=\u2009280\u2009nm; IR : 3035 (CH-arom.), 1693 , 1621 (quinoline C=N str.), and 599 (aromatic C=C str.); 1H NMR : \u03b4H 7.65 , 7.88 , 7.97 , 8.07 , 8.74 , and 10.54 ; 13C NMR : \u03b4C 126.3 (C-1), 126.5 (C-8), 128.2 (C-6), 128.6 (C-4a), 129.7 (C-5), 133.6 (C-7), 140.3 (C-4), 149.6 (C-8a), 150.1 (C-2), and 189.1 (C-9).The crude product of 4 was purified by recrystallization from ethyl acetate. It was yellow crystal; mp 146\u2013148\u00b0C; yield 49%; Rf\u2009=\u20090.63 (n-hexane\u2009:\u2009EtOAc\u2009=\u20099\u2009:\u20091). UV-Vis \u03bbmax (MeOH)\u2009=\u2009375\u2009nm; IR : 3035 (CH-arom.), 1635 , 1621 (quinoline C=N str.), and 599 : \u03b4H 6.72 , 6.91 , 7.16 , 7.44 , 7.56 , 7.66 , 7.78 , 7.94 , and 8.14 ; 13C NMR : \u03b4C 125.7 (C-9), 127.2 (C-4), 127.4 (C-5), 127.9 (C-6), 128.0 (C-3), 128.3 (C-4\u2032), 128.4 (C-8), 129.0 , 129.1 , 131.2 (C-10), 133.7 (C-4), 135.9 (C-7), 138.9 (C-11), 146.6 (C-2), and 149.9 (C-8a).The crude product of 5 was purified by silica gel column chromatography using n-hexane\u2009:\u2009acetate (9\u2009:\u20091) as an eluent. The yield was 35.5%, a white powder; mp 58\u201360\u00b0C; n-hexane\u2009:\u2009ethyl acetate (8\u2009:\u20091) as an eluent. The yield was 40.5%, a dull yellow powder; mp 178\u2013180\u00b0C; Rf\u2009=\u20090.29 (n-hexane\u2009:\u2009EtOAc\u2009=\u20096\u2009:\u20091). UV-Vis \u03bbmax (MeOH)\u2009=\u2009400\u2009nm; IR : 3429 (N-H str.), 3023 (aromatic C-H), 1673 , 1610 (quinoline C=N str.), and 1558 and 1465 (aromatic C=C str.); 1H NMR : \u03b4H 6.56 , 6.75 , 7.09 , 7.23 , 7.32 , 7.44 , 7.59 . 7.66 , and 11.97 ; 13C NMR : \u03b4C 115.3 (C-8), 119.3 (C-4a), 122.4 (C-3), 125.4 (C-4), 127.0 (C-6), 127.9 (C-9), 128.9 , 129.0 , 129.3 (C-4\u2032), 130.6 (C-7), 132.2 (C-5), 136.9 (C-1\u2032), 137.5 (C-10), 138.7 (C-8a), and 161.8 (C-2).The crude product of 7 was purified by silica gel column chromatography using Rf\u2009=\u20090.32 (n-hexane\u2009:\u2009EtOAc\u2009=\u20099\u2009:\u20091). UV-Vis \u03bbmax (MeOH)\u2009=\u2009295\u2009nm; IR : 3065.4 (aromatic C-H str.), 2919.3 , 2847 , 1673 , 1620 (quinoline C=N str.), and 1599 and 1579 (aromatic C=C str.); 1H NMR : \u03b4H 4.22 , 7.45 , 7.76 , 7.85 , 8.60 , and 10.49 ; 13C NMR : \u03b4C 55.9 (C-10), 120.0 (C-3), 124.4 (C-6), 125.1 (C-4a), 127.1 (C-8), 129.8 (C-5), 132.6 (C-7), 140.0 (C-3), 149.0 (C-8a), 161.2 (C-2), and 189.4 (C-9).Compound 8 was a gray powder; the yield was 90%; mp 106\u2013108\u00b0C; n-hexane\u2009:\u2009ethylacetate (9\u2009:\u20091) as an eluent. The yield was 28.3%; it was a gray powder; mp 138\u2013140\u00b0C; Rf\u2009=\u20090.52 (n-hexane\u2009:\u2009EtOAc\u2009=\u20099\u2009:\u20091). UV-Vis \u03bbmax (MeOH)\u2009=\u2009322\u2009nm; IR : 3065.4 (aromatic C-H str.), 2919.3 , 2847 , 1630 , 1620 (quinoline C=N str.), and 1599 and 1579 (aromatic C=C str.); 1H NMR : \u03b4H 3.97 , 6.65 , 6.78 , 7.21 , 7.34 , 7.42 , 7.61 , 7.78 , and 7.91 ; 13C NMR : \u03b4C 54.1 (-OCH3), 122.1 (C-3), 124.6 (C-4a), 124.7 (C-9), 126.9 (C-2\u2032), 127.1 (C-8), 127.9 (C-5), 128.0 (C-6\u2032), 128.8 , 129.29 (C-4\u2032), 130.0 (C-10), 132.7 (C-4), 136.7 (C-7), 137.7 (C-1\u2032), 145.6 (C-8a), and 160.2 (C-2).The crude product of 9 was purified by silica gel column chromatography using Rf\u2009=\u20090.25 (n-hexane\u2009:\u2009Methanol\u2009=\u20097\u2009:\u20093). UV-Vis \u03bbmax (MeOH)\u2009=\u2009390\u2009nm; IR : 3525\u20133510 (O-H and N-H), 3065.4 (aromatic C-H str.), 2919.3 , 2847 , 1623 (imine C=N str.), 1620 (quinoline C=N str.), and 1599 and 1579 (aromatic C=C str.) 1H NMR : \u03b4H 3.65 , 4.72 , 4.92 , 7.19 , 7.55 , 7.72 , 8.21 , 8.5 , and 9.55 ; 13C NMR : \u03b4C 43.4 (C-14), 60.5 (C-12), 61.2 (C-15), 63.7 (C-11), 117.2 (C-3), 121.9 (C-8), 122.4 (C-4a), 125.7 (C-5), 128.9 (C-6), 131.5 (C-7), 143.0 (C-4), 148.3 (C-8a), 155.4 (C-2), and 163.8 (C-9); Dept-135 \u03b4C 43.4 (C-14 down), 60.5 (C-12 down), 61.2 (C-15 down), 63.7 ( C-11 down), 121.9 (C-8), 125.7 (C-5), 128.9 (C-6), 131.5 (C-7), 143.0 (C-4), and 163.8 (C-9).Compound 10 was a yellow powder, and the overall yield was 84%; mp 80\u201382\u00b0C; Rf\u2009=\u20090.30 (n-hexane\u2009:\u2009EtOAc\u2009=\u20099\u2009:\u20091). UV-Vis \u03bbmax (MeOH)\u2009=\u2009295\u2009nm; IR  3223, 3025 (arom-C-H.), 2956 , 2837 , 1683.3 (C=O str.), 1621 (quinoline C=N str.), and 1579 (aromatic C=C str.); 1H NMR : \u03b4H 2.80 , 7.53 , 7.70 , 7.78 , 8.70 , and 10.6 ; 13C NMR : \u03b4C 17.8 (C-10), 126.0 (C-3), 126.5 (C-6), 127.5 (C-5), 127.8 (C-4a), 133.6 (C-7), 136.9 (C-8), 140.4 (C-4), 148.7 (C-2), 149.4 (C-8a), and 189.5 (C-1).The crude product 14 was recrystallized from EtOAc. Yield after recrystallization was 38.75%, pale yellow crystal; mp 139 140\u00b0C; n-hexane\u2009:\u2009ethyl acetate 9\u2009:\u20091). The yield was a yellow gum; Rf\u2009=\u20090.7 (n-hexane\u2009:\u2009EtOAc\u2009=\u20099\u2009:\u20091). UV-Vis \u03bbmax (MeOH)\u2009=\u2009375\u2009nm; IR  3025 (arom-C-H.), 2956 , 2837 , 1630 , 1621 (quinoline C=N str.), and 1579 (aromatic C=C str.); 1H NMR : \u03b4H 7.36 , 7.44 , 7.52 , 7.61 , 7.66 , 7.85 , and 7 and 8.78 ; 13C NMR : \u03b4C 17.5 (C-11), 123.1 (C-6), 126.4 (C-6), 126.4 (C-9), 127.4 , 127.7 (C-9), 127.8 (C-4\u2032), 128.1 (C-6\u2032), 129.4 , 129.7 (C-4a), 131.1 (C-2\u2032), 133.9 (C-7), 135.4 (C-4), 135.8 (C-8), 136.8 (C-1\u2032), 145.7 (C-2), and 148.7 (C-8a).The crude product of 14 was purified by silica gel column chromatography (solvent Rf\u2009=\u20090.41 (n-hexane\u2009:\u2009EtOAc\u2009=\u20091\u2009:\u20091). UV-Vis \u03bbmax (MeOH)\u2009=\u2009375\u2009nm, IR  3429 (O-H str.), 3179.5 (NH str.), 3023 (aromatic C-H), 2919.8 , 2837.2  1673 (C=O str.), 1610 (quinoline C=N str.), and 1558 and 1465 (aromatic C=C str.); 1H NMR : \u03b4H 2.56 , 7.23 , 7.51 , 7.61 , 8.49 , and 10.48 ; 13C NMR : \u03b4C 16.7 (C-10), 117.9 (C-6), 123.3 , 129.1 , 135.0 (C-5), 139.1 (C-8a), 144.2 (C-4), 162.7 (C-2), 190.00 (C-9).Compound 15 was yellow powder; mp 176\u2013178\u00b0C; 16 was purified by column chromatography with solvent n-hexane: ethylacetate (8\u2009:\u20091). The pure product was a dull yellow powder; mp 60\u201362\u00b0C; Rf\u2009=\u20090.38 (n-hexane\u2009:\u2009EtOAc\u2009=\u20096\u2009:\u20091).The crude product of \u03bbmax (MeOH)\u2009=\u2009375\u2009nm; IR : 3429 (N-H str.), 3023 (aromatic C-H), 2919.8 , 2837.2 , 1630 , 1610 (quinoline C=N str.), and 1558 and 1465 (aromatic C=C str.); 1H NMR : \u03b4H 2.56 , 7.11 , 7.24\u20137.42 , 7.69 , 8.23 , and 11.10 ; 13C NMR : \u03b4C 17.7 (C-11), 119.9 (C-8), 122.37 (C-6), 123.4 (C-4), 123.6 (C-5), 123.7 (C-9), 126.5 (C-4\u2032), 127.0 , 128.3 (C-4a), 128.4 , 131.3 (C-7), 133.7 (C-3), 136.1 (C-10), 137.7 (C-1\u2032), 136.7 (C-8a), and 162.1 (C-2).UV-Vis n-hexane\u2009:\u2009ethylacetate (7\u2009:\u20091). The pure product was a pink powder; mp 150\u2013152\u00b0C; Rf\u2009=\u20090.61 (n-hexane\u2009:\u2009EtOAc\u2009=\u20097\u2009:\u20093). UV-Vis \u03bbmax (MeOH) 315\u2009nm, 319\u2009nm; IR : 3055 (aromatic C-H str.), 1620 , 1615 (quinoline C=N str.), 1577 (aromatic C=C str.), and 1512 and 1340 (O=N-O str.); 1H NMR : \u03b4H 2.36 , 6.78 , 6.88 , 7-21-7.78 , 8.14 , 8.26 , 8.33 , and 8.72 , 13C NMR : \u03b4C 17.4 (-CH3), 121.1 (C-9), 122.3 , 122.7 (C-6), 123.6 (C-5), 127.3 , 128.1 (C-14), 128.8 , 129.3 , 130.5 (C-10), 133.8 (C-7), 135.0 , 136.9 , 137.1 (C-20), 140.0 (C-4), 143.6 (C-17), 157.2 (C-2), and 159.2 (C-8a), and peaks due to their stereoisomers were also seen.The crude product of 19 was purified by silica gel column chromatography using Rf\u2009=\u20090.42 (n-hexane\u2009:\u2009EtOAc\u2009=\u20097\u2009:\u20095). UV-Vis \u03bbmax (MeOH); IR  3281.8 (N-H str), 3055 (aromatic C-H str.), 1645.7 (NHC=O) 1620 , 1615 (quinoline C=N str.), and 1577 (aromatic C=C str.); 1H NMR : \u03b4H 2.3 , 2.33 , 6.81 , 6.89 , 7.08 , 7.25 , 7.42 , 7.63 , 7.68 , 8.06 , and 8.66 (NH); 13C NMR : \u03b4C 17.4 (C-25), 24.4 (C-24), 120.0 , 122.3 , 124.2 (C-6), 125.1 (C-5), 125.5 , 127.2 (C-9), 128.0 (C-28), 128.9 , 129.3 (C-13), 130.3 (C-15), 133.3 (C-7), 134.7 (C-20) 136.4 (C-8), 137.0 (C-11), 139.2 (C-10), 143.9 (C-17), 148.9 (C-8a), 158.6 (C-23), and 168.6 (C-2).The crude product 22 was purified by silica gel column chromatography with n-hexane\u2009:\u2009ethyl acetate (7\u2009:\u20094) as eluent. mp 178\u2013180\u00b0C; Rf\u2009=\u20090.4 (n-hexane\u2009:\u2009EtOAc\u2009=\u20097\u2009:\u20093); UV-Vis \u03bbmax (MeOH) 325\u2009nm; IR : 3470 , 3013 (aromatic C-H str.), 2930.9 , 1625 (quinoline C=N str.), 1620 , and 1589.6 and 1475.5 (aromatic C=C str.); 1H NMR : \u03b4H 2.65 , 3.99 , 5.20 , 5.25 , 7.31 , 7.51 , 7.72 , and 8.28 ; 13C NMR : \u03b4C 17.3 (C-10), 52.9 (C-11), 69.2 (C-9), 117.2 (C-6), 124.79 (C-3), 125.33 (C-5), 127.1 (C-4a), 128.9 (C-7), 133.8 (C-8), 136.7 (C-4), 143.6 (C-8a), and 158.26 (C-2).Compound 24 was purified by silica gel column chromatography using solvent n-hexane\u2009:\u2009ethyl acetate (8\u2009:\u20091). The final product was a white powder; mp 202\u2013204\u00b0C; Staphylococcus aureus (ATCC25923) and Bacillus subtilis (ATCC6633)), and two Gram-negative bacteria  and Salmonella typhimurium (ATCC 13311)) were obtained from the Adama Public Health Research & Referral Laboratory Center to evaluate the antibacterial activity of the synthetic compounds. The identity of the bacterial strains were recognized and confirmed by morphology of colony and Gram staining and by standard biochemical tests following the methods of Bergey's Manual of Determinative Bacteriology (1994) [\u03bcg/mL. Sterile filter paper discs of 6\u2009mm diameter were soaked in 1\u2009mL DMSO solution of the compounds at 250 and 500\u2009\u03bcg/mL concentrations. Then, the saturated paper discs were placed on the centre of each MHA plate. Ciprofloxacin was the standard drug used as positive control, and DMSO was used as negative control. The plates were then inverted and incubated for 24 hours at 37\u00b0C, and the zone of inhibition was recorded. The results were expressed as the mean of three measurements . The DPPH radical scavenging rate of each sample was calculated as follows [Ao is the absorbance of the control reaction and A1 is the absorbance in the presence of the test or standard sample.DPPH radical scavenging activity was used to evaluate the antioxidant activity of the synthetic compounds and compared with ascorbic acid . All syn follows , 22:(1)%The control DPPH solution was prepared by mixing 2\u2009mL 0.004% DPPH with 2\u2009mL methanol to afford 0.002% DPPH methanolic solution. The results were presented in percent radical scavenging activity , and theE. coli gyrase A and synthetic compounds in a 3D fashion, the compounds were docked within the binding site of the protein. AutoDock Vina with our previously reported protocol was used to dock the proteins  and compounds (5\u201324) into the active site of proteins [E. coli DNA gyrase A (PDB ID 1ZI0) and S. aureus Gyrase complex with ciprofloxacin and DNA (PDB ID: 2XCT) was downloaded from protein data bank. The protein preparation was carried out using the reported [To investigate the mode of interaction between the proteins , 23. Theproteins , 23. Thepounds 5\u2013 into thepounds 5\u2013 into thehttp://www.graphpad.com). Groups were analyzed for significant differences using a linear model of variance analysis (ANOVA) test for comparisons, with significance accepted for p < 0.05.Experiments were conducted in triplicates. The data presented are mean\u2009\u00b1\u2009SD of the three independent experiments. GraphPad Prism version 5.00 for Windows was used to perform the Analysis  and 2-methylacetanilide (11) were synthesized by acetylation of aniline and o-toluidine in acetic anhydride-acetic acid mixtures (3) and 2-chloro-8-methylquinoline-3-carbaldehyde (13) were developed by the application of Vilsmeier\u2013Haack reaction  as a solvent and K2CO3 as a base. The latter was selected due to its weak basicity and poor nucleophilic character which does not interfere with nucleophiles in most nucleophilic substitution reactions. The attractive features of DMF including high dielectric constant, its aprotic nature, wide liquid range, low volatility, dissolving all reactants, and supplying sufficient activation energy for the reactions allow us to use this reagent as a solvent. Furthermore, it is also miscible in water which eases the isolation of the desired product by adding the reaction mixture into cold ice water which causes the water-insoluble product to precipitate out [The hybridization of biologically active molecules is a nice tool for drug development used to treat a variety of diseases. It provides a means to improve the bioactivity of bioactive molecules through synergetic effect. Hybrid drugs can provide combination therapies in a single multifunctional agent , 24, 25.mixtures  and 2. Treaction  and 2 us3 in DMF , 24. Subtate out . Compouncis isomers which were confirmed by the coupling constant of the olefinic double bonds in the stilbenes. This agreed very well with previous products of Wittig reactions carried out at ambient temperature in DMF/KOH which gives the cis-stilbenes in good yield [cis and trans stereoisomers. A further attempt to purify 19 using silica gel column chromatography was unsuccessful since the spots of the two stereoisomers overlapped in its TLC profile. Pinacolization of carbonyls has been conducted by using a number of reagents such as Mg-MgI2 [2, transition metals, actinides, and lanthanides [II and TiIII reagents have also received considerable attention, although olefination is a competing reaction with these reagents [After securing crucial intermediates 3 and 13, attention was given to the synthesis of a series of stilbenes quinolines and their substituted analogs using Wittig reaction. In this regard, the desired products were made by reacting derivatives of compounds 3 and 13 with benzyltriphenylphosphonium chloride using DMF as a solvent and KOH as a base. The products produced are mainly od yield . However Mg-MgI2 , Zn-ZnC1thanides . TiII anreagents . Among treagents \u201328. In treagents . Methanoreagents  (Scheme S.aureus (ATCC25923), B.subtilis (ATCC6633), E. coli , and S. typhimurium (ATCC 13311)) using the paper disc diffusion method. The results of this evaluation are presented in Tables E. coli varies from 8.0\u2009\u00b1\u20090.82 to 16.0\u2009\u00b1\u20090.82\u2009mm, whereas for standard drug (ciprofloxacin) at the same concentration, it was 18.67\u2009\u00b1\u20090.47 diameter. Compounds 14 (with a mean inhibition zone of 12.67\u2009\u00b1\u20090.82\u2009mm) and 19 (with a mean inhibition zone of 16.0\u2009\u00b1\u20090.82\u2009mm) were the ones with maximum activity against E. coli.Quinolines and stilbenes and their analogs have been associated with various biological activities. Compounds containing the quinoline moiety have shown good amoebicidal, bactericidal, fungicidal, and antimalarial activities , 32. ExpZ-factor is a reflective of both the assay signal dynamic range and the data variation associated with signal measurements and, therefore, is suitable for assay quality assessment [Z-factor provides a useful tool for comparison and evaluation of the quality of assay and can be utilized in assay optimization and validation [Z-factor is defined in terms of four parameters: the means (\u03bc) and standard deviations (\u03c3) of the sample and the positive and negative controls as shown below [\u03c3s and \u03c3c are the standard deviation of the sample and control and \u03bcs and \u03bcc are the mean of the sample and control.sessment . Z-factolidation . The Z-fwn below , 31.(2)ZZ\u2032-factor can be calculated using only control data as follows:\u03c3c+ and \u03c3c\u2212 are the standard deviation of the positive and negative and \u03bcc+ and \u03bcc\u2212 are the mean of the positive and negative control, respectively.A Z-factor of the synthetic compounds and standards was calculated, and the results are presented in Z\u2032-factor for the controls ranges from 0.82 to 0.92, a reflective of excellent quality assay. It was also found out that the Z-factor for six samples was greater than 0.5, while for another six samples, the Z-value was between 0.0 to 0.5. For four and two samples, the values were between \u22120.5 to 0 and between \u22120.5 to \u22121.0, respectively. Hence, the data obtained showed a good overall assay.The S. typhimurium. Within the series, compound 16 with a mean inhibition zone of 9.67\u2009\u00b1\u20090.47\u2009mm diameter was the maximum while a 13.56\u2009\u00b1\u20090.82\u2009mm mean inhibition zone was observed for the standard drug at the same concentration. In addition, 24 showed the strongest activity against S. aureus with a 16.0\u2009\u00b1\u20091.63\u2009mm mean inhibition zone compared to 11.67\u2009\u00b1\u20090.47\u2009mm for the standard drug. However, none of the compounds showed activity against B. subtilis. Overall, among the compounds reported herein, only five of them displayed potent bioactivity.Compounds 5, 16, and 24 have moderate activity against ortho position relative to the amino group) to afford sufficient yields. However, most important bioisosters such as F, Cl, carbonyl, carboxylic acid, and sulfonyl group are electron withdrawers and deactivators and cannot be incorporated in the quinoline nucleus. But, the current hybrid scaffold overcomes this limitation since the phenyl nucleus can bear various types of functional groups (electron withdrawer or donors) in one or more of the five positions. Thus, the current strategy provides a manageable way to optimize the bioactivity through structural modification. Owing to Wittig reaction tolerance of various functional groups, phenyl ring can comprise one or more bioisosters which would be used to improve the bioactivity of quinoline-stilbenes. Regarding compound 24, which was generated by pinacolization of 2-chloro-8-methylquinoline-3-carbaldehyde, a huge improvement in the bacterial activity was observed relative to the monoalcohol  methanol of the same reactant. Previously, we reported [E. coli (with mean inhibition zone of 9.33\u2009\u00b1\u20090.89\u2009mm diameter), whereas the correspondent diol (24) was active against both S. aureus (with a mean inhibition zone of 16.0\u2009\u00b1\u20091.63\u2009mm diameter) and S. typhimurium (with a mean inhibition zone of 8.67\u2009\u00b1\u20090.47\u2009mm diameter), respectively. Furthermore, the study revealed that there is an opportunity of developing stronger bioactive molecules by pinacolization of quionoline-3-carbaldehyde derivatives bearing various bioisosteric substituents.In the current synthetic compound, the phenyl nucleus did not bear any substituents and the substituents in the quinoline nucleus were limited to the second and eight position. As a limitation, quinoline analogs synthesized by application of Vilsmeier\u2013Hack reaction require activated aniline derivatives  used as a natural antioxidant. This indicates that the activities shown by the synthetic compounds are moderate in antioxidant activity. This is in good agreement with the literature reported for closely related compounds [Most of the synthetic quinolone stilbenes and their analogs possess moderate antioxidant activity relative to ascorbic acid . Compounompounds , 33.Z-factors for the radical scavenging activity of the synthetic compounds lie between 0.88 and 0.99 . The compounds (5\u201324) were displayed a minimum binding energy ranging from \u22125.6 to \u22127.1\u2009kcal/mol , 14 , and 22  have shown hydrogen bond interaction with different amino-acid residues. The in silico interaction results are agreeing with in vitro antimicrobial analysis of the synthesized compounds against E.coli.DNA gyrase is an enzyme belonging to a member of bacterial topoisomerase which controls the topology of DNA \u201337. Henckcal/mol , with thE.coli, and among them, compound 24 revealed better activity [5 and 9 do not show any hydrogen bond interaction with any amino-acid residues within the active site. Compounds 5, 7, 9, 10, and 22 docking results were partially matching the clinical drug ciprofloxacin interactions with amino-acid residues. Based on the in silico molecular docking analysis result, compound 24  showed the highest binding affinity compared to ciprofloxacin . Therefore, compound 24 might be a better antibacterial agent than the other synthesized compounds reported herein. The binding affinity, H-bond, and residual interaction of nine compounds are summarized in E.coli DNA gyrase A are depicted in Figures Compounds 14 , 16 , 19 , and 24  showed good activities against activity . CompounE. coli with an inhibition zone of 16.0\u2009\u00b1\u20090.82\u2009mm and 14.67\u2009\u00b1\u20090.94\u2009mm at 500 and 250\u2009\u03bcg/mL, respectively. This is close to ciprofloxacin which is used as a positive control. The results of in silico molecular docking evaluation of the compounds against E. coli DNA gyrase A were also in good agreement with in vitro antibacterial analysis. Two of the compounds, 19 and 24, exhibited the highest binding affinity comparable to ciprofloxacin. Some of these compounds  possess potent antibacterial properties. The antioxidant properties of these compounds revealed that they were active only to a half extent of ascorbic acid at the same concentration. Finally, we recommended that both the antibacterial and antioxidant activities can be further optimized by incorporating active bioisostere groups on the phenyl ring of the hybrid scaffold.In conclusion, quinolone-stilbenes-merged hybrid molecules were reported by utilizing Wittig reaction between 2-chloroquinoline-3-carbaldehyde derivatives and benzyltriphenylphosphonium chloride. The 2-chloroquinoline-3- carbldehyde derivatives were synthesized by Vilsmeier\u2013Haack reaction, and the chlorine atom was replaced by various nucleophiles via a nucleophilic substitution reaction. A novel pinacol of quinoline was also synthesized by pinacolization of 2-methoxyquinoline-3-carbaldehyde with Al/KOH reagent system. The antibacterial activities of the compounds were evaluated with paper-disc diffusion against two Gram-negative and two Gram- positive bacterial strains with the best activity displayed by compound 19 against"]}
-{"representative": "The scientific assessment of regional ecosystem service value (ESV) is helpful in developing scientific ecological protection plans and compensation policies. However, an ESV evaluation method that can adapt to the complex and diverse characteristics of the ecological environment has not been established. This study takes Gansu Province in China as an example, fully considering the regional differences in ecosystem service function. Five correction indices for the value equivalent factor per unit area were constructed on a provincial scale, and a regional difference adjustment index for 11 categories of ecosystem services was constructed on a regional scale. In this way, a value evaluation model based on regional differences was established. The results show that in 2015, the total ESV reached 2,239.56 billion yuan in Gansu Province, with ESV gradually increasing from the northeast to the southwest, and the high-value areas of service function being located in Qilian and Longnan Mountains. The forest and grassland ecosystems contributed the most to the ESV. From the perspective of value composition, local climate regulation and biodiversity maintenance functions are the main service functions of Gansu Province. From 2000 to 2015, ESV increased by 3.43 billion yuan in the province. The value of forest and urban ecosystems continued to increase, whereas the value of cultivated land ecosystem continued to decrease. In terms of spatial characteristics of the service value change, the area that experienced value reduction gradually moved from the central part of Gansu Province to the surrounding areas. The evaluation method proposed in this paper provides a relatively comprehensive evaluation scheme for the spatiotemporal dynamic evaluation of ESV in complex ecological environments. Ecosystems not only provide various raw materials or products directly for human survival, but also have other functions such as regulating climate, reducing pollution, conserving water sources, maintaining soil quality, preventing wind and sand erosion, reducing disasters such as floods and fires, and protecting biodiversity. All ecosystem products and services are collectively referred to as ecosystem services (ES) ,2. The eAt present, research on the evaluation method of ESV can be roughly divided into two categories. The fist is a method based on the service function price per unit area. This method evaluates some key service functions by means of a series of ecological equations, such as food production, soil and water conservation, carbon and oxygen production, and habitat quality \u201314. The However, scholars have found that the evaluation results of the equivalent factor method are valid and reliable only when the equivalent factor accurately reflects the ecological background in the study area ,20,21. TBased on the research framework of value equivalent factor per unit area, we adopted the method of meta-analysis and fully used the evaluation results based on the physical quantity method to determine the average unit area equivalent factor in different ecosystems in Gansu Province. This method avoids or reduces the subjective conjecture easily caused by relying on the experience of experts. Additionally, abundant ecological environment data are used to correct the equivalent factor, thus completing the evaluation of ESV in complex ecological environments. Compared with previous studies ,19,27,28The types of ecosystems are complex and diverse in Gansu Province. The diversity of ecosystem types has caused significant regional differences. However, current research mostly focuses on single or several ecosystems, and only investigate certain ES functions in the ESV in Gansu Province, such as forests \u201331, grasThis study considers the regional differences and the simplicity of the equivalent factor method. In view of the application of the equivalent factors of various ecosystems on a large scale, it is necessary to closely relate the equivalent factors to the national (large) scale and to the actual situation in Gansu Province. Based on a more refined classification of the ecosystem types in Gansu Province, the study added some ecosystem equivalent factors, constructed a revised index, and revised the equivalent factors studied by Xie et al.  to form 2, with complex and diverse geological landforms and climate types. In addition to the marine ecosystem, there are six main land use or cover types, including forests, grasslands, deserts, wetlands, farmland, and urban areas. The Gansu region forms part of China\u2019s \u201ctwo screens and three belts\u201d strategic ecological security barrier policy, which aims to maintain and protect the survival and reproduction of organisms, maintain the natural ecological balance, and guarantee people\u2019s livelihoods on the Qinghai Tibet Plateau, the Sichuan\u2013Yunnan Loess Plateau and the north sand belt. It is an important water conservation and supply area in the upper reaches of the Yangtze River and the Yellow River.The case study region is located in northwest China , at the We used national ecosystem type datasets from the Satellite Application Center of the Ministry of Ecology and Environment and the Chinese Academy of Sciences, for the periods 2000, 2005, 2010, and 2015, for the classification of ecosystems. The resolution of Landsat TM/ETM images was 30 m, SPOT-5 images was 5 or 2.5 m, Envisat image was 30 m, and HJ-1 images was 30 m. From this data, and according to the study requirements, the ecosystem types were divided into 7 primary types and 21 secondary types in the research area, and a corresponding database was established.We then used data from 2,508 ground verification points, including 38 different ecosystem types, and integrated these ecosystem types with the ecosystem types obtained through the satellite images, into a final database with 21 ecosystem types, as shown in http://cdc.nmic.cn).In this study, the monthly average temperature, precipitation, and sunshine hours from 1981 to 2012 in Gansu Province and its surrounding meteorological stations were used. The data was obtained from Gansu Meteorological Bureau and China Meteorological Science Data Sharing Service Network , and the grain output of each county is from Gansu Province Rural Yearbook (2000\u20132014). The monitoring data of atmospheric environmental quality status comes from Gansu Environmental Monitoring Center Station for the period 2015\u20132018, and the monitoring data of surface water comes from the Bulletin of Environmental Conditions in Gansu Province and the Bulletin of Environmental Conditions in China, for the period 2000\u20132015.Based on the research results of Costanza et al. , de GrooD represents the ESV of a standard equivalent factor (yuan \u00b7 hm-1); SW, St, SV, and SX represe the sowing area proportion of wheat, corn, potato, and oil to the sowing area of the four crops; and FW, FT, FV, and FX represent the average net profit of wheat, corn, potato, and oil crops per unit area in Gansu Province (yuan \u00b7 hm-1).The research period in this study is 2000\u20132015, and the net profit of agricultural products differed each year due to changes in social and economic conditions, and agricultural production technology. The ESV calculated only by the net profit of agricultural products during the study period is not representative. Therefore, in addition to the statistical information obtained , the sowing area and net profit of wheat, corn, potato, and oil crops per unit area were obtained, and the average sowing proportion and average net profit were calculated. Based on this, the value of a standard equivalent factor was calculated. The calculation method was as follows:The basic value equivalent of ecosystem service function per unit area  refers to the annual average value equivalent of various service functions of different ecosystem types per unit area. Previous studies on equivalence factors ,18,19 arFor the types of ecosystems and the corresponding ecosystem service types in Gansu Province , the naRelevant international literature, such as publications by Elsevier, Springer Nature, Wiley, and the Chinese How Net database, was searched. We inputted retrieval words such as Gansu Province, the names of each basin and city in Gansu Province, Qilian Mountain, and Gannan Plateau, to obtain research results on ecosystem service value calculated by ecosystem service function quantity in Gansu Province. If, in the future, there are many more papers on the evaluation of ESV, the journals with the highest influence should be selected for average calculation, and the proportion with standard equivalent should be calculated as the basic equivalent of ecosystem service functions, such as the local climate regulation and soil conservation functions of shrubs.We prioritized the collection and sorting of domestic published research results of ecosystem service value calculated by ecosystem service function quantity. The average of selected ESV, and thereafter the proportion with standard equivalents, should be calculated, so as to convert them into the average value equivalent factor of ecosystem service function, as the basic equivalent of the ecosystem service function, which is used to determine the value equivalent of ecosystem service functions, such as garden land, shrub land, forest land, and swamp wetland.If no relevant research results for Gansu Province can be found, relevant research results for other regions in China should be collected. ESV per unit area of ecosystem should be calculated, and then compared with the standard equivalent value. It can be converted into an average value equivalent factor of ecosystem service function by constructing a correction coefficient, as the basic equivalent of the ecosystem service function, which is used to determine the value equivalent of some ecosystem service functions, such as lakes, reservoirs, saline alkali land, and urban green space.There are great differences between the ecosystem service functions in Gansu Province and those of the entire country. Therefore, in this study, the value equivalence factor was localized and calibrated by calculating the ecosystem service function quantity per unit area, such as the biodiversity maintenance value of forest land, grassland, wetlands, and desert ecosystems, and the crop supply service of paddy fields and dry land.If there is no ecosystem service function value listed in directly corresponding documents in the secondary classification of ecosystem, and it is therefore difficult to calculate the ESV, refer to the equivalent factors listed by Xie et al. , as theyThrough the above six steps, the value of the main ecosystem types for a certain ecosystem service function per unit area in Gansu Province can be obtained, by referring to relevant literature or doing calculations, as shown in 1N)Crop supply correction index  \u00d7 sowing proportion of wheat + (average yield per unit area of corn/average yield per unit area of corn) \u00d7 sowing proportion of corn + (average yield per unit area of potato/average yield per unit area of potato) \u00d7 sowing proportion of potato + (average yield per unit area of oil/average yield per unit area of oil) \u00d7 sowing proportion of oil.The calculation of y is based on the following formula: Y is the same as that of y.The calculation method of 2D)Fresh water supply correction index , and W is the average water supply per unit area in China . The water supply data comes from the Water Resources Bulletins (2000\u20132015) for Gansu Province and China.The fresh water supply correction index is calculated as follows:3Air quality regulation correction index (K)a is the average proportion of air quality standards of prefecture level cities in Gansu Province, and A is the average proportion of air quality standards of prefecture level cities in China. The air quality standards data come from the Environmental Quality Bulletins (2000\u20132015) for Gansu Province and China.The air quality regulation correction index is calculated as follows:4S)Water purification correction index  for Gansu Province and China.The calculation method of water purification correction index is as follows:5Y)Entertainment and aesthetic value correction index  for Gansu Province and China.The calculation method of entertainment and aesthetics value is calculated as follows:1A1)Crop supply regulation index Livestock supply adjustment index Fresh water supply regulation index di is the average NPP of each partition; d1 is the NPP value of the high adjustment area; d2 is the mean value of NPP in the middle regulation area; and d3 is the NPP value of the low regulation area.The local climate regulation index was calculated as follows:A large amount of observation data analysis shows that a change in surface vegetation may have a significant impact on local and regional climate by changing surface attributes such as surface albedo, roughness, and soil moisture \u201376. The 5A5)Air quality regulation index Groundwater recharge regulation index Soil conservation regulation index Regulation index of windbreak and sand fixation Water purification regulation index Entertainment aesthetics value adjustment index  is generally regarded as the tourism area, with the remaining areas having the lowest entertainment and aesthetic value. The adjustment indexes of the different regions are assigned by expert judgment.11a11)Biodiversity maintenance value regulation index  was calculated using the following equation ; and n is the grid number.Different geomorphic types will affect the distribution of light, heat, water, and soil types in the region . Similarequation :V=\u2211i=1cDesert is the largest ecosystem type in Gansu Province , followeIn general, ESV decreases from south to north, and from east to west in Gansu Province , which iThe value of local climate regulation and biodiversity maintenance  is much The value of the grassland and forest ecosystems is the highest, accounting for more than 75% of the total value , whereasOver the past 15 y, the townships with increased ESV are mainly distributed in the east and south of Gansu Province, and west of the Hexi Corridor. The townships which had a decrease in ESV are located in Qilian Mountain and Gannan Plateau .Over the past 15 y, the number of townships with increased ESV has decreased. There were 959 townships with an increased ESV in 2000\u20132005, 758 townships in 2005\u20132010, and only 391 townships increased in value in 2010\u20132015. From 2000 to 2015, there were 818 townships with increased ESV.From 2000 to 2005, townships with increased ESV were mainly distributed in the Qilian Mountain, and the eastern and southern parts of Gansu . From 2005 to 2010, the ESV of most townships decreased in the Gannan Plateau and Qilian Mountain, whereas the increased townships were mainly located in Tianshui, Longnan, and the western section of the Hexi Corridor. From 2010 to 2015, the ESV of most townships declined in Lanzhou, Baiyin, Dingxi, Gannan Plateau, and Hexi Corridor, and the townships where the value increased were concentrated in the north and south.In this study, ESV was evaluated by improving the value equivalent factor per unit area and constructing a regional differential value assessment model in Gansu Province. Different ecosystem types provide different ES types to humans. In the current research on ESV, scholars mostly refer to the classification of ecosystem types by Costanza et al. , which iIn different regions, the same ecosystem type provides different ES and their value to humans are quite different. Therefore, the value equivalent factor of Costanza et al.  and Xie The accurate construction of the equivalent factor table is the core of the equivalent factor method. In the process of improving the equivalent factor table of Xie et al. , this stESV assessment has been studied extensively in other regions of China, whereas there are few related studies on ESV in Gansu Province. The existing research focuses on the value of a single ecosystem service on a provincial scale ,34,81, aBased on the characteristics of ecosystems in Gansu Province, this study developed a revised index based on an increase in some ecosystem equivalent factors, and revised the equivalent factors studied by Xie et al.  to form The desert ecosystem type covers the largest area in Gansu Province, followed by grassland, arable land, and forest ecosystems, and the remaining ecosystems account for only a small part. Desert is mostly located in northern Gansu. Grasslands are mainly located in the Gannan Plateau, Longzhong, and Longdong. Cultivated land is mainly located in Longzhong and Hexi Corridor, and forests are mainly located in Longnan, Ziwuling, and the Qilian Mountains.From 2000 to 2015, the grassland ecosystem area increased the most, whereas the cultivated land ecosystem area decreased the most. Forest, grassland, and urban ecosystems in Gansu Province continue to increase. Cultivated land ecosystems continue to decrease. Although wetlands and glacial ecosystems have increased over the past 15 y, they have decreased over the long term. The number of desert ecosystems has increased.In 2015, the total ESV for Gansu Province reached 2,239.56 billion yuan, to which the forest and grassland ecosystems contributed the most. In terms of the value of each service function of the ecosystem, the local climate regulation and biodiversity maintenance functions are the main service functions in the province. Regarding the spatial distribution of service values, ESV gradually increases from northeast to southwest, and the areas with high ESV concentrations are Qilian and Longnan Mountains.From 2000 to 2015, ESV increased by 3.43 billion yuan in Gansu Province. The value of forest ecosystems increased the most, whereas the value of grassland ecosystems decreased the most, showing a trend of increasing first, then decreasing, and then slowly increasing again. The value of forest and urban ecosystems continues to increase, and the value of cultivated land ecosystems continues to decrease. From the spatial characteristics of ESV changes, areas with reduced values gradually move from central Gansu to the surrounding areas.S1 Data(ZIP)Click here for additional data file. 27 Oct 2020PONE-D-20-28811Evaluation method of ecosystem service value under complex ecological environment: A case study of Gansu Province, ChinaPLOS ONEDear Dr. zhao,Thank you for submitting your manuscript to PLOS ONE. After careful consideration, we feel that it has merit but does not fully meet PLOS ONE\u2019s publication criteria as it currently stands. Therefore, we invite you to submit a revised version of the manuscript that addresses the points raised during the review process.plosone@plos.org. When you're ready to submit your revision, log on to https://www.editorialmanager.com/pone/ and select the 'Submissions Needing Revision' folder to locate your manuscript file.Please submit your revised manuscript by Dec 11 2020 11:59PM. If you will need more time than this to complete your revisions, please reply to this message or contact the journal office at Please include the following items when submitting your revised manuscript:A rebuttal letter that responds to each point raised by the academic editor and reviewer(s). You should upload this letter as a separate file labeled 'Response to Reviewers'.A marked-up copy of your manuscript that highlights changes made to the original version. You should upload this as a separate file labeled 'Revised Manuscript with Track Changes'.An unmarked version of your revised paper without tracked changes. You should upload this as a separate file labeled 'Manuscript'.If you would like to make changes to your financial disclosure, please include your updated statement in your cover letter. Guidelines for resubmitting your figure files are available below the reviewer comments at the end of this letter.http://journals.plos.org/plosone/s/submission-guidelines#loc-laboratory-protocolsIf applicable, we recommend that you deposit your laboratory protocols in protocols.io to enhance the reproducibility of your results. Protocols.io assigns your protocol its own identifier (DOI) so that it can be cited independently in the future. For instructions see:\u00a0We look forward to receiving your revised manuscript.Kind regards,Bing Xue, Ph.D.Academic EditorPLOS ONEJournal Requirements:When submitting your revision, we need you to address these additional requirements.1. Please ensure that your manuscript meets PLOS ONE's style requirements, including those for file naming. The PLOS ONE style templates can be found athttps://journals.plos.org/plosone/s/file?id=wjVg/PLOSOne_formatting_sample_main_body.pdf andhttps://journals.plos.org/plosone/s/file?id=ba62/PLOSOne_formatting_sample_title_authors_affiliations.pdf2.\u00a0 We suggest you thoroughly copyedit your manuscript for language usage, spelling, and grammar. If you do not know anyone who can help you do this, you may wish to consider employing a professional scientific editing service. \u00a0http://learn.aje.com/plos/) for a 15% discount off AJE services. To take advantage of our partnership with Editage, visit the Editage website (www.editage.com) and enter referral code PLOSEDIT for a 15% discount off Editage services.\u00a0 If the PLOS editorial team finds any language issues in text that either AJE or Editage has edited, the service provider will re-edit the text for free.Whilst you may use any professional scientific editing service of your choice, PLOS has partnered with both American Journal Experts (AJE) and Editage to provide discounted services to PLOS authors. Both organizations have experience helping authors meet PLOS guidelines and can provide language editing, translation, manuscript formatting, and figure formatting to ensure your manuscript meets our submission guidelines. To take advantage of our partnership with AJE, visit the AJE website A clean copy of the edited manuscript (uploaded as the new *manuscript* file)3. Thank you for stating the following financial disclosure:\"The full name of each funder\"At this time, please address the following queries:Please clarify the sources of funding  for your study. List the grants or organizations that supported your study, including funding received from your institution.State what role the funders took in the study. If the funders had no role in your study, please state: \u201cThe funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript.\u201dIf any authors received a salary from any of your funders, please state which authors and which funders.If you did not receive any funding for this study, please state: \u201cThe authors received no specific funding for this work.\u201dPlease include your amended statements within your cover letter; we will change the online submission form on your behalf.https://www.youtube.com/watch?v=_xcclfuvtxQ3. PLOS requires an ORCID iD for the corresponding author in Editorial Manager on papers submitted after December 6th, 2016. Please ensure that you have an ORCID iD and that it is validated in Editorial Manager. To do this, go to \u2018Update my Information\u2019 (in the upper left-hand corner of the main menu), and click on the Fetch/Validate link next to the ORCID field. This will take you to the ORCID site and allow you to create a new iD or authenticate a pre-existing iD in Editorial Manager. Please see the following video for instructions on linking an ORCID iD to your Editorial Manager account: http://journals.plos.org/plosone/s/licenses-and-copyright.4. We note that Figures 1, 3 and 4 in your submission contain map images which may be copyrighted. All PLOS content is published under the Creative Commons Attribution License (CC BY 4.0), which means that the manuscript, images, and Supporting Information files will be freely available online, and any third party is permitted to access, download, copy, distribute, and use these materials in any way, even commercially, with proper attribution. For these reasons, we cannot publish previously copyrighted maps or satellite images created using proprietary data, such as Google software . For more information, see our copyright guidelines: We require you to either (1) present written permission from the copyright holder to publish these figures specifically under the CC BY 4.0 license, or (2) remove the figures from your submission:4.1.\u00a0\u00a0\u00a0 You may seek permission from the original copyright holder of Figures 1, 3 and 4 to publish the content specifically under the CC BY 4.0 license.\u00a0http://journals.plos.org/plosone/s/file?id=7c09/content-permission-form.pdf) and the following text:We recommend that you contact the original copyright holder with the Content Permission Form (http://creativecommons.org/licenses/by/4.0/). Please be aware that this license allows unrestricted use and distribution, even commercially, by third parties. Please reply and provide explicit written permission to publish XXX under a CC BY license and complete the attached form.\u201d\u201cI request permission for the open-access journal PLOS ONE to publish XXX under the Creative Commons Attribution License (CCAL) CC BY 4.0  remove the figure or ii) supply a replacement figure that complies with the CC BY 4.0 license. Please check copyright information on all replacement figures and update the figure caption with source information. If applicable, please specify in the figure caption text when a figure is similar but not identical to the original image and is therefore for illustrative purposes only.The following resources for replacing copyrighted map figures may be helpful:http://viewer.nationalmap.gov/viewer/USGS National Map Viewer (public domain): http://eol.jsc.nasa.gov/sseop/clickmap/The Gateway to Astronaut Photography of Earth (public domain): https://www.cia.gov/library/publications/the-world-factbook/index.html and https://www.cia.gov/library/publications/cia-maps-publications/index.htmlMaps at the CIA (public domain): http://earthobservatory.nasa.gov/NASA Earth Observatory (public domain): http://landsat.visibleearth.nasa.gov/Landsat: http://eros.usgs.gov/#USGS EROS (Earth Resources Observatory and Science (EROS) Center) (public domain): http://www.naturalearthdata.com/Natural Earth (public domain): [Note: HTML markup is below. Please do not edit.]Reviewers' comments:Reviewer's Responses to QuestionsComments to the Author1. Is the manuscript technically sound, and do the data support the conclusions?The manuscript must describe a technically sound piece of scientific research with data that supports the conclusions. Experiments must have been conducted rigorously, with appropriate controls, replication, and sample sizes. The conclusions must be drawn appropriately based on the data presented. Reviewer #1:\u00a0YesReviewer #2:\u00a0YesReviewer #3:\u00a0Yes**********2. Has the statistical analysis been performed appropriately and rigorously? Reviewer #1:\u00a0YesReviewer #2:\u00a0YesReviewer #3:\u00a0N/A**********3. Have the authors made all data underlying the findings in their manuscript fully available?PLOS Data policy requires authors to make all data underlying the findings described in their manuscript fully available without restriction, with rare exception (please refer to the Data Availability Statement in the manuscript PDF file). The data should be provided as part of the manuscript or its supporting information, or deposited to a public repository. For example, in addition to summary statistics, the data points behind means, medians and variance measures should be available. If there are restrictions on publicly sharing data\u2014e.g. participant privacy or use of data from a third party\u2014those must be specified.The Reviewer #1:\u00a0YesReviewer #2:\u00a0YesReviewer #3:\u00a0Yes**********4. Is the manuscript presented in an intelligible fashion and written in standard English?PLOS ONE does not copyedit accepted manuscripts, so the language in submitted articles must be clear, correct, and unambiguous. Any typographical or grammatical errors should be corrected at revision, so please note any specific errors here.Reviewer #1:\u00a0YesReviewer #2:\u00a0YesReviewer #3:\u00a0No**********5. Review Comments to the AuthorPlease use the space provided to explain your answers to the questions above. You may also include additional comments for the author, including concerns about dual publication, research ethics, or publication ethics. Reviewer #1:\u00a0In this paper, xiaojiong Zhao et al. has taken Gansu Province as an example, the regional division method of ecosystem service function is proposed based on the characteristics of differences among different regions, and the variation trend of ESV in Gansu province from 2000 to 2015 is analyzed, which expands the thinking of regional ecological evaluation. The subject matter of this paper is novel, the Angle is clear, the data analysis process is accurate and careful. However, the manuscript needs revision before it is acceptable for publication. The writing of the paper should be improved, I found some of the text is repetition and some parts are not very fluid. The specific sections are questions that should be answered before accepting and proceeding to publications.1. In introduction, It is recommended that authors add comparisons with other ecosystem service value studies and introduce the advantages of the approach used in this article;2. In the discussion section, I suggest comparing with other ecological service value assessment methods in Gansu Province;3.There are still some problems in English grammar and sentences. Please check and correct them carefully.Reviewer #2:\u00a0comments to the Author:The first time I looked at the title \" Evaluation method of ecosystem service value under complex ecological environment: A case study of Gansu Province, China \", I was just wondering to know how would the authors deal with this topic. I was a little impressed and felt that this might be a very interesting manuscript. When I reviewed the manuscript, I didn't feel disappointed. In the manuscript, On the one hand, the average value equivalent factor per unit area of different ecosystems is determined in Gansu Province, with reference to the six calculation process. This method of meta-analysis will avoid or reduce the subjective conjecture which is easy to be caused by relying on experts' experience; On the other, through abundant eco-environmental data, this study established a value evaluation model and completed the evaluation of ecosystem service value under complex ecological environment. In particular, one thing is affirmed that the human activity factors that affect ecosystem service value are fully considered by Author to the evaluation of ecosystem service value, such as carrying capacity, air pollution, over exploitation of groundwater and water pollution etc. The methods and data used in the study are new. The manuscript meets the requirement for acceptation for publication.My main concerns are as follows:Introduction1. The description of Gansu Province may be suitable for the part of study area.2. There lacks enough literature review on the topic in the study area. The authors may check some references on this topic in last decades.Materials and Methods1. What is the basis of the ecosystem type classification?2. Please supplement the distribution map of ecosystem types3. from 2000-2015, what does this mean? The authors have to state clearly which year was used.4. Classification of ecosystem service functions. Please explain the specific problem of repeatability. The description is not fully understood due to the ecological integrity has been evaluated in previous research.Result1. In the Table3, the unit of area is km2, while in formula 19, the unit of area is ha.2. Biodiversity maintenance value regulation index (a11), How the habitat quality index is measured?3. \"invest\" should be \"InVEST\"Other detail questionEnglish needs proofreading and editing, especially those sentences related to comparison. In addition, there exists many formatting problems in this manuscript, please verify the full text.1.Please unify the number of decimal points in the whole text.2. Table1. Please note that the black space.Reviewer #3:\u00a0(1)The paper takes Gansu Province as an example, on the basis of fully considering the 6 regional differences of ecosystem service function. But it don\u2019t explain why Gansu was taken as an example? Does Gansu have a typical ecological service system?(2)making dialogue with the ESV evaluation and calculation literatures by taking the role of your specific context.(3)This paper did a poor job in readability, with many typo errors and unstructured sentences. The authors need a copy editor before next submission.**********what does this mean?). If published, this will include your full peer review and any attached files.6. PLOS authors have the option to publish the peer review history of their article  digital diagnostic tool,\u00a0Attachmentreviewers comments.docxSubmitted filename: Click here for additional data file. 12 Dec 2020Reply to Reviewer #1Comment1:\u201cIn introduction, It is recommended that authors add comparisons with other ecosystem service value studies and introduce the advantages of the approach used in this article.\u201dResponse1: We added comparisons with other ecosystem service value studies and introduce the advantages of the approach used in this article, line108-118 in marked-up copy of my manuscript. The modified part is highlighted in yellow.Comment2:\u201cIn the discussion section, I suggest comparing with other ecological service value assessment methods in Gansu Province.\u201dResponse2: There are few methods to evaluate the value of ecosystem services in Gansu Province, through literature retrieval, we compared with the study by Wang et al; line735-736 in marked-up copy of my manuscript. The modified part is highlighted in yellow.Comment3:\u201cThere are still some problems in English grammar and sentences. Please check and correct them carefully.\u201dResponse3: We used Editage for English language editing that edited my manuscript, and we have carefully and thoroughly proofread the manuscript to correct all the grammar and typos. For details of manuscript editing, please refer to marked-up copy of my manuscript.Reply to Reviewer #2Comment1: \u201cIn introduction, the description of Gansu Province may be suitable for the part of study area.\u201dResponse1:In introduction,\u201cGansu Province is located in the northwestern inland in China. \u2026..Its special geographical location and natural conditions form a more distinct ecological structure.\u201d, this part is repeated with the content in the study area, so this description of Gansu Province has been deleted in introduction. line 119 in marked-up copy of my manuscript. The modified part is highlighted in yellow.Comment2: \u201cThere lacks enough literature review on the topic in the study area. The authors may check some references on this topic in last decades. \u201dResponse2: We checked some references about method of ecosystem services value, and added other ecosystem service value studies. line 108-118 in marked-up copy of my manuscript. The modified part is highlighted in yellow.Comment3: \u201cWhat is the basis of the ecosystem type classification? \u201dResponse3: The basis of the ecosystem type classification was added in Ecosystem type data, line 160-184 in marked-up copy of my manuscript. The modified part is highlighted in yellow.Comment4: \u201cPlease supplement the distribution map of ecosystem types.\u201dResponse4:The distribution map of ecosystem types was added in line 185 in marked-up copy of my manuscript. The modified part is highlighted in yellow.Comment5: \u201cfrom 2000-2015, what does this mean? The authors have to state clearly which year was used. \u201dResponse5: The mean is \u201cfrom 2000, 2005, 2010, and 2015\u201d. line 194-195 in marked-up copy of my manuscript. The modified part is highlighted in yellow.Comment6: \u201cClassification of ecosystem service functions. Please explain the specific problem of repeatability. The description is not fully understood due to the ecological integrity has been evaluated in previous research. \u201dResponse6: \u201cThe specific problem of repeatability\u201d means is \u201cthe double- counting problem between ecological integrity and other ecosystem services\u201d. line 217-219 in marked-up copy of my manuscript. The modified part is highlighted in yellow.Comment7: \u201cIn the Table3, the unit of area is km2, while in formula 19, the unit of area is ha. \u201dResponse7: The unit of area is unified as km2. line 593 in marked-up copy of my manuscript. The modified part is highlighted in yellow.Comment8: \u201cBiodiversity maintenance value regulation index (a11), How the habitat quality index is measured? \u201dResponse8: The habitat quality index was measured in detail in another article of the author, so we added the reference. line 562-563 in marked-up copy of my manuscript. The modified part is highlighted in yellow.Comment9:\u201c\"invest\" should be \"InVEST\"\u201dResponse9: We modified the invest to InVEST. line 562 in marked-up copy of my manuscript. The modified part is highlighted in yellow.Comment10:\u201cEnglish needs proofreading and editing, especially those sentences related to comparison. In addition, there exists many formatting problems in this manuscript, please verify the full text. \u201dResponse10: We used Editage for English language editing that edited my manuscript, and we have carefully and thoroughly proofread the manuscript to correct all the grammar and typos. For details of manuscript editing, please refer to marked-up copy of my manuscript.Comment11:\u201cPlease unify the number of decimal points in the whole text. \u201dResponse11: We unified the number of decimal points in the whole text.line 37, 42,567,612,632,646 in marked-up copy of my manuscript. The modified part is highlighted in yellow.Comment 12:\u201cTable1. Please note that the black space. \u201dResponse12: We revised the black space. line 314 in marked-up copy of my manuscript. The modified part is highlighted in yellow.Reply to Reviewer #3Comment1: \u201cThe paper takes Gansu Province as an example, on the basis of fully considering the 6 regional differences of ecosystem service function. But it don\u2019t explain why Gansu was taken as an example? Does Gansu have a typical ecological service system? \u201dResponse1: We stated the reasons that the types of ecosystems are complex and diverse in Gansu Province, line 119-127 in marked-up copy of my manuscript. The modified part is highlighted in yellow.Comment2: \u201cmaking dialogue with the ESV evaluation and calculation literatures by taking the role of your specific context. \u201dResponse2: We have supplemented the relevant references on the other ecosystem service value studies, line108-118, 858-863 in marked-up copy of my manuscript. The modified part is highlighted in yellow.Comment3: \u201cThis paper did a poor job in readability, with many typo errors and unstructured sentences. The authors need a copy editor before next submission. \u201dResponse3: We used Editage for English language editing that edited my manuscript, and we have carefully and thoroughly proofread the manuscript to correct all the grammar and typos. For details of manuscript editing, please refer to marked-up copy of my manuscript.AttachmentResponse to Reviewers.docxSubmitted filename: Click here for additional data file. 18 Jan 2021Ecosystem service value evaluation method in a complex ecological environment: A case study of Gansu Province, ChinaPONE-D-20-28811R1Dear Dr. zhao,We\u2019re pleased to inform you that your manuscript has been judged scientifically suitable for publication and will be formally accepted for publication once it meets all outstanding technical requirements.Within one week, you\u2019ll receive an e-mail detailing the required amendments. When these have been addressed, you\u2019ll receive a formal acceptance letter and your manuscript will be scheduled for publication.http://www.editorialmanager.com/pone/, click the 'Update My Information' link at the top of the page, and double check that your user information is up-to-date. If you have any billing related questions, please contact our Author Billing department directly at authorbilling@plos.org.An invoice for payment will follow shortly after the formal acceptance. To ensure an efficient process, please log into Editorial Manager at onepress@plos.org.If your institution or institutions have a press office, please notify them about your upcoming paper to help maximize its impact. If they\u2019ll be preparing press materials, please inform our press team as soon as possible -- no later than 48 hours after receiving the formal acceptance. Your manuscript will remain under strict press embargo until 2 pm Eastern Time on the date of publication. For more information, please contact Kind regards,Bing Xue, Ph.D.Academic EditorPLOS ONEAdditional Editor Comments :Reviewers' comments:Reviewer's Responses to QuestionsComments to the Author1. If the authors have adequately addressed your comments raised in a previous round of review and you feel that this manuscript is now acceptable for publication, you may indicate that here to bypass the \u201cComments to the Author\u201d section, enter your conflict of interest statement in the \u201cConfidential to Editor\u201d section, and submit your \"Accept\" recommendation.Reviewer #1:\u00a0All comments have been addressedReviewer #3:\u00a0All comments have been addressed**********2. Is the manuscript technically sound, and do the data support the conclusions?The manuscript must describe a technically sound piece of scientific research with data that supports the conclusions. Experiments must have been conducted rigorously, with appropriate controls, replication, and sample sizes. The conclusions must be drawn appropriately based on the data presented. Reviewer #1:\u00a0YesReviewer #3:\u00a0Yes**********3. Has the statistical analysis been performed appropriately and rigorously? Reviewer #1:\u00a0YesReviewer #3:\u00a0Yes**********4. Have the authors made all data underlying the findings in their manuscript fully available?PLOS Data policy requires authors to make all data underlying the findings described in their manuscript fully available without restriction, with rare exception (please refer to the Data Availability Statement in the manuscript PDF file). The data should be provided as part of the manuscript or its supporting information, or deposited to a public repository. For example, in addition to summary statistics, the data points behind means, medians and variance measures should be available. If there are restrictions on publicly sharing data\u2014e.g. participant privacy or use of data from a third party\u2014those must be specified.The Reviewer #1:\u00a0YesReviewer #3:\u00a0Yes**********5. Is the manuscript presented in an intelligible fashion and written in standard English?PLOS ONE does not copyedit accepted manuscripts, so the language in submitted articles must be clear, correct, and unambiguous. Any typographical or grammatical errors should be corrected at revision, so please note any specific errors here.Reviewer #1:\u00a0YesReviewer #3:\u00a0Yes**********6. Review Comments to the AuthorPlease use the space provided to explain your answers to the questions above. You may also include additional comments for the author, including concerns about dual publication, research ethics, or publication ethics. Reviewer #1:\u00a0The author has added comparisons with other ecosystem service value studies and introduce the advantages of the approach used in the introduction and grammar problems also have been solved.The overall structure of the article is clear and has strong scientific and practical significance.Reviewer #3:\u00a0I really appreciate the revision made by the author, which can be seen to improve the readability of the paper.**********what does this mean?). If published, this will include your full peer review and any attached files.7. PLOS authors have the option to publish the peer review history of their article (If you choose \u201cno\u201d, your identity will remain anonymous but your review may still be made public.Do you want your identity to be public for this peer review? For information about this choice, including consent withdrawal, please see our Privacy Policy.Reviewer #1:\u00a0NoReviewer #3:\u00a0No 21 Jan 2021PONE-D-20-28811R1 Ecosystem service value evaluation method in a complex ecological environment: A case study of Gansu Province, China Dear Dr. Zhao:I'm pleased to inform you that your manuscript has been deemed suitable for publication in PLOS ONE. Congratulations! Your manuscript is now with our production department. onepress@plos.org.If your institution or institutions have a press office, please let them know about your upcoming paper now to help maximize its impact. If they'll be preparing press materials, please inform our press team within the next 48 hours. Your manuscript will remain under strict press embargo until 2 pm Eastern Time on the date of publication. For more information please contact plosone@plos.org. If we can help with anything else, please email us at Thank you for submitting your work to PLOS ONE and supporting open access. Kind regards, PLOS ONE Editorial Office Staffon behalf ofProfessor Bing Xue Academic EditorPLOS ONE", "texts": ["The scientific assessment of regional ecosystem service value (ESV) is helpful in developing scientific ecological protection plans and compensation policies. However, an ESV evaluation method that can adapt to the complex and diverse characteristics of the ecological environment has not been established. This study takes Gansu Province in China as an example, fully considering the regional differences in ecosystem service function. Five correction indices for the value equivalent factor per unit area were constructed on a provincial scale, and a regional difference adjustment index for 11 categories of ecosystem services was constructed on a regional scale. In this way, a value evaluation model based on regional differences was established. The results show that in 2015, the total ESV reached 2,239.56 billion yuan in Gansu Province, with ESV gradually increasing from the northeast to the southwest, and the high-value areas of service function being located in Qilian and Longnan Mountains. The forest and grassland ecosystems contributed the most to the ESV. From the perspective of value composition, local climate regulation and biodiversity maintenance functions are the main service functions of Gansu Province. From 2000 to 2015, ESV increased by 3.43 billion yuan in the province. The value of forest and urban ecosystems continued to increase, whereas the value of cultivated land ecosystem continued to decrease. In terms of spatial characteristics of the service value change, the area that experienced value reduction gradually moved from the central part of Gansu Province to the surrounding areas. The evaluation method proposed in this paper provides a relatively comprehensive evaluation scheme for the spatiotemporal dynamic evaluation of ESV in complex ecological environments. Ecosystems not only provide various raw materials or products directly for human survival, but also have other functions such as regulating climate, reducing pollution, conserving water sources, maintaining soil quality, preventing wind and sand erosion, reducing disasters such as floods and fires, and protecting biodiversity. All ecosystem products and services are collectively referred to as ecosystem services (ES) ,2. The eAt present, research on the evaluation method of ESV can be roughly divided into two categories. The fist is a method based on the service function price per unit area. This method evaluates some key service functions by means of a series of ecological equations, such as food production, soil and water conservation, carbon and oxygen production, and habitat quality \u201314. The However, scholars have found that the evaluation results of the equivalent factor method are valid and reliable only when the equivalent factor accurately reflects the ecological background in the study area ,20,21. TBased on the research framework of value equivalent factor per unit area, we adopted the method of meta-analysis and fully used the evaluation results based on the physical quantity method to determine the average unit area equivalent factor in different ecosystems in Gansu Province. This method avoids or reduces the subjective conjecture easily caused by relying on the experience of experts. Additionally, abundant ecological environment data are used to correct the equivalent factor, thus completing the evaluation of ESV in complex ecological environments. Compared with previous studies ,19,27,28The types of ecosystems are complex and diverse in Gansu Province. The diversity of ecosystem types has caused significant regional differences. However, current research mostly focuses on single or several ecosystems, and only investigate certain ES functions in the ESV in Gansu Province, such as forests \u201331, grasThis study considers the regional differences and the simplicity of the equivalent factor method. In view of the application of the equivalent factors of various ecosystems on a large scale, it is necessary to closely relate the equivalent factors to the national (large) scale and to the actual situation in Gansu Province. Based on a more refined classification of the ecosystem types in Gansu Province, the study added some ecosystem equivalent factors, constructed a revised index, and revised the equivalent factors studied by Xie et al.  to form 2, with complex and diverse geological landforms and climate types. In addition to the marine ecosystem, there are six main land use or cover types, including forests, grasslands, deserts, wetlands, farmland, and urban areas. The Gansu region forms part of China\u2019s \u201ctwo screens and three belts\u201d strategic ecological security barrier policy, which aims to maintain and protect the survival and reproduction of organisms, maintain the natural ecological balance, and guarantee people\u2019s livelihoods on the Qinghai Tibet Plateau, the Sichuan\u2013Yunnan Loess Plateau and the north sand belt. It is an important water conservation and supply area in the upper reaches of the Yangtze River and the Yellow River.The case study region is located in northwest China , at the We used national ecosystem type datasets from the Satellite Application Center of the Ministry of Ecology and Environment and the Chinese Academy of Sciences, for the periods 2000, 2005, 2010, and 2015, for the classification of ecosystems. The resolution of Landsat TM/ETM images was 30 m, SPOT-5 images was 5 or 2.5 m, Envisat image was 30 m, and HJ-1 images was 30 m. From this data, and according to the study requirements, the ecosystem types were divided into 7 primary types and 21 secondary types in the research area, and a corresponding database was established.We then used data from 2,508 ground verification points, including 38 different ecosystem types, and integrated these ecosystem types with the ecosystem types obtained through the satellite images, into a final database with 21 ecosystem types, as shown in http://cdc.nmic.cn).In this study, the monthly average temperature, precipitation, and sunshine hours from 1981 to 2012 in Gansu Province and its surrounding meteorological stations were used. The data was obtained from Gansu Meteorological Bureau and China Meteorological Science Data Sharing Service Network , and the grain output of each county is from Gansu Province Rural Yearbook (2000\u20132014). The monitoring data of atmospheric environmental quality status comes from Gansu Environmental Monitoring Center Station for the period 2015\u20132018, and the monitoring data of surface water comes from the Bulletin of Environmental Conditions in Gansu Province and the Bulletin of Environmental Conditions in China, for the period 2000\u20132015.Based on the research results of Costanza et al. , de GrooD represents the ESV of a standard equivalent factor (yuan \u00b7 hm-1); SW, St, SV, and SX represe the sowing area proportion of wheat, corn, potato, and oil to the sowing area of the four crops; and FW, FT, FV, and FX represent the average net profit of wheat, corn, potato, and oil crops per unit area in Gansu Province (yuan \u00b7 hm-1).The research period in this study is 2000\u20132015, and the net profit of agricultural products differed each year due to changes in social and economic conditions, and agricultural production technology. The ESV calculated only by the net profit of agricultural products during the study period is not representative. Therefore, in addition to the statistical information obtained , the sowing area and net profit of wheat, corn, potato, and oil crops per unit area were obtained, and the average sowing proportion and average net profit were calculated. Based on this, the value of a standard equivalent factor was calculated. The calculation method was as follows:The basic value equivalent of ecosystem service function per unit area  refers to the annual average value equivalent of various service functions of different ecosystem types per unit area. Previous studies on equivalence factors ,18,19 arFor the types of ecosystems and the corresponding ecosystem service types in Gansu Province , the naRelevant international literature, such as publications by Elsevier, Springer Nature, Wiley, and the Chinese How Net database, was searched. We inputted retrieval words such as Gansu Province, the names of each basin and city in Gansu Province, Qilian Mountain, and Gannan Plateau, to obtain research results on ecosystem service value calculated by ecosystem service function quantity in Gansu Province. If, in the future, there are many more papers on the evaluation of ESV, the journals with the highest influence should be selected for average calculation, and the proportion with standard equivalent should be calculated as the basic equivalent of ecosystem service functions, such as the local climate regulation and soil conservation functions of shrubs.We prioritized the collection and sorting of domestic published research results of ecosystem service value calculated by ecosystem service function quantity. The average of selected ESV, and thereafter the proportion with standard equivalents, should be calculated, so as to convert them into the average value equivalent factor of ecosystem service function, as the basic equivalent of the ecosystem service function, which is used to determine the value equivalent of ecosystem service functions, such as garden land, shrub land, forest land, and swamp wetland.If no relevant research results for Gansu Province can be found, relevant research results for other regions in China should be collected. ESV per unit area of ecosystem should be calculated, and then compared with the standard equivalent value. It can be converted into an average value equivalent factor of ecosystem service function by constructing a correction coefficient, as the basic equivalent of the ecosystem service function, which is used to determine the value equivalent of some ecosystem service functions, such as lakes, reservoirs, saline alkali land, and urban green space.There are great differences between the ecosystem service functions in Gansu Province and those of the entire country. Therefore, in this study, the value equivalence factor was localized and calibrated by calculating the ecosystem service function quantity per unit area, such as the biodiversity maintenance value of forest land, grassland, wetlands, and desert ecosystems, and the crop supply service of paddy fields and dry land.If there is no ecosystem service function value listed in directly corresponding documents in the secondary classification of ecosystem, and it is therefore difficult to calculate the ESV, refer to the equivalent factors listed by Xie et al. , as theyThrough the above six steps, the value of the main ecosystem types for a certain ecosystem service function per unit area in Gansu Province can be obtained, by referring to relevant literature or doing calculations, as shown in 1N)Crop supply correction index  \u00d7 sowing proportion of wheat + (average yield per unit area of corn/average yield per unit area of corn) \u00d7 sowing proportion of corn + (average yield per unit area of potato/average yield per unit area of potato) \u00d7 sowing proportion of potato + (average yield per unit area of oil/average yield per unit area of oil) \u00d7 sowing proportion of oil.The calculation of y is based on the following formula: Y is the same as that of y.The calculation method of 2D)Fresh water supply correction index , and W is the average water supply per unit area in China . The water supply data comes from the Water Resources Bulletins (2000\u20132015) for Gansu Province and China.The fresh water supply correction index is calculated as follows:3Air quality regulation correction index (K)a is the average proportion of air quality standards of prefecture level cities in Gansu Province, and A is the average proportion of air quality standards of prefecture level cities in China. The air quality standards data come from the Environmental Quality Bulletins (2000\u20132015) for Gansu Province and China.The air quality regulation correction index is calculated as follows:4S)Water purification correction index  for Gansu Province and China.The calculation method of water purification correction index is as follows:5Y)Entertainment and aesthetic value correction index  for Gansu Province and China.The calculation method of entertainment and aesthetics value is calculated as follows:1A1)Crop supply regulation index Livestock supply adjustment index Fresh water supply regulation index di is the average NPP of each partition; d1 is the NPP value of the high adjustment area; d2 is the mean value of NPP in the middle regulation area; and d3 is the NPP value of the low regulation area.The local climate regulation index was calculated as follows:A large amount of observation data analysis shows that a change in surface vegetation may have a significant impact on local and regional climate by changing surface attributes such as surface albedo, roughness, and soil moisture \u201376. The 5A5)Air quality regulation index Groundwater recharge regulation index Soil conservation regulation index Regulation index of windbreak and sand fixation Water purification regulation index Entertainment aesthetics value adjustment index  is generally regarded as the tourism area, with the remaining areas having the lowest entertainment and aesthetic value. The adjustment indexes of the different regions are assigned by expert judgment.11a11)Biodiversity maintenance value regulation index  was calculated using the following equation ; and n is the grid number.Different geomorphic types will affect the distribution of light, heat, water, and soil types in the region . Similarequation :V=\u2211i=1cDesert is the largest ecosystem type in Gansu Province , followeIn general, ESV decreases from south to north, and from east to west in Gansu Province , which iThe value of local climate regulation and biodiversity maintenance  is much The value of the grassland and forest ecosystems is the highest, accounting for more than 75% of the total value , whereasOver the past 15 y, the townships with increased ESV are mainly distributed in the east and south of Gansu Province, and west of the Hexi Corridor. The townships which had a decrease in ESV are located in Qilian Mountain and Gannan Plateau .Over the past 15 y, the number of townships with increased ESV has decreased. There were 959 townships with an increased ESV in 2000\u20132005, 758 townships in 2005\u20132010, and only 391 townships increased in value in 2010\u20132015. From 2000 to 2015, there were 818 townships with increased ESV.From 2000 to 2005, townships with increased ESV were mainly distributed in the Qilian Mountain, and the eastern and southern parts of Gansu . From 2005 to 2010, the ESV of most townships decreased in the Gannan Plateau and Qilian Mountain, whereas the increased townships were mainly located in Tianshui, Longnan, and the western section of the Hexi Corridor. From 2010 to 2015, the ESV of most townships declined in Lanzhou, Baiyin, Dingxi, Gannan Plateau, and Hexi Corridor, and the townships where the value increased were concentrated in the north and south.In this study, ESV was evaluated by improving the value equivalent factor per unit area and constructing a regional differential value assessment model in Gansu Province. Different ecosystem types provide different ES types to humans. In the current research on ESV, scholars mostly refer to the classification of ecosystem types by Costanza et al. , which iIn different regions, the same ecosystem type provides different ES and their value to humans are quite different. Therefore, the value equivalent factor of Costanza et al.  and Xie The accurate construction of the equivalent factor table is the core of the equivalent factor method. In the process of improving the equivalent factor table of Xie et al. , this stESV assessment has been studied extensively in other regions of China, whereas there are few related studies on ESV in Gansu Province. The existing research focuses on the value of a single ecosystem service on a provincial scale ,34,81, aBased on the characteristics of ecosystems in Gansu Province, this study developed a revised index based on an increase in some ecosystem equivalent factors, and revised the equivalent factors studied by Xie et al.  to form The desert ecosystem type covers the largest area in Gansu Province, followed by grassland, arable land, and forest ecosystems, and the remaining ecosystems account for only a small part. Desert is mostly located in northern Gansu. Grasslands are mainly located in the Gannan Plateau, Longzhong, and Longdong. Cultivated land is mainly located in Longzhong and Hexi Corridor, and forests are mainly located in Longnan, Ziwuling, and the Qilian Mountains.From 2000 to 2015, the grassland ecosystem area increased the most, whereas the cultivated land ecosystem area decreased the most. Forest, grassland, and urban ecosystems in Gansu Province continue to increase. Cultivated land ecosystems continue to decrease. Although wetlands and glacial ecosystems have increased over the past 15 y, they have decreased over the long term. The number of desert ecosystems has increased.In 2015, the total ESV for Gansu Province reached 2,239.56 billion yuan, to which the forest and grassland ecosystems contributed the most. In terms of the value of each service function of the ecosystem, the local climate regulation and biodiversity maintenance functions are the main service functions in the province. Regarding the spatial distribution of service values, ESV gradually increases from northeast to southwest, and the areas with high ESV concentrations are Qilian and Longnan Mountains.From 2000 to 2015, ESV increased by 3.43 billion yuan in Gansu Province. The value of forest ecosystems increased the most, whereas the value of grassland ecosystems decreased the most, showing a trend of increasing first, then decreasing, and then slowly increasing again. The value of forest and urban ecosystems continues to increase, and the value of cultivated land ecosystems continues to decrease. From the spatial characteristics of ESV changes, areas with reduced values gradually move from central Gansu to the surrounding areas.S1 Data(ZIP)Click here for additional data file. 27 Oct 2020PONE-D-20-28811Evaluation method of ecosystem service value under complex ecological environment: A case study of Gansu Province, ChinaPLOS ONEDear Dr. zhao,Thank you for submitting your manuscript to PLOS ONE. After careful consideration, we feel that it has merit but does not fully meet PLOS ONE\u2019s publication criteria as it currently stands. Therefore, we invite you to submit a revised version of the manuscript that addresses the points raised during the review process.plosone@plos.org. When you're ready to submit your revision, log on to https://www.editorialmanager.com/pone/ and select the 'Submissions Needing Revision' folder to locate your manuscript file.Please submit your revised manuscript by Dec 11 2020 11:59PM. If you will need more time than this to complete your revisions, please reply to this message or contact the journal office at Please include the following items when submitting your revised manuscript:A rebuttal letter that responds to each point raised by the academic editor and reviewer(s). You should upload this letter as a separate file labeled 'Response to Reviewers'.A marked-up copy of your manuscript that highlights changes made to the original version. You should upload this as a separate file labeled 'Revised Manuscript with Track Changes'.An unmarked version of your revised paper without tracked changes. You should upload this as a separate file labeled 'Manuscript'.If you would like to make changes to your financial disclosure, please include your updated statement in your cover letter. Guidelines for resubmitting your figure files are available below the reviewer comments at the end of this letter.http://journals.plos.org/plosone/s/submission-guidelines#loc-laboratory-protocolsIf applicable, we recommend that you deposit your laboratory protocols in protocols.io to enhance the reproducibility of your results. Protocols.io assigns your protocol its own identifier (DOI) so that it can be cited independently in the future. For instructions see:\u00a0We look forward to receiving your revised manuscript.Kind regards,Bing Xue, Ph.D.Academic EditorPLOS ONEJournal Requirements:When submitting your revision, we need you to address these additional requirements.1. Please ensure that your manuscript meets PLOS ONE's style requirements, including those for file naming. The PLOS ONE style templates can be found athttps://journals.plos.org/plosone/s/file?id=wjVg/PLOSOne_formatting_sample_main_body.pdf andhttps://journals.plos.org/plosone/s/file?id=ba62/PLOSOne_formatting_sample_title_authors_affiliations.pdf2.\u00a0 We suggest you thoroughly copyedit your manuscript for language usage, spelling, and grammar. If you do not know anyone who can help you do this, you may wish to consider employing a professional scientific editing service. \u00a0http://learn.aje.com/plos/) for a 15% discount off AJE services. To take advantage of our partnership with Editage, visit the Editage website (www.editage.com) and enter referral code PLOSEDIT for a 15% discount off Editage services.\u00a0 If the PLOS editorial team finds any language issues in text that either AJE or Editage has edited, the service provider will re-edit the text for free.Whilst you may use any professional scientific editing service of your choice, PLOS has partnered with both American Journal Experts (AJE) and Editage to provide discounted services to PLOS authors. Both organizations have experience helping authors meet PLOS guidelines and can provide language editing, translation, manuscript formatting, and figure formatting to ensure your manuscript meets our submission guidelines. To take advantage of our partnership with AJE, visit the AJE website A clean copy of the edited manuscript (uploaded as the new *manuscript* file)3. Thank you for stating the following financial disclosure:\"The full name of each funder\"At this time, please address the following queries:Please clarify the sources of funding  for your study. List the grants or organizations that supported your study, including funding received from your institution.State what role the funders took in the study. If the funders had no role in your study, please state: \u201cThe funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript.\u201dIf any authors received a salary from any of your funders, please state which authors and which funders.If you did not receive any funding for this study, please state: \u201cThe authors received no specific funding for this work.\u201dPlease include your amended statements within your cover letter; we will change the online submission form on your behalf.https://www.youtube.com/watch?v=_xcclfuvtxQ3. PLOS requires an ORCID iD for the corresponding author in Editorial Manager on papers submitted after December 6th, 2016. Please ensure that you have an ORCID iD and that it is validated in Editorial Manager. To do this, go to \u2018Update my Information\u2019 (in the upper left-hand corner of the main menu), and click on the Fetch/Validate link next to the ORCID field. This will take you to the ORCID site and allow you to create a new iD or authenticate a pre-existing iD in Editorial Manager. Please see the following video for instructions on linking an ORCID iD to your Editorial Manager account: http://journals.plos.org/plosone/s/licenses-and-copyright.4. We note that Figures 1, 3 and 4 in your submission contain map images which may be copyrighted. All PLOS content is published under the Creative Commons Attribution License (CC BY 4.0), which means that the manuscript, images, and Supporting Information files will be freely available online, and any third party is permitted to access, download, copy, distribute, and use these materials in any way, even commercially, with proper attribution. For these reasons, we cannot publish previously copyrighted maps or satellite images created using proprietary data, such as Google software . For more information, see our copyright guidelines: We require you to either (1) present written permission from the copyright holder to publish these figures specifically under the CC BY 4.0 license, or (2) remove the figures from your submission:4.1.\u00a0\u00a0\u00a0 You may seek permission from the original copyright holder of Figures 1, 3 and 4 to publish the content specifically under the CC BY 4.0 license.\u00a0http://journals.plos.org/plosone/s/file?id=7c09/content-permission-form.pdf) and the following text:We recommend that you contact the original copyright holder with the Content Permission Form (http://creativecommons.org/licenses/by/4.0/). Please be aware that this license allows unrestricted use and distribution, even commercially, by third parties. Please reply and provide explicit written permission to publish XXX under a CC BY license and complete the attached form.\u201d\u201cI request permission for the open-access journal PLOS ONE to publish XXX under the Creative Commons Attribution License (CCAL) CC BY 4.0  remove the figure or ii) supply a replacement figure that complies with the CC BY 4.0 license. Please check copyright information on all replacement figures and update the figure caption with source information. If applicable, please specify in the figure caption text when a figure is similar but not identical to the original image and is therefore for illustrative purposes only.The following resources for replacing copyrighted map figures may be helpful:http://viewer.nationalmap.gov/viewer/USGS National Map Viewer (public domain): http://eol.jsc.nasa.gov/sseop/clickmap/The Gateway to Astronaut Photography of Earth (public domain): https://www.cia.gov/library/publications/the-world-factbook/index.html and https://www.cia.gov/library/publications/cia-maps-publications/index.htmlMaps at the CIA (public domain): http://earthobservatory.nasa.gov/NASA Earth Observatory (public domain): http://landsat.visibleearth.nasa.gov/Landsat: http://eros.usgs.gov/#USGS EROS (Earth Resources Observatory and Science (EROS) Center) (public domain): http://www.naturalearthdata.com/Natural Earth (public domain): [Note: HTML markup is below. Please do not edit.]Reviewers' comments:Reviewer's Responses to QuestionsComments to the Author1. Is the manuscript technically sound, and do the data support the conclusions?The manuscript must describe a technically sound piece of scientific research with data that supports the conclusions. Experiments must have been conducted rigorously, with appropriate controls, replication, and sample sizes. The conclusions must be drawn appropriately based on the data presented. Reviewer #1:\u00a0YesReviewer #2:\u00a0YesReviewer #3:\u00a0Yes**********2. Has the statistical analysis been performed appropriately and rigorously? Reviewer #1:\u00a0YesReviewer #2:\u00a0YesReviewer #3:\u00a0N/A**********3. Have the authors made all data underlying the findings in their manuscript fully available?PLOS Data policy requires authors to make all data underlying the findings described in their manuscript fully available without restriction, with rare exception (please refer to the Data Availability Statement in the manuscript PDF file). The data should be provided as part of the manuscript or its supporting information, or deposited to a public repository. For example, in addition to summary statistics, the data points behind means, medians and variance measures should be available. If there are restrictions on publicly sharing data\u2014e.g. participant privacy or use of data from a third party\u2014those must be specified.The Reviewer #1:\u00a0YesReviewer #2:\u00a0YesReviewer #3:\u00a0Yes**********4. Is the manuscript presented in an intelligible fashion and written in standard English?PLOS ONE does not copyedit accepted manuscripts, so the language in submitted articles must be clear, correct, and unambiguous. Any typographical or grammatical errors should be corrected at revision, so please note any specific errors here.Reviewer #1:\u00a0YesReviewer #2:\u00a0YesReviewer #3:\u00a0No**********5. Review Comments to the AuthorPlease use the space provided to explain your answers to the questions above. You may also include additional comments for the author, including concerns about dual publication, research ethics, or publication ethics. Reviewer #1:\u00a0In this paper, xiaojiong Zhao et al. has taken Gansu Province as an example, the regional division method of ecosystem service function is proposed based on the characteristics of differences among different regions, and the variation trend of ESV in Gansu province from 2000 to 2015 is analyzed, which expands the thinking of regional ecological evaluation. The subject matter of this paper is novel, the Angle is clear, the data analysis process is accurate and careful. However, the manuscript needs revision before it is acceptable for publication. The writing of the paper should be improved, I found some of the text is repetition and some parts are not very fluid. The specific sections are questions that should be answered before accepting and proceeding to publications.1. In introduction, It is recommended that authors add comparisons with other ecosystem service value studies and introduce the advantages of the approach used in this article;2. In the discussion section, I suggest comparing with other ecological service value assessment methods in Gansu Province;3.There are still some problems in English grammar and sentences. Please check and correct them carefully.Reviewer #2:\u00a0comments to the Author:The first time I looked at the title \" Evaluation method of ecosystem service value under complex ecological environment: A case study of Gansu Province, China \", I was just wondering to know how would the authors deal with this topic. I was a little impressed and felt that this might be a very interesting manuscript. When I reviewed the manuscript, I didn't feel disappointed. In the manuscript, On the one hand, the average value equivalent factor per unit area of different ecosystems is determined in Gansu Province, with reference to the six calculation process. This method of meta-analysis will avoid or reduce the subjective conjecture which is easy to be caused by relying on experts' experience; On the other, through abundant eco-environmental data, this study established a value evaluation model and completed the evaluation of ecosystem service value under complex ecological environment. In particular, one thing is affirmed that the human activity factors that affect ecosystem service value are fully considered by Author to the evaluation of ecosystem service value, such as carrying capacity, air pollution, over exploitation of groundwater and water pollution etc. The methods and data used in the study are new. The manuscript meets the requirement for acceptation for publication.My main concerns are as follows:Introduction1. The description of Gansu Province may be suitable for the part of study area.2. There lacks enough literature review on the topic in the study area. The authors may check some references on this topic in last decades.Materials and Methods1. What is the basis of the ecosystem type classification?2. Please supplement the distribution map of ecosystem types3. from 2000-2015, what does this mean? The authors have to state clearly which year was used.4. Classification of ecosystem service functions. Please explain the specific problem of repeatability. The description is not fully understood due to the ecological integrity has been evaluated in previous research.Result1. In the Table3, the unit of area is km2, while in formula 19, the unit of area is ha.2. Biodiversity maintenance value regulation index (a11), How the habitat quality index is measured?3. \"invest\" should be \"InVEST\"Other detail questionEnglish needs proofreading and editing, especially those sentences related to comparison. In addition, there exists many formatting problems in this manuscript, please verify the full text.1.Please unify the number of decimal points in the whole text.2. Table1. Please note that the black space.Reviewer #3:\u00a0(1)The paper takes Gansu Province as an example, on the basis of fully considering the 6 regional differences of ecosystem service function. But it don\u2019t explain why Gansu was taken as an example? Does Gansu have a typical ecological service system?(2)making dialogue with the ESV evaluation and calculation literatures by taking the role of your specific context.(3)This paper did a poor job in readability, with many typo errors and unstructured sentences. The authors need a copy editor before next submission.**********what does this mean?). If published, this will include your full peer review and any attached files.6. PLOS authors have the option to publish the peer review history of their article  digital diagnostic tool,\u00a0Attachmentreviewers comments.docxSubmitted filename: Click here for additional data file. 12 Dec 2020Reply to Reviewer #1Comment1:\u201cIn introduction, It is recommended that authors add comparisons with other ecosystem service value studies and introduce the advantages of the approach used in this article.\u201dResponse1: We added comparisons with other ecosystem service value studies and introduce the advantages of the approach used in this article, line108-118 in marked-up copy of my manuscript. The modified part is highlighted in yellow.Comment2:\u201cIn the discussion section, I suggest comparing with other ecological service value assessment methods in Gansu Province.\u201dResponse2: There are few methods to evaluate the value of ecosystem services in Gansu Province, through literature retrieval, we compared with the study by Wang et al; line735-736 in marked-up copy of my manuscript. The modified part is highlighted in yellow.Comment3:\u201cThere are still some problems in English grammar and sentences. Please check and correct them carefully.\u201dResponse3: We used Editage for English language editing that edited my manuscript, and we have carefully and thoroughly proofread the manuscript to correct all the grammar and typos. For details of manuscript editing, please refer to marked-up copy of my manuscript.Reply to Reviewer #2Comment1: \u201cIn introduction, the description of Gansu Province may be suitable for the part of study area.\u201dResponse1:In introduction,\u201cGansu Province is located in the northwestern inland in China. \u2026..Its special geographical location and natural conditions form a more distinct ecological structure.\u201d, this part is repeated with the content in the study area, so this description of Gansu Province has been deleted in introduction. line 119 in marked-up copy of my manuscript. The modified part is highlighted in yellow.Comment2: \u201cThere lacks enough literature review on the topic in the study area. The authors may check some references on this topic in last decades. \u201dResponse2: We checked some references about method of ecosystem services value, and added other ecosystem service value studies. line 108-118 in marked-up copy of my manuscript. The modified part is highlighted in yellow.Comment3: \u201cWhat is the basis of the ecosystem type classification? \u201dResponse3: The basis of the ecosystem type classification was added in Ecosystem type data, line 160-184 in marked-up copy of my manuscript. The modified part is highlighted in yellow.Comment4: \u201cPlease supplement the distribution map of ecosystem types.\u201dResponse4:The distribution map of ecosystem types was added in line 185 in marked-up copy of my manuscript. The modified part is highlighted in yellow.Comment5: \u201cfrom 2000-2015, what does this mean? The authors have to state clearly which year was used. \u201dResponse5: The mean is \u201cfrom 2000, 2005, 2010, and 2015\u201d. line 194-195 in marked-up copy of my manuscript. The modified part is highlighted in yellow.Comment6: \u201cClassification of ecosystem service functions. Please explain the specific problem of repeatability. The description is not fully understood due to the ecological integrity has been evaluated in previous research. \u201dResponse6: \u201cThe specific problem of repeatability\u201d means is \u201cthe double- counting problem between ecological integrity and other ecosystem services\u201d. line 217-219 in marked-up copy of my manuscript. The modified part is highlighted in yellow.Comment7: \u201cIn the Table3, the unit of area is km2, while in formula 19, the unit of area is ha. \u201dResponse7: The unit of area is unified as km2. line 593 in marked-up copy of my manuscript. The modified part is highlighted in yellow.Comment8: \u201cBiodiversity maintenance value regulation index (a11), How the habitat quality index is measured? \u201dResponse8: The habitat quality index was measured in detail in another article of the author, so we added the reference. line 562-563 in marked-up copy of my manuscript. The modified part is highlighted in yellow.Comment9:\u201c\"invest\" should be \"InVEST\"\u201dResponse9: We modified the invest to InVEST. line 562 in marked-up copy of my manuscript. The modified part is highlighted in yellow.Comment10:\u201cEnglish needs proofreading and editing, especially those sentences related to comparison. In addition, there exists many formatting problems in this manuscript, please verify the full text. \u201dResponse10: We used Editage for English language editing that edited my manuscript, and we have carefully and thoroughly proofread the manuscript to correct all the grammar and typos. For details of manuscript editing, please refer to marked-up copy of my manuscript.Comment11:\u201cPlease unify the number of decimal points in the whole text. \u201dResponse11: We unified the number of decimal points in the whole text.line 37, 42,567,612,632,646 in marked-up copy of my manuscript. The modified part is highlighted in yellow.Comment 12:\u201cTable1. Please note that the black space. \u201dResponse12: We revised the black space. line 314 in marked-up copy of my manuscript. The modified part is highlighted in yellow.Reply to Reviewer #3Comment1: \u201cThe paper takes Gansu Province as an example, on the basis of fully considering the 6 regional differences of ecosystem service function. But it don\u2019t explain why Gansu was taken as an example? Does Gansu have a typical ecological service system? \u201dResponse1: We stated the reasons that the types of ecosystems are complex and diverse in Gansu Province, line 119-127 in marked-up copy of my manuscript. The modified part is highlighted in yellow.Comment2: \u201cmaking dialogue with the ESV evaluation and calculation literatures by taking the role of your specific context. \u201dResponse2: We have supplemented the relevant references on the other ecosystem service value studies, line108-118, 858-863 in marked-up copy of my manuscript. The modified part is highlighted in yellow.Comment3: \u201cThis paper did a poor job in readability, with many typo errors and unstructured sentences. The authors need a copy editor before next submission. \u201dResponse3: We used Editage for English language editing that edited my manuscript, and we have carefully and thoroughly proofread the manuscript to correct all the grammar and typos. For details of manuscript editing, please refer to marked-up copy of my manuscript.AttachmentResponse to Reviewers.docxSubmitted filename: Click here for additional data file. 18 Jan 2021Ecosystem service value evaluation method in a complex ecological environment: A case study of Gansu Province, ChinaPONE-D-20-28811R1Dear Dr. zhao,We\u2019re pleased to inform you that your manuscript has been judged scientifically suitable for publication and will be formally accepted for publication once it meets all outstanding technical requirements.Within one week, you\u2019ll receive an e-mail detailing the required amendments. When these have been addressed, you\u2019ll receive a formal acceptance letter and your manuscript will be scheduled for publication.http://www.editorialmanager.com/pone/, click the 'Update My Information' link at the top of the page, and double check that your user information is up-to-date. If you have any billing related questions, please contact our Author Billing department directly at authorbilling@plos.org.An invoice for payment will follow shortly after the formal acceptance. To ensure an efficient process, please log into Editorial Manager at onepress@plos.org.If your institution or institutions have a press office, please notify them about your upcoming paper to help maximize its impact. If they\u2019ll be preparing press materials, please inform our press team as soon as possible -- no later than 48 hours after receiving the formal acceptance. Your manuscript will remain under strict press embargo until 2 pm Eastern Time on the date of publication. For more information, please contact Kind regards,Bing Xue, Ph.D.Academic EditorPLOS ONEAdditional Editor Comments :Reviewers' comments:Reviewer's Responses to QuestionsComments to the Author1. If the authors have adequately addressed your comments raised in a previous round of review and you feel that this manuscript is now acceptable for publication, you may indicate that here to bypass the \u201cComments to the Author\u201d section, enter your conflict of interest statement in the \u201cConfidential to Editor\u201d section, and submit your \"Accept\" recommendation.Reviewer #1:\u00a0All comments have been addressedReviewer #3:\u00a0All comments have been addressed**********2. Is the manuscript technically sound, and do the data support the conclusions?The manuscript must describe a technically sound piece of scientific research with data that supports the conclusions. Experiments must have been conducted rigorously, with appropriate controls, replication, and sample sizes. The conclusions must be drawn appropriately based on the data presented. Reviewer #1:\u00a0YesReviewer #3:\u00a0Yes**********3. Has the statistical analysis been performed appropriately and rigorously? Reviewer #1:\u00a0YesReviewer #3:\u00a0Yes**********4. Have the authors made all data underlying the findings in their manuscript fully available?PLOS Data policy requires authors to make all data underlying the findings described in their manuscript fully available without restriction, with rare exception (please refer to the Data Availability Statement in the manuscript PDF file). The data should be provided as part of the manuscript or its supporting information, or deposited to a public repository. For example, in addition to summary statistics, the data points behind means, medians and variance measures should be available. If there are restrictions on publicly sharing data\u2014e.g. participant privacy or use of data from a third party\u2014those must be specified.The Reviewer #1:\u00a0YesReviewer #3:\u00a0Yes**********5. Is the manuscript presented in an intelligible fashion and written in standard English?PLOS ONE does not copyedit accepted manuscripts, so the language in submitted articles must be clear, correct, and unambiguous. Any typographical or grammatical errors should be corrected at revision, so please note any specific errors here.Reviewer #1:\u00a0YesReviewer #3:\u00a0Yes**********6. Review Comments to the AuthorPlease use the space provided to explain your answers to the questions above. You may also include additional comments for the author, including concerns about dual publication, research ethics, or publication ethics. Reviewer #1:\u00a0The author has added comparisons with other ecosystem service value studies and introduce the advantages of the approach used in the introduction and grammar problems also have been solved.The overall structure of the article is clear and has strong scientific and practical significance.Reviewer #3:\u00a0I really appreciate the revision made by the author, which can be seen to improve the readability of the paper.**********what does this mean?). If published, this will include your full peer review and any attached files.7. PLOS authors have the option to publish the peer review history of their article (If you choose \u201cno\u201d, your identity will remain anonymous but your review may still be made public.Do you want your identity to be public for this peer review? For information about this choice, including consent withdrawal, please see our Privacy Policy.Reviewer #1:\u00a0NoReviewer #3:\u00a0No 21 Jan 2021PONE-D-20-28811R1 Ecosystem service value evaluation method in a complex ecological environment: A case study of Gansu Province, China Dear Dr. Zhao:I'm pleased to inform you that your manuscript has been deemed suitable for publication in PLOS ONE. Congratulations! Your manuscript is now with our production department. onepress@plos.org.If your institution or institutions have a press office, please let them know about your upcoming paper now to help maximize its impact. If they'll be preparing press materials, please inform our press team within the next 48 hours. Your manuscript will remain under strict press embargo until 2 pm Eastern Time on the date of publication. For more information please contact plosone@plos.org. If we can help with anything else, please email us at Thank you for submitting your work to PLOS ONE and supporting open access. Kind regards, PLOS ONE Editorial Office Staffon behalf ofProfessor Bing Xue Academic EditorPLOS ONE"]}
-{"representative": "This review examines the effectiveness of diet and physical activity interventions to reduce cardiometabolic risk among Chinese immigrants and their descendants living in high income countries. The objective of this review is to provide information to help build future interventions aimed at improving diet and increasing physical activity levels among Chinese immigrants.Outcomes included BMI, weight, waist circumference (WC), waist-hip ratio (WHR), cholesterol , systolic and diastolic blood pressure , hemoglobin A1c (HgbA1c), fasting blood glucose (FBG), and HOMA-IR. Six databases were systematically searched from database inception to date of search (February 2020). Meta-analyses used random effect models to estimate pooled effects of outcomes with 95% confidence intervals. The outcomes assessed were changes in mean outcomes (post-intervention versus baseline) among the intervention group versus control groups.2; , I2\u00a0=\u200931%). There were also significant effects of intervention among adults in terms of changes in SBP and DBP, as the pooled effect across three studies was \u2212\u20096.08\u2009mmHg , I2\u00a0=\u20090% and\u2009\u2212\u20093.81\u2009mmHg , I2\u00a0=\u20090%, respectively. Among adults there were no other significant effects among the meta-analyses conducted .Twenty-one articles were included for synthesis, and eight of these were included in the meta-analysis. Among children/adolescents, there were no significant effects of intervention for any of the outcomes having sufficient data for meta-analysis . Among adults, the pooled effect including three studies showed significant changes in BMI , and among children, there was no evidence of effect for any cardiometabolic outcomes. Given our mixed findings, more work is needed to support the design of successful interventions, particularly those targeting children and their families.CRD42018117842).The systematic review protocol was registered in PROSPERO on December 17, 2018, the international prospective register of systematic reviews (registration number:  People of Chinese origin make up one of the fastest expanding groups in high-income countries such as the United States, Australia and Canada . The carThere is good evidence of differences in physical activity and dietary practices between Chinese migrant groups and the rest of the population in a number of countries with the largest Chinese-origin populations. There was a higher prevalence of inactivity among Chinese Australians than non-Chinese Australians , CanadiaDietary differences are harder to characterize. Those of Chinese origin ate greater amounts of fruit and vegetables than the general population in the UK and fat intake was relatively low , while sConsiderations for developing interventions for Chinese migrants and/or their descendants include: 1) language ; 2) health literacy; 3) traditional Chinese diet; 4) migration and acculturation; and 5) traditional Chinese medicine . SuccessIn the context of some concerns about diet and physical activity in those of Chinese origin living in high-income countries, and evidence that this group may benefit from tailored interventions, this review examines the effectiveness of interventions designed to modify dietary and physical activity behaviors to reduce cardiometabolic risk in this group. The objective of this review is to provide information to build future interventions aimed at improving the diet and increasing physical activity levels among Chinese immigrants.CRD42018117842).The review was conducted following the PRISMA Protocol for Systematic Reviews (PRISMA)  and the In February 2020, co-author (TR), an experienced Medical Librarian, searched PubMed Central, Ovid Medline, Ovid Embase, CABI, Food Science Technology Cinahl and the Cochrane Central Register of Controlled Trials. The Ovid Medline Search is included as supplementary material  they quantitatively described the effect of an intervention designed to modify dietary and/or physical activity behaviors on cardiometabolic risk factors , waist-hip ratio (WHR), LDL and/or HDL cholesterol, systolic and diastolic blood pressure (SBP and DBP), hemoglobin A1c (HgbA1c), fasting blood glucose (FBG), and HOMA-IR), and 2) the recipients of the intervention were of Chinese origin and living in a high-income economy, as defined by the World Bank . ExclusiTitles and abstracts were screened by four independent reviewers , with each citation receiving two votes. The full-texts of studies with relevant abstracts were assessed for eligibility by two screeners independently . Any conflicts were discussed and resolved through consensus of all four reviewers.Data from studies eligible for inclusion were extracted using a data extraction form adapted from published sources such as the Cochrane review , 22. If A narrative synthesis was used as it allows the compilation of data despite potential differences in research questions, design, or context in order to find a common underlying pattern. If at least two studies included the same outcome variable and pre- and post-intervention values were reported for both the intervention and control group, a meta-analysis was conducted. In cases where multiple post-intervention measurements were available, we extracted the measure that corresponded most closely to the endpoint of the intervention. We stratified analyses by age group (children/adolescents and adults).2 statistic. Results are to be interpreted with caution where there is significant heterogeneity (I2\u00a0>\u200950%). Meta-analyses were performed in R software using the \u2018meta\u2019 package.Where meta-analysis was possible (e.g. pre-post measures were available for intervention and control groups), the analyses involved two steps. The first step was to assess mean differences (MD) in outcomes for both the intervention and control group by comparing changes in the mean as the difference between post-intervention and baseline measures. For calculating MD, available adjusted or unadjusted means as reported in the included studies were used. The corresponding changes in standard deviation (SD) were not directly reported in most studies, and therefore was estimated using the formula suggested by the Cochrane handbook for systematic reviews of interventions . A correAfter duplicates were removed, 4443 articles were identified Fig.\u00a0. The iniAmong children/adolescents, the first study was published in 2008  and the Among studies conducted in children/adolescents Fig.\u00a0 and b, oAmong studies conducted in adults Fig.\u00a0a and b, Among children/adolescents, four studies were randomized controlled trials, three studies were pre-post single-arm interventions, and one study included a historical control group Table\u00a0. The mosAmong adults, three studies were randomized controlled trials, nine studies were pre-post single-arm interventions, and two studies were two-group repeated measures quasi-experimental design Table\u00a0. Interve2;   Fig.\u00a0a. For WHFor the three single group design studies, Chen 2008 only reported changes in BMI stratified by overweight status , while t2; 95%CI \u2212\u20092.06, \u2212\u20090.21) , and just three of the adult interventions were conducted outside the United States . Eight were conducted in children/adolescents; of these, seven were conducted by the same research group in San Francisco.As of February 2020, there were 21 published studies describing behavioral diet and physical interventions in Chinese migrants living in high-income countries. The majority were conducted in adults  how interventions are culturally adapted; (2) the types of behavior change techniques and theories that are used to underpin interventions; (3) loss to follow-up by study arm; (4) variability within the Chinese-origin population, particularly with respect to generational differences that may be important for the design of interventions; and (5) contextual factors, such as whether the setting is rural or urban. These recommendations would enable reviewers to assess how behavior change techniques and theories moderate effectiveness, to assess the equity impacts of interventions, and to examine explanations for heterogeneity between interventions.Given our mixed findings, more work is needed to support the design of successful interventions, particularly those targeting children and their families. The development of effective interventions may well require a great deal of qualitative and quantitative research on knowledge, attitudes, behaviors, and perceptions. More research is needed into the differential effects of lifestyle interventions for Chinese immigrants compared with other ethnicities.Additional file 1: Supplemental Table\u00a01 Ovid Medline Database Search Strategy.", "texts": ["This review examines the effectiveness of diet and physical activity interventions to reduce cardiometabolic risk among Chinese immigrants and their descendants living in high income countries. The objective of this review is to provide information to help build future interventions aimed at improving diet and increasing physical activity levels among Chinese immigrants.Outcomes included BMI, weight, waist circumference (WC), waist-hip ratio (WHR), cholesterol , systolic and diastolic blood pressure , hemoglobin A1c (HgbA1c), fasting blood glucose (FBG), and HOMA-IR. Six databases were systematically searched from database inception to date of search (February 2020). Meta-analyses used random effect models to estimate pooled effects of outcomes with 95% confidence intervals. The outcomes assessed were changes in mean outcomes (post-intervention versus baseline) among the intervention group versus control groups.2; , I2\u00a0=\u200931%). There were also significant effects of intervention among adults in terms of changes in SBP and DBP, as the pooled effect across three studies was \u2212\u20096.08\u2009mmHg , I2\u00a0=\u20090% and\u2009\u2212\u20093.81\u2009mmHg , I2\u00a0=\u20090%, respectively. Among adults there were no other significant effects among the meta-analyses conducted .Twenty-one articles were included for synthesis, and eight of these were included in the meta-analysis. Among children/adolescents, there were no significant effects of intervention for any of the outcomes having sufficient data for meta-analysis . Among adults, the pooled effect including three studies showed significant changes in BMI , and among children, there was no evidence of effect for any cardiometabolic outcomes. Given our mixed findings, more work is needed to support the design of successful interventions, particularly those targeting children and their families.CRD42018117842).The systematic review protocol was registered in PROSPERO on December 17, 2018, the international prospective register of systematic reviews (registration number:  People of Chinese origin make up one of the fastest expanding groups in high-income countries such as the United States, Australia and Canada . The carThere is good evidence of differences in physical activity and dietary practices between Chinese migrant groups and the rest of the population in a number of countries with the largest Chinese-origin populations. There was a higher prevalence of inactivity among Chinese Australians than non-Chinese Australians , CanadiaDietary differences are harder to characterize. Those of Chinese origin ate greater amounts of fruit and vegetables than the general population in the UK and fat intake was relatively low , while sConsiderations for developing interventions for Chinese migrants and/or their descendants include: 1) language ; 2) health literacy; 3) traditional Chinese diet; 4) migration and acculturation; and 5) traditional Chinese medicine . SuccessIn the context of some concerns about diet and physical activity in those of Chinese origin living in high-income countries, and evidence that this group may benefit from tailored interventions, this review examines the effectiveness of interventions designed to modify dietary and physical activity behaviors to reduce cardiometabolic risk in this group. The objective of this review is to provide information to build future interventions aimed at improving the diet and increasing physical activity levels among Chinese immigrants.CRD42018117842).The review was conducted following the PRISMA Protocol for Systematic Reviews (PRISMA)  and the In February 2020, co-author (TR), an experienced Medical Librarian, searched PubMed Central, Ovid Medline, Ovid Embase, CABI, Food Science Technology Cinahl and the Cochrane Central Register of Controlled Trials. The Ovid Medline Search is included as supplementary material  they quantitatively described the effect of an intervention designed to modify dietary and/or physical activity behaviors on cardiometabolic risk factors , waist-hip ratio (WHR), LDL and/or HDL cholesterol, systolic and diastolic blood pressure (SBP and DBP), hemoglobin A1c (HgbA1c), fasting blood glucose (FBG), and HOMA-IR), and 2) the recipients of the intervention were of Chinese origin and living in a high-income economy, as defined by the World Bank . ExclusiTitles and abstracts were screened by four independent reviewers , with each citation receiving two votes. The full-texts of studies with relevant abstracts were assessed for eligibility by two screeners independently . Any conflicts were discussed and resolved through consensus of all four reviewers.Data from studies eligible for inclusion were extracted using a data extraction form adapted from published sources such as the Cochrane review , 22. If A narrative synthesis was used as it allows the compilation of data despite potential differences in research questions, design, or context in order to find a common underlying pattern. If at least two studies included the same outcome variable and pre- and post-intervention values were reported for both the intervention and control group, a meta-analysis was conducted. In cases where multiple post-intervention measurements were available, we extracted the measure that corresponded most closely to the endpoint of the intervention. We stratified analyses by age group (children/adolescents and adults).2 statistic. Results are to be interpreted with caution where there is significant heterogeneity (I2\u00a0>\u200950%). Meta-analyses were performed in R software using the \u2018meta\u2019 package.Where meta-analysis was possible (e.g. pre-post measures were available for intervention and control groups), the analyses involved two steps. The first step was to assess mean differences (MD) in outcomes for both the intervention and control group by comparing changes in the mean as the difference between post-intervention and baseline measures. For calculating MD, available adjusted or unadjusted means as reported in the included studies were used. The corresponding changes in standard deviation (SD) were not directly reported in most studies, and therefore was estimated using the formula suggested by the Cochrane handbook for systematic reviews of interventions . A correAfter duplicates were removed, 4443 articles were identified Fig.\u00a0. The iniAmong children/adolescents, the first study was published in 2008  and the Among studies conducted in children/adolescents Fig.\u00a0 and b, oAmong studies conducted in adults Fig.\u00a0a and b, Among children/adolescents, four studies were randomized controlled trials, three studies were pre-post single-arm interventions, and one study included a historical control group Table\u00a0. The mosAmong adults, three studies were randomized controlled trials, nine studies were pre-post single-arm interventions, and two studies were two-group repeated measures quasi-experimental design Table\u00a0. Interve2;   Fig.\u00a0a. For WHFor the three single group design studies, Chen 2008 only reported changes in BMI stratified by overweight status , while t2; 95%CI \u2212\u20092.06, \u2212\u20090.21) , and just three of the adult interventions were conducted outside the United States . Eight were conducted in children/adolescents; of these, seven were conducted by the same research group in San Francisco.As of February 2020, there were 21 published studies describing behavioral diet and physical interventions in Chinese migrants living in high-income countries. The majority were conducted in adults  how interventions are culturally adapted; (2) the types of behavior change techniques and theories that are used to underpin interventions; (3) loss to follow-up by study arm; (4) variability within the Chinese-origin population, particularly with respect to generational differences that may be important for the design of interventions; and (5) contextual factors, such as whether the setting is rural or urban. These recommendations would enable reviewers to assess how behavior change techniques and theories moderate effectiveness, to assess the equity impacts of interventions, and to examine explanations for heterogeneity between interventions.Given our mixed findings, more work is needed to support the design of successful interventions, particularly those targeting children and their families. The development of effective interventions may well require a great deal of qualitative and quantitative research on knowledge, attitudes, behaviors, and perceptions. More research is needed into the differential effects of lifestyle interventions for Chinese immigrants compared with other ethnicities.Additional file 1: Supplemental Table\u00a01 Ovid Medline Database Search Strategy."]}
-{"representative": "This study aimed to design an optimal emotion recognition method using multiple physiological signal parameters acquired by bio-signal sensors for improving the accuracy of classifying individual emotional responses. Multiple physiological signals such as respiration (RSP) and heart rate variability (HRV) were acquired in an experiment from 53 participants when six basic emotion states were induced. Two RSP parameters were acquired from a chest-band respiration sensor, and five HRV parameters were acquired from a finger-clip blood volume pulse (BVP) sensor. A newly designed deep-learning model based on a convolutional neural network (CNN) was adopted for detecting the identification accuracy of individual emotions. Additionally, the signal combination of the acquired parameters was proposed to obtain high classification accuracy. Furthermore, a dominant factor influencing the accuracy was found by comparing the relativeness of the parameters, providing a basis for supporting the results of emotion classification. The users of this proposed model will soon be able to improve the emotion recognition model further based on CNN using multimodal physiological signals and their sensors. The negative stimuli that people experience in their daily lives vary widely, and the accumulation of these negative stimuli causes stress and mental illnesses such as depression. However, owing to the lack of awareness of the dangers of mental illness and the negative social perception, treatment behaviors are often passive. Additionally, efforts to alleviate negative stimuli are ongoing, but it is difficult to grasp the degree of stress of an individual, and, in many cases, emotional differences make assessment difficult. Therefore, differences in personal emotions are very important in relieving stress and treating mental illnesses.Representative techniques for recognizing emotions include image-based recognition, voice-based recognition, and physiological-signal-based recognition . All thrK-nearest neighbor (KNN) [Emotion classification through defined emotions and measured signals is performed in various ways, ranging from traditional statistical methods and machine learning  to the latest technique, deep learning. In particular, the support vector machine (SVM) is a widely used method for emotion classification ,10,11. Tor (KNN) ,15, and or (KNN)  have beeor (KNN) ,18, Deepor (KNN) , and Spaor (KNN) , or modeor (KNN) ,22. In aor (KNN) ,24,25,26As mentioned above, previous studies classified emotions by acquiring physiological signals and then classifying these signals in various ways. In other words, the research focus was on the processing of data and classification of signals using classification models. In contrast, the present study proposes an optimum emotion classification model beyond simple emotion classification. For this purpose, we compared the classification accuracy of single-signal and multi-signal approaches, experimented with various combinations between input signals for classify emotions into various stages, and verified the dominance of parameters using principal component analysis. Furthermore, the emotion recognition methods using various deep-learning techniques proposed in this study are expected to be referred to classify emotions efficiently. The overall flow of this study is shown in In many studies related to existing emotions, human emotions are divided into arousal and valence  by usingEmotions defined in this way can be measured using physiological signals. Physiological signals can be easily measured using non-invasive sensors and wearable devices, and various signals such as electrocardiogram (ECG), electromyogram (EMG), electroencephalogram (EEG), galvanic skin response (GSR), skin temperature (SKT) and respiration (RSP) are closely related to human emotions . DiffereTo analyze emotions through respiration, the subject\u2019s respiration should be measured in real time. There are many ways to measure respiration, including the direct measurement of air flow during inhalation and exhalation, the use of a photoplethysmogram (PPG) sensor, and a method of measuring changes in the width of the thoracic cavity by using a respiratory band. The direct measurement of air flow allows the precise measurement of breathing volume, but it involves specific testing equipment and requires subjects to wear inconvenient airflow transducers. As an alternative to this problem, PPG sensors, which use peripheral circulation changes through respiration, may be used ,37. HoweEmotions can also be recognized using heartbeat signals in addition to respiratory signals. Heartbeat signals can be measured using various methods. Of these, a method of acquiring an electrocardiogram (ECG) directly through an attached electrode and a measurement method of using a PPG/blood volume pulse (BVP) sensor on a finger or an earlobe are the most commonly used. The direct method of acquiring an ECG utilizes the principle that the skin senses electrical impulses that occur each time the heart beats. The measurement using a PPG/BVP sensor measures the blood flow and extracts the heartbeat signal from optical electronics by absorbing the infrared light of the cell and blood vessels. The method of measuring and applying bio-signals in this manner has the advantages of simplicity and ease of operation even with the newest smartphones .The heart rate (HR) is the rate of heartbeats, and it is measured as the number of beats of the heart per minute. In other words, HR is the number of peak-to-peak periods in the ECG per minute. One cycle of an ECG consists of QRS waves. The highest peak in one cycle is referred to as the R peak, and the peak-to-peak time interval of each electrocardiogram is called the RR or NN interval or inter-beat interval . A contiThe analysis of HRV can be divided into analysis in the time domain and analysis in the frequency domain. The simplest method of analyzing HRV is time-domain analysis, in which the time interval of the QRS wave or the instantaneous heart rate at a specific time is analyzed. Analysis in the frequency domain is used to analyze the power distribution of the function to frequency and to quantify the balance of the autonomic nervous system ,42. The In this study, a finger-clip BVP sensor was used to obtain HRV parameters in the time domain and frequency domain. The different variables that can be obtained from the time-domain analysis are the mean RR interval (RRI), standard deviation of normal to normal interval (SDNN), root-mean-square of successive differences (RMSSD) and pNN50(proportion of NN50), but we used the most basic HR and HRV amplitudes. In addition, different variables such as very low frequency (VLF), low frequency (LF), high frequency (HF), VLF/HF ratio, and LF/HF ratio can be extracted through analysis in the frequency domain. The present study used LF, which indicates the activity of the sympathetic nervous system, and HF, which indicates the activity of the parasympathetic nervous system, as parameters, and they were obtained through analysis in the frequency domain. In addition, the LF/HF ratio , which cThere have been many studies using various parameters of bio signals using sensors. Fujiwara et al.  proposedResearch on classifying human emotions using physiological signals has been performed using various methods and systems. Emotion classification starts with the definition of the emotions to be recognized, the measurement of signals, and the selection of classifiers. In the definition of emotions, the emotions to recognize are selected based on the discrete emotion model or by using a two- or three-dimensional emotion model. Verma et al.  and Wen In the present study, we classified emotions using CNN. Many other studies have classified emotions in other ways. As mentioned in the Introduction, a method of classifying emotions uses conventional statistical analysis techniques and deep learning. Many studies used both\u2014statistical analysis and deep learning\u2014methods or combined them to increase the accuracy of the model. Yin et al.  classifiHowever, unlike previous studies, the present study proposes an emotion classification into various stages using CNN model. In As mentioned in the Introduction, experiments were conducted to classify six emotions and compare the classifiers. It was an open label and single arm experiment performed from November to December 2017 at Seoul Metropolitan Government\u2014Seoul National University (SMG-SNU) Borame Medical Center, Seoul, Korea. Ethical approval was provided by the Institutional Review Board (IRB) at site, and the study adhered to the principles outlined in the Declaration of Helsinki and good clinical practice guidelines. The trial is registered in the Boramae IRB . The experiment was conducted in a controlled environment where a monitor capable of displaying video clips with six distinct emotions and a sensor capable of acquiring physiological signals were installed. To stimulate the participants, video clips expressing happiness, fear, surprise, anger, sadness, and disgust were played for one minute in that order. In order of emotion, the video clips used in the experiment were part of About Time (2013), The Shining (1980), Capricorn One (1977), The Attorney (2013), The Champ (1979), and Pink Flamingos (1972). Snapshots of video clips are not provided in this paper in order not to be restricted by copyright issues.Before the start of the experiment, participants were sufficiently briefed about the experiment and its side effects. When seated in front of the monitor, the participant put a BVP sensor on the finger and a respiration band on the abdomen. When the experiment began and it was determined that physiological stability was ensured, we measured the physiological signal in the neutral state for 1 min to be used as a different emotion for Control group. Then, participants relaxed for 2 min. After the measurement of the physiological signal of the neutral state and relax, the participant watched the happiness video for 1 min and maintained a relaxed state for 2 min thereafter. When the second relaxed state ended, the participant watched the fear video and the remaining videos in the order indicated in The software and hardware used in the experiment were products of Mind Media B.V. . The BVP signal was from the BVP finger-clip sensor of NeXus-10 MKII, and the sampling rate of the sensor is 32 samples/s. The measurement unit of the BVP sensor is Beats per minute (BPM), and parameters such as Relative Blood Flow and Heart Rate (HR) can be extracted. The measuring range is 40\u2013240 BPM. The wavelength of the BVP sensor IR light is \u00b1940 nm . The resThe participants wore the BVP sensor as a finger clip. The BVP finger-clip sensor has built-in optical electronics that measures blood flow through the absorption of infrared light in tissue and blood vessels. Every heartbeat causes blood to flow into the arteries and veins. The waveform amplitude of the BVP signal is related to blood flow as well as to the vasodilation and vasoconstriction of blood vessels. The participants wore the respiration band on the chest or abdomen, and the magnetic-field sensor of the band measured the stretching of the band when the participant breathed. The measured band-expansion value is related to the respiration signal. Because this non-invasive and simple measurement method was used to extract physiological signals by using the above-mentioned equipment, the burden on the participants was minimized. In the actual experiment, the sensor mentioned above and shown in In the BVP signal, various parameters can be obtained to confirm the response of the autonomic nervous system. In this experiment, HRV parameters such as heart rate, HRV amplitude, LF, HF, and LF/HF were extracted. From the RSP signal, the RSP value and RSP rate, which are the RSP parameters, can be extracted. The HRV and RSP parameters in the raw signal were automatically calculated, processed, and stored using Biotrace + software, which did not require manual intervention.All signals obtained from the experiment can be recorded and confirmed through Biotrace+ software. Based on this software, we selected the data suitable for the study and split them based on the experiment time. From the 53 participants\u2019 signals, 49 signals  were used for the study. The remaining four signals were discarded due to signal instability or other reasons. The signal to be analyzed was selected from among the HRV parameters  and RSP parameters , which are stored as time-series data. Subsequently, we split the data according to the markers, as recorded in the experiment, and extracted the data corresponding to the six emotions for 1 min. Data processing was completed by labeling each of the six extracted signals with their corresponding emotion. The overall procedure of data processing is represented in The number and type of data obtained through data preprocessing procedures are summarized in Although the number of all data is specified here, the data used in the actual analysis may vary slightly depending on the individual characteristics of the experiment participants. The data used for analysis depend on the combination of features. The combination of features can also be found in The pre-processed data obtained from the data-processing step were applied to the classification of emotions. Although emotions can be classified in various ways, in this study, we compared results of single-signal and multi-signal classification and classified emotions into various stages. For this study, we constructed a CNN model and applied the pre-processed data. The overall procedure of comparing single-signal and multi-signal from data acquisition from each sensor is shown in The obtained HRV-  and RSP-parameter  data were applied to the CNN as parameters to classify the emotions. Each CNN model used emotion-  and neutral-labeled data as input data to classify a given emotion.The phased combination of each parameter was proceeded to find the optimal classification model. The combination of all physiological signal parameters obtained through experiments is depicted in Combination steps (1) and (2) correspond to single-signal classification (RSP parameter or HRV parameter). Combination steps (3) and (4) correspond to multi-signal classification (combination of RSP and each domain of HRV parameters). Combination step (5) corresponds to multi-signal classification (RSP and HRV parameters).Particularly, Combination step (3) was applied to the classification model through the fusion of the RSP parameters and the frequency-domain HRV parameters. Similarly, Combination step (4) was applied through the fusion of the RSP parameters and the time-domain HRV parameters. These step-by-step combinations of parameters were intended to verify the optimal emotional classification model.CNN is generally used for the classification and prediction of images. However, by modifying the structure of CNN, we used a method of row-by-row reading of input data to classify physiological signals. CNN used Python\u2019s frameworks, Keras, and Tensorflow. CNN utilized 70% of all data as a training set and the other 30% as a test set. However, when the Combination steps (1)\u2013(5) were classified using the CNN, the input data varied according to the number of input parameters. That is, when classifying the RSP: Combination step (1), the model used the input data shape (2 1 1), while Combination step (2) with HRV used (5 1 1). Thus, for RSP and HRV (Combination step (5)), (7 1 1) was used. Overall, the model was constructed to have similar tendencies in large frameworks. The input data shapes are listed in n, n-1, n-2, n-3, etc.). Therefore, in Model 1, the input shape was (2 1 1) because two input parameters were applied, and the shape decreased as learning progressed. Models 2\u20134 were constructed to have the same tendency. Furthermore, in Models 2\u20134, we reduced the number of convolution filters from 50 to 25 and then increased it to 50. In all models, batch normalization and activation functions were applied between two convolution layers. Finally, maxpooling proceeded. We also initialized weights with the \u201cHe kernel initializer\u201d function in all convolution layers. Finally, a He kernel initializer was used in the ReLu and Softmax functions along with Dense, and the dropout rate was set to 0.5.The tendency of the overall CNN model constructed in this study was designed by reducing the size of the shape by one , false positive (FP), true negative (TN), and false negative (FN). In these four cases, the formula for accuracy is shown in Equation (1).We classified the parameters into six emotions based on the CNN models described in the preceding subsection and evaluated the single-signal and multi-signal classification performance. The classification results are summarized in The classification accuracy was 63.18% and 77.42% when emotions were classified using the single-signal with CNN Models 1 and 2, respectively. This result suggests that both classifiers can classify emotions with proper performance when using the HRV parameters and show better results compared to classification using the RSP parameters alone. The results of the classification were identified, but the results contained some meanings that were insufficient to be used as a model for general emotion classification. Therefore, instead of classifying emotions using a single-signal, we verified the classification results of emotions using multi-signal. The classification accuracy was 78.31% and 76.02% when parameters which combined RSP and some HRV were classified using the multi-signal with CNN Models 2 and 3, respectively. This result suggests that both classifiers can classify emotions with proper performance when using the parameters which combine RSP and some HRV parameters. Unfortunately, while CNN Models 2 and 3 were used to classify emotions properly, similar to some of the results in These five cases reveal that multi-signal classification is better than single-signal classification. However, not all multi-signal models have outstanding results, and multi-signal consisting of only some domains of HRV did not yield high classification results. Therefore, this study confirms that the accuracy of multi-signal emotion classification is higher than that of single-signal emotion classification. When classifying emotions using multi-signal, all domains of the HRV parameter must be used.Various physiological signals can be detected in the human body, and each physiological signal can describe various states of the body. In addition, since physiological signals cannot be changed at will, it is a good indicator for analyzing a person\u2019s emotional state. Much research has been conducted on emotional analysis ,58,59,60The optimal emotion classification model can reduce unnecessary procedures in analysis and experimentation. Therefore, we compared the accuracy of multi-signal and single-signal classification, performed classification using combined physiological signals into various stage, and then judged the accuracy of emotion classification using some parts of cardiac and respiratory signals.A total of 53 subjects participated in the experiment. They watched video clips corresponding to the six basic emotions while wearing a finger-clip BVP sensor and chest-band respiration band. The BVP and RSP signals of the subjects were measured while they watched the video clips. Of the raw signals, 49 signals were used in the study, removing inappropriate data. The signal selecting and splitting proceeded according to the research purpose. Subsequently, labeling and data pre-processing were performed.The labeled data obtained in the pre-processing step were applied to the classifier. RSP  and HRV  were applied to CNN to identify single-signal classification performance. For this purpose, two CNN models (CNN Models 1 and 2) were created for each parameter. Through the results, when single-signal was used, it was confirmed that proper emotion classification performance can be obtained. However, it cannot be used for an independent emotion classification model because of the low performance.To solve this problem, we decided to classify emotions through the combination of different domains of HRV or all of HRV and RSP. Combining different types of signals can improve classification performance. The signals were combined in three ways: the combination between the RSP signal and frequency-domain HRV signal; the combination between the RSP signal and time-domain HRV signal; and the combination between the RSP signal and HRV signal. These were named Combination steps (3)\u2013(5), respectively.The combined signal was classified with CNN in the same manner as in the previous cases. As a result of classification using Combination steps (3) and (4) signals with CNN, the accuracy was confirmed to be similar for the two classifiers. In addition, Combination step (5) results show an accuracy greater than 94%; thus, it was confirmed that Combination step (5) yielded higher performance with all classifiers. Multi-signal classification showed the better performance than single-signal classification. Therefore, it can be said that the use of many types of input signals can enhance the emotion classification performance. However, when using multi-signal, all domains of HRV must be applied as input data.However, in the combination of RSP and some of HRV signal, the results of emotion classification are similar. In other words, the accuracies of Combination steps (3) and (4) are similar. We identified the dominance of the entire HRV parameters to verify why both results are similar. Therefore, we performed principal component analysis (PCA) for all the HRV parameters. Based on the results shown in As shown in Based on the above studies, we can determine that the optimal model for classifying emotions using multi-signal is CNN Model 4, and it is difficult to classify general emotions with single-signal or some combination of data. Therefore, when classifying emotions, both RSP and HRV parameters should be used.By modifying the structure of the CNN model, we developed a general signal classifier. The data were acquired through six emotion-based video viewing experiments and preprocessed. Four different CNN models were developed for preprocessed data. Based on this, the classification accuracy of single- and multi-signal was compared. In addition, emotions were classified at various stages by signal combinations, and the dominance of HRV parameters was verified to confirm that it is difficult to classify emotions with multi-signal combined with several domains. Finally, an optimal model for classifying emotions with high accuracy is presented.The response of the human autonomic nervous system is a good indicator of emotions because it cannot be manipulated at will. In this study, we studied the optimal emotion classification models. Unlike previous studies using many physiological signals for emotion classification, the present study attempted to obtain an optimal emotion classification model. Respiration and cardiac signals corresponding to six basic emotions were extracted through experiments; the signals were combined variously to find the optimal classification model; and several CNN models were built to classify emotions. PCA was also used to determine the cause of similar emotional classification results.Although multi-signal emotion classification shows very good results, it takes a relatively long time because of the many parameters and data used, and the calculation requires high computing power. Therefore, further research should be conducted to improve the performance of emotion classification with fewer parameters and advanced CNN models.Finally, signals were measured for one minute in the experiment. If the constructed model were commercialized, this may be a rather long time. Since classification results may vary depending on the measurement time of the signal, further research will be required to shorten the time of signal extraction and improve the model accuracy. Although there are limitations in the present research, it is possible to develop a more efficient emotion estimation technology from the results of this study.", "texts": ["This study aimed to design an optimal emotion recognition method using multiple physiological signal parameters acquired by bio-signal sensors for improving the accuracy of classifying individual emotional responses. Multiple physiological signals such as respiration (RSP) and heart rate variability (HRV) were acquired in an experiment from 53 participants when six basic emotion states were induced. Two RSP parameters were acquired from a chest-band respiration sensor, and five HRV parameters were acquired from a finger-clip blood volume pulse (BVP) sensor. A newly designed deep-learning model based on a convolutional neural network (CNN) was adopted for detecting the identification accuracy of individual emotions. Additionally, the signal combination of the acquired parameters was proposed to obtain high classification accuracy. Furthermore, a dominant factor influencing the accuracy was found by comparing the relativeness of the parameters, providing a basis for supporting the results of emotion classification. The users of this proposed model will soon be able to improve the emotion recognition model further based on CNN using multimodal physiological signals and their sensors. The negative stimuli that people experience in their daily lives vary widely, and the accumulation of these negative stimuli causes stress and mental illnesses such as depression. However, owing to the lack of awareness of the dangers of mental illness and the negative social perception, treatment behaviors are often passive. Additionally, efforts to alleviate negative stimuli are ongoing, but it is difficult to grasp the degree of stress of an individual, and, in many cases, emotional differences make assessment difficult. Therefore, differences in personal emotions are very important in relieving stress and treating mental illnesses.Representative techniques for recognizing emotions include image-based recognition, voice-based recognition, and physiological-signal-based recognition . All thrK-nearest neighbor (KNN) [Emotion classification through defined emotions and measured signals is performed in various ways, ranging from traditional statistical methods and machine learning  to the latest technique, deep learning. In particular, the support vector machine (SVM) is a widely used method for emotion classification ,10,11. Tor (KNN) ,15, and or (KNN)  have beeor (KNN) ,18, Deepor (KNN) , and Spaor (KNN) , or modeor (KNN) ,22. In aor (KNN) ,24,25,26As mentioned above, previous studies classified emotions by acquiring physiological signals and then classifying these signals in various ways. In other words, the research focus was on the processing of data and classification of signals using classification models. In contrast, the present study proposes an optimum emotion classification model beyond simple emotion classification. For this purpose, we compared the classification accuracy of single-signal and multi-signal approaches, experimented with various combinations between input signals for classify emotions into various stages, and verified the dominance of parameters using principal component analysis. Furthermore, the emotion recognition methods using various deep-learning techniques proposed in this study are expected to be referred to classify emotions efficiently. The overall flow of this study is shown in In many studies related to existing emotions, human emotions are divided into arousal and valence  by usingEmotions defined in this way can be measured using physiological signals. Physiological signals can be easily measured using non-invasive sensors and wearable devices, and various signals such as electrocardiogram (ECG), electromyogram (EMG), electroencephalogram (EEG), galvanic skin response (GSR), skin temperature (SKT) and respiration (RSP) are closely related to human emotions . DiffereTo analyze emotions through respiration, the subject\u2019s respiration should be measured in real time. There are many ways to measure respiration, including the direct measurement of air flow during inhalation and exhalation, the use of a photoplethysmogram (PPG) sensor, and a method of measuring changes in the width of the thoracic cavity by using a respiratory band. The direct measurement of air flow allows the precise measurement of breathing volume, but it involves specific testing equipment and requires subjects to wear inconvenient airflow transducers. As an alternative to this problem, PPG sensors, which use peripheral circulation changes through respiration, may be used ,37. HoweEmotions can also be recognized using heartbeat signals in addition to respiratory signals. Heartbeat signals can be measured using various methods. Of these, a method of acquiring an electrocardiogram (ECG) directly through an attached electrode and a measurement method of using a PPG/blood volume pulse (BVP) sensor on a finger or an earlobe are the most commonly used. The direct method of acquiring an ECG utilizes the principle that the skin senses electrical impulses that occur each time the heart beats. The measurement using a PPG/BVP sensor measures the blood flow and extracts the heartbeat signal from optical electronics by absorbing the infrared light of the cell and blood vessels. The method of measuring and applying bio-signals in this manner has the advantages of simplicity and ease of operation even with the newest smartphones .The heart rate (HR) is the rate of heartbeats, and it is measured as the number of beats of the heart per minute. In other words, HR is the number of peak-to-peak periods in the ECG per minute. One cycle of an ECG consists of QRS waves. The highest peak in one cycle is referred to as the R peak, and the peak-to-peak time interval of each electrocardiogram is called the RR or NN interval or inter-beat interval . A contiThe analysis of HRV can be divided into analysis in the time domain and analysis in the frequency domain. The simplest method of analyzing HRV is time-domain analysis, in which the time interval of the QRS wave or the instantaneous heart rate at a specific time is analyzed. Analysis in the frequency domain is used to analyze the power distribution of the function to frequency and to quantify the balance of the autonomic nervous system ,42. The In this study, a finger-clip BVP sensor was used to obtain HRV parameters in the time domain and frequency domain. The different variables that can be obtained from the time-domain analysis are the mean RR interval (RRI), standard deviation of normal to normal interval (SDNN), root-mean-square of successive differences (RMSSD) and pNN50(proportion of NN50), but we used the most basic HR and HRV amplitudes. In addition, different variables such as very low frequency (VLF), low frequency (LF), high frequency (HF), VLF/HF ratio, and LF/HF ratio can be extracted through analysis in the frequency domain. The present study used LF, which indicates the activity of the sympathetic nervous system, and HF, which indicates the activity of the parasympathetic nervous system, as parameters, and they were obtained through analysis in the frequency domain. In addition, the LF/HF ratio , which cThere have been many studies using various parameters of bio signals using sensors. Fujiwara et al.  proposedResearch on classifying human emotions using physiological signals has been performed using various methods and systems. Emotion classification starts with the definition of the emotions to be recognized, the measurement of signals, and the selection of classifiers. In the definition of emotions, the emotions to recognize are selected based on the discrete emotion model or by using a two- or three-dimensional emotion model. Verma et al.  and Wen In the present study, we classified emotions using CNN. Many other studies have classified emotions in other ways. As mentioned in the Introduction, a method of classifying emotions uses conventional statistical analysis techniques and deep learning. Many studies used both\u2014statistical analysis and deep learning\u2014methods or combined them to increase the accuracy of the model. Yin et al.  classifiHowever, unlike previous studies, the present study proposes an emotion classification into various stages using CNN model. In As mentioned in the Introduction, experiments were conducted to classify six emotions and compare the classifiers. It was an open label and single arm experiment performed from November to December 2017 at Seoul Metropolitan Government\u2014Seoul National University (SMG-SNU) Borame Medical Center, Seoul, Korea. Ethical approval was provided by the Institutional Review Board (IRB) at site, and the study adhered to the principles outlined in the Declaration of Helsinki and good clinical practice guidelines. The trial is registered in the Boramae IRB . The experiment was conducted in a controlled environment where a monitor capable of displaying video clips with six distinct emotions and a sensor capable of acquiring physiological signals were installed. To stimulate the participants, video clips expressing happiness, fear, surprise, anger, sadness, and disgust were played for one minute in that order. In order of emotion, the video clips used in the experiment were part of About Time (2013), The Shining (1980), Capricorn One (1977), The Attorney (2013), The Champ (1979), and Pink Flamingos (1972). Snapshots of video clips are not provided in this paper in order not to be restricted by copyright issues.Before the start of the experiment, participants were sufficiently briefed about the experiment and its side effects. When seated in front of the monitor, the participant put a BVP sensor on the finger and a respiration band on the abdomen. When the experiment began and it was determined that physiological stability was ensured, we measured the physiological signal in the neutral state for 1 min to be used as a different emotion for Control group. Then, participants relaxed for 2 min. After the measurement of the physiological signal of the neutral state and relax, the participant watched the happiness video for 1 min and maintained a relaxed state for 2 min thereafter. When the second relaxed state ended, the participant watched the fear video and the remaining videos in the order indicated in The software and hardware used in the experiment were products of Mind Media B.V. . The BVP signal was from the BVP finger-clip sensor of NeXus-10 MKII, and the sampling rate of the sensor is 32 samples/s. The measurement unit of the BVP sensor is Beats per minute (BPM), and parameters such as Relative Blood Flow and Heart Rate (HR) can be extracted. The measuring range is 40\u2013240 BPM. The wavelength of the BVP sensor IR light is \u00b1940 nm . The resThe participants wore the BVP sensor as a finger clip. The BVP finger-clip sensor has built-in optical electronics that measures blood flow through the absorption of infrared light in tissue and blood vessels. Every heartbeat causes blood to flow into the arteries and veins. The waveform amplitude of the BVP signal is related to blood flow as well as to the vasodilation and vasoconstriction of blood vessels. The participants wore the respiration band on the chest or abdomen, and the magnetic-field sensor of the band measured the stretching of the band when the participant breathed. The measured band-expansion value is related to the respiration signal. Because this non-invasive and simple measurement method was used to extract physiological signals by using the above-mentioned equipment, the burden on the participants was minimized. In the actual experiment, the sensor mentioned above and shown in In the BVP signal, various parameters can be obtained to confirm the response of the autonomic nervous system. In this experiment, HRV parameters such as heart rate, HRV amplitude, LF, HF, and LF/HF were extracted. From the RSP signal, the RSP value and RSP rate, which are the RSP parameters, can be extracted. The HRV and RSP parameters in the raw signal were automatically calculated, processed, and stored using Biotrace + software, which did not require manual intervention.All signals obtained from the experiment can be recorded and confirmed through Biotrace+ software. Based on this software, we selected the data suitable for the study and split them based on the experiment time. From the 53 participants\u2019 signals, 49 signals  were used for the study. The remaining four signals were discarded due to signal instability or other reasons. The signal to be analyzed was selected from among the HRV parameters  and RSP parameters , which are stored as time-series data. Subsequently, we split the data according to the markers, as recorded in the experiment, and extracted the data corresponding to the six emotions for 1 min. Data processing was completed by labeling each of the six extracted signals with their corresponding emotion. The overall procedure of data processing is represented in The number and type of data obtained through data preprocessing procedures are summarized in Although the number of all data is specified here, the data used in the actual analysis may vary slightly depending on the individual characteristics of the experiment participants. The data used for analysis depend on the combination of features. The combination of features can also be found in The pre-processed data obtained from the data-processing step were applied to the classification of emotions. Although emotions can be classified in various ways, in this study, we compared results of single-signal and multi-signal classification and classified emotions into various stages. For this study, we constructed a CNN model and applied the pre-processed data. The overall procedure of comparing single-signal and multi-signal from data acquisition from each sensor is shown in The obtained HRV-  and RSP-parameter  data were applied to the CNN as parameters to classify the emotions. Each CNN model used emotion-  and neutral-labeled data as input data to classify a given emotion.The phased combination of each parameter was proceeded to find the optimal classification model. The combination of all physiological signal parameters obtained through experiments is depicted in Combination steps (1) and (2) correspond to single-signal classification (RSP parameter or HRV parameter). Combination steps (3) and (4) correspond to multi-signal classification (combination of RSP and each domain of HRV parameters). Combination step (5) corresponds to multi-signal classification (RSP and HRV parameters).Particularly, Combination step (3) was applied to the classification model through the fusion of the RSP parameters and the frequency-domain HRV parameters. Similarly, Combination step (4) was applied through the fusion of the RSP parameters and the time-domain HRV parameters. These step-by-step combinations of parameters were intended to verify the optimal emotional classification model.CNN is generally used for the classification and prediction of images. However, by modifying the structure of CNN, we used a method of row-by-row reading of input data to classify physiological signals. CNN used Python\u2019s frameworks, Keras, and Tensorflow. CNN utilized 70% of all data as a training set and the other 30% as a test set. However, when the Combination steps (1)\u2013(5) were classified using the CNN, the input data varied according to the number of input parameters. That is, when classifying the RSP: Combination step (1), the model used the input data shape (2 1 1), while Combination step (2) with HRV used (5 1 1). Thus, for RSP and HRV (Combination step (5)), (7 1 1) was used. Overall, the model was constructed to have similar tendencies in large frameworks. The input data shapes are listed in n, n-1, n-2, n-3, etc.). Therefore, in Model 1, the input shape was (2 1 1) because two input parameters were applied, and the shape decreased as learning progressed. Models 2\u20134 were constructed to have the same tendency. Furthermore, in Models 2\u20134, we reduced the number of convolution filters from 50 to 25 and then increased it to 50. In all models, batch normalization and activation functions were applied between two convolution layers. Finally, maxpooling proceeded. We also initialized weights with the \u201cHe kernel initializer\u201d function in all convolution layers. Finally, a He kernel initializer was used in the ReLu and Softmax functions along with Dense, and the dropout rate was set to 0.5.The tendency of the overall CNN model constructed in this study was designed by reducing the size of the shape by one , false positive (FP), true negative (TN), and false negative (FN). In these four cases, the formula for accuracy is shown in Equation (1).We classified the parameters into six emotions based on the CNN models described in the preceding subsection and evaluated the single-signal and multi-signal classification performance. The classification results are summarized in The classification accuracy was 63.18% and 77.42% when emotions were classified using the single-signal with CNN Models 1 and 2, respectively. This result suggests that both classifiers can classify emotions with proper performance when using the HRV parameters and show better results compared to classification using the RSP parameters alone. The results of the classification were identified, but the results contained some meanings that were insufficient to be used as a model for general emotion classification. Therefore, instead of classifying emotions using a single-signal, we verified the classification results of emotions using multi-signal. The classification accuracy was 78.31% and 76.02% when parameters which combined RSP and some HRV were classified using the multi-signal with CNN Models 2 and 3, respectively. This result suggests that both classifiers can classify emotions with proper performance when using the parameters which combine RSP and some HRV parameters. Unfortunately, while CNN Models 2 and 3 were used to classify emotions properly, similar to some of the results in These five cases reveal that multi-signal classification is better than single-signal classification. However, not all multi-signal models have outstanding results, and multi-signal consisting of only some domains of HRV did not yield high classification results. Therefore, this study confirms that the accuracy of multi-signal emotion classification is higher than that of single-signal emotion classification. When classifying emotions using multi-signal, all domains of the HRV parameter must be used.Various physiological signals can be detected in the human body, and each physiological signal can describe various states of the body. In addition, since physiological signals cannot be changed at will, it is a good indicator for analyzing a person\u2019s emotional state. Much research has been conducted on emotional analysis ,58,59,60The optimal emotion classification model can reduce unnecessary procedures in analysis and experimentation. Therefore, we compared the accuracy of multi-signal and single-signal classification, performed classification using combined physiological signals into various stage, and then judged the accuracy of emotion classification using some parts of cardiac and respiratory signals.A total of 53 subjects participated in the experiment. They watched video clips corresponding to the six basic emotions while wearing a finger-clip BVP sensor and chest-band respiration band. The BVP and RSP signals of the subjects were measured while they watched the video clips. Of the raw signals, 49 signals were used in the study, removing inappropriate data. The signal selecting and splitting proceeded according to the research purpose. Subsequently, labeling and data pre-processing were performed.The labeled data obtained in the pre-processing step were applied to the classifier. RSP  and HRV  were applied to CNN to identify single-signal classification performance. For this purpose, two CNN models (CNN Models 1 and 2) were created for each parameter. Through the results, when single-signal was used, it was confirmed that proper emotion classification performance can be obtained. However, it cannot be used for an independent emotion classification model because of the low performance.To solve this problem, we decided to classify emotions through the combination of different domains of HRV or all of HRV and RSP. Combining different types of signals can improve classification performance. The signals were combined in three ways: the combination between the RSP signal and frequency-domain HRV signal; the combination between the RSP signal and time-domain HRV signal; and the combination between the RSP signal and HRV signal. These were named Combination steps (3)\u2013(5), respectively.The combined signal was classified with CNN in the same manner as in the previous cases. As a result of classification using Combination steps (3) and (4) signals with CNN, the accuracy was confirmed to be similar for the two classifiers. In addition, Combination step (5) results show an accuracy greater than 94%; thus, it was confirmed that Combination step (5) yielded higher performance with all classifiers. Multi-signal classification showed the better performance than single-signal classification. Therefore, it can be said that the use of many types of input signals can enhance the emotion classification performance. However, when using multi-signal, all domains of HRV must be applied as input data.However, in the combination of RSP and some of HRV signal, the results of emotion classification are similar. In other words, the accuracies of Combination steps (3) and (4) are similar. We identified the dominance of the entire HRV parameters to verify why both results are similar. Therefore, we performed principal component analysis (PCA) for all the HRV parameters. Based on the results shown in As shown in Based on the above studies, we can determine that the optimal model for classifying emotions using multi-signal is CNN Model 4, and it is difficult to classify general emotions with single-signal or some combination of data. Therefore, when classifying emotions, both RSP and HRV parameters should be used.By modifying the structure of the CNN model, we developed a general signal classifier. The data were acquired through six emotion-based video viewing experiments and preprocessed. Four different CNN models were developed for preprocessed data. Based on this, the classification accuracy of single- and multi-signal was compared. In addition, emotions were classified at various stages by signal combinations, and the dominance of HRV parameters was verified to confirm that it is difficult to classify emotions with multi-signal combined with several domains. Finally, an optimal model for classifying emotions with high accuracy is presented.The response of the human autonomic nervous system is a good indicator of emotions because it cannot be manipulated at will. In this study, we studied the optimal emotion classification models. Unlike previous studies using many physiological signals for emotion classification, the present study attempted to obtain an optimal emotion classification model. Respiration and cardiac signals corresponding to six basic emotions were extracted through experiments; the signals were combined variously to find the optimal classification model; and several CNN models were built to classify emotions. PCA was also used to determine the cause of similar emotional classification results.Although multi-signal emotion classification shows very good results, it takes a relatively long time because of the many parameters and data used, and the calculation requires high computing power. Therefore, further research should be conducted to improve the performance of emotion classification with fewer parameters and advanced CNN models.Finally, signals were measured for one minute in the experiment. If the constructed model were commercialized, this may be a rather long time. Since classification results may vary depending on the measurement time of the signal, further research will be required to shorten the time of signal extraction and improve the model accuracy. Although there are limitations in the present research, it is possible to develop a more efficient emotion estimation technology from the results of this study."]}
-{"representative": "To describe the human resources for health and analyze the inequality in its distribution in Mexico. Cross-sectional study based on the National Occupation and Employment Survey (ENOE in Spanish) for the fourth quarter of 2018 in Mexico. Graduated physicians and nurses, and auxiliary/technician nurses with completed studies were considered as human resources for health. States were grouped by degree of marginalization. Densities of human resources for health per 1,000 inhabitants, Index of Dissimilarity (DI) and Concentration Indices (CI) were estimated as measures of unequal distribution. The density of human resources for health was 4.6 per 1,000 inhabitants. We found heterogeneity among states with densities from 2.3 to 10.5 per 1,000 inhabitants. Inequality was higher in the states with a very low degree of marginalization (CI = 0.4) than those with high marginalization (CI = 0.1), and the inequality in the distribution of physicians (CI = 0.5) was greater than in graduated nurses (CI = 0.3) among states. In addition, 17 states showed a density above the threshold of 4.5 per 1,000 inhabitants proposed in the Global Strategy on Human Resources for Health. That implies a deficit of nearly 60,000 human resources for health among the 15 states below the threshold. For all states, to reach a density equal to the national density of 4.6, about 12.6% of human health resources would have to be distributed among states that were below national density. In Mexico, there is inequality in the distribution of human resources for health, with state differences. Government mechanisms could support the balance in the labor market of physicians and nurses through a human resources policy. Anand and B\u00e4rnighausen criticize the conceptual framework of health systems proposed by the World Health Organization (WHO), which considers human resources for health (HRH) as one of the building blocks of the system1. They propose a conceptual framework in which human resources are the core of health systems3. The fulfillment of goals and patient satisfaction depend on the HRH, since they provide preventive and curative care, as well as information on diagnosis, treatment and monitoring, and decide which technology and/or drug to use. Therefore, their size, composition and distribution are very relevant to ensure the population\u2019s access to health services3.Human resources working in health institutions are considered one of the fundamental components for the proper performance of health systems4. In 2004, the Joint Learning Initiative, [JLI] recommended a density of 2.5 per 1,000 inhabitants to achieve 80.0% measles immunization coverage and deliveries performed by health personnel5. Under the Millennium Development Goals (MDG), the 2006 WHO Global Report suggested a minimum threshold of 2.3 physicians, nurses and midwives per thousand inhabitants to reach 80.0% of deliveries performed by qualified personnel; 57 countries did not reach such an indicator4.The availability of HRH, measured by density per number of inhabitants, has been used as a health coverage indicator. A positive relationship has been found with some interventions, such as vaccination or births performed by qualified personnel6, the WHO established a density of 4.5 physicians, nurses and midwives per 1,000 inhabitants as the minimum threshold required for the implementation of the Global Strategy on Human Resources for Health (GSHRH) under Universal Health Coverage (UHC)7. Unlike the 2006 indicator, this threshold includes 12 indicators related to UHC and SDG targets. With this indicator, the WHO predicted that 18 million more health workers would be needed in low-middle-income countries to achieve SDG8, although it became an emphasis that it should not be a target for all countries given their differences in health needs7.In 2016, under the Sustainable Development Goals (SDG)Seguro Popular de Salud  in 2003, to provide financial protection to the population excluded from social security9. At the end of 2017, 53.5 million Mexicans were affiliated with PHI10. In 2005\u20132016, public spending on health per capita increased by 31.0%, and the density of physicians and nurses per thousand inhabitants increased by 34.0 and 32.0%, respectively. Despite these advances, the public health system faces problems of accessibility and quality in care, which can be explained by the lack of an explicit policy on human resources for health11 and by the imbalance between the health needs of the population and human and financial resources12.In Mexico, the federal government launched the public health insurance known as Secretar\u00eda del Trabajo y Previsi\u00f3n Social  makes periodic estimates of the number of graduated physicians and nurses who are employed13; however, these estimates do not show whether employed professionals practice the medical profession nor specify the length of the working day. Other sources of information such as the Organization for Economic Cooperation and Development (OECD) indicate for Mexico a density of 2.4 and 2.9 physicians and nurses, respectively, in 2017. However, these data include intern physicians (undergraduate) and residents , use different sources of information and recognize the possibility of duplication14. In both cases, the HRH density indicator may be overestimated, and it is not possible to estimate the professional deficit that is necessary to reach the 4.5 threshold recommended in GSHRH. Therefore, this study aimed to describe the HRH and analyze it\u2019s inequal distribution in Mexico.At national level, the 15. Databases are publicly available and do not contain identifiable information about individuals.Cross-sectional study based on secondary data analysis to describe characteristics of the physicians and nurses. The National Occupation and Employment Survey , conducted by the National Institute of Statistics and Geography  was used. ENOE has a probabilistic, two-phased, stratified and clustered design. It is carried out quarterly, has national and state geographic coverage, and it aims to provide information on the occupational characteristics of the population aged 15 and olderENOE-based inequality indicators were constructed for the fourth quarter of 2018 (quarter IV-2018). All professionals with medical or nursing studies who reported completing their undergraduate studies at the time of the survey were considered Human Resources for Health (HRH) or health workers. We also included those who studied nursing at the technical level (auxiliary nursing).Employed (Emp): physicians and nurses who worked 20 hours or more a week performing functions according to their proffesional training in the health area, or performing administrative functions in the health sector.Unemployed (Une): physicians and nurses who looked for a job because they did not have an economic activity.Quantitative underemployment (QuantiUn): physicians and nurses employed less than 20 hours a week and with functions according to their profession, or who exercised the health profession as a secondary job.Qualitative underemployment : physicians and nurses employed but with functions or activities outside their professional training, regardless of working hours per week.Economically Active Population (EAP): physicians and nurses employed, underemployed and unemployed.Densities of Human Resources for Health per 1,000 inhabitants:a.Density of employed human resources (DHRH): b.Density of Human Resources EAP: In both cases, the HRH deficit was obtained from the threshold recommended in GSHRH according to the following formulas:c.Employed deficit: d.EAP Deficit: Socio-economic factors  in both professions were analyzed, and state densities of human resources for health of 1) employed health personnel per 1,000 inhabitants (DHRH), and 2) economically active population (EAP) per 1,000 inhabitants were estimated. In both cases, densities were compared with the density of 4.5 per 1,000 inhabitants recommended in GSHRH, and the number of health workers needed to meet this threshold was estimated.19. It is estimated using the formula sjh is the proportion of HRH in state j with respect to the national total of HRH, and sjp is the proportion of the population in state j with respect to the national population. In this study, the ID was interpreted as the proportion (or percentage) of workers who would have to be redistributed among states so that everyone had the same DHRH.The Index of dissimilarity (ID) is one indicator used in the analysis of health inequalities19. In this study, curves were elaborated considering states as an analysis unit. The proportion of HRH in state j with respect to the national total of HRH (sjh) was estimated, and the proportion of Disability-Adjusted Life Year (DALY) in state j was estimated from the national total of DALYs (sjd). The concentration curve plots the cumulative proportion of DALY by the states  with the accumulated proportions of HRH in the Y-axis. If workers are equally distributed among states according to their percentage of the national disease burden, the concentration curve matches the diagonal joining the points (0.0) and (1.1), which is called the equality line. The area between the CC and the equality line is the Concentration Index (CI) and the higher the absolute value of the larger IC, higher the inequality. A scatter plot was built between the DHRH per 1,000 inhabitants and the DALY per 100 thousand inhabitants in each state18. In addition, another dispersion plot was built between the DHRH per 1,000 inhabitants and the Gross Domestic Product (GDP) per capita, and the Spearman\u2019s correlation was estimated.Another index used in the analysis of health inequalities is the index from the Concentration Curve (CC)20. The classification and grouping of states according to degree of marginalization comes from the classification proposed by CONAPO21. Data on the Gross Domestic Product (GDP) were obtained from the INEGI website22. DALY information was obtained from global disease burden estimates conducted by the Institute for Health Metrics and Evaluation (IHME)23.The three inequality indicators in the distribution of human resources at the national level and by states grouped by degree of marginalization were used: the DHRH per 1,000 inhabitants, the ID and the CI. Population size information comes from the population projections of the National Population Council  available on the website of the Directorate-General for Health Information  of the Ministry of HealthThe analyses were conducted using the survey weights, and its complex design was considered using the SVY module of the STATA MP 13.0 package. Pearson Chi-square tests assess the differences in distribution between the type of profession (medicine or nursing) and its socioeconomic factors considering p < 0.05 for statistical significance and confidence intervals at 95% (95%CI).In 2018, there were 413,000 physicians and 714,000 nurses in Mexico, of whom 62.9% and 44.4%, respectively, were employed 20 hours or more in the health sector , which iThe density of health professionals (DHRH) per 1,000 inhabitants was 4.6 , exceeding the threshold of 4.5 recommended in GSHRH . Howeverper capita . This coincided with what was described above, according to which the groups of entities of very low and very high marginalization had higher and lower DHRH, respectively  with the smallest proportions of DALY concentrated less than 25.0% of the entire workforce, while five of them  concentrated more than 40.0% (CI = 0.4). This pattern was mainly caused by the inequality in the distribution of medical personnel (CI = 0.5) and technical nursing (CI = 0.5), and to a lesser extent to the distribution of professional nursing (CI = 0.3) . In addiectively .Seventeen states reached a density of 4.5  and 3b. 24. While, according to GSHRH criteria, the density of health workers could be considered acceptable, inequality within the country is reflected in the variability among states, particularly those with high marginalization that do not reach the threshold. Considering that OECD data include interns and residents, and there is the possibility of double counting of physicians and nurses working simultaneously in the public and private sector, the availability of HRH for lower-density areas is likely to be below current demand and with a larger deficit for future years. In this sense, requirement projections by medical specialists in Mexico have estimated that health needs arising from population aging will require more specialists in internal medicine and surgery than in pediatrics, which will imply a growing challenge for the provision of services25.Our study shows a disadvantage of Mexico in the availability of HRH compared with the average of OECD countries26. Our results could reflect other weak areas of the health system itself, such as insufficient equipment or required inputs, poor quality of care, as well as conditions typical of the demographic and epidemiological transition. The consequences of these multiple factors are chronic-degenerative health needs that lead to disability for a greater proportion of the population27.A relevant finding was the lack of consistency in the relation between the density of health workers and DALY rates. As has been documented in other studies, a negative correlation would be expected, which would support evidence of having more health professionals to reduce the burden of disease28, due to their high economic development, which provide better job opportunities and better income expectations29; or 2) the distribution of the number of students enrolled at universities across the country where six states, of very low or low marginalization, concentrate to 50.0% and 35.0% of the enrollments of medical and nursing students in the 2017\u20132018 school year, respectively; in contrast, three very high-marginalization entities account for 15.7% of registered nursing students and 6.5% of medical students30. These imbalances in the distribution of human resources pose a challenge to the health system as the population living in areas of high degree of marginalization is less likely to have access to health services.By contrast, the positive relationship between DHRH and state GDP could be explained by the following reasons: 1) qualified medical personnel can switch residency to Mexican regions with attractive cities for medical mobility31, but are not considered in the estimation of the 4.5 per 1,000 Inhabitants threshold; c) the estimation of employment rates does not include physicians and nurses in health teaching and research activities. Therefore, they may have included as underemployed, and 5) ENOE is a national and state representative survey of the entire population over 15 years; medical and nursing staff account for less than 2.0% of the population, which could be construed as a weakness in outcomes at the state level. However, given the random design of ENOE and the sample sizes are large for both professions, representativeness can be assumed for this subgroup.Limitations of this analysis are the difficulties in identifying labor mobility, which may affect the estimation of state densities over time, and limitations from ENOE: a) it is not possible to distinguish between levels of care or between insurance schemes, which prevents more precise inequalities among population groups or health needs; b) midwives were not included, since it is not possible to identify them in the survey, nor were other categories of health personnel such as dentists, pharmacists, laboratory technicians or community promoters, who are also considered a health workforceIn brief, the results of this study indicate inequality in the distribution of HRH across states, which may potentially be linked to the number of enrollment offered in educational institutions, the preference of health personnel to be placed into areas with better living conditions, and greater availability of sources of work in states with greater health infrastructure. The establishment of a new human resources policy is a priority that, based on the health needs of the population, articulates the training of physicians, nurses, and other health professionals for incorporation into health institutions, considering the areas of greatest demand. In addition, it is necessary to regulate professional practice, which encourages balance in the public and private labor market. 2. Anand y B\u00e4rnighausen hacen una cr\u00edtica al marco conceptual de los sistemas de salud propuesto por la Organizaci\u00f3n Mundial de la Salud (OMS) que considera a los recursos humanos en salud (RHS) como uno de los bloques del sistema1. Proponen un marco conceptual en el que los recursos humanos son el centro de los sistemas de salud3. El cumplimiento de las metas y la satisfacci\u00f3n de los pacientes dependen de los RHS, dado que son ellos quienes realizan las actividades de provisi\u00f3n de servicios preventivos y curativos, entregan informaci\u00f3n sobre el diagn\u00f3stico, tratamiento y seguimiento, y deciden qu\u00e9 tecnolog\u00eda y/o medicamento utilizar, por lo cual su tama\u00f1o, composici\u00f3n y distribuci\u00f3n son muy relevantes para asegurar el acceso de la poblaci\u00f3n a los servicios de salud3.Los recursos humanos que laboran en las instituciones de salud son considerados uno de los pilares para el adecuado desempe\u00f1o de los sistemas de salud4. En 2004, la Iniciativa Conjunta de Aprendizaje , recomend\u00f3 una densidad de 2,5 por 1.000 habitantes para alcanzar una cobertura de 80,0% de inmunizaci\u00f3n contra el sarampi\u00f3n y partos atendidos por personal de salud5. En el marco de los Objetivos de Desarrollo del Milenio (ODM), el informe mundial de la OMS de 2006 sugiri\u00f3 un umbral m\u00ednimo de 2,3 m\u00e9dicos, enfermeras y parteras por cada mil habitantes para alcanzar un 80,0% de partos atendidos por personal calificado; 57 pa\u00edses no alcanzaban tal indicador4.La disponibilidad de RHS, medida a trav\u00e9s de la densidad por n\u00famero de habitantes, ha sido relacionada con indicadores de cobertura. Se ha encontrado una relaci\u00f3n positiva con algunas intervenciones como cobertura de vacunaci\u00f3n o cobertura de partos atendidos por personal calificado6, la OMS estableci\u00f3 una densidad de 4,5 m\u00e9dicos, enfermeras y parteras por 1.000 habitantes como umbral m\u00ednimo requerido para la implementaci\u00f3n de la Estrategia Global sobre Recursos Humanos para la Salud (EGRHS) en el marco de la cobertura universal de salud (CUS)7. A diferencia del indicador de 2006, este umbral contempla 12 indicadores relacionados con metas de la CUS y los ODS. Con este indicador, la OMS pronostic\u00f3 que se necesitar\u00edan 18 millones m\u00e1s de trabajadores de la salud en los pa\u00edses de ingreso medio-bajo para alcanzar los ODS8, aunque se hizo enfasis en que este no debe representar una meta para todos los paises dadas sus diferencias en las necesidades de salud7.En 2016, en el marco de los Objetivos de Desarrollo Sostenible (ODS)9, con un logro de afiliaci\u00f3n de 53,5 millones de mexicanos hacia finales de 201710. Adicionalmente, en el per\u00edodo 2005\u20132016, el gasto p\u00fablico en salud per c\u00e1pita aument\u00f3 31,0% y la densidad de m\u00e9dicos y enfermeras por cada mil habitantes se increment\u00f3 en 34,0 y 32,0%, respectivamente. A pesar de estos avances, el sistema p\u00fablico de salud enfrenta problemas de accesibilidad y calidad de atenci\u00f3n, que pueden ser explicados por la carencia de una pol\u00edtica expl\u00edcita de recursos humanos en salud11, y por el desequilibrio entre las necesidades de salud de la poblaci\u00f3n y los recursos humanos y financieros12.En M\u00e9xico, el gobierno federal lanz\u00f3 en 2003 un seguro p\u00fablico de salud conocido como Seguro Popular de Salud (SPS) para brindar protecci\u00f3n financiera a la poblaci\u00f3n excluida de la seguridad social13; no obstante, estas estimaciones no muestran si los profesionales ejercen la profesi\u00f3n m\u00e9dica ni se especifica la duraci\u00f3n de la jornada laboral. Otras fuentes de informaci\u00f3n como la Organizaci\u00f3n para la Cooperaci\u00f3n y el Desarrollo Economicos (OCDE) reportaron para M\u00e9xico una densidad de 2,4 y 2,9 m\u00e9dicos y enfermeras, respectivamente, en 2017. Sin embargo, estos datos incluyen a m\u00e9dicos internos (pre-grado) y residentes , utilizan datos provenientes de distintas fuentes de informaci\u00f3n y en ellas se reconoce la posibilidad de duplicaci\u00f3n14. En ambos casos, el indicador de densidad de RHS puede estar sobreestimado y no es posible calcular el d\u00e9ficit de profesionales que son necesarios para alcanzar el umbral de 4,5 recomendado en la EGRHS. Por lo anterior, el presente estudio tuvo como objetivo describir los RHS y analizar la desigualdad en su distribuci\u00f3n en M\u00e9xico.A nivel nacional, la Secretar\u00eda del Trabajo y Previsi\u00f3n Social (STPS) realiza estimaciones peri\u00f3dicas del n\u00famero de m\u00e9dicos y enfermeras con licenciatura que est\u00e1n empleados15. Las bases de datos est\u00e1n disponibles p\u00fablicamente y no contienen informaci\u00f3n identificable de los individuos.Estudio transversal realizado a partir de an\u00e1lisis secundario de datos para describir caracter\u00edsticas del personal m\u00e9dico y de enfermer\u00eda. Se utiliz\u00f3 la Encuesta Nacional de Ocupaci\u00f3n y Empleo (ENOE), realizada por el Instituto Nacional de Estad\u00edstica y Geograf\u00eda (INEGI). La ENOE tiene un dise\u00f1o probabil\u00edstico, bi\u00e9tapico, estratificado y por conglomerados, se levanta trimestralmente, tiene cobertura geogr\u00e1fica nacional y estatal, y su objetivo es proporcionar informaci\u00f3n sobre las caracter\u00edsticas ocupacionales de la poblaci\u00f3n de 15 a\u00f1os y m\u00e1sSe construyeron indicadores de desigualdad con base en la ENOE del cuarto trimestre de 2018 (trimestre IV-2018). Todas las personas con estudios en medicina o enfermer\u00eda que refirieron haber terminado sus estudios de licenciatura al momento de la encuesta fueron consideradas Recursos Humanos en Salud (RHS) o personal sanitario. Tambi\u00e9n se incluyeron a quienes estudiaron enfermer\u00eda a nivel t\u00e9cnico (enfermer\u00eda auxiliar).Personal empleado/ocupado (Emp): personal sanitario que trabajaba 20 horas o m\u00e1s a la semana realizando funciones de acuerdo a su formaci\u00f3n ac\u00e1demica en el \u00e1rea de la salud, o realizaba funciones administrativas en el sector salud.Personal desempleado (Des): personal sanitario que en la semana de referencia de la encuesta busc\u00f3 trabajo porque no estaba vinculado a una actividad econ\u00f3mica.Personal con subempleo cuantitativo (SubCt): personal sanitario empleado/ocupado menos de 20 horas a la semana y con funciones de acuerdo a su profesi\u00f3n, o bien, que ejerc\u00eda la profesi\u00f3n sanitaria como un empleo secundario.Personal con subempleo cualitativo (SubCl): personal sanitario empleado/ocupado pero con funciones o actividades ajenas a su formaci\u00f3n ac\u00e1demica, independientemente de las horas laborales por semana.Poblaci\u00f3n Econ\u00f3micamente Activa (PEA): personal sanitario empleado, subempleado y desempleado.Densidades de Recursos Humanos en Salud por 1.000 habitantes:a.Densidad de recursos humanos empleados (DRHS): b.Densidad de recursos humanos PEA: En ambos casos, se obtuvo el d\u00e9ficit de RHS respecto al umbral recomendado en la EGRHS de acuerdo con las siguientes f\u00f3rmulas:c.D\u00e9ficit de empleados: d.D\u00e9ficit de PEA: Se analizaron los factores socioec\u00f3nomicos  en ambas profesiones, y se calcularon las densidades de recursos humanos en salud por entidad federativa de 1) personal sanitario empleado por 1.000 habitantes (DRHS), y 2) poblaci\u00f3n econ\u00f3micamente activa (PEA) por 1.000 habitantes. En ambos casos, se compararon las densidades con el umbral de 4,5 por 1.000 recomendado en la EGRHS y se estim\u00f3 el n\u00famero de trabajadores de la salud necesarios para alcanzar dicho umbral.19. Su c\u00e1lculo proviene de la f\u00f3rmula sjh es la proporci\u00f3n del personal sanitario en el estado j respecto al total nacional, y sjp es la proporci\u00f3n de la poblaci\u00f3n en el estado j respecto a la poblaci\u00f3n nacional. En este estudio, el ID se interpret\u00f3 como la proporci\u00f3n (o porcentaje) de trabajadores que tendr\u00edan que redistribuirse entre los estados para que todos tuvieran la misma DRHS.El \u00edndice de disimilitud (ID) es uno de los indicadores usados en el an\u00e1lisis de las desigualdades en salud19. En este estudio, se construyeron las curvas considerando a los estados como unidad de an\u00e1lisis. Se calcul\u00f3 la proporci\u00f3n de RHS en el estado j respecto al total nacional (sjh), y se calcul\u00f3 la proporci\u00f3n de los A\u00f1os de Vida Saludable perdidos por Discapacidad (AVISA) en el estado j respecto al total nacional (sjd). La curva de concentraci\u00f3n grafica la proporci\u00f3n acumulada de AVISA por los estados  con las proporciones acumuladas de RHS. Si los trabajadores est\u00e1n igualmente distribuidos entre los estados, de acuerdo con su porcentaje de la carga de la enfermedad nacional, la curva de concentraci\u00f3n coincide con la diagonal que une los puntos  y , llamada l\u00ednea de igualdad. El \u00e1rea entre la CC y la l\u00ednea de igualdad es el \u00cdndice de Concentraci\u00f3n (IC) y entre mayor sea el valor absoluto del IC m\u00e1s grande es la desigualdad. Se construy\u00f3 un gr\u00e1fico de dispersi\u00f3n entre la DRHS por 1.000 habitantes y los AVISA por 100 mil habitantes en cada estado18. Adicionalmente, se construy\u00f3 otro gr\u00e1fico de dispersi\u00f3n entre la DRHS por 1.000 habitantes y el Producto Interno Bruto (PIB) per c\u00e1pita, y se estim\u00f3 la correlaci\u00f3n de Spearman.Otro \u00edndice usado en el an\u00e1lisis de las desigualdades en salud es el \u00edndice que proviene de la Curva Concentraci\u00f3n (CC)20. La clasificaci\u00f3n y agrupaci\u00f3n de los estados seg\u00fan grado de marginaci\u00f3n proviene de la clasificaci\u00f3n propuesta por CONAPO21. Los datos del Producto Interno Bruto (PIB) se obtuvieron de la p\u00e1gina electr\u00f3nica del Instituto Nacional de Estad\u00edstica y Geograf\u00eda (INEGI)22. La informaci\u00f3n de los AVISA se obtuvo de las estimaciones de la Carga Global de la Enfermedad realizadas por el Instituto de M\u00e9tricas y Evaluaci\u00f3n de la Salud de 2017 23.Se utilizaron los tres indicadores de desigualdad en la distribuci\u00f3n de recursos humanos a nivel nacional y por estados agrupados por grado de marginaci\u00f3n: la DRHS por 1.000 habitantes, el ID y el IC. La informaci\u00f3n del tama\u00f1o de la poblaci\u00f3n proviene de las proyecciones de poblaci\u00f3n del Consejo Nacional de Poblaci\u00f3n (CONAPO) disponibles en la p\u00e1gina electr\u00f3nica de la Direcci\u00f3n General de Informaci\u00f3n en Salud (DGIS) de la Secretar\u00eda de SaludLos an\u00e1lisis se realizaron utilizando los factores de expansi\u00f3n de la encuesta y se consider\u00f3 su dise\u00f1o complejo utilizando el m\u00f3dulo SVY del paquete STATA MP 13.0. Pruebas Chi-cuadrada de Pearson eval\u00faan las diferencias en la distribuci\u00f3n entre el tipo de profesi\u00f3n (medicina o enfermer\u00eda) y sus factores socioecon\u00f3micos considerando p < 0.05 para la significancia estad\u00edstica e intervalos de confianza al 95% (IC95%).En 2018, hab\u00eda 413 mil m\u00e9dicos y 714 mil enfermeras en M\u00e9xico, de los cuales 62,9% y 44,4%, respectivamente, estaban empleados 20 horas o m\u00e1s en el sector salud , equivalLa densidad de profesionales de la salud (DRHS) por 1.000 habitantes fue de 4,6 , superando el umbral de 4,5 recomendado en la EGRHS . Sin embper c\u00e1pita . Esto coincidi\u00f3 con lo descrito anteriomente, seg\u00fan lo cual los grupos de entidades de muy baja y muy alta marginaci\u00f3n ten\u00edan mayores y menores DRHS, respectivamente  con las menores proporciones de AVISA concentraron menos de 25,0% de toda la fuerza laboral, mientras que cinco de ellos  concentraron m\u00e1s de 40,0% . Este patr\u00f3n fue originado principalmente por la desigualdad en la distribuci\u00f3n del personal m\u00e9dico  y de enfermer\u00eda t\u00e9cnica , y en menor medida a la distribuci\u00f3n de la enfermer\u00eda profesional  . Adicionivamente .Diecisiete entidades alcanzaron una densidad de 4,5 , 3a y 3b24. Si bien, de acuerdo a los criterios de la EGRHS, la densidad de trabajadores de la salud podr\u00eda considerarse aceptable, la desigualdad al interior del pa\u00eds se refleja en la variabilidad entre estados, en particular aquellos con alta marginaci\u00f3n que no alcanzan el umbral. Si se reconoce que en los datos de la OCDE se incluye a los m\u00e9dicos internos y residentes, y existe la posibilidad de doble conteo de m\u00e9dicos y enfermeras que trabajan simult\u00e1neamente en el sector p\u00fablico y privado, la disponibilidad de RHS para las \u00e1reas con menor densidad probablemente quedar\u00e1 por debajo de la demanda actual y con mayor d\u00e9ficit para a\u00f1os futuros. En este sentido, proyecciones de requerimiento de m\u00e9dicos especialistas en M\u00e9xico han estimado que las necesidades de salud derivadas del envejecimiento poblacional requerir\u00e1n mayor n\u00famero de especialistas en medicina interna y cirug\u00eda que en pediatr\u00eda, lo que implicar\u00e1 un reto creciente para la provisi\u00f3n de servicios25.Nuestro estudio muestra una desventaja de M\u00e9xico en la disponibilidad de RHS respecto al promedio de los pa\u00edses pertenecientes a la OCDE26. Dicho resultado pudiera reflejar otras \u00e1reas d\u00e9biles del propio sistema de salud, como insuficiencia en equipamiento o insumos requeridos, deficiencia en la calidad de la atenci\u00f3n, as\u00ed como condiciones propias de la transici\u00f3n demogr\u00e1fica y epidemiol\u00f3gica. Eso resulta en necesidades de salud cr\u00f3nico-degenerativas que derivan en discapacidad para una mayor proporci\u00f3n de la poblaci\u00f3n27.Un hallazgo relevante fue la falta de consistencia en la relaci\u00f3n entre la densidad de trabajadores de la salud y las tasas de AVISA. Se esperar\u00eda una correlaci\u00f3n negativa, como ha sido documentado en otros estudios, que apoyar\u00eda la evidencia de contar con una mayor cantidad de profesionales de la salud para disminuir la carga de enfermedad28, que tienen mayor desarrollo econ\u00f3mico y brindan mayores oportunidades laborales y expectativas de mejor ingreso29; o bien, 2) la distribuci\u00f3n del n\u00famero de matr\u00edculas registradas en las universidades a lo largo del pa\u00eds donde seis estados, de marginaci\u00f3n muy baja o baja, concentran al 50 y 35,0% de las matr\u00edculas de estudiantes de medicina y enfermer\u00eda en el ciclo escolar 2017\u20132018, respectivamente, y tres entidades de muy alta marginaci\u00f3n concentran al 15,7% de los estudiantes de enfermer\u00eda matriculados y 6,5% de los estudiantes de medicina matriculados30. Estos desequilibrios en la distribuci\u00f3n de los recursos humanos representan un reto para el sistema de salud, ya que la poblaci\u00f3n que vive en las zonas de alto grado de marginaci\u00f3n presenta menor posibilidad en el acceso a los servicios de salud.En contraste, la relaci\u00f3n positiva entre la DRHS y el PIB estatal podr\u00eda ser explicada por las siguientes razones: 1) el personal m\u00e9dico calificado puede cambiar su residencia a las regiones de M\u00e9xico con ciudades identificadas como focos de atracci\u00f3n en la movilidad m\u00e9dica31, pero que no se consideran en la construcci\u00f3n del umbral de 4,5 por 1.000 habitantes; c) la construcci\u00f3n de la tasas de empleo no contempla la posibilidad de que m\u00e9dicos y enfermeras pudieran dedicarse a actividades de docencia e investigaci\u00f3n en salud, por lo que es muy posible que existan profesionales que son profesores e investigadores que est\u00e9n incluidos en la categor\u00eda de personal subempleado, y 5) la ENOE es una encuesta representativa a nivel nacional y estatal de toda la poblaci\u00f3n mayor de 15 a\u00f1os; el personal m\u00e9dico y de enfermer\u00eda representa menos de 2,0% de la poblaci\u00f3n, lo que podr\u00eda interpretarse como una debilidad de los resultados a nivel estatal. Sin embargo, dado el dise\u00f1o aleatorio de la ENOE y que los tama\u00f1os de muestra son grandes para ambas profesiones, se puede asumir representatividad para este subgrupo.Son limitaciones de este an\u00e1lisis la dificultad para identificar la movilidad laboral, que puede afectar la estimaci\u00f3n de las densidades estatales en el tiempo, y limitaciones provenientes de la ENOE: a) no es posible distinguir entre niveles de atenci\u00f3n ni entre esquemas de aseguramiento, lo que impide establecer de manera m\u00e1s precisa desigualdades entre grupos poblacionales o necesidades de salud; b) no se incluy\u00f3 a las parteras debido a que no es posible identificarlas en la encuesta, y tampoco se incluyeron otras categor\u00edas de personal de salud como dentistas, farmac\u00e9uticos, t\u00e9cnicos de laboratorio o promotores comunitarios que tambi\u00e9n son considerados como fuerza laboral en saludLos resultados indican desigualdad en la distribuci\u00f3n de los RHS a trav\u00e9s de los estados, la cual puede estar potencialmente ligada al n\u00famero de matr\u00edculas que se ofertan en las instituciones educativas, la preferencia del personal de salud para insertarse laboralmente en \u00e1reas con mejores condiciones de vida, y mayor disponibilidad de fuentes de trabajo en estados con mayor infraestructura en salud. Es prioritario el establecimiento de una nueva pol\u00edtica de recursos humanos que, a partir de las necesidades de salud de la poblaci\u00f3n, articule la formaci\u00f3n de m\u00e9dicos, enfermeras y otros profesionales de la salud para su incorporaci\u00f3n en las instituciones de salud considerando las \u00e1reas de mayor demanda. Adem\u00e1s, es necesaria la regulaci\u00f3n de la pr\u00e1ctica profesional, que incentive el equilibrio en el mercado de trabajo p\u00fablico y privado.", "texts": ["To describe the human resources for health and analyze the inequality in its distribution in Mexico. Cross-sectional study based on the National Occupation and Employment Survey (ENOE in Spanish) for the fourth quarter of 2018 in Mexico. Graduated physicians and nurses, and auxiliary/technician nurses with completed studies were considered as human resources for health. States were grouped by degree of marginalization. Densities of human resources for health per 1,000 inhabitants, Index of Dissimilarity (DI) and Concentration Indices (CI) were estimated as measures of unequal distribution. The density of human resources for health was 4.6 per 1,000 inhabitants. We found heterogeneity among states with densities from 2.3 to 10.5 per 1,000 inhabitants. Inequality was higher in the states with a very low degree of marginalization (CI = 0.4) than those with high marginalization (CI = 0.1), and the inequality in the distribution of physicians (CI = 0.5) was greater than in graduated nurses (CI = 0.3) among states. In addition, 17 states showed a density above the threshold of 4.5 per 1,000 inhabitants proposed in the Global Strategy on Human Resources for Health. That implies a deficit of nearly 60,000 human resources for health among the 15 states below the threshold. For all states, to reach a density equal to the national density of 4.6, about 12.6% of human health resources would have to be distributed among states that were below national density. In Mexico, there is inequality in the distribution of human resources for health, with state differences. Government mechanisms could support the balance in the labor market of physicians and nurses through a human resources policy. Anand and B\u00e4rnighausen criticize the conceptual framework of health systems proposed by the World Health Organization (WHO), which considers human resources for health (HRH) as one of the building blocks of the system1. They propose a conceptual framework in which human resources are the core of health systems3. The fulfillment of goals and patient satisfaction depend on the HRH, since they provide preventive and curative care, as well as information on diagnosis, treatment and monitoring, and decide which technology and/or drug to use. Therefore, their size, composition and distribution are very relevant to ensure the population\u2019s access to health services3.Human resources working in health institutions are considered one of the fundamental components for the proper performance of health systems4. In 2004, the Joint Learning Initiative, [JLI] recommended a density of 2.5 per 1,000 inhabitants to achieve 80.0% measles immunization coverage and deliveries performed by health personnel5. Under the Millennium Development Goals (MDG), the 2006 WHO Global Report suggested a minimum threshold of 2.3 physicians, nurses and midwives per thousand inhabitants to reach 80.0% of deliveries performed by qualified personnel; 57 countries did not reach such an indicator4.The availability of HRH, measured by density per number of inhabitants, has been used as a health coverage indicator. A positive relationship has been found with some interventions, such as vaccination or births performed by qualified personnel6, the WHO established a density of 4.5 physicians, nurses and midwives per 1,000 inhabitants as the minimum threshold required for the implementation of the Global Strategy on Human Resources for Health (GSHRH) under Universal Health Coverage (UHC)7. Unlike the 2006 indicator, this threshold includes 12 indicators related to UHC and SDG targets. With this indicator, the WHO predicted that 18 million more health workers would be needed in low-middle-income countries to achieve SDG8, although it became an emphasis that it should not be a target for all countries given their differences in health needs7.In 2016, under the Sustainable Development Goals (SDG)Seguro Popular de Salud  in 2003, to provide financial protection to the population excluded from social security9. At the end of 2017, 53.5 million Mexicans were affiliated with PHI10. In 2005\u20132016, public spending on health per capita increased by 31.0%, and the density of physicians and nurses per thousand inhabitants increased by 34.0 and 32.0%, respectively. Despite these advances, the public health system faces problems of accessibility and quality in care, which can be explained by the lack of an explicit policy on human resources for health11 and by the imbalance between the health needs of the population and human and financial resources12.In Mexico, the federal government launched the public health insurance known as Secretar\u00eda del Trabajo y Previsi\u00f3n Social  makes periodic estimates of the number of graduated physicians and nurses who are employed13; however, these estimates do not show whether employed professionals practice the medical profession nor specify the length of the working day. Other sources of information such as the Organization for Economic Cooperation and Development (OECD) indicate for Mexico a density of 2.4 and 2.9 physicians and nurses, respectively, in 2017. However, these data include intern physicians (undergraduate) and residents , use different sources of information and recognize the possibility of duplication14. In both cases, the HRH density indicator may be overestimated, and it is not possible to estimate the professional deficit that is necessary to reach the 4.5 threshold recommended in GSHRH. Therefore, this study aimed to describe the HRH and analyze it\u2019s inequal distribution in Mexico.At national level, the 15. Databases are publicly available and do not contain identifiable information about individuals.Cross-sectional study based on secondary data analysis to describe characteristics of the physicians and nurses. The National Occupation and Employment Survey , conducted by the National Institute of Statistics and Geography  was used. ENOE has a probabilistic, two-phased, stratified and clustered design. It is carried out quarterly, has national and state geographic coverage, and it aims to provide information on the occupational characteristics of the population aged 15 and olderENOE-based inequality indicators were constructed for the fourth quarter of 2018 (quarter IV-2018). All professionals with medical or nursing studies who reported completing their undergraduate studies at the time of the survey were considered Human Resources for Health (HRH) or health workers. We also included those who studied nursing at the technical level (auxiliary nursing).Employed (Emp): physicians and nurses who worked 20 hours or more a week performing functions according to their proffesional training in the health area, or performing administrative functions in the health sector.Unemployed (Une): physicians and nurses who looked for a job because they did not have an economic activity.Quantitative underemployment (QuantiUn): physicians and nurses employed less than 20 hours a week and with functions according to their profession, or who exercised the health profession as a secondary job.Qualitative underemployment : physicians and nurses employed but with functions or activities outside their professional training, regardless of working hours per week.Economically Active Population (EAP): physicians and nurses employed, underemployed and unemployed.Densities of Human Resources for Health per 1,000 inhabitants:a.Density of employed human resources (DHRH): b.Density of Human Resources EAP: In both cases, the HRH deficit was obtained from the threshold recommended in GSHRH according to the following formulas:c.Employed deficit: d.EAP Deficit: Socio-economic factors  in both professions were analyzed, and state densities of human resources for health of 1) employed health personnel per 1,000 inhabitants (DHRH), and 2) economically active population (EAP) per 1,000 inhabitants were estimated. In both cases, densities were compared with the density of 4.5 per 1,000 inhabitants recommended in GSHRH, and the number of health workers needed to meet this threshold was estimated.19. It is estimated using the formula sjh is the proportion of HRH in state j with respect to the national total of HRH, and sjp is the proportion of the population in state j with respect to the national population. In this study, the ID was interpreted as the proportion (or percentage) of workers who would have to be redistributed among states so that everyone had the same DHRH.The Index of dissimilarity (ID) is one indicator used in the analysis of health inequalities19. In this study, curves were elaborated considering states as an analysis unit. The proportion of HRH in state j with respect to the national total of HRH (sjh) was estimated, and the proportion of Disability-Adjusted Life Year (DALY) in state j was estimated from the national total of DALYs (sjd). The concentration curve plots the cumulative proportion of DALY by the states  with the accumulated proportions of HRH in the Y-axis. If workers are equally distributed among states according to their percentage of the national disease burden, the concentration curve matches the diagonal joining the points (0.0) and (1.1), which is called the equality line. The area between the CC and the equality line is the Concentration Index (CI) and the higher the absolute value of the larger IC, higher the inequality. A scatter plot was built between the DHRH per 1,000 inhabitants and the DALY per 100 thousand inhabitants in each state18. In addition, another dispersion plot was built between the DHRH per 1,000 inhabitants and the Gross Domestic Product (GDP) per capita, and the Spearman\u2019s correlation was estimated.Another index used in the analysis of health inequalities is the index from the Concentration Curve (CC)20. The classification and grouping of states according to degree of marginalization comes from the classification proposed by CONAPO21. Data on the Gross Domestic Product (GDP) were obtained from the INEGI website22. DALY information was obtained from global disease burden estimates conducted by the Institute for Health Metrics and Evaluation (IHME)23.The three inequality indicators in the distribution of human resources at the national level and by states grouped by degree of marginalization were used: the DHRH per 1,000 inhabitants, the ID and the CI. Population size information comes from the population projections of the National Population Council  available on the website of the Directorate-General for Health Information  of the Ministry of HealthThe analyses were conducted using the survey weights, and its complex design was considered using the SVY module of the STATA MP 13.0 package. Pearson Chi-square tests assess the differences in distribution between the type of profession (medicine or nursing) and its socioeconomic factors considering p < 0.05 for statistical significance and confidence intervals at 95% (95%CI).In 2018, there were 413,000 physicians and 714,000 nurses in Mexico, of whom 62.9% and 44.4%, respectively, were employed 20 hours or more in the health sector , which iThe density of health professionals (DHRH) per 1,000 inhabitants was 4.6 , exceeding the threshold of 4.5 recommended in GSHRH . Howeverper capita . This coincided with what was described above, according to which the groups of entities of very low and very high marginalization had higher and lower DHRH, respectively  with the smallest proportions of DALY concentrated less than 25.0% of the entire workforce, while five of them  concentrated more than 40.0% (CI = 0.4). This pattern was mainly caused by the inequality in the distribution of medical personnel (CI = 0.5) and technical nursing (CI = 0.5), and to a lesser extent to the distribution of professional nursing (CI = 0.3) . In addiectively .Seventeen states reached a density of 4.5  and 3b. 24. While, according to GSHRH criteria, the density of health workers could be considered acceptable, inequality within the country is reflected in the variability among states, particularly those with high marginalization that do not reach the threshold. Considering that OECD data include interns and residents, and there is the possibility of double counting of physicians and nurses working simultaneously in the public and private sector, the availability of HRH for lower-density areas is likely to be below current demand and with a larger deficit for future years. In this sense, requirement projections by medical specialists in Mexico have estimated that health needs arising from population aging will require more specialists in internal medicine and surgery than in pediatrics, which will imply a growing challenge for the provision of services25.Our study shows a disadvantage of Mexico in the availability of HRH compared with the average of OECD countries26. Our results could reflect other weak areas of the health system itself, such as insufficient equipment or required inputs, poor quality of care, as well as conditions typical of the demographic and epidemiological transition. The consequences of these multiple factors are chronic-degenerative health needs that lead to disability for a greater proportion of the population27.A relevant finding was the lack of consistency in the relation between the density of health workers and DALY rates. As has been documented in other studies, a negative correlation would be expected, which would support evidence of having more health professionals to reduce the burden of disease28, due to their high economic development, which provide better job opportunities and better income expectations29; or 2) the distribution of the number of students enrolled at universities across the country where six states, of very low or low marginalization, concentrate to 50.0% and 35.0% of the enrollments of medical and nursing students in the 2017\u20132018 school year, respectively; in contrast, three very high-marginalization entities account for 15.7% of registered nursing students and 6.5% of medical students30. These imbalances in the distribution of human resources pose a challenge to the health system as the population living in areas of high degree of marginalization is less likely to have access to health services.By contrast, the positive relationship between DHRH and state GDP could be explained by the following reasons: 1) qualified medical personnel can switch residency to Mexican regions with attractive cities for medical mobility31, but are not considered in the estimation of the 4.5 per 1,000 Inhabitants threshold; c) the estimation of employment rates does not include physicians and nurses in health teaching and research activities. Therefore, they may have included as underemployed, and 5) ENOE is a national and state representative survey of the entire population over 15 years; medical and nursing staff account for less than 2.0% of the population, which could be construed as a weakness in outcomes at the state level. However, given the random design of ENOE and the sample sizes are large for both professions, representativeness can be assumed for this subgroup.Limitations of this analysis are the difficulties in identifying labor mobility, which may affect the estimation of state densities over time, and limitations from ENOE: a) it is not possible to distinguish between levels of care or between insurance schemes, which prevents more precise inequalities among population groups or health needs; b) midwives were not included, since it is not possible to identify them in the survey, nor were other categories of health personnel such as dentists, pharmacists, laboratory technicians or community promoters, who are also considered a health workforceIn brief, the results of this study indicate inequality in the distribution of HRH across states, which may potentially be linked to the number of enrollment offered in educational institutions, the preference of health personnel to be placed into areas with better living conditions, and greater availability of sources of work in states with greater health infrastructure. The establishment of a new human resources policy is a priority that, based on the health needs of the population, articulates the training of physicians, nurses, and other health professionals for incorporation into health institutions, considering the areas of greatest demand. In addition, it is necessary to regulate professional practice, which encourages balance in the public and private labor market. 2. Anand y B\u00e4rnighausen hacen una cr\u00edtica al marco conceptual de los sistemas de salud propuesto por la Organizaci\u00f3n Mundial de la Salud (OMS) que considera a los recursos humanos en salud (RHS) como uno de los bloques del sistema1. Proponen un marco conceptual en el que los recursos humanos son el centro de los sistemas de salud3. El cumplimiento de las metas y la satisfacci\u00f3n de los pacientes dependen de los RHS, dado que son ellos quienes realizan las actividades de provisi\u00f3n de servicios preventivos y curativos, entregan informaci\u00f3n sobre el diagn\u00f3stico, tratamiento y seguimiento, y deciden qu\u00e9 tecnolog\u00eda y/o medicamento utilizar, por lo cual su tama\u00f1o, composici\u00f3n y distribuci\u00f3n son muy relevantes para asegurar el acceso de la poblaci\u00f3n a los servicios de salud3.Los recursos humanos que laboran en las instituciones de salud son considerados uno de los pilares para el adecuado desempe\u00f1o de los sistemas de salud4. En 2004, la Iniciativa Conjunta de Aprendizaje , recomend\u00f3 una densidad de 2,5 por 1.000 habitantes para alcanzar una cobertura de 80,0% de inmunizaci\u00f3n contra el sarampi\u00f3n y partos atendidos por personal de salud5. En el marco de los Objetivos de Desarrollo del Milenio (ODM), el informe mundial de la OMS de 2006 sugiri\u00f3 un umbral m\u00ednimo de 2,3 m\u00e9dicos, enfermeras y parteras por cada mil habitantes para alcanzar un 80,0% de partos atendidos por personal calificado; 57 pa\u00edses no alcanzaban tal indicador4.La disponibilidad de RHS, medida a trav\u00e9s de la densidad por n\u00famero de habitantes, ha sido relacionada con indicadores de cobertura. Se ha encontrado una relaci\u00f3n positiva con algunas intervenciones como cobertura de vacunaci\u00f3n o cobertura de partos atendidos por personal calificado6, la OMS estableci\u00f3 una densidad de 4,5 m\u00e9dicos, enfermeras y parteras por 1.000 habitantes como umbral m\u00ednimo requerido para la implementaci\u00f3n de la Estrategia Global sobre Recursos Humanos para la Salud (EGRHS) en el marco de la cobertura universal de salud (CUS)7. A diferencia del indicador de 2006, este umbral contempla 12 indicadores relacionados con metas de la CUS y los ODS. Con este indicador, la OMS pronostic\u00f3 que se necesitar\u00edan 18 millones m\u00e1s de trabajadores de la salud en los pa\u00edses de ingreso medio-bajo para alcanzar los ODS8, aunque se hizo enfasis en que este no debe representar una meta para todos los paises dadas sus diferencias en las necesidades de salud7.En 2016, en el marco de los Objetivos de Desarrollo Sostenible (ODS)9, con un logro de afiliaci\u00f3n de 53,5 millones de mexicanos hacia finales de 201710. Adicionalmente, en el per\u00edodo 2005\u20132016, el gasto p\u00fablico en salud per c\u00e1pita aument\u00f3 31,0% y la densidad de m\u00e9dicos y enfermeras por cada mil habitantes se increment\u00f3 en 34,0 y 32,0%, respectivamente. A pesar de estos avances, el sistema p\u00fablico de salud enfrenta problemas de accesibilidad y calidad de atenci\u00f3n, que pueden ser explicados por la carencia de una pol\u00edtica expl\u00edcita de recursos humanos en salud11, y por el desequilibrio entre las necesidades de salud de la poblaci\u00f3n y los recursos humanos y financieros12.En M\u00e9xico, el gobierno federal lanz\u00f3 en 2003 un seguro p\u00fablico de salud conocido como Seguro Popular de Salud (SPS) para brindar protecci\u00f3n financiera a la poblaci\u00f3n excluida de la seguridad social13; no obstante, estas estimaciones no muestran si los profesionales ejercen la profesi\u00f3n m\u00e9dica ni se especifica la duraci\u00f3n de la jornada laboral. Otras fuentes de informaci\u00f3n como la Organizaci\u00f3n para la Cooperaci\u00f3n y el Desarrollo Economicos (OCDE) reportaron para M\u00e9xico una densidad de 2,4 y 2,9 m\u00e9dicos y enfermeras, respectivamente, en 2017. Sin embargo, estos datos incluyen a m\u00e9dicos internos (pre-grado) y residentes , utilizan datos provenientes de distintas fuentes de informaci\u00f3n y en ellas se reconoce la posibilidad de duplicaci\u00f3n14. En ambos casos, el indicador de densidad de RHS puede estar sobreestimado y no es posible calcular el d\u00e9ficit de profesionales que son necesarios para alcanzar el umbral de 4,5 recomendado en la EGRHS. Por lo anterior, el presente estudio tuvo como objetivo describir los RHS y analizar la desigualdad en su distribuci\u00f3n en M\u00e9xico.A nivel nacional, la Secretar\u00eda del Trabajo y Previsi\u00f3n Social (STPS) realiza estimaciones peri\u00f3dicas del n\u00famero de m\u00e9dicos y enfermeras con licenciatura que est\u00e1n empleados15. Las bases de datos est\u00e1n disponibles p\u00fablicamente y no contienen informaci\u00f3n identificable de los individuos.Estudio transversal realizado a partir de an\u00e1lisis secundario de datos para describir caracter\u00edsticas del personal m\u00e9dico y de enfermer\u00eda. Se utiliz\u00f3 la Encuesta Nacional de Ocupaci\u00f3n y Empleo (ENOE), realizada por el Instituto Nacional de Estad\u00edstica y Geograf\u00eda (INEGI). La ENOE tiene un dise\u00f1o probabil\u00edstico, bi\u00e9tapico, estratificado y por conglomerados, se levanta trimestralmente, tiene cobertura geogr\u00e1fica nacional y estatal, y su objetivo es proporcionar informaci\u00f3n sobre las caracter\u00edsticas ocupacionales de la poblaci\u00f3n de 15 a\u00f1os y m\u00e1sSe construyeron indicadores de desigualdad con base en la ENOE del cuarto trimestre de 2018 (trimestre IV-2018). Todas las personas con estudios en medicina o enfermer\u00eda que refirieron haber terminado sus estudios de licenciatura al momento de la encuesta fueron consideradas Recursos Humanos en Salud (RHS) o personal sanitario. Tambi\u00e9n se incluyeron a quienes estudiaron enfermer\u00eda a nivel t\u00e9cnico (enfermer\u00eda auxiliar).Personal empleado/ocupado (Emp): personal sanitario que trabajaba 20 horas o m\u00e1s a la semana realizando funciones de acuerdo a su formaci\u00f3n ac\u00e1demica en el \u00e1rea de la salud, o realizaba funciones administrativas en el sector salud.Personal desempleado (Des): personal sanitario que en la semana de referencia de la encuesta busc\u00f3 trabajo porque no estaba vinculado a una actividad econ\u00f3mica.Personal con subempleo cuantitativo (SubCt): personal sanitario empleado/ocupado menos de 20 horas a la semana y con funciones de acuerdo a su profesi\u00f3n, o bien, que ejerc\u00eda la profesi\u00f3n sanitaria como un empleo secundario.Personal con subempleo cualitativo (SubCl): personal sanitario empleado/ocupado pero con funciones o actividades ajenas a su formaci\u00f3n ac\u00e1demica, independientemente de las horas laborales por semana.Poblaci\u00f3n Econ\u00f3micamente Activa (PEA): personal sanitario empleado, subempleado y desempleado.Densidades de Recursos Humanos en Salud por 1.000 habitantes:a.Densidad de recursos humanos empleados (DRHS): b.Densidad de recursos humanos PEA: En ambos casos, se obtuvo el d\u00e9ficit de RHS respecto al umbral recomendado en la EGRHS de acuerdo con las siguientes f\u00f3rmulas:c.D\u00e9ficit de empleados: d.D\u00e9ficit de PEA: Se analizaron los factores socioec\u00f3nomicos  en ambas profesiones, y se calcularon las densidades de recursos humanos en salud por entidad federativa de 1) personal sanitario empleado por 1.000 habitantes (DRHS), y 2) poblaci\u00f3n econ\u00f3micamente activa (PEA) por 1.000 habitantes. En ambos casos, se compararon las densidades con el umbral de 4,5 por 1.000 recomendado en la EGRHS y se estim\u00f3 el n\u00famero de trabajadores de la salud necesarios para alcanzar dicho umbral.19. Su c\u00e1lculo proviene de la f\u00f3rmula sjh es la proporci\u00f3n del personal sanitario en el estado j respecto al total nacional, y sjp es la proporci\u00f3n de la poblaci\u00f3n en el estado j respecto a la poblaci\u00f3n nacional. En este estudio, el ID se interpret\u00f3 como la proporci\u00f3n (o porcentaje) de trabajadores que tendr\u00edan que redistribuirse entre los estados para que todos tuvieran la misma DRHS.El \u00edndice de disimilitud (ID) es uno de los indicadores usados en el an\u00e1lisis de las desigualdades en salud19. En este estudio, se construyeron las curvas considerando a los estados como unidad de an\u00e1lisis. Se calcul\u00f3 la proporci\u00f3n de RHS en el estado j respecto al total nacional (sjh), y se calcul\u00f3 la proporci\u00f3n de los A\u00f1os de Vida Saludable perdidos por Discapacidad (AVISA) en el estado j respecto al total nacional (sjd). La curva de concentraci\u00f3n grafica la proporci\u00f3n acumulada de AVISA por los estados  con las proporciones acumuladas de RHS. Si los trabajadores est\u00e1n igualmente distribuidos entre los estados, de acuerdo con su porcentaje de la carga de la enfermedad nacional, la curva de concentraci\u00f3n coincide con la diagonal que une los puntos  y , llamada l\u00ednea de igualdad. El \u00e1rea entre la CC y la l\u00ednea de igualdad es el \u00cdndice de Concentraci\u00f3n (IC) y entre mayor sea el valor absoluto del IC m\u00e1s grande es la desigualdad. Se construy\u00f3 un gr\u00e1fico de dispersi\u00f3n entre la DRHS por 1.000 habitantes y los AVISA por 100 mil habitantes en cada estado18. Adicionalmente, se construy\u00f3 otro gr\u00e1fico de dispersi\u00f3n entre la DRHS por 1.000 habitantes y el Producto Interno Bruto (PIB) per c\u00e1pita, y se estim\u00f3 la correlaci\u00f3n de Spearman.Otro \u00edndice usado en el an\u00e1lisis de las desigualdades en salud es el \u00edndice que proviene de la Curva Concentraci\u00f3n (CC)20. La clasificaci\u00f3n y agrupaci\u00f3n de los estados seg\u00fan grado de marginaci\u00f3n proviene de la clasificaci\u00f3n propuesta por CONAPO21. Los datos del Producto Interno Bruto (PIB) se obtuvieron de la p\u00e1gina electr\u00f3nica del Instituto Nacional de Estad\u00edstica y Geograf\u00eda (INEGI)22. La informaci\u00f3n de los AVISA se obtuvo de las estimaciones de la Carga Global de la Enfermedad realizadas por el Instituto de M\u00e9tricas y Evaluaci\u00f3n de la Salud de 2017 23.Se utilizaron los tres indicadores de desigualdad en la distribuci\u00f3n de recursos humanos a nivel nacional y por estados agrupados por grado de marginaci\u00f3n: la DRHS por 1.000 habitantes, el ID y el IC. La informaci\u00f3n del tama\u00f1o de la poblaci\u00f3n proviene de las proyecciones de poblaci\u00f3n del Consejo Nacional de Poblaci\u00f3n (CONAPO) disponibles en la p\u00e1gina electr\u00f3nica de la Direcci\u00f3n General de Informaci\u00f3n en Salud (DGIS) de la Secretar\u00eda de SaludLos an\u00e1lisis se realizaron utilizando los factores de expansi\u00f3n de la encuesta y se consider\u00f3 su dise\u00f1o complejo utilizando el m\u00f3dulo SVY del paquete STATA MP 13.0. Pruebas Chi-cuadrada de Pearson eval\u00faan las diferencias en la distribuci\u00f3n entre el tipo de profesi\u00f3n (medicina o enfermer\u00eda) y sus factores socioecon\u00f3micos considerando p < 0.05 para la significancia estad\u00edstica e intervalos de confianza al 95% (IC95%).En 2018, hab\u00eda 413 mil m\u00e9dicos y 714 mil enfermeras en M\u00e9xico, de los cuales 62,9% y 44,4%, respectivamente, estaban empleados 20 horas o m\u00e1s en el sector salud , equivalLa densidad de profesionales de la salud (DRHS) por 1.000 habitantes fue de 4,6 , superando el umbral de 4,5 recomendado en la EGRHS . Sin embper c\u00e1pita . Esto coincidi\u00f3 con lo descrito anteriomente, seg\u00fan lo cual los grupos de entidades de muy baja y muy alta marginaci\u00f3n ten\u00edan mayores y menores DRHS, respectivamente  con las menores proporciones de AVISA concentraron menos de 25,0% de toda la fuerza laboral, mientras que cinco de ellos  concentraron m\u00e1s de 40,0% . Este patr\u00f3n fue originado principalmente por la desigualdad en la distribuci\u00f3n del personal m\u00e9dico  y de enfermer\u00eda t\u00e9cnica , y en menor medida a la distribuci\u00f3n de la enfermer\u00eda profesional  . Adicionivamente .Diecisiete entidades alcanzaron una densidad de 4,5 , 3a y 3b24. Si bien, de acuerdo a los criterios de la EGRHS, la densidad de trabajadores de la salud podr\u00eda considerarse aceptable, la desigualdad al interior del pa\u00eds se refleja en la variabilidad entre estados, en particular aquellos con alta marginaci\u00f3n que no alcanzan el umbral. Si se reconoce que en los datos de la OCDE se incluye a los m\u00e9dicos internos y residentes, y existe la posibilidad de doble conteo de m\u00e9dicos y enfermeras que trabajan simult\u00e1neamente en el sector p\u00fablico y privado, la disponibilidad de RHS para las \u00e1reas con menor densidad probablemente quedar\u00e1 por debajo de la demanda actual y con mayor d\u00e9ficit para a\u00f1os futuros. En este sentido, proyecciones de requerimiento de m\u00e9dicos especialistas en M\u00e9xico han estimado que las necesidades de salud derivadas del envejecimiento poblacional requerir\u00e1n mayor n\u00famero de especialistas en medicina interna y cirug\u00eda que en pediatr\u00eda, lo que implicar\u00e1 un reto creciente para la provisi\u00f3n de servicios25.Nuestro estudio muestra una desventaja de M\u00e9xico en la disponibilidad de RHS respecto al promedio de los pa\u00edses pertenecientes a la OCDE26. Dicho resultado pudiera reflejar otras \u00e1reas d\u00e9biles del propio sistema de salud, como insuficiencia en equipamiento o insumos requeridos, deficiencia en la calidad de la atenci\u00f3n, as\u00ed como condiciones propias de la transici\u00f3n demogr\u00e1fica y epidemiol\u00f3gica. Eso resulta en necesidades de salud cr\u00f3nico-degenerativas que derivan en discapacidad para una mayor proporci\u00f3n de la poblaci\u00f3n27.Un hallazgo relevante fue la falta de consistencia en la relaci\u00f3n entre la densidad de trabajadores de la salud y las tasas de AVISA. Se esperar\u00eda una correlaci\u00f3n negativa, como ha sido documentado en otros estudios, que apoyar\u00eda la evidencia de contar con una mayor cantidad de profesionales de la salud para disminuir la carga de enfermedad28, que tienen mayor desarrollo econ\u00f3mico y brindan mayores oportunidades laborales y expectativas de mejor ingreso29; o bien, 2) la distribuci\u00f3n del n\u00famero de matr\u00edculas registradas en las universidades a lo largo del pa\u00eds donde seis estados, de marginaci\u00f3n muy baja o baja, concentran al 50 y 35,0% de las matr\u00edculas de estudiantes de medicina y enfermer\u00eda en el ciclo escolar 2017\u20132018, respectivamente, y tres entidades de muy alta marginaci\u00f3n concentran al 15,7% de los estudiantes de enfermer\u00eda matriculados y 6,5% de los estudiantes de medicina matriculados30. Estos desequilibrios en la distribuci\u00f3n de los recursos humanos representan un reto para el sistema de salud, ya que la poblaci\u00f3n que vive en las zonas de alto grado de marginaci\u00f3n presenta menor posibilidad en el acceso a los servicios de salud.En contraste, la relaci\u00f3n positiva entre la DRHS y el PIB estatal podr\u00eda ser explicada por las siguientes razones: 1) el personal m\u00e9dico calificado puede cambiar su residencia a las regiones de M\u00e9xico con ciudades identificadas como focos de atracci\u00f3n en la movilidad m\u00e9dica31, pero que no se consideran en la construcci\u00f3n del umbral de 4,5 por 1.000 habitantes; c) la construcci\u00f3n de la tasas de empleo no contempla la posibilidad de que m\u00e9dicos y enfermeras pudieran dedicarse a actividades de docencia e investigaci\u00f3n en salud, por lo que es muy posible que existan profesionales que son profesores e investigadores que est\u00e9n incluidos en la categor\u00eda de personal subempleado, y 5) la ENOE es una encuesta representativa a nivel nacional y estatal de toda la poblaci\u00f3n mayor de 15 a\u00f1os; el personal m\u00e9dico y de enfermer\u00eda representa menos de 2,0% de la poblaci\u00f3n, lo que podr\u00eda interpretarse como una debilidad de los resultados a nivel estatal. Sin embargo, dado el dise\u00f1o aleatorio de la ENOE y que los tama\u00f1os de muestra son grandes para ambas profesiones, se puede asumir representatividad para este subgrupo.Son limitaciones de este an\u00e1lisis la dificultad para identificar la movilidad laboral, que puede afectar la estimaci\u00f3n de las densidades estatales en el tiempo, y limitaciones provenientes de la ENOE: a) no es posible distinguir entre niveles de atenci\u00f3n ni entre esquemas de aseguramiento, lo que impide establecer de manera m\u00e1s precisa desigualdades entre grupos poblacionales o necesidades de salud; b) no se incluy\u00f3 a las parteras debido a que no es posible identificarlas en la encuesta, y tampoco se incluyeron otras categor\u00edas de personal de salud como dentistas, farmac\u00e9uticos, t\u00e9cnicos de laboratorio o promotores comunitarios que tambi\u00e9n son considerados como fuerza laboral en saludLos resultados indican desigualdad en la distribuci\u00f3n de los RHS a trav\u00e9s de los estados, la cual puede estar potencialmente ligada al n\u00famero de matr\u00edculas que se ofertan en las instituciones educativas, la preferencia del personal de salud para insertarse laboralmente en \u00e1reas con mejores condiciones de vida, y mayor disponibilidad de fuentes de trabajo en estados con mayor infraestructura en salud. Es prioritario el establecimiento de una nueva pol\u00edtica de recursos humanos que, a partir de las necesidades de salud de la poblaci\u00f3n, articule la formaci\u00f3n de m\u00e9dicos, enfermeras y otros profesionales de la salud para su incorporaci\u00f3n en las instituciones de salud considerando las \u00e1reas de mayor demanda. Adem\u00e1s, es necesaria la regulaci\u00f3n de la pr\u00e1ctica profesional, que incentive el equilibrio en el mercado de trabajo p\u00fablico y privado."]}
-{"representative": "To compare the access to and effective use of health services available among international migrants and Chileans.Caracterizaci\u00f3n Socioecon\u00f3mica Nacional ), version 2017. Indicators of access to the health system  and effective use of health services  were described in immigrants and local population, self-reported. Gaps by immigrant status were estimated using logistic regressions, with complex samples. Secondary analysis of the National Socioeconomic Characterization Survey , coverage (OR: 2.7 95%CI: 2.0\u20133.7) and unsatisfied need. The difference between immigrants and locals was not statistically significant in barriers to health care access (\u03b1 = 0.005). Disadvantages persist regarding the access to and use of health services by immigrants as opposed to Chileans compared with information from previous years. It is necessary to reduce the gaps between immigrants and people born in Chile, especially in terms of health system access. This is the first barrier to effective use of services. The generation of concrete strategies and health policies that consider an approach of social participation of the immigrant community is suggested to bring the health system closer to this population. It was recognized globally by most countries in the treaty adopted by the United Nations General Assembly in 1966 and came into force in 1976. In 2002, Latin American countries and the Caribbean agreed to initiate efforts to extend social health protection. It also appears as one of the eight Areas of Action defined in the Health Agenda for the Americas 2008\u20132017. In this agenda, all the Ministers of Health from Ibero-America committed themselves to combating health exclusion and building integrated social protection systems with the signing of the Iquique Declaration in July 20072 . Each dimension is essential for a State to provide and guarantee the right to health in its fundamental aspects. Vertical coverage includes the indicator of effective use of health services or benefits5 , of special relevance for the identification of gaps in health access by the general population and vulnerable groups7 . Differences in the effective use of health benefits between social groups, in the face of the same perceived need, correspond to unjust and preventable differences  that require constant attention and reparation. The indicator of effective use of health services or benefits can be disaggregated into the chain of health need and demand: (i) perceived health need, (ii) expressed and unexpressed demand, (iii) satisfied and unsatisfied demand8 .Social health protection is a concrete safeguard measure of the human right to health. It is developed through three main and complementary dimensions: (i) horizontal coverage ; (ii) vertical coverage (access to benefits); and (iii) financial protection9 . This country has a mixed health system, with a public component (close to 70.0% of the population) that protects the sickest and the poorest, a private component (close to 25.0% of the population) that protects the youngest and wealthiest, and a minor component of the armed forces and public order (5.0%). The Constitution of Chile indicates that free and equal access to health should be provided, but this premise has failed by demonstrating profound health inequalities among social groups, to the detriment of the least advantaged in their socioeconomic position. International migrant population has the right to use the public or private health system if they have a valid residence visa, selecting the type of provision according to co-payment capacity. For migrants going through a visa application process, an opportunity for health access on an equal footing with other migrants and Chileans was created if they document a situation of lack of resources to a witness of faith, usually a social worker, in the same health system .In Chile, there is still a debate about repositioning social health protection as a human right for the entire population residing in our territory, regardless of their sex, ethnicity, socioeconomic level or migratory status10 . Human displacement in all its forms is one of humanity\u2019s greatest challenges. Migration is also recognized as a social determinant of health in the world. The process of migration itself, as well as factors associated with it when some degree of vulnerability or lack of protection of universal rights is experienced, have the potential to affect the physical, mental and emotional health of migrants and their families12 .Health protection for international migrants is a global concern. In ancient times and in modern life, moving from one place to another has always offered the opportunity to improve well-being. International migration represents an issue of global attention, reflecting international processes of social inequality and development, conflict and international stratification of labor, and processes of population ageing, to name only some of its dimensions. Added to this, in the globalization era, and given the ease access to information, the advance in communications and the reduced time and cost of moving from one place to another is faster and less costly today than in the past10 . On the other hand, risks associated with displacement, such as psychosocial disorders, reproductive health problems, increased neonatal mortality, drug abuse, nutritional disorders, alcoholism and exposure to violence have also been described12 . One of the aspects of growing interest on a global scale concerns the continuity of care in the transnational setting. This is due to the risks of health care interruption, mainly due to lack of health access in the receiving country12 .The health of migrants is affected when they are not adequately protected. Accidents, hypothermia, burns, cardiovascular accidents, complications in pregnancy and childbirth, diabetes and hypertension are the conditions most frequently mentioned by the World Health Organization12 . The migratory experience can have a negative impact on all social strata. However, health problems tend to concentrate on those migrants who experience poverty, exclusion and discrimination14 .The most recent estimate from the Department of Foreigners and Migration of the Ministry of Interior and Public Security in Chile, from April 2018, indicated there would be a 6.6% international migrant population, corresponding to a marked increase from 2012 census statistics that estimated 2.5-3.0%. The majority of international migrants come from countries of the Southern Cone , especially Argentina, Colombia, Venezuela, Ecuador, Bolivia and Haiti (2017 Short Census). It is important to recognize the great socioeconomic variability that the international migrant population presents in Chile and in the world. Just as there are migrants of high social hierarchy, there are also those of medium and low socioeconomic levels15 reported that the immigrant population would underutilize healthy child control compared with the local population, would use Pap smears screening similarly to the national one, and would use more prenatal and gynecological care services than locals. In addition, a clear socioeconomic gradient is observed in most of these services.In both Chile and the region as a whole, the evidence for the use of health services by international migrants is limited. Studies conducted by Cabieses et al.The aim of this study was to compare the effective use of the health services available among international and Chilean migrants. This comparison enables us to identify inequality gaps in the use of services, which are potentially modifiable, can have a negative impact on the health of migrants and run counter to the universal goal of social health protection.16 . This survey allows us to observe general patterns of the population that self-reports as an immigrant (born abroad) and to compare it with the Chilean population (born in Chile).Cross-sectional observational study. Secondary analysis of the National Socioeconomic Characterization Survey , version 201716 .The CASEN survey is developed periodically by the Ministry of Social Development. It is an instrument for diagnosis, evaluation and targeting, with the objective of knowing the socioeconomic conditions of the country\u2019s households, especially those groups defined as priorities by social policies. This anonymous and free survey uses a complex probabilistic sample, allowing the representation of individuals in private residences of 324 towns of the 16 regions of the country, excluding towns with difficult access and institutionalized peopleCASEN had 70,948 households in 2017, considering a non-response rate of 26.6%. This survey contains information of 216,439 people residing in private households, of which 207,603  were Chilean and 6,811  immigrants. Thus, 94.6% of the population represented was Chilean and 4.4%, immigrant; 0.94% of the individuals did not report their migratory status, and therefore were excluded from the analysis. Data collection was carried out by a structured direct interview with habitual residents or an adult of the family, able to answer for the other members of the household.The study variables were:1.Access to the health systemAffiliation of a health insurance system [yes/no].Type of health insurance [public/private/other].Both were created by recoding the question \u201cWhich health insurance system do you use? .\u201d2.Indicators of effective use of health services17: Self-reports constructed from the variables available in the CASEN 201716 survey   .Perceived need for health: Short-term  and long-term .Demand expressed and not expressed: have consulted the Chilean health system, or not, for those who reported having had some short-term health need [yes/no]; and to be covered or not by the AUGE-GES system in the case of long-term needs.Satisfied and unsatisfied demand: (yes) Appointment or coverage of the perceived health need in short or long term, respectively, or no appointment or coverage for voluntary reasons. (No) no appointment or coverage for involuntary reasons.Reasons for not having an appointment  or coverage .Barriers to health care: Presence of problems during the appointment due to short-term need [yes/no]. Indicator constructed from the questions: When you had an appointment, did you have any of the following problems? a) arriving for the appointment, hospital, clinic, etc. b) to get an appointment/health care (slot). c) to be attended at the establishment  d) paying for care due to cost e) delivery of medications at the healthcare establishment or access to them because of the costs.In cases of short and long-term perceived health need, a higher indicator value reflected a worse health condition. On the other hand, a higher value in the indicators: no access to a health insurance system, demand not expressed, no appointment, no coverage, no appointment or no coverage for involuntary reasons, unsatisfied need and presence of barriers to access, indicated a worse access to health services.3.Sociodemographic control variables: age, sex, area of residence [urban/rural], educational level [no education/basic/high/technical or professional], activity status [employed/unemployed/active], autonomous quintile of total household income.2 with second-order Rao-Scott correction (statistic F).The indicators of access to the health system and effective use of health services were analyzed descriptively for immigrants and people born in Chile, in totality and stratified according to sociodemographic variables. The independence between migratory status and indicators of effective use of health services and access to the health system was analyzed through Pearson\u2019s test \u03c7Logistic regression models were performed, adjusted for sociodemographic variables, considering the use of a health insurance system, Demand satisfied in the short and long-term and Barriers to care, as dependent variables, and immigrant status as an independent variable. This is for the total population and for people over 14 years old (adults), additionally considering the activity condition variable.Database management and data analysis was performed using STATA 14 (StataCorp) software, considering the complex design of the survey (conglomerate stratum and expansion factor) and an estimate of variance by linearization by Taylor series. A significance of 0.05 and 95% confidence was considered for all analyses.The total of 16.3% of the country\u2019s immigrants affirmed that they did not use a health insurance system, a value seven times higher compared with the Chileans (2.3%).Immigrants showed significantly less perceived health need than those born in Chile in both short and long-term. In the short-term, in immigrants, 15.1% of the total population reported illness or accident in the three months prior to the survey (vs. 20.2% in Chileans); of these, 9.3% did not have an appointment and 1.7 of every 100 people did not meet their health need by not having an appointment for reasons beyond their control. For Chileans, these values will correspond to 6.1% and 0.7 out of 100, respectively, significantly lower than in immigrants. On the contrary, immigrants and Chileans reported a similar proportion of problems during the appointment (access barriers): approximately 25.0% of consultants for short-term needs . In the long term, 9.6% of the immigrants were in medical treatment for some illness during the year prior to the survey (vs. 26.2% in Chileans), of which 44.4% were for another health condition different from the 20 main AUGE-GES pathologies treated. This percentage corresponded to 27.2% in Chileans. Immigrants significantly reported a higher proportion of no coverage  and unsatisfied needs , being specifically 2.9 and 4.7 times higher in immigrants than in Chileans, respectively   . In terAfter adjusting for socio-demographic variables, immigrants have 7.5 times more chances of not having health insurance than Chileans. The odds were 6.2 times greater in immigrants than in Chileans over 15 years old and considering the activity condition .Sex, having secondary or higher education compared with no schooling, and belonging to the richest income quintile were significant factors in the lack of health provision, disadvantageous to women, people with no schooling and lower income for the total population. In people over 15 years old, in addition, age and unemployment in reference to occupation will turn out to be significant. On the other hand, having a high school education in relation to no schooling ceased to be significant   .Among the 632,770 immigrants with health insurance, 80.0% used the public system, 18.0% from the private system and 2.0% from the armed forces (FF.AA.) or other, while in Chileans these percentages were 82.1%, 15.0% and 2.9%, respectively. The proportion of men and women using the private health system was higher in both immigrants and Chileans. 15.2% (95%CI:12.26\u201318.79%) of women with pensions used the public system, while in men, 21.0% (95%CI:16.78\u201326.03%) were immigrants. [Results not presented in the table]The immigrant population presented 21.0% (OR = 0.79) less odds of having short-term health needs (illnesses or accidents) than Chileans. However, their odds of not getting an appointment were 1.7 times higher because of this need and the odds of not satisfying this need or not getting an appointment for involuntary reasons were 3.1 higher. All this after adjusting for sociodemographic variables. This situation was maintained for people older than 15 years. Sex, age, schooling and belonging to the richest quintile were significant variables in non-expression of demand. Education ceased to be significant in individuals over 15 years old, and the rest of the income quintiles (with the exception of the III) and the activity condition became significant   .Immigrants had 2.0% (OR = 0.98) times less chance of presenting access barriers than Chileans. After adjusting for socio-demographic variables, this situation was reversed. Immigrants had a greater chance of presenting access barriers both for the entire population and for those aged 15 years or older. It was not significant for none of the cases   .For long-term needs (treatment of some diseases), immigrants had greater odds of not having their treatment covered despite having a lesser chance of receiving treatment. Specifically, adjusting for sociodemographic variables, immigrants had 53.0% (OR = 0.47) times less odds of being in treatment for some disease than Chileans and 37.0% (OR = 0.63) times less odds that this disease was an AUGE-GES pathology. Among those with AUGE-GES pathologies, the immigrant population had 2.7 times more odds of not being covered and 3.3 times more odds of not satisfying this necessity for coverage than Chileans. Immigrants older than 15 years had a greater chance of not being covered by AUGE-GES and not satisfying their long-term need compared with Chileans. With the exception of sex and basic education in contrast to no schooling, all variables considered were significant in no coverage and no satisfaction. In people over 15 years old, it was also not significant to have a secondary education in contrast to having no schooling   .When analyzing the models of indicators of effective use of health services stratified with and without health provision, the presence of long-term needs and coverage of this immigrant status variable was significant   .The results of this study indicate that immigrants are still at a disadvantage in terms of access and use of health services compared with Chileans. Immigrants presented 7.5 times more chances of not having health insurance than Chileans and a lower perceived need but less appointment, coverage or need satisfaction in the short and long-term. Immigrants were 1.7 times more likely to get an appointment in case of an illness or accident and 3.1 times more likely to not satisfy their need by not attending the appointment for reasons out of their control than people born in Chile. On the other hand, the immigrant population were 2.7 times more likely to not have their treatment covered by AUGE-GES and 3.3 times more likely to not satisfy this need for coverage than Chileans.17 .Many countries have been challenged by the global increase in international migrants recently. This brings a series of challenges for diverse sectors, education, health and social protection, just to name a few, which become more complex to face when this population is in conditions of social vulnerability. Health protection in international migrants is a global concern, and access to health services is a fundamental aspect of this work18 . On the other hand, it has been reported that a significant proportion of them live in conditions of social vulnerability. Because they are in an irregular situation, poverty, inadequate housing conditions, unemployment or informal employment and processes of discrimination and abuse or because of the difficulty in obtaining official residence identity document in the country, which, in matters of health access, is essential in order to use the health pension system19 . The number of 15.7% immigrants were not affiliated to any health system in 2015, a value 5.8 times greater than that compared with people born in Chile. The immigrant population was at a disadvantage as to the local population in other indicators of health access, such as the medical care rate for health problems and the issue with health care access18 .The percentage of first-generation immigrants present in the country increased 0.7% in Chile between 2013 and 2015, and it represents 110,738 immigrants17 . Even more worrying is that some of these indicators have increased between 2013 and 2017. 15.6% of immigrants had no health insurance in 2013, while it was 16.3% in 2017; 8.9% of those with short-term needs did not had an appointment because of this need in 2013, while it was 9.4% in 2017. 27.9% of those in treatment for an AUGE-GES disease were not covered by it in 2013, while this value was 44.6% in 2017.The same problems are observed in previous years by Cabieses et al. regarding the effective use of health services for short and long-term needs and access to the health system17 . Even more so in Chile, where according to the CASEN survey (2015), 18.5% of 12 years old or older immigrants participated or participate in some organization or group18 . The CASEN survey in all its versions is nationally representative and allows a diagnosis of the situation of the immigrant population in the country with respect to various socioeconomic conditions. In this specific case of health, it provides information about health conditions , access to the system, health services, health insurance, use of these and associated payments, which in turn may be associated with each other and with a wide range of demographic, cultural and socioeconomic factors17 . Despite this, the sample selection process of the survey does not seek to represent the international migrant population in particular and the country of birth  has non-response percentages (responds \u201cdoes not know\u201d) of 0.9% in 2017. On the other hand, the CASEN survey only allows the analysis of residents in homes, leaving out of the scenario the number of immigrants in street situations, which, according to local media, are increasing20 . The analyses carried out from this survey are limited to the variables present in it. Some of the cultural challenges such as differences in perceptions, traditions and lifestyles, among others, represented as barriers to integration and therefore into obstacles and challenges in access to health systems and services19 cannot be analyzed directly. It is therefore widely useful in the future to complement the analyses presented in this manuscript.It is necessary to reduce inequality gaps in health access and use of health services by the migrant population. To this end, concrete health strategies and policies are necessary, allowing, by social determinants of health, to protect the health and well-being of migrants, from the appearance of short and long-term health problems, and factors that may favor them, to their effective resolution. Interventions that consider a social participation approach of the international migrant community and that bring the Chilean health system closer to this population are widely recommendedThis study indicates that disadvantages persist in access to health services and their use among immigrants compared with those born in Chile. It is necessary to reduce the gaps between immigrants and Chileans, especially in terms of affiliation to a health system. This is the first barrier to the effective use of services. We suggest the generation of concrete strategies and health policies that consider a social participation approach of the immigrant community and, additionally, bring the health system closer to this population.Demand model (short-term): N=3,415,253Df=1,289 F=10.64. Model Satisfaction requirement (short-term): N=3,393,049 Df=1,289 F=6.91. Model Barriers: N=3,146. Df=1,288 F=17.78. Adult demand model (short-term): N=2,797,755 Df=1,288 F=6.54. F=6,08. Model Satisfaction of needs in adults (short-term): N=2,778,419 Df=1,288 F=3.72. Model Obstacles in adults: N=2,563,952 Df=1,287 F=13.76. Model Coverage: N=2,974,923 Df=1,295 F=118.55. Model Coverage in adults: N=2,840,844Df=1,295 F=25.94. Model Satisfaction (long-term): N=2,853,809 Df=1,295 F=100.76. Model Adult satisfaction (long-term): N=2,727,317 Df=1,295 F=21.8 1 .El derecho a la salud es un derecho humano universal e inalienable. Fue reconocido de forma global por la mayor\u00eda de los pa\u00edses del mundo en el tratado adoptado por la Asamblea General de las Naciones Unidas en 1966 y puesto en vigor en 1976. En 2002, pa\u00edses de Am\u00e9rica Latina y el Caribe acordaron iniciar esfuerzos para extender la protecci\u00f3n social en salud. Esta aparece tambi\u00e9n como una de las ocho \u00c1reas de Acci\u00f3n definidas en la Agenda de Salud de las Am\u00e9ricas 2008\u20132017. En dicha agenda, todos los Ministros de Salud de Iberoam\u00e9rica se comprometieron a combatir la exclusi\u00f3n en salud y construir sistemas integrados de protecci\u00f3n social con la firma de la declaraci\u00f3n de Iquique en Julio 20072 Cada dimensi\u00f3n es esencial para que un Estado otorgue y garantice el derecho a la salud en sus aspectos fundamentales. Dentro de la cobertura vertical est\u00e1 el indicador de uso/utilizaci\u00f3n efectiva de servicios o prestaciones de salud5 , de especial relevancia para la identificaci\u00f3n de brechas de acceso a salud por parte de poblaci\u00f3n general y grupos vulnerables7 . Diferencias de uso efectivo de prestaciones de salud entre grupos sociales, ante igual necesidad sentida, corresponde a diferencias injustas y prevenibles  que requieren de constante atenci\u00f3n y reparaci\u00f3n. El indicador de uso/utilizaci\u00f3n efectiva de servicios o prestaciones de salud puede desagregarse en la cadena de necesidad y demanda en salud: (i) necesidad sentida de salud, (ii) demanda expresada y no expresada, (iii) demanda satisfecha y no satisfecha8 .La protecci\u00f3n social en salud es una medida concreta de garant\u00eda del derecho humano en salud. Se desarrolla a trav\u00e9s de tres dimensiones principales y complementarias entre s\u00ed: (i) cobertura horizontal ; (ii) cobertura vertical (acceso a prestaciones); y (iii) protecci\u00f3n financiera9 . Este pa\u00eds cuenta con un sistema de salud mixto, con componente p\u00fablico  que protege a los m\u00e1s enfermos y a los m\u00e1s pobres, componente privado  que protege a los m\u00e1s j\u00f3venes y adinerados, y componente menor de fuerzas armadas y del orden p\u00fablico . La Constituci\u00f3n de Chile indica que se debe brindar acceso libre e igualitario a la salud, pero esta premisa ha fallado al demostrarse profundas desigualdades en salud entre grupos sociales, en desmedro de los menos aventajados en su posici\u00f3n socioecon\u00f3mica. La poblaci\u00f3n migrante internacional cuenta con derecho a uso del sistema de salud p\u00fablico o privado si tiene su visa de residencia vigente, seleccionando el tipo de previsi\u00f3n seg\u00fan capacidad de copago. Para migrantes con visa en tr\u00e1mite, se cre\u00f3 la oportunidad de acceso a salud en igualdad de condici\u00f3n que los dem\u00e1s migrantes y chilenos si es que documentan situaci\u00f3n de carencia de recursos a un testigo de fe, habitualmente trabajador social, en el mismo sistema de salud .En Chile, a\u00fan est\u00e1 presente el debate de reposicionar la protecci\u00f3n social en salud como un derecho humano para toda la poblaci\u00f3n residente en nuestro territorio, independientemente de su condici\u00f3n de g\u00e9nero, etnia, nivel socioecon\u00f3mico o estatus migratorio10 . El desplazamiento humano en todas sus formas es uno de los mayores desaf\u00edos de la humanidad. La migraci\u00f3n es adem\u00e1s un reconocido determinante social de la salud en el mundo. El proceso de migrar en s\u00ed mismo, as\u00ed como factores asociados a este cuando se experimenta alg\u00fan grado de vulnerabilidad o falta de protecci\u00f3n a derechos universales, tienen el potencial de afectar la salud f\u00edsica, mental y emocional de las personas migrantes y sus familias12 .La protecci\u00f3n de la salud por parte de migrantes internacionales es de preocupaci\u00f3n global. En tiempos antiguos y en la vida moderna, el desplazamiento de un lugar a otro siempre ha ofrecido la oportunidad de mejor bienestar. La migraci\u00f3n internacional representa un tema de atenci\u00f3n mundial, al ser reflejo de procesos internacionales de desigualdad social y de desarrollo, de conflicto y de estratificaci\u00f3n internacional del trabajo, y de procesos de envejecimiento poblacional, por mencionar algunas de sus dimensiones. Sumado a esto, en la era de la globalizaci\u00f3n, y dadas las facilidades de acceso a informaci\u00f3n, el avance en las comunicaciones y el menor tiempo y costo de los traslados, el llegar de un lugar a otro resulta hoy en d\u00eda m\u00e1s r\u00e1pido y menos costoso que en el pasado10 . Por otra parte, riesgos derivados de los desplazamientos, tales como trastornos psicosociales, problemas de salud reproductiva, mayor mortalidad neonatal, uso indebido de drogas, trastornos nutricionales, alcoholismo y exposici\u00f3n a la violencia, tambi\u00e9n han sido descritos12 . Uno de los aspectos de creciente inter\u00e9s a escala global tiene relaci\u00f3n con la continuidad del cuidado en el escenario transnacional. Esto por los riesgos en salud de la interrupci\u00f3n de la atenci\u00f3n, fundamentalmente por falta de acceso a ella en el pa\u00eds receptor12 .La salud de personas migrantes puede verse afectada cuando no cuentan con adecuada protecci\u00f3n. Accidentes, hipotermia, quemaduras, accidentes cardiovasculares, complicaciones del embarazo y el parto, diabetes e hipertensi\u00f3n, son las afecciones m\u00e1s mencionadas por la Organizaci\u00f3n Mundial de la Salud12 . La experiencia migratoria puede impactar negativamente en todos los estratos sociales; sin embargo, los problemas de salud tienden a concentrarse en aquellos migrantes que experimentan pobreza, exclusi\u00f3n y discriminaci\u00f3n14 .La m\u00e1s reciente estimaci\u00f3n del Departamento de Extranjer\u00eda y Migraci\u00f3n del Ministerio del Interior y Seguridad P\u00fablica en Chile en abril del 2018 indicaba que existir\u00eda un 6,6% de poblaci\u00f3n migrante internacional, correspondiendo a un marcado aumento desde estad\u00edsticas censales del 2012 que estimaban un 2,5-3,0%. La mayor\u00eda de los migrantes internacionales provienen de pa\u00edses del cono sur (el llamado patr\u00f3n migratorio \u201csur-sur\u201d propio de la regi\u00f3n de Latinoam\u00e9rica), en especial Argentina, Colombia, Venezuela, Ecuador, Bolivia y Hait\u00ed (Censo abreviado del 2017). Es relevante reconocer la gran variabilidad socioecon\u00f3mica que la poblaci\u00f3n migrante internacional presenta en Chile y el mundo. As\u00ed como existen migrantes de alta jerarqu\u00eda social, tambi\u00e9n los hay de nivel socioecon\u00f3mico medio y bajo15 han reportado que la poblaci\u00f3n inmigrante sub-utilizar\u00eda el control de ni\u00f1o sano comparado con la poblaci\u00f3n local, utilizar\u00eda en forma similar el screening de Papanicolaou a la nacional, y utilizar\u00eda m\u00e1s servicios de atenci\u00f3n prenatal y ginecol\u00f3gica que la local. Adem\u00e1s, se ha observado un claro gradiente socioecon\u00f3mico en la mayor\u00eda de estas prestaciones.Tanto en Chile como en la regi\u00f3n en su conjunto, existe evidencia limitada del uso de servicios de salud por parte de poblaci\u00f3n migrante internacional. Estudios realizados por Cabieses y colaboradoresEl objetivo de este estudio fue comparar el uso efectivo de servicios de salud disponibles entre migrantes internacionales y chilenos. Dicha comparaci\u00f3n permite identificar brechas de desigualdad en uso de servicios, que son potencialmente modificables, que pueden impactar negativamente en la salud de los migrantes y que van en contra de la meta universal de protecci\u00f3n social en salud.16 . Esta encuesta permite observar patrones generales de poblaci\u00f3n que se autorreporta como inmigrante (nacida en el extranjero) y compararla con la chilena (nacida en Chile).Estudio observacional de corte transversal. An\u00e1lisis secundario de encuesta de Caracterizaci\u00f3n Socioecon\u00f3mica Nacional (CASEN), versi\u00f3n 201716 .La encuesta CASEN es desarrollada peri\u00f3dicamente por el Ministerio de Desarrollo Social. Es un instrumento de diagn\u00f3stico, evaluaci\u00f3n y focalizaci\u00f3n, con el objetivo de conocer condiciones socioecon\u00f3micas de los hogares del pa\u00eds, especialmente aquellos grupos definidos como prioritarios por las pol\u00edticas sociales. Esta encuesta, an\u00f3nima y de libre disposici\u00f3n, utiliza un muestreo probabil\u00edstico de naturaleza compleja, permitiendo la representatividad de residentes en viviendas particulares de 324 comunas de las 16 regiones del pa\u00eds, excluyendo comunas de dif\u00edcil acceso y personas institucionalizadasCASEN cont\u00f3 con 70.948 hogares en 2017, considerando una tasa de no respuesta del 26,6%. Esta encuesta contiene informaci\u00f3n de 216.439 personas residentes en hogares particulares, de las cuales 207.603 (representativos de 16.843.471) eran chilenas y 6.811 (representativas de 777.407) inmigrantes. As\u00ed, el 94,6% de la poblaci\u00f3n representada era chilena y 4,4% inmigrante; 0,94% de los individuos no reportaron su estatus migratorio, y por ende fueron excluidos del an\u00e1lisis. La recolecci\u00f3n de datos se realiz\u00f3 mediante entrevista estructurada directa a residentes habituales o un adulto de la familia, teniendo la facultad de responder por otros miembros del hogar.Las variables del estudio fueron:1.Acceso al sistema de saludPertenencia a un sistema de previsional de salud [s\u00ed/no].Tipo de previsi\u00f3n de salud [p\u00fablica/privada/otra].Ambos creados a partir de la recodificaci\u00f3n de la pregunta \u201c\u00bfA qu\u00e9 sistema previsional de salud pertenece usted? \u201d17 : Autorreportes construidos a partir de las variables disponibles en encuesta CASEN 201716  y a largo plazo (Durante los \u00faltimos 12 meses \u00bfha estado en tratamiento m\u00e9dico? [s\u00ed/no]).Demanda expresada y no expresada: Haber consultado o no al sistema de salud chileno, para aquellos que reportaron haber tenido alguna necesidad de salud de corto plazo [s\u00ed/no]. Y encontrarse cubierto o no el tratamiento por el sistema AUGE-GES en el caso de las necesidades a largo plazo.Demanda satisfecha y no satisfecha: (s\u00ed) Consulta o cobertura de la necesidad sentida en salud a corto o largo plazo, respectivamente, o no consulta o cobertura por motivos voluntarios. (no) no consulta o cobertura por motivos involuntarios.Razones de no consulta (\u00bfPor qu\u00e9 no tuvo consulta ni atenci\u00f3n?) o cobertura (\u00bfPor qu\u00e9 este tratamiento m\u00e9dico no fue cubierto por el sistema AUGE-GES?).Barreras de atenci\u00f3n: Presencia de problemas durante la consulta por necesidad a corto plazo [s\u00ed/no]. Indicador construido a partir de las preguntas: Cuando consult\u00f3, \u00bfse le present\u00f3 alguno de los siguientes problemas? a) llegar a la consulta, hospital, consultorio, etc. b) conseguir una cita/atenci\u00f3n (hora). c) ser atendido en el establecimiento  d) pagar por la atenci\u00f3n debido al costo e) entrega de medicamentos en el establecimiento de salud o acceso a ellos por su costo.En los casos de necesidad sentida de salud a corto y largo plazo, un mayor valor del indicador reflejaba una peor condici\u00f3n de salud. Por otro lado, un mayor valor en los indicadores de: no pertenencia a un sistema previsional de salud, demanda no expresada, no consulta, no cobertura, no consulta o no cobertura por motivos involuntarios, necesidad no satisfecha y presencia de barreras de acceso, indicaba un peor acceso a servicios de salud.3.Variables sociodemogr\u00e1ficas de control: edad, sexo, zona de residencia [urbano/rural], nivel educacional [sin educaci\u00f3n/primaria/secundaria/t\u00e9cnica o profesional], condici\u00f3n de actividad [ocupados/desocupados/inactivos], quintil aut\u00f3nomo del ingreso total del hogar.Los indicadores de acceso al sistema de salud y uso efectivo de servicios de salud fueron analizados descriptivamente para inmigrantes y nacidos en Chile, en su totalidad y estratificados seg\u00fan variables sociodemogr\u00e1ficas. Se analiz\u00f3 la independencia entre la condici\u00f3n migratoria e indicadores de uso efectivo de servicios de salud y acceso al sistema de salud mediante el test de Pearson con correcci\u00f3n de segundo orden Rao y Scott (estad\u00edstico F).Se realizaron modelos de regresi\u00f3n log\u00edstica, ajustados por variables sociodemogr\u00e1ficas, considerando Pertenencia a un sistema de previsional de salud, Demanda satisfecha a corto y largo plazo y Barreras de atenci\u00f3n, como variables dependientes, y condici\u00f3n de inmigrante como variable independiente. Esto para el total de la poblaci\u00f3n y para mayores de 14 a\u00f1os (adultos) considerando adicionalmente la variable condici\u00f3n de actividad.El manejo de base de datos y an\u00e1lisis de estos se realiz\u00f3 mediante el software STATA 14 (StataCorp), considerando el dise\u00f1o complejo de la encuesta (estrato conglomerado y factor de expansi\u00f3n) y una estimaci\u00f3n de varianza por linealizaci\u00f3n por series de Taylor. Se consider\u00f3 una significancia de 0,05 y confianza del 95% para todos los an\u00e1lisis.Un 16,3% de los inmigrantes del pa\u00eds afirmaban no pertenecer a un sistema previsional de salud, valor siete veces mayor en comparaci\u00f3n con los nacidos en Chile .Los inmigrantes presentaron significativamente una menor necesidad sentida en salud que los nacidos en Chile tanto a largo como a corto plazo. A corto plazo, en inmigrantes, un 15,1% del total de la poblaci\u00f3n report\u00f3 enfermedad o accidente en los tres meses previos a la encuesta ; de estos, el 9,3% no consultaron y 1,7 de cada 100 no logr\u00f3 satisfacer su necesidad en salud al no consultar por motivos ajenos a su voluntad. En chilenos, estos valores corresponder\u00e1n a 6,1% y 0,7 de cada 100, respectivamente, significativamente menores que en inmigrantes. Por el contrario, inmigrantes y chilenos reportaron una proporci\u00f3n similar de presencia de problemas durante la consulta (barreras de acceso): aproximadamente un 25,0% del total de consultantes por necesidades a corto plazo . A largo plazo, un 9,6% de los inmigrantes se encontraba en tratamiento m\u00e9dico por alguna enfermedad durante el a\u00f1o previo a la encuesta , de los cuales el 44,4% eran por otra condici\u00f3n de salud distinta a las 20 principales patolog\u00edas AUGE-GES consultadas; este porcentaje correspondi\u00f3 al 27,2% en chilenos. Los inmigrantes reportaron significativamente una mayor proporci\u00f3n de no cobertura  y necesidades no satisfechas , siendo espec\u00edficamente 2,9 y 4,7 veces mayor en inmigrantes que en chilenos, respectivamente   . En t\u00e9rTras ajustar por variables sociodemogr\u00e1ficas, los inmigrantes presentan 7,5 veces m\u00e1s chances de no tener previsi\u00f3n de salud que los chilenos. Este chance fue 6,2 veces mayor en inmigrantes que en chilenos en mayores de 15 a\u00f1os y considerando la condici\u00f3n de actividad .El sexo, el tener educaci\u00f3n media o superior en comparaci\u00f3n con no tener educaci\u00f3n, y el pertenecer el quintil de ingreso m\u00e1s rico en comparaci\u00f3n con el m\u00e1s pobre, resultaron ser factores significativos en la falta de previsi\u00f3n de salud, en desventaja de las mujeres, personas sin educaci\u00f3n y de menores ingresos para el total de la poblaci\u00f3n. En mayores de 15 a\u00f1os, adicionalmente, la edad y desocupaci\u00f3n en referencia a la ocupaci\u00f3n resultaran ser significativas. Por otro lado, el tener educaci\u00f3n media en referencia a no tener educaci\u00f3n dej\u00f3 de ser significativa   .Dentro de los 632.770 inmigrantes con previsi\u00f3n de salud, el 80,0% pertenec\u00eda al sistema p\u00fablico, el 18,0% al privado y el 2,0% fuerzas armadas (FF.AA.) u otro, mientras que en chilenos estos porcentajes fueron 82,1%, 15,0% y 2,9% respectivamente. La proporci\u00f3n de pertenecientes al sistema privado de salud en hombres que en mujeres fue mayor tanto en inmigrantes como en nacidos en Chile. El 15,2%  de las mujeres con previsi\u00f3n pertenec\u00edan al sistema p\u00fablico, mientras que en hombres un 21,0%  en inmigrantes. [Resultados no presentados en tabla]La poblaci\u00f3n inmigrante present\u00f3 significativamente 21,0%  menos chance de tener necesidades a corto plazo en salud (enfermedades o accidentes) que los chilenos. Sin embargo, tuvieron 1,7 veces m\u00e1s chance de no consultar ante esta necesidad y 3,1 veces m\u00e1s chance de no satisfacer esta, es decir, no haber consultado por motivos involuntarios. Todo esto tras ajustar por variables sociodemogr\u00e1ficas. Esta situaci\u00f3n se mantuvo en mayores de 15 a\u00f1os. Sexo, edad, educaci\u00f3n y pertenecer al quintil m\u00e1s rico en contraste con el m\u00e1s pobre fueron variables significativas en la no expresi\u00f3n de la demanda. La educaci\u00f3n dej\u00f3 de ser significativa en mayores de 15 a\u00f1os, y el resto de los quintiles de ingreso (a excepci\u00f3n del III) y la condici\u00f3n de actividad pasaron a serlo   .De manera cruda, los inmigrantes ten\u00edan 2,0%  veces menos chance de presentar barreras de acceso que los chilenos. Tras ajustar por variables sociodemogr\u00e1ficas, esta situaci\u00f3n se invirti\u00f3. Los inmigrantes presentaran una mayor chance de presentar barreras de acceso tanto para el total de la poblaci\u00f3n como para los de 15 a\u00f1os o m\u00e1s. Para ninguno de los casos esto fue significativo   .Para las necesidades a largo plazo  de manera significativa, los inmigrantes tuvieron un mayor chance de no tener su tratamiento cubierto pese a presentar un menor chance de estar en tratamiento. Espec\u00edficamente, ajustando por variables sociodemogr\u00e1ficas, los inmigrantes ten\u00edan 53,0%  veces menos chance de estar en tratamiento por alguna enfermedad que los chilenos y 37,0%  veces menos chance de que esta enfermedad fuera una patolog\u00eda AUGE-GES. Entre aquellos con patolog\u00edas AUGE-GES, la poblaci\u00f3n inmigrante ten\u00eda 2,7 veces m\u00e1s chance de no estar cubierta y 3,3 veces m\u00e1s chance de no satisfacer esta necesidad de cobertura que los chilenos. En mayores de 15 a\u00f1os, los inmigrantes tuvieron mayor chance de no estar cubiertos por el AUGE-GES y no satisfacer su necesidad a largo plazo que los chilenos. A excepci\u00f3n del sexo y el tener educaci\u00f3n b\u00e1sica en contraste con el no tener educaci\u00f3n, todas las variables consideradas fueron significativas en la no cobertura y no satisfacci\u00f3n. En mayores de 15 a\u00f1os tampoco fue significativo el tener educaci\u00f3n media en contraste con no tener educaci\u00f3n   .Al analizar los modelos de indicadores de uso efectivo de servicios de salud estratificados por con y sin previsi\u00f3n de salud, la presencia de necesidades a largo plazo y cobertura de esta la variable condici\u00f3n de inmigrante fue significativa   .Los resultados de este estudio indican que los inmigrantes a\u00fan se encuentran en desventaja en t\u00e9rminos de acceso y uso a servicios de salud en comparaci\u00f3n con los nacidos en Chile. Los inmigrantes presentaron 7,5 veces m\u00e1s chances de no tener previsi\u00f3n de salud que los chilenos y una menor necesidad sentida pero una menor consulta, cobertura o satisfacci\u00f3n de estas necesidades a corto y a largo plazo. Los inmigrantes ten\u00edan 1,7 veces m\u00e1s chance de no consultar ante una enfermedad o accidente y 3,1 veces m\u00e1s chance de no satisfacer su necesidad, al no consultar por motivos ajenos a su voluntad, que los nacidos en Chile. Por otro lado, la poblaci\u00f3n inmigrante ten\u00eda 2,7 veces m\u00e1s chance de no tener cubierto su tratamiento por el AUGE-GES y 3,3 veces m\u00e1s chance de no satisfacer esta necesidad de cobertura que los chilenos.17 .Muchos pa\u00edses se han visto desafiados por el aumento global de poblaci\u00f3n migrante internacional en los \u00faltimos a\u00f1os. Esto trae consigo una seria de desaf\u00edos para diversos sectores, educaci\u00f3n, salud y protecci\u00f3n social, solo por nombrar algunos, los cuales se vuelven m\u00e1s complejos de enfrentar cuando esta poblaci\u00f3n se encuentra en condiciones de vulnerabilidad social. La protecci\u00f3n de la salud en migrantes internacionales es de preocupaci\u00f3n global, y el acceso a servicios de salud una arista fundamental para esta labor18 . Por otro lado, se ha reportado que una proporci\u00f3n significativa de estos viven en condiciones de vulnerabilidad social, ya sea por encontrarse en situaci\u00f3n irregular, pobreza, malas condiciones de vivienda, desempleo o empleo informal y procesos de discriminaci\u00f3n y abuso o la dificultada para obtener documentaci\u00f3n oficial de identidad de residencia en el pa\u00eds, lo cual en temas de acceso a salud es esencial para poder pertenecer al sistema previsional de salud19 . Para el a\u00f1o 2015, un 15,7% de los inmigrantes no se encontraba afiliado a ning\u00fan sistema de salud, valor 5,8 veces mayor que en nacidos en Chile. La poblaci\u00f3n inmigrante se encontraba en situaci\u00f3n de desventaja respecto a la poblaci\u00f3n local tambi\u00e9n en otros indicadores de acceso a salud, como tasa de atenci\u00f3n m\u00e9dica ante problema de salud y problema de acceso a atenci\u00f3n18 .El porcentaje de inmigrantes de primera generaci\u00f3n presentes en el pa\u00eds aument\u00f3 en 0,7% en Chile, entre el 2013 y 2015, lo cual se traduce en 110.738 inmigrantes17 . M\u00e1s preocupante aun es que algunos de estos indicadores han aumentado entre 2013 y 2017. Un 15,6% de los inmigrantes no ten\u00edan previsi\u00f3n de salud en 2013, mientras que fueron un 16,3% en 2017; un 8,9% de los que ten\u00edan necesidades a corto plazo no consultaron por esta necesidad en 2013, mientras que fue un 9,4% en 2017. Un 27,9% de los que se encontraban en tratamiento por una enfermedad AUGE-GES no se encontraban cubiertos por el mismo en 2013, mientras que este valor fue de 44,6% en 2017.Se observan las mismas falencias que en a\u00f1os anteriores por Cabieses y cols. en cuanto al uso efectivo de servicios de salud por necesidades a corto y largo plazo y acceso al sistema de salud17 ; m\u00e1s a\u00fan en Chile, en donde seg\u00fan la encuesta CASEN (2015), un 18,5% de los inmigrantes de 12 a\u00f1os o m\u00e1s han participado o participan en alguna organizaci\u00f3n o grupo organizado18 . La encuesta CASEN en todas sus versiones es de representaci\u00f3n nacional y permite obtener un diagn\u00f3stico de la situaci\u00f3n de la poblaci\u00f3n inmigrante en el pa\u00eds respecto a diversas condiciones socioecon\u00f3micas. En este caso espec\u00edfico de la salud, esta permite conocer: condiciones de salud , acceso al sistema, servicios de salud, seguros de salud, uso de estos y pagos asociados, las cuales a su vez pueden asociarse entre ellas y entre una amplia diversidad de factores demogr\u00e1ficos, culturales y socioecon\u00f3micos17 . Pese a esto, el proceso de selecci\u00f3n muestral de la encuesta no busca representar a la poblaci\u00f3n migrante internacional en particular y la variable de pa\u00eds de nacimiento (que permite la estratificaci\u00f3n entre inmigrante y chileno) cuenta con porcentajes no respuesta (responde \u201cno sabe\u201d) en 2017 del 0,9%. Por otro lado, la encuesta CASEN solo permite el an\u00e1lisis de residentes en viviendas, dejando fuera del panorama a aquellos inmigrantes en situaci\u00f3n de calle, los cuales seg\u00fan medios locales se encuentran en incremento20 . Los an\u00e1lisis realizados a partir de esta encuesta se encuentran limitados a las variables presentes en ella. Algunos de los desaf\u00edos culturales como diferencias en visiones, tradiciones y estilos de vida, entre otros, que se traducen en barreras de integraci\u00f3n y por ende en barreras y desaf\u00edos en el acceso a sistemas y servicios de salud19 no pueden ser analizados directamente. Es, por tanto, de amplia utilidad a futuro complementar los an\u00e1lisis presentados en este manuscrito.Es necesario reducir brechas de desigualdad en acceso y uso de servicios de salud por parte de poblaci\u00f3n migrante. Para eso, son necesarias estrategias concretas en salud y pol\u00edticas que permitan, a trav\u00e9s los determinantes sociales de la salud, proteger la salud y bienestar de migrantes, desde la aparici\u00f3n de problemas de salud de corto y largo plazo, y factores que puedan favorecer estos, hasta su efectiva resoluci\u00f3n. Intervenciones que consideren un enfoque de participaci\u00f3n social de la comunidad migrante internacional y que acerquen el sistema de salud chileno a esta poblaci\u00f3n son ampliamente recomendadasEl presente estudio indica que persisten las desventajas en acceso y uso a servicios de salud en inmigrantes en comparaci\u00f3n con los nacidos en Chile. Es necesario reducir las brechas entre inmigrantes y nacidos en Chile, sobre todo en cuanto a pertenencia a un sistema de salud. Esta es la primera barrera para un uso efectivo de servicios. Se sugiere generar estrategias concretas y pol\u00edticas en salud que consideren un enfoque de participaci\u00f3n social de la comunidad inmigrante y, adicionalmente, acerquen al sistema de salud a esta poblaci\u00f3n.Modelo Demanda (corto plazo): N=3.415.253Df=1.289 F=10,64. Modelo Satisfacci\u00f3n necesidad (corto plazo): N=3.393.049 Df=1.289 F=6,91. Modelo Barreras: N=3.146. Df=1.288 F=17,78. Modelo Demanda en adultos (corto plazo): N=2.797.755 Df=1.288 F=6,54. F=6,08. Modelo Satisfacci\u00f3n necesidad en adultos (corto plazo): N=2.778.419 Df=1.288 F=3,72. Modelo barreras en adultos: N=2.563.952 Df=1.287 F=13,76. Modelo Cobertura: N=2.974.923 Df=1.295 F=118,55. Modelo Cobertura en adultos: N=2.840.844Df=1.295 F=25,94. Modelo Satisfacci\u00f3n necesidad (largo plazo): N=2.853.809 Df=1.295 F=100,76. Modelo Satisfacci\u00f3n necesidad en adultos (largo plazo): N=2.727.317 Df=1.295 F=21,8", "texts": ["To compare the access to and effective use of health services available among international migrants and Chileans.Caracterizaci\u00f3n Socioecon\u00f3mica Nacional ), version 2017. Indicators of access to the health system  and effective use of health services  were described in immigrants and local population, self-reported. Gaps by immigrant status were estimated using logistic regressions, with complex samples. Secondary analysis of the National Socioeconomic Characterization Survey , coverage (OR: 2.7 95%CI: 2.0\u20133.7) and unsatisfied need. The difference between immigrants and locals was not statistically significant in barriers to health care access (\u03b1 = 0.005). Disadvantages persist regarding the access to and use of health services by immigrants as opposed to Chileans compared with information from previous years. It is necessary to reduce the gaps between immigrants and people born in Chile, especially in terms of health system access. This is the first barrier to effective use of services. The generation of concrete strategies and health policies that consider an approach of social participation of the immigrant community is suggested to bring the health system closer to this population. It was recognized globally by most countries in the treaty adopted by the United Nations General Assembly in 1966 and came into force in 1976. In 2002, Latin American countries and the Caribbean agreed to initiate efforts to extend social health protection. It also appears as one of the eight Areas of Action defined in the Health Agenda for the Americas 2008\u20132017. In this agenda, all the Ministers of Health from Ibero-America committed themselves to combating health exclusion and building integrated social protection systems with the signing of the Iquique Declaration in July 20072 . Each dimension is essential for a State to provide and guarantee the right to health in its fundamental aspects. Vertical coverage includes the indicator of effective use of health services or benefits5 , of special relevance for the identification of gaps in health access by the general population and vulnerable groups7 . Differences in the effective use of health benefits between social groups, in the face of the same perceived need, correspond to unjust and preventable differences  that require constant attention and reparation. The indicator of effective use of health services or benefits can be disaggregated into the chain of health need and demand: (i) perceived health need, (ii) expressed and unexpressed demand, (iii) satisfied and unsatisfied demand8 .Social health protection is a concrete safeguard measure of the human right to health. It is developed through three main and complementary dimensions: (i) horizontal coverage ; (ii) vertical coverage (access to benefits); and (iii) financial protection9 . This country has a mixed health system, with a public component (close to 70.0% of the population) that protects the sickest and the poorest, a private component (close to 25.0% of the population) that protects the youngest and wealthiest, and a minor component of the armed forces and public order (5.0%). The Constitution of Chile indicates that free and equal access to health should be provided, but this premise has failed by demonstrating profound health inequalities among social groups, to the detriment of the least advantaged in their socioeconomic position. International migrant population has the right to use the public or private health system if they have a valid residence visa, selecting the type of provision according to co-payment capacity. For migrants going through a visa application process, an opportunity for health access on an equal footing with other migrants and Chileans was created if they document a situation of lack of resources to a witness of faith, usually a social worker, in the same health system .In Chile, there is still a debate about repositioning social health protection as a human right for the entire population residing in our territory, regardless of their sex, ethnicity, socioeconomic level or migratory status10 . Human displacement in all its forms is one of humanity\u2019s greatest challenges. Migration is also recognized as a social determinant of health in the world. The process of migration itself, as well as factors associated with it when some degree of vulnerability or lack of protection of universal rights is experienced, have the potential to affect the physical, mental and emotional health of migrants and their families12 .Health protection for international migrants is a global concern. In ancient times and in modern life, moving from one place to another has always offered the opportunity to improve well-being. International migration represents an issue of global attention, reflecting international processes of social inequality and development, conflict and international stratification of labor, and processes of population ageing, to name only some of its dimensions. Added to this, in the globalization era, and given the ease access to information, the advance in communications and the reduced time and cost of moving from one place to another is faster and less costly today than in the past10 . On the other hand, risks associated with displacement, such as psychosocial disorders, reproductive health problems, increased neonatal mortality, drug abuse, nutritional disorders, alcoholism and exposure to violence have also been described12 . One of the aspects of growing interest on a global scale concerns the continuity of care in the transnational setting. This is due to the risks of health care interruption, mainly due to lack of health access in the receiving country12 .The health of migrants is affected when they are not adequately protected. Accidents, hypothermia, burns, cardiovascular accidents, complications in pregnancy and childbirth, diabetes and hypertension are the conditions most frequently mentioned by the World Health Organization12 . The migratory experience can have a negative impact on all social strata. However, health problems tend to concentrate on those migrants who experience poverty, exclusion and discrimination14 .The most recent estimate from the Department of Foreigners and Migration of the Ministry of Interior and Public Security in Chile, from April 2018, indicated there would be a 6.6% international migrant population, corresponding to a marked increase from 2012 census statistics that estimated 2.5-3.0%. The majority of international migrants come from countries of the Southern Cone , especially Argentina, Colombia, Venezuela, Ecuador, Bolivia and Haiti (2017 Short Census). It is important to recognize the great socioeconomic variability that the international migrant population presents in Chile and in the world. Just as there are migrants of high social hierarchy, there are also those of medium and low socioeconomic levels15 reported that the immigrant population would underutilize healthy child control compared with the local population, would use Pap smears screening similarly to the national one, and would use more prenatal and gynecological care services than locals. In addition, a clear socioeconomic gradient is observed in most of these services.In both Chile and the region as a whole, the evidence for the use of health services by international migrants is limited. Studies conducted by Cabieses et al.The aim of this study was to compare the effective use of the health services available among international and Chilean migrants. This comparison enables us to identify inequality gaps in the use of services, which are potentially modifiable, can have a negative impact on the health of migrants and run counter to the universal goal of social health protection.16 . This survey allows us to observe general patterns of the population that self-reports as an immigrant (born abroad) and to compare it with the Chilean population (born in Chile).Cross-sectional observational study. Secondary analysis of the National Socioeconomic Characterization Survey , version 201716 .The CASEN survey is developed periodically by the Ministry of Social Development. It is an instrument for diagnosis, evaluation and targeting, with the objective of knowing the socioeconomic conditions of the country\u2019s households, especially those groups defined as priorities by social policies. This anonymous and free survey uses a complex probabilistic sample, allowing the representation of individuals in private residences of 324 towns of the 16 regions of the country, excluding towns with difficult access and institutionalized peopleCASEN had 70,948 households in 2017, considering a non-response rate of 26.6%. This survey contains information of 216,439 people residing in private households, of which 207,603  were Chilean and 6,811  immigrants. Thus, 94.6% of the population represented was Chilean and 4.4%, immigrant; 0.94% of the individuals did not report their migratory status, and therefore were excluded from the analysis. Data collection was carried out by a structured direct interview with habitual residents or an adult of the family, able to answer for the other members of the household.The study variables were:1.Access to the health systemAffiliation of a health insurance system [yes/no].Type of health insurance [public/private/other].Both were created by recoding the question \u201cWhich health insurance system do you use? .\u201d2.Indicators of effective use of health services17: Self-reports constructed from the variables available in the CASEN 201716 survey   .Perceived need for health: Short-term  and long-term .Demand expressed and not expressed: have consulted the Chilean health system, or not, for those who reported having had some short-term health need [yes/no]; and to be covered or not by the AUGE-GES system in the case of long-term needs.Satisfied and unsatisfied demand: (yes) Appointment or coverage of the perceived health need in short or long term, respectively, or no appointment or coverage for voluntary reasons. (No) no appointment or coverage for involuntary reasons.Reasons for not having an appointment  or coverage .Barriers to health care: Presence of problems during the appointment due to short-term need [yes/no]. Indicator constructed from the questions: When you had an appointment, did you have any of the following problems? a) arriving for the appointment, hospital, clinic, etc. b) to get an appointment/health care (slot). c) to be attended at the establishment  d) paying for care due to cost e) delivery of medications at the healthcare establishment or access to them because of the costs.In cases of short and long-term perceived health need, a higher indicator value reflected a worse health condition. On the other hand, a higher value in the indicators: no access to a health insurance system, demand not expressed, no appointment, no coverage, no appointment or no coverage for involuntary reasons, unsatisfied need and presence of barriers to access, indicated a worse access to health services.3.Sociodemographic control variables: age, sex, area of residence [urban/rural], educational level [no education/basic/high/technical or professional], activity status [employed/unemployed/active], autonomous quintile of total household income.2 with second-order Rao-Scott correction (statistic F).The indicators of access to the health system and effective use of health services were analyzed descriptively for immigrants and people born in Chile, in totality and stratified according to sociodemographic variables. The independence between migratory status and indicators of effective use of health services and access to the health system was analyzed through Pearson\u2019s test \u03c7Logistic regression models were performed, adjusted for sociodemographic variables, considering the use of a health insurance system, Demand satisfied in the short and long-term and Barriers to care, as dependent variables, and immigrant status as an independent variable. This is for the total population and for people over 14 years old (adults), additionally considering the activity condition variable.Database management and data analysis was performed using STATA 14 (StataCorp) software, considering the complex design of the survey (conglomerate stratum and expansion factor) and an estimate of variance by linearization by Taylor series. A significance of 0.05 and 95% confidence was considered for all analyses.The total of 16.3% of the country\u2019s immigrants affirmed that they did not use a health insurance system, a value seven times higher compared with the Chileans (2.3%).Immigrants showed significantly less perceived health need than those born in Chile in both short and long-term. In the short-term, in immigrants, 15.1% of the total population reported illness or accident in the three months prior to the survey (vs. 20.2% in Chileans); of these, 9.3% did not have an appointment and 1.7 of every 100 people did not meet their health need by not having an appointment for reasons beyond their control. For Chileans, these values will correspond to 6.1% and 0.7 out of 100, respectively, significantly lower than in immigrants. On the contrary, immigrants and Chileans reported a similar proportion of problems during the appointment (access barriers): approximately 25.0% of consultants for short-term needs . In the long term, 9.6% of the immigrants were in medical treatment for some illness during the year prior to the survey (vs. 26.2% in Chileans), of which 44.4% were for another health condition different from the 20 main AUGE-GES pathologies treated. This percentage corresponded to 27.2% in Chileans. Immigrants significantly reported a higher proportion of no coverage  and unsatisfied needs , being specifically 2.9 and 4.7 times higher in immigrants than in Chileans, respectively   . In terAfter adjusting for socio-demographic variables, immigrants have 7.5 times more chances of not having health insurance than Chileans. The odds were 6.2 times greater in immigrants than in Chileans over 15 years old and considering the activity condition .Sex, having secondary or higher education compared with no schooling, and belonging to the richest income quintile were significant factors in the lack of health provision, disadvantageous to women, people with no schooling and lower income for the total population. In people over 15 years old, in addition, age and unemployment in reference to occupation will turn out to be significant. On the other hand, having a high school education in relation to no schooling ceased to be significant   .Among the 632,770 immigrants with health insurance, 80.0% used the public system, 18.0% from the private system and 2.0% from the armed forces (FF.AA.) or other, while in Chileans these percentages were 82.1%, 15.0% and 2.9%, respectively. The proportion of men and women using the private health system was higher in both immigrants and Chileans. 15.2% (95%CI:12.26\u201318.79%) of women with pensions used the public system, while in men, 21.0% (95%CI:16.78\u201326.03%) were immigrants. [Results not presented in the table]The immigrant population presented 21.0% (OR = 0.79) less odds of having short-term health needs (illnesses or accidents) than Chileans. However, their odds of not getting an appointment were 1.7 times higher because of this need and the odds of not satisfying this need or not getting an appointment for involuntary reasons were 3.1 higher. All this after adjusting for sociodemographic variables. This situation was maintained for people older than 15 years. Sex, age, schooling and belonging to the richest quintile were significant variables in non-expression of demand. Education ceased to be significant in individuals over 15 years old, and the rest of the income quintiles (with the exception of the III) and the activity condition became significant   .Immigrants had 2.0% (OR = 0.98) times less chance of presenting access barriers than Chileans. After adjusting for socio-demographic variables, this situation was reversed. Immigrants had a greater chance of presenting access barriers both for the entire population and for those aged 15 years or older. It was not significant for none of the cases   .For long-term needs (treatment of some diseases), immigrants had greater odds of not having their treatment covered despite having a lesser chance of receiving treatment. Specifically, adjusting for sociodemographic variables, immigrants had 53.0% (OR = 0.47) times less odds of being in treatment for some disease than Chileans and 37.0% (OR = 0.63) times less odds that this disease was an AUGE-GES pathology. Among those with AUGE-GES pathologies, the immigrant population had 2.7 times more odds of not being covered and 3.3 times more odds of not satisfying this necessity for coverage than Chileans. Immigrants older than 15 years had a greater chance of not being covered by AUGE-GES and not satisfying their long-term need compared with Chileans. With the exception of sex and basic education in contrast to no schooling, all variables considered were significant in no coverage and no satisfaction. In people over 15 years old, it was also not significant to have a secondary education in contrast to having no schooling   .When analyzing the models of indicators of effective use of health services stratified with and without health provision, the presence of long-term needs and coverage of this immigrant status variable was significant   .The results of this study indicate that immigrants are still at a disadvantage in terms of access and use of health services compared with Chileans. Immigrants presented 7.5 times more chances of not having health insurance than Chileans and a lower perceived need but less appointment, coverage or need satisfaction in the short and long-term. Immigrants were 1.7 times more likely to get an appointment in case of an illness or accident and 3.1 times more likely to not satisfy their need by not attending the appointment for reasons out of their control than people born in Chile. On the other hand, the immigrant population were 2.7 times more likely to not have their treatment covered by AUGE-GES and 3.3 times more likely to not satisfy this need for coverage than Chileans.17 .Many countries have been challenged by the global increase in international migrants recently. This brings a series of challenges for diverse sectors, education, health and social protection, just to name a few, which become more complex to face when this population is in conditions of social vulnerability. Health protection in international migrants is a global concern, and access to health services is a fundamental aspect of this work18 . On the other hand, it has been reported that a significant proportion of them live in conditions of social vulnerability. Because they are in an irregular situation, poverty, inadequate housing conditions, unemployment or informal employment and processes of discrimination and abuse or because of the difficulty in obtaining official residence identity document in the country, which, in matters of health access, is essential in order to use the health pension system19 . The number of 15.7% immigrants were not affiliated to any health system in 2015, a value 5.8 times greater than that compared with people born in Chile. The immigrant population was at a disadvantage as to the local population in other indicators of health access, such as the medical care rate for health problems and the issue with health care access18 .The percentage of first-generation immigrants present in the country increased 0.7% in Chile between 2013 and 2015, and it represents 110,738 immigrants17 . Even more worrying is that some of these indicators have increased between 2013 and 2017. 15.6% of immigrants had no health insurance in 2013, while it was 16.3% in 2017; 8.9% of those with short-term needs did not had an appointment because of this need in 2013, while it was 9.4% in 2017. 27.9% of those in treatment for an AUGE-GES disease were not covered by it in 2013, while this value was 44.6% in 2017.The same problems are observed in previous years by Cabieses et al. regarding the effective use of health services for short and long-term needs and access to the health system17 . Even more so in Chile, where according to the CASEN survey (2015), 18.5% of 12 years old or older immigrants participated or participate in some organization or group18 . The CASEN survey in all its versions is nationally representative and allows a diagnosis of the situation of the immigrant population in the country with respect to various socioeconomic conditions. In this specific case of health, it provides information about health conditions , access to the system, health services, health insurance, use of these and associated payments, which in turn may be associated with each other and with a wide range of demographic, cultural and socioeconomic factors17 . Despite this, the sample selection process of the survey does not seek to represent the international migrant population in particular and the country of birth  has non-response percentages (responds \u201cdoes not know\u201d) of 0.9% in 2017. On the other hand, the CASEN survey only allows the analysis of residents in homes, leaving out of the scenario the number of immigrants in street situations, which, according to local media, are increasing20 . The analyses carried out from this survey are limited to the variables present in it. Some of the cultural challenges such as differences in perceptions, traditions and lifestyles, among others, represented as barriers to integration and therefore into obstacles and challenges in access to health systems and services19 cannot be analyzed directly. It is therefore widely useful in the future to complement the analyses presented in this manuscript.It is necessary to reduce inequality gaps in health access and use of health services by the migrant population. To this end, concrete health strategies and policies are necessary, allowing, by social determinants of health, to protect the health and well-being of migrants, from the appearance of short and long-term health problems, and factors that may favor them, to their effective resolution. Interventions that consider a social participation approach of the international migrant community and that bring the Chilean health system closer to this population are widely recommendedThis study indicates that disadvantages persist in access to health services and their use among immigrants compared with those born in Chile. It is necessary to reduce the gaps between immigrants and Chileans, especially in terms of affiliation to a health system. This is the first barrier to the effective use of services. We suggest the generation of concrete strategies and health policies that consider a social participation approach of the immigrant community and, additionally, bring the health system closer to this population.Demand model (short-term): N=3,415,253Df=1,289 F=10.64. Model Satisfaction requirement (short-term): N=3,393,049 Df=1,289 F=6.91. Model Barriers: N=3,146. Df=1,288 F=17.78. Adult demand model (short-term): N=2,797,755 Df=1,288 F=6.54. F=6,08. Model Satisfaction of needs in adults (short-term): N=2,778,419 Df=1,288 F=3.72. Model Obstacles in adults: N=2,563,952 Df=1,287 F=13.76. Model Coverage: N=2,974,923 Df=1,295 F=118.55. Model Coverage in adults: N=2,840,844Df=1,295 F=25.94. Model Satisfaction (long-term): N=2,853,809 Df=1,295 F=100.76. Model Adult satisfaction (long-term): N=2,727,317 Df=1,295 F=21.8 1 .El derecho a la salud es un derecho humano universal e inalienable. Fue reconocido de forma global por la mayor\u00eda de los pa\u00edses del mundo en el tratado adoptado por la Asamblea General de las Naciones Unidas en 1966 y puesto en vigor en 1976. En 2002, pa\u00edses de Am\u00e9rica Latina y el Caribe acordaron iniciar esfuerzos para extender la protecci\u00f3n social en salud. Esta aparece tambi\u00e9n como una de las ocho \u00c1reas de Acci\u00f3n definidas en la Agenda de Salud de las Am\u00e9ricas 2008\u20132017. En dicha agenda, todos los Ministros de Salud de Iberoam\u00e9rica se comprometieron a combatir la exclusi\u00f3n en salud y construir sistemas integrados de protecci\u00f3n social con la firma de la declaraci\u00f3n de Iquique en Julio 20072 Cada dimensi\u00f3n es esencial para que un Estado otorgue y garantice el derecho a la salud en sus aspectos fundamentales. Dentro de la cobertura vertical est\u00e1 el indicador de uso/utilizaci\u00f3n efectiva de servicios o prestaciones de salud5 , de especial relevancia para la identificaci\u00f3n de brechas de acceso a salud por parte de poblaci\u00f3n general y grupos vulnerables7 . Diferencias de uso efectivo de prestaciones de salud entre grupos sociales, ante igual necesidad sentida, corresponde a diferencias injustas y prevenibles  que requieren de constante atenci\u00f3n y reparaci\u00f3n. El indicador de uso/utilizaci\u00f3n efectiva de servicios o prestaciones de salud puede desagregarse en la cadena de necesidad y demanda en salud: (i) necesidad sentida de salud, (ii) demanda expresada y no expresada, (iii) demanda satisfecha y no satisfecha8 .La protecci\u00f3n social en salud es una medida concreta de garant\u00eda del derecho humano en salud. Se desarrolla a trav\u00e9s de tres dimensiones principales y complementarias entre s\u00ed: (i) cobertura horizontal ; (ii) cobertura vertical (acceso a prestaciones); y (iii) protecci\u00f3n financiera9 . Este pa\u00eds cuenta con un sistema de salud mixto, con componente p\u00fablico  que protege a los m\u00e1s enfermos y a los m\u00e1s pobres, componente privado  que protege a los m\u00e1s j\u00f3venes y adinerados, y componente menor de fuerzas armadas y del orden p\u00fablico . La Constituci\u00f3n de Chile indica que se debe brindar acceso libre e igualitario a la salud, pero esta premisa ha fallado al demostrarse profundas desigualdades en salud entre grupos sociales, en desmedro de los menos aventajados en su posici\u00f3n socioecon\u00f3mica. La poblaci\u00f3n migrante internacional cuenta con derecho a uso del sistema de salud p\u00fablico o privado si tiene su visa de residencia vigente, seleccionando el tipo de previsi\u00f3n seg\u00fan capacidad de copago. Para migrantes con visa en tr\u00e1mite, se cre\u00f3 la oportunidad de acceso a salud en igualdad de condici\u00f3n que los dem\u00e1s migrantes y chilenos si es que documentan situaci\u00f3n de carencia de recursos a un testigo de fe, habitualmente trabajador social, en el mismo sistema de salud .En Chile, a\u00fan est\u00e1 presente el debate de reposicionar la protecci\u00f3n social en salud como un derecho humano para toda la poblaci\u00f3n residente en nuestro territorio, independientemente de su condici\u00f3n de g\u00e9nero, etnia, nivel socioecon\u00f3mico o estatus migratorio10 . El desplazamiento humano en todas sus formas es uno de los mayores desaf\u00edos de la humanidad. La migraci\u00f3n es adem\u00e1s un reconocido determinante social de la salud en el mundo. El proceso de migrar en s\u00ed mismo, as\u00ed como factores asociados a este cuando se experimenta alg\u00fan grado de vulnerabilidad o falta de protecci\u00f3n a derechos universales, tienen el potencial de afectar la salud f\u00edsica, mental y emocional de las personas migrantes y sus familias12 .La protecci\u00f3n de la salud por parte de migrantes internacionales es de preocupaci\u00f3n global. En tiempos antiguos y en la vida moderna, el desplazamiento de un lugar a otro siempre ha ofrecido la oportunidad de mejor bienestar. La migraci\u00f3n internacional representa un tema de atenci\u00f3n mundial, al ser reflejo de procesos internacionales de desigualdad social y de desarrollo, de conflicto y de estratificaci\u00f3n internacional del trabajo, y de procesos de envejecimiento poblacional, por mencionar algunas de sus dimensiones. Sumado a esto, en la era de la globalizaci\u00f3n, y dadas las facilidades de acceso a informaci\u00f3n, el avance en las comunicaciones y el menor tiempo y costo de los traslados, el llegar de un lugar a otro resulta hoy en d\u00eda m\u00e1s r\u00e1pido y menos costoso que en el pasado10 . Por otra parte, riesgos derivados de los desplazamientos, tales como trastornos psicosociales, problemas de salud reproductiva, mayor mortalidad neonatal, uso indebido de drogas, trastornos nutricionales, alcoholismo y exposici\u00f3n a la violencia, tambi\u00e9n han sido descritos12 . Uno de los aspectos de creciente inter\u00e9s a escala global tiene relaci\u00f3n con la continuidad del cuidado en el escenario transnacional. Esto por los riesgos en salud de la interrupci\u00f3n de la atenci\u00f3n, fundamentalmente por falta de acceso a ella en el pa\u00eds receptor12 .La salud de personas migrantes puede verse afectada cuando no cuentan con adecuada protecci\u00f3n. Accidentes, hipotermia, quemaduras, accidentes cardiovasculares, complicaciones del embarazo y el parto, diabetes e hipertensi\u00f3n, son las afecciones m\u00e1s mencionadas por la Organizaci\u00f3n Mundial de la Salud12 . La experiencia migratoria puede impactar negativamente en todos los estratos sociales; sin embargo, los problemas de salud tienden a concentrarse en aquellos migrantes que experimentan pobreza, exclusi\u00f3n y discriminaci\u00f3n14 .La m\u00e1s reciente estimaci\u00f3n del Departamento de Extranjer\u00eda y Migraci\u00f3n del Ministerio del Interior y Seguridad P\u00fablica en Chile en abril del 2018 indicaba que existir\u00eda un 6,6% de poblaci\u00f3n migrante internacional, correspondiendo a un marcado aumento desde estad\u00edsticas censales del 2012 que estimaban un 2,5-3,0%. La mayor\u00eda de los migrantes internacionales provienen de pa\u00edses del cono sur (el llamado patr\u00f3n migratorio \u201csur-sur\u201d propio de la regi\u00f3n de Latinoam\u00e9rica), en especial Argentina, Colombia, Venezuela, Ecuador, Bolivia y Hait\u00ed (Censo abreviado del 2017). Es relevante reconocer la gran variabilidad socioecon\u00f3mica que la poblaci\u00f3n migrante internacional presenta en Chile y el mundo. As\u00ed como existen migrantes de alta jerarqu\u00eda social, tambi\u00e9n los hay de nivel socioecon\u00f3mico medio y bajo15 han reportado que la poblaci\u00f3n inmigrante sub-utilizar\u00eda el control de ni\u00f1o sano comparado con la poblaci\u00f3n local, utilizar\u00eda en forma similar el screening de Papanicolaou a la nacional, y utilizar\u00eda m\u00e1s servicios de atenci\u00f3n prenatal y ginecol\u00f3gica que la local. Adem\u00e1s, se ha observado un claro gradiente socioecon\u00f3mico en la mayor\u00eda de estas prestaciones.Tanto en Chile como en la regi\u00f3n en su conjunto, existe evidencia limitada del uso de servicios de salud por parte de poblaci\u00f3n migrante internacional. Estudios realizados por Cabieses y colaboradoresEl objetivo de este estudio fue comparar el uso efectivo de servicios de salud disponibles entre migrantes internacionales y chilenos. Dicha comparaci\u00f3n permite identificar brechas de desigualdad en uso de servicios, que son potencialmente modificables, que pueden impactar negativamente en la salud de los migrantes y que van en contra de la meta universal de protecci\u00f3n social en salud.16 . Esta encuesta permite observar patrones generales de poblaci\u00f3n que se autorreporta como inmigrante (nacida en el extranjero) y compararla con la chilena (nacida en Chile).Estudio observacional de corte transversal. An\u00e1lisis secundario de encuesta de Caracterizaci\u00f3n Socioecon\u00f3mica Nacional (CASEN), versi\u00f3n 201716 .La encuesta CASEN es desarrollada peri\u00f3dicamente por el Ministerio de Desarrollo Social. Es un instrumento de diagn\u00f3stico, evaluaci\u00f3n y focalizaci\u00f3n, con el objetivo de conocer condiciones socioecon\u00f3micas de los hogares del pa\u00eds, especialmente aquellos grupos definidos como prioritarios por las pol\u00edticas sociales. Esta encuesta, an\u00f3nima y de libre disposici\u00f3n, utiliza un muestreo probabil\u00edstico de naturaleza compleja, permitiendo la representatividad de residentes en viviendas particulares de 324 comunas de las 16 regiones del pa\u00eds, excluyendo comunas de dif\u00edcil acceso y personas institucionalizadasCASEN cont\u00f3 con 70.948 hogares en 2017, considerando una tasa de no respuesta del 26,6%. Esta encuesta contiene informaci\u00f3n de 216.439 personas residentes en hogares particulares, de las cuales 207.603 (representativos de 16.843.471) eran chilenas y 6.811 (representativas de 777.407) inmigrantes. As\u00ed, el 94,6% de la poblaci\u00f3n representada era chilena y 4,4% inmigrante; 0,94% de los individuos no reportaron su estatus migratorio, y por ende fueron excluidos del an\u00e1lisis. La recolecci\u00f3n de datos se realiz\u00f3 mediante entrevista estructurada directa a residentes habituales o un adulto de la familia, teniendo la facultad de responder por otros miembros del hogar.Las variables del estudio fueron:1.Acceso al sistema de saludPertenencia a un sistema de previsional de salud [s\u00ed/no].Tipo de previsi\u00f3n de salud [p\u00fablica/privada/otra].Ambos creados a partir de la recodificaci\u00f3n de la pregunta \u201c\u00bfA qu\u00e9 sistema previsional de salud pertenece usted? \u201d17 : Autorreportes construidos a partir de las variables disponibles en encuesta CASEN 201716  y a largo plazo (Durante los \u00faltimos 12 meses \u00bfha estado en tratamiento m\u00e9dico? [s\u00ed/no]).Demanda expresada y no expresada: Haber consultado o no al sistema de salud chileno, para aquellos que reportaron haber tenido alguna necesidad de salud de corto plazo [s\u00ed/no]. Y encontrarse cubierto o no el tratamiento por el sistema AUGE-GES en el caso de las necesidades a largo plazo.Demanda satisfecha y no satisfecha: (s\u00ed) Consulta o cobertura de la necesidad sentida en salud a corto o largo plazo, respectivamente, o no consulta o cobertura por motivos voluntarios. (no) no consulta o cobertura por motivos involuntarios.Razones de no consulta (\u00bfPor qu\u00e9 no tuvo consulta ni atenci\u00f3n?) o cobertura (\u00bfPor qu\u00e9 este tratamiento m\u00e9dico no fue cubierto por el sistema AUGE-GES?).Barreras de atenci\u00f3n: Presencia de problemas durante la consulta por necesidad a corto plazo [s\u00ed/no]. Indicador construido a partir de las preguntas: Cuando consult\u00f3, \u00bfse le present\u00f3 alguno de los siguientes problemas? a) llegar a la consulta, hospital, consultorio, etc. b) conseguir una cita/atenci\u00f3n (hora). c) ser atendido en el establecimiento  d) pagar por la atenci\u00f3n debido al costo e) entrega de medicamentos en el establecimiento de salud o acceso a ellos por su costo.En los casos de necesidad sentida de salud a corto y largo plazo, un mayor valor del indicador reflejaba una peor condici\u00f3n de salud. Por otro lado, un mayor valor en los indicadores de: no pertenencia a un sistema previsional de salud, demanda no expresada, no consulta, no cobertura, no consulta o no cobertura por motivos involuntarios, necesidad no satisfecha y presencia de barreras de acceso, indicaba un peor acceso a servicios de salud.3.Variables sociodemogr\u00e1ficas de control: edad, sexo, zona de residencia [urbano/rural], nivel educacional [sin educaci\u00f3n/primaria/secundaria/t\u00e9cnica o profesional], condici\u00f3n de actividad [ocupados/desocupados/inactivos], quintil aut\u00f3nomo del ingreso total del hogar.Los indicadores de acceso al sistema de salud y uso efectivo de servicios de salud fueron analizados descriptivamente para inmigrantes y nacidos en Chile, en su totalidad y estratificados seg\u00fan variables sociodemogr\u00e1ficas. Se analiz\u00f3 la independencia entre la condici\u00f3n migratoria e indicadores de uso efectivo de servicios de salud y acceso al sistema de salud mediante el test de Pearson con correcci\u00f3n de segundo orden Rao y Scott (estad\u00edstico F).Se realizaron modelos de regresi\u00f3n log\u00edstica, ajustados por variables sociodemogr\u00e1ficas, considerando Pertenencia a un sistema de previsional de salud, Demanda satisfecha a corto y largo plazo y Barreras de atenci\u00f3n, como variables dependientes, y condici\u00f3n de inmigrante como variable independiente. Esto para el total de la poblaci\u00f3n y para mayores de 14 a\u00f1os (adultos) considerando adicionalmente la variable condici\u00f3n de actividad.El manejo de base de datos y an\u00e1lisis de estos se realiz\u00f3 mediante el software STATA 14 (StataCorp), considerando el dise\u00f1o complejo de la encuesta (estrato conglomerado y factor de expansi\u00f3n) y una estimaci\u00f3n de varianza por linealizaci\u00f3n por series de Taylor. Se consider\u00f3 una significancia de 0,05 y confianza del 95% para todos los an\u00e1lisis.Un 16,3% de los inmigrantes del pa\u00eds afirmaban no pertenecer a un sistema previsional de salud, valor siete veces mayor en comparaci\u00f3n con los nacidos en Chile .Los inmigrantes presentaron significativamente una menor necesidad sentida en salud que los nacidos en Chile tanto a largo como a corto plazo. A corto plazo, en inmigrantes, un 15,1% del total de la poblaci\u00f3n report\u00f3 enfermedad o accidente en los tres meses previos a la encuesta ; de estos, el 9,3% no consultaron y 1,7 de cada 100 no logr\u00f3 satisfacer su necesidad en salud al no consultar por motivos ajenos a su voluntad. En chilenos, estos valores corresponder\u00e1n a 6,1% y 0,7 de cada 100, respectivamente, significativamente menores que en inmigrantes. Por el contrario, inmigrantes y chilenos reportaron una proporci\u00f3n similar de presencia de problemas durante la consulta (barreras de acceso): aproximadamente un 25,0% del total de consultantes por necesidades a corto plazo . A largo plazo, un 9,6% de los inmigrantes se encontraba en tratamiento m\u00e9dico por alguna enfermedad durante el a\u00f1o previo a la encuesta , de los cuales el 44,4% eran por otra condici\u00f3n de salud distinta a las 20 principales patolog\u00edas AUGE-GES consultadas; este porcentaje correspondi\u00f3 al 27,2% en chilenos. Los inmigrantes reportaron significativamente una mayor proporci\u00f3n de no cobertura  y necesidades no satisfechas , siendo espec\u00edficamente 2,9 y 4,7 veces mayor en inmigrantes que en chilenos, respectivamente   . En t\u00e9rTras ajustar por variables sociodemogr\u00e1ficas, los inmigrantes presentan 7,5 veces m\u00e1s chances de no tener previsi\u00f3n de salud que los chilenos. Este chance fue 6,2 veces mayor en inmigrantes que en chilenos en mayores de 15 a\u00f1os y considerando la condici\u00f3n de actividad .El sexo, el tener educaci\u00f3n media o superior en comparaci\u00f3n con no tener educaci\u00f3n, y el pertenecer el quintil de ingreso m\u00e1s rico en comparaci\u00f3n con el m\u00e1s pobre, resultaron ser factores significativos en la falta de previsi\u00f3n de salud, en desventaja de las mujeres, personas sin educaci\u00f3n y de menores ingresos para el total de la poblaci\u00f3n. En mayores de 15 a\u00f1os, adicionalmente, la edad y desocupaci\u00f3n en referencia a la ocupaci\u00f3n resultaran ser significativas. Por otro lado, el tener educaci\u00f3n media en referencia a no tener educaci\u00f3n dej\u00f3 de ser significativa   .Dentro de los 632.770 inmigrantes con previsi\u00f3n de salud, el 80,0% pertenec\u00eda al sistema p\u00fablico, el 18,0% al privado y el 2,0% fuerzas armadas (FF.AA.) u otro, mientras que en chilenos estos porcentajes fueron 82,1%, 15,0% y 2,9% respectivamente. La proporci\u00f3n de pertenecientes al sistema privado de salud en hombres que en mujeres fue mayor tanto en inmigrantes como en nacidos en Chile. El 15,2%  de las mujeres con previsi\u00f3n pertenec\u00edan al sistema p\u00fablico, mientras que en hombres un 21,0%  en inmigrantes. [Resultados no presentados en tabla]La poblaci\u00f3n inmigrante present\u00f3 significativamente 21,0%  menos chance de tener necesidades a corto plazo en salud (enfermedades o accidentes) que los chilenos. Sin embargo, tuvieron 1,7 veces m\u00e1s chance de no consultar ante esta necesidad y 3,1 veces m\u00e1s chance de no satisfacer esta, es decir, no haber consultado por motivos involuntarios. Todo esto tras ajustar por variables sociodemogr\u00e1ficas. Esta situaci\u00f3n se mantuvo en mayores de 15 a\u00f1os. Sexo, edad, educaci\u00f3n y pertenecer al quintil m\u00e1s rico en contraste con el m\u00e1s pobre fueron variables significativas en la no expresi\u00f3n de la demanda. La educaci\u00f3n dej\u00f3 de ser significativa en mayores de 15 a\u00f1os, y el resto de los quintiles de ingreso (a excepci\u00f3n del III) y la condici\u00f3n de actividad pasaron a serlo   .De manera cruda, los inmigrantes ten\u00edan 2,0%  veces menos chance de presentar barreras de acceso que los chilenos. Tras ajustar por variables sociodemogr\u00e1ficas, esta situaci\u00f3n se invirti\u00f3. Los inmigrantes presentaran una mayor chance de presentar barreras de acceso tanto para el total de la poblaci\u00f3n como para los de 15 a\u00f1os o m\u00e1s. Para ninguno de los casos esto fue significativo   .Para las necesidades a largo plazo  de manera significativa, los inmigrantes tuvieron un mayor chance de no tener su tratamiento cubierto pese a presentar un menor chance de estar en tratamiento. Espec\u00edficamente, ajustando por variables sociodemogr\u00e1ficas, los inmigrantes ten\u00edan 53,0%  veces menos chance de estar en tratamiento por alguna enfermedad que los chilenos y 37,0%  veces menos chance de que esta enfermedad fuera una patolog\u00eda AUGE-GES. Entre aquellos con patolog\u00edas AUGE-GES, la poblaci\u00f3n inmigrante ten\u00eda 2,7 veces m\u00e1s chance de no estar cubierta y 3,3 veces m\u00e1s chance de no satisfacer esta necesidad de cobertura que los chilenos. En mayores de 15 a\u00f1os, los inmigrantes tuvieron mayor chance de no estar cubiertos por el AUGE-GES y no satisfacer su necesidad a largo plazo que los chilenos. A excepci\u00f3n del sexo y el tener educaci\u00f3n b\u00e1sica en contraste con el no tener educaci\u00f3n, todas las variables consideradas fueron significativas en la no cobertura y no satisfacci\u00f3n. En mayores de 15 a\u00f1os tampoco fue significativo el tener educaci\u00f3n media en contraste con no tener educaci\u00f3n   .Al analizar los modelos de indicadores de uso efectivo de servicios de salud estratificados por con y sin previsi\u00f3n de salud, la presencia de necesidades a largo plazo y cobertura de esta la variable condici\u00f3n de inmigrante fue significativa   .Los resultados de este estudio indican que los inmigrantes a\u00fan se encuentran en desventaja en t\u00e9rminos de acceso y uso a servicios de salud en comparaci\u00f3n con los nacidos en Chile. Los inmigrantes presentaron 7,5 veces m\u00e1s chances de no tener previsi\u00f3n de salud que los chilenos y una menor necesidad sentida pero una menor consulta, cobertura o satisfacci\u00f3n de estas necesidades a corto y a largo plazo. Los inmigrantes ten\u00edan 1,7 veces m\u00e1s chance de no consultar ante una enfermedad o accidente y 3,1 veces m\u00e1s chance de no satisfacer su necesidad, al no consultar por motivos ajenos a su voluntad, que los nacidos en Chile. Por otro lado, la poblaci\u00f3n inmigrante ten\u00eda 2,7 veces m\u00e1s chance de no tener cubierto su tratamiento por el AUGE-GES y 3,3 veces m\u00e1s chance de no satisfacer esta necesidad de cobertura que los chilenos.17 .Muchos pa\u00edses se han visto desafiados por el aumento global de poblaci\u00f3n migrante internacional en los \u00faltimos a\u00f1os. Esto trae consigo una seria de desaf\u00edos para diversos sectores, educaci\u00f3n, salud y protecci\u00f3n social, solo por nombrar algunos, los cuales se vuelven m\u00e1s complejos de enfrentar cuando esta poblaci\u00f3n se encuentra en condiciones de vulnerabilidad social. La protecci\u00f3n de la salud en migrantes internacionales es de preocupaci\u00f3n global, y el acceso a servicios de salud una arista fundamental para esta labor18 . Por otro lado, se ha reportado que una proporci\u00f3n significativa de estos viven en condiciones de vulnerabilidad social, ya sea por encontrarse en situaci\u00f3n irregular, pobreza, malas condiciones de vivienda, desempleo o empleo informal y procesos de discriminaci\u00f3n y abuso o la dificultada para obtener documentaci\u00f3n oficial de identidad de residencia en el pa\u00eds, lo cual en temas de acceso a salud es esencial para poder pertenecer al sistema previsional de salud19 . Para el a\u00f1o 2015, un 15,7% de los inmigrantes no se encontraba afiliado a ning\u00fan sistema de salud, valor 5,8 veces mayor que en nacidos en Chile. La poblaci\u00f3n inmigrante se encontraba en situaci\u00f3n de desventaja respecto a la poblaci\u00f3n local tambi\u00e9n en otros indicadores de acceso a salud, como tasa de atenci\u00f3n m\u00e9dica ante problema de salud y problema de acceso a atenci\u00f3n18 .El porcentaje de inmigrantes de primera generaci\u00f3n presentes en el pa\u00eds aument\u00f3 en 0,7% en Chile, entre el 2013 y 2015, lo cual se traduce en 110.738 inmigrantes17 . M\u00e1s preocupante aun es que algunos de estos indicadores han aumentado entre 2013 y 2017. Un 15,6% de los inmigrantes no ten\u00edan previsi\u00f3n de salud en 2013, mientras que fueron un 16,3% en 2017; un 8,9% de los que ten\u00edan necesidades a corto plazo no consultaron por esta necesidad en 2013, mientras que fue un 9,4% en 2017. Un 27,9% de los que se encontraban en tratamiento por una enfermedad AUGE-GES no se encontraban cubiertos por el mismo en 2013, mientras que este valor fue de 44,6% en 2017.Se observan las mismas falencias que en a\u00f1os anteriores por Cabieses y cols. en cuanto al uso efectivo de servicios de salud por necesidades a corto y largo plazo y acceso al sistema de salud17 ; m\u00e1s a\u00fan en Chile, en donde seg\u00fan la encuesta CASEN (2015), un 18,5% de los inmigrantes de 12 a\u00f1os o m\u00e1s han participado o participan en alguna organizaci\u00f3n o grupo organizado18 . La encuesta CASEN en todas sus versiones es de representaci\u00f3n nacional y permite obtener un diagn\u00f3stico de la situaci\u00f3n de la poblaci\u00f3n inmigrante en el pa\u00eds respecto a diversas condiciones socioecon\u00f3micas. En este caso espec\u00edfico de la salud, esta permite conocer: condiciones de salud , acceso al sistema, servicios de salud, seguros de salud, uso de estos y pagos asociados, las cuales a su vez pueden asociarse entre ellas y entre una amplia diversidad de factores demogr\u00e1ficos, culturales y socioecon\u00f3micos17 . Pese a esto, el proceso de selecci\u00f3n muestral de la encuesta no busca representar a la poblaci\u00f3n migrante internacional en particular y la variable de pa\u00eds de nacimiento (que permite la estratificaci\u00f3n entre inmigrante y chileno) cuenta con porcentajes no respuesta (responde \u201cno sabe\u201d) en 2017 del 0,9%. Por otro lado, la encuesta CASEN solo permite el an\u00e1lisis de residentes en viviendas, dejando fuera del panorama a aquellos inmigrantes en situaci\u00f3n de calle, los cuales seg\u00fan medios locales se encuentran en incremento20 . Los an\u00e1lisis realizados a partir de esta encuesta se encuentran limitados a las variables presentes en ella. Algunos de los desaf\u00edos culturales como diferencias en visiones, tradiciones y estilos de vida, entre otros, que se traducen en barreras de integraci\u00f3n y por ende en barreras y desaf\u00edos en el acceso a sistemas y servicios de salud19 no pueden ser analizados directamente. Es, por tanto, de amplia utilidad a futuro complementar los an\u00e1lisis presentados en este manuscrito.Es necesario reducir brechas de desigualdad en acceso y uso de servicios de salud por parte de poblaci\u00f3n migrante. Para eso, son necesarias estrategias concretas en salud y pol\u00edticas que permitan, a trav\u00e9s los determinantes sociales de la salud, proteger la salud y bienestar de migrantes, desde la aparici\u00f3n de problemas de salud de corto y largo plazo, y factores que puedan favorecer estos, hasta su efectiva resoluci\u00f3n. Intervenciones que consideren un enfoque de participaci\u00f3n social de la comunidad migrante internacional y que acerquen el sistema de salud chileno a esta poblaci\u00f3n son ampliamente recomendadasEl presente estudio indica que persisten las desventajas en acceso y uso a servicios de salud en inmigrantes en comparaci\u00f3n con los nacidos en Chile. Es necesario reducir las brechas entre inmigrantes y nacidos en Chile, sobre todo en cuanto a pertenencia a un sistema de salud. Esta es la primera barrera para un uso efectivo de servicios. Se sugiere generar estrategias concretas y pol\u00edticas en salud que consideren un enfoque de participaci\u00f3n social de la comunidad inmigrante y, adicionalmente, acerquen al sistema de salud a esta poblaci\u00f3n.Modelo Demanda (corto plazo): N=3.415.253Df=1.289 F=10,64. Modelo Satisfacci\u00f3n necesidad (corto plazo): N=3.393.049 Df=1.289 F=6,91. Modelo Barreras: N=3.146. Df=1.288 F=17,78. Modelo Demanda en adultos (corto plazo): N=2.797.755 Df=1.288 F=6,54. F=6,08. Modelo Satisfacci\u00f3n necesidad en adultos (corto plazo): N=2.778.419 Df=1.288 F=3,72. Modelo barreras en adultos: N=2.563.952 Df=1.287 F=13,76. Modelo Cobertura: N=2.974.923 Df=1.295 F=118,55. Modelo Cobertura en adultos: N=2.840.844Df=1.295 F=25,94. Modelo Satisfacci\u00f3n necesidad (largo plazo): N=2.853.809 Df=1.295 F=100,76. Modelo Satisfacci\u00f3n necesidad en adultos (largo plazo): N=2.727.317 Df=1.295 F=21,8"]}
-{"representative": "Background: Foundry workers are occupationally exposed to hazardous substances such as silicadusts and toxic gases. The aim of this study was to examine the effects of simultaneous exposure tocomplex mixtures of silica dust, formaldehyde, and triethylamine on lung function parameters.Study design: A cross-sectional study.Methods: This study was conducted on 55 male workers of core making unit of a foundry plant (thecase group) and 55 workers in a food industry were enrolled as a control group in 2015. Workers weremonitored for personal exposure to crystalline silica respirable dust, according the NIOSH methodNo.7602. The concentrations of formaldehyde and triethylamine were measured using a PIDinstrument. Lung function tests were performed according to the ERS/ATS standards.Results: The mean concentrations of personal exposure to silica dust, formaldehyde, andtriethylamine in the core making workers were 0.23 mg/m3, 2.85 ppm, and 5.55 ppm and respectiveexposures of control subjects were less than the LOD (limit of detection). There were significantassociations between exposure to silica dust and decreases in FVC  values(P<0.05). The findings showed a statistically significant synergistic effect of silica dust andtriethylamine on FVC values (P<0.05).Conclusions: The mean exposure of all studied substances was higher than occupational exposurelimits. Synergistic effects of exposure to silica dust and triethylamine on some lung functionparameters were observed. Simultaneous exposure of foundry workers to silica dust and triethylaminecould impair lung function. Exposure to silica dust in foundry workers has been described previously3. Exposure to crystalline silica has caused silicosis, lung cancer, pulmonary tuberculosis, chronic bronchitis, and chronic obstructive pulmonary disease6. International Agency for Research on Cancer (IARC) classified inhaled crystalline silica as a group 1 carcinogen8.Workers in many workplace settings are occupationally exposed to a number of hazardous substances, associated with a wide range of adverse health effects9conducted a case-control study in a cohort of 5016 foundry workers employed for at least one year in the studied aluminum foundries in Sweden including 31 cases of lung cancer. Their results indicate the odds ratio of lung cancer of cumulative quartz exposures in the range of 0.001\u20131.0 mg/m3-yr at a value of 1.6 . The geometric mean value for occupational exposure to crystalline silica aerosols in 20 studied foundry workers in the east zone of Tehran was 0.343 mg per cubic meter10. The concentration of respirable crystalline silica dust in aluminum foundry workers was 0.10 mg per cubic meter11. The air concentrations of respirable silica dust in the studied stone crushing units in Iran exceeded the threshold limit value (TLV) in industrial units of Azandarian12.Westberg and Bellander13 studied the effect of exposure to silica dust on lung function tests of 209 male foundry workers and 239 office workers selected as a control group. Geometric mean concentration of the quartz in molding and core making units were 0.051 mg/m3 and 0.023 mg/m3, respectively. All ventilation parameters except FVC were significantly lower in foundry workers than those in the control group were. The reduction in the FVC and FEV1 values of workers exposed to respirable crystalline silica dust was reported14.Several attempts have been made to measure pulmonary function among foundry workers. Koo et al. 15. Exposed workers were reported to suffer from irritation of the upper respiratory system, change in pulmonary function parameters such as decline in the FEV1, and sensitization effects17. IARC classified formaldehyde as human carcinogens that cause nasopharyngeal cancer in humans19. Reversible changes in the lung function parameters have been observed at 2.4 mg/m3 exposure level20.Formaldehyde as a highly reactive carbonyl compound may cause irritation and health symptoms21. The general effects of tertiary amines include irritation, headache, nausea, anxiety, faintness and corrosive effects to the skin, mucous membrane, eye, nose, throat, respiratory distress, cough, and corneal edema22.Tertiary amines such as triethylamine are used in the core making processesGiven the importance of adverse health effects of workers' exposure, there has been little discussion on the effects of simultaneous exposure to complex mixtures of silica dust, formaldehyde, and triethylamine on the respiratory system of foundry workers abroad and in Iran.Therefore, the objective of this study was to examine the effects of simultaneous exposure to complex mixtures of silica dust, formaldehyde, and triethylamine on the respiratory system of core making workers at a foundry located in the greater Tehran, Iran.-five male subjects of a food manufacturing plant without active exposure to any dusts or gases from similar socioeconomic class participated as a control group as well. Workers and controls were matched for gender and the number of participants. The demographic features such as age, work experience, body mass index (BMI) of workers, and cigarette smoking habit in the case and control groups were obtained prior to survey. None of the exposed workers used personal protective equipment.Census procedure was used to determine the sample size and all 55 male workers of core making unit of a foundry plant , located in Tehran, Iran with inclusion criteria of one year of work experience and willing to participate in the research were enrolled in this cross-sectional analytical study in 2015 (the case group). FiftyAll subjects signed consent forms and the study was approved by local Ethics Committee.Since, the concentration of air pollutants is affected by indoor climate parameters, indoor climate factors, including relative humidity, air pressure level, and wind speed were measured in core making environment.24. Each set was comprised of a calibrated SKC sampling pump  equipped with mixed cellulose ester (MCE) filters  and a 10-mm nylon cyclone (SKC) at a flow rate of 1.7 L/min. Quartz purchased from Merck (Germany) was used for the preparation of standard samples in the range of 20-200 \u00b5g per sample. After personal sampling, 200 mg potassium bromide purchased from Merck Co. was added to MCE filters. All filters were placed in the muffle furnace at 600 \u00b0C for 2 h. Subsequently, all samples were transferred to a mortar for complete mixing and homogenizing. Finally, each sample was pressed under 20 mega-pascal for 2 min for manufacturing 13 mm pellets. Each pellet was analyzed for crystalline silica by WQF-510A FT-IR spectrometer (China) in a range from 400 to 4000 cm-1 or 710-825 nm24.Workers' exposure to crystalline silica dust was monitored according to an improved method of National Institute for Occupational Safety and Health (NIOSH) 760225. The intra- and inter-day coefficients of variation were considered for the precision of the method and accuracy was examined as percentage of recovery of standards. The coefficient of variation less than 10% and recovery efficiency in the range of 80% to 100% was considered as acceptable26. The LOD and LOQ (limit of quantification) values for analysis of crystalline silica dust were calculated according to equation No. 1 and No. 2, respectively.The validity of silica dust measurements was determined as wellLOD = Xbi + 3Sbi Eq. 1LOQ = Xbi + 10Sbi Eq. 2i was the mean concentration of the blank and Sbi was the standard deviation (SD) of the blank27.Where Xb28. PhoCheck Tiger PID was used to measure some compounds in previous work such as the toluene concentration at the inlet and outlet of the oxidation reactor29. The instrument was calibrated using the contamination-free air in the range of 0.4 to 14 ppm prepared in Tedlar bags . Atmospheric stock gas standards were prepared through static injection of known amounts of volatile liquid (using micro syringe Hamilton Company) into a 1L Tedlar bag containing contamination-free air. Hamilton gas tight syringe (0-500 \u00b5l) was used to transfer known amount of gas volume into 10 L Tedlar bags and filling them with known volume of contamination-free air by setting the proper flow and time parameters. Contamination-free atmosphere gases in the range of 0.4 to 14 and 0.4 to 12 as ppm for formaldehyde and trimethylamine respectively were prepared for calibration of PID.The concentrations of formaldehyde and triethylamine were measured using a photoionization detector (PID) apparatus . The usual mechanism of action of PID instrument as a real-time analyzer is ionization using ultraviolet radiation-7 a.m.) and after shift (during 4-5 p.m.). The workers' state of respiratory health was classified according to ATS/ERS guidelines for spirometric patterns of normal, obstructed, restricted, or mixed obstructed and restricted32. The subjects rested for 5 min before performing pulmonary-function tests. Spirometry was performed in standing positions of subjects and at least three acceptable maneuvers were obtained. Spirometric values were corrected for age, height, weight, and smoking habitLung function tests were performed using a spirometer . Pulmonary function parameters such as FVC, FEV1, FEV1/FVC, peak expiratory flow (PEF), and mid forced expiratory flow (FEF 25\u201375%) were considered. Lung function tests were measured according to the ERS/ATS standards before shift . The normality of the data was determined using Kolmogorov\u2013Smirnov test. The independent 2, respectively. Among core making workers, 32.7% smoked cigarettes. The average (SD) number of cigarettes smoked per day was 11.56 (7) during 10.81 (7.33) yr on average. The average (SD) regarding age, work experience, and BMI of workers in the control group were 37.15 (7.96) yr, 10.72 (6.84) yr, and 25.24 (3.77) kg/m2, respectively. Among subjects in the control group, 14.5% smoked cigarettes. The average (SD) number of cigarettes smoked per day was 7.50 (5.34) during 8.38 (5.29) yr on average. The independent samples t-test indicated significant differences in age and work experience of workers in the case and control groups (P<0.001). The chi-square test revealed that the numbers of current smokers were significantly higher (P=0.025) in the case group than in the control group. Because the spirometric values were based on subjects' age in the case and control groups, no adjustment was applied to this variable. The results were adjusted for work experience and the number of cigarette smokers. However, no statistical significant differences were found for other demographic variables.The average (SD) regarding age, work experience, and BMI of core making workers was 31.98 (6.90) yr, 5.32 (4.59) yr, and 25.11 (3.82) kg/m-IR spectroscopy method was 2.57 and 3.61%, respectively. The efficiency of recovery for silica dust samples was 100%. The LOD and LOQ for silica dust samples were 5.04 \u03bcg/sample and 3.82\u03bcg/sample, respectively.Measured indoor air parameters in the core-making unit of a foundry plant are presented in 34.The results obtained from the monitoring of occupational exposure to crystalline silica, formaldehyde, and triethylamine in the core-making unit are shown in t-test showed significant decreases (P <0.05) in the mean values of some lung function parameters including FVC, FEV1, and FEV1/FVC values in the exposed group compared to control group for before and after work shifts. Linear regression  indicated significant differences (P<0.05) in FVC and FEV1 values between exposed and control subjects before and after work shifts.Results of lung function tests for exposed and control groups were compared . However-Whitney tests revealed that differences in the spirometric patterns of workers between the exposed and control groups before starting a work shift (P=0.001) and after the work shift (P=0.007) were significant  denotes that increases for exposure to silica dust and triethylamine were associated with decreases in FEV1 and FVC values . No signP=0.034; \u03b2=-0.301) and after shift . There were significant associations between exposure to silica dust and FEV1 values only after shift .The association of lung function parameters with exposures to silica dust was determined after adjusting for exposures to formaldehyde, and triethylamine. The multiple regression analysis of data revealed that there were significant associations between exposure to silica dust and FVC values before shift (P=0.025) and after (P=0.029) work shifts. In addition, the results indicated a statistically significant synergistic effect of silica dust and triethylamine on FEV1 (P=0.010) and PEF (P=0.009) before and after work shifts FEV1 (P=0.001); PEF (P=0.003). The statistically significant synergistic effect of exposures to formaldehyde and smoking habits on FEF 25\u201375% values before (P=0.036) and after (P=0.028) work shifts were noticed.he synergistic effects of simultaneous exposures to silica dust, formaldehyde, and triethylamine were investigated using linear regression analysis. The findings showed a statistically significant synergistic effect of silica dust and triethylamine on FVC values before (*years of work) data indicated that there were significant associations between exposure to silica dust and FVC, FEV1, and FEF 25\u201375% values before and after work shifts (P<0.05).The simple regression analysis of cumulative exposure  reported on 19 workers in 3 foundries36.The occupational exposure of foundry workers in this study (0.41-6.47 ppm) to formaldehyde was approximately in the same range as the formaldehyde concentrations in the breathing zone in a steel foundry (2-4 ppm)35who found lower mean values of FVC among steel foundry workers. This finding also is in agreement with those of Johnson et al. 37who found significantly lower mean values of FEV1 among workers in an iron and steel foundry than control subjects did. In addition, our results are consistent with those of other findings and suggest that there was no difference in spirometric values of smokers and non-smokers in the case group13.This finding supports previous research, which stated the prime role of silica dust exposure in reducing ventilator capacity of the foundry workers13.We found that FVC and FEV1 values were significantly lower in foundry workers than in control subjects. Our findings are consistent with those of Low and Mitchell38. Although extensive research has been carried out to examine the synergistic effects of exposure to toxic agents40, to the best of our knowledge, too little attention has been paid to determine the combined effects of respirable silica dust, formaldehyde, and triethylamine on lung function parameters in literature.The results of this study revealed that combined exposure to silica dust and triethylamine had synergistic effects with some lung function parameters. This was accompanied by significant decreases in the values of FVC and FEV1. The phenomenon of simultaneous exposure of foundry workers to dust and fumes impaired their lung function parameters. In another study, combined occupational exposures to airborne dusts, gases, and fumes were associated with a reduction in peak expiratory flow rate (PEF)Prevalence of obstructive, restrictive, and mixed ventilatory impairments were significantly higher among our foundry workers than among control subjects. Although there were no statistically significant correlation between formaldehyde exposure and lung function parameters, the cumulative exposure of formaldehyde of our foundry workers was significantly correlated with FEF 25\u201375 after work shifts. This phenomenon signifies short and long-term effects of formaldehyde as irritant gas.41, more stringent of control measures, and health promotion programs are recommended for foundry workers.Results of combined exposure to silica dust and irritant gases on lung function parameters of foundry workers in this study, has raised serious concerns about their respiratory health. Therefore, more thorough examinations of their occupational exposures and health surveillance, including radiographic assessments of workers' lung conditions, according to Steenland and Ward (2014)The mean concentrations of silica dust, formaldehyde, and triethylamine in the breathing- zone air of study foundry workers were higher than proposed occupational exposure limits. Some lung function parameters such as FVC and FEV1 values were significantly lower in foundry workers than in control subjects. The findings showed a statistically significant synergistic effect of silica dust and triethylamine on FVC values. Synergistic effects of exposure to formaldehyde and smoking habits on FEF 25\u201375 values were observed.This study was done as a partial fulfillment of Master of Science degree in Occupational Health Engineering. The authors also appreciate the workers and management of the foundry plant for their sincere supports and corporations.The authors have declared no conflict of interest.This project was financially supported by the Safety Promotion and Injury Prevention Research Center, Shahid Beheshti University of Medical Sciences, Tehran, Iran.The air concentrations of silica dust, formaldehyde, and triethylamine exceeded the respective threshold limit values.Lower values for some lung function parameters were observed in foundry workers compared to the control subjects. Synergistic effects of combined exposure to silica dust and triethylamine on FVC values were reported.", "texts": ["Background: Foundry workers are occupationally exposed to hazardous substances such as silicadusts and toxic gases. The aim of this study was to examine the effects of simultaneous exposure tocomplex mixtures of silica dust, formaldehyde, and triethylamine on lung function parameters.Study design: A cross-sectional study.Methods: This study was conducted on 55 male workers of core making unit of a foundry plant (thecase group) and 55 workers in a food industry were enrolled as a control group in 2015. Workers weremonitored for personal exposure to crystalline silica respirable dust, according the NIOSH methodNo.7602. The concentrations of formaldehyde and triethylamine were measured using a PIDinstrument. Lung function tests were performed according to the ERS/ATS standards.Results: The mean concentrations of personal exposure to silica dust, formaldehyde, andtriethylamine in the core making workers were 0.23 mg/m3, 2.85 ppm, and 5.55 ppm and respectiveexposures of control subjects were less than the LOD (limit of detection). There were significantassociations between exposure to silica dust and decreases in FVC  values(P<0.05). The findings showed a statistically significant synergistic effect of silica dust andtriethylamine on FVC values (P<0.05).Conclusions: The mean exposure of all studied substances was higher than occupational exposurelimits. Synergistic effects of exposure to silica dust and triethylamine on some lung functionparameters were observed. Simultaneous exposure of foundry workers to silica dust and triethylaminecould impair lung function. Exposure to silica dust in foundry workers has been described previously3. Exposure to crystalline silica has caused silicosis, lung cancer, pulmonary tuberculosis, chronic bronchitis, and chronic obstructive pulmonary disease6. International Agency for Research on Cancer (IARC) classified inhaled crystalline silica as a group 1 carcinogen8.Workers in many workplace settings are occupationally exposed to a number of hazardous substances, associated with a wide range of adverse health effects9conducted a case-control study in a cohort of 5016 foundry workers employed for at least one year in the studied aluminum foundries in Sweden including 31 cases of lung cancer. Their results indicate the odds ratio of lung cancer of cumulative quartz exposures in the range of 0.001\u20131.0 mg/m3-yr at a value of 1.6 . The geometric mean value for occupational exposure to crystalline silica aerosols in 20 studied foundry workers in the east zone of Tehran was 0.343 mg per cubic meter10. The concentration of respirable crystalline silica dust in aluminum foundry workers was 0.10 mg per cubic meter11. The air concentrations of respirable silica dust in the studied stone crushing units in Iran exceeded the threshold limit value (TLV) in industrial units of Azandarian12.Westberg and Bellander13 studied the effect of exposure to silica dust on lung function tests of 209 male foundry workers and 239 office workers selected as a control group. Geometric mean concentration of the quartz in molding and core making units were 0.051 mg/m3 and 0.023 mg/m3, respectively. All ventilation parameters except FVC were significantly lower in foundry workers than those in the control group were. The reduction in the FVC and FEV1 values of workers exposed to respirable crystalline silica dust was reported14.Several attempts have been made to measure pulmonary function among foundry workers. Koo et al. 15. Exposed workers were reported to suffer from irritation of the upper respiratory system, change in pulmonary function parameters such as decline in the FEV1, and sensitization effects17. IARC classified formaldehyde as human carcinogens that cause nasopharyngeal cancer in humans19. Reversible changes in the lung function parameters have been observed at 2.4 mg/m3 exposure level20.Formaldehyde as a highly reactive carbonyl compound may cause irritation and health symptoms21. The general effects of tertiary amines include irritation, headache, nausea, anxiety, faintness and corrosive effects to the skin, mucous membrane, eye, nose, throat, respiratory distress, cough, and corneal edema22.Tertiary amines such as triethylamine are used in the core making processesGiven the importance of adverse health effects of workers' exposure, there has been little discussion on the effects of simultaneous exposure to complex mixtures of silica dust, formaldehyde, and triethylamine on the respiratory system of foundry workers abroad and in Iran.Therefore, the objective of this study was to examine the effects of simultaneous exposure to complex mixtures of silica dust, formaldehyde, and triethylamine on the respiratory system of core making workers at a foundry located in the greater Tehran, Iran.-five male subjects of a food manufacturing plant without active exposure to any dusts or gases from similar socioeconomic class participated as a control group as well. Workers and controls were matched for gender and the number of participants. The demographic features such as age, work experience, body mass index (BMI) of workers, and cigarette smoking habit in the case and control groups were obtained prior to survey. None of the exposed workers used personal protective equipment.Census procedure was used to determine the sample size and all 55 male workers of core making unit of a foundry plant , located in Tehran, Iran with inclusion criteria of one year of work experience and willing to participate in the research were enrolled in this cross-sectional analytical study in 2015 (the case group). FiftyAll subjects signed consent forms and the study was approved by local Ethics Committee.Since, the concentration of air pollutants is affected by indoor climate parameters, indoor climate factors, including relative humidity, air pressure level, and wind speed were measured in core making environment.24. Each set was comprised of a calibrated SKC sampling pump  equipped with mixed cellulose ester (MCE) filters  and a 10-mm nylon cyclone (SKC) at a flow rate of 1.7 L/min. Quartz purchased from Merck (Germany) was used for the preparation of standard samples in the range of 20-200 \u00b5g per sample. After personal sampling, 200 mg potassium bromide purchased from Merck Co. was added to MCE filters. All filters were placed in the muffle furnace at 600 \u00b0C for 2 h. Subsequently, all samples were transferred to a mortar for complete mixing and homogenizing. Finally, each sample was pressed under 20 mega-pascal for 2 min for manufacturing 13 mm pellets. Each pellet was analyzed for crystalline silica by WQF-510A FT-IR spectrometer (China) in a range from 400 to 4000 cm-1 or 710-825 nm24.Workers' exposure to crystalline silica dust was monitored according to an improved method of National Institute for Occupational Safety and Health (NIOSH) 760225. The intra- and inter-day coefficients of variation were considered for the precision of the method and accuracy was examined as percentage of recovery of standards. The coefficient of variation less than 10% and recovery efficiency in the range of 80% to 100% was considered as acceptable26. The LOD and LOQ (limit of quantification) values for analysis of crystalline silica dust were calculated according to equation No. 1 and No. 2, respectively.The validity of silica dust measurements was determined as wellLOD = Xbi + 3Sbi Eq. 1LOQ = Xbi + 10Sbi Eq. 2i was the mean concentration of the blank and Sbi was the standard deviation (SD) of the blank27.Where Xb28. PhoCheck Tiger PID was used to measure some compounds in previous work such as the toluene concentration at the inlet and outlet of the oxidation reactor29. The instrument was calibrated using the contamination-free air in the range of 0.4 to 14 ppm prepared in Tedlar bags . Atmospheric stock gas standards were prepared through static injection of known amounts of volatile liquid (using micro syringe Hamilton Company) into a 1L Tedlar bag containing contamination-free air. Hamilton gas tight syringe (0-500 \u00b5l) was used to transfer known amount of gas volume into 10 L Tedlar bags and filling them with known volume of contamination-free air by setting the proper flow and time parameters. Contamination-free atmosphere gases in the range of 0.4 to 14 and 0.4 to 12 as ppm for formaldehyde and trimethylamine respectively were prepared for calibration of PID.The concentrations of formaldehyde and triethylamine were measured using a photoionization detector (PID) apparatus . The usual mechanism of action of PID instrument as a real-time analyzer is ionization using ultraviolet radiation-7 a.m.) and after shift (during 4-5 p.m.). The workers' state of respiratory health was classified according to ATS/ERS guidelines for spirometric patterns of normal, obstructed, restricted, or mixed obstructed and restricted32. The subjects rested for 5 min before performing pulmonary-function tests. Spirometry was performed in standing positions of subjects and at least three acceptable maneuvers were obtained. Spirometric values were corrected for age, height, weight, and smoking habitLung function tests were performed using a spirometer . Pulmonary function parameters such as FVC, FEV1, FEV1/FVC, peak expiratory flow (PEF), and mid forced expiratory flow (FEF 25\u201375%) were considered. Lung function tests were measured according to the ERS/ATS standards before shift . The normality of the data was determined using Kolmogorov\u2013Smirnov test. The independent 2, respectively. Among core making workers, 32.7% smoked cigarettes. The average (SD) number of cigarettes smoked per day was 11.56 (7) during 10.81 (7.33) yr on average. The average (SD) regarding age, work experience, and BMI of workers in the control group were 37.15 (7.96) yr, 10.72 (6.84) yr, and 25.24 (3.77) kg/m2, respectively. Among subjects in the control group, 14.5% smoked cigarettes. The average (SD) number of cigarettes smoked per day was 7.50 (5.34) during 8.38 (5.29) yr on average. The independent samples t-test indicated significant differences in age and work experience of workers in the case and control groups (P<0.001). The chi-square test revealed that the numbers of current smokers were significantly higher (P=0.025) in the case group than in the control group. Because the spirometric values were based on subjects' age in the case and control groups, no adjustment was applied to this variable. The results were adjusted for work experience and the number of cigarette smokers. However, no statistical significant differences were found for other demographic variables.The average (SD) regarding age, work experience, and BMI of core making workers was 31.98 (6.90) yr, 5.32 (4.59) yr, and 25.11 (3.82) kg/m-IR spectroscopy method was 2.57 and 3.61%, respectively. The efficiency of recovery for silica dust samples was 100%. The LOD and LOQ for silica dust samples were 5.04 \u03bcg/sample and 3.82\u03bcg/sample, respectively.Measured indoor air parameters in the core-making unit of a foundry plant are presented in 34.The results obtained from the monitoring of occupational exposure to crystalline silica, formaldehyde, and triethylamine in the core-making unit are shown in t-test showed significant decreases (P <0.05) in the mean values of some lung function parameters including FVC, FEV1, and FEV1/FVC values in the exposed group compared to control group for before and after work shifts. Linear regression  indicated significant differences (P<0.05) in FVC and FEV1 values between exposed and control subjects before and after work shifts.Results of lung function tests for exposed and control groups were compared . However-Whitney tests revealed that differences in the spirometric patterns of workers between the exposed and control groups before starting a work shift (P=0.001) and after the work shift (P=0.007) were significant  denotes that increases for exposure to silica dust and triethylamine were associated with decreases in FEV1 and FVC values . No signP=0.034; \u03b2=-0.301) and after shift . There were significant associations between exposure to silica dust and FEV1 values only after shift .The association of lung function parameters with exposures to silica dust was determined after adjusting for exposures to formaldehyde, and triethylamine. The multiple regression analysis of data revealed that there were significant associations between exposure to silica dust and FVC values before shift (P=0.025) and after (P=0.029) work shifts. In addition, the results indicated a statistically significant synergistic effect of silica dust and triethylamine on FEV1 (P=0.010) and PEF (P=0.009) before and after work shifts FEV1 (P=0.001); PEF (P=0.003). The statistically significant synergistic effect of exposures to formaldehyde and smoking habits on FEF 25\u201375% values before (P=0.036) and after (P=0.028) work shifts were noticed.he synergistic effects of simultaneous exposures to silica dust, formaldehyde, and triethylamine were investigated using linear regression analysis. The findings showed a statistically significant synergistic effect of silica dust and triethylamine on FVC values before (*years of work) data indicated that there were significant associations between exposure to silica dust and FVC, FEV1, and FEF 25\u201375% values before and after work shifts (P<0.05).The simple regression analysis of cumulative exposure  reported on 19 workers in 3 foundries36.The occupational exposure of foundry workers in this study (0.41-6.47 ppm) to formaldehyde was approximately in the same range as the formaldehyde concentrations in the breathing zone in a steel foundry (2-4 ppm)35who found lower mean values of FVC among steel foundry workers. This finding also is in agreement with those of Johnson et al. 37who found significantly lower mean values of FEV1 among workers in an iron and steel foundry than control subjects did. In addition, our results are consistent with those of other findings and suggest that there was no difference in spirometric values of smokers and non-smokers in the case group13.This finding supports previous research, which stated the prime role of silica dust exposure in reducing ventilator capacity of the foundry workers13.We found that FVC and FEV1 values were significantly lower in foundry workers than in control subjects. Our findings are consistent with those of Low and Mitchell38. Although extensive research has been carried out to examine the synergistic effects of exposure to toxic agents40, to the best of our knowledge, too little attention has been paid to determine the combined effects of respirable silica dust, formaldehyde, and triethylamine on lung function parameters in literature.The results of this study revealed that combined exposure to silica dust and triethylamine had synergistic effects with some lung function parameters. This was accompanied by significant decreases in the values of FVC and FEV1. The phenomenon of simultaneous exposure of foundry workers to dust and fumes impaired their lung function parameters. In another study, combined occupational exposures to airborne dusts, gases, and fumes were associated with a reduction in peak expiratory flow rate (PEF)Prevalence of obstructive, restrictive, and mixed ventilatory impairments were significantly higher among our foundry workers than among control subjects. Although there were no statistically significant correlation between formaldehyde exposure and lung function parameters, the cumulative exposure of formaldehyde of our foundry workers was significantly correlated with FEF 25\u201375 after work shifts. This phenomenon signifies short and long-term effects of formaldehyde as irritant gas.41, more stringent of control measures, and health promotion programs are recommended for foundry workers.Results of combined exposure to silica dust and irritant gases on lung function parameters of foundry workers in this study, has raised serious concerns about their respiratory health. Therefore, more thorough examinations of their occupational exposures and health surveillance, including radiographic assessments of workers' lung conditions, according to Steenland and Ward (2014)The mean concentrations of silica dust, formaldehyde, and triethylamine in the breathing- zone air of study foundry workers were higher than proposed occupational exposure limits. Some lung function parameters such as FVC and FEV1 values were significantly lower in foundry workers than in control subjects. The findings showed a statistically significant synergistic effect of silica dust and triethylamine on FVC values. Synergistic effects of exposure to formaldehyde and smoking habits on FEF 25\u201375 values were observed.This study was done as a partial fulfillment of Master of Science degree in Occupational Health Engineering. The authors also appreciate the workers and management of the foundry plant for their sincere supports and corporations.The authors have declared no conflict of interest.This project was financially supported by the Safety Promotion and Injury Prevention Research Center, Shahid Beheshti University of Medical Sciences, Tehran, Iran.The air concentrations of silica dust, formaldehyde, and triethylamine exceeded the respective threshold limit values.Lower values for some lung function parameters were observed in foundry workers compared to the control subjects. Synergistic effects of combined exposure to silica dust and triethylamine on FVC values were reported."]}
-{"representative": "Sponge-mediated miR138-5p inactivation specifically in mouse parvalbumin (PV)-expressing interneurons impairs spatial recognition memory and enhances GABAergic synaptic input onto pyramidal neurons. Cellular and behavioral phenotypes associated with miR138-5p inactivation are paralleled by an upregulation of the schizophrenia (SCZ)-associated Erbb4, which we validated as a direct miR138-5p target gene. Our findings suggest that miR138-5p is a critical regulator of PV interneuron function in mice, with implications for cognition and SCZ. More generally, they provide evidence that microRNAs orchestrate neural circuit development by fine-tuning both excitatory and inhibitory synaptic transmission.The proper development and function of neuronal circuits rely on a tightly regulated balance between excitatory and inhibitory (E/I) synaptic transmission, and disrupting this balance can cause neurodevelopmental disorders, for example, schizophrenia. MicroRNA-dependent gene regulation in pyramidal neurons is important for excitatory synaptic function and cognition, but its role in inhibitory interneurons is poorly understood. Here, we identify  MicroRNAs (miRNAs) are short noncoding RNAs that act as negative regulators of mRNA translation and stability . Over thIn the rodent hippocampus, microcircuits of excitatory pyramidal neurons and local inhibitory interneurons provide an extensively studied model in the context of information processing, with specific implications for the control of spatial short-term and long-term memory . Among tmiR138-5p as an important regulator of excitatory synapse function in hippocampal pyramidal neurons  which allows expression of a miR138-5p inactivating sponge transcript harboring a lacZ coding sequence and six imperfect miR138-5p binding sites (6x-miR-138sponge) upon Cre-recombinase expression. Sponge transcripts sequester endogenous miRNA, thereby leading to miRNA inactivation and the derepression of cognate target genes  followed by two perfect miR-138 binding sites and a mCherry cds  in CA1 pyramidal neurons. Amplitude and frequency of mEPSCs were indistinguishable between 138-spongeub and control slices   were not differentially expressed between 138-spongeub and control mice (Gene ontology (GO) term analysis on DEGs from the RNA-seq analysis  revealedpocampus . Surpristivation . Accordirneurons . In control mice .miR138-5p expression at subcellular resolution. This analysis revealed strong expression of miR138-5p in both Camk2a-positive excitatory and Erbb4-positive inhibitory hippocampal neurons . Erbb4 is an SCZ risk gene that has been linked to the regulation of GABAergic synaptic transmission and short-term memory . rAAV expressing Dlx-138 sponge or DLX-control sponge co-localizes with Gad65/67 in primary rat hippocampal neurons, confirming interneuron-specific expression (Erbb4 RNA based on single-molecule fluorescence in situ hybridization (smFISH) was significantly elevated in Dlx-138 sponge compared to Dlx-control sponge infected interneurons  interneurons in the hippocampal circuit, frequency of miniature inhibitory postsynaptic current (mIPSC) was significantly increased in mice injected with the Dlx-138 sponge as compared to control sponge injected mice . In contmiR138-5p inactivation might be more robust in PV+ interneurons compared to other cell types. Thus, we again injected a miR-138 pbds sensor construct into the hippocampus of control or miR-138 spongeUb mice . Thus, the observed lack of regulation of miR138-5p targets in excitatory pyramidal neurons of 138-spongeUb mice is likely a result of inefficient sponge-mediated miR138-5p inhibition in this cell type. Since miR138-5p and alterations in PV+ interneuron function had recently been linked to SCZ  of PV-expressing inhibitory interneurons (PV-positive cells) . Our analysis revealed no significant difference in the number and intensity of PV-positive presynaptic boutons impinging onto the somata of CA1 pyramidal cells between 138-spongePV mice and their littermate controls  . On a becontrols . However and increases neurotransmitter release    or are dMiR-138 sponge was cloned into the BsrGI and HindIII restriction sites of a modified pAAV-6P-SEWB backbone, where the GFP has previously been replaced with dsRed . DiffereMiR-138 sponge imperfect binding site: 5\u2032 CGGCCTGATTCGTTCACCAGT 3\u2032; spacer sequence: 5\u2032 TTTTT 3\u2032; Control sponge sequence: 5\u2032 TGTGACTGGGGGCCAGAGG 3\u2032; spacer sequence: 5\u2032 CAGTG 3\u2032.Dlx-138 sponge and Dlx-control sponge were cloned into a modified mCaMKII\u03b1-mCherry-WPRE-hGHp(A)  backbone where 138-sponge and 138-sponge reversed (control-sponge) were previously inserted using MiR-138 sponge vector as template. The backbone was opened with MluI (NEB: R0198S) and KpnI (NEB: R0142). pAAV-mDlx-GFP-Fishell-1  was used to cut out Dlx enhancer and HBB promoter with MluI and EheI (NEB: R0606S).5\u2032 CACCACCTGTTCCTGTAGTGTAC 3\u2032; 5\u2032 CCAGAGGTTGATTATCGATAAGCTTAAC 3\u2032.Primers for 138 and control sponge: AAV expressing Cre-recombinase under the control of the CMV promoter .The oligonucleotides were designed without any specific overhangs to allow blunt-end cloning in both directions for a perfect binding site reporter and an antisense control reporter. They were annealed and ligated into a pGL3 promoter vector  expressing firefly luciferase. For cloning, the pGL3 vector was before digested with XbaI and the ends were blunted to insert the binding sites via blunt-end cloning at the 3\u2032end of the firefly open reading frame. After cloning, several clones were sequenced to determine sense and antisense reporter.5\u2032CTAGACGGCCTGATTCACAACACCAGCTACCGGCCTGATTCACAACACCAGCTGGATCC 3\u2032.5\u2032CTAGCGGATCCAGCTGGTGTTGTGAATCAGGCCGGTAGCTGGTGTTGTGAATCAGGCCGT 3\u2032.An EcoR1-BglII PCR fragment spanning the pCMV promoter, mCherry coding sequence, and SV40 poly adenylation signal were amplified using C1-mCherry  as template. The PCR product was cloned into the BGlII/EcoR1 sites of the AAV-hSyn-EGFP , upstream of the human Synapsin 1 promoter. Two miR-138 perfectly complementary binding sites were cloned into the SpeI and HIndIII restriction sites, between the EGFP coding sequence and WPRE element of AAV-hSYN-GFP, to generate the final AAV-138 sensor.5\u2032CTAGACGGCCTGATTCACAACACCAGCTACCGGCCTGATTCACAACACCAGCTGGATCC 3\u2032.5\u2032CTAGCGGATCCAGCTGGTGTTGTGAATCAGGCCGGTAGCTGGTGTTGTGAATCAGGCCGT 3\u2032.pmirGLO dual-luciferase expression vector reporter  was used to clone portions of 3\u2032 untranslated regions of the investigated mRNAs. XhoI and SalI restriction enzymes were used.5\u2032TTGAATGAAGCAATATGGAAGCAACCAGCAGATTAACTAATTTAAATACTTC 3\u2032.5\u2019TTGAATGAAGCAATATGGAAGCAgCatGaAGATTAACTAATTTAAATACTTC 3\u2019.5\u2019GCCTCAGTCACCAGCTCTGTACCAGCAATACTCACCCCTCCACCTCCCTGACTT 3\u2019.5\u2019GCCTCAGTgAtatcCTCTGTACCAGCAATACTCACCCCTCCACCTCCCTGACTT 3\u2019.Cultures of dissociated primary cortical and hippocampal neurons from embryonic day 18 (E18) Sprague-Dawley rats  were prepared and cultured as described previously . Animal Transfection of primary neurons was performed using Lipofectamine 2000 . For each well of a 24-well plate, a total of 1 \u00b5g DNA was mixed with a 1:50 dilution of Lipofectamine in NB/NBP medium. After an incubation of 20 min at room temperature, it was further diluted 1:5 in NB/NBP medium and applied to the cells. Neurons were incubated for 2 hr with the mix. A 1:1000 dilution of APV (20 mM) in NB+/NBP+ was applied for 45\u201360 min afterward before exchanging with NB+/NBP+.Luciferase assays were performed using the dual-luciferase reporter assay system on a GloMax R96 Microplate Luminometer (Promega). pmirGLO dual-luciferase expression vector reporter  was used to clone portions of 3\u2032 untranslated regions of the investigated mRNAs. PcDNA3 was used to balance all amounts to a total of 1 \u00b5g DNA per condition.tm2459 ArteGt(ROSA)26So  (hereafter named \u2018138-floxed\u2019) mouse lines were created at TaconicArtemis GmbH . The targeting strategy allowed the generation of a constitutive LacZ-miRNA138 Sponge Knock-In (KI) allele in the C57Bl/6 mouse ROSA26 locus via targeted transgenesis. The presence of the loxP-flanked transcriptional STOP cassette is expected to terminate the transcription from the CAG promoter and thus prevent the expression of the NLS-LacZ miRNA138 Sponge cDNA, which allows this line to be used as a control (138-floxed line). The constitutive KI allele was obtained after Cre-mediated removal of the loxP-flanked transcriptional STOP cassette from the conditional KI allele, by crossing the 138-flox line with a B6.C-Tg(CMV-Cre)1Cgn (CMV-CRE) line, which allows the expression of the sponge construct (138-spongeub mice). In all experiments, heterozygous male mice were used. The 138-spongePV line was generated by crossing 138-floxed line with a previously characterized B6;129P2-tm1(cre)ArbrPvalb/J (PV-CRE) line.The C57BL/6NTac-Animals were housed in groups of 3\u20135 per cage, with food and water ad libitum. All experiments were performed on adult male mice (3\u20135 months old).The animal house had an inverted light-dark cycle, all testing was done during the dark phase (8 a.m. to 8 p.m.). Mice were handled for 10 min for 5 days before the experiments began. All measures were analyzed by Noldus Ethovision xt 14, unless stated differently. During the experimental phase, mice were transported individually and allowed to acclimatize to the experimental room in a holding cage for at least 20 min before the beginning of the task. At the end of each experiment, they were transported back into the animal storage room in their holding cage and placed back into their original home cage with their littermates. 10 ml/L detergent  was used to clean equipment in between trials. Tasks which required the use of the same apparatus were scheduled at least 4 days apart. Two separate cohorts of mice were tested ( seven mice each). No cohort-specific differences were found. The behavioral essays were performed from the least to the most stressful: home cage activity, open field, y-maze, EPM, NOR, and CFC. All animal experiments were performed in accordance with the animal protection law of Switzerland and were approved by the local cantonal authorities (ZH017/18).OFT was performed as described previously . Each seSpontaneous alternation: mice were placed in a Y-shaped maze (8.5 cm width \u00d7 50 cm length \u00d7 10 cm height) for 5 min. They were free to explore the whole maze and the alternation between the arms was calculated.Novelty preference test: mice were given 5 min to explore two arms of the maze during the familiarization phase. A door made from the same Plexiglas used for the walls was used to prevent the access of the subjects into the third arm. At the end of the familiarization phase, mice were placed in their holding cage for 90 s, while the apparatus was cleaned to avoid olfactory trails. Mice were then placed back into the maze for the test phase, where all three arms were accessible. Preference ratio between the familiar and new arm was then scored based on the time spent in those arms.The maze was elevated 60 cm from the floor, with two arms enclosed by dark Plexiglas walls (5 cm width\u00d730 cm length\u00d715 cm height), two opposing open arms, and a central platform/intersection. Experiments were conducted in a homogenously illuminated room, with the maze placed in the center of the room. Mice were placed in the central platform of the EPM. The position and motion of the animals were automatically determined and recorded for 5 min. Time spent and distance traveled in the different arms were scored.Objects were based on the Nature protocol published previously . They weThis task was performed as previously described . BrieflyAdult male mice (4 months old) were anesthetized with isoflurane  and then quickly cervically dislocated and decapitated. Hippocampal tissue was dissected and freshly processed. RNA was extracted using mirVana microRNA Isolation Kit (Life Technologies) according to the manufacturer\u2019s instructions.Stranded polyA+ enriched RNA sequencing libraries were prepared at the GENCORE  and sequenced on an Illumina HiSeq 2000 machine using a 50-nt paired-end protocol .We removed the sequencing adapter and quality-trimmed all short reads from the 3\u2032end using FLEXBAR 2.5.3 and a Phred score cutoff >10. All reads longer than 18 bp were retained and rRNA reads were subtracted in silico using bowtie2 and an index of the complete repeating rRNA unit (BK000964.3). We used the STAR aligner 2.4.2a4 to map against the mouse genome (EnsEMBL 79 genome+annotations). We performed differential gene expression analysis using Cuffdiff 2.2.1.qPCR was performed as described earlier . Primer  5\u2032GACTCCAATAGGAATCAGTTTGTC 3\u2032.ErbB4 FW:5\u2032 TACTGGAGCCTCTGGTATGG 3\u2032.ErbB4 REV: 5\u2032 GCATCAGCGGTGAGATCTGT 3\u2032.Rims3 FW:  5\u2019 CTGGGTCAAGCCGACGATAG 3\u2019.Rims3 REV:Image acquisition was done with the experimenter being blinded to the different conditions. Pictures were taken on a confocal laser scanning microscope equipped with an Airyscan detector . Image analysis was carried out on Fiji (ImageJ).A 63\u00d7 oil objective was used to take images from the CA1 hippocampal region immunostained with PV, VGAT and Hoechst were used to counterstain the nuclei (further details in the immunostaining section). The number of PV+ and VGAT+ en passant boutons around the nuclear perimeter were counted and normalized to the total length of the perimeter. vGAT puncta mean intensity: vGAT puncta mean intensity: ImageJ was used to measure the intensity of all the vGAT puncta in the pictures used to quantify PV boutons.2).A 20\u00d7 objective was used and PV+ cells were counted on a maximum projection intensity of the CA1 region immunostained with PV . The number of PV + cells was normalized to a defined region of interest . To balance all amounts to a total of 1 \u00b5g DNA per condition, PcDNA3 was used. At 18 DIV, cells were fixed using 4% PFA for 15 min and mounted on glass slides using Aqua-Poly/Mount . The experimenter was blinded to all the conditions. The z-stack images of GFP-positive neurons exhibiting pyramidal morphology were taken with the 63\u00d7 objective of a confocal laser scanning microscope . Eight consecutive optical sections of the dendrites were taken at a 0.4-\u03bcm interval with a 1024\u00d71024 pixel resolution. Spine volumes were analyzed with the ImageJ software using the maximum intensity projections of the z-stack images. The GFP intensity of 150\u2013200 spines per cell was measured and normalized to the total intensity of the dendritic tree. For each experimental condition, at least 18 representative neurons derived from three independent experiments were analyzed.ub mice were processed with FD Rapid GolgiStain Kit  according to the manufacturer\u2019s protocol. Pictures were taken with a Zeiss axio-observer seven inverted widefield fluorescence microscope equipped with an Axiocam 702 mono Zeiss camera with a 100\u00d7 oil objective. Dendritic spines were manually analyzed with Fiji (ImageJ).Brains from 3-month-old 138-floxed and 138-spongeub, and 138-spongePV mice (age: 6\u20138 weeks) and incubated at 34\u00b0C in sucrose-containing artificial cerebrospinal fluid  for 0.5 hr, and then held at room temperature until recording.Hippocampal slices (300-\u03bcm thick) were prepared at 4\u00b0C, as previously described , from 13Whole-cell patch-clamp recordings were performed at 32\u00b0C on an upright microscope (Olympus BX51WI) under visual control using infrared differential interference contrast optics. Data were collected with an Axon MultiClamp 700B amplifier and a Digidata 1550B digitizer and analyzed with pClamp 11 software . Signals were filtered at 2 kHz for mEPSCs and mIPSCs and digitized at 5 kHz. Stimulus evoked and unitary postsynaptic currents were filtered at 4 kHz, fast-spiking interneurons at 10 kHz, both were digitized at 100 kHz. Recording pipettes were pulled from borosilicate capillary glass  with a DMZ-Universal-Electrode-Puller (Zeitz) and had resistances between 2 and 3 M\u03a9.3, 1.25 NaH2PO4, 2 CaCl2, 2 MgCl2, and 10 glucose. For EPSCs measured in CA1 pyramidal cells and for fast-spiking interneurons, the intracellular solution was composed of 125 K-Gluconate, 20 KCl 0.5 EGTA, 10 HEPES, 4 Mg-ATP, 0.3 GTP, and 10 Na2-phosphocreatine (adjusted to pH 7.3 with KOH). Cells were held at \u201370 mV for mEPSCs and at \u201360 mV for stimulus evoked EPSCs (eEPSCs). 1 \u03bcM Gabazine was added to isolate AMPA-mediated postsynaptic currents, additionally 1 \u03bcM TTX for mEPSCs. For IPSCs intracellular solution was composed of 135 Cs-Gluconate, 5 KCl, 2 NaCl, 0.2 EGTA, 10 HEPES, 4 Mg-ATP, 0.3 GTP, and 10 Na2-phosphocreatine (adjusted to pH 7.3 with CsOH). Cells were held at +10 mV for mIPSCs and at \u201310 mV for stimulus evoked inhibitory postsynaptic currents (eIPSCs) and uIPSCs. 25 \u03bcM AP-5, 10 \u03bcM NBQX, and 10 \u03bcM SCH 50911 were added to isolate GABAa-mediated postsynaptic currents for eIPSCs, additionally 1 \u03bcM TTX for mIPSCs. Synaptic currents were evoked by mono-polar stimulation with a patch pipette filled with ACSF and positioned in the middle of CA1 stratum radiatum for eEPSCs and in stratum pyramidale for eIPSCs. Series resistance of CA1 pyramidal neurons  was monitored and recordings were discarded if series resistance changed by more than 20%. Membrane potentials were not corrected for liquid junction potential.The extracellular solution (ACSF) was composed of (in mM) 126 NaCl, 2.5 KCl, 26 NaHCOFor paired recordings, whole-cell configuration was first established in putative fast-spiking interneurons. Cells were selected based on morphological appearance in stratum pyramidale of hippocampal CA1, on fast-spiking properties and on input resistance characteristics for PV-positive interneurons . Subsequhttps://storage.googleapis.com/linnarsson-lab-loom/l5_all.loom, restricted it to hippocampus cells, and aggregated to the pseudo-bulk level using muscat  was used to perform GO enrichment analysis, essentially as in To sum up, genes were annotated with the \u2018Cellular Component\u2019 ontology and significantly changed genes subsequently tested against the expressed background. For the main figure, we plotted the Top10 GO-Terms ranked by significance (filtering out those with more than 200 annotated genes).miR138-5p. Putative miR-138 targets (including site-type information) were then aligned with the genes and log fold changes (logFC) as obtained by the differential expression analysis. Plotted is the cumulative proportion (logFC rank (\u20131)/number of genes (\u20131)) over the logFC.Mouse 3\u2032UTR positions of predicted conserved microRNA binding sites were downloaded from Targetscan (version 7.2)  and filtsmFISH for miRNA detection on hippocampal neuron cultures was performed using the QuantiGene ViewRNA miRNA Cell Assay Kit (Thermo Fisher Scientific) according to the manufacturer\u2019s protocol with slight modifications. To preserve dendrite morphology, protease treatment was reduced to a dilution of 1:10,000 in phosphate-buffered saline (PBS) for 45 s. smFISH for mRNA detection was performed using the QuantiGene ViewRNA ISH Cell Assay Kit (Thermo Fisher Scientific) as previously described , but omi12 vector genomes/ml. Stereotactic brain injections were performed on 2- to 3-month-old 138-floxed and 138-spongeub mice as previously described ]rev-hSyn1-EGFP-2x (miR138-5p)-WPRE-SV40p(A)) was produced by the local Viral Vector Facility (VVF9 of the Neuroscience Center Zurich). The produced virus had a physical titer of 6.1\u00d710eescribed . BrieflyPV mice) or overnight (138-flox and 138-spongeub mice) at 4\u00b0C. The fixed tissue was placed in sucrose solution (30% sucrose in PBS) for 24 hr and frozen in tissue mounting medium . The tissue was coronally sectioned at 50\u201360 \u00b5m thickness on a cryostat, immediately placed in ice-cold PBS, and subsequently conserved in cryoprotectant solution  at \u201320\u00b0C.Animals were sacrificed by intraperitoneal injection of pentobarbital (150 mg/kg). When in deep anesthesia, mice were perfused intracardially with ice-cold PBS pH 7.4, followed by perfusion with 4% paraformaldehyde in PBS pH 7.4. The brains were then isolated and postfixed for 2\u20133 hr : for immunofluorescence, cryosections were washed in ice-cold PBS for 30 min, placed on microscope slides , and air-dried for 5\u201310 min. Afterward, permeabilization was performed by incubating sections in permeabilization solution (0.5% Triton X-100 in PBS) for 30 min at room temperature, followed by a blocking step in blocking buffer  with the addition of blocking Reagent  for 1 hr at room temperature. Cryosections were washed in PBS two times for 10 min at room temperature and incubated with primary antibodies in blocking buffer overnight at 4\u00b0C. Subsequently, the sections were washed three times with blocking buffer, incubated with secondary antibodies and Hoechst 33342 in blocking buffer for 1 hr at room temperature, washed again three times in blocking buffer, washed in PBS, air-dried, and mounted with Aqua-Poly/Mount .Ex vivo (Ex vivo (vibratome sections): for immunofluorescence, 300 \u00b5M sections were sliced on a vibratome in ice-cold sucrose-containing artificial cerebrospinal fluid, and then fixed in 4% PFA overnight. Free-floating sections were washed in ice-cold 1\u00d7 PBS for 30 min, permeabilized by incubation in 0.5% PBX (0.5% Triton X-100 in PBS) for 30 min at room temperature, followed by a quenching step in 0.1 M Glycine to reduce background autofluorescence. Sections were blocked in blocking buffer  for 1 hr at room temperature, and then incubated in primary antibodies for 36 hr at 4\u00b0C. Sections were washed in 0.05% PBX two times for 10 min at room temperature, and then incubated with secondary antibodies in 0.05% PBX with 10% normal goat serum at room temperature for 3 hr.Subsequently, the sections were washed three times with 0.05% PBX, incubated with Hoechst 33342 in 1\u00d7 PBS for 10 min, and then washed again three times in PBS, mounted on SuperFrost + slides with Aqua-Poly/Mount . A 40-\u00b5M Z-stack (with 0.25 \u00b5M z-step) was acquired on a Zeiss LSM 880 confocal microscope, with a Plan-Apochromatic 63\u00d7/1.4NA DIC M27 oil objective and FastAiryScan detector settings in the hippocampal CA1 region.2O) for 20 min. Primary antibody was diluted in GDB and incubated for 1 hr at room temperature, followed by five washes with PBS . Secondary antibody was diluted in GDB and incubated in the dark, at room temperature for 1 hr. The cells were then washed again with PBS . In the second last wash, Hoechst 33342 was added to the PBS. The coverslips were mounted with Aqua-Poly/Mount  on microscope slides .In vitro: cells were washed once with NBP, fixed for 20 min with 4%PFA and, after five washes with PBS , permeabilized with GDB (20 mM sodium phosphate buffer (pH 7.4), 450 mM NaCl, 0.3% Triton X-100, 0.1% gelatin, and ddHStatistical analysis was performed on either GraphPad Prism 8.0 or RStudio. Plots were generated in R, mainly using the packages ggplot2, ggsci, ggrepel, and scales. For data sets with n>4, Box plots (Tukey style) were used. For data sets with n<5, average\u00b1s.d., including individual data points, is shown. Normal distribution of data was tested with the Shapiro-Wilk test. Based on the results, parametric  or nonparametric (e.g. Mann-Whitney and Kolmogorov-Smirnov) tests were used.The detailed parameters  for the statistical assessment of the data are provided in the figure legends. The authors provide evidence for a role of the micro RNA \u2013 mi-138 \u2013 in synaptic inhibition and behavior in mice. They designed a novel transgenic model in which a miR-138 sponge is conditionally expressed to sequester endogenous miR-138 in a cell-type specific manner. Using this tool they show that sequestration of miR-138 in a major, parvalbumin-expressing inhibitory cell type results in enhanced inhibitory transmission, and deficits in memory. In the interests of transparency, eLife publishes the most substantive revision requests and the accompanying author responses.Review Commons.][Editors' note: this paper was reviewed by  Reviewer #1 ):Daswani et al. study the role of miR-138-5p, a microRNA the authors previously found to regulated excitatory synapse function, in mutant mice. To this end they overexpress a miR-138 sponge construct first ubiquitously and find that short term memory is impaired. Gene-expression analysis points to a specific role in inhibitory neurons, which the authors confirm by repeating key experiments in mutant mice in which the miR-138 sponge is expressed in PV-inhibitory neurons. This is a very interesting study that pioneers the analysis of microRNAs in a cell-type specific manner in the CNS. The following point represent helpful suggestion the authors could address before submission.- A question that may come up is related to the mutant mice the controls. One could argue that the better control would the transgenic mice expressing the \"control sponge\". At present the control group are mice that carry the construct but its not expressed, as far as I understood. The authors may want to address this issue upfront and discuss somewhere in the manuscript that their control animals are suitable.We agree with this reviewer that an independent line expressing a \u201ccontrol sponge\u201d construct might represent a \u201cgold standard\u201d control. However, we decided to take the current approach for two reasons: (1) considering the RRR principles of animal research, including an independent mouse line would have doubled the number of animals needed for experiments. (2) although a control sponge line addresses potential specificity issues of expressing a sponge transcript, it also has its own limitations since behavioural experiments cannot be done with littermates, which could also introduce variability. Nevertheless, we have rigorously validated the specificity of the miR-138 sponge construct by comparing it to a highly similar miR-138 control sponge construct in several assays: (i) miR-138 perfect binding site luciferase sensor assay ; (ii) dendritic spine size assay ; (iii) mIPSC electrophysiological recordings from hippocampal slices of intracerebrally injected mice ; (iv) short-term memory assay in intracerebrally injected mice ; (v) Erbb4 FISH in primary rat hippocampal neurons infected with Dlx-138-sponge . As suggested by this reviewer, we have discussed our approach in more detail in the revised manuscript .- Moreover, as far as I understand it, the sponge construct will be expressed from early developmental stages in all cells of the body in the initial experiment. While the authors later study specifically PV neurons, this may also represent early neurodevelopmental effects. It might be helpful for the reader to explain the approach and rational in more detail. want the specifically focus on the role of miR-138 in neurodevelopmental diseases  in which case the approach would make sense. However, I am not aware that miR-138 has been genetically linked yet to neurodevelopmental disease but I might have missed this. This could clarified specifically in the introduction.We agree with this reviewer that the phenotypes we observe might have an early developmental origin, at least in the ubiquitous sponge mouse line. However, as pointed out by reviewer 2, expression of PV doesn\u2019t kick in before the second postnatal week, arguing for a postnatal role of miR-138-5p in the PV-sponge model. Moreover, stereotactic injections of Dlx-138-sponge into the hippocampus  were performed in young adult mice, providing further support that perturbing miR-138-5p at adult stages impacts physiology and behaviour. Our findings are thus in line with a link to a disease like schizophrenia whose onset is either during adolescence (early-onset) or in adulthood (late-onset). In fact, miR-138 has been linked to cognitive functions, and a rare variant in the miR-138-2 gene has been associated with schizophrenia . We have now better clarified these links in the introduction and discussion of our revised manuscript. In addition, we have provided additional data showing a preferred deregulation of SCZ-associated genes in the miR-138 sponge model .- Figure 1B. To convincingly demonstrate the functionality of the construct in vivo it may help to assay the regulation of some confirmed targets at the mRNA/Protein level or point already here to the exp. later shown in Figure 2.Ub mice using Western blot . Unfortunately, we were unable to obtain conclusive Western blot results for Rims3 using several commercially available antibodies.We agree with this reviewer, that showing target gene regulation is imperical to confirm the functionality of the miR-138 loss-of-function approach. However, we want to stress that a number of experiments in this context were already included in our original manuscript. (1) Expression of the sponge in mice in vivo leads to a preferential upregulation of predicted miR-138 targets compared to non-targets , which provides strong evidence that expression of the construct leads to a specific loss-of-function of miR-138. (2) Validation by qPCR confirmed upregulation of PV-enriched genes at the RNA level, e.g. Rims3 and Erbb4. (3) In the revised manuscript, we further included protein data for Erbb4 upregulation in the hippocampus of miR-138-sponge- Supplemental Figure 1.: n=1 for pGL3 CTR may not be sufficient for statistical analysis. Panel (A) Please explain this assay in greater detail. What is measured here?In fact, this assay has been repeated 3 times. The lack of error bar in the control conditions is due to normalization. Statistical test could still be performed with a 1-sample t-test, which revealed a significant difference. The experiment measures the endogenous activity of miR-138 in hippocampal neurons (based on the extent of cleavage of the luciferase reporter).- Supplemental Fig1d: No scale bar. Why show a small section of the cerebellum when later hippocampus is analyzed? I suggest to show a selection of brain regions with high quality images.We agree and have now included a lacZ staining from the hippocampus in the revised manuscript .- Figure 1. The authors may want to consider that no effect in the contextual fear conditioning may not be sufficient to claim that specifically short-term memory is affected in mutant mice. A more thorough behavioral characterization may be necessary or it should be discussed why this is not necessary in the context of the current manuscript.In the revised manuscript, we have now further included CFC data from the PV-sponge mouse line , which also didn\u2019t reveal a significant genotype-dependent difference. That said, we fully agree that results from only one behavioural paradigm (CFC) are not sufficient to make general statements about the specific types of memories affected by miR-138 loss-of-function. However, since our laboratory is currently not set up to perform an extensive behavioural characterization of memory function using different tests, we consider such experiments beyond the scope of this revision. We therefore decided to tone down the statements in the manuscript related to short-term memory specificity accordingly.- Figure 2: please explain in more detail (in the methods) the statistics behind the diff. expression analysis.A more detailed statistical description has been included in the methods section of the revised manuscript .- Figure 2d. To further strengthen the idea that DEG are enriched in inhibitory neurons, corresponding viol plots across cell types may help. The authors could plot for example selected genes are the eigen-vector expression of DEGs.We agree with this reviewer that an alternative presentation of the DEG data could be helpful. We have therefore added another panel  illustrating the distribution of expression of the\u00a0sponge-upregulated-DEGs in the different cell types. In our view, this presentation is more easily interpretable compared to viol plots.- The selection of Erbb4 and Rims3 for further analysis could be explained better.Based on the available data, we have now decided to prioritize on Erbb4 regulation in the revised manuscript (Rims3 data was moved to the supplement). We have further provided a more detailed rationale for studying Erbb4 in the context of inhibitory synaptic transmission and short-term memory.- Figure 3B.Maybe show representative images.Representative pictures have now been included in the revised manuscript .- How about FC and other long-term memory assays in 138-spongePV\u00b4 mice?We have now additionally performed CFC in 138-sponge-PV mice, and found no significant difference in memory performance between 138-sponge and control mice . As outlined above, additional memory assays are beyond the scope of this study.- Please address the finding that behavior phenotypes are similar in 138-spongeub and 138-spongePV\u00b4 mice, while e-physiology differs (mini ipsc).Ub mice We assume that this is a misunderstanding, since we did not measure mIPSCs in pyramidal neurons of 138-sponge- I guess an obvious question could be to show the regulation of miR-138 target genes in PV neurons and /or study the transcriptome in PV-neurons as a result of sponge expression.We agree that assessing the transcriptome specifically of PV neurons would be a logical next step. However, this is technically rather challenging, either involving FACS sorting of PV-positive neurons or single-cell RNAseq approaches, both of which are currently not established in the laboratory. We therefore feel that such experiments, also considering the limited new insight that would be expected from them, are beyond the scope of this revision.- The discussion is comparatively short. The specific reference to miR-138 as a target for schizophrenia and ASD provokes the question of more detailed analysis, e.g behavioral phenotypes for ASD and schizophrenia in mutant mice or comparing the DEG to genes de-regulated in other mouse models for these diseases.We agree that making more functional connections to ASD/schizophrenia would be exciting. However, this would involve a battery of additional mouse behavioural experiments, which is in our view clearly beyond the scope of this revision. Concerning the second point, we have performed a comparison between DEGs deregulated in the miR138 sponge model and a previous study about schizophrenia . Excitingly, we found that the genes upregulated in the 138-sponge (at FDR<0.05) are significantly enriched for genes found upregulated in the brain of SCZ patients , which provides additional correlative evidence for an involvement of miR-138 in SCZ. Moreover, we have elaborated more on the role of miR-138 in cognition and SCZ in the discussion .- Given that the literature suggests of role for miR-138 also excitatory neurons, the phenotypes should be discussed in more detail. Why are mainly genes in inhibitory neurons affected in 138-spongeub mice?Based on our new results from a cell-type specific miR-138 sensor assay  we speculate that the reason for the preferential regulation in inhibitory neurons is the more efficient miR-138 inhibition in this cell type. This is now discussed in more detail . Please see also our comments to the other reviewers regarding this topic.Reviewer #1 (Significance (Required)): Generally this study addresses the cell-type specific role of microRNAs in the CNS, which is important to still innovative.The finding that miR-138 controls specific functions in inhibitory neurons and that this is linkned to behavioral alterations is novelThe data will be mainly intersting for the neuroscientific communityReviewer #2 ):Understanding the role of miRNAs in different neuronal cell types remains a paramount goal in neuroscience. Using a conditional miR-138 sponge transgenic line, Daswani and colleagues demonstrate that miR-138 in parvalbumin+ (PV) GABAergic neurons is necessary for short-term memory. Further, they identify a possible cellular mechanism underlying this behavioral deficit: CA1 pyramidal neurons receive more inhibition from neighboring PVs. This work is timely, impactful, and an important contribution to the field. However, there are important aspects that needs to be addressed before publication:Major:It is surprising that the miR-138 sponge has no effect in pyramidal neurons. The authors' laboratory has published beautiful work showing that miR-138 has important roles for synaptogenesis in this cell type. The authors hypothesize that the expression levels of the miR-138 sponge might not be high enough for pyramidal neurons (where miR-138 is highly expressed) and instead it is sufficient for PVs. However, sensor data in Figure 1b and spines data in Sup Figure 1c are from pyramidal neurons. For the miR-138 sponge to be credible, the authors must demonstrate that, as they claim, the sponge is effectively working in PVs and only partially in pyramidal neurons. This could be achieved by showing that miR-138 is expressed at different levels in the two cell types: (i) analysis of miR-138 expression levels from He et al. (2012) in different cell types; (ii) FACS of PVs and pyramidal neurons and assessing miR-138 levels; (iii) quantifying miRNA FISH in different cell types. In addition, the authors should demonstrate that the miR-138 has different levels of efficacy in the two cell types, i.e. analyzing sensor data in PNs vs PVs . If the results from this further analysis don't support the original hypothesis, the authors must find a plausible reason and validate it.Ub sponge mice.We fully agree with this reviewer that the absence of phenotype in pyramidal neurons is surprising and that we do not have a full explanation for this yet. To further test our hypothesis of an incomplete miR-138 inhibition in excitatory pyramidal neurons of the miR-138 sponge line, we have now performed a series of new experiments, largely following the suggestions made by this reviewer: (i) we monitored miR-138 expression from a published small RNA-seq study  . (Ii) we quantified miR-138 signal in already existing smFISH datasets from hippocampal neurons containing PNs and PVs . (Iii) we quantified mir-138 sensor activity in PNs and PVs in hippocampal slices stained for PN and PV markers . Altogether, this analysis suggests that while miR-138 is expressed to a similar level in PNs and PVs, its activity is markedly higher in PVs and more robustly inhibited in PVs by expression of a miR-138 sponge. Although the mechanistical underpinnings are unknown, these observations might explain why we preferentially observed miR-138-5p dependent regulation of interneuron-enriched genes in miR-138Minor:The sensor data are somewhat confusing. It would benefit to add schemes of the sensor and sponge constructs and to represent the data in Figure 1b with a bar graph. To further support the claims of incomplete effects of the miR-138 sponge, the authors should have a mutated MRE sensor (maximum de-repression) and express the effect of the sponge in different cell types as percentage of maximum de-repression. Please also add text explaining the sensor experiments in more detail so that the non-specialist can follow.As suggested by this reviewer, we have now added a scheme of the sensor and presented the data in Figure 1b as a bar graph. In addition, we have performed the sensor analysis separately for PNs and PVs . This analysis clearly shows that the degree of inhibition exerted by the 138-sponge is more pronounced in PV+ interneurons compared to PV- neurons, thereby supporting our model that transgenic expression of the miR-138 sponge preferentially de-represses miR-138-5p target genes in interneurons.The choice of PV-Cre is interesting. PV-Cre does not kick in until the second postnatal week, it is notoriously not a very efficient Cre line, and although it correlates well in the cortex with basket cells, it turns on also in cerebellar purkinje cells and in the peripheral nervous system. Some of these limitations should be discussed, considering that behavior is used as readout.The point about ectopic expression of PV-Cre in PV- cells in cerebellar purkinje cells and the peripheral nervous system is well taken. We therefore decided to perform a complementary approach where we delivered 138-sponge and control-sponge specifically to hippocampal interneurons by stereotactic injection of a rAAV-Dlx5/6 construct . Intriguingly, the miR-138-sponge associated behavioural and electrophysiological phenotypes were fully recapitulated by this approach. Together with our detailed electrophysiological characterization of hippocampal PV+ interneurons in paired recordings , we are confident that hippocampal PV dysfunction contributes in an important way to the observed phenotypes.The authors should remove emphasis from E/I. The physiology experiments performed don't assess E/I but E and I in isolation. It is the opinion of this reviewer that the work is impactful because it reveals novel miRNA mechanisms in GABAergic cells, no need to claiming anything else.We agree that our claims about E/I are currently overstated, and have now toned down the respective statements in the revised manuscript (e.g. by removing emphasis from E/I in the introduction).Sup Figure 1c. Should the y axes say something like Spines Density?We have added the y-axes label as suggested.Sup Figure 1d. Why did the authors choose the cerebellum to show CMV-Cre efficacy? The rest of the paper focuses on the hippocampus.We have now provided a new lacZ staining from the hippocampus to illustrate efficient Cre-mediated recombination in this region .In the introduction, the Tan et al. paper from the Schaefer lab should be mentioned, considering that miR-128 was knocked out in GABAergic cells (MSNs).We thank the reviewer for this reminder and have now referenced this paper in the introduction.Reviewer #2 (Significance (Required)): Identifying cell type-specific roles of miRNAs has eluded the field, specifically in the case of rare cell types, i.e GABAergic interneurons. The paper from Daswani and colleagues is an important step forward in this direction. Somewhat serendipitously, the authors have found that miR-138 targets preferentially genes enriched in GABAergic interneurons. Indeed, PV-specific knockout of miR-138 recapitulates behavioral deficits induced by global miR-138 knockout. The only similar contributions are well referenced in the introduction: (i) Tuncdemir et al. (Fishell lab) performed MGE-specific Dicer knockout and found defects in GABAergic interneuron survival, migration, and lamination; (ii) Qiu et al. (Miao He lab) showed that Dicer ko in VIP cells induces long-term dysfunction in GABAergic interneuron computations and survival.This manuscript should be of interest to both the miRNA field and the synaptic plasticity, learning and memory fields.I am a neurobiologist that studies the roles of miRNAs in instructing network formation.Reviewer #3 ):Daswani et al. report an interesting role for miR-138-5p in the control of short-term memory and inhibitory synaptic transmission. They notably built on an elegant transgenic model in which a miR-138 sponge is conditionally expressed using the Cre-Lox system and allows the sequestering of endogenous miR-138 in a cell-type specific manner. Using this model, the authors provide evidence that miR-138-5p expressed in parvalbumin-expressing neurons controls short-term memory as well as inhibitory synaptic input onto CA1 pyramidal neurons. Using RNAseq and qrtPCR, they identify presynaptic genes whose expression is regulated by miR-138 and possibly accounting for inhibitory synaptic alterations. Overall, the experiments are well conducted. The data are interesting, solid and logically presented and the methods are sufficiently described. However, there are some concerns that should be considered prior publication:Major concerns:(1) In the abstract, the authors' claim that \"miR-138-5p regulates the expression of presynaptic genes in hippocampal parvalbumin-expressing inhibitory interneurons to control short-term memory\" is overstated. Indeed, while the authors provide compelling evidence that miR-138 sponge controls short-term memory, the causal evidence to demonstrate that this is going through the regulation of presynaptic genes expression is missing. Moreover, because they are using a transgenic model in which the 138-sponge is constitutively expressed in any cell types and brain areas, the short-term memory deficits found by the authors are not necessarily resulting from hippocampal synaptic alterations. Therefore, the authors should either tone down this claim or perform additional experiments to support their model (see points 3 and 4).We largely agree with these statements and specifically address them under points 3 and 4.(2) While the authors provide convincing data demonstrating the efficiency of the miR-138 sponge both in cultured neurons and in vivo using sensor constructs and luciferase assays, the only evidence that the 138-sponge specifically inhibits miR-138 is by using a control sponge in cultured neurons and by measuring luciferase activity from sensors or spine size. To better support the specificity of the 138-sponge, it is important to demonstrate the absence of effect of the control sponge on inhibitory synaptic transmission, at least in cultured neurons.As suggested by this reviewer, we have now performed additional experiments to support the specificity of the 138-sponge in interneurons. Therefore, we generated rAAV expressing 138-sponge selectively in interneurons due to the presence of a Dlx5/6 promoter (Dlx-138-sponge). (i) expression of Dlx-138-sponge, but not Dlx-control-sponge, elevated Erbb4 expression in rat hippocampal interneurons in culture as assessed by smFISH ; (ii) stereotactic injection into the adult mouse hippocampus of Dlx-138-sponge, but not Dlx-control-sponge, impairs short-term memory  and inhibitory synaptic transmission in pyramidal neurons .Moreover, it would be reassuring to see that not all miRNAs are regulated by miR-138 (for instance by using sensors for distinct miRNAs).A priori, one cannot rule out that miR-138 inactivation indirectly regulates the expression and/or activity of other miRNAs, for example by regulating targets which control miRNA biogenesis. Therefore, the proposed sensor experiments for selected miRNA candidates are in our view not suitable to unequivocally judge the specificity of the miR-138 sponge approach. Moreover, such experiments would have required the stereotactic injection of at least two additional cohorts of mice, which was not covered by our currently approved animal experimentation license. Finally, only a low number of miRNAs could be screened with such an in vivo approach, making general conclusions difficult. By weighing all these arguments, we decided not to perform sensor experiments for additional miRNAs and instead added further experiments which support the specificity of the 138-sponge approach (see above).(3) The authors propose that miR-138 expression in the hippocampus regulates short-term memory. Although there is evidence from previous studies that hippocampal PV+ interneurons are involved in short-term memory, the data do not directly address this point. Specific involvement of miR-138 in hippocampal PV+ interneurons could be easily tested through stereotaxic injections of rAAVs carrying PV-Cre in 138-floxed mice in order to drive the expression of miR-138 sponge selectively in CA1 hippocampal interneurons.Ub and 138-spongePV mice. We did not pursue the PV-Cre injections into 138-floxed mice, since viral expression of PV-Cre (as opposed to transgenic expression in PV-Cre mice) apparently is not very specific and therefore not frequently used .We agree that the data presented in the original manuscript didn\u2019t provide direct evidence for a role of the hippocampus in miR-138-dependent regulation of short-term memory. Therefore, we now inactivated miR-138-5p specifically in hippocampal interneurons by stereotactic injection of a Dlx-138-sponge rAAV construct . This led to a similar impairment in both short-term memory  and inhibitory synaptic transmission  as observed in 138-sponge(4) Although not required for the paper as it is, experiments addressing the causal link between (1) the miR-138-dependent regulation of ErbB4 and/or RimS3 in CA1 interneurons and (2) the role of miR-138 in inhibitory synaptic transmission and/or short-term memory would considerably strengthen the model proposed. To address that, the authors could alter the expression/function of the candidate genes in their transgenic model. Alternatively, strategies could be used to selectively protect putative target from the action of miR-138-5p .Addressing the molecular mechanism underlying impaired short-term memory and inhibitory transmission is clearly the next step in this project, but beyond the scope of the current manuscript, as also pointed out by this reviewer.(5) Description of statistics require clarifications: - n should be clearly defined in all figure legends .- The authors should indicate whether and how they tested for normal distribution of their data.\u2014figure supplement Figure 1a-c and Suppl. Figure 3a : a non-parametric test should be used to compare the different conditions, considering the too low n number which does not allow to conclude on a normal distribution.We have now addressed these statistical issues in the revised manuscript. (i) we have now clearly defined n in all figure legends. (ii) normal distribution of the data was tested with the Shapiro-Wilk test in GraphPad (stated in the Methods section). When normal distribution was not observed, non-parametric tests were used . (iii) we agree with this reviewer that the n for the indicated experiments is too low to conclude on a normal distribution with a common test. However, visual inspection of the data suggested normal distribution for luciferase assays presented in Suppl. Figure 1a-c, considering our long-term experience with these assays. We therefore did not see the necessity to use non-parametric tests in this case. Concerning the PV+ cell density count , we now applied the Mann-Whitney test.Minor issues: (1) The fact that excitatory synapses onto pyramidal neurons are unaffected in 138-sponge mice is puzzling when considering the previous study from the same authors  as well as the results obtained in cultured neurons to validate the sponge . While the authors propose that 'the absence of changes in excitatory synaptic transmission in the hippocampus of 138-sponge-ub mice might be due to ineffective silencing of the highly abundant miR-138-5p in pyramidal neurons' they could actually refine their analysis to give support this hypothesis:- By quantifying the signal from single-molecule FISH for miR-138 in Camk2a+ neurons versus Erbb4+ neurons . In the images shown, it is not evident that excitatory neurons express more miR-138 in comparison to inhibitory ones.- By quantifying the degree of inhibition of miR-138 in pyramidal neurons versus interneurons using the dual sensor system . In Figure 1b, the authors do not discriminate between cell types. A lack of increase of the GFP signal in pyramidal cells may indicate an inability of those cells to express the sponge.- By checking whether APT1, a known miR-138 target that they previously identified in excitatory neurons  is also a regulated gene in 138-sponge mice. If APT1 expression remains unchanged, this could give support to the fact that the sponge is indeed ineffective in excitatory neurons.We agree with the comments made by this reviewer, which are also in agreement with those from reviewer 2 . Concerning the last point of reviewer 3, we now checked the expression APT1 (new nomenclature LYPLA1), as well as two other validated miR-138 targets from excitatory neurons  in our RNA-seq data. None of these targets was differentially expressed . Together, this data supports our hypothesis that miR-138 is not effectively inhibited by the sponge transgene in PNs.(2) The analysis of VGAT signal intensity in individual PV+ boutons may provide useful information about the content in vesicles per bouton. One could expect a higher VGAT intensity/bouton in 138-sponge mice, correlated with an increase number of release sites per bouton (as proposed by the authors) or a similar trend as for increased success rate or decreased PPR.PV and control mice, suggesting that the gross morphology of inhibitory release sites is unchanged. Further ultrastructural investigation of synaptic release sites will require super-resolution microscopy, which is currently not established in the laboratory and therefore beyond the scope of this revision.We agree that the analysis of VGAT signal intensity might provide additional information regarding the observed inhibitory synapse phenotype and therefore performed the respective analysis . However, this didn\u2019t reveal any significant differences between miR-138-sponge(3) For the following data, titles of the graph axis are not accurate and the authors should indicate more precisely what are the exact parameters measured: Figure 1b, Suppl. Figure 1a, Suppl. Figure 1c, Suppl. Figure 3b.We have fixed these issues in the revised manuscript.(4) Figure 3j: \"Coefficient of variance\" should be corrected for \"coefficient of variation\".We have changed this expression accordingly.(5) Results \u2013 L70: the use of the miR-138 sponge is critical for the key findings of the study. It is therefore important to detail within the text how the specificity and the efficiency of the sponge were tested.Please refer to our comments for reviewer 1 and 2 regarding miR-138 sponge validation in vitro and in vivo. In addition, we have provided more discussion of the sponge strategy in the text .(6) Results \u2013 L75: the authors should introduce briefly how the dual sensor works and why an increase of the GFP signals indicate efficient sequestering of endogenous miR-138.We have now explained the sensor strategy in more detail in the Results section  and in addition provided a schematic (7) Supplementary figure 1d: to illustrate the 'penetrant expression' of the sponge, the authors should provide an image representative of the hippocampus not the cerebellum.We have now provided a representative picture of the hippocampus .(8) Suppl. Figure 1g and Suppl. Figure 3B: the use of a single two-way ANOVA test with a single P value is not clear to me as two different parameters are measured (distance and time).We apologize for the confusion. The two parameters have now been plotted as individual panels  and separately analyzed with heteroscedastic t-tests.(9) Suppl. Figure 1i,j and suppl. Figure 3d: the authors should mention whether a statistical test was used to compare the two conditions. n values (cells) should be indicated.The respective figures correspond to bar graphs in the main manuscript , for which a statistical test was provided. However, we now also provided a statistical assessment of the cumulative graphs (using KS-test) in the revised manuscript.Reviewer #3 (Significance (Required)): This study provides important findings that will be of interest for a large audience of neuroscientists interested in synaptic physiology and pathologies:(1) The authors developed an elegant transgenic model allowing to address the role of miR-138 in a cell specific manner and which allows to correlate synaptic alterations to the behavior.(2) While the majority of studies have investigated the role of miRNAs at excitatory synapses, this study provides important insight about the role of one identified miRNA, miR-138, at inhibitory synapses. Interestingly, because miR-138 was also shown to regulate excitatory synapses, the data suggest a central role of miR-138 in regulating E-I balance in hippocampal circuits.(3) The study further shows that alterations in inhibitory synaptic transmission resulting from miR-138 inhibition are correlated with deficits in working memory. Because miR-138 as well as its targets are associated with cognitive deficits and neuropsychiatric disorders such as autism and schizophrenia , this study thus suggests a critical role of miR-138 in disorders with altered E/I balance.I have expertise in the role of microRNAs in synaptic development and plasticity. While I have little expertise regarding behavioral investigations in general, I feel that the behavioral data shown in the present paper are easily accessible and straightforward.", "texts": ["Sponge-mediated miR138-5p inactivation specifically in mouse parvalbumin (PV)-expressing interneurons impairs spatial recognition memory and enhances GABAergic synaptic input onto pyramidal neurons. Cellular and behavioral phenotypes associated with miR138-5p inactivation are paralleled by an upregulation of the schizophrenia (SCZ)-associated Erbb4, which we validated as a direct miR138-5p target gene. Our findings suggest that miR138-5p is a critical regulator of PV interneuron function in mice, with implications for cognition and SCZ. More generally, they provide evidence that microRNAs orchestrate neural circuit development by fine-tuning both excitatory and inhibitory synaptic transmission.The proper development and function of neuronal circuits rely on a tightly regulated balance between excitatory and inhibitory (E/I) synaptic transmission, and disrupting this balance can cause neurodevelopmental disorders, for example, schizophrenia. MicroRNA-dependent gene regulation in pyramidal neurons is important for excitatory synaptic function and cognition, but its role in inhibitory interneurons is poorly understood. Here, we identify  MicroRNAs (miRNAs) are short noncoding RNAs that act as negative regulators of mRNA translation and stability . Over thIn the rodent hippocampus, microcircuits of excitatory pyramidal neurons and local inhibitory interneurons provide an extensively studied model in the context of information processing, with specific implications for the control of spatial short-term and long-term memory . Among tmiR138-5p as an important regulator of excitatory synapse function in hippocampal pyramidal neurons  which allows expression of a miR138-5p inactivating sponge transcript harboring a lacZ coding sequence and six imperfect miR138-5p binding sites (6x-miR-138sponge) upon Cre-recombinase expression. Sponge transcripts sequester endogenous miRNA, thereby leading to miRNA inactivation and the derepression of cognate target genes  followed by two perfect miR-138 binding sites and a mCherry cds  in CA1 pyramidal neurons. Amplitude and frequency of mEPSCs were indistinguishable between 138-spongeub and control slices   were not differentially expressed between 138-spongeub and control mice (Gene ontology (GO) term analysis on DEGs from the RNA-seq analysis  revealedpocampus . Surpristivation . Accordirneurons . In control mice .miR138-5p expression at subcellular resolution. This analysis revealed strong expression of miR138-5p in both Camk2a-positive excitatory and Erbb4-positive inhibitory hippocampal neurons . Erbb4 is an SCZ risk gene that has been linked to the regulation of GABAergic synaptic transmission and short-term memory . rAAV expressing Dlx-138 sponge or DLX-control sponge co-localizes with Gad65/67 in primary rat hippocampal neurons, confirming interneuron-specific expression (Erbb4 RNA based on single-molecule fluorescence in situ hybridization (smFISH) was significantly elevated in Dlx-138 sponge compared to Dlx-control sponge infected interneurons  interneurons in the hippocampal circuit, frequency of miniature inhibitory postsynaptic current (mIPSC) was significantly increased in mice injected with the Dlx-138 sponge as compared to control sponge injected mice . In contmiR138-5p inactivation might be more robust in PV+ interneurons compared to other cell types. Thus, we again injected a miR-138 pbds sensor construct into the hippocampus of control or miR-138 spongeUb mice . Thus, the observed lack of regulation of miR138-5p targets in excitatory pyramidal neurons of 138-spongeUb mice is likely a result of inefficient sponge-mediated miR138-5p inhibition in this cell type. Since miR138-5p and alterations in PV+ interneuron function had recently been linked to SCZ  of PV-expressing inhibitory interneurons (PV-positive cells) . Our analysis revealed no significant difference in the number and intensity of PV-positive presynaptic boutons impinging onto the somata of CA1 pyramidal cells between 138-spongePV mice and their littermate controls  . On a becontrols . However and increases neurotransmitter release    or are dMiR-138 sponge was cloned into the BsrGI and HindIII restriction sites of a modified pAAV-6P-SEWB backbone, where the GFP has previously been replaced with dsRed . DiffereMiR-138 sponge imperfect binding site: 5\u2032 CGGCCTGATTCGTTCACCAGT 3\u2032; spacer sequence: 5\u2032 TTTTT 3\u2032; Control sponge sequence: 5\u2032 TGTGACTGGGGGCCAGAGG 3\u2032; spacer sequence: 5\u2032 CAGTG 3\u2032.Dlx-138 sponge and Dlx-control sponge were cloned into a modified mCaMKII\u03b1-mCherry-WPRE-hGHp(A)  backbone where 138-sponge and 138-sponge reversed (control-sponge) were previously inserted using MiR-138 sponge vector as template. The backbone was opened with MluI (NEB: R0198S) and KpnI (NEB: R0142). pAAV-mDlx-GFP-Fishell-1  was used to cut out Dlx enhancer and HBB promoter with MluI and EheI (NEB: R0606S).5\u2032 CACCACCTGTTCCTGTAGTGTAC 3\u2032; 5\u2032 CCAGAGGTTGATTATCGATAAGCTTAAC 3\u2032.Primers for 138 and control sponge: AAV expressing Cre-recombinase under the control of the CMV promoter .The oligonucleotides were designed without any specific overhangs to allow blunt-end cloning in both directions for a perfect binding site reporter and an antisense control reporter. They were annealed and ligated into a pGL3 promoter vector  expressing firefly luciferase. For cloning, the pGL3 vector was before digested with XbaI and the ends were blunted to insert the binding sites via blunt-end cloning at the 3\u2032end of the firefly open reading frame. After cloning, several clones were sequenced to determine sense and antisense reporter.5\u2032CTAGACGGCCTGATTCACAACACCAGCTACCGGCCTGATTCACAACACCAGCTGGATCC 3\u2032.5\u2032CTAGCGGATCCAGCTGGTGTTGTGAATCAGGCCGGTAGCTGGTGTTGTGAATCAGGCCGT 3\u2032.An EcoR1-BglII PCR fragment spanning the pCMV promoter, mCherry coding sequence, and SV40 poly adenylation signal were amplified using C1-mCherry  as template. The PCR product was cloned into the BGlII/EcoR1 sites of the AAV-hSyn-EGFP , upstream of the human Synapsin 1 promoter. Two miR-138 perfectly complementary binding sites were cloned into the SpeI and HIndIII restriction sites, between the EGFP coding sequence and WPRE element of AAV-hSYN-GFP, to generate the final AAV-138 sensor.5\u2032CTAGACGGCCTGATTCACAACACCAGCTACCGGCCTGATTCACAACACCAGCTGGATCC 3\u2032.5\u2032CTAGCGGATCCAGCTGGTGTTGTGAATCAGGCCGGTAGCTGGTGTTGTGAATCAGGCCGT 3\u2032.pmirGLO dual-luciferase expression vector reporter  was used to clone portions of 3\u2032 untranslated regions of the investigated mRNAs. XhoI and SalI restriction enzymes were used.5\u2032TTGAATGAAGCAATATGGAAGCAACCAGCAGATTAACTAATTTAAATACTTC 3\u2032.5\u2019TTGAATGAAGCAATATGGAAGCAgCatGaAGATTAACTAATTTAAATACTTC 3\u2019.5\u2019GCCTCAGTCACCAGCTCTGTACCAGCAATACTCACCCCTCCACCTCCCTGACTT 3\u2019.5\u2019GCCTCAGTgAtatcCTCTGTACCAGCAATACTCACCCCTCCACCTCCCTGACTT 3\u2019.Cultures of dissociated primary cortical and hippocampal neurons from embryonic day 18 (E18) Sprague-Dawley rats  were prepared and cultured as described previously . Animal Transfection of primary neurons was performed using Lipofectamine 2000 . For each well of a 24-well plate, a total of 1 \u00b5g DNA was mixed with a 1:50 dilution of Lipofectamine in NB/NBP medium. After an incubation of 20 min at room temperature, it was further diluted 1:5 in NB/NBP medium and applied to the cells. Neurons were incubated for 2 hr with the mix. A 1:1000 dilution of APV (20 mM) in NB+/NBP+ was applied for 45\u201360 min afterward before exchanging with NB+/NBP+.Luciferase assays were performed using the dual-luciferase reporter assay system on a GloMax R96 Microplate Luminometer (Promega). pmirGLO dual-luciferase expression vector reporter  was used to clone portions of 3\u2032 untranslated regions of the investigated mRNAs. PcDNA3 was used to balance all amounts to a total of 1 \u00b5g DNA per condition.tm2459 ArteGt(ROSA)26So  (hereafter named \u2018138-floxed\u2019) mouse lines were created at TaconicArtemis GmbH . The targeting strategy allowed the generation of a constitutive LacZ-miRNA138 Sponge Knock-In (KI) allele in the C57Bl/6 mouse ROSA26 locus via targeted transgenesis. The presence of the loxP-flanked transcriptional STOP cassette is expected to terminate the transcription from the CAG promoter and thus prevent the expression of the NLS-LacZ miRNA138 Sponge cDNA, which allows this line to be used as a control (138-floxed line). The constitutive KI allele was obtained after Cre-mediated removal of the loxP-flanked transcriptional STOP cassette from the conditional KI allele, by crossing the 138-flox line with a B6.C-Tg(CMV-Cre)1Cgn (CMV-CRE) line, which allows the expression of the sponge construct (138-spongeub mice). In all experiments, heterozygous male mice were used. The 138-spongePV line was generated by crossing 138-floxed line with a previously characterized B6;129P2-tm1(cre)ArbrPvalb/J (PV-CRE) line.The C57BL/6NTac-Animals were housed in groups of 3\u20135 per cage, with food and water ad libitum. All experiments were performed on adult male mice (3\u20135 months old).The animal house had an inverted light-dark cycle, all testing was done during the dark phase (8 a.m. to 8 p.m.). Mice were handled for 10 min for 5 days before the experiments began. All measures were analyzed by Noldus Ethovision xt 14, unless stated differently. During the experimental phase, mice were transported individually and allowed to acclimatize to the experimental room in a holding cage for at least 20 min before the beginning of the task. At the end of each experiment, they were transported back into the animal storage room in their holding cage and placed back into their original home cage with their littermates. 10 ml/L detergent  was used to clean equipment in between trials. Tasks which required the use of the same apparatus were scheduled at least 4 days apart. Two separate cohorts of mice were tested ( seven mice each). No cohort-specific differences were found. The behavioral essays were performed from the least to the most stressful: home cage activity, open field, y-maze, EPM, NOR, and CFC. All animal experiments were performed in accordance with the animal protection law of Switzerland and were approved by the local cantonal authorities (ZH017/18).OFT was performed as described previously . Each seSpontaneous alternation: mice were placed in a Y-shaped maze (8.5 cm width \u00d7 50 cm length \u00d7 10 cm height) for 5 min. They were free to explore the whole maze and the alternation between the arms was calculated.Novelty preference test: mice were given 5 min to explore two arms of the maze during the familiarization phase. A door made from the same Plexiglas used for the walls was used to prevent the access of the subjects into the third arm. At the end of the familiarization phase, mice were placed in their holding cage for 90 s, while the apparatus was cleaned to avoid olfactory trails. Mice were then placed back into the maze for the test phase, where all three arms were accessible. Preference ratio between the familiar and new arm was then scored based on the time spent in those arms.The maze was elevated 60 cm from the floor, with two arms enclosed by dark Plexiglas walls (5 cm width\u00d730 cm length\u00d715 cm height), two opposing open arms, and a central platform/intersection. Experiments were conducted in a homogenously illuminated room, with the maze placed in the center of the room. Mice were placed in the central platform of the EPM. The position and motion of the animals were automatically determined and recorded for 5 min. Time spent and distance traveled in the different arms were scored.Objects were based on the Nature protocol published previously . They weThis task was performed as previously described . BrieflyAdult male mice (4 months old) were anesthetized with isoflurane  and then quickly cervically dislocated and decapitated. Hippocampal tissue was dissected and freshly processed. RNA was extracted using mirVana microRNA Isolation Kit (Life Technologies) according to the manufacturer\u2019s instructions.Stranded polyA+ enriched RNA sequencing libraries were prepared at the GENCORE  and sequenced on an Illumina HiSeq 2000 machine using a 50-nt paired-end protocol .We removed the sequencing adapter and quality-trimmed all short reads from the 3\u2032end using FLEXBAR 2.5.3 and a Phred score cutoff >10. All reads longer than 18 bp were retained and rRNA reads were subtracted in silico using bowtie2 and an index of the complete repeating rRNA unit (BK000964.3). We used the STAR aligner 2.4.2a4 to map against the mouse genome (EnsEMBL 79 genome+annotations). We performed differential gene expression analysis using Cuffdiff 2.2.1.qPCR was performed as described earlier . Primer  5\u2032GACTCCAATAGGAATCAGTTTGTC 3\u2032.ErbB4 FW:5\u2032 TACTGGAGCCTCTGGTATGG 3\u2032.ErbB4 REV: 5\u2032 GCATCAGCGGTGAGATCTGT 3\u2032.Rims3 FW:  5\u2019 CTGGGTCAAGCCGACGATAG 3\u2019.Rims3 REV:Image acquisition was done with the experimenter being blinded to the different conditions. Pictures were taken on a confocal laser scanning microscope equipped with an Airyscan detector . Image analysis was carried out on Fiji (ImageJ).A 63\u00d7 oil objective was used to take images from the CA1 hippocampal region immunostained with PV, VGAT and Hoechst were used to counterstain the nuclei (further details in the immunostaining section). The number of PV+ and VGAT+ en passant boutons around the nuclear perimeter were counted and normalized to the total length of the perimeter. vGAT puncta mean intensity: vGAT puncta mean intensity: ImageJ was used to measure the intensity of all the vGAT puncta in the pictures used to quantify PV boutons.2).A 20\u00d7 objective was used and PV+ cells were counted on a maximum projection intensity of the CA1 region immunostained with PV . The number of PV + cells was normalized to a defined region of interest . To balance all amounts to a total of 1 \u00b5g DNA per condition, PcDNA3 was used. At 18 DIV, cells were fixed using 4% PFA for 15 min and mounted on glass slides using Aqua-Poly/Mount . The experimenter was blinded to all the conditions. The z-stack images of GFP-positive neurons exhibiting pyramidal morphology were taken with the 63\u00d7 objective of a confocal laser scanning microscope . Eight consecutive optical sections of the dendrites were taken at a 0.4-\u03bcm interval with a 1024\u00d71024 pixel resolution. Spine volumes were analyzed with the ImageJ software using the maximum intensity projections of the z-stack images. The GFP intensity of 150\u2013200 spines per cell was measured and normalized to the total intensity of the dendritic tree. For each experimental condition, at least 18 representative neurons derived from three independent experiments were analyzed.ub mice were processed with FD Rapid GolgiStain Kit  according to the manufacturer\u2019s protocol. Pictures were taken with a Zeiss axio-observer seven inverted widefield fluorescence microscope equipped with an Axiocam 702 mono Zeiss camera with a 100\u00d7 oil objective. Dendritic spines were manually analyzed with Fiji (ImageJ).Brains from 3-month-old 138-floxed and 138-spongeub, and 138-spongePV mice (age: 6\u20138 weeks) and incubated at 34\u00b0C in sucrose-containing artificial cerebrospinal fluid  for 0.5 hr, and then held at room temperature until recording.Hippocampal slices (300-\u03bcm thick) were prepared at 4\u00b0C, as previously described , from 13Whole-cell patch-clamp recordings were performed at 32\u00b0C on an upright microscope (Olympus BX51WI) under visual control using infrared differential interference contrast optics. Data were collected with an Axon MultiClamp 700B amplifier and a Digidata 1550B digitizer and analyzed with pClamp 11 software . Signals were filtered at 2 kHz for mEPSCs and mIPSCs and digitized at 5 kHz. Stimulus evoked and unitary postsynaptic currents were filtered at 4 kHz, fast-spiking interneurons at 10 kHz, both were digitized at 100 kHz. Recording pipettes were pulled from borosilicate capillary glass  with a DMZ-Universal-Electrode-Puller (Zeitz) and had resistances between 2 and 3 M\u03a9.3, 1.25 NaH2PO4, 2 CaCl2, 2 MgCl2, and 10 glucose. For EPSCs measured in CA1 pyramidal cells and for fast-spiking interneurons, the intracellular solution was composed of 125 K-Gluconate, 20 KCl 0.5 EGTA, 10 HEPES, 4 Mg-ATP, 0.3 GTP, and 10 Na2-phosphocreatine (adjusted to pH 7.3 with KOH). Cells were held at \u201370 mV for mEPSCs and at \u201360 mV for stimulus evoked EPSCs (eEPSCs). 1 \u03bcM Gabazine was added to isolate AMPA-mediated postsynaptic currents, additionally 1 \u03bcM TTX for mEPSCs. For IPSCs intracellular solution was composed of 135 Cs-Gluconate, 5 KCl, 2 NaCl, 0.2 EGTA, 10 HEPES, 4 Mg-ATP, 0.3 GTP, and 10 Na2-phosphocreatine (adjusted to pH 7.3 with CsOH). Cells were held at +10 mV for mIPSCs and at \u201310 mV for stimulus evoked inhibitory postsynaptic currents (eIPSCs) and uIPSCs. 25 \u03bcM AP-5, 10 \u03bcM NBQX, and 10 \u03bcM SCH 50911 were added to isolate GABAa-mediated postsynaptic currents for eIPSCs, additionally 1 \u03bcM TTX for mIPSCs. Synaptic currents were evoked by mono-polar stimulation with a patch pipette filled with ACSF and positioned in the middle of CA1 stratum radiatum for eEPSCs and in stratum pyramidale for eIPSCs. Series resistance of CA1 pyramidal neurons  was monitored and recordings were discarded if series resistance changed by more than 20%. Membrane potentials were not corrected for liquid junction potential.The extracellular solution (ACSF) was composed of (in mM) 126 NaCl, 2.5 KCl, 26 NaHCOFor paired recordings, whole-cell configuration was first established in putative fast-spiking interneurons. Cells were selected based on morphological appearance in stratum pyramidale of hippocampal CA1, on fast-spiking properties and on input resistance characteristics for PV-positive interneurons . Subsequhttps://storage.googleapis.com/linnarsson-lab-loom/l5_all.loom, restricted it to hippocampus cells, and aggregated to the pseudo-bulk level using muscat  was used to perform GO enrichment analysis, essentially as in To sum up, genes were annotated with the \u2018Cellular Component\u2019 ontology and significantly changed genes subsequently tested against the expressed background. For the main figure, we plotted the Top10 GO-Terms ranked by significance (filtering out those with more than 200 annotated genes).miR138-5p. Putative miR-138 targets (including site-type information) were then aligned with the genes and log fold changes (logFC) as obtained by the differential expression analysis. Plotted is the cumulative proportion (logFC rank (\u20131)/number of genes (\u20131)) over the logFC.Mouse 3\u2032UTR positions of predicted conserved microRNA binding sites were downloaded from Targetscan (version 7.2)  and filtsmFISH for miRNA detection on hippocampal neuron cultures was performed using the QuantiGene ViewRNA miRNA Cell Assay Kit (Thermo Fisher Scientific) according to the manufacturer\u2019s protocol with slight modifications. To preserve dendrite morphology, protease treatment was reduced to a dilution of 1:10,000 in phosphate-buffered saline (PBS) for 45 s. smFISH for mRNA detection was performed using the QuantiGene ViewRNA ISH Cell Assay Kit (Thermo Fisher Scientific) as previously described , but omi12 vector genomes/ml. Stereotactic brain injections were performed on 2- to 3-month-old 138-floxed and 138-spongeub mice as previously described ]rev-hSyn1-EGFP-2x (miR138-5p)-WPRE-SV40p(A)) was produced by the local Viral Vector Facility (VVF9 of the Neuroscience Center Zurich). The produced virus had a physical titer of 6.1\u00d710eescribed . BrieflyPV mice) or overnight (138-flox and 138-spongeub mice) at 4\u00b0C. The fixed tissue was placed in sucrose solution (30% sucrose in PBS) for 24 hr and frozen in tissue mounting medium . The tissue was coronally sectioned at 50\u201360 \u00b5m thickness on a cryostat, immediately placed in ice-cold PBS, and subsequently conserved in cryoprotectant solution  at \u201320\u00b0C.Animals were sacrificed by intraperitoneal injection of pentobarbital (150 mg/kg). When in deep anesthesia, mice were perfused intracardially with ice-cold PBS pH 7.4, followed by perfusion with 4% paraformaldehyde in PBS pH 7.4. The brains were then isolated and postfixed for 2\u20133 hr : for immunofluorescence, cryosections were washed in ice-cold PBS for 30 min, placed on microscope slides , and air-dried for 5\u201310 min. Afterward, permeabilization was performed by incubating sections in permeabilization solution (0.5% Triton X-100 in PBS) for 30 min at room temperature, followed by a blocking step in blocking buffer  with the addition of blocking Reagent  for 1 hr at room temperature. Cryosections were washed in PBS two times for 10 min at room temperature and incubated with primary antibodies in blocking buffer overnight at 4\u00b0C. Subsequently, the sections were washed three times with blocking buffer, incubated with secondary antibodies and Hoechst 33342 in blocking buffer for 1 hr at room temperature, washed again three times in blocking buffer, washed in PBS, air-dried, and mounted with Aqua-Poly/Mount .Ex vivo (Ex vivo (vibratome sections): for immunofluorescence, 300 \u00b5M sections were sliced on a vibratome in ice-cold sucrose-containing artificial cerebrospinal fluid, and then fixed in 4% PFA overnight. Free-floating sections were washed in ice-cold 1\u00d7 PBS for 30 min, permeabilized by incubation in 0.5% PBX (0.5% Triton X-100 in PBS) for 30 min at room temperature, followed by a quenching step in 0.1 M Glycine to reduce background autofluorescence. Sections were blocked in blocking buffer  for 1 hr at room temperature, and then incubated in primary antibodies for 36 hr at 4\u00b0C. Sections were washed in 0.05% PBX two times for 10 min at room temperature, and then incubated with secondary antibodies in 0.05% PBX with 10% normal goat serum at room temperature for 3 hr.Subsequently, the sections were washed three times with 0.05% PBX, incubated with Hoechst 33342 in 1\u00d7 PBS for 10 min, and then washed again three times in PBS, mounted on SuperFrost + slides with Aqua-Poly/Mount . A 40-\u00b5M Z-stack (with 0.25 \u00b5M z-step) was acquired on a Zeiss LSM 880 confocal microscope, with a Plan-Apochromatic 63\u00d7/1.4NA DIC M27 oil objective and FastAiryScan detector settings in the hippocampal CA1 region.2O) for 20 min. Primary antibody was diluted in GDB and incubated for 1 hr at room temperature, followed by five washes with PBS . Secondary antibody was diluted in GDB and incubated in the dark, at room temperature for 1 hr. The cells were then washed again with PBS . In the second last wash, Hoechst 33342 was added to the PBS. The coverslips were mounted with Aqua-Poly/Mount  on microscope slides .In vitro: cells were washed once with NBP, fixed for 20 min with 4%PFA and, after five washes with PBS , permeabilized with GDB (20 mM sodium phosphate buffer (pH 7.4), 450 mM NaCl, 0.3% Triton X-100, 0.1% gelatin, and ddHStatistical analysis was performed on either GraphPad Prism 8.0 or RStudio. Plots were generated in R, mainly using the packages ggplot2, ggsci, ggrepel, and scales. For data sets with n>4, Box plots (Tukey style) were used. For data sets with n<5, average\u00b1s.d., including individual data points, is shown. Normal distribution of data was tested with the Shapiro-Wilk test. Based on the results, parametric  or nonparametric (e.g. Mann-Whitney and Kolmogorov-Smirnov) tests were used.The detailed parameters  for the statistical assessment of the data are provided in the figure legends. The authors provide evidence for a role of the micro RNA \u2013 mi-138 \u2013 in synaptic inhibition and behavior in mice. They designed a novel transgenic model in which a miR-138 sponge is conditionally expressed to sequester endogenous miR-138 in a cell-type specific manner. Using this tool they show that sequestration of miR-138 in a major, parvalbumin-expressing inhibitory cell type results in enhanced inhibitory transmission, and deficits in memory. In the interests of transparency, eLife publishes the most substantive revision requests and the accompanying author responses.Review Commons.][Editors' note: this paper was reviewed by  Reviewer #1 ):Daswani et al. study the role of miR-138-5p, a microRNA the authors previously found to regulated excitatory synapse function, in mutant mice. To this end they overexpress a miR-138 sponge construct first ubiquitously and find that short term memory is impaired. Gene-expression analysis points to a specific role in inhibitory neurons, which the authors confirm by repeating key experiments in mutant mice in which the miR-138 sponge is expressed in PV-inhibitory neurons. This is a very interesting study that pioneers the analysis of microRNAs in a cell-type specific manner in the CNS. The following point represent helpful suggestion the authors could address before submission.- A question that may come up is related to the mutant mice the controls. One could argue that the better control would the transgenic mice expressing the \"control sponge\". At present the control group are mice that carry the construct but its not expressed, as far as I understood. The authors may want to address this issue upfront and discuss somewhere in the manuscript that their control animals are suitable.We agree with this reviewer that an independent line expressing a \u201ccontrol sponge\u201d construct might represent a \u201cgold standard\u201d control. However, we decided to take the current approach for two reasons: (1) considering the RRR principles of animal research, including an independent mouse line would have doubled the number of animals needed for experiments. (2) although a control sponge line addresses potential specificity issues of expressing a sponge transcript, it also has its own limitations since behavioural experiments cannot be done with littermates, which could also introduce variability. Nevertheless, we have rigorously validated the specificity of the miR-138 sponge construct by comparing it to a highly similar miR-138 control sponge construct in several assays: (i) miR-138 perfect binding site luciferase sensor assay ; (ii) dendritic spine size assay ; (iii) mIPSC electrophysiological recordings from hippocampal slices of intracerebrally injected mice ; (iv) short-term memory assay in intracerebrally injected mice ; (v) Erbb4 FISH in primary rat hippocampal neurons infected with Dlx-138-sponge . As suggested by this reviewer, we have discussed our approach in more detail in the revised manuscript .- Moreover, as far as I understand it, the sponge construct will be expressed from early developmental stages in all cells of the body in the initial experiment. While the authors later study specifically PV neurons, this may also represent early neurodevelopmental effects. It might be helpful for the reader to explain the approach and rational in more detail. want the specifically focus on the role of miR-138 in neurodevelopmental diseases  in which case the approach would make sense. However, I am not aware that miR-138 has been genetically linked yet to neurodevelopmental disease but I might have missed this. This could clarified specifically in the introduction.We agree with this reviewer that the phenotypes we observe might have an early developmental origin, at least in the ubiquitous sponge mouse line. However, as pointed out by reviewer 2, expression of PV doesn\u2019t kick in before the second postnatal week, arguing for a postnatal role of miR-138-5p in the PV-sponge model. Moreover, stereotactic injections of Dlx-138-sponge into the hippocampus  were performed in young adult mice, providing further support that perturbing miR-138-5p at adult stages impacts physiology and behaviour. Our findings are thus in line with a link to a disease like schizophrenia whose onset is either during adolescence (early-onset) or in adulthood (late-onset). In fact, miR-138 has been linked to cognitive functions, and a rare variant in the miR-138-2 gene has been associated with schizophrenia . We have now better clarified these links in the introduction and discussion of our revised manuscript. In addition, we have provided additional data showing a preferred deregulation of SCZ-associated genes in the miR-138 sponge model .- Figure 1B. To convincingly demonstrate the functionality of the construct in vivo it may help to assay the regulation of some confirmed targets at the mRNA/Protein level or point already here to the exp. later shown in Figure 2.Ub mice using Western blot . Unfortunately, we were unable to obtain conclusive Western blot results for Rims3 using several commercially available antibodies.We agree with this reviewer, that showing target gene regulation is imperical to confirm the functionality of the miR-138 loss-of-function approach. However, we want to stress that a number of experiments in this context were already included in our original manuscript. (1) Expression of the sponge in mice in vivo leads to a preferential upregulation of predicted miR-138 targets compared to non-targets , which provides strong evidence that expression of the construct leads to a specific loss-of-function of miR-138. (2) Validation by qPCR confirmed upregulation of PV-enriched genes at the RNA level, e.g. Rims3 and Erbb4. (3) In the revised manuscript, we further included protein data for Erbb4 upregulation in the hippocampus of miR-138-sponge- Supplemental Figure 1.: n=1 for pGL3 CTR may not be sufficient for statistical analysis. Panel (A) Please explain this assay in greater detail. What is measured here?In fact, this assay has been repeated 3 times. The lack of error bar in the control conditions is due to normalization. Statistical test could still be performed with a 1-sample t-test, which revealed a significant difference. The experiment measures the endogenous activity of miR-138 in hippocampal neurons (based on the extent of cleavage of the luciferase reporter).- Supplemental Fig1d: No scale bar. Why show a small section of the cerebellum when later hippocampus is analyzed? I suggest to show a selection of brain regions with high quality images.We agree and have now included a lacZ staining from the hippocampus in the revised manuscript .- Figure 1. The authors may want to consider that no effect in the contextual fear conditioning may not be sufficient to claim that specifically short-term memory is affected in mutant mice. A more thorough behavioral characterization may be necessary or it should be discussed why this is not necessary in the context of the current manuscript.In the revised manuscript, we have now further included CFC data from the PV-sponge mouse line , which also didn\u2019t reveal a significant genotype-dependent difference. That said, we fully agree that results from only one behavioural paradigm (CFC) are not sufficient to make general statements about the specific types of memories affected by miR-138 loss-of-function. However, since our laboratory is currently not set up to perform an extensive behavioural characterization of memory function using different tests, we consider such experiments beyond the scope of this revision. We therefore decided to tone down the statements in the manuscript related to short-term memory specificity accordingly.- Figure 2: please explain in more detail (in the methods) the statistics behind the diff. expression analysis.A more detailed statistical description has been included in the methods section of the revised manuscript .- Figure 2d. To further strengthen the idea that DEG are enriched in inhibitory neurons, corresponding viol plots across cell types may help. The authors could plot for example selected genes are the eigen-vector expression of DEGs.We agree with this reviewer that an alternative presentation of the DEG data could be helpful. We have therefore added another panel  illustrating the distribution of expression of the\u00a0sponge-upregulated-DEGs in the different cell types. In our view, this presentation is more easily interpretable compared to viol plots.- The selection of Erbb4 and Rims3 for further analysis could be explained better.Based on the available data, we have now decided to prioritize on Erbb4 regulation in the revised manuscript (Rims3 data was moved to the supplement). We have further provided a more detailed rationale for studying Erbb4 in the context of inhibitory synaptic transmission and short-term memory.- Figure 3B.Maybe show representative images.Representative pictures have now been included in the revised manuscript .- How about FC and other long-term memory assays in 138-spongePV\u00b4 mice?We have now additionally performed CFC in 138-sponge-PV mice, and found no significant difference in memory performance between 138-sponge and control mice . As outlined above, additional memory assays are beyond the scope of this study.- Please address the finding that behavior phenotypes are similar in 138-spongeub and 138-spongePV\u00b4 mice, while e-physiology differs (mini ipsc).Ub mice We assume that this is a misunderstanding, since we did not measure mIPSCs in pyramidal neurons of 138-sponge- I guess an obvious question could be to show the regulation of miR-138 target genes in PV neurons and /or study the transcriptome in PV-neurons as a result of sponge expression.We agree that assessing the transcriptome specifically of PV neurons would be a logical next step. However, this is technically rather challenging, either involving FACS sorting of PV-positive neurons or single-cell RNAseq approaches, both of which are currently not established in the laboratory. We therefore feel that such experiments, also considering the limited new insight that would be expected from them, are beyond the scope of this revision.- The discussion is comparatively short. The specific reference to miR-138 as a target for schizophrenia and ASD provokes the question of more detailed analysis, e.g behavioral phenotypes for ASD and schizophrenia in mutant mice or comparing the DEG to genes de-regulated in other mouse models for these diseases.We agree that making more functional connections to ASD/schizophrenia would be exciting. However, this would involve a battery of additional mouse behavioural experiments, which is in our view clearly beyond the scope of this revision. Concerning the second point, we have performed a comparison between DEGs deregulated in the miR138 sponge model and a previous study about schizophrenia . Excitingly, we found that the genes upregulated in the 138-sponge (at FDR<0.05) are significantly enriched for genes found upregulated in the brain of SCZ patients , which provides additional correlative evidence for an involvement of miR-138 in SCZ. Moreover, we have elaborated more on the role of miR-138 in cognition and SCZ in the discussion .- Given that the literature suggests of role for miR-138 also excitatory neurons, the phenotypes should be discussed in more detail. Why are mainly genes in inhibitory neurons affected in 138-spongeub mice?Based on our new results from a cell-type specific miR-138 sensor assay  we speculate that the reason for the preferential regulation in inhibitory neurons is the more efficient miR-138 inhibition in this cell type. This is now discussed in more detail . Please see also our comments to the other reviewers regarding this topic.Reviewer #1 (Significance (Required)): Generally this study addresses the cell-type specific role of microRNAs in the CNS, which is important to still innovative.The finding that miR-138 controls specific functions in inhibitory neurons and that this is linkned to behavioral alterations is novelThe data will be mainly intersting for the neuroscientific communityReviewer #2 ):Understanding the role of miRNAs in different neuronal cell types remains a paramount goal in neuroscience. Using a conditional miR-138 sponge transgenic line, Daswani and colleagues demonstrate that miR-138 in parvalbumin+ (PV) GABAergic neurons is necessary for short-term memory. Further, they identify a possible cellular mechanism underlying this behavioral deficit: CA1 pyramidal neurons receive more inhibition from neighboring PVs. This work is timely, impactful, and an important contribution to the field. However, there are important aspects that needs to be addressed before publication:Major:It is surprising that the miR-138 sponge has no effect in pyramidal neurons. The authors' laboratory has published beautiful work showing that miR-138 has important roles for synaptogenesis in this cell type. The authors hypothesize that the expression levels of the miR-138 sponge might not be high enough for pyramidal neurons (where miR-138 is highly expressed) and instead it is sufficient for PVs. However, sensor data in Figure 1b and spines data in Sup Figure 1c are from pyramidal neurons. For the miR-138 sponge to be credible, the authors must demonstrate that, as they claim, the sponge is effectively working in PVs and only partially in pyramidal neurons. This could be achieved by showing that miR-138 is expressed at different levels in the two cell types: (i) analysis of miR-138 expression levels from He et al. (2012) in different cell types; (ii) FACS of PVs and pyramidal neurons and assessing miR-138 levels; (iii) quantifying miRNA FISH in different cell types. In addition, the authors should demonstrate that the miR-138 has different levels of efficacy in the two cell types, i.e. analyzing sensor data in PNs vs PVs . If the results from this further analysis don't support the original hypothesis, the authors must find a plausible reason and validate it.Ub sponge mice.We fully agree with this reviewer that the absence of phenotype in pyramidal neurons is surprising and that we do not have a full explanation for this yet. To further test our hypothesis of an incomplete miR-138 inhibition in excitatory pyramidal neurons of the miR-138 sponge line, we have now performed a series of new experiments, largely following the suggestions made by this reviewer: (i) we monitored miR-138 expression from a published small RNA-seq study  . (Ii) we quantified miR-138 signal in already existing smFISH datasets from hippocampal neurons containing PNs and PVs . (Iii) we quantified mir-138 sensor activity in PNs and PVs in hippocampal slices stained for PN and PV markers . Altogether, this analysis suggests that while miR-138 is expressed to a similar level in PNs and PVs, its activity is markedly higher in PVs and more robustly inhibited in PVs by expression of a miR-138 sponge. Although the mechanistical underpinnings are unknown, these observations might explain why we preferentially observed miR-138-5p dependent regulation of interneuron-enriched genes in miR-138Minor:The sensor data are somewhat confusing. It would benefit to add schemes of the sensor and sponge constructs and to represent the data in Figure 1b with a bar graph. To further support the claims of incomplete effects of the miR-138 sponge, the authors should have a mutated MRE sensor (maximum de-repression) and express the effect of the sponge in different cell types as percentage of maximum de-repression. Please also add text explaining the sensor experiments in more detail so that the non-specialist can follow.As suggested by this reviewer, we have now added a scheme of the sensor and presented the data in Figure 1b as a bar graph. In addition, we have performed the sensor analysis separately for PNs and PVs . This analysis clearly shows that the degree of inhibition exerted by the 138-sponge is more pronounced in PV+ interneurons compared to PV- neurons, thereby supporting our model that transgenic expression of the miR-138 sponge preferentially de-represses miR-138-5p target genes in interneurons.The choice of PV-Cre is interesting. PV-Cre does not kick in until the second postnatal week, it is notoriously not a very efficient Cre line, and although it correlates well in the cortex with basket cells, it turns on also in cerebellar purkinje cells and in the peripheral nervous system. Some of these limitations should be discussed, considering that behavior is used as readout.The point about ectopic expression of PV-Cre in PV- cells in cerebellar purkinje cells and the peripheral nervous system is well taken. We therefore decided to perform a complementary approach where we delivered 138-sponge and control-sponge specifically to hippocampal interneurons by stereotactic injection of a rAAV-Dlx5/6 construct . Intriguingly, the miR-138-sponge associated behavioural and electrophysiological phenotypes were fully recapitulated by this approach. Together with our detailed electrophysiological characterization of hippocampal PV+ interneurons in paired recordings , we are confident that hippocampal PV dysfunction contributes in an important way to the observed phenotypes.The authors should remove emphasis from E/I. The physiology experiments performed don't assess E/I but E and I in isolation. It is the opinion of this reviewer that the work is impactful because it reveals novel miRNA mechanisms in GABAergic cells, no need to claiming anything else.We agree that our claims about E/I are currently overstated, and have now toned down the respective statements in the revised manuscript (e.g. by removing emphasis from E/I in the introduction).Sup Figure 1c. Should the y axes say something like Spines Density?We have added the y-axes label as suggested.Sup Figure 1d. Why did the authors choose the cerebellum to show CMV-Cre efficacy? The rest of the paper focuses on the hippocampus.We have now provided a new lacZ staining from the hippocampus to illustrate efficient Cre-mediated recombination in this region .In the introduction, the Tan et al. paper from the Schaefer lab should be mentioned, considering that miR-128 was knocked out in GABAergic cells (MSNs).We thank the reviewer for this reminder and have now referenced this paper in the introduction.Reviewer #2 (Significance (Required)): Identifying cell type-specific roles of miRNAs has eluded the field, specifically in the case of rare cell types, i.e GABAergic interneurons. The paper from Daswani and colleagues is an important step forward in this direction. Somewhat serendipitously, the authors have found that miR-138 targets preferentially genes enriched in GABAergic interneurons. Indeed, PV-specific knockout of miR-138 recapitulates behavioral deficits induced by global miR-138 knockout. The only similar contributions are well referenced in the introduction: (i) Tuncdemir et al. (Fishell lab) performed MGE-specific Dicer knockout and found defects in GABAergic interneuron survival, migration, and lamination; (ii) Qiu et al. (Miao He lab) showed that Dicer ko in VIP cells induces long-term dysfunction in GABAergic interneuron computations and survival.This manuscript should be of interest to both the miRNA field and the synaptic plasticity, learning and memory fields.I am a neurobiologist that studies the roles of miRNAs in instructing network formation.Reviewer #3 ):Daswani et al. report an interesting role for miR-138-5p in the control of short-term memory and inhibitory synaptic transmission. They notably built on an elegant transgenic model in which a miR-138 sponge is conditionally expressed using the Cre-Lox system and allows the sequestering of endogenous miR-138 in a cell-type specific manner. Using this model, the authors provide evidence that miR-138-5p expressed in parvalbumin-expressing neurons controls short-term memory as well as inhibitory synaptic input onto CA1 pyramidal neurons. Using RNAseq and qrtPCR, they identify presynaptic genes whose expression is regulated by miR-138 and possibly accounting for inhibitory synaptic alterations. Overall, the experiments are well conducted. The data are interesting, solid and logically presented and the methods are sufficiently described. However, there are some concerns that should be considered prior publication:Major concerns:(1) In the abstract, the authors' claim that \"miR-138-5p regulates the expression of presynaptic genes in hippocampal parvalbumin-expressing inhibitory interneurons to control short-term memory\" is overstated. Indeed, while the authors provide compelling evidence that miR-138 sponge controls short-term memory, the causal evidence to demonstrate that this is going through the regulation of presynaptic genes expression is missing. Moreover, because they are using a transgenic model in which the 138-sponge is constitutively expressed in any cell types and brain areas, the short-term memory deficits found by the authors are not necessarily resulting from hippocampal synaptic alterations. Therefore, the authors should either tone down this claim or perform additional experiments to support their model (see points 3 and 4).We largely agree with these statements and specifically address them under points 3 and 4.(2) While the authors provide convincing data demonstrating the efficiency of the miR-138 sponge both in cultured neurons and in vivo using sensor constructs and luciferase assays, the only evidence that the 138-sponge specifically inhibits miR-138 is by using a control sponge in cultured neurons and by measuring luciferase activity from sensors or spine size. To better support the specificity of the 138-sponge, it is important to demonstrate the absence of effect of the control sponge on inhibitory synaptic transmission, at least in cultured neurons.As suggested by this reviewer, we have now performed additional experiments to support the specificity of the 138-sponge in interneurons. Therefore, we generated rAAV expressing 138-sponge selectively in interneurons due to the presence of a Dlx5/6 promoter (Dlx-138-sponge). (i) expression of Dlx-138-sponge, but not Dlx-control-sponge, elevated Erbb4 expression in rat hippocampal interneurons in culture as assessed by smFISH ; (ii) stereotactic injection into the adult mouse hippocampus of Dlx-138-sponge, but not Dlx-control-sponge, impairs short-term memory  and inhibitory synaptic transmission in pyramidal neurons .Moreover, it would be reassuring to see that not all miRNAs are regulated by miR-138 (for instance by using sensors for distinct miRNAs).A priori, one cannot rule out that miR-138 inactivation indirectly regulates the expression and/or activity of other miRNAs, for example by regulating targets which control miRNA biogenesis. Therefore, the proposed sensor experiments for selected miRNA candidates are in our view not suitable to unequivocally judge the specificity of the miR-138 sponge approach. Moreover, such experiments would have required the stereotactic injection of at least two additional cohorts of mice, which was not covered by our currently approved animal experimentation license. Finally, only a low number of miRNAs could be screened with such an in vivo approach, making general conclusions difficult. By weighing all these arguments, we decided not to perform sensor experiments for additional miRNAs and instead added further experiments which support the specificity of the 138-sponge approach (see above).(3) The authors propose that miR-138 expression in the hippocampus regulates short-term memory. Although there is evidence from previous studies that hippocampal PV+ interneurons are involved in short-term memory, the data do not directly address this point. Specific involvement of miR-138 in hippocampal PV+ interneurons could be easily tested through stereotaxic injections of rAAVs carrying PV-Cre in 138-floxed mice in order to drive the expression of miR-138 sponge selectively in CA1 hippocampal interneurons.Ub and 138-spongePV mice. We did not pursue the PV-Cre injections into 138-floxed mice, since viral expression of PV-Cre (as opposed to transgenic expression in PV-Cre mice) apparently is not very specific and therefore not frequently used .We agree that the data presented in the original manuscript didn\u2019t provide direct evidence for a role of the hippocampus in miR-138-dependent regulation of short-term memory. Therefore, we now inactivated miR-138-5p specifically in hippocampal interneurons by stereotactic injection of a Dlx-138-sponge rAAV construct . This led to a similar impairment in both short-term memory  and inhibitory synaptic transmission  as observed in 138-sponge(4) Although not required for the paper as it is, experiments addressing the causal link between (1) the miR-138-dependent regulation of ErbB4 and/or RimS3 in CA1 interneurons and (2) the role of miR-138 in inhibitory synaptic transmission and/or short-term memory would considerably strengthen the model proposed. To address that, the authors could alter the expression/function of the candidate genes in their transgenic model. Alternatively, strategies could be used to selectively protect putative target from the action of miR-138-5p .Addressing the molecular mechanism underlying impaired short-term memory and inhibitory transmission is clearly the next step in this project, but beyond the scope of the current manuscript, as also pointed out by this reviewer.(5) Description of statistics require clarifications: - n should be clearly defined in all figure legends .- The authors should indicate whether and how they tested for normal distribution of their data.\u2014figure supplement Figure 1a-c and Suppl. Figure 3a : a non-parametric test should be used to compare the different conditions, considering the too low n number which does not allow to conclude on a normal distribution.We have now addressed these statistical issues in the revised manuscript. (i) we have now clearly defined n in all figure legends. (ii) normal distribution of the data was tested with the Shapiro-Wilk test in GraphPad (stated in the Methods section). When normal distribution was not observed, non-parametric tests were used . (iii) we agree with this reviewer that the n for the indicated experiments is too low to conclude on a normal distribution with a common test. However, visual inspection of the data suggested normal distribution for luciferase assays presented in Suppl. Figure 1a-c, considering our long-term experience with these assays. We therefore did not see the necessity to use non-parametric tests in this case. Concerning the PV+ cell density count , we now applied the Mann-Whitney test.Minor issues: (1) The fact that excitatory synapses onto pyramidal neurons are unaffected in 138-sponge mice is puzzling when considering the previous study from the same authors  as well as the results obtained in cultured neurons to validate the sponge . While the authors propose that 'the absence of changes in excitatory synaptic transmission in the hippocampus of 138-sponge-ub mice might be due to ineffective silencing of the highly abundant miR-138-5p in pyramidal neurons' they could actually refine their analysis to give support this hypothesis:- By quantifying the signal from single-molecule FISH for miR-138 in Camk2a+ neurons versus Erbb4+ neurons . In the images shown, it is not evident that excitatory neurons express more miR-138 in comparison to inhibitory ones.- By quantifying the degree of inhibition of miR-138 in pyramidal neurons versus interneurons using the dual sensor system . In Figure 1b, the authors do not discriminate between cell types. A lack of increase of the GFP signal in pyramidal cells may indicate an inability of those cells to express the sponge.- By checking whether APT1, a known miR-138 target that they previously identified in excitatory neurons  is also a regulated gene in 138-sponge mice. If APT1 expression remains unchanged, this could give support to the fact that the sponge is indeed ineffective in excitatory neurons.We agree with the comments made by this reviewer, which are also in agreement with those from reviewer 2 . Concerning the last point of reviewer 3, we now checked the expression APT1 (new nomenclature LYPLA1), as well as two other validated miR-138 targets from excitatory neurons  in our RNA-seq data. None of these targets was differentially expressed . Together, this data supports our hypothesis that miR-138 is not effectively inhibited by the sponge transgene in PNs.(2) The analysis of VGAT signal intensity in individual PV+ boutons may provide useful information about the content in vesicles per bouton. One could expect a higher VGAT intensity/bouton in 138-sponge mice, correlated with an increase number of release sites per bouton (as proposed by the authors) or a similar trend as for increased success rate or decreased PPR.PV and control mice, suggesting that the gross morphology of inhibitory release sites is unchanged. Further ultrastructural investigation of synaptic release sites will require super-resolution microscopy, which is currently not established in the laboratory and therefore beyond the scope of this revision.We agree that the analysis of VGAT signal intensity might provide additional information regarding the observed inhibitory synapse phenotype and therefore performed the respective analysis . However, this didn\u2019t reveal any significant differences between miR-138-sponge(3) For the following data, titles of the graph axis are not accurate and the authors should indicate more precisely what are the exact parameters measured: Figure 1b, Suppl. Figure 1a, Suppl. Figure 1c, Suppl. Figure 3b.We have fixed these issues in the revised manuscript.(4) Figure 3j: \"Coefficient of variance\" should be corrected for \"coefficient of variation\".We have changed this expression accordingly.(5) Results \u2013 L70: the use of the miR-138 sponge is critical for the key findings of the study. It is therefore important to detail within the text how the specificity and the efficiency of the sponge were tested.Please refer to our comments for reviewer 1 and 2 regarding miR-138 sponge validation in vitro and in vivo. In addition, we have provided more discussion of the sponge strategy in the text .(6) Results \u2013 L75: the authors should introduce briefly how the dual sensor works and why an increase of the GFP signals indicate efficient sequestering of endogenous miR-138.We have now explained the sensor strategy in more detail in the Results section  and in addition provided a schematic (7) Supplementary figure 1d: to illustrate the 'penetrant expression' of the sponge, the authors should provide an image representative of the hippocampus not the cerebellum.We have now provided a representative picture of the hippocampus .(8) Suppl. Figure 1g and Suppl. Figure 3B: the use of a single two-way ANOVA test with a single P value is not clear to me as two different parameters are measured (distance and time).We apologize for the confusion. The two parameters have now been plotted as individual panels  and separately analyzed with heteroscedastic t-tests.(9) Suppl. Figure 1i,j and suppl. Figure 3d: the authors should mention whether a statistical test was used to compare the two conditions. n values (cells) should be indicated.The respective figures correspond to bar graphs in the main manuscript , for which a statistical test was provided. However, we now also provided a statistical assessment of the cumulative graphs (using KS-test) in the revised manuscript.Reviewer #3 (Significance (Required)): This study provides important findings that will be of interest for a large audience of neuroscientists interested in synaptic physiology and pathologies:(1) The authors developed an elegant transgenic model allowing to address the role of miR-138 in a cell specific manner and which allows to correlate synaptic alterations to the behavior.(2) While the majority of studies have investigated the role of miRNAs at excitatory synapses, this study provides important insight about the role of one identified miRNA, miR-138, at inhibitory synapses. Interestingly, because miR-138 was also shown to regulate excitatory synapses, the data suggest a central role of miR-138 in regulating E-I balance in hippocampal circuits.(3) The study further shows that alterations in inhibitory synaptic transmission resulting from miR-138 inhibition are correlated with deficits in working memory. Because miR-138 as well as its targets are associated with cognitive deficits and neuropsychiatric disorders such as autism and schizophrenia , this study thus suggests a critical role of miR-138 in disorders with altered E/I balance.I have expertise in the role of microRNAs in synaptic development and plasticity. While I have little expertise regarding behavioral investigations in general, I feel that the behavioral data shown in the present paper are easily accessible and straightforward."]}
-{"representative": "Cell membrane fusion and multinucleation in macrophages are associated with physiologic homeostasis as well as disease. Osteoclasts are multinucleated macrophages that resorb bone through increased metabolic activity resulting from cell fusion. Fusion of macrophages also generates multinucleated giant cells (MGCs) in white adipose tissue (WAT) of obese individuals. For years, our knowledge of MGCs in WAT has been limited to their description as part of crown-like structures (CLS) surrounding damaged adipocytes. However, recent evidence indicates that these cells can phagocytose oversized lipid remnants, suggesting that, as in osteoclasts, cell fusion and multinucleation are required for specialized catabolic functions. We thus reason that WAT MGCs can be viewed as functionally analogous to osteoclasts and refer to them in this article as adipoclasts. We first review current knowledge on adipoclasts and their described functions. In view of recent advances in single cell genomics, we describe WAT macrophages from a \u2018fusion perspective\u2019 and speculate on the ontogeny of adipoclasts. Specifically, we highlight the role of CD9 and TREM2, two plasma membrane markers of lipid-associated macrophages in WAT, which have been previously described as regulators of fusion and multinucleation in osteoclasts and MGCs. Finally, we consider whether strategies aiming to target WAT macrophages can be more selectively directed against adipoclasts. Mycobacterium tuberculosis) or foreign materials. MGCs are derived from monocyte progenitors [Macrophages have a unique potential to fuse with themselves to form multinucleated giant cells (MGCs) . During genitors  but theigenitors , an obsegenitors . These oThe adipose tissue contains macrophages and during obesity, their number increases significantly  to correlate with metabolic dysfunction characterized by inflammation, fibrosis and insulin resistance \u201311. TheiThere is an intriguing association between lipids and macrophage fusion. Cholesterol-rich MGCs have been reported as a frequent and non-specific histological feature in lung biopsies . HistoriWe first describe the current knowledge on CLS and their proposed function. We then review recent advances in WAT single cell transcriptomics, with a specific focus on TREM2 and CD9, membrane receptors that have been previously described in macrophage fusion and multinucleation. We highlight the respective roles of TREM2 and CD9 in osteoclasts, in order to speculate on the adipoclasts\u2019 origin and function. Finally, we discuss whether recent macrophage-targeting therapies in the fat may be beneficial or fine-tuned in targeting adipoclasts in obesity. The review does not cover the polarization of macrophages in adipose tissue nor the significance of WAT inflammation in insulin resistance and metabolic disorders in general\u2014an area that is amply covered by excellent reviews ob/ob) [The infiltration of immune cells in the obese adipose tissue was shown in the 1960s , 25 and ob/ob) , 28. Froob/ob) , surrounob/ob) , 28. Todob/ob)  and the ob/ob) . A bead ob/ob) . Interesob/ob)  and thisob/ob) .In summary, while it is well-accepted that adipoclasts are specialized in efferocytosis of damaged adipocytes, many questions remain regarding the mechanisms underlying this process, as well as the other advantages that cell fusion and multinucleation may confer in the context of prolonged obesity. Furthermore, given the presence of mononucleated, often foamy macrophages in WAT, it is necessary to consider more trophic functions and crosstalk between macrophages and adipocytes  includinDuring prolonged obesity, adipose tissue remodelling is a well-described phenomenon that consists in depot-dependent adipocyte death associated with macrophage infiltration , 34. OurHence adipoclasts have been linked to adipocytes in different cellular states that describe broadly cellular stress and ultimately death. This raises the question of whether adipoclasts can \u2018sense\u2019 a particular adipocyte state and whether their fusion from mononuclear macrophages is triggered through adipocyte-derived markers of stress. For instance, using a co-culture setup, it was shown that adipocyte death triggers MGC formation in vitro . FurtherWhile it is accepted that obesity is associated with a shift toward pro-inflammatory macrophage function \u201347, WAT None of the single cell RNA-seq studies in the WAT distinguished multinucleated macrophages (i.e. adipoclasts) from other macrophage subsets. Although technically challenging, this could have been attempted by sorting LAMs with > 2 nuclei. The advantage of such an approach would have been the identification of potential precursors of adipoclasts, in order to make a distinction between \u2018fusion-competent\u2019 LAMs and adipoclasts, as well as the polarization state of each cell type. Nevertheless, the recent single cell transcriptomic approaches in human WAT suggest that adipoclasts and/or adipoclast precursors express TREM2 and CD9 \u201354.The existence of CD9+ and TREM2+ adipoclasts is worth highlighting from a macrophage fusion perspective, especially given the relevance of these two membrane proteins in osteoclast and MGC fusion and multinucleation.TREM2 (the triggering receptor expressed on myeloid cells 2) is essential for macrophage multinucleation as part of a signalling pathway that includes DAP12 and Syk [TREM2 are causally associated with Nasu\u2013Hakola disease, a dementia associated with bone cystic lesions [TREM2 and DAP12 induce defective multinucleation in osteoclasts, resulting in impaired bone resorption [Trem2 is a trans-acting genetic regulator of a macrophage multinucleation gene co-expression network [Besides its widely studied role in microglial phagocytosis  and neur and Syk . TREM2 r and Syk \u201361 and a and Syk . Further lesions , 64. Impsorption . Trem2 i network , 66, whi network  and the  network , 68.Trem2 [ApoE) is a Trem2 ligand [Trem2 and ApoE are expressed by a subpopulation of tumour-associated macrophages [Trem2 in this process is yet to be found. The lipid sensing role of TREM2 has been shown as part of the microglia response [Ldlr-/-) mice identified macrophages with high Trem2 expression, specialized in lipid metabolism/catabolism and enriched in the osteoclast gene signature [Trem2 expressing macrophages accumulate lipids and become fusogenic, giving rise to adipoclast precursors and adipoclasts. Fusion and multinucleation could be considered as the final differentiation step of these precursors. However, the exact Trem2-dependent and lipid-related mechanisms allowing the transition from fusion-competent adipoclast precursors to adipoclasts remain to be identified, and in that sense, some parallels drawn from knowledge on osteoclast lipid metabolism may be of relevance. Cholesterol is indispensable for membrane fusion and osteoclast v-ATPase activity [Ldlr-/- mice have defective osteoclast fusion [Jaitin et al. identified TREM2, not only as a marker, but also as a driver of the LAM cell molecular program as lipid uptake and storage were abrogated in the absence of Trem2 . Interes2 ligand , 70 and rophages . Macrophrophages , but a presponse  but alsoresponse . This raresponse . Interesignature . If one activity , 77 and t fusion . Since ot fusion , adipoclt fusion  and palmt fusion . On the t fusion . This sut fusion . As the t fusion  can be aTetraspanins are a superfamily of membrane proteins, and among them, CD9 and CD81 are closely related and known to control cell\u2013cell fusion as they negatively regulate fusion of osteoclasts and MGCs , 86. The+CD9+ adipoclasts or adipoclasts precursors seems to correlate with WAT inflammation and the severity of obesity-related pathologies , repres and CD9 .Fig. 2T+/K+-ATPase blockers such as ouabain [To date, it is well-accepted that obesity triggers the recruitment of monocytes into adipose tissue to promote inflammation, which itself may cause ectopic fat deposition in the liver and insulin resistance , 100. Th ouabain . A recen ouabain .Csf1r in rats and Trib1 in mice reduces adipose tissue mass [Trem2-/- and Marco-/- LAMs lose their efficacy in lipid buffering [Trem2) should be taken into consideration as it may influence metabolic health [When considering macrophage-targeted treatments in adipose tissue, it is crucial to keep in mind the heterogeneity and master regulatory role of macrophages in the development and homeostatic function of adipose tissue. It has become evident that macrophages express organ-specific genes in addition to canonical macrophage genes, a phenomenon referred to as niche-specific programming , 117. Thsue mass , 123, whuffering , 124. Ofuffering , 126 whic health . AltogetBased on current knowledge, adipoclasts are likely to form when relatively high numbers of macrophages infiltrate the adipose tissue due to prolonged obesity. It is still not clear whether adipoclasts are only homokaryons or whether they can also form by fusion of mononucleated macrophages and adipocytes. Here we argue that inhibiting adipoclast formation may improve insulin sensitivity. Rather than global approaches aiming to target adipose tissue macrophages, one can envisage inhibition of adipoclast formation. However, such therapies require a better understanding of adipoclast formation and the identification of novel markers that differentiate mononucleated precursors from multinucleated fused cells. Integrating transcriptomic, epigenetic and metabolic events that accompany cell fusion and multinucleation in the WAT will fine-tune cell-based therapies in obesity and metabolic syndrome.", "texts": ["Cell membrane fusion and multinucleation in macrophages are associated with physiologic homeostasis as well as disease. Osteoclasts are multinucleated macrophages that resorb bone through increased metabolic activity resulting from cell fusion. Fusion of macrophages also generates multinucleated giant cells (MGCs) in white adipose tissue (WAT) of obese individuals. For years, our knowledge of MGCs in WAT has been limited to their description as part of crown-like structures (CLS) surrounding damaged adipocytes. However, recent evidence indicates that these cells can phagocytose oversized lipid remnants, suggesting that, as in osteoclasts, cell fusion and multinucleation are required for specialized catabolic functions. We thus reason that WAT MGCs can be viewed as functionally analogous to osteoclasts and refer to them in this article as adipoclasts. We first review current knowledge on adipoclasts and their described functions. In view of recent advances in single cell genomics, we describe WAT macrophages from a \u2018fusion perspective\u2019 and speculate on the ontogeny of adipoclasts. Specifically, we highlight the role of CD9 and TREM2, two plasma membrane markers of lipid-associated macrophages in WAT, which have been previously described as regulators of fusion and multinucleation in osteoclasts and MGCs. Finally, we consider whether strategies aiming to target WAT macrophages can be more selectively directed against adipoclasts. Mycobacterium tuberculosis) or foreign materials. MGCs are derived from monocyte progenitors [Macrophages have a unique potential to fuse with themselves to form multinucleated giant cells (MGCs) . During genitors  but theigenitors , an obsegenitors . These oThe adipose tissue contains macrophages and during obesity, their number increases significantly  to correlate with metabolic dysfunction characterized by inflammation, fibrosis and insulin resistance \u201311. TheiThere is an intriguing association between lipids and macrophage fusion. Cholesterol-rich MGCs have been reported as a frequent and non-specific histological feature in lung biopsies . HistoriWe first describe the current knowledge on CLS and their proposed function. We then review recent advances in WAT single cell transcriptomics, with a specific focus on TREM2 and CD9, membrane receptors that have been previously described in macrophage fusion and multinucleation. We highlight the respective roles of TREM2 and CD9 in osteoclasts, in order to speculate on the adipoclasts\u2019 origin and function. Finally, we discuss whether recent macrophage-targeting therapies in the fat may be beneficial or fine-tuned in targeting adipoclasts in obesity. The review does not cover the polarization of macrophages in adipose tissue nor the significance of WAT inflammation in insulin resistance and metabolic disorders in general\u2014an area that is amply covered by excellent reviews ob/ob) [The infiltration of immune cells in the obese adipose tissue was shown in the 1960s , 25 and ob/ob) , 28. Froob/ob) , surrounob/ob) , 28. Todob/ob)  and the ob/ob) . A bead ob/ob) . Interesob/ob)  and thisob/ob) .In summary, while it is well-accepted that adipoclasts are specialized in efferocytosis of damaged adipocytes, many questions remain regarding the mechanisms underlying this process, as well as the other advantages that cell fusion and multinucleation may confer in the context of prolonged obesity. Furthermore, given the presence of mononucleated, often foamy macrophages in WAT, it is necessary to consider more trophic functions and crosstalk between macrophages and adipocytes  includinDuring prolonged obesity, adipose tissue remodelling is a well-described phenomenon that consists in depot-dependent adipocyte death associated with macrophage infiltration , 34. OurHence adipoclasts have been linked to adipocytes in different cellular states that describe broadly cellular stress and ultimately death. This raises the question of whether adipoclasts can \u2018sense\u2019 a particular adipocyte state and whether their fusion from mononuclear macrophages is triggered through adipocyte-derived markers of stress. For instance, using a co-culture setup, it was shown that adipocyte death triggers MGC formation in vitro . FurtherWhile it is accepted that obesity is associated with a shift toward pro-inflammatory macrophage function \u201347, WAT None of the single cell RNA-seq studies in the WAT distinguished multinucleated macrophages (i.e. adipoclasts) from other macrophage subsets. Although technically challenging, this could have been attempted by sorting LAMs with > 2 nuclei. The advantage of such an approach would have been the identification of potential precursors of adipoclasts, in order to make a distinction between \u2018fusion-competent\u2019 LAMs and adipoclasts, as well as the polarization state of each cell type. Nevertheless, the recent single cell transcriptomic approaches in human WAT suggest that adipoclasts and/or adipoclast precursors express TREM2 and CD9 \u201354.The existence of CD9+ and TREM2+ adipoclasts is worth highlighting from a macrophage fusion perspective, especially given the relevance of these two membrane proteins in osteoclast and MGC fusion and multinucleation.TREM2 (the triggering receptor expressed on myeloid cells 2) is essential for macrophage multinucleation as part of a signalling pathway that includes DAP12 and Syk [TREM2 are causally associated with Nasu\u2013Hakola disease, a dementia associated with bone cystic lesions [TREM2 and DAP12 induce defective multinucleation in osteoclasts, resulting in impaired bone resorption [Trem2 is a trans-acting genetic regulator of a macrophage multinucleation gene co-expression network [Besides its widely studied role in microglial phagocytosis  and neur and Syk . TREM2 r and Syk \u201361 and a and Syk . Further lesions , 64. Impsorption . Trem2 i network , 66, whi network  and the  network , 68.Trem2 [ApoE) is a Trem2 ligand [Trem2 and ApoE are expressed by a subpopulation of tumour-associated macrophages [Trem2 in this process is yet to be found. The lipid sensing role of TREM2 has been shown as part of the microglia response [Ldlr-/-) mice identified macrophages with high Trem2 expression, specialized in lipid metabolism/catabolism and enriched in the osteoclast gene signature [Trem2 expressing macrophages accumulate lipids and become fusogenic, giving rise to adipoclast precursors and adipoclasts. Fusion and multinucleation could be considered as the final differentiation step of these precursors. However, the exact Trem2-dependent and lipid-related mechanisms allowing the transition from fusion-competent adipoclast precursors to adipoclasts remain to be identified, and in that sense, some parallels drawn from knowledge on osteoclast lipid metabolism may be of relevance. Cholesterol is indispensable for membrane fusion and osteoclast v-ATPase activity [Ldlr-/- mice have defective osteoclast fusion [Jaitin et al. identified TREM2, not only as a marker, but also as a driver of the LAM cell molecular program as lipid uptake and storage were abrogated in the absence of Trem2 . Interes2 ligand , 70 and rophages . Macrophrophages , but a presponse  but alsoresponse . This raresponse . Interesignature . If one activity , 77 and t fusion . Since ot fusion , adipoclt fusion  and palmt fusion . On the t fusion . This sut fusion . As the t fusion  can be aTetraspanins are a superfamily of membrane proteins, and among them, CD9 and CD81 are closely related and known to control cell\u2013cell fusion as they negatively regulate fusion of osteoclasts and MGCs , 86. The+CD9+ adipoclasts or adipoclasts precursors seems to correlate with WAT inflammation and the severity of obesity-related pathologies , repres and CD9 .Fig. 2T+/K+-ATPase blockers such as ouabain [To date, it is well-accepted that obesity triggers the recruitment of monocytes into adipose tissue to promote inflammation, which itself may cause ectopic fat deposition in the liver and insulin resistance , 100. Th ouabain . A recen ouabain .Csf1r in rats and Trib1 in mice reduces adipose tissue mass [Trem2-/- and Marco-/- LAMs lose their efficacy in lipid buffering [Trem2) should be taken into consideration as it may influence metabolic health [When considering macrophage-targeted treatments in adipose tissue, it is crucial to keep in mind the heterogeneity and master regulatory role of macrophages in the development and homeostatic function of adipose tissue. It has become evident that macrophages express organ-specific genes in addition to canonical macrophage genes, a phenomenon referred to as niche-specific programming , 117. Thsue mass , 123, whuffering , 124. Ofuffering , 126 whic health . AltogetBased on current knowledge, adipoclasts are likely to form when relatively high numbers of macrophages infiltrate the adipose tissue due to prolonged obesity. It is still not clear whether adipoclasts are only homokaryons or whether they can also form by fusion of mononucleated macrophages and adipocytes. Here we argue that inhibiting adipoclast formation may improve insulin sensitivity. Rather than global approaches aiming to target adipose tissue macrophages, one can envisage inhibition of adipoclast formation. However, such therapies require a better understanding of adipoclast formation and the identification of novel markers that differentiate mononucleated precursors from multinucleated fused cells. Integrating transcriptomic, epigenetic and metabolic events that accompany cell fusion and multinucleation in the WAT will fine-tune cell-based therapies in obesity and metabolic syndrome."]}
-{"representative": "We propose probabilistic spike propagation, an approach to optimize rate-coded SNNs by interpreting synaptic weights as probabilities, and utilizing these probabilities to regulate spike propagation. The approach results in 2.4\u20133.69\u00d7 reduction in spikes propagated, leading to reduced time and energy consumption. We propose Probabilistic Spiking Neural Network Application Processor (P-SNNAP), a specialized SNN accelerator with support for probabilistic spike propagation. Our evaluations across a suite of benchmark SNNs demonstrate that probabilistic spike propagation results in 1.39\u20132\u00d7 energy reduction with simultaneous speedups of 1.16\u20131.62\u00d7 compared to the traditional model of SNN evaluation.Spiking neural networks (SNNs) have gained considerable attention in recent years due to their ability to model temporal event streams, be trained using unsupervised learning rules, and be realized on low-power event-driven hardware. Notwithstanding the intrinsic desirable attributes of SNNs, there is a need to further optimize their computational efficiency to enable their deployment in highly resource-constrained systems. The complexity of evaluating an SNN is strongly correlated to the spiking activity in the network, and can be measured in terms of a fundamental unit of computation,  Spiking Neural Networks (SNNs), often referred to as the third generation of neural networks Maass, , are attSNNs represent information as discrete spike events and follow an event-driven model of computation, where the work done  is proportional to the number of spike events. Further, they do not require multiplication to be performed when processing a spike, offering the prospect of reduced hardware complexity compared to conventional Artificial Neural Networks (ANNs). Due to these differences, SNNs are not well-suited to commodity hardware platforms like graphics processing units (GPUs). Further, in contrast to hardware accelerators for ANNs, which usually focus on exploiting regular data parallelism, hardware architectures for spiking networks  spike injection, (b) spike generation, and (c) spike propagation, as illustrated in A more detailed description of SNN evaluation is presented in vm is fetched and the bias is added to it (line 10). Next, it is checked for firing by comparing it with the threshold voltage vth (line 11). In case of firing, the neuron ID is pushed into a spike queue (line 12), and the membrane potential is reset and written back to the memory (line 13). If every neuron in the network is evaluated at every timestep, the above process will involve at least one memory access per neuron per timestep. Thus, the number of computations and memory accesses performed during spike generation are proportional to the number of neurons.The second phase, spike generation, is the process of evaluating each neuron and, based on a mathematical model of the neuron, determining whether it produces a spike. Neuron models with varying levels of bio-fidelity have been proposed. In this work, we use the Integrate-and-Fire (IF) neuron model for illustration, but the approach is largely independent of the underlying neuron model. The spike generation step, as described in The final phase, spike propagation, as described in viz. IBM TrueNorth  in an SNN, that are connected by a synapse. Neuron i is called presynaptic and neuron j postsynaptic if the output of i is used to drive the membrane potential of j. The magnitude of the weight associated with the synapse is wij, which we will assume  to be a real-valued number \u2208 . This is a safe assumption since the effects of the weights are evaluated relative to a threshold value, and so it is possible to normalize all weights to this range of magnitudes. Note that negative weights would correspond to inhibitory synapses, which are modeled in exactly the same way as excitatory synapses, and only the magnitude of the weight matters for the discussion that follows.Consider two neurons  is the total number of times neuron i has spiked until time t. We term this process of spike propagation as deterministic, and denote it using the superscript d. It should be noted here that i has on the membrane potential of neuron j, while the spiking behavior of neuron j itself depends on the neuron model and its potentiation by other presynaptic neurons.where j by wij every time neuron i spikes, if we apply a weight of \u0175ij for a random subset of the spikes, the total potentiation becomesInstead of potentiating neuron \u015ci(t) is the random subset of spikes from neuron i that were propagated to neuron j and \u0108i(t) is the number of spikes in \u015ci(t) till time t. In other words, we propagate a spike from neuron i to neuron j with a probability of pij, wherep.We term this process of spike propagation as probabilistic, and denote it by the superscript j by neuron i as follows:We can define the average potentiation of neuron i. For the deterministic approach, the average potentiation is equal to the synaptic weight itself.It should be noted that the average potentiation is defined when there is at least one spike from neuron On the other hand, for the probabilistic approach corresponding to Equation (3), the average potentiation is a limit.pij and \u0175ij in the probabilistic approach. One interesting choice is to set pij = wij and \u0175ij = 1, which is simply an alternative interpretation of each weight as the probability of spike propagation. We highlight the effects of such a probabilistic approach through an example below.We hypothesize that, it is sufficient that the average potentiation for probabilistic spike propagation tends toward the average potentiation for the deterministic case, for the network to achieve similar levels of accuracy with both the probabilistic and deterministic approaches. This can be achieved by carefully choosing values for Consider the connectivity pattern illustrated in S3 for neuron 3 is shown in The spike patterns of neurons 1 and 2 are shown in Overall, when the spikes are propagated in a probabilistic fashion, the instantaneous membrane potential of neuron 3 may differ from that under deterministic propagation, but as more and more spikes are generated by the presynaptic neuron, the average potentiation for the probabilistic case converges to the deterministic one, which is essentially the synaptic weight. We introduced randomness into the process of spike propagation in a network that is otherwise deterministic, and allowed the temporal nature of the network to average it out.The crux of our hypothesis is that even though the introduced randomness alters the instantaneous state of the network, the variations will average out over time and result in a network-level equivalence with the deterministic evaluation scheme. In the following subsections, we describe how to take advantage of this randomness to develop efficient implementations of SNNs.From wij. The number of Bernoulli trials required, which in this case is the number of spikes, for an approximation with low relative error is inversely proportional to the probability of success .It is important to note that, for a given number of timesteps, the probability of spike propagation controls a trade-off relationship between cost and performance. The lower the probability, the lower the number of synaptic updates and poorer network performance. The higher the probability, the higher the number of synaptic updates and better network performance. We explore this trade-off in greater detail in section 6.wij. The probability of success of this Bernoulli trial isA probabilistic synapse can be realized by generating a uniformly distributed random number wij greater than rb.which is equal to the desired probability of propagation presented in the previous discussion. Hence, the spike can be propagated on every synapse that has a weight While this implements the probabilistic synapse, it requires fetching of the weight for each synapse from memory prior to the decision of propagation. This can be cheaper than the deterministic approach, as for the synapses that we don't propagate the spikes on, the post-synaptic neurons need not be updated. It should be noted that this random skipping of synapses can cause pipeline inefficiencies in a hardware implementation. In the probabilistic spike propagation process described in i has spiked. Assume that the weights of the outgoing synapses of neuron i in synaptic cluster b are ranked from 1 to rb (line 3). Since the weights are stored in sorted order, every synaptic update requires reading the index (line 5) and weight (line 7), but as soon as the comparison fails for one synapse, all the remaining synapses in the cluster can be skipped (line 10). The index j of the postsynaptic neuron can be determined with the indices of the presynaptic neuron and the synapse (line 6), based on the underlying connectivity pattern.Consider that neuron termination point of the spike propagation from neuron i, wij > rb. It is the rank of the smallest weight in the synaptic cluster that is greater than rb. In the straightforward method of determining tp described above, note that we need both the actual weight value and the index of the target neuron, potentially requiring twice the number of memory accesses.We define the i in synaptic cluster b with weights lesser than rb. Therefore, the termination point tp is essentially tp through a single memory access (line 4). Consequently, we can perform synaptic updates without fetching the synaptic weights.An alternate approach is to use a cumulative histogram of the outgoing weights of each neuron in each cluster, indicated by rb. For discrete values of rb, we can store the termination point tp directly and sample from these points. The number of discrete points correspond to the number of bins of the cumulative histogram and is a parameter of concern. It controls the trade-off between memory overhead and performance. The higher the number of bins, the better the fidelity of the termination point. The lower the resolution, the lower the memory overhead. In this work, we have implemented this approach in the hardware architecture and have studied its implications on accuracy and cost. The trade-off between accuracy and memory overhead has been studied in section 6.Another way to look at this is as a way of discretizing the space of random number generation for In summary, the proposed probabilistic spike propagation approach reduces the number of synaptic updates, and consequently the number of memory accesses in SNNs by introducing randomness into the process of spike propagation.To evaluate the system-level impact of probabilistic spike propagation, we develop P-SNNAP, an SNN accelerator based on SNNAP , the Eval unit and the global controller. It also contains three types of on-chip memories\u2014the spike memory, the weight memory, and the state memory, for storing spikes, weights, and neuronal state variables, respectively.In a deterministic SNN evaluation, as performed in SNNAP, the neurons in every layer are evaluated at each timestep before moving on to the next timestep. However, it involves loading the neuronal state variables and weights for each layer into the on-chip memory repeatedly at every timestep. To avoid these repeated off-chip memory accesses and increase the reuse of loaded weight values, we evaluate one layer for the total number of timesteps before moving on to the next layer. The spikes generated at each timestep during the evaluation of one layer are stored in the spike memory and subsequently fetched during the evaluation of the next layer. Since a large number of modern deep networks are strictly feed-forward, this layer-wise evaluation scheme can be applied to reduce the required buffering. Specifically, all networks evaluated as part of this work are feed-forward networks. We note that this optimization is orthogonal to our proposal and is applied to both deterministic and probabilistic SNN evaluation.The Eval unit, similar to the Leak-and-Spike unit in SNNAP, is the module that performs neuron evaluation. It fetches the membrane potentials from the state memory, increments it by the bias value and compares it with the threshold. If the membrane potential exceeds the threshold, a spike is generated and communicated to the controller. The updated membrane potentials are written back to the state memory.The Controller orchestrates the functioning of the accelerator. It has two phases of operation\u2014the first phase controls the SNPEs and the second phase controls the Eval unit. For each timestep, the controller goes through both phases. In the first phase, the controller fetches the spikes generated by the previous layer from the spike memory and sends them to the SNPEs. Once all the spikes are sent and the SNPEs finish their operations, the controller moves on to the second phase, in which the controller receives spikes from the Eval unit as it evaluates all the neurons in the layer and writes the spikes to the spike memory. Once all the neurons of the current layer are evaluated, the current timestep is completed and the controller moves on to the next timestep for the layer.Spike propagation is realized by an array of Spike Neural Processing Elements (SNPEs). The propagation along different outgoing synapses of neurons are parallelized and balanced across the 16 lanes of the SNPE array. Each lane has an SNPE coupled with two blocks of on-chip memory, one each for membrane potentials and weights. When a layer is evaluated, the controller fetches the spikes from the previous layer and sends them to the SNPEs. On receiving a spike, an SNPE uses the index of the spiking neuron to iterate through its outgoing synpases. For each synapse, the SNPE calculates the index of the post-synaptic neuron. This calculation depends on the connectivity pattern of the layer being evaluated. Next, for each post-synaptic neuron, its membrane potential and the weight of the corresponding synapse are fetched. The membrane potential is updated and written back.Both the lanes of SNPEs in the architecture and the synaptic clusters in the probabilistic approach group outgoing synapses of neurons. Despite the similarity, the grouping is done with different goals. While deciding the number of lanes, the primary concerns are inference speed and the required logic area and size of the on-chip memories, at the hardware level. On the other hand, while deciding the number of synaptic clusters, the concerns are computational effort and accuracy.When the number of synaptic clusters and lanes are chosen to be equal, a simple direct mapping is possible\u2014the outer loop in The weight memory in each SNPE lane stores all the information required to perform probabilistic spike propagation, including the discretized cumulative histograms for the corresponding mapped synaptic clusters, the sorted synaptic indices and the maximum weight values.tp that each lane comes up with is random and thus, they perform different number of synaptic updates and end up taking unequal amounts of time, as illustrated in In the deterministic propagation of spikes, since the outgoing synapses of the spiked neuron are distributed equally among the lanes, each lane ends up performing an equal number of synaptic updates, which means that all the SNPEs take an equal amount of time, as shown in To address the aforementioned challenge, P-SNNAP implements asynchronous spike processing. Each SNPE is equipped with a queue as shown in In this section, we describe the experimental methodology and benchmarks used to evaluate the proposed concepts.The benefits of the proposed approach have been studied across a range of image classification networks trained on MNIST, SVHN, CIFAR10, CIFAR100, and ImageNet datasets, as listed in We refer to the deterministic evaluation of all synapses in a network as the baseline (BSL) approach in section 6. On the other hand, for the Probabilistic Spike Propagation (PSP) approach in section 6, we empirically choose between deterministic or probabilistic spike propagation at a layer-granularity for each network in the benchmark suite, with the goal of iso-timesteps operation. The probabilistic approach is beneficial only for layers with large numbers of synaptic connections and high activity. For instance, the CIFAR10-AllConv network in our benchmark suite is the All-CNN-C network from Springenberg et al. , that wamm2. The compute power consumption is 28.6 mW. A version of SNNAP without support for probabilistic spike propagation was implemented to act as the baseline in our comparisons. We observe that the probabilistic approach incurs a compute logic area overhead of 12% and compute logic power overhead of 23.5%. These hardware additions facilitate significant improvements in time and energy consumed to evaluate SNNs, as discussed in the following section.The P-SNNAP engine was designed at the Register Transfer Level and synthesized to the Nangate 15 nm technology using Synopsys Design Compiler. CACTI  in SNNs.In this subsection, we study the trade-off between classification accuracy of a network and the number of synaptic updates performed during its evaluation. Specifically, we record the classification accuracy and number of synaptic updates  at each timestep for both the deterministic and probabilistic propagation schemes. The results for the CIFAR10 all-convolutional network are presented in The benefits of PSP in terms of the reduction in the number of synaptic updates, total energy, and execution time on the P-SNNAP architecture are presented in As discussed in section 3.2, increasing the number of synaptic clusters causes the number of synapses affected by outlier weights to go down, and their probabilities of propagation go up.We observe that this improves the classification accuracy for iso-synaptic updates. In the extreme case, with 1 synapse per cluster, probabilistic propagation becomes identical to the deterministic approach. This dictates that the trade-off relationship between number of synaptic updates and accuracy has a sweet spot on the possible number of synaptic clusters.The all-convolutional CIFAR10 network has been studied to explore this relationship in more detail. The network is evaluated with different number of synaptic clusters and the accuracy and average number of synaptic updates per inference image are measured. The contour plot in It should be noted that this sweet spot is dependent, at a high level, on the number of synapses per cluster, which is decided by the size of the network. Ideally, the number of synaptic clusters could be determined at a per-neuron granularity. However, in this work, we have chosen it to be a network-level hyperparameter to reduce the overall search space.rb, as it affects the value of the termination point tp determined from the cumulative histogram. Therefore, it directly affects the degradation in classification accuracy. At the same time, reducing the number of bins reduces the memory footprint. It should be noted that, the number of accesses to determine tp is only one per lane per spike, irrelevant of the number of bins used in the cumulative histogram.The number of bins used in the cumulative histogram impacts the fidelity of the random number We specifically study the effect of the number of bins on the classification accuracy of CIFAR10 all-convolutional network. A cumulative histogram of 50 bins causes a memory overhead of 23.7% in the CIFAR10-AllConv network. While this can be considered to be significant, we note the followingThe memory overhead is much lower in larger models like CIFAR100-VGG16 (10.9%) and ImageNet-VGG16 (1.1%).Although the memory footprint is larger, the total number of memory accesses with PSP is substantially lower.The focus of this work is to improve the energy efficiency of spiking neural networks by utilizing a probabilistic approach to spike propagation for reducing the number of memory accesses. It can be directly applied to pre-trained spiking networks, without any structural or behavioral modifications. We now relate this to previously proposed approaches for improving SNN implementations and highlight the unique aspects of our approach.There have been several custom hardware accelerators designed expressly to implement spiking networks (Neil and Liu, Stochastic computation techniques apply randomness to the process of computation itself (Shanbhag et al., Ahmed et al.  considerPruning is a technique used to reduce memory footprint of neural networks. Rathi et al.  propose Approximate computing is well-known in the area of signal processing and neural network hardware, but has seen limited application to spiking networks. One example is Sen et al. , where nFinally, there are approaches that rely on the use of new and emerging technologies, such as spin-based computing (Sengupta et al., In this work, we introduce probabilistic spike propagation as a new approach for improving the energy efficiency of spiking neural networks. The proposed approach reduces the number of memory accesses during the spike propagation phase in SNNs by casting spike propagation as a probabilistic process. We show that the temporal nature of SNNs allows the network to regain any accuracy loss caused by this approach. We successfully apply the technique on pre-trained spiking networks without any network modifications or retraining and demonstrate significant reductions in the number of synaptic updates performed during evaluation while maintaining near iso-accuracy performance levels. We further develop a new hardware architecture, P-SNNAP, to realize probabilistic spike propagation in hardware and show that the proposed approach achieves considerable execution time and energy savings when compared to deterministic spike propagation.http://yann.lecun.com/exdb/mnist/; http://ufldl.stanford.edu/housenumbers/; https://www.cs.toronto.edu/~kriz/cifar.html; http://www.image-net.org/.Publicly available datasets were analyzed in this study. This data can be found at: AN implemented the experimental framework. All authors contributed to the conception of the ideas, design of the experiments, analysis of the results, and development of the manuscript.SS was employed at IBM Thomas J. Watson Research Center. The remaining authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest.", "texts": ["We propose probabilistic spike propagation, an approach to optimize rate-coded SNNs by interpreting synaptic weights as probabilities, and utilizing these probabilities to regulate spike propagation. The approach results in 2.4\u20133.69\u00d7 reduction in spikes propagated, leading to reduced time and energy consumption. We propose Probabilistic Spiking Neural Network Application Processor (P-SNNAP), a specialized SNN accelerator with support for probabilistic spike propagation. Our evaluations across a suite of benchmark SNNs demonstrate that probabilistic spike propagation results in 1.39\u20132\u00d7 energy reduction with simultaneous speedups of 1.16\u20131.62\u00d7 compared to the traditional model of SNN evaluation.Spiking neural networks (SNNs) have gained considerable attention in recent years due to their ability to model temporal event streams, be trained using unsupervised learning rules, and be realized on low-power event-driven hardware. Notwithstanding the intrinsic desirable attributes of SNNs, there is a need to further optimize their computational efficiency to enable their deployment in highly resource-constrained systems. The complexity of evaluating an SNN is strongly correlated to the spiking activity in the network, and can be measured in terms of a fundamental unit of computation,  Spiking Neural Networks (SNNs), often referred to as the third generation of neural networks Maass, , are attSNNs represent information as discrete spike events and follow an event-driven model of computation, where the work done  is proportional to the number of spike events. Further, they do not require multiplication to be performed when processing a spike, offering the prospect of reduced hardware complexity compared to conventional Artificial Neural Networks (ANNs). Due to these differences, SNNs are not well-suited to commodity hardware platforms like graphics processing units (GPUs). Further, in contrast to hardware accelerators for ANNs, which usually focus on exploiting regular data parallelism, hardware architectures for spiking networks  spike injection, (b) spike generation, and (c) spike propagation, as illustrated in A more detailed description of SNN evaluation is presented in vm is fetched and the bias is added to it (line 10). Next, it is checked for firing by comparing it with the threshold voltage vth (line 11). In case of firing, the neuron ID is pushed into a spike queue (line 12), and the membrane potential is reset and written back to the memory (line 13). If every neuron in the network is evaluated at every timestep, the above process will involve at least one memory access per neuron per timestep. Thus, the number of computations and memory accesses performed during spike generation are proportional to the number of neurons.The second phase, spike generation, is the process of evaluating each neuron and, based on a mathematical model of the neuron, determining whether it produces a spike. Neuron models with varying levels of bio-fidelity have been proposed. In this work, we use the Integrate-and-Fire (IF) neuron model for illustration, but the approach is largely independent of the underlying neuron model. The spike generation step, as described in The final phase, spike propagation, as described in viz. IBM TrueNorth  in an SNN, that are connected by a synapse. Neuron i is called presynaptic and neuron j postsynaptic if the output of i is used to drive the membrane potential of j. The magnitude of the weight associated with the synapse is wij, which we will assume  to be a real-valued number \u2208 . This is a safe assumption since the effects of the weights are evaluated relative to a threshold value, and so it is possible to normalize all weights to this range of magnitudes. Note that negative weights would correspond to inhibitory synapses, which are modeled in exactly the same way as excitatory synapses, and only the magnitude of the weight matters for the discussion that follows.Consider two neurons  is the total number of times neuron i has spiked until time t. We term this process of spike propagation as deterministic, and denote it using the superscript d. It should be noted here that i has on the membrane potential of neuron j, while the spiking behavior of neuron j itself depends on the neuron model and its potentiation by other presynaptic neurons.where j by wij every time neuron i spikes, if we apply a weight of \u0175ij for a random subset of the spikes, the total potentiation becomesInstead of potentiating neuron \u015ci(t) is the random subset of spikes from neuron i that were propagated to neuron j and \u0108i(t) is the number of spikes in \u015ci(t) till time t. In other words, we propagate a spike from neuron i to neuron j with a probability of pij, wherep.We term this process of spike propagation as probabilistic, and denote it by the superscript j by neuron i as follows:We can define the average potentiation of neuron i. For the deterministic approach, the average potentiation is equal to the synaptic weight itself.It should be noted that the average potentiation is defined when there is at least one spike from neuron On the other hand, for the probabilistic approach corresponding to Equation (3), the average potentiation is a limit.pij and \u0175ij in the probabilistic approach. One interesting choice is to set pij = wij and \u0175ij = 1, which is simply an alternative interpretation of each weight as the probability of spike propagation. We highlight the effects of such a probabilistic approach through an example below.We hypothesize that, it is sufficient that the average potentiation for probabilistic spike propagation tends toward the average potentiation for the deterministic case, for the network to achieve similar levels of accuracy with both the probabilistic and deterministic approaches. This can be achieved by carefully choosing values for Consider the connectivity pattern illustrated in S3 for neuron 3 is shown in The spike patterns of neurons 1 and 2 are shown in Overall, when the spikes are propagated in a probabilistic fashion, the instantaneous membrane potential of neuron 3 may differ from that under deterministic propagation, but as more and more spikes are generated by the presynaptic neuron, the average potentiation for the probabilistic case converges to the deterministic one, which is essentially the synaptic weight. We introduced randomness into the process of spike propagation in a network that is otherwise deterministic, and allowed the temporal nature of the network to average it out.The crux of our hypothesis is that even though the introduced randomness alters the instantaneous state of the network, the variations will average out over time and result in a network-level equivalence with the deterministic evaluation scheme. In the following subsections, we describe how to take advantage of this randomness to develop efficient implementations of SNNs.From wij. The number of Bernoulli trials required, which in this case is the number of spikes, for an approximation with low relative error is inversely proportional to the probability of success .It is important to note that, for a given number of timesteps, the probability of spike propagation controls a trade-off relationship between cost and performance. The lower the probability, the lower the number of synaptic updates and poorer network performance. The higher the probability, the higher the number of synaptic updates and better network performance. We explore this trade-off in greater detail in section 6.wij. The probability of success of this Bernoulli trial isA probabilistic synapse can be realized by generating a uniformly distributed random number wij greater than rb.which is equal to the desired probability of propagation presented in the previous discussion. Hence, the spike can be propagated on every synapse that has a weight While this implements the probabilistic synapse, it requires fetching of the weight for each synapse from memory prior to the decision of propagation. This can be cheaper than the deterministic approach, as for the synapses that we don't propagate the spikes on, the post-synaptic neurons need not be updated. It should be noted that this random skipping of synapses can cause pipeline inefficiencies in a hardware implementation. In the probabilistic spike propagation process described in i has spiked. Assume that the weights of the outgoing synapses of neuron i in synaptic cluster b are ranked from 1 to rb (line 3). Since the weights are stored in sorted order, every synaptic update requires reading the index (line 5) and weight (line 7), but as soon as the comparison fails for one synapse, all the remaining synapses in the cluster can be skipped (line 10). The index j of the postsynaptic neuron can be determined with the indices of the presynaptic neuron and the synapse (line 6), based on the underlying connectivity pattern.Consider that neuron termination point of the spike propagation from neuron i, wij > rb. It is the rank of the smallest weight in the synaptic cluster that is greater than rb. In the straightforward method of determining tp described above, note that we need both the actual weight value and the index of the target neuron, potentially requiring twice the number of memory accesses.We define the i in synaptic cluster b with weights lesser than rb. Therefore, the termination point tp is essentially tp through a single memory access (line 4). Consequently, we can perform synaptic updates without fetching the synaptic weights.An alternate approach is to use a cumulative histogram of the outgoing weights of each neuron in each cluster, indicated by rb. For discrete values of rb, we can store the termination point tp directly and sample from these points. The number of discrete points correspond to the number of bins of the cumulative histogram and is a parameter of concern. It controls the trade-off between memory overhead and performance. The higher the number of bins, the better the fidelity of the termination point. The lower the resolution, the lower the memory overhead. In this work, we have implemented this approach in the hardware architecture and have studied its implications on accuracy and cost. The trade-off between accuracy and memory overhead has been studied in section 6.Another way to look at this is as a way of discretizing the space of random number generation for In summary, the proposed probabilistic spike propagation approach reduces the number of synaptic updates, and consequently the number of memory accesses in SNNs by introducing randomness into the process of spike propagation.To evaluate the system-level impact of probabilistic spike propagation, we develop P-SNNAP, an SNN accelerator based on SNNAP , the Eval unit and the global controller. It also contains three types of on-chip memories\u2014the spike memory, the weight memory, and the state memory, for storing spikes, weights, and neuronal state variables, respectively.In a deterministic SNN evaluation, as performed in SNNAP, the neurons in every layer are evaluated at each timestep before moving on to the next timestep. However, it involves loading the neuronal state variables and weights for each layer into the on-chip memory repeatedly at every timestep. To avoid these repeated off-chip memory accesses and increase the reuse of loaded weight values, we evaluate one layer for the total number of timesteps before moving on to the next layer. The spikes generated at each timestep during the evaluation of one layer are stored in the spike memory and subsequently fetched during the evaluation of the next layer. Since a large number of modern deep networks are strictly feed-forward, this layer-wise evaluation scheme can be applied to reduce the required buffering. Specifically, all networks evaluated as part of this work are feed-forward networks. We note that this optimization is orthogonal to our proposal and is applied to both deterministic and probabilistic SNN evaluation.The Eval unit, similar to the Leak-and-Spike unit in SNNAP, is the module that performs neuron evaluation. It fetches the membrane potentials from the state memory, increments it by the bias value and compares it with the threshold. If the membrane potential exceeds the threshold, a spike is generated and communicated to the controller. The updated membrane potentials are written back to the state memory.The Controller orchestrates the functioning of the accelerator. It has two phases of operation\u2014the first phase controls the SNPEs and the second phase controls the Eval unit. For each timestep, the controller goes through both phases. In the first phase, the controller fetches the spikes generated by the previous layer from the spike memory and sends them to the SNPEs. Once all the spikes are sent and the SNPEs finish their operations, the controller moves on to the second phase, in which the controller receives spikes from the Eval unit as it evaluates all the neurons in the layer and writes the spikes to the spike memory. Once all the neurons of the current layer are evaluated, the current timestep is completed and the controller moves on to the next timestep for the layer.Spike propagation is realized by an array of Spike Neural Processing Elements (SNPEs). The propagation along different outgoing synapses of neurons are parallelized and balanced across the 16 lanes of the SNPE array. Each lane has an SNPE coupled with two blocks of on-chip memory, one each for membrane potentials and weights. When a layer is evaluated, the controller fetches the spikes from the previous layer and sends them to the SNPEs. On receiving a spike, an SNPE uses the index of the spiking neuron to iterate through its outgoing synpases. For each synapse, the SNPE calculates the index of the post-synaptic neuron. This calculation depends on the connectivity pattern of the layer being evaluated. Next, for each post-synaptic neuron, its membrane potential and the weight of the corresponding synapse are fetched. The membrane potential is updated and written back.Both the lanes of SNPEs in the architecture and the synaptic clusters in the probabilistic approach group outgoing synapses of neurons. Despite the similarity, the grouping is done with different goals. While deciding the number of lanes, the primary concerns are inference speed and the required logic area and size of the on-chip memories, at the hardware level. On the other hand, while deciding the number of synaptic clusters, the concerns are computational effort and accuracy.When the number of synaptic clusters and lanes are chosen to be equal, a simple direct mapping is possible\u2014the outer loop in The weight memory in each SNPE lane stores all the information required to perform probabilistic spike propagation, including the discretized cumulative histograms for the corresponding mapped synaptic clusters, the sorted synaptic indices and the maximum weight values.tp that each lane comes up with is random and thus, they perform different number of synaptic updates and end up taking unequal amounts of time, as illustrated in In the deterministic propagation of spikes, since the outgoing synapses of the spiked neuron are distributed equally among the lanes, each lane ends up performing an equal number of synaptic updates, which means that all the SNPEs take an equal amount of time, as shown in To address the aforementioned challenge, P-SNNAP implements asynchronous spike processing. Each SNPE is equipped with a queue as shown in In this section, we describe the experimental methodology and benchmarks used to evaluate the proposed concepts.The benefits of the proposed approach have been studied across a range of image classification networks trained on MNIST, SVHN, CIFAR10, CIFAR100, and ImageNet datasets, as listed in We refer to the deterministic evaluation of all synapses in a network as the baseline (BSL) approach in section 6. On the other hand, for the Probabilistic Spike Propagation (PSP) approach in section 6, we empirically choose between deterministic or probabilistic spike propagation at a layer-granularity for each network in the benchmark suite, with the goal of iso-timesteps operation. The probabilistic approach is beneficial only for layers with large numbers of synaptic connections and high activity. For instance, the CIFAR10-AllConv network in our benchmark suite is the All-CNN-C network from Springenberg et al. , that wamm2. The compute power consumption is 28.6 mW. A version of SNNAP without support for probabilistic spike propagation was implemented to act as the baseline in our comparisons. We observe that the probabilistic approach incurs a compute logic area overhead of 12% and compute logic power overhead of 23.5%. These hardware additions facilitate significant improvements in time and energy consumed to evaluate SNNs, as discussed in the following section.The P-SNNAP engine was designed at the Register Transfer Level and synthesized to the Nangate 15 nm technology using Synopsys Design Compiler. CACTI  in SNNs.In this subsection, we study the trade-off between classification accuracy of a network and the number of synaptic updates performed during its evaluation. Specifically, we record the classification accuracy and number of synaptic updates  at each timestep for both the deterministic and probabilistic propagation schemes. The results for the CIFAR10 all-convolutional network are presented in The benefits of PSP in terms of the reduction in the number of synaptic updates, total energy, and execution time on the P-SNNAP architecture are presented in As discussed in section 3.2, increasing the number of synaptic clusters causes the number of synapses affected by outlier weights to go down, and their probabilities of propagation go up.We observe that this improves the classification accuracy for iso-synaptic updates. In the extreme case, with 1 synapse per cluster, probabilistic propagation becomes identical to the deterministic approach. This dictates that the trade-off relationship between number of synaptic updates and accuracy has a sweet spot on the possible number of synaptic clusters.The all-convolutional CIFAR10 network has been studied to explore this relationship in more detail. The network is evaluated with different number of synaptic clusters and the accuracy and average number of synaptic updates per inference image are measured. The contour plot in It should be noted that this sweet spot is dependent, at a high level, on the number of synapses per cluster, which is decided by the size of the network. Ideally, the number of synaptic clusters could be determined at a per-neuron granularity. However, in this work, we have chosen it to be a network-level hyperparameter to reduce the overall search space.rb, as it affects the value of the termination point tp determined from the cumulative histogram. Therefore, it directly affects the degradation in classification accuracy. At the same time, reducing the number of bins reduces the memory footprint. It should be noted that, the number of accesses to determine tp is only one per lane per spike, irrelevant of the number of bins used in the cumulative histogram.The number of bins used in the cumulative histogram impacts the fidelity of the random number We specifically study the effect of the number of bins on the classification accuracy of CIFAR10 all-convolutional network. A cumulative histogram of 50 bins causes a memory overhead of 23.7% in the CIFAR10-AllConv network. While this can be considered to be significant, we note the followingThe memory overhead is much lower in larger models like CIFAR100-VGG16 (10.9%) and ImageNet-VGG16 (1.1%).Although the memory footprint is larger, the total number of memory accesses with PSP is substantially lower.The focus of this work is to improve the energy efficiency of spiking neural networks by utilizing a probabilistic approach to spike propagation for reducing the number of memory accesses. It can be directly applied to pre-trained spiking networks, without any structural or behavioral modifications. We now relate this to previously proposed approaches for improving SNN implementations and highlight the unique aspects of our approach.There have been several custom hardware accelerators designed expressly to implement spiking networks (Neil and Liu, Stochastic computation techniques apply randomness to the process of computation itself (Shanbhag et al., Ahmed et al.  considerPruning is a technique used to reduce memory footprint of neural networks. Rathi et al.  propose Approximate computing is well-known in the area of signal processing and neural network hardware, but has seen limited application to spiking networks. One example is Sen et al. , where nFinally, there are approaches that rely on the use of new and emerging technologies, such as spin-based computing (Sengupta et al., In this work, we introduce probabilistic spike propagation as a new approach for improving the energy efficiency of spiking neural networks. The proposed approach reduces the number of memory accesses during the spike propagation phase in SNNs by casting spike propagation as a probabilistic process. We show that the temporal nature of SNNs allows the network to regain any accuracy loss caused by this approach. We successfully apply the technique on pre-trained spiking networks without any network modifications or retraining and demonstrate significant reductions in the number of synaptic updates performed during evaluation while maintaining near iso-accuracy performance levels. We further develop a new hardware architecture, P-SNNAP, to realize probabilistic spike propagation in hardware and show that the proposed approach achieves considerable execution time and energy savings when compared to deterministic spike propagation.http://yann.lecun.com/exdb/mnist/; http://ufldl.stanford.edu/housenumbers/; https://www.cs.toronto.edu/~kriz/cifar.html; http://www.image-net.org/.Publicly available datasets were analyzed in this study. This data can be found at: AN implemented the experimental framework. All authors contributed to the conception of the ideas, design of the experiments, analysis of the results, and development of the manuscript.SS was employed at IBM Thomas J. Watson Research Center. The remaining authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest."]}
-{"representative": "CAMAP predictions were significantly more accurate when using original codon sequences than shuffled codon sequences which reflect amino acid usage. Furthermore, predictions were independent of mRNA expression and MAP binding affinity to MHC-I molecules and applied to several cell types and species. Combining MAP ligand scores, transcript expression level and CAMAP scores was particularly useful to increase MAP prediction accuracy. Using an in vitro assay, we showed that varying the synonymous codons in the regions flanking the MCCs (without changing the amino acid sequence) resulted in significant modulation of MAP presentation at the cell surface. Taken together, our results demonstrate the role of codon arrangement in the regulation of MAP presentation and support integration of both translational and post-translational events in predictive algorithms to ameliorate modeling of the immunopeptidome.MHC-I associated peptides (MAPs) play a central role in the elimination of virus-infected and neoplastic cells by CD8 T cells. However, accurately predicting the MAP repertoire remains difficult, because only a fraction of the transcriptome generates MAPs. In this study, we investigated whether codon arrangement (usage and placement) regulates MAP biogenesis. We developed an artificial neural network called Codon Arrangement MAP Predictor (CAMAP), predicting MAP presentation solely from mRNA sequences flanking the MAP-coding codons (MCCs), while excluding the MCC  per se, CAMAP\u2019s novelty is to analyze the MAP-flanking mRNA sequences, thereby providing completely independent information for MAP prediction. We show on several datasets that the integration of CAMAP scores with other known factors involved in MAP presentation (i.e. MAP ligand score and mRNA expression) significantly improves MAP prediction accuracy, and further validate CAMAP learned features using an in-vitro assay. These findings may have major implications for the design of vaccines against cancers and viruses, and in times of pandemics could accelerate the identification of relevant MAPs of viral origins.MHC-I associated peptides (MAPs) are small fragments of intracellular proteins presented at the surface of cells and used by the immune system to detect and eliminate cancerous or virus-infected cells. While it is theoretically possible to predict which portions of the intracellular proteins will be naturally processed by the cells to ultimately reach the surface, current methodologies have prohibitively high false discovery rates. Here we introduce an artificial neural network called Codon Arrangement MAP Predictor (CAMAP) which integrates information from mRNA-to-protein translation to other factors regulating MAP biogenesis (e.g. MAP ligand score and transcript expression levels) to improve MAP prediction accuracy. While most MAP predictive approaches focus on MAP sequences  PLOS Computational Biology Methods paper.This is a In jawed vertebrates, virtually all nucleated cells present at their surface major histocompatibility complex class-I (MHC-I) associated peptides (MAPs), collectively referred to as the immunopeptidome ,2. MAPs The generation of the immunopeptidome can be conceptualized in two main events: (a) the generation of MAP candidates (i.e. peptides of appropriate length for MHC-I presentation) through protein degradation, and (b) a subsequent filtering step through the binding of MAP candidates to the available MHC-I molecules. Rules that regulate the second event have been well characterized using artificial neural networks (ANN) and weighted matrix approaches ,8. HowevA large body of evidence suggests that a substantial portion of MAPs are produced co-translationally \u201315, deriper se from our positive (hits) and negative (decoys) sequences  by a total of 33 MHC-I alleles from 18 subjects ,22. Becaequences . To faci2 > 0.95) with the amino acid distribution, compared to only 69% in the original dataset  in which original codon sequences were randomly replaced by synonymous codons according to their usage frequency in the human transcriptome . This trTo assess the importance of codon usage in MAP biogenesis, we reasoned that if codons bear important information that is operative at the translational rather than the post-translational level, then: (i) CAMAP trained to identify MCCs flanking regions should consistently perform better when trained on original codon sequences than on shuffled codon sequences (reflecting amino acid sequences), and (ii) synonymous codons should have different effects on the prediction. To test these hypotheses, CAMAP received as inputs MCCs flanking regions from hit and decoy sequences from either the original or shuffled datasets. It was then trained to predict the probability that individual input sequences were MCCs flanking regions (i.e. hit) rather than sequences from the negative dataset . We first evaluated MAPs that could originate from different transcripts within the transcriptome (i.e. transcripts with sufficient expression levels detected by RNA sequencing) as they are likely to represent conserved regions in the genome. While 79.9% of MAPs originated from unique contexts , only 2.\u221216, Non-source transcripts have been previously associated with higher GC content . To evalPrevious studies have shown that codon bias plays a significant role in translation efficiency (TE) by co-adaptation to the tRNA pool ,26. This-16, We evaluated whether CAMAP would still be predictive for negative examples (decoys) derived from source transcripts. While most decoys derived from source transcripts showed a CAMAP score above 0.5 and are thus classified as source, they still had a lower CAMAP score compared to hits from source transcripts  in CAMAP\u2019s predictions. The shuffling method used above Figs  and 2 ge\u22124). This could be due to the limited number of synonymous codons available for swapping within a single example. This also suggests that the overall codon composition of the MAP-flanking sequences has more impact on CAMAP predictions than the codons\u2019 position within the MAP-flanking sequences. The third nucleotide shuffling also decreased CAMAP performances (mean AUC of 0.676) but remained above that of the transcriptome shuffled dataset (mean AUC of 0.647). These results suggest that the GC content has a significant impact on CAMAP performances, as the codon swap and third nucleotide shuffling both preserves the GC content within each example, while the transcriptome shuffling does not. This is also supported by the negative correlation between GC content and CAMAP scores, as shown in As shown in Taken together, these results support a role for codon arrangements, and especially for codon usage in the regulation of MAP biogenesis which cannot be reduced to codon\u2019s impact on gene expression levels, GC content or translation efficiency.We next validated our CAMAP trained on 9-mer MAPs derived from B-LCL using 5 datasets derived from different human and mouse cell types. All the validation datasets were described through proteogenomic analyses similarly to our B-LCL training datasets. However, all the validation datasets included MAPs of 8\u201311 mers, in contrast with the training dataset that contained only 9-mer MAPs. The validation datasets consisted of (i) our B-LCL dataset, this time including all peptide lengths ,22, (ii)The lower performances of CAMAP trained with shuffled sequences (representing amino acid distribution) suggests that amino acids in MAP-flanking sequences are less informative than codons regarding MAP presentation. We formally quantified this difference in information using the Kullback-Leibler (KL) divergence see . These rWe wondered whether some regions were more influential on MAP presentation than others. To address this question, we retrieved the model preferences for each codon at each position. The preferences correspond to the prediction score of our best model  when a single codon at a single position is provided as input  and mRNA transcript expression levels. We used ligand scores as predicted by NetMHCpan4.0, which was shown to possess the best predictive capacities for naturally processed peptides compared to other predictive algorithms . Becauseper se. We thus additionally assessed the value of each prediction method using a multi-layer perceptron (MLP) classifier. Results show that for all of them, adding CAMAP score to the input improves prediction accuracy  and CAMAP scores third, . As expeaccuracy . Similaraccuracy . Interesin silico, both encoding for the same OVA protein but using different synonymous codons: one predicted to enhance SIINFEKL presentation (OVA-EP), the other predicted to reduce it (OVA-RP). Accordingly, the respective CAMAP scores for OVA-RP, OVA-WT and OVA-EP were: 0.03, 0.65, and 0.96  protein containing the model MAP SIINFEKL . One conand 0.96 . All varBecause codon usage affects translation efficiency, theoretically leading to DRiP formation through premature translation arrest ,21, we eb specific T-cell activation assay  and reimplemented identically for this work using pyTorch (results presented herein derive from the pyTorch version). An Embedding layer was used to associate each label superior to 0 to a set of 2D trainable parameters; the 0 label represents a null (masking) embedding fixed at coordinates . As an output layer, we used a Softmax layer with two outputs (positive / negative). Because negative sequences are more numerous than positive ones, we used an oversampling strategy during training. At each epoch, CAMAPs were randomly presented with the same number of positive and negative sequences. All CAMAPs in this work share the same architecture  and used this encoding to transform every sequence into a vector of integers representing codons. Neural networks were first developed using the Python package Mariana  [https:/itecture , number null value.For each condition (e.g. context size), the positive and negative datasets were randomly divided into three non-redundant subsets: (i) the training subsets containing 60% of the positive and negative examples, (ii) the validation and (iii) the test subsets each containing 20% of the positive and negative examples. Examples were assigned through a sequence redundancy removal algorithm, thereby ensuring that no example was assigned to multiple subsets. We used an early stopping strategy on validation sets to prevent over-fitting and reported average performances computed on test sets. We trained 12 CAMAPs for each combination of conditions, each one using a different random split of train/validation/test sets. To mask sequences either before or after the MCCs, we masked either half with The Kullback-Leibler (KL) divergence computes how well a given distribution is approximated by another distribution. Its value can be either positive or 0, a null value indicating that the two distributions are identical. Accordingly, a higher KL divergence for codon distributions vs. amino acid distributions would indicate that codon variations are not entirely accounted for by amino acid variations. KL divergence is not a metric, as it is neither symmetric nor does it satisfy the triangle inequality. It is nevertheless an accurate and most common way of comparing two probability distributions.c at position i as a function of the number of occurrences of c at position i, divided by the total number of occurrences of that same codon:We defined the probability of having codon Q is a probability, N is a number of occurrences, c is a codon, y is a class (positive or negative), s indicates if codons have been shuffled , i is a position in sequence. For the remainder of the text we will use the following abbreviations:Here cP distributions approximate cD distributions and cPS distributions approximate cDS distributions.We then used the KL divergence to compute how well The KL divergence was defined as:We performed this calculation for both the original and the shuffled dataset, which we then compared together. If codons and amino acid distributions were equivalent, KL divergence between hits and decoys would be the same for both original and shuffled sequences, and codons would cluster along the diagonal.Preferences are a way of interpreting CAMAP networks that naturally derives from CAMAP\u2019s mathematical formalism. The validity of the preference method for CAMAP has been demonstrated when we used it to define the EP and RP constructs. By following this method, we were able to precisely engineer codon sequences that maximized or minimized the predictions of a CAMAP network. CAMAP only has two processing layers: an embedding layer and an output layer with no latent processing in between. Moreover, the output layer has no bias. In these very specific conditions, the manifold is the embedding layer. The word embedding layer encodes the importance of codons, while the weights of the output layer encode the importance of the position.The output is thus computed as:E is the vector of embeddings for a sequence and W is the weight matrix of the output layer. When masking all codons but one, we obtain the importance (I) of that codon (c) at that position (x):Where Wx are the weights of the output layer for position x. The preference is just this quantity  normalized to a probability (using a Softmax function) for ease of interpretation.Where LogisticRegressionCV or MLPClassifier functions from the python package sklearn . In each case, the dataset containing hits and decoy sequences was split into train and test datasets with a ratio of 0.7 to 0.3, respectively. Values for CAMAP score, Ligand Score and TPM were each scaled to a range of 0\u20131 in the train set using MinMaxScaler from sklearn.preprocessing and the same scaling model was applied to the test set afterwards. Regression analysis was performed using LogisticRegressionCV with a 10x cross-validation using the lbfgs solver with 1000 iterations. MLP with one hidden layer of 1000 neurons was trained using MLPClassifier for 4000 iterations using the adam solver with early stopping. Classes were balanced prior to training for both models. Matthew correlation coefficients were calculated using matthews_corrcoef from sklearn.metrics. When a peptide had multiple sources (multiple transcripts or genes), only the maximum transcript expression is used.The prediction capacity of CAMAP, NetMHCpan-4.0 ligand score and transcription expression (TPM) was tested in different combinations of those parameters  using the An inducible translation reporter was generated by flanking the truncated chicken ovalbumin (OVA) cDNA (amino acids 144\u2013386) with EGFP-P2A (in 5\u2019) and P2A-Ametrine (in 3\u2019) cDNA sequences. MCCs flanking contexts for the EP and RP construct were synthesized as gBlocks (purchased from Integrated DNA Technologies). The fragments were amplified by PCR and joined by Gibson assembly under a doxycycline-inducible Tet-ON promoter in a pCW backbone. Synthetic variants of the OVA coding sequence were generated in silico by varying synonymous codon usage in the MAP context regions (i.e. 162 nucleotides pre- and post-MCCs). Importantly, the amino acid sequence was preserved between the different variants; only nucleotide sequences in the MAP context (162 nucleotides on either side) differed. The sequences with the highest (EP) and the lowest (RP) prediction scores were selected for further in vitro validation and swapped into the iTR-OVA plasmid by Gibson assembly . OVA-EP Important features of our inducible translation reporter construct and T cell activation assay were: (i) No changes in amino acid sequence between the three variants: only co-translational events can differ between the three variants, post-translational events being equivalent for the three constructs; (ii) Only one start codon, at the beginning of the eGFP coding sequence: this is important for the translation reporter aspect of our construct (i.e. Ametrine/eGFP ratio), to ensure that translation can only start at the 5\u2019-end of the whole construct, and not at the beginning of the OVA or Ametrine coding sequences; (iii) Separation of the three proteins using P2A peptide: allows the inducible synthesis of three separate proteins in a highly correlated manner .Lentiviral particles were produced from HEK293T cells by co-transfection of iTR-OVA WT, EP or RP along with pMD2-VSVG, pMDLg/pRRE and pRSV-REV plasmids. Viral supernatants were used for Raw-Kb OVA-EP, OVA-RP and OVA-WT cells were plated at a density of 250,000 cells/well in 24 well-plates 24h prior to doxycycline treatment (1 mg/ml). After the corresponding treatment duration, cells were harvested and fixed using PFA 1% for 10 minutes at room temperature and washed using DMEM 10% FBS. Raw-Kb were then co-cultured  in triplicates with the CD8 T cell hybridoma cell line B3Z cells at a 3:2 ratio for 16h (7.5 x 105 B3Z and 5 x 105 Raw-Kb) in 96 well-plates. Cells were lysed for 20 minutes at room temperature using 50 \u03bcl/well of lysis solution . 170 \u03bcl/well CPRG buffer was added , 50mM Na2HPO4\u20227H20, 35mM NaH2PO4\u2022H20, 9mM KCl, 0.9mM MgSO4\u20227H2O). \u03b2-galactosidase activity was measured at 575 nm using SpectraMax 190 Microplate Reader (Molecular Devices). In parallel, cells were analyzed by flow cytometry using a BD FACS CantoII for eGFP and Ametrine fluorescence.Raw-KS1 Fig2) factors and (b) Kullback-Leibler (KL) divergence between positional distribution of codons and their corresponding amino acid in the shuffled (y axis) VS original (x axis) datasets. For all codons, the shuffled dataset showed greater correlations (A) and smaller KL divergence to their respective amino acid distributions than the original datasets .(A) Pearson correlation (R(TIF)Click here for additional data file.S2 Fig2 > 0.95, compared to only 69% in the original dataset (p < 5x10-5).92% of codons in the shuffled dataset reflecting the amino acids distribution with a R(TIF)Click here for additional data file.S3 Fig(EPS)Click here for additional data file.S4 Fig(EPS)Click here for additional data file.S5 Fig(EPS)Click here for additional data file.S6 Fig(EPS)Click here for additional data file.S7 Fig(EPS)Click here for additional data file.S8 Fig(EPS)Click here for additional data file.S9 Fig(EPS)Click here for additional data file.S10 Fig(EPS)Click here for additional data file.S11 Fig(EPS)Click here for additional data file.S12 Fig(EPS)Click here for additional data file.S13 Fig(EPS)Click here for additional data file.S14 Fig(EPS)Click here for additional data file.S15 Fig(EPS)Click here for additional data file.S16 Fig(EPS)Click here for additional data file.S17 Fig(EPS)Click here for additional data file.S18 Fig(EPS)Click here for additional data file.S19 Fig(EPS)Click here for additional data file.S20 Fig(EPS)Click here for additional data file.S21 Fig(A) Architecture of the ANN used in this work. (B) Results for the AUC on all train, validation and test subsets. Grey areas represent the 95% confidence intervals. (C) Distributions of output probabilities of CAMAPs used to calculate correlations in (TIF)Click here for additional data file.S22 FigFor each sequence in the test set we calculated the average prediction score given by CAMAPs in each condition, and calculated the Pearson correlation using the R software. Densities were calculated on all points and drawn using ggplot2. Only a random subset of the points is represented in the figures to limit their size.(TIF)Click here for additional data file.S23 Fig(TIF)Click here for additional data file.S24 Figp = 5.36 x 10\u22127).(A) Distribution of transcript expression levels for normal datasets (related to (TIF)Click here for additional data file.S25 Fig(TIF)Click here for additional data file.S26 Fig(TIF)Click here for additional data file.S27 Figp = 1.21 x 10\u22129).(A) Distribution of binding affinities for normal dataset (related to (TIF)Click here for additional data file.S28 Fig(A) Proportion of unique MAPs that can be ascribed to a single origin, 2\u20133, 4\u201310 or >10 possible origins. (B) Proportion of entries in the hit dataset that encode for MAPs with a single origin, 2\u20133, 4\u201310 or >10 possible origins(TIF)Click here for additional data file.S29 Fig(TIF)Click here for additional data file.S30 Fig(TIF)Click here for additional data file.S31 FigPearson\u2019s R correlation score is shown on the graphs.(TIF)Click here for additional data file.S32 Figp = 1.07 x 10\u22124).(A) Distribution of transcripts\u2019 GC content for normal dataset (related to (TIF)Click here for additional data file.S33 FigCAMAP was trained using hits from source transcripts and decoys from non-source transcripts only. Significance was assessed using bilateral unpaired T test.(TIF)Click here for additional data file.S34 Fig(A) Transcriptome shuffling: generates shuffled sequences by replacing each codon by one of its synonymous codons (including itself) according to the codon usage within the transcriptome, regardless of the codon used within each example. (B) Codon swap shuffling: synonymous codons present within a given example are swapped with one another. (C) Third nucleotide shuffling or N3: the third nucleotide of codons are swapped within each example to preserve amino acid sequences and GC content. Here, the global codon usage is completely different than normal codon usage in humans, as the frequency of codons is not taken into account during shuffling.(TIF)Click here for additional data file.S35 FigThe performance of CAMAP networks (n = 12) pre-trained on original (non-shuffled) datasets was evaluated on three shuffled datasets according to the methods depicted in (TIF)Click here for additional data file.S36 FigShuffled sequences represent amino acid usage, as codon-specific information are removed with synonymous codon shuffling.(TIF)Click here for additional data file.S37 FigSee (TIF)Click here for additional data file.S38 Fig(A) Comparison of the OVA-EP nucleotide sequence to the wildtype OVA sequence. The OVA-EP and OVA-WT sequences have 93.3% nucleotide identity for a total of 78 modified nucleotides. (B) Comparison of the OVA-RP nucleotide sequence to the wildtype OVA sequence. The OVA-EP and OVA-WT sequences have 92.6% nucleotide identity, for a total of 86 modified nucleotides. Mutations, shown in red, are located only in the 162 nucleotide regions flanking the SIINFEKL coding codons. Of note, the SIINFEKL coding codons (nucleotides 772\u2013799) were not modified between the 3 constructs.(TIF)Click here for additional data file.S39 FigSingle cell eGFP and Ametrine fluorescence intensities measured at 10 hours post-induction are shown for the OVA-WT (A), OVA-EP (B) and OVA-RP (C) constructs. N.B.: only transduced cells are shown (eGFP+ cells).(TIF)Click here for additional data file.S40 Figet al. (2016) using the new versions of MAP binding affinity prediction algorithm NetMHC4.0 (A) and NetMHCpan4.0 (B).Validation of MHC-I associated peptides (MAP) dataset from Pearson H. (TIF)Click here for additional data file.S41 FigC x 2 + 27, where C is the context size in nucleotides and 27 the length of the MCCs. Related to Transcript length corresponds to (TIF)Click here for additional data file.S1 TableSIINFEKL MCCs are shown in bold, while the variant regions  are in blue and italics. Related to (DOCX)Click here for additional data file.S2 TableThe lower the number of peptides needed to capture the respective number of epitopes, the better the performance of the prediction model. This is also illustrated by the percentage of false identification  reported here. Peptides were rank ordered according to regression scores. Of note, only the maximal transcript expression was used for peptides with multiple potential origins.(DOCX)Click here for additional data file.S3 TableThe lower the number of peptides needed to capture the respective number of epitopes, the better the performance of the prediction model. This is also illustrated by the percentage of false identification  reported here. The non-linear classifier led to better predictions when using ligand score and transcript expression, with or without CAMAP scores compared to logistic regression model. Peptides were rank ordered according to regression scores. Of note, only the maximal transcript expression was used for peptides with multiple potential origins.(DOCX)Click here for additional data file.", "texts": ["CAMAP predictions were significantly more accurate when using original codon sequences than shuffled codon sequences which reflect amino acid usage. Furthermore, predictions were independent of mRNA expression and MAP binding affinity to MHC-I molecules and applied to several cell types and species. Combining MAP ligand scores, transcript expression level and CAMAP scores was particularly useful to increase MAP prediction accuracy. Using an in vitro assay, we showed that varying the synonymous codons in the regions flanking the MCCs (without changing the amino acid sequence) resulted in significant modulation of MAP presentation at the cell surface. Taken together, our results demonstrate the role of codon arrangement in the regulation of MAP presentation and support integration of both translational and post-translational events in predictive algorithms to ameliorate modeling of the immunopeptidome.MHC-I associated peptides (MAPs) play a central role in the elimination of virus-infected and neoplastic cells by CD8 T cells. However, accurately predicting the MAP repertoire remains difficult, because only a fraction of the transcriptome generates MAPs. In this study, we investigated whether codon arrangement (usage and placement) regulates MAP biogenesis. We developed an artificial neural network called Codon Arrangement MAP Predictor (CAMAP), predicting MAP presentation solely from mRNA sequences flanking the MAP-coding codons (MCCs), while excluding the MCC  per se, CAMAP\u2019s novelty is to analyze the MAP-flanking mRNA sequences, thereby providing completely independent information for MAP prediction. We show on several datasets that the integration of CAMAP scores with other known factors involved in MAP presentation (i.e. MAP ligand score and mRNA expression) significantly improves MAP prediction accuracy, and further validate CAMAP learned features using an in-vitro assay. These findings may have major implications for the design of vaccines against cancers and viruses, and in times of pandemics could accelerate the identification of relevant MAPs of viral origins.MHC-I associated peptides (MAPs) are small fragments of intracellular proteins presented at the surface of cells and used by the immune system to detect and eliminate cancerous or virus-infected cells. While it is theoretically possible to predict which portions of the intracellular proteins will be naturally processed by the cells to ultimately reach the surface, current methodologies have prohibitively high false discovery rates. Here we introduce an artificial neural network called Codon Arrangement MAP Predictor (CAMAP) which integrates information from mRNA-to-protein translation to other factors regulating MAP biogenesis (e.g. MAP ligand score and transcript expression levels) to improve MAP prediction accuracy. While most MAP predictive approaches focus on MAP sequences  PLOS Computational Biology Methods paper.This is a In jawed vertebrates, virtually all nucleated cells present at their surface major histocompatibility complex class-I (MHC-I) associated peptides (MAPs), collectively referred to as the immunopeptidome ,2. MAPs The generation of the immunopeptidome can be conceptualized in two main events: (a) the generation of MAP candidates (i.e. peptides of appropriate length for MHC-I presentation) through protein degradation, and (b) a subsequent filtering step through the binding of MAP candidates to the available MHC-I molecules. Rules that regulate the second event have been well characterized using artificial neural networks (ANN) and weighted matrix approaches ,8. HowevA large body of evidence suggests that a substantial portion of MAPs are produced co-translationally \u201315, deriper se from our positive (hits) and negative (decoys) sequences  by a total of 33 MHC-I alleles from 18 subjects ,22. Becaequences . To faci2 > 0.95) with the amino acid distribution, compared to only 69% in the original dataset  in which original codon sequences were randomly replaced by synonymous codons according to their usage frequency in the human transcriptome . This trTo assess the importance of codon usage in MAP biogenesis, we reasoned that if codons bear important information that is operative at the translational rather than the post-translational level, then: (i) CAMAP trained to identify MCCs flanking regions should consistently perform better when trained on original codon sequences than on shuffled codon sequences (reflecting amino acid sequences), and (ii) synonymous codons should have different effects on the prediction. To test these hypotheses, CAMAP received as inputs MCCs flanking regions from hit and decoy sequences from either the original or shuffled datasets. It was then trained to predict the probability that individual input sequences were MCCs flanking regions (i.e. hit) rather than sequences from the negative dataset . We first evaluated MAPs that could originate from different transcripts within the transcriptome (i.e. transcripts with sufficient expression levels detected by RNA sequencing) as they are likely to represent conserved regions in the genome. While 79.9% of MAPs originated from unique contexts , only 2.\u221216, Non-source transcripts have been previously associated with higher GC content . To evalPrevious studies have shown that codon bias plays a significant role in translation efficiency (TE) by co-adaptation to the tRNA pool ,26. This-16, We evaluated whether CAMAP would still be predictive for negative examples (decoys) derived from source transcripts. While most decoys derived from source transcripts showed a CAMAP score above 0.5 and are thus classified as source, they still had a lower CAMAP score compared to hits from source transcripts  in CAMAP\u2019s predictions. The shuffling method used above Figs  and 2 ge\u22124). This could be due to the limited number of synonymous codons available for swapping within a single example. This also suggests that the overall codon composition of the MAP-flanking sequences has more impact on CAMAP predictions than the codons\u2019 position within the MAP-flanking sequences. The third nucleotide shuffling also decreased CAMAP performances (mean AUC of 0.676) but remained above that of the transcriptome shuffled dataset (mean AUC of 0.647). These results suggest that the GC content has a significant impact on CAMAP performances, as the codon swap and third nucleotide shuffling both preserves the GC content within each example, while the transcriptome shuffling does not. This is also supported by the negative correlation between GC content and CAMAP scores, as shown in As shown in Taken together, these results support a role for codon arrangements, and especially for codon usage in the regulation of MAP biogenesis which cannot be reduced to codon\u2019s impact on gene expression levels, GC content or translation efficiency.We next validated our CAMAP trained on 9-mer MAPs derived from B-LCL using 5 datasets derived from different human and mouse cell types. All the validation datasets were described through proteogenomic analyses similarly to our B-LCL training datasets. However, all the validation datasets included MAPs of 8\u201311 mers, in contrast with the training dataset that contained only 9-mer MAPs. The validation datasets consisted of (i) our B-LCL dataset, this time including all peptide lengths ,22, (ii)The lower performances of CAMAP trained with shuffled sequences (representing amino acid distribution) suggests that amino acids in MAP-flanking sequences are less informative than codons regarding MAP presentation. We formally quantified this difference in information using the Kullback-Leibler (KL) divergence see . These rWe wondered whether some regions were more influential on MAP presentation than others. To address this question, we retrieved the model preferences for each codon at each position. The preferences correspond to the prediction score of our best model  when a single codon at a single position is provided as input  and mRNA transcript expression levels. We used ligand scores as predicted by NetMHCpan4.0, which was shown to possess the best predictive capacities for naturally processed peptides compared to other predictive algorithms . Becauseper se. We thus additionally assessed the value of each prediction method using a multi-layer perceptron (MLP) classifier. Results show that for all of them, adding CAMAP score to the input improves prediction accuracy  and CAMAP scores third, . As expeaccuracy . Similaraccuracy . Interesin silico, both encoding for the same OVA protein but using different synonymous codons: one predicted to enhance SIINFEKL presentation (OVA-EP), the other predicted to reduce it (OVA-RP). Accordingly, the respective CAMAP scores for OVA-RP, OVA-WT and OVA-EP were: 0.03, 0.65, and 0.96  protein containing the model MAP SIINFEKL . One conand 0.96 . All varBecause codon usage affects translation efficiency, theoretically leading to DRiP formation through premature translation arrest ,21, we eb specific T-cell activation assay  and reimplemented identically for this work using pyTorch (results presented herein derive from the pyTorch version). An Embedding layer was used to associate each label superior to 0 to a set of 2D trainable parameters; the 0 label represents a null (masking) embedding fixed at coordinates . As an output layer, we used a Softmax layer with two outputs (positive / negative). Because negative sequences are more numerous than positive ones, we used an oversampling strategy during training. At each epoch, CAMAPs were randomly presented with the same number of positive and negative sequences. All CAMAPs in this work share the same architecture  and used this encoding to transform every sequence into a vector of integers representing codons. Neural networks were first developed using the Python package Mariana  [https:/itecture , number null value.For each condition (e.g. context size), the positive and negative datasets were randomly divided into three non-redundant subsets: (i) the training subsets containing 60% of the positive and negative examples, (ii) the validation and (iii) the test subsets each containing 20% of the positive and negative examples. Examples were assigned through a sequence redundancy removal algorithm, thereby ensuring that no example was assigned to multiple subsets. We used an early stopping strategy on validation sets to prevent over-fitting and reported average performances computed on test sets. We trained 12 CAMAPs for each combination of conditions, each one using a different random split of train/validation/test sets. To mask sequences either before or after the MCCs, we masked either half with The Kullback-Leibler (KL) divergence computes how well a given distribution is approximated by another distribution. Its value can be either positive or 0, a null value indicating that the two distributions are identical. Accordingly, a higher KL divergence for codon distributions vs. amino acid distributions would indicate that codon variations are not entirely accounted for by amino acid variations. KL divergence is not a metric, as it is neither symmetric nor does it satisfy the triangle inequality. It is nevertheless an accurate and most common way of comparing two probability distributions.c at position i as a function of the number of occurrences of c at position i, divided by the total number of occurrences of that same codon:We defined the probability of having codon Q is a probability, N is a number of occurrences, c is a codon, y is a class (positive or negative), s indicates if codons have been shuffled , i is a position in sequence. For the remainder of the text we will use the following abbreviations:Here cP distributions approximate cD distributions and cPS distributions approximate cDS distributions.We then used the KL divergence to compute how well The KL divergence was defined as:We performed this calculation for both the original and the shuffled dataset, which we then compared together. If codons and amino acid distributions were equivalent, KL divergence between hits and decoys would be the same for both original and shuffled sequences, and codons would cluster along the diagonal.Preferences are a way of interpreting CAMAP networks that naturally derives from CAMAP\u2019s mathematical formalism. The validity of the preference method for CAMAP has been demonstrated when we used it to define the EP and RP constructs. By following this method, we were able to precisely engineer codon sequences that maximized or minimized the predictions of a CAMAP network. CAMAP only has two processing layers: an embedding layer and an output layer with no latent processing in between. Moreover, the output layer has no bias. In these very specific conditions, the manifold is the embedding layer. The word embedding layer encodes the importance of codons, while the weights of the output layer encode the importance of the position.The output is thus computed as:E is the vector of embeddings for a sequence and W is the weight matrix of the output layer. When masking all codons but one, we obtain the importance (I) of that codon (c) at that position (x):Where Wx are the weights of the output layer for position x. The preference is just this quantity  normalized to a probability (using a Softmax function) for ease of interpretation.Where LogisticRegressionCV or MLPClassifier functions from the python package sklearn . In each case, the dataset containing hits and decoy sequences was split into train and test datasets with a ratio of 0.7 to 0.3, respectively. Values for CAMAP score, Ligand Score and TPM were each scaled to a range of 0\u20131 in the train set using MinMaxScaler from sklearn.preprocessing and the same scaling model was applied to the test set afterwards. Regression analysis was performed using LogisticRegressionCV with a 10x cross-validation using the lbfgs solver with 1000 iterations. MLP with one hidden layer of 1000 neurons was trained using MLPClassifier for 4000 iterations using the adam solver with early stopping. Classes were balanced prior to training for both models. Matthew correlation coefficients were calculated using matthews_corrcoef from sklearn.metrics. When a peptide had multiple sources (multiple transcripts or genes), only the maximum transcript expression is used.The prediction capacity of CAMAP, NetMHCpan-4.0 ligand score and transcription expression (TPM) was tested in different combinations of those parameters  using the An inducible translation reporter was generated by flanking the truncated chicken ovalbumin (OVA) cDNA (amino acids 144\u2013386) with EGFP-P2A (in 5\u2019) and P2A-Ametrine (in 3\u2019) cDNA sequences. MCCs flanking contexts for the EP and RP construct were synthesized as gBlocks (purchased from Integrated DNA Technologies). The fragments were amplified by PCR and joined by Gibson assembly under a doxycycline-inducible Tet-ON promoter in a pCW backbone. Synthetic variants of the OVA coding sequence were generated in silico by varying synonymous codon usage in the MAP context regions (i.e. 162 nucleotides pre- and post-MCCs). Importantly, the amino acid sequence was preserved between the different variants; only nucleotide sequences in the MAP context (162 nucleotides on either side) differed. The sequences with the highest (EP) and the lowest (RP) prediction scores were selected for further in vitro validation and swapped into the iTR-OVA plasmid by Gibson assembly . OVA-EP Important features of our inducible translation reporter construct and T cell activation assay were: (i) No changes in amino acid sequence between the three variants: only co-translational events can differ between the three variants, post-translational events being equivalent for the three constructs; (ii) Only one start codon, at the beginning of the eGFP coding sequence: this is important for the translation reporter aspect of our construct (i.e. Ametrine/eGFP ratio), to ensure that translation can only start at the 5\u2019-end of the whole construct, and not at the beginning of the OVA or Ametrine coding sequences; (iii) Separation of the three proteins using P2A peptide: allows the inducible synthesis of three separate proteins in a highly correlated manner .Lentiviral particles were produced from HEK293T cells by co-transfection of iTR-OVA WT, EP or RP along with pMD2-VSVG, pMDLg/pRRE and pRSV-REV plasmids. Viral supernatants were used for Raw-Kb OVA-EP, OVA-RP and OVA-WT cells were plated at a density of 250,000 cells/well in 24 well-plates 24h prior to doxycycline treatment (1 mg/ml). After the corresponding treatment duration, cells were harvested and fixed using PFA 1% for 10 minutes at room temperature and washed using DMEM 10% FBS. Raw-Kb were then co-cultured  in triplicates with the CD8 T cell hybridoma cell line B3Z cells at a 3:2 ratio for 16h (7.5 x 105 B3Z and 5 x 105 Raw-Kb) in 96 well-plates. Cells were lysed for 20 minutes at room temperature using 50 \u03bcl/well of lysis solution . 170 \u03bcl/well CPRG buffer was added , 50mM Na2HPO4\u20227H20, 35mM NaH2PO4\u2022H20, 9mM KCl, 0.9mM MgSO4\u20227H2O). \u03b2-galactosidase activity was measured at 575 nm using SpectraMax 190 Microplate Reader (Molecular Devices). In parallel, cells were analyzed by flow cytometry using a BD FACS CantoII for eGFP and Ametrine fluorescence.Raw-KS1 Fig2) factors and (b) Kullback-Leibler (KL) divergence between positional distribution of codons and their corresponding amino acid in the shuffled (y axis) VS original (x axis) datasets. For all codons, the shuffled dataset showed greater correlations (A) and smaller KL divergence to their respective amino acid distributions than the original datasets .(A) Pearson correlation (R(TIF)Click here for additional data file.S2 Fig2 > 0.95, compared to only 69% in the original dataset (p < 5x10-5).92% of codons in the shuffled dataset reflecting the amino acids distribution with a R(TIF)Click here for additional data file.S3 Fig(EPS)Click here for additional data file.S4 Fig(EPS)Click here for additional data file.S5 Fig(EPS)Click here for additional data file.S6 Fig(EPS)Click here for additional data file.S7 Fig(EPS)Click here for additional data file.S8 Fig(EPS)Click here for additional data file.S9 Fig(EPS)Click here for additional data file.S10 Fig(EPS)Click here for additional data file.S11 Fig(EPS)Click here for additional data file.S12 Fig(EPS)Click here for additional data file.S13 Fig(EPS)Click here for additional data file.S14 Fig(EPS)Click here for additional data file.S15 Fig(EPS)Click here for additional data file.S16 Fig(EPS)Click here for additional data file.S17 Fig(EPS)Click here for additional data file.S18 Fig(EPS)Click here for additional data file.S19 Fig(EPS)Click here for additional data file.S20 Fig(EPS)Click here for additional data file.S21 Fig(A) Architecture of the ANN used in this work. (B) Results for the AUC on all train, validation and test subsets. Grey areas represent the 95% confidence intervals. (C) Distributions of output probabilities of CAMAPs used to calculate correlations in (TIF)Click here for additional data file.S22 FigFor each sequence in the test set we calculated the average prediction score given by CAMAPs in each condition, and calculated the Pearson correlation using the R software. Densities were calculated on all points and drawn using ggplot2. Only a random subset of the points is represented in the figures to limit their size.(TIF)Click here for additional data file.S23 Fig(TIF)Click here for additional data file.S24 Figp = 5.36 x 10\u22127).(A) Distribution of transcript expression levels for normal datasets (related to (TIF)Click here for additional data file.S25 Fig(TIF)Click here for additional data file.S26 Fig(TIF)Click here for additional data file.S27 Figp = 1.21 x 10\u22129).(A) Distribution of binding affinities for normal dataset (related to (TIF)Click here for additional data file.S28 Fig(A) Proportion of unique MAPs that can be ascribed to a single origin, 2\u20133, 4\u201310 or >10 possible origins. (B) Proportion of entries in the hit dataset that encode for MAPs with a single origin, 2\u20133, 4\u201310 or >10 possible origins(TIF)Click here for additional data file.S29 Fig(TIF)Click here for additional data file.S30 Fig(TIF)Click here for additional data file.S31 FigPearson\u2019s R correlation score is shown on the graphs.(TIF)Click here for additional data file.S32 Figp = 1.07 x 10\u22124).(A) Distribution of transcripts\u2019 GC content for normal dataset (related to (TIF)Click here for additional data file.S33 FigCAMAP was trained using hits from source transcripts and decoys from non-source transcripts only. Significance was assessed using bilateral unpaired T test.(TIF)Click here for additional data file.S34 Fig(A) Transcriptome shuffling: generates shuffled sequences by replacing each codon by one of its synonymous codons (including itself) according to the codon usage within the transcriptome, regardless of the codon used within each example. (B) Codon swap shuffling: synonymous codons present within a given example are swapped with one another. (C) Third nucleotide shuffling or N3: the third nucleotide of codons are swapped within each example to preserve amino acid sequences and GC content. Here, the global codon usage is completely different than normal codon usage in humans, as the frequency of codons is not taken into account during shuffling.(TIF)Click here for additional data file.S35 FigThe performance of CAMAP networks (n = 12) pre-trained on original (non-shuffled) datasets was evaluated on three shuffled datasets according to the methods depicted in (TIF)Click here for additional data file.S36 FigShuffled sequences represent amino acid usage, as codon-specific information are removed with synonymous codon shuffling.(TIF)Click here for additional data file.S37 FigSee (TIF)Click here for additional data file.S38 Fig(A) Comparison of the OVA-EP nucleotide sequence to the wildtype OVA sequence. The OVA-EP and OVA-WT sequences have 93.3% nucleotide identity for a total of 78 modified nucleotides. (B) Comparison of the OVA-RP nucleotide sequence to the wildtype OVA sequence. The OVA-EP and OVA-WT sequences have 92.6% nucleotide identity, for a total of 86 modified nucleotides. Mutations, shown in red, are located only in the 162 nucleotide regions flanking the SIINFEKL coding codons. Of note, the SIINFEKL coding codons (nucleotides 772\u2013799) were not modified between the 3 constructs.(TIF)Click here for additional data file.S39 FigSingle cell eGFP and Ametrine fluorescence intensities measured at 10 hours post-induction are shown for the OVA-WT (A), OVA-EP (B) and OVA-RP (C) constructs. N.B.: only transduced cells are shown (eGFP+ cells).(TIF)Click here for additional data file.S40 Figet al. (2016) using the new versions of MAP binding affinity prediction algorithm NetMHC4.0 (A) and NetMHCpan4.0 (B).Validation of MHC-I associated peptides (MAP) dataset from Pearson H. (TIF)Click here for additional data file.S41 FigC x 2 + 27, where C is the context size in nucleotides and 27 the length of the MCCs. Related to Transcript length corresponds to (TIF)Click here for additional data file.S1 TableSIINFEKL MCCs are shown in bold, while the variant regions  are in blue and italics. Related to (DOCX)Click here for additional data file.S2 TableThe lower the number of peptides needed to capture the respective number of epitopes, the better the performance of the prediction model. This is also illustrated by the percentage of false identification  reported here. Peptides were rank ordered according to regression scores. Of note, only the maximal transcript expression was used for peptides with multiple potential origins.(DOCX)Click here for additional data file.S3 TableThe lower the number of peptides needed to capture the respective number of epitopes, the better the performance of the prediction model. This is also illustrated by the percentage of false identification  reported here. The non-linear classifier led to better predictions when using ligand score and transcript expression, with or without CAMAP scores compared to logistic regression model. Peptides were rank ordered according to regression scores. Of note, only the maximal transcript expression was used for peptides with multiple potential origins.(DOCX)Click here for additional data file."]}
-{"representative": "The forensic toxicologist is challenged to provide scientific evidence to distinguish the source of ethanol  determined in the postmortem blood and to properly interpret the relevant blood alcohol concentration (BAC) results, in regard to ethanol levels at death and subsequent behavioral impairment of the person at the time of death. Higher alcohols , and 3-methyl-2-butanol ) are among the volatile compounds that are often detected in postmortem specimens and have been correlated with putrefaction and microbial activity. This brief review investigates the role of the higher alcohols as biomarkers of postmortem, microbial ethanol production, notably, regarding the modeling of postmortem ethanol production. Main conclusions of this contribution are, firstly, that the higher alcohols are qualitative and quantitative indicators of microbial ethanol production, and, secondly that the respective models of microbial ethanol production are tools offering additional data to interpret properly the origin of the ethanol concentrations measured in postmortem cases. More studies are needed to clarify current uncertainties about the origin of higher alcohols in postmortem specimens.  Blood ethanol analysis is the most frequent test performed in a forensic toxicology laboratory, as part of the investigation process of death, accident, or crime. The applied analytical procedures are rather simple and provide accurate, specific, and precise results on ethanol concentration. The relative analytical data are used to support the forensic evidence, as part of the judicial inquiry, in relation to the inter-relation between the consumption of alcoholic beverages, the measured blood ethanol concentration, and the impairment of body functions ,2,3. ParThe possible sources of ethanol detected in postmortem specimens could be either antemortem ingestion by a living person who consumed alcoholic beverages, or antemortem endogenous production due to microbial fermentation in the intestine (\u201cauto brewery\u201d syndrome ), or posTherefore, the discrimination of the source of ethanol, ante mortem ingestion or postmortem microbial production, is of vital importance for the proper interpretation of postmortem BAC results. It is the forensic toxicologist who is challenged to provide the relative, available scientific evidence on the ethanol levels at death and the subsequent behavioral impairment of the person at the time of death ,3,5,6.Factors, such as the putrefaction state of the cadaver at autopsy, the clinical history of the deceased, the determination of glucose levels, the identification of microbes in the analyzed sample, and the evaluation of the discrepancies between ethanol concentration from various sampling sites and from different specimens, have been used to evaluate the origin of the measured ethanol, in the effort to achieve feasible accuracy in interpreting the postmortem ethanol analysis results ,2,3,6. FThe detection of low molecular weight volatiles in human specimens has been related, for decades, with microbial activity and ethanol neoformation, while their presence in postmortem specimens has been correlated with putrefaction and microbial activity . Among tE. coli . Th. Th39]. Two more studies have reported blood ethanol and 1-propanol concentrations from postmortem cases  13,40].,40.13,40Many studies reported on the microbial ethanol generation post-sampling in postmortem samples ,3,6. On At this point, it should be mentioned that the increased temperature and the duration of storage are recognized as the premium influencing factors of the post-sampling alcohol production , besidesThe higher alcohols, 1-propanol, isobutanol, 1-butanol, and 3-methyl-1-butanol, are among the primarily targeted congeners during the alcohol congener analysis workflow and evaluation ,50. PartIn As could be concluded from As was already mentioned, the higher alcohol mostly correlated to putrefaction and microbial ethanol production is 1-propanol ,16,18,19More recently, another semi-quantitative approach, the 1-propanol concentration of 0.104 mg/dL (the \u201c1-propanol criterion\u201d), was suggested as an effective threshold concentration (\u201ccut-off\u201d) for \u201cflagging\u201d an autopsy blood sample as positive or \u201cnegative\u201d for postmortem ethanol production . It was The approach of \u201cmodeling microbial (postmortem) ethanol production\u201d has considered all the higher alcohols  as quantitative biomarkers of postmortem ethanol production ,34,35,36E. faecalis cultures, where 1-butanol preceded the other higher alcohols. This observation probably explains why 1-propanol is the most studied higher alcohol in postmortem cases, given that bacteria are the most common inhabitants of a dead body and that they, usually, invade first the different body compartments after death [The first stage of the modeling procedure was the development of bacterial, clostridial, and fungal cultures under controlled laboratory conditions, selected to approximate the conditions after death, and the recording of the concentrations of ethanol and higher alcohols produced by the microbes ,34,35,36er death ,27,37,38C. perfrigens and C. sporogenes) produced more 1-butanol than 1-propanol. This observation probably indicates that clostridia prefer the butyrate-butanol-acetate fermentation pathway, which produces 1-butanol directly from carbohydrates  predominated against 1-propanol\u2019s levels, while 1-butanol levels were negligible. Therefore, it is reasonable to conclude that C. albicans, under the applied laboratory conditions, prefer the synthesis of branched higher alcohols than the neoformation of 1-propanol. This aspect differentiates fungal cultures [C. sporogenes). Secondly, the concentrations of 1-butanol are higher in the cultures than in postmortem cases, while some postmortem cases have 1-butanol levels as high as those determined for the C. sporogenes cultures. Thirdly, 1-propanol concentrations in cultures are within the range of 1-propanol reported usually for postmortem cases  to 100% . It became apparent, as is already known [The initial glucose levels to the BHI and SDB culture media , and isobutanol, are quantitative indicators of microbial ethanol production. Furthermore, the quantitative relationships between the microbial higher alcohols\u2019 concentrations and the microbial ethanol\u2019 concentrations, as expressed by the suggested models, allow the estimation of the postmortem neoformed ethanol concentrationThe applicability of the constructed models was tested in a series of autopsy blood samples where ethanol was detected simultaneously with at least one higher alcohol ,34,35,36S. aureus models [E. coli models [C. sporogenes and C. perfrigens models achieved the predefined score in 45% to 68% of the cases, respectively [E. coli models, and in 85% of the cases by the clostridia ones [E. coli, E. faecalis, C. perfrigens, and C. sporogenes models achieved the score in more than 95% of the cases [The relevant studies reported that the bacterial models succeeded the predefined score (E < \u00b140%) in 19% of the cases for the s models , up to 4i models ,34. The ectively . When eadia ones ,34. Whenhe cases ,34,35. Fhe cases . Althoughe cases , in posthe cases  developeSo far, the most studied and the most abundant higher alcohol in postmortem cases is 1-propanol. However, it is not the only higher alcohol which indicates microbial ethanol production. The five higher alcohols, 1-propanol, 1-butanol, isobutanol, 3-methyl-2-butanol , and 2-methyl-1-butanol , are qualitative and quantitative indicators of microbial ethanol production, as it is indicated by the respective bacterial, clostridial, and fungal ethanol production models.The models of microbial ethanol production are tools offering additional data to properly interpret BAC in postmortem cases, as well as to define the origin of ethanol in the sample. The employed, relatively simple linear models for estimating microbial ethanol production provide a noteworthy accuracy in cultures and autopsy blood.In the view of this review, the proper interpretation of postmortem ethanol analysis results should follow a step-by-step approach to estimate the suggested in the literature indicators, starting from the more easily obtainable, the detection of 1-propanol, isobutanol, methyl-butanols, and 1-butanol, during the chromatographic ethanol analysis. Then, the microbial models should be used to calculate the microbial generated ethanol and, subsequently, to evaluate the results in relation to case specific characteristics, such as putrefaction state, clinical history, and others. Finally, more selective analyses, providing more elaborate indicators of the ethanol origin , could be performed, to provide complementary data that would aim accurate interpretation of postmortem BAC.In conclusion, the evaluation of the postmortem BAC remains a complicated, multifunctional procedure. Needless to underline that more studies should be performed regarding the levels of higher alcohols in postmortem and ante mortem cases, to document the extent of applicability of the suggested models, to achieve feasible accuracy in interpreting the results of ethanol analysis, and to estimate the BAC origin in postmortem samples with increased certainty.", "texts": ["The forensic toxicologist is challenged to provide scientific evidence to distinguish the source of ethanol  determined in the postmortem blood and to properly interpret the relevant blood alcohol concentration (BAC) results, in regard to ethanol levels at death and subsequent behavioral impairment of the person at the time of death. Higher alcohols , and 3-methyl-2-butanol ) are among the volatile compounds that are often detected in postmortem specimens and have been correlated with putrefaction and microbial activity. This brief review investigates the role of the higher alcohols as biomarkers of postmortem, microbial ethanol production, notably, regarding the modeling of postmortem ethanol production. Main conclusions of this contribution are, firstly, that the higher alcohols are qualitative and quantitative indicators of microbial ethanol production, and, secondly that the respective models of microbial ethanol production are tools offering additional data to interpret properly the origin of the ethanol concentrations measured in postmortem cases. More studies are needed to clarify current uncertainties about the origin of higher alcohols in postmortem specimens.  Blood ethanol analysis is the most frequent test performed in a forensic toxicology laboratory, as part of the investigation process of death, accident, or crime. The applied analytical procedures are rather simple and provide accurate, specific, and precise results on ethanol concentration. The relative analytical data are used to support the forensic evidence, as part of the judicial inquiry, in relation to the inter-relation between the consumption of alcoholic beverages, the measured blood ethanol concentration, and the impairment of body functions ,2,3. ParThe possible sources of ethanol detected in postmortem specimens could be either antemortem ingestion by a living person who consumed alcoholic beverages, or antemortem endogenous production due to microbial fermentation in the intestine (\u201cauto brewery\u201d syndrome ), or posTherefore, the discrimination of the source of ethanol, ante mortem ingestion or postmortem microbial production, is of vital importance for the proper interpretation of postmortem BAC results. It is the forensic toxicologist who is challenged to provide the relative, available scientific evidence on the ethanol levels at death and the subsequent behavioral impairment of the person at the time of death ,3,5,6.Factors, such as the putrefaction state of the cadaver at autopsy, the clinical history of the deceased, the determination of glucose levels, the identification of microbes in the analyzed sample, and the evaluation of the discrepancies between ethanol concentration from various sampling sites and from different specimens, have been used to evaluate the origin of the measured ethanol, in the effort to achieve feasible accuracy in interpreting the postmortem ethanol analysis results ,2,3,6. FThe detection of low molecular weight volatiles in human specimens has been related, for decades, with microbial activity and ethanol neoformation, while their presence in postmortem specimens has been correlated with putrefaction and microbial activity . Among tE. coli . Th. Th39]. Two more studies have reported blood ethanol and 1-propanol concentrations from postmortem cases  13,40].,40.13,40Many studies reported on the microbial ethanol generation post-sampling in postmortem samples ,3,6. On At this point, it should be mentioned that the increased temperature and the duration of storage are recognized as the premium influencing factors of the post-sampling alcohol production , besidesThe higher alcohols, 1-propanol, isobutanol, 1-butanol, and 3-methyl-1-butanol, are among the primarily targeted congeners during the alcohol congener analysis workflow and evaluation ,50. PartIn As could be concluded from As was already mentioned, the higher alcohol mostly correlated to putrefaction and microbial ethanol production is 1-propanol ,16,18,19More recently, another semi-quantitative approach, the 1-propanol concentration of 0.104 mg/dL (the \u201c1-propanol criterion\u201d), was suggested as an effective threshold concentration (\u201ccut-off\u201d) for \u201cflagging\u201d an autopsy blood sample as positive or \u201cnegative\u201d for postmortem ethanol production . It was The approach of \u201cmodeling microbial (postmortem) ethanol production\u201d has considered all the higher alcohols  as quantitative biomarkers of postmortem ethanol production ,34,35,36E. faecalis cultures, where 1-butanol preceded the other higher alcohols. This observation probably explains why 1-propanol is the most studied higher alcohol in postmortem cases, given that bacteria are the most common inhabitants of a dead body and that they, usually, invade first the different body compartments after death [The first stage of the modeling procedure was the development of bacterial, clostridial, and fungal cultures under controlled laboratory conditions, selected to approximate the conditions after death, and the recording of the concentrations of ethanol and higher alcohols produced by the microbes ,34,35,36er death ,27,37,38C. perfrigens and C. sporogenes) produced more 1-butanol than 1-propanol. This observation probably indicates that clostridia prefer the butyrate-butanol-acetate fermentation pathway, which produces 1-butanol directly from carbohydrates  predominated against 1-propanol\u2019s levels, while 1-butanol levels were negligible. Therefore, it is reasonable to conclude that C. albicans, under the applied laboratory conditions, prefer the synthesis of branched higher alcohols than the neoformation of 1-propanol. This aspect differentiates fungal cultures [C. sporogenes). Secondly, the concentrations of 1-butanol are higher in the cultures than in postmortem cases, while some postmortem cases have 1-butanol levels as high as those determined for the C. sporogenes cultures. Thirdly, 1-propanol concentrations in cultures are within the range of 1-propanol reported usually for postmortem cases  to 100% . It became apparent, as is already known [The initial glucose levels to the BHI and SDB culture media , and isobutanol, are quantitative indicators of microbial ethanol production. Furthermore, the quantitative relationships between the microbial higher alcohols\u2019 concentrations and the microbial ethanol\u2019 concentrations, as expressed by the suggested models, allow the estimation of the postmortem neoformed ethanol concentrationThe applicability of the constructed models was tested in a series of autopsy blood samples where ethanol was detected simultaneously with at least one higher alcohol ,34,35,36S. aureus models [E. coli models [C. sporogenes and C. perfrigens models achieved the predefined score in 45% to 68% of the cases, respectively [E. coli models, and in 85% of the cases by the clostridia ones [E. coli, E. faecalis, C. perfrigens, and C. sporogenes models achieved the score in more than 95% of the cases [The relevant studies reported that the bacterial models succeeded the predefined score (E < \u00b140%) in 19% of the cases for the s models , up to 4i models ,34. The ectively . When eadia ones ,34. Whenhe cases ,34,35. Fhe cases . Althoughe cases , in posthe cases  developeSo far, the most studied and the most abundant higher alcohol in postmortem cases is 1-propanol. However, it is not the only higher alcohol which indicates microbial ethanol production. The five higher alcohols, 1-propanol, 1-butanol, isobutanol, 3-methyl-2-butanol , and 2-methyl-1-butanol , are qualitative and quantitative indicators of microbial ethanol production, as it is indicated by the respective bacterial, clostridial, and fungal ethanol production models.The models of microbial ethanol production are tools offering additional data to properly interpret BAC in postmortem cases, as well as to define the origin of ethanol in the sample. The employed, relatively simple linear models for estimating microbial ethanol production provide a noteworthy accuracy in cultures and autopsy blood.In the view of this review, the proper interpretation of postmortem ethanol analysis results should follow a step-by-step approach to estimate the suggested in the literature indicators, starting from the more easily obtainable, the detection of 1-propanol, isobutanol, methyl-butanols, and 1-butanol, during the chromatographic ethanol analysis. Then, the microbial models should be used to calculate the microbial generated ethanol and, subsequently, to evaluate the results in relation to case specific characteristics, such as putrefaction state, clinical history, and others. Finally, more selective analyses, providing more elaborate indicators of the ethanol origin , could be performed, to provide complementary data that would aim accurate interpretation of postmortem BAC.In conclusion, the evaluation of the postmortem BAC remains a complicated, multifunctional procedure. Needless to underline that more studies should be performed regarding the levels of higher alcohols in postmortem and ante mortem cases, to document the extent of applicability of the suggested models, to achieve feasible accuracy in interpreting the results of ethanol analysis, and to estimate the BAC origin in postmortem samples with increased certainty."]}
-{"representative": "Traumatic myositis ossificans (MO) is an unusual complication after muscle injury and is predominantly seen in young adults and adolescents. Pediatric MO cases are even rarer. We report an 8-year-old girl who was diagnosed with a lateral humeral condyle fracture. She was treated surgically, and her elbow joint was fixed with plaster. Rehabilitation exercise was administered 1 month after the operation. Due to the wrong exercise method, a palpable bony mass appeared around the elbow 1 month later. The clinical radiological diagnosis showed MO, and conservative treatment was administered. After 3 years of follow-up, the affected limb functioned well, with no sign of recurrence. Here, we report this long-term follow-up case of MO resulting from excessive rehabilitation exercise. Myositis ossificans (MO) is a benign tumor-like lesion, which is predominantly seen in young adults and adolescents. Pediatric MO cases are even rarer . Approxivia X-ray radiography  was made directly on the lateral condyle of the humerus on the outside of the elbow joint under aseptic conditions. After separating the skin and fascia layer by layer, the fracture ends were exposed. After clearing the congestion and reducing the incarcerated soft tissue, three K-wires were used to fix the fracture. The results from intraoperative fluoroscopy showed a good reduction. The lateral collateral ligament was examined to confirm its integrity immediately. Postoperatively, a long-arm posterior splint was placed with the elbow flexed 90 degrees . The opeiography . Since tiography , 2018/12iography , 2019/3 iography , and 201iography . The resiography , and cliMO is predominantly seen in young adults and adolescents and is most commonly secondary to trauma. Although the exact etiology remains unclear, patients typically present with pain and restricted range of motion following trauma or overuse . In thisvia radiographic monitoring. Thus, the mass was not a tumor.Due to the bone hyperplasia early during the disease, such masses may be mistaken for osteosarcoma or soft-tissue tumors . Throughvia X-ray radiography, whether it is accompanied by any TRASH lesion should be determined. MRI or arthrography can be more informative than X-ray radiography in the assessment for a cartilage fracture. In clinical practice, the gap of a lateral condyle fracture is often used to determine whether surgical treatment is required. The fracture is stable when the fracture gap is <2 mm, often without osteochondral fractures, and plaster fixation is often used as the treatment modality. However, the lateral condyle of this patient was significantly displaced (>2 mm), and thus the fracture gap was deemed unstable and needed closed reduction along with K-wire fixation  often require surgical intervention . As the fixation . During An intense fibrocartilagenous callus can also develop in lateral condyle fractures, albeit rarely. Such cases are often accompanied by nonunion and lack adequate immobilization or stability to progress to the union. They are common in the conservative treatment of pediatric clavicle fractures . Studiesvia conservative treatment. Over a period of 14 months, radiographs showed increasing ossification of the mass, which required operative treatment. Kanthimathi et al. ' legal guardian/next of kin for the publication of any potentially identifiable images or data included in this article.HJZ, JHS, and HYZ collected the data. JC wrote the first draft of the manuscript. CG contributed to data interpretation, edited the manuscript, and approved the final version. All authors were involved in the conception of the study.The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest.All claims expressed in this article are solely those of the authors and do not necessarily represent those of their affiliated organizations, or those of the publisher, the editors and the reviewers. Any product that may be evaluated in this article, or claim that may be made by its manufacturer, is not guaranteed or endorsed by the publisher.", "texts": ["Traumatic myositis ossificans (MO) is an unusual complication after muscle injury and is predominantly seen in young adults and adolescents. Pediatric MO cases are even rarer. We report an 8-year-old girl who was diagnosed with a lateral humeral condyle fracture. She was treated surgically, and her elbow joint was fixed with plaster. Rehabilitation exercise was administered 1 month after the operation. Due to the wrong exercise method, a palpable bony mass appeared around the elbow 1 month later. The clinical radiological diagnosis showed MO, and conservative treatment was administered. After 3 years of follow-up, the affected limb functioned well, with no sign of recurrence. Here, we report this long-term follow-up case of MO resulting from excessive rehabilitation exercise. Myositis ossificans (MO) is a benign tumor-like lesion, which is predominantly seen in young adults and adolescents. Pediatric MO cases are even rarer . Approxivia X-ray radiography  was made directly on the lateral condyle of the humerus on the outside of the elbow joint under aseptic conditions. After separating the skin and fascia layer by layer, the fracture ends were exposed. After clearing the congestion and reducing the incarcerated soft tissue, three K-wires were used to fix the fracture. The results from intraoperative fluoroscopy showed a good reduction. The lateral collateral ligament was examined to confirm its integrity immediately. Postoperatively, a long-arm posterior splint was placed with the elbow flexed 90 degrees . The opeiography . Since tiography , 2018/12iography , 2019/3 iography , and 201iography . The resiography , and cliMO is predominantly seen in young adults and adolescents and is most commonly secondary to trauma. Although the exact etiology remains unclear, patients typically present with pain and restricted range of motion following trauma or overuse . In thisvia radiographic monitoring. Thus, the mass was not a tumor.Due to the bone hyperplasia early during the disease, such masses may be mistaken for osteosarcoma or soft-tissue tumors . Throughvia X-ray radiography, whether it is accompanied by any TRASH lesion should be determined. MRI or arthrography can be more informative than X-ray radiography in the assessment for a cartilage fracture. In clinical practice, the gap of a lateral condyle fracture is often used to determine whether surgical treatment is required. The fracture is stable when the fracture gap is <2 mm, often without osteochondral fractures, and plaster fixation is often used as the treatment modality. However, the lateral condyle of this patient was significantly displaced (>2 mm), and thus the fracture gap was deemed unstable and needed closed reduction along with K-wire fixation  often require surgical intervention . As the fixation . During An intense fibrocartilagenous callus can also develop in lateral condyle fractures, albeit rarely. Such cases are often accompanied by nonunion and lack adequate immobilization or stability to progress to the union. They are common in the conservative treatment of pediatric clavicle fractures . Studiesvia conservative treatment. Over a period of 14 months, radiographs showed increasing ossification of the mass, which required operative treatment. Kanthimathi et al. ' legal guardian/next of kin for the publication of any potentially identifiable images or data included in this article.HJZ, JHS, and HYZ collected the data. JC wrote the first draft of the manuscript. CG contributed to data interpretation, edited the manuscript, and approved the final version. All authors were involved in the conception of the study.The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest.All claims expressed in this article are solely those of the authors and do not necessarily represent those of their affiliated organizations, or those of the publisher, the editors and the reviewers. Any product that may be evaluated in this article, or claim that may be made by its manufacturer, is not guaranteed or endorsed by the publisher."]}
-{"representative": "Bezoar is a term from Arabic \u201cb\u0101zahr\u201d or ultimately from Middle Persian \u201cp'tzhl\u201d . It was believed to have the power of a universal antidote that works against any poison, and a glass containing a bezoar could neutralize any poison poured into it. In science, it is a mass of hair or undigested vegetable matter found in a human or animal intestines, similar to a hairball. Otherwise, the name could derive from a kind of Turkish goat whose name is just bezoar. Usually, it is found trapped in every part of the gastrointestinal system and must be distinguished by pseudobezoar, which is an nondigestible object voluntarily introduced into the digestive tract. The most common causes are a previous gastric surgery such as a gastric band (for weight loss) or gastric bypass, a reduced stomach acid (hypochlorhydria) or decreased stomach size, and a delayed gastric emptying, typically due to diabetes, autoimmune disorders, or mixed connective tissue disease. Seed bezoars are usually found in the rectum of patients without predisposing factors, causing constipation and pain. Rectal impaction is common after ingestion of seeds, while a true occlusion is rare. Although several cases of phytobezoars composed of various types of seeds are reported in the literature, bezoars of pumpkin seeds have rarely been reported. The authors report a case of fecal impaction by pumpkin seed bezoars with abdominal pain: a difficulty to void with subsequent rectal inflammation and hemorrhoid enlargement was observed. The patient underwent a successful manual disimpaction. In J.K. Rowling's Book of Harry Potter, the apprentice scientist is quizzed on bezoar during the very first Potions Class . Bezoar Usually, it is found trapped in every part of the gastrointestinal system and must be distinguished by pseudobezoar that is an nondigestible object voluntarily introduced into the digestive tract , 6.Bezoars take the name from the core substance so that we can distinguish them: phytobezoars are composed of vegetable fibers and seeds, trichobezoars are formed from hair, lactobezoars are from inspissated milk, and diospyrobezoars are from unripe persimmon fruits .The overall incidence of bezoars is felt to be low and is extremely rare in healthy individuals occurring in far less than 1% of patients in retrospective endoscopic series . Kadian Certain at-risk groups have been identified and include patients with altered upper GI anatomy after surgery and psychiatric illness or cognitive impairment. The most common causes are a previous gastric surgery such as a gastric band (for weight loss) or gastric bypass, a reduced stomach acid (hypochlorhydria) or decreased stomach size, and a delayed gastric emptying, typically due to diabetes, autoimmune disorders, or mixed connective tissue disease. Other causes are patients who cannot or do not chew their food properly, usually because they have no teeth or poorly fitting dentures and because of an excessive intake of fibers. Edentulous patients with poor mastication of food particles may also be at greater risk for bezoar development, especially if coexisting risk factors, as described above, are also present. In addition, patients with psychiatric illnesses are at an increased risk of bezoar formation due to the possible ingestion of hair and medications , 9.Many cases of bezoars have also been reported in children or adults having psychosocial problems; nevertheless, the condition can occur in normal children with no apparent psychosocial issues .Seed bezoars are usually found in the rectum of patients without predisposing factors, causing constipation and pain. Although the literature has reported several cases of phytobezoars composed of various types of seeds, bezoars formed from pumpkin seeds have rarely been reported . The diaWe report a case of a man aged 50 years with a rectal bezoar composed of pumpkin seeds ingested with their shell, necessitating extensive treatment, including manual disimpaction and rectoscopy.The description of the case follows the 2013 CARE Checklist Guidelines  with their shell. He was unemployed and showed a depressed attitude. He reported never having had problems of this nature before but having problems of constipation in the last months.The plain x-ray of the abdomen showed dilatation of the left and bowel. A proctological inspection revealed a hard bolus in the rectum  with bloUnder sedation with propofol, a disimpaction of the bezoar was accomplished with a colon washing. The patient was discharged on the same evening with a prescription of intestinal antibiotics and a large bowel toilet with polyethylene glycol and enemas.Two days after the first admission, the patient returned to the outpatient department complaining of a persistent difficulty to void with a burning sensation and blood loss. A residual hard bolus, smaller than the first, was detected in the rectum, and another disimpaction under local anesthesia was performed. A proctoscopy showed small diffuse ulcerations of the rectal mucosa and enlargement of hemorrhoids . The colThree weeks after this episode, the rectal mucosa reverted to normal, and the patient declared to move regularly without a burning sensation.Rectal seed bezoar is an uncommon cause of fecal impaction, more frequent in eastern than western countries and particularly in Middle Eastern and South Asian countries where roasted seeds are very popular . The comSeed bezoar is a subcategory of phytobezoar caused by the accumulation of indigestible vegetable or fruit seeds in the intestine lumen. They usually pass the stomach and the ileocecal valve and deposit in the colon up to the rectum, where the compound is dehydrated and forms a hard bolus impossible to evacuate . Seed beSeed bezoar occurs most frequently in the rectum both in children and adults, and symptoms are mainly constipation followed by abdominal pain and rectal burning. A true intestinal obstruction is rare, and perforation is reported only in one case , 19. FibFrom 1980 to 2018, 52 studies were reported by Manatakis  respondiPreventive therapy to avoid recurrence must be implemented when the bezoar is removed. The patient should be advised to increase the amount of water intake. Dietary habits must be investigated since inadequate chewing, swallowing whole seeds, or eating seeds with their shell may impact as bezoar , 23, 24.P\u2009=\u20090.02), Further investigation is needed to understand the pathogenesis of bezoar formation in this selected population  developed gastric bezoars confirmed by upper endoscopy and 94% of patients with bezoars (16 of 17) had cystic fibrosis (pulation .Seed bezoar is an uncommon cause of fecal impaction, more frequent in eastern than western countries and particularly in Middle Eastern and South Asian countries. Seed bezoar is a subcategory of phytobezoar caused by the accumulation of indigestible vegetable or fruit seeds in the intestinal lumen: it occurs most frequently in the rectum both in children and adults, and symptoms are constipation followed by abdominal pain and rectal burning. Intestinal obstruction is rare, and perforation is reported only in one case. Manual disimpaction is the commonly used procedure both in children and adults, while surgery is more frequent in adults than in children. Preventive therapy to avoid recurrence must be implemented when the bezoar is removed. An increase in the amount of water intake should be advised. Psychiatric support is mandatory in patients with recurrent episodes of seed ingestion.", "texts": ["Bezoar is a term from Arabic \u201cb\u0101zahr\u201d or ultimately from Middle Persian \u201cp'tzhl\u201d . It was believed to have the power of a universal antidote that works against any poison, and a glass containing a bezoar could neutralize any poison poured into it. In science, it is a mass of hair or undigested vegetable matter found in a human or animal intestines, similar to a hairball. Otherwise, the name could derive from a kind of Turkish goat whose name is just bezoar. Usually, it is found trapped in every part of the gastrointestinal system and must be distinguished by pseudobezoar, which is an nondigestible object voluntarily introduced into the digestive tract. The most common causes are a previous gastric surgery such as a gastric band (for weight loss) or gastric bypass, a reduced stomach acid (hypochlorhydria) or decreased stomach size, and a delayed gastric emptying, typically due to diabetes, autoimmune disorders, or mixed connective tissue disease. Seed bezoars are usually found in the rectum of patients without predisposing factors, causing constipation and pain. Rectal impaction is common after ingestion of seeds, while a true occlusion is rare. Although several cases of phytobezoars composed of various types of seeds are reported in the literature, bezoars of pumpkin seeds have rarely been reported. The authors report a case of fecal impaction by pumpkin seed bezoars with abdominal pain: a difficulty to void with subsequent rectal inflammation and hemorrhoid enlargement was observed. The patient underwent a successful manual disimpaction. In J.K. Rowling's Book of Harry Potter, the apprentice scientist is quizzed on bezoar during the very first Potions Class . Bezoar Usually, it is found trapped in every part of the gastrointestinal system and must be distinguished by pseudobezoar that is an nondigestible object voluntarily introduced into the digestive tract , 6.Bezoars take the name from the core substance so that we can distinguish them: phytobezoars are composed of vegetable fibers and seeds, trichobezoars are formed from hair, lactobezoars are from inspissated milk, and diospyrobezoars are from unripe persimmon fruits .The overall incidence of bezoars is felt to be low and is extremely rare in healthy individuals occurring in far less than 1% of patients in retrospective endoscopic series . Kadian Certain at-risk groups have been identified and include patients with altered upper GI anatomy after surgery and psychiatric illness or cognitive impairment. The most common causes are a previous gastric surgery such as a gastric band (for weight loss) or gastric bypass, a reduced stomach acid (hypochlorhydria) or decreased stomach size, and a delayed gastric emptying, typically due to diabetes, autoimmune disorders, or mixed connective tissue disease. Other causes are patients who cannot or do not chew their food properly, usually because they have no teeth or poorly fitting dentures and because of an excessive intake of fibers. Edentulous patients with poor mastication of food particles may also be at greater risk for bezoar development, especially if coexisting risk factors, as described above, are also present. In addition, patients with psychiatric illnesses are at an increased risk of bezoar formation due to the possible ingestion of hair and medications , 9.Many cases of bezoars have also been reported in children or adults having psychosocial problems; nevertheless, the condition can occur in normal children with no apparent psychosocial issues .Seed bezoars are usually found in the rectum of patients without predisposing factors, causing constipation and pain. Although the literature has reported several cases of phytobezoars composed of various types of seeds, bezoars formed from pumpkin seeds have rarely been reported . The diaWe report a case of a man aged 50 years with a rectal bezoar composed of pumpkin seeds ingested with their shell, necessitating extensive treatment, including manual disimpaction and rectoscopy.The description of the case follows the 2013 CARE Checklist Guidelines  with their shell. He was unemployed and showed a depressed attitude. He reported never having had problems of this nature before but having problems of constipation in the last months.The plain x-ray of the abdomen showed dilatation of the left and bowel. A proctological inspection revealed a hard bolus in the rectum  with bloUnder sedation with propofol, a disimpaction of the bezoar was accomplished with a colon washing. The patient was discharged on the same evening with a prescription of intestinal antibiotics and a large bowel toilet with polyethylene glycol and enemas.Two days after the first admission, the patient returned to the outpatient department complaining of a persistent difficulty to void with a burning sensation and blood loss. A residual hard bolus, smaller than the first, was detected in the rectum, and another disimpaction under local anesthesia was performed. A proctoscopy showed small diffuse ulcerations of the rectal mucosa and enlargement of hemorrhoids . The colThree weeks after this episode, the rectal mucosa reverted to normal, and the patient declared to move regularly without a burning sensation.Rectal seed bezoar is an uncommon cause of fecal impaction, more frequent in eastern than western countries and particularly in Middle Eastern and South Asian countries where roasted seeds are very popular . The comSeed bezoar is a subcategory of phytobezoar caused by the accumulation of indigestible vegetable or fruit seeds in the intestine lumen. They usually pass the stomach and the ileocecal valve and deposit in the colon up to the rectum, where the compound is dehydrated and forms a hard bolus impossible to evacuate . Seed beSeed bezoar occurs most frequently in the rectum both in children and adults, and symptoms are mainly constipation followed by abdominal pain and rectal burning. A true intestinal obstruction is rare, and perforation is reported only in one case , 19. FibFrom 1980 to 2018, 52 studies were reported by Manatakis  respondiPreventive therapy to avoid recurrence must be implemented when the bezoar is removed. The patient should be advised to increase the amount of water intake. Dietary habits must be investigated since inadequate chewing, swallowing whole seeds, or eating seeds with their shell may impact as bezoar , 23, 24.P\u2009=\u20090.02), Further investigation is needed to understand the pathogenesis of bezoar formation in this selected population  developed gastric bezoars confirmed by upper endoscopy and 94% of patients with bezoars (16 of 17) had cystic fibrosis (pulation .Seed bezoar is an uncommon cause of fecal impaction, more frequent in eastern than western countries and particularly in Middle Eastern and South Asian countries. Seed bezoar is a subcategory of phytobezoar caused by the accumulation of indigestible vegetable or fruit seeds in the intestinal lumen: it occurs most frequently in the rectum both in children and adults, and symptoms are constipation followed by abdominal pain and rectal burning. Intestinal obstruction is rare, and perforation is reported only in one case. Manual disimpaction is the commonly used procedure both in children and adults, while surgery is more frequent in adults than in children. Preventive therapy to avoid recurrence must be implemented when the bezoar is removed. An increase in the amount of water intake should be advised. Psychiatric support is mandatory in patients with recurrent episodes of seed ingestion."]}
-{"representative": "The Editorial Office has been made aware of potential issues surrounding the scientific validity of this paper, hence has issued an expression of concern to notify readers whilst the Editorial Office investigates. It has been noted that the \u2018Model\u2019 line in the flow cytometry data from Figure 5B would be impossible to attain, as it should not bend to the left in such a way when the X value is increasing", "texts": ["The Editorial Office has been made aware of potential issues surrounding the scientific validity of this paper, hence has issued an expression of concern to notify readers whilst the Editorial Office investigates. There appears to be a duplicated image, with some possible signs of alteration, between the first two panels of Figure 4E.", "The Editorial Office has been made aware of potential issues surrounding the scientific validity of this paper, hence has issued an expression of concern to notify readers whilst the Editorial Office investigates. It has been noted that the \u2018Model\u2019 line in the flow cytometry data from Figure 5B would be impossible to attain, as it should not bend to the left in such a way when the X value is increasing"]}
-{"representative": "Ceratitiscapitata flies was carried out in different locations in Tunisia.Several nematode isolates were recovered, laboratory colonies were established,and their taxonomic identities were determined based on molecular methods. Amongall the recovered nematode isolates, two of them, Oscheiustipulae TC2 and OC2, were evaluated for their capacity to controlC. capitata flies and for their ability tokill and reproduce on Galleria mellonella larvae. Our resultsshow a great potential of these two isolates as biocontrol agents as they killC. capitata eggs and pupae and interferewith the metamorphosis of C. capitata larvae.More specifically, TC2 and OC2 nematodes killed 39 and 31% ofC. capitata eggs, respectively, impaired themetamorphosis of up to 77% and up to 67% of C.capitata larvae, respectively, and killed up to 66% and upto 58% of C. capitata pupae, respectively. Theefficacy of TC2 and OC2 nematodes was particularly high on C.capitata pupae, and significant insect mortalities wereobserved even at concentrations of 1 and 5 nematodes/pupae, respectively. Wealso found that TC2 and OC2 nematodes efficiently kill and reproduce inG. mellonella larvae, suggesting thatthese insects could be used for mass-multiplication of these nematodes. Theseresults reveal the potential of O. tipulae tocomplement integrated pest management programs against C.capitata flies.A survey to collect soil nematodes with potential to control  Ceratitis capitata (Wiedemann) (Diptera: Tephritidae), theMediterranean fruit fly or medfly, is one of the most limiting insect pests forcitrus production [Clementine,Mandarin, Navel, Maltaise,Valencia Late and Double Fine oranges areattacked by C. capitata although to differentdegrees of intensities [The citrus agro-industry is one of the most important sectors for the economy ofTunisia. Citrus production is unfortunately hampered by the occurrence of differentdiseases and pests that considerably impair tree growth and crop yields.oduction .Severalensities ,3. This ensities . The conensities ,5. The uensities ,7.Steinernema(Travassos) (Nematoda: Rhabditida) and Heterorhabditis (Poinar)(Nematoda: Rhabditida), which are associated with bacteria of the genusXenorhabdus and Photorhabdus, respectively[Oscheius (Andr\u00e1ssy) (Nematoda: Rhabditidae) [From the great variety of biocontrol agents, entomopathogenic nematodes (EPNs) arehighly promising due to their capacity to efficiently control different insect pests\u201310. The ectively\u201317. Seveectively\u201320. Aparditidae) \u201330.Oscheius nematodes are soil-dwelling nematodes of the Rhabditidaefamily. Several of the species of this genus are considered scavengers, orbacteriophagous free-living nematodes, while several others have been shown to killinsects. Currently, there are about 30 recognized species in the genusOscheius, and more than 13 have the ability to kill insects[Oscheiusonirici kills the larvae of Galleria mellonella(Linnaeus) , Tenebrio molitor (Linnaeus)(Coleoptera: Tenebrionidae) and Drosophila suzukii (Matsumura)(Diptera: Drosophilidae); Oscheius carolinensis has potential as abiological control agent against Pieris rapae (Linnaeus)(Lepidoptera: Papilionoidae) and T. molitor;Oscheius gingeri was efficient against G.mellonella and Conogethes punctiferalis(Guen\u00e9e) (Lepidoptera: Crambidae) larvae; and Oscheius tipulae andO. rugaoensis also kill G.mellonella larvae [O. onirici isolates were shown to killdifferent insect species, while a Swiss isolate was not harmful toG. mellonella [O. saproxylicus, and O.tereticorpus, whose ability to kill insects have not beentested, however, suggesting that this trait could be much more spread in the genusthan it is currently thought [Steinernema and Heterorhabditis nematodes tocontrol agricultural pests. insects,22. For a larvae ,23\u201330. Ta larvae . Howeverllonella ,33. Ther thought ,32\u201340. COscheius nematodes as biocontrolagents and aiming at increasing their availability to be used to controlC. capitata flies, we collected soil-dwellingnematodes at several locations in Tunisia using C.capitata pupae as baits, characterized them using moleculartools to determine their taxonomic identities, and selectedOscheius nematodes to specifically evaluate their abilities tokill C. capitata at different developmental stagesand temperatures. As C. capitata pupates in thesoil, it is one of the most suitable stages for biocontrol using soil-born nematodessuch as O. tipulae. The objective of our study wasto show the great biocontrol potential of two O.tipulae isolates against C.capitata flies. Hence, our study encourages to continuestudying the biology of O. tipulae nematodes andtheir interaction with C. capitata and otherinsect pests to determine their actual biocontrol potential and to explore thepossibility of incorporating them in biocontrol programs against agriculturalpests.Given the promising potential of Citrussinensis var. Maltaise) infested by C.capitata. Twenty soil samples per location were collectedat a depth of 0-30cm using a hand shovel. Samples were placed in plastic bagsand stored at 7\u00b0C for further analyses. Soil nematodes were recovered from thesoil samples using C. capitata pupae orgreater wax moth larvae as baits according to the procedures described byBedding and Akhurst [Ceratitis capitata pupae were included as baits to obtainnematodes closely associated to this pest. For each sample, 300g of soil wereplaced in 500ml plastic containers. Then, ten C.capitata pupae, reared in artificial diets as describedbelow, were added to the plastic containers. Soil was moistened using a watersprayer. Plastic containers were incubated at 22\u00b0C in the dark for 5 days. Afterthis period, all dead insects were collected, rinsed three times with distilledwater and incubated for 24 hours at ambient temperature. Then, fiveG. mellonella larvae were added to thesame soil container. Plastic containers were incubated at 22\u00b0C in the dark for 5days. All dead insects were collected, rinsed three times with distilled water,incubated for 24 hours at ambient temperature, transferred to White traps andincubated at 22\u00b0C for 8 days in darkness [C. capitata pupae and G.mellonella larvae, or were cultured in egg yolk media . In all cases, cultures weremaintained in darkness at 25\u00b0C. Progenies were collected and cultured in freshmedia/insects. After several cycles, the nematode cultures were inspected undera light microscope  to determinepotential mixture of different nematode species.Soil samples were collected, during the winter season of 2019 and 2020, at fivedifferent locations in Tunisia: Morneg, Takilsa, Kobba, Sidi-Saad, and Ouzra.Soil samples were taken from soils of citrus crops  . Adult f5\u2019-TTGATTACGTCCCTGCCCTTT-3\u2019 (forward), and 26S:5\u2019-TTTCACTCGCCGTTACTAAGG-3\u2019 (reverse) [5\u2019-CCTTAGTAACGGCGAGTGAAA-3\u2019 (forward) and 536:5\u2019-CAGCTATCCTGAGGAAAC-3\u2019(reverse). The 18S rRNA genewas amplified using primers NEM18SF:5\u2019-CGCGAATRGCTCATTACAACAGC-3\u2019 (forward) and NEM18SR:5\u2019-GGGCGGTATCTGATCGCC-3\u2019 (reverse) [Nematode genomic DNA was extracted from about five thousand nematodes at alldevelopmental stages using the genomic DNA isolation kit from NORGEN BioTEK(Cat. 24700) following the manufacturer\u2019s instructions. Genomic DNA was used toamplify different regions of the rRNA genes by PCR. Briefly, ITS regions  were amplified using primers 18S:reverse) . The frareverse) . PCR cycThe evolutionary histories based on the different rRNA gene sequences wereinferred by using the Maximum Likelihood method based on the General TimeReversible model (18S and D2D3) or on the Tamura 3-parameter model (ITS) ,48. BestO. tipulaenematodes to control C. capitata, we evaluatedmetamorphosis and mortality of C. capitataeggs, larvae, and pupae exposed to different concentrations of twoO. tipulae isolates, TC2 and OC2, asdescribed below.To evaluate the potential of O. tipulae TC2and OC2 nematodes on C. capitata eggs wasevaluated based on the induced mortality of these latter. Fifty eggs wereplaced in sterile Petri plates (60 mm diameter) layered with two filterpaper sheets. Then, 5000 O. tipulae TC2 or5000 OC2 nematodes suspended in 2ml of sterile water were added to eachPetri plate. Controls were treated with water only. Then, all Petri plateswere sealed with Parafilm. Six Petri plates for each treatment wereevaluated (n = 6). Egg mortalities, measured as the number of eggs that didnot hatch, were recorded three days post-treatment. The bioassay wasmaintained at 22\u00b0C.The biocontrol potential of O. tipulae TC2and OC2 nematodes on C. capitata larvae waevaluated based on successful metamorphic transition of C.capitata larvae. Twenty third instar larvae were placedin sterile Petri plates (60 mm diameter) layered with two filter papersheets. Then, either 50, 125, 250 or 500 nematodes/larva suspended in 1 mldistilled water were added to each Petri plate. Controls were treated withpure water only. Then, all Petri plates were sealed with Parafilm. FivePetri plates for each treatment were evaluated (n = 5). Due to the rapidtransition from the larval to the pupal stage, the number of healthy andunhealthy pupae was recorded three days post-treatment. The bioassay wasmaintained at 25\u00b0C.The biocontrol potential of O. tipulae TC2and OC2 nematodes on C. capitata pupae wasevaluated based on the induced mortality of these latter. Six nematode doseswere used: 1, 5, 10, 50, 100 and 500 nematodes/pupa suspended in 1 ml ofwater. Controls were treated with pure water only. For each treatment, 5Petri plates (60 mm diameter) layered with two filter paper sheets and with20 pupae each were assayed. All Petri plates were sealed with Parafilm. Thebioassays were maintained at 25\u00b0C.The biocontrol potential of O. tipulae TC2 and OC2 nematodes, themortality of C. capitata pupae exposed todifferent nematode concentrations was evaluated at different temperatures.Four different nematode concentrations were used: 50, 125, 250 and 500nematodes/pupa suspended in 1 ml of distilled water. Controls were treatedwith pure water only. Five Petri plates (60 mm diameter) layered with twofilter paper sheets and with twenty 3- to 5-day-old pupae each were assayed.All Petri plates were sealed with Parafilm. The bioassays were maintained at20, 25, and 30\u00b0C.To evaluate the impact of temperature on the biocontrol potential ofO. tipulae TC2 andOC2 nematodes to kill and reproduce on G.mellonella, the mortality of G.mellonella larvae and the number of emerging nematodes fromG. mellonella larvae exposed to thesenematodes was evaluated in three independent experiments. In the firstexperiment, Petri plates (110mm diameter) were layered with two filter papersheets, then ten first-instar G. mellonellalarvae were placed in each plate and treated with either O.tipulae TC2 or OC2 nematodes at a concentration of 500nematodes/larva suspended in 1 ml of water. Four Petri plates per nematodestrain were used. In the second experiment, Petri plates (60 mm diameter) wereeach layered with two filter paper sheets, then one first-instarG. mellonella larva was placed in eachPetri plate and treated with either O. tipulaeTC2 or OC2 nematodes at a concentration of 500 nematodes/larva suspended in 1mlof water. Ten Petri plates per nematode strain were used. In the thirdexperiment, Petri plates (60 mm diameter) were layered with two filter papersheets, then ten first-instar G. mellonellalarvae were placed in each Petri plate and treated with eitherO. tipulae TC2 or OC2 nematodes at aconcentration of either 250 or 500 nematodes/larva suspended in 1 ml of water.Three Petri plates per nematode strain and concentration were used. In allexperiments, controls were treated with pure water only. Insect mortality wasrecorded every 24h for five days. To evaluate the reproductive potential ofnematodes, all dead larvae from the third experiment were rinsed with water andindividually placed in White traps [To evaluate the potential of te traps . EmerginC. capitata pupae wasassessed by three-way ANOVA with temperature, nematode isolate and nematodeconcentration as factors. Galleria mellonella mortalities wereanalyzed by two-way repeated measures ANOVA with time and nematode isolate asfactors. Nematode reproduction was evaluated by two-way ANOVA with nematodeisolate and nematode concentration as factors. Normality and equality ofvariance were verified using Shapiro\u2013Wilk and Levene\u2019s tests, respectively.Holm\u2013Sidak post hoc tests were used for multiple comparisons. All statisticalanalyses were conducted using Sigma Plot 14.5 .Differences in egg mortalities were assessed by one-way ANOVA with nematodeisolate as a factor. Differences in the number of deformed pupae and pupalmortalities were assessed by two-way ANOVA with nematode isolate and nematodeconcentration as factors. The effect of temperature on nematode biocontrolpotential against O.tipulae , Caenorhabditis elegans(TG3), and Acrobeloides spp.    andS2.equences .Howeveridi-Saad .O. tipulae TC2 and OC2show clear symptoms of infestation , andtherefore are used as biocontrol agents against many insect pests . Howeverize EPNs . Severalsothovii , O. carolinensis , O.choningensis ,63,O. mcrovilli , O.myriiophilus , O. onir onirici , O.rugagaoensis \u201368,O. safricana  and O.ttipulae . Some spropsophi  and O. eancensis . ApparenO. tipulaeare capable of killing C. capitata andG. mellonella, in a manner that is comparableto highly efficient entomopathogenic nematodes such asHeterorhabditis and Steinernema [C. capitata pupae. Thus, we add more evidenceon the ability of free-living, bacteriophagous nematodes to kill insects, and theirpotential to complement pest management programs based on these biological controlagents [Our results show that two populations of inernema \u201373. Signlagents . ClearlyO.tipulae, O. onirici andAcrobeloides spp. have been found to naturally co-occur withEPNs in certain regions of the world and have been isolated in conjunction with EPNsfrom G. mellonella cadavers retrieved from baitedtraps in the soil [Heterorhabditis and Steinernema were found insoil samples, supporting this notion, and suggesting that free-living nematodesmight out compete EPNs or that certain edaphic or climatic parameters might favorthem over the EPNs.Several studies have shown that some free-living nematodes in Rhabditida orderinteract with EPNs ,58,74,75the soil ,76,77. Uthe soil ,58. In tOscheius species, can be considered EPNs[O.tipulae nematodes, and also that less than five individuals cancause significant mortality of C. capitata pupae,but we still do not know if this effect is caused by insect-pathogenic bacteria. Themode of action is therefore uncertain and clearly deserves more attention. Hence, itremains to be determined if O. tipulae can beconsidered an EPN, based on Dillman\u2019s definition [O. chongmingensis and O.carolinensis are considered EPNs [O.tipulae is considered a facultative kleptoparasite that competewith EPNs for insects [There is still a lot of controversy on whether or not certain species of free-livingnematodes, including red EPNs. An EPN,red EPNs. Inour finition . Other mred EPNs ,62. Howered EPNs . Similar insects ,an ento insects , and oth insects . ClearlyC.capitata and G. mellonellaare highly susceptible to these nematodes. If they rely on closely-associatedbacteria to kill remains to be investigated. The entomopathogenic action of someOscheius species has been linked to Serratiabacteria which play an essential role during the infection and presumably cause thedeath of the host insect [O. carolinensis wasconsistently associated with four bacterial species, one of which, Serratiamarcescens, appears to be carried on the cuticle of the nematodes andthrough its association provides the worms with entomopathogenic potential [Independently of their ecological classification, we show that t insect . For exaotential . Anotherotential ,82. CleaO. tipulae against C.capitata. Under which circumstances and the exact mechanismshow these free-living bacteriophagous nematodes kill insect hosts remain to beinvestigated. Likewise, their real potential to be used as a biological controlagent in the future requires further studies such as extensive field trials.In conclusion, the present study shows the high control potential of two strains ofS1 FigPhylogenetic relationships based on the nucleotide sequences of the D2-D3expansion segments of the 28S rRNA gene were inferred by using the MaximumLikelihood method based on the General Time Reversible model. The tree withthe highest log likelihood (-6470.16) is shown. The percentage of trees inwhich the associated taxa clustered together is shown next to the branches.A discrete Gamma distribution was used to model evolutionary ratedifferences among sites ). The ratevariation model allowed for some sites to be evolutionarily invariable. The tree is drawn to scale, with branch lengthsmeasured in the number of substitutions per site. NCBI accession numbers ofthe sequences used for the analyses are shown.(PDF)Click here for additional data file.S2 FigPhylogenetic relationships based on the nucleotide sequences of the internaltranscribed spacer (ITS) region of the rRNA gene were inferred by using theMaximum Likelihood method based on the Tamura 3-parameter. The tree with thehighest log likelihood (-10573.30) is shown. The percentage of trees inwhich the associated taxa clustered together is shown next to the branches.A discrete Gamma distribution was used to model evolutionary ratedifferences among sites ). The ratevariation model allowed for some sites to be evolutionarily invariable. The tree is drawn to scale, with branch lengthsmeasured in the number of substitutions per site. NCBI accession numbers ofthe sequences used for the analyses are shown.(PDF)Click here for additional data file.S1 Table(PDF)Click here for additional data file.S1 File(XLSX)Click here for additional data file.", "texts": ["Ceratitiscapitata flies was carried out in different locations in Tunisia.Several nematode isolates were recovered, laboratory colonies were established,and their taxonomic identities were determined based on molecular methods. Amongall the recovered nematode isolates, two of them, Oscheiustipulae TC2 and OC2, were evaluated for their capacity to controlC. capitata flies and for their ability tokill and reproduce on Galleria mellonella larvae. Our resultsshow a great potential of these two isolates as biocontrol agents as they killC. capitata eggs and pupae and interferewith the metamorphosis of C. capitata larvae.More specifically, TC2 and OC2 nematodes killed 39 and 31% ofC. capitata eggs, respectively, impaired themetamorphosis of up to 77% and up to 67% of C.capitata larvae, respectively, and killed up to 66% and upto 58% of C. capitata pupae, respectively. Theefficacy of TC2 and OC2 nematodes was particularly high on C.capitata pupae, and significant insect mortalities wereobserved even at concentrations of 1 and 5 nematodes/pupae, respectively. Wealso found that TC2 and OC2 nematodes efficiently kill and reproduce inG. mellonella larvae, suggesting thatthese insects could be used for mass-multiplication of these nematodes. Theseresults reveal the potential of O. tipulae tocomplement integrated pest management programs against C.capitata flies.A survey to collect soil nematodes with potential to control  Ceratitis capitata (Wiedemann) (Diptera: Tephritidae), theMediterranean fruit fly or medfly, is one of the most limiting insect pests forcitrus production [Clementine,Mandarin, Navel, Maltaise,Valencia Late and Double Fine oranges areattacked by C. capitata although to differentdegrees of intensities [The citrus agro-industry is one of the most important sectors for the economy ofTunisia. Citrus production is unfortunately hampered by the occurrence of differentdiseases and pests that considerably impair tree growth and crop yields.oduction .Severalensities ,3. This ensities . The conensities ,5. The uensities ,7.Steinernema(Travassos) (Nematoda: Rhabditida) and Heterorhabditis (Poinar)(Nematoda: Rhabditida), which are associated with bacteria of the genusXenorhabdus and Photorhabdus, respectively[Oscheius (Andr\u00e1ssy) (Nematoda: Rhabditidae) [From the great variety of biocontrol agents, entomopathogenic nematodes (EPNs) arehighly promising due to their capacity to efficiently control different insect pests\u201310. The ectively\u201317. Seveectively\u201320. Aparditidae) \u201330.Oscheius nematodes are soil-dwelling nematodes of the Rhabditidaefamily. Several of the species of this genus are considered scavengers, orbacteriophagous free-living nematodes, while several others have been shown to killinsects. Currently, there are about 30 recognized species in the genusOscheius, and more than 13 have the ability to kill insects[Oscheiusonirici kills the larvae of Galleria mellonella(Linnaeus) , Tenebrio molitor (Linnaeus)(Coleoptera: Tenebrionidae) and Drosophila suzukii (Matsumura)(Diptera: Drosophilidae); Oscheius carolinensis has potential as abiological control agent against Pieris rapae (Linnaeus)(Lepidoptera: Papilionoidae) and T. molitor;Oscheius gingeri was efficient against G.mellonella and Conogethes punctiferalis(Guen\u00e9e) (Lepidoptera: Crambidae) larvae; and Oscheius tipulae andO. rugaoensis also kill G.mellonella larvae [O. onirici isolates were shown to killdifferent insect species, while a Swiss isolate was not harmful toG. mellonella [O. saproxylicus, and O.tereticorpus, whose ability to kill insects have not beentested, however, suggesting that this trait could be much more spread in the genusthan it is currently thought [Steinernema and Heterorhabditis nematodes tocontrol agricultural pests. insects,22. For a larvae ,23\u201330. Ta larvae . Howeverllonella ,33. Ther thought ,32\u201340. COscheius nematodes as biocontrolagents and aiming at increasing their availability to be used to controlC. capitata flies, we collected soil-dwellingnematodes at several locations in Tunisia using C.capitata pupae as baits, characterized them using moleculartools to determine their taxonomic identities, and selectedOscheius nematodes to specifically evaluate their abilities tokill C. capitata at different developmental stagesand temperatures. As C. capitata pupates in thesoil, it is one of the most suitable stages for biocontrol using soil-born nematodessuch as O. tipulae. The objective of our study wasto show the great biocontrol potential of two O.tipulae isolates against C.capitata flies. Hence, our study encourages to continuestudying the biology of O. tipulae nematodes andtheir interaction with C. capitata and otherinsect pests to determine their actual biocontrol potential and to explore thepossibility of incorporating them in biocontrol programs against agriculturalpests.Given the promising potential of Citrussinensis var. Maltaise) infested by C.capitata. Twenty soil samples per location were collectedat a depth of 0-30cm using a hand shovel. Samples were placed in plastic bagsand stored at 7\u00b0C for further analyses. Soil nematodes were recovered from thesoil samples using C. capitata pupae orgreater wax moth larvae as baits according to the procedures described byBedding and Akhurst [Ceratitis capitata pupae were included as baits to obtainnematodes closely associated to this pest. For each sample, 300g of soil wereplaced in 500ml plastic containers. Then, ten C.capitata pupae, reared in artificial diets as describedbelow, were added to the plastic containers. Soil was moistened using a watersprayer. Plastic containers were incubated at 22\u00b0C in the dark for 5 days. Afterthis period, all dead insects were collected, rinsed three times with distilledwater and incubated for 24 hours at ambient temperature. Then, fiveG. mellonella larvae were added to thesame soil container. Plastic containers were incubated at 22\u00b0C in the dark for 5days. All dead insects were collected, rinsed three times with distilled water,incubated for 24 hours at ambient temperature, transferred to White traps andincubated at 22\u00b0C for 8 days in darkness [C. capitata pupae and G.mellonella larvae, or were cultured in egg yolk media . In all cases, cultures weremaintained in darkness at 25\u00b0C. Progenies were collected and cultured in freshmedia/insects. After several cycles, the nematode cultures were inspected undera light microscope  to determinepotential mixture of different nematode species.Soil samples were collected, during the winter season of 2019 and 2020, at fivedifferent locations in Tunisia: Morneg, Takilsa, Kobba, Sidi-Saad, and Ouzra.Soil samples were taken from soils of citrus crops  . Adult f5\u2019-TTGATTACGTCCCTGCCCTTT-3\u2019 (forward), and 26S:5\u2019-TTTCACTCGCCGTTACTAAGG-3\u2019 (reverse) [5\u2019-CCTTAGTAACGGCGAGTGAAA-3\u2019 (forward) and 536:5\u2019-CAGCTATCCTGAGGAAAC-3\u2019(reverse). The 18S rRNA genewas amplified using primers NEM18SF:5\u2019-CGCGAATRGCTCATTACAACAGC-3\u2019 (forward) and NEM18SR:5\u2019-GGGCGGTATCTGATCGCC-3\u2019 (reverse) [Nematode genomic DNA was extracted from about five thousand nematodes at alldevelopmental stages using the genomic DNA isolation kit from NORGEN BioTEK(Cat. 24700) following the manufacturer\u2019s instructions. Genomic DNA was used toamplify different regions of the rRNA genes by PCR. Briefly, ITS regions  were amplified using primers 18S:reverse) . The frareverse) . PCR cycThe evolutionary histories based on the different rRNA gene sequences wereinferred by using the Maximum Likelihood method based on the General TimeReversible model (18S and D2D3) or on the Tamura 3-parameter model (ITS) ,48. BestO. tipulaenematodes to control C. capitata, we evaluatedmetamorphosis and mortality of C. capitataeggs, larvae, and pupae exposed to different concentrations of twoO. tipulae isolates, TC2 and OC2, asdescribed below.To evaluate the potential of O. tipulae TC2and OC2 nematodes on C. capitata eggs wasevaluated based on the induced mortality of these latter. Fifty eggs wereplaced in sterile Petri plates (60 mm diameter) layered with two filterpaper sheets. Then, 5000 O. tipulae TC2 or5000 OC2 nematodes suspended in 2ml of sterile water were added to eachPetri plate. Controls were treated with water only. Then, all Petri plateswere sealed with Parafilm. Six Petri plates for each treatment wereevaluated (n = 6). Egg mortalities, measured as the number of eggs that didnot hatch, were recorded three days post-treatment. The bioassay wasmaintained at 22\u00b0C.The biocontrol potential of O. tipulae TC2and OC2 nematodes on C. capitata larvae waevaluated based on successful metamorphic transition of C.capitata larvae. Twenty third instar larvae were placedin sterile Petri plates (60 mm diameter) layered with two filter papersheets. Then, either 50, 125, 250 or 500 nematodes/larva suspended in 1 mldistilled water were added to each Petri plate. Controls were treated withpure water only. Then, all Petri plates were sealed with Parafilm. FivePetri plates for each treatment were evaluated (n = 5). Due to the rapidtransition from the larval to the pupal stage, the number of healthy andunhealthy pupae was recorded three days post-treatment. The bioassay wasmaintained at 25\u00b0C.The biocontrol potential of O. tipulae TC2and OC2 nematodes on C. capitata pupae wasevaluated based on the induced mortality of these latter. Six nematode doseswere used: 1, 5, 10, 50, 100 and 500 nematodes/pupa suspended in 1 ml ofwater. Controls were treated with pure water only. For each treatment, 5Petri plates (60 mm diameter) layered with two filter paper sheets and with20 pupae each were assayed. All Petri plates were sealed with Parafilm. Thebioassays were maintained at 25\u00b0C.The biocontrol potential of O. tipulae TC2 and OC2 nematodes, themortality of C. capitata pupae exposed todifferent nematode concentrations was evaluated at different temperatures.Four different nematode concentrations were used: 50, 125, 250 and 500nematodes/pupa suspended in 1 ml of distilled water. Controls were treatedwith pure water only. Five Petri plates (60 mm diameter) layered with twofilter paper sheets and with twenty 3- to 5-day-old pupae each were assayed.All Petri plates were sealed with Parafilm. The bioassays were maintained at20, 25, and 30\u00b0C.To evaluate the impact of temperature on the biocontrol potential ofO. tipulae TC2 andOC2 nematodes to kill and reproduce on G.mellonella, the mortality of G.mellonella larvae and the number of emerging nematodes fromG. mellonella larvae exposed to thesenematodes was evaluated in three independent experiments. In the firstexperiment, Petri plates (110mm diameter) were layered with two filter papersheets, then ten first-instar G. mellonellalarvae were placed in each plate and treated with either O.tipulae TC2 or OC2 nematodes at a concentration of 500nematodes/larva suspended in 1 ml of water. Four Petri plates per nematodestrain were used. In the second experiment, Petri plates (60 mm diameter) wereeach layered with two filter paper sheets, then one first-instarG. mellonella larva was placed in eachPetri plate and treated with either O. tipulaeTC2 or OC2 nematodes at a concentration of 500 nematodes/larva suspended in 1mlof water. Ten Petri plates per nematode strain were used. In the thirdexperiment, Petri plates (60 mm diameter) were layered with two filter papersheets, then ten first-instar G. mellonellalarvae were placed in each Petri plate and treated with eitherO. tipulae TC2 or OC2 nematodes at aconcentration of either 250 or 500 nematodes/larva suspended in 1 ml of water.Three Petri plates per nematode strain and concentration were used. In allexperiments, controls were treated with pure water only. Insect mortality wasrecorded every 24h for five days. To evaluate the reproductive potential ofnematodes, all dead larvae from the third experiment were rinsed with water andindividually placed in White traps [To evaluate the potential of te traps . EmerginC. capitata pupae wasassessed by three-way ANOVA with temperature, nematode isolate and nematodeconcentration as factors. Galleria mellonella mortalities wereanalyzed by two-way repeated measures ANOVA with time and nematode isolate asfactors. Nematode reproduction was evaluated by two-way ANOVA with nematodeisolate and nematode concentration as factors. Normality and equality ofvariance were verified using Shapiro\u2013Wilk and Levene\u2019s tests, respectively.Holm\u2013Sidak post hoc tests were used for multiple comparisons. All statisticalanalyses were conducted using Sigma Plot 14.5 .Differences in egg mortalities were assessed by one-way ANOVA with nematodeisolate as a factor. Differences in the number of deformed pupae and pupalmortalities were assessed by two-way ANOVA with nematode isolate and nematodeconcentration as factors. The effect of temperature on nematode biocontrolpotential against O.tipulae , Caenorhabditis elegans(TG3), and Acrobeloides spp.    andS2.equences .Howeveridi-Saad .O. tipulae TC2 and OC2show clear symptoms of infestation , andtherefore are used as biocontrol agents against many insect pests . Howeverize EPNs . Severalsothovii , O. carolinensis , O.choningensis ,63,O. mcrovilli , O.myriiophilus , O. onir onirici , O.rugagaoensis \u201368,O. safricana  and O.ttipulae . Some spropsophi  and O. eancensis . ApparenO. tipulaeare capable of killing C. capitata andG. mellonella, in a manner that is comparableto highly efficient entomopathogenic nematodes such asHeterorhabditis and Steinernema [C. capitata pupae. Thus, we add more evidenceon the ability of free-living, bacteriophagous nematodes to kill insects, and theirpotential to complement pest management programs based on these biological controlagents [Our results show that two populations of inernema \u201373. Signlagents . ClearlyO.tipulae, O. onirici andAcrobeloides spp. have been found to naturally co-occur withEPNs in certain regions of the world and have been isolated in conjunction with EPNsfrom G. mellonella cadavers retrieved from baitedtraps in the soil [Heterorhabditis and Steinernema were found insoil samples, supporting this notion, and suggesting that free-living nematodesmight out compete EPNs or that certain edaphic or climatic parameters might favorthem over the EPNs.Several studies have shown that some free-living nematodes in Rhabditida orderinteract with EPNs ,58,74,75the soil ,76,77. Uthe soil ,58. In tOscheius species, can be considered EPNs[O.tipulae nematodes, and also that less than five individuals cancause significant mortality of C. capitata pupae,but we still do not know if this effect is caused by insect-pathogenic bacteria. Themode of action is therefore uncertain and clearly deserves more attention. Hence, itremains to be determined if O. tipulae can beconsidered an EPN, based on Dillman\u2019s definition [O. chongmingensis and O.carolinensis are considered EPNs [O.tipulae is considered a facultative kleptoparasite that competewith EPNs for insects [There is still a lot of controversy on whether or not certain species of free-livingnematodes, including red EPNs. An EPN,red EPNs. Inour finition . Other mred EPNs ,62. Howered EPNs . Similar insects ,an ento insects , and oth insects . ClearlyC.capitata and G. mellonellaare highly susceptible to these nematodes. If they rely on closely-associatedbacteria to kill remains to be investigated. The entomopathogenic action of someOscheius species has been linked to Serratiabacteria which play an essential role during the infection and presumably cause thedeath of the host insect [O. carolinensis wasconsistently associated with four bacterial species, one of which, Serratiamarcescens, appears to be carried on the cuticle of the nematodes andthrough its association provides the worms with entomopathogenic potential [Independently of their ecological classification, we show that t insect . For exaotential . Anotherotential ,82. CleaO. tipulae against C.capitata. Under which circumstances and the exact mechanismshow these free-living bacteriophagous nematodes kill insect hosts remain to beinvestigated. Likewise, their real potential to be used as a biological controlagent in the future requires further studies such as extensive field trials.In conclusion, the present study shows the high control potential of two strains ofS1 FigPhylogenetic relationships based on the nucleotide sequences of the D2-D3expansion segments of the 28S rRNA gene were inferred by using the MaximumLikelihood method based on the General Time Reversible model. The tree withthe highest log likelihood (-6470.16) is shown. The percentage of trees inwhich the associated taxa clustered together is shown next to the branches.A discrete Gamma distribution was used to model evolutionary ratedifferences among sites ). The ratevariation model allowed for some sites to be evolutionarily invariable. The tree is drawn to scale, with branch lengthsmeasured in the number of substitutions per site. NCBI accession numbers ofthe sequences used for the analyses are shown.(PDF)Click here for additional data file.S2 FigPhylogenetic relationships based on the nucleotide sequences of the internaltranscribed spacer (ITS) region of the rRNA gene were inferred by using theMaximum Likelihood method based on the Tamura 3-parameter. The tree with thehighest log likelihood (-10573.30) is shown. The percentage of trees inwhich the associated taxa clustered together is shown next to the branches.A discrete Gamma distribution was used to model evolutionary ratedifferences among sites ). The ratevariation model allowed for some sites to be evolutionarily invariable. The tree is drawn to scale, with branch lengthsmeasured in the number of substitutions per site. NCBI accession numbers ofthe sequences used for the analyses are shown.(PDF)Click here for additional data file.S1 Table(PDF)Click here for additional data file.S1 File(XLSX)Click here for additional data file."]}
-{"representative": "To evaluate systolic flow-sensitive alternating inversion recovery (FAIR) during rest and exercise stress using 2RR (two cardiac cycles) or 1RR intervals between inversion pulse and imaging.t tests.1RR and 2RR FAIR was implemented on a 3T scanner. Ten healthy subjects were scanned during rest and stress. Stress was performed using an in-bore ergometer. Heart rate, mean myocardial blood flow (MBF) and temporal signal-to-noise ratio (TSNR) were compared using paired p\u2009<\u20090.01) and 2RR FAIR . Mean stress MBF was higher than rest for 1RR FAIR  and 2RR FAIR . Resting mean MBF was higher for 1RR FAIR than 2RR FAIR (p\u2009<\u20090.05), but not during stress. TSNR was lower for stress compared to rest for 1RR FAIR  and 2RR FAIR . 2RR FAIR TSNR was higher than 1RR FAIR for rest (p\u2009<\u20090.05) and stress (p\u2009<\u20090.001).Mean heart rate during stress was higher than rest for 1RR FAIR (85.8\u2009\u00b1\u200913.7\u00a0bpm vs 63.3\u2009\u00b1\u200911.1\u00a0bpm; We have demonstrated feasibility of systolic FAIR in rest and exercise stress. 2RR delay systolic FAIR enables non-contrast perfusion assessment during stress with relatively high TSNR. Cardiovascular magnetic resonance (CMR) allows non-invasive assessment of myocardial ischemia using contrast-enhanced first-pass myocardial perfusion . AlthougIn recent years, there has been increased interest in developing CMR techniques to assess myocardial ischemia without the use of contrast agents or pharmacological stress agents. This includes T1 mapping , 6, oxygA limitation of ASL in general, and myocardial FAIR in particular, is the low signal sensitivity of this technique. This is primarily due to the intrinsically low signal variability which may be attributed to perfusion of maximum 4\u20138% , approxiAnother approach to increase robustness of cardiac FAIR is to time the data acquisition to the systolic rather than diastolic rest period, as this leads to an increased area of analyzable myocardium and may be preferable during high heart rates as typically encountered in stress perfusion \u201326. HoweAll experiments were performed on a 3\u00a0T Philips scanner  using a 24-channel torso coil. The study was approved by the institutional review board (Dnr 2016/546-32) and all subjects provided written informed consent.Ten healthy volunteers  were scanned at rest and during exercise stress. For the exercise stress test an in-bore ergometer , shown in Fig.\u00a00 image was acquired in a separate scan without any magnetization preparation to estimate baseline magnetization for every data set. Myocardial blood flow (MBF) was calculated for both 1RR FAIR and 2RR FAIR using the formula for double-gated myocardial ASL:C and T are the control and tagged images, respectively. T1 is the longitudinal relaxation time for blood at 3\u00a0T, estimated at 1700\u00a0ms [The prosed systolic FAIR technique was ECG-triggered and used double-gating to ensure the inversion pulses were performed in the same cardiac phase but a preceding cardiac cycle as the image acquisition. In this work, cardiac FAIR was performed either with one cardiac cycle delay between inversion pulse and imaging (1RR FAIR) or with two cardiac cycle delay (2RR FAIR). Apart from this modification, the double-gated myocardial FAIR acquisition was performed as in previous studies, where tagged and control images were acquired within one breath hold of approximately ten seconds with 8\u00a0s of delay between inversion pulses. In addition, an M 1700\u00a0ms .2, FOV\u2009=\u2009300\u2009\u00d7\u2009300\u2009\u00d7\u200910\u00a0mm, flip angle\u2009=\u200950\u00b0, TR/TE\u2009=\u20092.2/1.1\u00a0ms, acquisition time\u2009=\u2009110\u00a0ms, 25 ramp-up radiofrequency pulses preceded the data acquisition with linearly increasing flip angles, from 1 to 49\u00ba with 2 increments\u00ba. Compressed SENSitivity Encoding (SENSE) was used for image acceleration with a factor of 3. The systolic rest period was visually determined using a four-chamber cine slice with 50 cardiac phases acquired during rest and assumed to be the same for the stress scans [For the in-vivo experiments, a mid-ventricular 2D FAIR image was acquired in short-axis and each data set consisted of six pairs of tagged and control images, each pair acquired during a breath-hold and with alternating order of the control/tagged images. Imaging parameters were: spatial resolution\u2009=\u20092\u2009\u00d7\u20092 mmss scans . The sca0) were jointly co-registered using non-linear image registration to account for differences in respiratory position within and between breath-holds [The images were processed offline to generate pixelwise maps of MBF. First, all images  was calculated based on a region of interest which was manually drawn to include the entire myocardium in the mid-ventricular slice. TSNR was defined as the ratio between the mean MBF and the standard deviation of the MBF across the 6 measurements .t test were used to statistically compare group mean differences for heart rate, mean MBF and TSNR. A threshold of P\u2009<\u20090.05 was used to define statistically significant differences.Two-tailed paired student\u2019s The rest and stress 1RR FAIR and 2RR FAIR scans were successfully performed in all but one volunteer, where excessive respiratory motion during the 1RR FAIR stress scan could not be sufficiently corrected and resulted in uninterpretable MBF maps. Therefore, 1RR and 2RR FAIR data for this volunteer were not included in the statistical analysis to allow pairwise comparisons.p\u2009<\u20090.01) and 2RR FAIR . However, there was no statistical difference in heart-rate between 1 and 2RR FAIR for either rest and stress. The MBF of the stress scans were significantly higher compared to the rest scans for both 1RR FAIR  and 2RR FAIR . The MBF was significantly higher using 1RR FAIR during rest compared to 2RR FAIR (p\u2009<\u20090.05), but not during stress. The myocardial perfusion reserve (MPR) was calculated for all volunteers using 1RR FAIR and 2RR FAIR, where both rest and stress were available. The MPR for 1RR FAIR was 2.28\u2009\u00b1\u20090.72 and for 2RR FAIR 2.56\u2009\u00b1\u20091.07, which was not statistically significant (p\u2009=\u20090.32). The TSNR was significantly lower for the stress scans compared to rest for both 1RR FAIR  and 2RR FAIR . However, TSNR was significantly higher for 2RR FAIR compared to 1RR FAIR for both rest (p\u2009<\u20090.05) and stress scans (p\u2009<\u20090.001). The measured MBF and MPR for each volunteer using 1RR FAIR and 2RR FAIR during rest and stress are shown in Fig.\u00a0Example perfusion maps for two subjects using 1RR and 2RR FAIR during rest and stress are shown in Fig.\u00a0Here, we have demonstrated the ability to estimate perfusion during rest and exercise stress using systolic FAIR. We compared the use of 2RR interval delays between inversion pulse and imaging acquisition to 1RR delay and found that the former approach yielded higher TSNR at both rest and stress at the expense of producing, on average, 6% lower MBF values during rest.Similar to previous studies exploring the use of 1RR and 2RR FAIR techniques, we found a reduction in MBF for the 2RR approach . This maThe rest mean MBF was approximately 1.2\u20131.4\u00a0mL/g/min in this study. Others also reported a similar range (1.3\u20131.5\u00a0mL/g/min) , 13, butA clinical exercise test aims to reach an age-based heart rate, to induce ischemia which may be hidden at rest . In this1 mapping [The clinically most common modality for perfusion measurement is Single Photon Emission Computed Tomography (SPECT), but it provides low temporal and spatial resolution. Photon Emission Tomography (PET) is considered the clinical gold standard but requires the use of ionizing radiation, unlike MRI . There a mapping  have bee mapping  and, the1 for blood of 1700\u00a0ms was used for all subjects. However, blood T1 varies particularly with hematocrit levels, and a subject-specific blood T1 measurement may yield more accurate MBF estimation. Finally, the systolic time was determined from cine images at rest, similar to a previous perfusion publication [The study has several limitations: The study comprised of a small number of healthy subjects, and larger studies including patients with coronary artery disease are warranted to evaluate this technique, including validation against quantitative reference techniques, such as contrast-enhanced MRI. Furthermore, validation using a perfusion phantom would be desirable and will be the focus of future work , 38. Thelication , but no We have demonstrated the feasibility of systolic FAIR during rest and exercise stress. Systolic FAIR with 2RR delay between inversion and imaging enables non-contrast perfusion assessment during stress with relatively high TSNR. MBF may be slightly underestimated compared to 1RR FAIR due to partial signal saturation. Further studies are warranted to investigate the diagnostic potential of this technique in patients with coronary artery disease.", "texts": ["To evaluate systolic flow-sensitive alternating inversion recovery (FAIR) during rest and exercise stress using 2RR (two cardiac cycles) or 1RR intervals between inversion pulse and imaging.t tests.1RR and 2RR FAIR was implemented on a 3T scanner. Ten healthy subjects were scanned during rest and stress. Stress was performed using an in-bore ergometer. Heart rate, mean myocardial blood flow (MBF) and temporal signal-to-noise ratio (TSNR) were compared using paired p\u2009<\u20090.01) and 2RR FAIR . Mean stress MBF was higher than rest for 1RR FAIR  and 2RR FAIR . Resting mean MBF was higher for 1RR FAIR than 2RR FAIR (p\u2009<\u20090.05), but not during stress. TSNR was lower for stress compared to rest for 1RR FAIR  and 2RR FAIR . 2RR FAIR TSNR was higher than 1RR FAIR for rest (p\u2009<\u20090.05) and stress (p\u2009<\u20090.001).Mean heart rate during stress was higher than rest for 1RR FAIR (85.8\u2009\u00b1\u200913.7\u00a0bpm vs 63.3\u2009\u00b1\u200911.1\u00a0bpm; We have demonstrated feasibility of systolic FAIR in rest and exercise stress. 2RR delay systolic FAIR enables non-contrast perfusion assessment during stress with relatively high TSNR. Cardiovascular magnetic resonance (CMR) allows non-invasive assessment of myocardial ischemia using contrast-enhanced first-pass myocardial perfusion . AlthougIn recent years, there has been increased interest in developing CMR techniques to assess myocardial ischemia without the use of contrast agents or pharmacological stress agents. This includes T1 mapping , 6, oxygA limitation of ASL in general, and myocardial FAIR in particular, is the low signal sensitivity of this technique. This is primarily due to the intrinsically low signal variability which may be attributed to perfusion of maximum 4\u20138% , approxiAnother approach to increase robustness of cardiac FAIR is to time the data acquisition to the systolic rather than diastolic rest period, as this leads to an increased area of analyzable myocardium and may be preferable during high heart rates as typically encountered in stress perfusion \u201326. HoweAll experiments were performed on a 3\u00a0T Philips scanner  using a 24-channel torso coil. The study was approved by the institutional review board (Dnr 2016/546-32) and all subjects provided written informed consent.Ten healthy volunteers  were scanned at rest and during exercise stress. For the exercise stress test an in-bore ergometer , shown in Fig.\u00a00 image was acquired in a separate scan without any magnetization preparation to estimate baseline magnetization for every data set. Myocardial blood flow (MBF) was calculated for both 1RR FAIR and 2RR FAIR using the formula for double-gated myocardial ASL:C and T are the control and tagged images, respectively. T1 is the longitudinal relaxation time for blood at 3\u00a0T, estimated at 1700\u00a0ms [The prosed systolic FAIR technique was ECG-triggered and used double-gating to ensure the inversion pulses were performed in the same cardiac phase but a preceding cardiac cycle as the image acquisition. In this work, cardiac FAIR was performed either with one cardiac cycle delay between inversion pulse and imaging (1RR FAIR) or with two cardiac cycle delay (2RR FAIR). Apart from this modification, the double-gated myocardial FAIR acquisition was performed as in previous studies, where tagged and control images were acquired within one breath hold of approximately ten seconds with 8\u00a0s of delay between inversion pulses. In addition, an M 1700\u00a0ms .2, FOV\u2009=\u2009300\u2009\u00d7\u2009300\u2009\u00d7\u200910\u00a0mm, flip angle\u2009=\u200950\u00b0, TR/TE\u2009=\u20092.2/1.1\u00a0ms, acquisition time\u2009=\u2009110\u00a0ms, 25 ramp-up radiofrequency pulses preceded the data acquisition with linearly increasing flip angles, from 1 to 49\u00ba with 2 increments\u00ba. Compressed SENSitivity Encoding (SENSE) was used for image acceleration with a factor of 3. The systolic rest period was visually determined using a four-chamber cine slice with 50 cardiac phases acquired during rest and assumed to be the same for the stress scans [For the in-vivo experiments, a mid-ventricular 2D FAIR image was acquired in short-axis and each data set consisted of six pairs of tagged and control images, each pair acquired during a breath-hold and with alternating order of the control/tagged images. Imaging parameters were: spatial resolution\u2009=\u20092\u2009\u00d7\u20092 mmss scans . The sca0) were jointly co-registered using non-linear image registration to account for differences in respiratory position within and between breath-holds [The images were processed offline to generate pixelwise maps of MBF. First, all images  was calculated based on a region of interest which was manually drawn to include the entire myocardium in the mid-ventricular slice. TSNR was defined as the ratio between the mean MBF and the standard deviation of the MBF across the 6 measurements .t test were used to statistically compare group mean differences for heart rate, mean MBF and TSNR. A threshold of P\u2009<\u20090.05 was used to define statistically significant differences.Two-tailed paired student\u2019s The rest and stress 1RR FAIR and 2RR FAIR scans were successfully performed in all but one volunteer, where excessive respiratory motion during the 1RR FAIR stress scan could not be sufficiently corrected and resulted in uninterpretable MBF maps. Therefore, 1RR and 2RR FAIR data for this volunteer were not included in the statistical analysis to allow pairwise comparisons.p\u2009<\u20090.01) and 2RR FAIR . However, there was no statistical difference in heart-rate between 1 and 2RR FAIR for either rest and stress. The MBF of the stress scans were significantly higher compared to the rest scans for both 1RR FAIR  and 2RR FAIR . The MBF was significantly higher using 1RR FAIR during rest compared to 2RR FAIR (p\u2009<\u20090.05), but not during stress. The myocardial perfusion reserve (MPR) was calculated for all volunteers using 1RR FAIR and 2RR FAIR, where both rest and stress were available. The MPR for 1RR FAIR was 2.28\u2009\u00b1\u20090.72 and for 2RR FAIR 2.56\u2009\u00b1\u20091.07, which was not statistically significant (p\u2009=\u20090.32). The TSNR was significantly lower for the stress scans compared to rest for both 1RR FAIR  and 2RR FAIR . However, TSNR was significantly higher for 2RR FAIR compared to 1RR FAIR for both rest (p\u2009<\u20090.05) and stress scans (p\u2009<\u20090.001). The measured MBF and MPR for each volunteer using 1RR FAIR and 2RR FAIR during rest and stress are shown in Fig.\u00a0Example perfusion maps for two subjects using 1RR and 2RR FAIR during rest and stress are shown in Fig.\u00a0Here, we have demonstrated the ability to estimate perfusion during rest and exercise stress using systolic FAIR. We compared the use of 2RR interval delays between inversion pulse and imaging acquisition to 1RR delay and found that the former approach yielded higher TSNR at both rest and stress at the expense of producing, on average, 6% lower MBF values during rest.Similar to previous studies exploring the use of 1RR and 2RR FAIR techniques, we found a reduction in MBF for the 2RR approach . This maThe rest mean MBF was approximately 1.2\u20131.4\u00a0mL/g/min in this study. Others also reported a similar range (1.3\u20131.5\u00a0mL/g/min) , 13, butA clinical exercise test aims to reach an age-based heart rate, to induce ischemia which may be hidden at rest . In this1 mapping [The clinically most common modality for perfusion measurement is Single Photon Emission Computed Tomography (SPECT), but it provides low temporal and spatial resolution. Photon Emission Tomography (PET) is considered the clinical gold standard but requires the use of ionizing radiation, unlike MRI . There a mapping  have bee mapping  and, the1 for blood of 1700\u00a0ms was used for all subjects. However, blood T1 varies particularly with hematocrit levels, and a subject-specific blood T1 measurement may yield more accurate MBF estimation. Finally, the systolic time was determined from cine images at rest, similar to a previous perfusion publication [The study has several limitations: The study comprised of a small number of healthy subjects, and larger studies including patients with coronary artery disease are warranted to evaluate this technique, including validation against quantitative reference techniques, such as contrast-enhanced MRI. Furthermore, validation using a perfusion phantom would be desirable and will be the focus of future work , 38. Thelication , but no We have demonstrated the feasibility of systolic FAIR during rest and exercise stress. Systolic FAIR with 2RR delay between inversion and imaging enables non-contrast perfusion assessment during stress with relatively high TSNR. MBF may be slightly underestimated compared to 1RR FAIR due to partial signal saturation. Further studies are warranted to investigate the diagnostic potential of this technique in patients with coronary artery disease."]}
-{"representative": "Lycorine (Lyc) is a natural alkaloid derived from medicinal plants of the Amaryllidaceae family. Lyc has been reported to inhibit the recurrence and metastasis of different kinds of tumors. However, Lyc\u2019s effect on angiogenesis and its specific mechanism are still not clear. This study was designed to test the antiangiogenesis effect of Lyc and to explore the possible mechanisms. We performed cell experiments to confirm Lyc\u2019s inhibitory effect on angiogenesis and employed sunitinib as a positive control. Moreover, the synergistic effect of Lyc and sunitinib was also explored. Next, we conducted bioinformatics analyses to predict the potential targets of Lyc and verified them by western blotting and immunofluorescence. Molecular docking, kinase activity assays, Biacore assays and cellular thermal shift assays (CETSAs) were applied to elucidate the mechanism by which Lyc inhibited target activity. Lyc inhibited angiogenesis in human umbilical vein endothelial cells (HUVECs). Employing bioinformatics, we found that Lyc\u2019s target was PDGFR\u03b1 and that Lyc attenuated PDGFR\u03b1 phosphorylation. We also found that Lyc inhibited PDGFR\u03b1 activation by docking to it to restrain its activity. Additionally, Lyc significantly inhibited PDGF-AA-induced angiogenesis. This study provides new insights into the molecular functions of Lyc and indicates its potential as a therapeutic agent for tumor angiogenesis.The online version contains supplementary material available at 10.1186/s12885-022-09929-y. Malignant tumors are the main cause of death and are important obstacles to improving life expectancy worldwide .3, the vasculature on the tumor surface is disordered. This is conducive to the exogenous growth of tumors and prevents drugs from entering the tumor body, resulting in reduced drug uptake, which is the theoretical basis for the treatment of tumors with antiangiogenic drugs [Angiogenesis is one of the hallmarks of tumors , and tumic drugs . Althougic drugs . In addiic drugs , 8. TherIn recent years, natural compounds have been proven to be effective in the treatment of tumors, including in antiangiogenesis \u201311. LycoNetwork pharmacology is a branch of pharmacology that is based on systems biology and multiple pharmacology theories and primarily focuses on biomolecular networks . In pharIn this study, we explored the anti-angiogenic roles of Lyc in vitro and in vivo, employing sunitinib as a positive control, and then the Lyc targets were predicted by the PharmMapper database. Lyc inhibited PDGFR\u03b1 activities by docking to it directly. This protocol can be considered an effective method for exploring completely new applications of natural products with exact structural formulas. This study improved the understanding of Lyc's molecular biological function and indicated that Lyc may be a promising anti-angiogenic therapy.2.Human Umbilical Vein Endothelial Cells (HUVECs) were purchased from Cell Bank of Representative Culture Preservation Committee of Chinese Academy of Sciences . HUVECs were cultured in HUV-EC-C medium and kept in an incubator at 37\u00a0\u00b0C with 5% COLyc was purchased from MedChemExpress (HY-N0288) and prepared as described before . SunitinCell viability was examined using the 3--2,5-diphenyltetrazolium bromide (MTT) assay. Cells (3000 cells/well) were seeded in a 96-well plate overnight and then exposed to different concentrations of Lyc (and/or sunitinib) and incubated for 24 and 48\u00a0h. A total of 20 \u00b5L of MTT solution  were added to each well and the cells were incubated for another 4\u00a0h at 37\u00a0\u00b0C. The supernatant was then removed and 200 \u00b5L of DMSO were added to each well to dissolve the precipitate. Absorbance was measured using a spectrophotometer  at 490\u00a0nm.Cells were seeded in six-well plates at a density of 1000 cells/well. On the next day, cells were treated with Lyc and/or sunitinib. Ten days after the treatment, cells were fixed with methanol for 15\u00a0min and then staixned with 0.1% crystal violet. Finally, stained cell colonies were photographed with a digital camera and analyzed using ImageJ , Bethesda, USA).Cells cultured in a Petri dish and treated with Lyc and/or sunitinib for a range of time points were collected and incubated with 5 \u00b5L of Annexin V and 10 \u00b5L of PI for 15\u00a0min in the dark. The samples were then evaluated using flow cytometry and the data were analyzed using FlowJo .4 cells/chamber) and different concentrations of Lyc (and/or sunitinib) were seeded in an upper Transwell chamber . HUV-EC-C medium containing 25\u00a0ng/mL PDGF-AA was added to the lower chamber. Non-migrated cells from the upper membrane were removed after incubation for 16\u00a0h at 37\u00a0\u00b0C. The migrated cells were stained with 0.1% crystal violet and photographed under a light microscope at\u2009\u00d7\u2009200. Migrated cells were analyzed quantitatively using ImageJ.For the migration assay, 200 \u00b5L of HUV-EC-C medium containing cells (2.0\u2009\u00d7\u2009105 cells/well) were seeded in six-well plates. As the cells became sub-confluent, a straight cell-free wound was scratched with a 10 \u00b5L pipette tip. Cells were then washed twice with PBS and incubated in serum-free medium containing different concentration of Lyc and/or sunitinib. Cell scratches were observed and measured at different time points. Cell migration distances were analyzed quantitatively using ImageJ.Cells  pre-coating at 37\u00a0\u00b0C for 30\u00a0min. Thereafter, HUVECs were treated with different concentrations of Lyc and/or sunitinib for 4\u00a0h. After exposure, HUVECs tubes and branches were photographed under a light microscope at\u2009\u00d7\u2009200. The formed branches were analyzed quantitatively using ImageJ.HUVECs were plated at a density of 1\u2009\u00d7\u2009102) and the shell membrane was removed with sterile forceps to expose the chorioallantoic membrane. A small rubber ring was placed on the chorioallantoic membrane and different concentrations of Lyc and/or sunitinib were added into the ring and incubated. At baseline and 8, 16\u00a0h later, the ring area was photographed by a scanner and the images were analyzed using Image-Pro Plus 6.0 .Five fresh 10-day-old fertile eggs were cleaned with alcohol and then incubated at 37\u00a0\u00b0C and 60\u201380% humidity in an egg incubator. The shell was cut to create a small window (20\u2009\u00d7\u200920 mmhttp://59.78.96.61/pharmmapper/) to obtain possible Lyc targets. The target names were then corrected to the official symbol using UniProt (https://www.uniprot.org/). Gene ontology (GO) functional annotation [http://www.webgestalt.org/) [www.genecards.org/) and intersected to the predicted targets in order to get possible Lyc targets for angiogenesis-inhibiting. Finally, target names were submitted to the Cytoscape software (http://www.cytoscape.org) [Lyc\u2019s structural formula was drawn using Chemdraw  and uploaded to PharmMapper   . Biologiape.org)  to visuaWestern blotting was conducted as we described before . BrieflyHUVECs administered with different concentrations of Lyc were grown at a 24-well plate after stimulated by PDGF-AA, fixed with 4% paraformaldehyde for 15\u00a0min and blocked with 5% bovine serum albumin for 1\u00a0h at room tempature. Sequently, primary antibody  was applied to incubate the cells overnight and incubated with Alexa Fluor 488 secondary antibody  for 2\u00a0h. Finally, cells were incubated with hoechst  for 5\u00a0min and visualized under an inverted fluorescent microscope.Molecular docking was performed using Schr\u00f6dinger software, which included Protein Preparation Wizard, LigPrep, and Glide modules. PDGFR\u03b1 crystal structure (PDB ID: 6JOK) was prepared from RCSB  and optiPDGFR\u03b1 enzymatic assay was performed using the Kinase Activity Assay Kit  following the manufacturer's protocol. Purified human PDGFR\u03b1 protein was treated with Lyc at different concentrations in a black 384-well plate. The fluorescence intensity was measured by an automatic microplate reader .Surface plasmon resonance (SPR) affinity experiment , 39 for CETSAs were conducted to detect the direct binding between Lyc and PDGFR\u03b1 in celluar. Briefly, cells were pre-treated with 6 uM of Lyc for 48\u00a0h, chilled on ice, washed with PBS containing protease inhibitor and then transferred into 1.5\u00a0ml PCR tubes and heated for 3\u00a0min at appropriate temperature. Subsequently, cells were lysed, seperated and detected by western blot assays.p-values\u2009<\u20090.05.Results were analyzed using SPSS software . All experiments were independently repeated at least three times and data were presented as the mean\u2009\u00b1\u2009SD. Student\u2019 s two-tailed t-test and one-way ANOVA were performed to determine statistical significance between different groups. Differences were considered significant when 50: 24\u00a0h 9.34\u00a0\u00b5M, 48\u00a0h 4.93\u00a0\u00b5M). To further evaluate the inhibitory effect of Lyc on the growth of HUVECs, we selected sunitinib, a commonly used anti-angiogenesis agent [Tumor blood vessels provide oxygen and nutrients necessary for the metabolism of tumor cells. Thus, angiogenesis is the most basic factor in the growth and metastasis of tumors. The proliferation and migration of vascular endothelial cells toward tumor cells via a gap in the basement membrane is a key step in tumor angiogenesis. The inhibitory effect of Lyc on the proliferation and migration of HUVECs was observed to explore its impact on angiogenesis. An MTT assay was used to determine the cell viability of HUVECs treated with Lyc at different concentrations and at different time points to detect the inhibitory effect of Lyc on the proliferation of HUVECs. As shown in Fig.\u00a0is agent , as the is agent , 42) hadThe structural formula for Lyc was uploaded to PharmMapper, and duplicate results were removed to obtain a total of 456 possible targets. The official symbols for the drug targets were obtained from UniProt. For a more in-depth understanding of the target protein, GO function and KEGG pathway analyses were applied in WebGestalt. Signal transduction was the most significant biological process (BP) term, cytoplasm and plasma membrane were the most significant cellular component (CC) terms, and protein binding was the most significant molecular function (MF) term . As shown in Fig.\u00a0As described above, PDGFR\u03b1 is dimerized and activated by the ligand PDGF. The ligand/receptor interactions proven to be important in vivo are PDGF-AA and PDGF-CC, which induce PDGFR\u03b1 dimerization. Therefore, we tested whether Lyc could inhibit PDGF-AA-induced angiogenesis. As shown in Fig.\u00a0Alkaloids are basic organic compounds containing nitrogen that mainly exist in plants and animals. Alkaloids have a complex ring structure, which mostly contains nitrogen. Based on this structure, alkaloids show rich physiological and pharmacological activities. Approximately 20 kinds of Lycoris spp. are widely distributed in the world. Lycoris was the first alkaloid isolated from Lycoris spp., and it is also the most common alkaloid in this family . In prevHUVECs extracted from the umbilical cord are an alternative model to study tumor angiogenesis. During proliferation and invasion, proteases secreted by tumor cells degrade the extracellular matrix (ECM), and immature vascular endothelial cells sprout into the tumor basement membrane. Then, vascular endothelial cells continue to mature and differentiate and form the vascular lumen. The capillary network further spreads and finally forms mature blood vessels . The proThe CAM assay has the advantages of simple sampling, a short experimental period and simple operation. However, the disadvantages of the CAM assay are that the local damage caused by the change in osmotic pressure and pH value affect angiogenesis, and the experimental operation process and the state of the chicken embryo chorionic membrane also have a great influence on the experimental results \u201353. In oThe PDGFRA gene, which maps to chromosome 4q12, encodes a highly homologous transmembrane glycoprotein,named PDGFR\u03b1,that belongs to the type III receptor tyrosine kinase family.Binding of PDGF stimulates PDGFR\u03b1 dimerization, which further initiates intracellular signaling . In soliCascade signaling pathway activation induced by PDGF/PDGFR\u03b1 can regulate vascular endothelial cells, enhance vascular permeability, and regulate angiogenesis . When thTyrosine kinase inhibitors (TKIs) bind to tyrosine residues in the intracellular region of membrane receptors and inhibit tyrosine phosphorylation, thereby preventing tumor-related signal activation. Molecular docking in computer-aided drug design (CADD) selects the optimal binding mode of the receptor and ligand according to the energy and spatial structure complementarity of the receptor and ligand. The reasonable relative position, molecular direction and dynamic change of receptor and ligand molecules are determined by molecular docking . In thisNatural products have unique advantages in tumor treatment, but their effective substances and mechanisms are not yet clear; thus, the specific targets of natural products have not been identified. In this study, using bioinformatics prediction, molecular docking, and in vitro and ex vivo experiments, Lyc was shown to attenuate PDGFR\u03b1 activation. In addition, natural products produce pharmacological effects on different targets, but this study only examined the role of Lyc on PDGFR\u03b1. The possible Lyc impact on other targets, especially other tyrosine kinases, needs to be further investigated. Clinical trials are the most critical step in the development of drugs and determining their applicability to extended indications. We look forward to clinical trials with large sample sizes to verify the efficacy of Lyc for the treatment of tumors.Additional file 1. Additional file 2. Additional file 3.", "texts": ["Lycorine (Lyc) is a natural alkaloid derived from medicinal plants of the Amaryllidaceae family. Lyc has been reported to inhibit the recurrence and metastasis of different kinds of tumors. However, Lyc\u2019s effect on angiogenesis and its specific mechanism are still not clear. This study was designed to test the antiangiogenesis effect of Lyc and to explore the possible mechanisms. We performed cell experiments to confirm Lyc\u2019s inhibitory effect on angiogenesis and employed sunitinib as a positive control. Moreover, the synergistic effect of Lyc and sunitinib was also explored. Next, we conducted bioinformatics analyses to predict the potential targets of Lyc and verified them by western blotting and immunofluorescence. Molecular docking, kinase activity assays, Biacore assays and cellular thermal shift assays (CETSAs) were applied to elucidate the mechanism by which Lyc inhibited target activity. Lyc inhibited angiogenesis in human umbilical vein endothelial cells (HUVECs). Employing bioinformatics, we found that Lyc\u2019s target was PDGFR\u03b1 and that Lyc attenuated PDGFR\u03b1 phosphorylation. We also found that Lyc inhibited PDGFR\u03b1 activation by docking to it to restrain its activity. Additionally, Lyc significantly inhibited PDGF-AA-induced angiogenesis. This study provides new insights into the molecular functions of Lyc and indicates its potential as a therapeutic agent for tumor angiogenesis.The online version contains supplementary material available at 10.1186/s12885-022-09929-y. Malignant tumors are the main cause of death and are important obstacles to improving life expectancy worldwide .3, the vasculature on the tumor surface is disordered. This is conducive to the exogenous growth of tumors and prevents drugs from entering the tumor body, resulting in reduced drug uptake, which is the theoretical basis for the treatment of tumors with antiangiogenic drugs [Angiogenesis is one of the hallmarks of tumors , and tumic drugs . Althougic drugs . In addiic drugs , 8. TherIn recent years, natural compounds have been proven to be effective in the treatment of tumors, including in antiangiogenesis \u201311. LycoNetwork pharmacology is a branch of pharmacology that is based on systems biology and multiple pharmacology theories and primarily focuses on biomolecular networks . In pharIn this study, we explored the anti-angiogenic roles of Lyc in vitro and in vivo, employing sunitinib as a positive control, and then the Lyc targets were predicted by the PharmMapper database. Lyc inhibited PDGFR\u03b1 activities by docking to it directly. This protocol can be considered an effective method for exploring completely new applications of natural products with exact structural formulas. This study improved the understanding of Lyc's molecular biological function and indicated that Lyc may be a promising anti-angiogenic therapy.2.Human Umbilical Vein Endothelial Cells (HUVECs) were purchased from Cell Bank of Representative Culture Preservation Committee of Chinese Academy of Sciences . HUVECs were cultured in HUV-EC-C medium and kept in an incubator at 37\u00a0\u00b0C with 5% COLyc was purchased from MedChemExpress (HY-N0288) and prepared as described before . SunitinCell viability was examined using the 3--2,5-diphenyltetrazolium bromide (MTT) assay. Cells (3000 cells/well) were seeded in a 96-well plate overnight and then exposed to different concentrations of Lyc (and/or sunitinib) and incubated for 24 and 48\u00a0h. A total of 20 \u00b5L of MTT solution  were added to each well and the cells were incubated for another 4\u00a0h at 37\u00a0\u00b0C. The supernatant was then removed and 200 \u00b5L of DMSO were added to each well to dissolve the precipitate. Absorbance was measured using a spectrophotometer  at 490\u00a0nm.Cells were seeded in six-well plates at a density of 1000 cells/well. On the next day, cells were treated with Lyc and/or sunitinib. Ten days after the treatment, cells were fixed with methanol for 15\u00a0min and then staixned with 0.1% crystal violet. Finally, stained cell colonies were photographed with a digital camera and analyzed using ImageJ , Bethesda, USA).Cells cultured in a Petri dish and treated with Lyc and/or sunitinib for a range of time points were collected and incubated with 5 \u00b5L of Annexin V and 10 \u00b5L of PI for 15\u00a0min in the dark. The samples were then evaluated using flow cytometry and the data were analyzed using FlowJo .4 cells/chamber) and different concentrations of Lyc (and/or sunitinib) were seeded in an upper Transwell chamber . HUV-EC-C medium containing 25\u00a0ng/mL PDGF-AA was added to the lower chamber. Non-migrated cells from the upper membrane were removed after incubation for 16\u00a0h at 37\u00a0\u00b0C. The migrated cells were stained with 0.1% crystal violet and photographed under a light microscope at\u2009\u00d7\u2009200. Migrated cells were analyzed quantitatively using ImageJ.For the migration assay, 200 \u00b5L of HUV-EC-C medium containing cells (2.0\u2009\u00d7\u2009105 cells/well) were seeded in six-well plates. As the cells became sub-confluent, a straight cell-free wound was scratched with a 10 \u00b5L pipette tip. Cells were then washed twice with PBS and incubated in serum-free medium containing different concentration of Lyc and/or sunitinib. Cell scratches were observed and measured at different time points. Cell migration distances were analyzed quantitatively using ImageJ.Cells  pre-coating at 37\u00a0\u00b0C for 30\u00a0min. Thereafter, HUVECs were treated with different concentrations of Lyc and/or sunitinib for 4\u00a0h. After exposure, HUVECs tubes and branches were photographed under a light microscope at\u2009\u00d7\u2009200. The formed branches were analyzed quantitatively using ImageJ.HUVECs were plated at a density of 1\u2009\u00d7\u2009102) and the shell membrane was removed with sterile forceps to expose the chorioallantoic membrane. A small rubber ring was placed on the chorioallantoic membrane and different concentrations of Lyc and/or sunitinib were added into the ring and incubated. At baseline and 8, 16\u00a0h later, the ring area was photographed by a scanner and the images were analyzed using Image-Pro Plus 6.0 .Five fresh 10-day-old fertile eggs were cleaned with alcohol and then incubated at 37\u00a0\u00b0C and 60\u201380% humidity in an egg incubator. The shell was cut to create a small window (20\u2009\u00d7\u200920 mmhttp://59.78.96.61/pharmmapper/) to obtain possible Lyc targets. The target names were then corrected to the official symbol using UniProt (https://www.uniprot.org/). Gene ontology (GO) functional annotation [http://www.webgestalt.org/) [www.genecards.org/) and intersected to the predicted targets in order to get possible Lyc targets for angiogenesis-inhibiting. Finally, target names were submitted to the Cytoscape software (http://www.cytoscape.org) [Lyc\u2019s structural formula was drawn using Chemdraw  and uploaded to PharmMapper   . Biologiape.org)  to visuaWestern blotting was conducted as we described before . BrieflyHUVECs administered with different concentrations of Lyc were grown at a 24-well plate after stimulated by PDGF-AA, fixed with 4% paraformaldehyde for 15\u00a0min and blocked with 5% bovine serum albumin for 1\u00a0h at room tempature. Sequently, primary antibody  was applied to incubate the cells overnight and incubated with Alexa Fluor 488 secondary antibody  for 2\u00a0h. Finally, cells were incubated with hoechst  for 5\u00a0min and visualized under an inverted fluorescent microscope.Molecular docking was performed using Schr\u00f6dinger software, which included Protein Preparation Wizard, LigPrep, and Glide modules. PDGFR\u03b1 crystal structure (PDB ID: 6JOK) was prepared from RCSB  and optiPDGFR\u03b1 enzymatic assay was performed using the Kinase Activity Assay Kit  following the manufacturer's protocol. Purified human PDGFR\u03b1 protein was treated with Lyc at different concentrations in a black 384-well plate. The fluorescence intensity was measured by an automatic microplate reader .Surface plasmon resonance (SPR) affinity experiment , 39 for CETSAs were conducted to detect the direct binding between Lyc and PDGFR\u03b1 in celluar. Briefly, cells were pre-treated with 6 uM of Lyc for 48\u00a0h, chilled on ice, washed with PBS containing protease inhibitor and then transferred into 1.5\u00a0ml PCR tubes and heated for 3\u00a0min at appropriate temperature. Subsequently, cells were lysed, seperated and detected by western blot assays.p-values\u2009<\u20090.05.Results were analyzed using SPSS software . All experiments were independently repeated at least three times and data were presented as the mean\u2009\u00b1\u2009SD. Student\u2019 s two-tailed t-test and one-way ANOVA were performed to determine statistical significance between different groups. Differences were considered significant when 50: 24\u00a0h 9.34\u00a0\u00b5M, 48\u00a0h 4.93\u00a0\u00b5M). To further evaluate the inhibitory effect of Lyc on the growth of HUVECs, we selected sunitinib, a commonly used anti-angiogenesis agent [Tumor blood vessels provide oxygen and nutrients necessary for the metabolism of tumor cells. Thus, angiogenesis is the most basic factor in the growth and metastasis of tumors. The proliferation and migration of vascular endothelial cells toward tumor cells via a gap in the basement membrane is a key step in tumor angiogenesis. The inhibitory effect of Lyc on the proliferation and migration of HUVECs was observed to explore its impact on angiogenesis. An MTT assay was used to determine the cell viability of HUVECs treated with Lyc at different concentrations and at different time points to detect the inhibitory effect of Lyc on the proliferation of HUVECs. As shown in Fig.\u00a0is agent , as the is agent , 42) hadThe structural formula for Lyc was uploaded to PharmMapper, and duplicate results were removed to obtain a total of 456 possible targets. The official symbols for the drug targets were obtained from UniProt. For a more in-depth understanding of the target protein, GO function and KEGG pathway analyses were applied in WebGestalt. Signal transduction was the most significant biological process (BP) term, cytoplasm and plasma membrane were the most significant cellular component (CC) terms, and protein binding was the most significant molecular function (MF) term . As shown in Fig.\u00a0As described above, PDGFR\u03b1 is dimerized and activated by the ligand PDGF. The ligand/receptor interactions proven to be important in vivo are PDGF-AA and PDGF-CC, which induce PDGFR\u03b1 dimerization. Therefore, we tested whether Lyc could inhibit PDGF-AA-induced angiogenesis. As shown in Fig.\u00a0Alkaloids are basic organic compounds containing nitrogen that mainly exist in plants and animals. Alkaloids have a complex ring structure, which mostly contains nitrogen. Based on this structure, alkaloids show rich physiological and pharmacological activities. Approximately 20 kinds of Lycoris spp. are widely distributed in the world. Lycoris was the first alkaloid isolated from Lycoris spp., and it is also the most common alkaloid in this family . In prevHUVECs extracted from the umbilical cord are an alternative model to study tumor angiogenesis. During proliferation and invasion, proteases secreted by tumor cells degrade the extracellular matrix (ECM), and immature vascular endothelial cells sprout into the tumor basement membrane. Then, vascular endothelial cells continue to mature and differentiate and form the vascular lumen. The capillary network further spreads and finally forms mature blood vessels . The proThe CAM assay has the advantages of simple sampling, a short experimental period and simple operation. However, the disadvantages of the CAM assay are that the local damage caused by the change in osmotic pressure and pH value affect angiogenesis, and the experimental operation process and the state of the chicken embryo chorionic membrane also have a great influence on the experimental results \u201353. In oThe PDGFRA gene, which maps to chromosome 4q12, encodes a highly homologous transmembrane glycoprotein,named PDGFR\u03b1,that belongs to the type III receptor tyrosine kinase family.Binding of PDGF stimulates PDGFR\u03b1 dimerization, which further initiates intracellular signaling . In soliCascade signaling pathway activation induced by PDGF/PDGFR\u03b1 can regulate vascular endothelial cells, enhance vascular permeability, and regulate angiogenesis . When thTyrosine kinase inhibitors (TKIs) bind to tyrosine residues in the intracellular region of membrane receptors and inhibit tyrosine phosphorylation, thereby preventing tumor-related signal activation. Molecular docking in computer-aided drug design (CADD) selects the optimal binding mode of the receptor and ligand according to the energy and spatial structure complementarity of the receptor and ligand. The reasonable relative position, molecular direction and dynamic change of receptor and ligand molecules are determined by molecular docking . In thisNatural products have unique advantages in tumor treatment, but their effective substances and mechanisms are not yet clear; thus, the specific targets of natural products have not been identified. In this study, using bioinformatics prediction, molecular docking, and in vitro and ex vivo experiments, Lyc was shown to attenuate PDGFR\u03b1 activation. In addition, natural products produce pharmacological effects on different targets, but this study only examined the role of Lyc on PDGFR\u03b1. The possible Lyc impact on other targets, especially other tyrosine kinases, needs to be further investigated. Clinical trials are the most critical step in the development of drugs and determining their applicability to extended indications. We look forward to clinical trials with large sample sizes to verify the efficacy of Lyc for the treatment of tumors.Additional file 1. Additional file 2. Additional file 3."]}
-{"representative": "Circularly polarised light will revolutionise emerging technologies, including encrypted light-based communications, quantum computing, bioimaging and multi-channel data processing. In order to make use of these remarkable opportunities, high performance photodetectors that can accurately differentiate between left- and right-handed circularly polarised light are desperately needed. Whilst this potential has resulted in considerable research interest in chiral materials and circularly polarised photodetecting devices, their translation into real-world technologies is limited by non-standardised reporting and testing protocols. This mini-review provides an accessible introduction into the working principles of circularly polarised photodetectors and a comprehensive overview of the performance metrics of state-of-the-art devices. We propose a rigorous device characterisation procedure that will allow for standardised evaluation of novel devices, which we hope will accelerate research and investment in this area. Here we provide a framework of standardised apparatus and tests which enable rigorous characterisation of the performance of photodetectors sensitive to circular polarisation, enabling meaningful comparisons between devices reported in literature. Organic based photodetectors are commonly referred to as OPDs; whilst we will use this term here, we note that most of the principles discussed and some of the examples provided involve hybrid or perovskite-based devices. Several OPD device architectures have been considered and strategies to improve device performance  are emerging.12 The circularly selective optical response of chiral functional materials makes them an exciting prospect for direct detection of CP light without the need for external optics.13 To this end, a variety of organic and organic\u2013inorganic chiral materials have been developed.14,15 Due to the strong focus of recent studies on maximising the CP selectivity of detectors, conventional non-CP figures of merit have been largely sidelined. This has led to poor overall performances of devices reported to date, limiting their suitability for widespread application of CP OPDs in real-world technologies. Furthermore, the rapidly growing highly interdisciplinary nature of the research field has resulted in a variety of characterisation protocols, and incomplete reporting of figures of merit, rendering meaningful comparisons between different materials and device architectures a challenge. The development and use of common standards, which were essential for the commercialisation of photovoltaics, photodetectors and light emitting diodes, are desperately needed.Owing to their tuneable detection wavelengths, simple processing requirements and compatibility with low-cost manufacturing processes, photodetectors based on organic and hybrid organic\u2013inorganic semiconductors have attracted intense research interest in recent years.13\u201316 Here we carefully set out the performance metrics and instrumentation essential to characterise device performance and CP selectivity of OPDs based on chiral functional materials. We hope that this tutorial review serves to advance the field, such that CP OPDs with device performances and sensitivities compatible with the demands of real-world sensing can be realised.Here we consider the experimental measurements required to characterise CP OPDs rigorously and accurately. We propose a standardised means of reporting their key figures of merit, including Linear Dynamic Range (LDR), Bandwidth and Responsivity. As recent reviews have focussed on the design of materials capable of detecting circularly polarised light and the characterisation of their chiroptical response, we do not provide a further comprehensive review of those aspects here. Instead, we direct readers to several recent and detailed review articles.We first provide a brief introduction to the materials systems of current state-of-the-art CP OPDs. We then describe the operating principles of the three most common photodetectors  and outline the standardised figures of merit of these devices. We conclude by outlining strategies to make testing protocols more robust, which should result in standardised evaluation and reporting of device performance.2.etc.There are several materials characteristics which are desirable in the pursuit of high-performance photodetectors, including large optical absorption coefficients and long recombination times. Advances in molecular design have improved the spectral sensitivity of and charge transport in non-chiral organic and hybrid organic\u2013inorganic materials, although some of these strategies do not transfer cleanly to chiral materials due to inherent differences in molecular shape, packing, \u03b5r \u223c 3.5 vs. \u03b5r \u2265 10), which results in the formation of Coulombically bound electron\u2013hole pairs (excitons) under optical excitation. As thermal dissociation is highly improbable in a low dielectric constant medium, the generation of free charges in organic semiconductors typically requires the intermixing of two semiconductors with suitable energetics to yield a heterojunction between an electron donating and an electron accepting component.17 The electron accepting or electron donating character of the organic semiconductor is controlled through chemical design, for example by incorporating electron withdrawing or donating groups into the molecular structure.Organic semiconductors display much lower dielectric constants than their inorganic counterparts , such as IDTBR, have emerged as alternatives to fullerene-based acceptors with broader spectral photosensitivity and improved long-term morphological stability whilst retaining good charge-transport properties.18,19 Most NFAs make use of push-pull hybridisation, which allows them to absorb strongly in the visible and NIR region of the solar spectrum, achieving higher voltage outputs compared to fullerene-based alternatives.18,19Until recently, the most common selection of non-chiral materials in OPDs comprised homopolymer donors, such as P3HT, or push\u2013pull polymers , in combination with fullerene-based acceptors see .18,19 Ree.g., perovskites) are popular candidates for photodetection, owing to their remarkable charge carrier mobilities and high optical absorption. Further, perovskites have large dielectric constants (\u03b5r \u223c 20\u201350), which circumvents the need for heterojunctions to efficiently generate free charges.20Alongside organic semiconductors, hybrid organic\u2013inorganic materials  and right-handed (RH) light. It should be noted that the measured absorption expression does not account for reflection losses occurring at the front and back surfaces of thin films. It is possible to mitigate for these reflection losses by calculating the corrected absorbance of the photoactive layer of thickness d:22\u03b1 can be determined by measuring the apparent absorbance (Absmeas) as a function of film thickness (d) and calculated using the following expression:R)2 accounts for reflection losses of a free-standing film. This allows a corrected absorbance g-factor (gcorr) to be determined:gabs (gph) within a CP photodetecting device describes the differential photocurrent (Iph) generated in CP illumination:IL and IR are the photocurrents Iph  under LH and RH light. Note that the analogous definitions of responsivity dissymmetry (gR) and external quantum efficiency dissymmetry (gEQE) used in literature are mathematically identical to gph for the same intensity and wavelength of incident light, and as such will not be defined here  and magnetic (m) transition dipole moments.15 For most molecular systems, |m| \u226a |\u00b5|, which results in vanishingly small dissymmetry factors (gabs \u223c 10\u22124\u201310\u22123). Strategies have emerged to increase gabs, including rational molecular design, the formation of supramolecular chiral structures in which considerable gabs can be achieved through circular-selective scattering, and coupling between excited states on nearby chromophores.23\u201329 For example, in the solid-state, systems based on achiral \u03c0-conjugated polymers blended with chiral small molecule additives can give rise to very large gabs (>0.1).30 However, these approaches can come at a cost: the twisted molecular structures required in these approaches can compromise molecular packing and impede charge transport.From a molecular perspective, 3.The photophysical mechanisms that underpin photodetection depend on the device architecture. Here we introduce the most common device architectures , discussIph), which is given by:q is the electron charge, \u03b7 is the photocurrent external quantum efficiency, Popt is the incident optical power, h\u03bd is the incident photon energy, \u03bc is the majority carrier mobility, \u03c4Rec is the electron\u2013hole recombination time, V is the applied voltage between the terminals, and L is the photoconductor electrode spacing.11,31Ip is the primary photocurrent  and Ga is the device gain, given by:\u03c4Rec) is longer than the transit time for carriers to move between the two electrodes (\u03c4Trans).11,31 Small \u03c4Trans requires small electrode spacing, L, which can reduce the photoactive area of the photoconductor, unless the device width is increased to compensate. In this scenario, photogenerated carriers can traverse the active layer for several cycles before recombining, with the average number of cycles equivalent to Ga  to exceed 100%.Photoconductors are two terminal devices in which the conductivity of the active layer increases upon illumination. Optical excitation results in the generation of charge carriers and flow of a photocurrent (nt to Ga . This en2 V\u22121 s\u22121) and long carrier lifetimes (10\u22126 s), which enables significant Ga.20,32\u201334 Carriers with long \u03c4Rec persist once the light is switched off, which means that these devices can be slow to respond and have low bandwidths. Chiral perovskite photoconductors generally suffer from poor CP selectivity in absorption (gabs) owing to weak intrinsic chiroptical activity, however a number of recent examples have demonstrated that reducing the dimensionality of the perovskite structure (from quasi-2D to 2D or from 2D to 1D) can enhance gabs by introducing greater asymmetry and helicity into the perovskite crystal structure.35\u201337 Even perovskites which demonstrate poor gabs can generate considerable gph, for example naphthylethylamine based quasi-2D perovskite . As such, a compromise exists between strong light absorption and efficient exciton harvesting. This has resulted in the development of various photodiode architectures, including bilayer devices, interpenetrating donor-acceptor networks (bulk heterojunctions), and tandem devices.et al demonstrated heterojunction CP OPDs with photocurrent dissymmetry (gPh) \u223c 0.1 by blending achiral polymer, P3CT, with a chiral small molecule additive, 1,1\u2032-binaphthyl polymer (F8T2): chiral small molecule (1-aza[6]helicene) additive donor layer, and exciton dissociation takes place at the donor\u2013acceptor (C60) interface  is above or below the \u2018threshold\u2019 voltage (VTh) of the device. Irradiation of p-type  organic phototransistors results in the flow of photogenerated holes to the drain electrode and photogenerated electrons flow to the source. When VG < VTh, phototransistors behave as photoconductors, with photocurrent given by VG > VTh) photogenerated holes contribute to the measured Iph, whilst photogenerated electrons serve to lower the injection barrier (and |VTh|), which increases Iph further:A is a proportionality constant, kT/q is the thermal voltage, \u03b7 is the photogeneration quantum efficiency, hc/\u03bb is the photon energy and Ipd is the dark current for minority carriers.Phototransistors are three-electrode  devices in which the channel conductivity and charge injection barrier are modulated by external illumination.gph \u223c 1).47\u201349 For our own studies of phototransistors based on the chiral fullerene bis-PCBM  and chiral polymeric systems (polyfluorene-based (co-)polymers) have been assessed in CP selective phototransistors, achieving very high photocurrent dissymmetry factors  but have performance metrics comparable with state-of-the-art OPDs. For example, in optical communications, a high-speed demodulation system requires a large response to the signal, a broad bandwidth to accommodate variations and minimal background noise. Here we look to establish the key parameters used to evaluate performance of OPDs and propose standard testing protocols that can ensure the accurate, non-biased evaluation of their photoresponse. We have summarised the performance metrics for CP OPDs reported so far in To be of any practical use CP OPDs must not only have impressive selectivity to CP light (high R), which quantifies the ability of a photodetector to convert light into an electrical current for an incident optical power:Popt is the incident optical power, e is the elementary charge, h is Planck's constant, c is the speed of light and \u03bb is the wavelength of the incident light. Whilst photoconductor gain can result in EQEs of over 100%, the EQE of photodiodes is limited to 100%, which leads to small electrical signals when exposed to weak light. Remarkably, the responsivities of 2D chiral perovskite nanowire photodetectors (R = 47 A W\u22121 at 505 nm) have already exceeded the responsivities of silicon-based devices (R = 0.6 A W\u22121 at 930 nm).62,68External quantum efficiency (EQE) describes the ratio of the number extracted charges to the number of incident photons at a particular wavelength, for a given applied bias. EQE is closely related to the responsivity  and is desirable for machine vision applications where images may contain both intense bright spots and low light regions which must be accurately measured. Our achiral polyfluorene-based (co-)polymer: chiral small molecule (1-aza[6]helicene) photodiodes achieve an LDR of \u223c80 decibels, which is considerably higher than that of InGaAs (\u223c66 dB) and rivals both silicon (120 dB) and non-chiral OPDs (\u223c100 dB).30,69Although an important figure of merit for OPDs, LDR is rarely reported in CP OPD literature see . Large LB) or the rise and fall times  of the photodetector.The response speed of a photodetector quantifies the time taken for the photocurrent of a photodetector to change in response to variations in incident light intensity. This establishes a limit on the speed of optical phenomena which can be detected by a given photodetector and the rate of data transfer in an optical communication system. Response speed can be quantified by measuring the bandwidth  or reduces the capacitance of the device (e.g. reducing the electrode area and reducing the photoactive area of the device) will reduce the characteristic RC time. In general, devices that exploit photoconductive gain have slower response times, which limits data transfer rates in optical communication systems. Whilst video applications require B > 10 kHz, frequencies from 100 GHz to THz are particularly promising for next-generation communications because of unused bands of the spectrum, and are essential for technological applications such as the Internet of Things (IoT), autonomous driving, and augmented reality.70The bandwidth  measurestr) is the time taken for the device response to rise from 10% to 90% of its maximum value and the fall time (tf) is the time taken for the device response to fall from 90% to 10% of its maximum value  the high hole mobility of MAPbI3, (ii) the high electron mobility of F8IC and (iii) the suppression of RC delay times due to the reduced active area of these devices . The use of chiral active layers with high charge carrier mobilities and devices with small active areas should be further explored to increase the speed of CP selective detectors to be compatible with communication applications.To date, the fastest organic CP selective photodetectors are our own photodiodes based on chiral small molecule (1-aza[6]helicene) \u2013 achiral polymer (F8T2) blends, with a bandwidth of 56 kHz see .30 WhileF8IC see .72 The fRon/off defines the ratio between the device drain current for the device in the on- and off-state for phototransistors:Ron/off value is desirable as this indicates that a low driving voltage is required to achieve a good signal-to-noise ratio.17 This reduces the energy consumption of circuits based on organic transistors and enables their use in low power applications such as IoT devices.On\u2013off ratio 7, exceeding the on\u2013off ratios of some inorganic phototransistors.52,73To date, the highest recorded on\u2013off ratio for a CP selective phototransistor is over 10et al.74 The minimum light power that can be detected is quantified by the noise equivalent power (NEP):B is the electrical bandwidth. The specific detectivity (D*) is the inverse of NEP normalised by the square root of the active area, and can be used to compare the detectivity of devices with different active areas:D*, yet a comprehensive understanding of the intrinsic and external sources is currently lacking.The dark current describes the flow of charge carriers through a photodetector in the dark, whilst the noise current describes random fluctuations in the dark current. Several mechanisms can generate the noise current inside organic photodetectors, which have been summarised by Hirsch 13 Jones for a phototransistor based on an organic small molecule single crystal, relative to a value of 2.3 \u00d7 1011 Jones for a typical Si photodiode.52,75The largest detectivity for a CP selective photodetector was reported as 2.9 \u00d7 10The operational lifetime of a photodetector represents time for which the photoconductor responsivity remains approximately constant under fixed bias and illumination conditions. For CP selective photodetectors, this must also include the stability of the dissymmetry of photocurrent over time.76,77 This is particularly common in perovskite devices.77Photodetectors typically undergo an initial rapid degradation in device responsivity, referred to as \u201cburn-in\u201d, followed by a slower, more stable decay period (post-burn-in), which must be accounted for in the measurement of operational lifetime.37To the best knowledge of the authors, only one report of the operational lifetime of a CP selective photodetector has been published. This device was a quasi-2D perovskite photoconductor with a reported operational lifetime of one month.5.78 and, separately, the chiroptical activity of chiral materials,79 here we summarise our own best practice for the complete characterisation of CP OPDs.The fast-paced interdisciplinary nature of photodetector research has resulted in incomplete reporting of figures of merit see , which lgabs of a solution or film are measured using a CD spectrometer. For solid state samples, CD spectra should be collected with the sample in various orientations . This allows for the identification of artefacts due to linear dichroism and linear birefringence, which would appear as a shift or inversion of the CD spectrum on rotation or flipping the side of the sample facing the light source.79 Linear artefacts may also be identified through the use of Mueller Matrix Spectroscopic Ellipsometry and Mueller Matrix Polarimetry Imaging, which are capable of resolving the circular dichroism, circular birefringence, linear dichroism and linear birefringence spectra for a sample simultaneously.79,80The circular dichroism (CD) and Responsivity and EQE are measured using the equipment shown in 81 The two EQE spectra of the device under L-CPL and R-CPL can then be used to calculate a photocurrent dissymmetry spectrum.By placing a linear polariser and Fresnel rhomb (a broadband quarter-waveplate) in the path of the chopped monochromatic beam, EQE and responsivity can be measured under circularly polarised light in the wavelength range of 400\u20131550 nm.via the calibrated photodiode photocurrent) are monitored using the source measure unit. The intensity of the incident light is steadily increased until the device under test deviates from a linear relationship between photocurrent and incident light intensity. The minimum and maximum photocurrents in this linear region are then applied to The LDR of a photodetector is measured using the setup shown in B is measured using the setup shown in f) of the light source is gradually increased until the peak-to-peak voltage of the photodetector signal (Vsin(f)) satisfies the 3 dB condition:Vcw is the continuous wave response of the photodetector to an unmodulated light source with an intensity equal to the peak intensity of the sinusoidally varying light source. This is the \u201cBandwidth\u201d or \u201c3 dB cut-off frequency\u201d of the device.Detector tr and tf of a photodetector can be extracted using the same setup which is used for the measurement of B. The photodetector is illuminated using a square wave modulated light source with a tuneable switching frequency. The frequency of modulation should be selected so that the device under test produces an oscilloscope signal of the form shown in tr and tf once a signal of this form is acquired. tr and tf should not be extracted using the current measurement of a digital source measure unit, as the measurement sampling frequency is often inadequate for accurate measurements of response times below 10 ms.The B, tr and tf, it is essential that the light source, modulation source, current preamplifier and oscilloscope have electrical bandwidths greater than the bandwidth of the photodetector under test, otherwise the lowest bandwidth component of the testing apparatus will be measured instead of the true bandwidth or response times of the device. For example, if the bandwidth of a photodiode with a \u22123 dB cut-off frequency of 100 kHz is measured using a current preamplifier with a bandwidth of 10 kHz, an incorrect bandwidth of approximately 10 kHz or less will be measured.In the measurement of et al. and Wang et al., defining the operational lifetime as the time required for the responsivity or photocurrent dissymmetry factor of a device to fall to 80% of their post-burn-in values, whichever comes first.76,77The operational lifetimes of both CP and non-CP photodetectors have been measured using several different methods in the literature. To standardise this measurement, we suggest a similar approach to that taken by Kielar gph as a function of device operation time, we propose that the operational lifetime of a device should be measured under pulsed CP illumination, alternating between L-CP illumination, dark conditions, R-CP illumination, and dark conditions repeatedly. This can be achieved using the setup shown in To measure responsivity and Idark of a photodetector is measured as simply the current flow through the photodetector under dark conditions.The The NEP of a photodetector can be determined by measuring the voltage output of a current preamplifier connected to the device under test in dark conditions using a lock-in amplifier. Most modern digital lock-in amplifiers can provide the noise spectral density of the input signal which, when divided by the responsivity of the detector at a given wavelength, yields the noise equivalent power at that wavelength. This can, in turn, be used to calculate the device detectivity using 6.e.g., linear dynamic range, bandwidth, detectivity) is rarely provided, which limits their application in real-world devices. In this tutorial review we have summarised the most important figures of merit for circularly polarised organic photodetectors and provided detailed descriptions of how to measure them.Circularly polarised organic photodetectors will facilitate future technologies based on image detection, chemical sensing, encrypted communications, and environmental monitoring. The diversity of accessible chiral functional materials that absorb circularly polarised light introduces a wide range of new possibilities, which has inspired considerable research interest in both academia and industry. Whilst reported devices often show impressive chiroptical responses, their device performances are often inferior when compared to non-chiral photodetectors. Further, complete and rigorous characterisation of the critical photodetector parameters  are essential for high-performance devices. Here, chiral organic\u2013inorganic systems  and supramolecular assemblies are the most attractive candidates. Finally, exciton dissociation and the efficient extraction of charge carriers will require the use of multi-layer devices and optimised heterojunction structures with intermixed donor and acceptor domains.Innovations in molecular design, novel device architectures and stronger collaborations between materials chemists and device physicists will advance the field. Optical sensing from the ultraviolet to the infrared is essential for a variety of industrial and scientific applications. To this end, chiral functional materials with photoresponses that span the full range from the UV to the NIR will likely show promise. Chiral materials with outstanding electronic properties (We hope that this review will help to advance this exciting and growing field and inform the design of novel materials/devices with outstanding chiroptical properties and device performance.There are no conflicts to declare.TC-010-D2TC01224C-s001", "texts": ["Circularly polarised light will revolutionise emerging technologies, including encrypted light-based communications, quantum computing, bioimaging and multi-channel data processing. In order to make use of these remarkable opportunities, high performance photodetectors that can accurately differentiate between left- and right-handed circularly polarised light are desperately needed. Whilst this potential has resulted in considerable research interest in chiral materials and circularly polarised photodetecting devices, their translation into real-world technologies is limited by non-standardised reporting and testing protocols. This mini-review provides an accessible introduction into the working principles of circularly polarised photodetectors and a comprehensive overview of the performance metrics of state-of-the-art devices. We propose a rigorous device characterisation procedure that will allow for standardised evaluation of novel devices, which we hope will accelerate research and investment in this area. Here we provide a framework of standardised apparatus and tests which enable rigorous characterisation of the performance of photodetectors sensitive to circular polarisation, enabling meaningful comparisons between devices reported in literature. Organic based photodetectors are commonly referred to as OPDs; whilst we will use this term here, we note that most of the principles discussed and some of the examples provided involve hybrid or perovskite-based devices. Several OPD device architectures have been considered and strategies to improve device performance  are emerging.12 The circularly selective optical response of chiral functional materials makes them an exciting prospect for direct detection of CP light without the need for external optics.13 To this end, a variety of organic and organic\u2013inorganic chiral materials have been developed.14,15 Due to the strong focus of recent studies on maximising the CP selectivity of detectors, conventional non-CP figures of merit have been largely sidelined. This has led to poor overall performances of devices reported to date, limiting their suitability for widespread application of CP OPDs in real-world technologies. Furthermore, the rapidly growing highly interdisciplinary nature of the research field has resulted in a variety of characterisation protocols, and incomplete reporting of figures of merit, rendering meaningful comparisons between different materials and device architectures a challenge. The development and use of common standards, which were essential for the commercialisation of photovoltaics, photodetectors and light emitting diodes, are desperately needed.Owing to their tuneable detection wavelengths, simple processing requirements and compatibility with low-cost manufacturing processes, photodetectors based on organic and hybrid organic\u2013inorganic semiconductors have attracted intense research interest in recent years.13\u201316 Here we carefully set out the performance metrics and instrumentation essential to characterise device performance and CP selectivity of OPDs based on chiral functional materials. We hope that this tutorial review serves to advance the field, such that CP OPDs with device performances and sensitivities compatible with the demands of real-world sensing can be realised.Here we consider the experimental measurements required to characterise CP OPDs rigorously and accurately. We propose a standardised means of reporting their key figures of merit, including Linear Dynamic Range (LDR), Bandwidth and Responsivity. As recent reviews have focussed on the design of materials capable of detecting circularly polarised light and the characterisation of their chiroptical response, we do not provide a further comprehensive review of those aspects here. Instead, we direct readers to several recent and detailed review articles.We first provide a brief introduction to the materials systems of current state-of-the-art CP OPDs. We then describe the operating principles of the three most common photodetectors  and outline the standardised figures of merit of these devices. We conclude by outlining strategies to make testing protocols more robust, which should result in standardised evaluation and reporting of device performance.2.etc.There are several materials characteristics which are desirable in the pursuit of high-performance photodetectors, including large optical absorption coefficients and long recombination times. Advances in molecular design have improved the spectral sensitivity of and charge transport in non-chiral organic and hybrid organic\u2013inorganic materials, although some of these strategies do not transfer cleanly to chiral materials due to inherent differences in molecular shape, packing, \u03b5r \u223c 3.5 vs. \u03b5r \u2265 10), which results in the formation of Coulombically bound electron\u2013hole pairs (excitons) under optical excitation. As thermal dissociation is highly improbable in a low dielectric constant medium, the generation of free charges in organic semiconductors typically requires the intermixing of two semiconductors with suitable energetics to yield a heterojunction between an electron donating and an electron accepting component.17 The electron accepting or electron donating character of the organic semiconductor is controlled through chemical design, for example by incorporating electron withdrawing or donating groups into the molecular structure.Organic semiconductors display much lower dielectric constants than their inorganic counterparts , such as IDTBR, have emerged as alternatives to fullerene-based acceptors with broader spectral photosensitivity and improved long-term morphological stability whilst retaining good charge-transport properties.18,19 Most NFAs make use of push-pull hybridisation, which allows them to absorb strongly in the visible and NIR region of the solar spectrum, achieving higher voltage outputs compared to fullerene-based alternatives.18,19Until recently, the most common selection of non-chiral materials in OPDs comprised homopolymer donors, such as P3HT, or push\u2013pull polymers , in combination with fullerene-based acceptors see .18,19 Ree.g., perovskites) are popular candidates for photodetection, owing to their remarkable charge carrier mobilities and high optical absorption. Further, perovskites have large dielectric constants (\u03b5r \u223c 20\u201350), which circumvents the need for heterojunctions to efficiently generate free charges.20Alongside organic semiconductors, hybrid organic\u2013inorganic materials  and right-handed (RH) light. It should be noted that the measured absorption expression does not account for reflection losses occurring at the front and back surfaces of thin films. It is possible to mitigate for these reflection losses by calculating the corrected absorbance of the photoactive layer of thickness d:22\u03b1 can be determined by measuring the apparent absorbance (Absmeas) as a function of film thickness (d) and calculated using the following expression:R)2 accounts for reflection losses of a free-standing film. This allows a corrected absorbance g-factor (gcorr) to be determined:gabs (gph) within a CP photodetecting device describes the differential photocurrent (Iph) generated in CP illumination:IL and IR are the photocurrents Iph  under LH and RH light. Note that the analogous definitions of responsivity dissymmetry (gR) and external quantum efficiency dissymmetry (gEQE) used in literature are mathematically identical to gph for the same intensity and wavelength of incident light, and as such will not be defined here  and magnetic (m) transition dipole moments.15 For most molecular systems, |m| \u226a |\u00b5|, which results in vanishingly small dissymmetry factors (gabs \u223c 10\u22124\u201310\u22123). Strategies have emerged to increase gabs, including rational molecular design, the formation of supramolecular chiral structures in which considerable gabs can be achieved through circular-selective scattering, and coupling between excited states on nearby chromophores.23\u201329 For example, in the solid-state, systems based on achiral \u03c0-conjugated polymers blended with chiral small molecule additives can give rise to very large gabs (>0.1).30 However, these approaches can come at a cost: the twisted molecular structures required in these approaches can compromise molecular packing and impede charge transport.From a molecular perspective, 3.The photophysical mechanisms that underpin photodetection depend on the device architecture. Here we introduce the most common device architectures , discussIph), which is given by:q is the electron charge, \u03b7 is the photocurrent external quantum efficiency, Popt is the incident optical power, h\u03bd is the incident photon energy, \u03bc is the majority carrier mobility, \u03c4Rec is the electron\u2013hole recombination time, V is the applied voltage between the terminals, and L is the photoconductor electrode spacing.11,31Ip is the primary photocurrent  and Ga is the device gain, given by:\u03c4Rec) is longer than the transit time for carriers to move between the two electrodes (\u03c4Trans).11,31 Small \u03c4Trans requires small electrode spacing, L, which can reduce the photoactive area of the photoconductor, unless the device width is increased to compensate. In this scenario, photogenerated carriers can traverse the active layer for several cycles before recombining, with the average number of cycles equivalent to Ga  to exceed 100%.Photoconductors are two terminal devices in which the conductivity of the active layer increases upon illumination. Optical excitation results in the generation of charge carriers and flow of a photocurrent (nt to Ga . This en2 V\u22121 s\u22121) and long carrier lifetimes (10\u22126 s), which enables significant Ga.20,32\u201334 Carriers with long \u03c4Rec persist once the light is switched off, which means that these devices can be slow to respond and have low bandwidths. Chiral perovskite photoconductors generally suffer from poor CP selectivity in absorption (gabs) owing to weak intrinsic chiroptical activity, however a number of recent examples have demonstrated that reducing the dimensionality of the perovskite structure (from quasi-2D to 2D or from 2D to 1D) can enhance gabs by introducing greater asymmetry and helicity into the perovskite crystal structure.35\u201337 Even perovskites which demonstrate poor gabs can generate considerable gph, for example naphthylethylamine based quasi-2D perovskite . As such, a compromise exists between strong light absorption and efficient exciton harvesting. This has resulted in the development of various photodiode architectures, including bilayer devices, interpenetrating donor-acceptor networks (bulk heterojunctions), and tandem devices.et al demonstrated heterojunction CP OPDs with photocurrent dissymmetry (gPh) \u223c 0.1 by blending achiral polymer, P3CT, with a chiral small molecule additive, 1,1\u2032-binaphthyl polymer (F8T2): chiral small molecule (1-aza[6]helicene) additive donor layer, and exciton dissociation takes place at the donor\u2013acceptor (C60) interface  is above or below the \u2018threshold\u2019 voltage (VTh) of the device. Irradiation of p-type  organic phototransistors results in the flow of photogenerated holes to the drain electrode and photogenerated electrons flow to the source. When VG < VTh, phototransistors behave as photoconductors, with photocurrent given by VG > VTh) photogenerated holes contribute to the measured Iph, whilst photogenerated electrons serve to lower the injection barrier (and |VTh|), which increases Iph further:A is a proportionality constant, kT/q is the thermal voltage, \u03b7 is the photogeneration quantum efficiency, hc/\u03bb is the photon energy and Ipd is the dark current for minority carriers.Phototransistors are three-electrode  devices in which the channel conductivity and charge injection barrier are modulated by external illumination.gph \u223c 1).47\u201349 For our own studies of phototransistors based on the chiral fullerene bis-PCBM  and chiral polymeric systems (polyfluorene-based (co-)polymers) have been assessed in CP selective phototransistors, achieving very high photocurrent dissymmetry factors  but have performance metrics comparable with state-of-the-art OPDs. For example, in optical communications, a high-speed demodulation system requires a large response to the signal, a broad bandwidth to accommodate variations and minimal background noise. Here we look to establish the key parameters used to evaluate performance of OPDs and propose standard testing protocols that can ensure the accurate, non-biased evaluation of their photoresponse. We have summarised the performance metrics for CP OPDs reported so far in To be of any practical use CP OPDs must not only have impressive selectivity to CP light (high R), which quantifies the ability of a photodetector to convert light into an electrical current for an incident optical power:Popt is the incident optical power, e is the elementary charge, h is Planck's constant, c is the speed of light and \u03bb is the wavelength of the incident light. Whilst photoconductor gain can result in EQEs of over 100%, the EQE of photodiodes is limited to 100%, which leads to small electrical signals when exposed to weak light. Remarkably, the responsivities of 2D chiral perovskite nanowire photodetectors (R = 47 A W\u22121 at 505 nm) have already exceeded the responsivities of silicon-based devices (R = 0.6 A W\u22121 at 930 nm).62,68External quantum efficiency (EQE) describes the ratio of the number extracted charges to the number of incident photons at a particular wavelength, for a given applied bias. EQE is closely related to the responsivity  and is desirable for machine vision applications where images may contain both intense bright spots and low light regions which must be accurately measured. Our achiral polyfluorene-based (co-)polymer: chiral small molecule (1-aza[6]helicene) photodiodes achieve an LDR of \u223c80 decibels, which is considerably higher than that of InGaAs (\u223c66 dB) and rivals both silicon (120 dB) and non-chiral OPDs (\u223c100 dB).30,69Although an important figure of merit for OPDs, LDR is rarely reported in CP OPD literature see . Large LB) or the rise and fall times  of the photodetector.The response speed of a photodetector quantifies the time taken for the photocurrent of a photodetector to change in response to variations in incident light intensity. This establishes a limit on the speed of optical phenomena which can be detected by a given photodetector and the rate of data transfer in an optical communication system. Response speed can be quantified by measuring the bandwidth  or reduces the capacitance of the device (e.g. reducing the electrode area and reducing the photoactive area of the device) will reduce the characteristic RC time. In general, devices that exploit photoconductive gain have slower response times, which limits data transfer rates in optical communication systems. Whilst video applications require B > 10 kHz, frequencies from 100 GHz to THz are particularly promising for next-generation communications because of unused bands of the spectrum, and are essential for technological applications such as the Internet of Things (IoT), autonomous driving, and augmented reality.70The bandwidth  measurestr) is the time taken for the device response to rise from 10% to 90% of its maximum value and the fall time (tf) is the time taken for the device response to fall from 90% to 10% of its maximum value  the high hole mobility of MAPbI3, (ii) the high electron mobility of F8IC and (iii) the suppression of RC delay times due to the reduced active area of these devices . The use of chiral active layers with high charge carrier mobilities and devices with small active areas should be further explored to increase the speed of CP selective detectors to be compatible with communication applications.To date, the fastest organic CP selective photodetectors are our own photodiodes based on chiral small molecule (1-aza[6]helicene) \u2013 achiral polymer (F8T2) blends, with a bandwidth of 56 kHz see .30 WhileF8IC see .72 The fRon/off defines the ratio between the device drain current for the device in the on- and off-state for phototransistors:Ron/off value is desirable as this indicates that a low driving voltage is required to achieve a good signal-to-noise ratio.17 This reduces the energy consumption of circuits based on organic transistors and enables their use in low power applications such as IoT devices.On\u2013off ratio 7, exceeding the on\u2013off ratios of some inorganic phototransistors.52,73To date, the highest recorded on\u2013off ratio for a CP selective phototransistor is over 10et al.74 The minimum light power that can be detected is quantified by the noise equivalent power (NEP):B is the electrical bandwidth. The specific detectivity (D*) is the inverse of NEP normalised by the square root of the active area, and can be used to compare the detectivity of devices with different active areas:D*, yet a comprehensive understanding of the intrinsic and external sources is currently lacking.The dark current describes the flow of charge carriers through a photodetector in the dark, whilst the noise current describes random fluctuations in the dark current. Several mechanisms can generate the noise current inside organic photodetectors, which have been summarised by Hirsch 13 Jones for a phototransistor based on an organic small molecule single crystal, relative to a value of 2.3 \u00d7 1011 Jones for a typical Si photodiode.52,75The largest detectivity for a CP selective photodetector was reported as 2.9 \u00d7 10The operational lifetime of a photodetector represents time for which the photoconductor responsivity remains approximately constant under fixed bias and illumination conditions. For CP selective photodetectors, this must also include the stability of the dissymmetry of photocurrent over time.76,77 This is particularly common in perovskite devices.77Photodetectors typically undergo an initial rapid degradation in device responsivity, referred to as \u201cburn-in\u201d, followed by a slower, more stable decay period (post-burn-in), which must be accounted for in the measurement of operational lifetime.37To the best knowledge of the authors, only one report of the operational lifetime of a CP selective photodetector has been published. This device was a quasi-2D perovskite photoconductor with a reported operational lifetime of one month.5.78 and, separately, the chiroptical activity of chiral materials,79 here we summarise our own best practice for the complete characterisation of CP OPDs.The fast-paced interdisciplinary nature of photodetector research has resulted in incomplete reporting of figures of merit see , which lgabs of a solution or film are measured using a CD spectrometer. For solid state samples, CD spectra should be collected with the sample in various orientations . This allows for the identification of artefacts due to linear dichroism and linear birefringence, which would appear as a shift or inversion of the CD spectrum on rotation or flipping the side of the sample facing the light source.79 Linear artefacts may also be identified through the use of Mueller Matrix Spectroscopic Ellipsometry and Mueller Matrix Polarimetry Imaging, which are capable of resolving the circular dichroism, circular birefringence, linear dichroism and linear birefringence spectra for a sample simultaneously.79,80The circular dichroism (CD) and Responsivity and EQE are measured using the equipment shown in 81 The two EQE spectra of the device under L-CPL and R-CPL can then be used to calculate a photocurrent dissymmetry spectrum.By placing a linear polariser and Fresnel rhomb (a broadband quarter-waveplate) in the path of the chopped monochromatic beam, EQE and responsivity can be measured under circularly polarised light in the wavelength range of 400\u20131550 nm.via the calibrated photodiode photocurrent) are monitored using the source measure unit. The intensity of the incident light is steadily increased until the device under test deviates from a linear relationship between photocurrent and incident light intensity. The minimum and maximum photocurrents in this linear region are then applied to The LDR of a photodetector is measured using the setup shown in B is measured using the setup shown in f) of the light source is gradually increased until the peak-to-peak voltage of the photodetector signal (Vsin(f)) satisfies the 3 dB condition:Vcw is the continuous wave response of the photodetector to an unmodulated light source with an intensity equal to the peak intensity of the sinusoidally varying light source. This is the \u201cBandwidth\u201d or \u201c3 dB cut-off frequency\u201d of the device.Detector tr and tf of a photodetector can be extracted using the same setup which is used for the measurement of B. The photodetector is illuminated using a square wave modulated light source with a tuneable switching frequency. The frequency of modulation should be selected so that the device under test produces an oscilloscope signal of the form shown in tr and tf once a signal of this form is acquired. tr and tf should not be extracted using the current measurement of a digital source measure unit, as the measurement sampling frequency is often inadequate for accurate measurements of response times below 10 ms.The B, tr and tf, it is essential that the light source, modulation source, current preamplifier and oscilloscope have electrical bandwidths greater than the bandwidth of the photodetector under test, otherwise the lowest bandwidth component of the testing apparatus will be measured instead of the true bandwidth or response times of the device. For example, if the bandwidth of a photodiode with a \u22123 dB cut-off frequency of 100 kHz is measured using a current preamplifier with a bandwidth of 10 kHz, an incorrect bandwidth of approximately 10 kHz or less will be measured.In the measurement of et al. and Wang et al., defining the operational lifetime as the time required for the responsivity or photocurrent dissymmetry factor of a device to fall to 80% of their post-burn-in values, whichever comes first.76,77The operational lifetimes of both CP and non-CP photodetectors have been measured using several different methods in the literature. To standardise this measurement, we suggest a similar approach to that taken by Kielar gph as a function of device operation time, we propose that the operational lifetime of a device should be measured under pulsed CP illumination, alternating between L-CP illumination, dark conditions, R-CP illumination, and dark conditions repeatedly. This can be achieved using the setup shown in To measure responsivity and Idark of a photodetector is measured as simply the current flow through the photodetector under dark conditions.The The NEP of a photodetector can be determined by measuring the voltage output of a current preamplifier connected to the device under test in dark conditions using a lock-in amplifier. Most modern digital lock-in amplifiers can provide the noise spectral density of the input signal which, when divided by the responsivity of the detector at a given wavelength, yields the noise equivalent power at that wavelength. This can, in turn, be used to calculate the device detectivity using 6.e.g., linear dynamic range, bandwidth, detectivity) is rarely provided, which limits their application in real-world devices. In this tutorial review we have summarised the most important figures of merit for circularly polarised organic photodetectors and provided detailed descriptions of how to measure them.Circularly polarised organic photodetectors will facilitate future technologies based on image detection, chemical sensing, encrypted communications, and environmental monitoring. The diversity of accessible chiral functional materials that absorb circularly polarised light introduces a wide range of new possibilities, which has inspired considerable research interest in both academia and industry. Whilst reported devices often show impressive chiroptical responses, their device performances are often inferior when compared to non-chiral photodetectors. Further, complete and rigorous characterisation of the critical photodetector parameters  are essential for high-performance devices. Here, chiral organic\u2013inorganic systems  and supramolecular assemblies are the most attractive candidates. Finally, exciton dissociation and the efficient extraction of charge carriers will require the use of multi-layer devices and optimised heterojunction structures with intermixed donor and acceptor domains.Innovations in molecular design, novel device architectures and stronger collaborations between materials chemists and device physicists will advance the field. Optical sensing from the ultraviolet to the infrared is essential for a variety of industrial and scientific applications. To this end, chiral functional materials with photoresponses that span the full range from the UV to the NIR will likely show promise. Chiral materials with outstanding electronic properties (We hope that this review will help to advance this exciting and growing field and inform the design of novel materials/devices with outstanding chiroptical properties and device performance.There are no conflicts to declare.TC-010-D2TC01224C-s001"]}
-{"representative": "The recognized limitations of the Red Flag Index include not being subjected to external validation, and the use of a patient\u2019s recollection of symptoms, which is subject to bias. In this issue of CC360, the architects of the IBD-REFER report on their effort to create an improved tool based upon both history and laboratory criteria for the identification of IBD in adults and children. Successfully employing both the Delphi method and multiple regression with sensitivity analysis, the IBD-REFER criteria demonstrated excellent operating characteristics in the internal, but also notably, in the external validation cohort, with sensitivity/specificity in adults reaching 98%/96% and 96%/96% in children. IBD-REFER outperformed the Red Flags Index when used on the same external validation cohort of IBD cases and controls, with respective ROC values of 0.97 vs 0.78 respectively (P < 0.001).The need for early, accurate identification of patients with inflammatory bowel disease (IBD) has never been more important, especially with rising incidence of IBDThe IBD-REFER criteria are technically precise in the differentiation of known IBD patients from other gastrointestinal (GI) clinic patients without IBD, with relative ease of use. Each major criterion, for which only one element is required for referral, can be obtained from the patient\u2019s stated history. The minor criteria, of which two are required for referral, are a mix of individual and family history, as well some laboratory criteria , which can also be easily obtained or are frequently already available. Notably, additional specialized testing like fecal calprotectin, imaging, or endoscopy are not part of the criteria, adding to the attractiveness of these criteria for ease of use. However, even in the external validation cohort of consecutive patients seen within a GI clinic, the same issues of recall and confirmation bias apply for patients with known diagnoses. Furthermore, the non-IBD controls in this cohort were carefully whittled down from 85 to 50 patients by excluding patients with specific other diagnoses, e.g. celiac disease and lactose intolerance, including 21 (25%) excluded for having additional other diagnoses. This was done with good intention to select an appropriate non-IBD comparison group, but potentially dilutes the true external validity should IBD-REFER be applied in its intended setting; for example, patients presenting to primary care with GI complaints. The performance of the IBD-REFER criteria in a more real-world setting, such as primary care or GI clinic patients without a known diagnosis, is unknown.4 In contrast, despite the availability of multiple GI bleeding scores , these are infrequently used in routine clinical practice. Arguably, this is because such scores predict mortality or re-bleeding, but are less helpful with decision making regarding the overall need for (e.g. to obtain a diagnosis) or relative timing of endoscopy. Such decisions are often the result of reliance on clinical judgement and experience within the local healthcare environment. Viewing the IBD-REFER criteria though this lens, the determination of who is likely to have IBD can be re-interpreted as clinical judgement; particularly the major criteria which are elements of patient history that would normally trigger a high degree of suspicion of IBD. In short, the IBD-REFER criteria seem to represent an attempt to quantify sound clinical judgment; perhaps making it most useful for those who have had less exposure to the diagnosis and care of patients with IBD.Finally, there are arguments and points of view to consider that apply to the use of any clinical tool. First is that many similar tools exist, including for other GI conditions, but few are used in routine clinical practice. This is probably due to a combination of usefulness in real-world situations, ease of use, and reliance on objective criteria. This likely explains the ubiquitous use of the Model for End Stage Liver Disease (MELD), consisting only of three common lab values, with use extending from its initial purpose of predicting survival after transjugular intrahepatic portosystemic shunt (TIPS), to now being central for liver transplant organ allocation, as well as predictive of alcoholic hepatitis survival and preoperative mortality.In summary, the IBD-REFER criteria were rigorously developed with sound methodology, are easy to apply, and have excellent performance characteristics. However, significant limitations to its use include significant reliance on historic recall over objective findings. Additionally, validation was performed on persons with known IBD vs non-IBD diagnoses, and therefore subject to biases that potentially limit external, real-world performance. A prospective investigation of the IBD-REFER criteria in primary care or undiagnosed GI referral patients, with randomization to a comparison group that undergo clinical judgement/usual care, would be of great interest.", "texts": ["The recognized limitations of the Red Flag Index include not being subjected to external validation, and the use of a patient\u2019s recollection of symptoms, which is subject to bias. In this issue of CC360, the architects of the IBD-REFER report on their effort to create an improved tool based upon both history and laboratory criteria for the identification of IBD in adults and children. Successfully employing both the Delphi method and multiple regression with sensitivity analysis, the IBD-REFER criteria demonstrated excellent operating characteristics in the internal, but also notably, in the external validation cohort, with sensitivity/specificity in adults reaching 98%/96% and 96%/96% in children. IBD-REFER outperformed the Red Flags Index when used on the same external validation cohort of IBD cases and controls, with respective ROC values of 0.97 vs 0.78 respectively (P < 0.001).The need for early, accurate identification of patients with inflammatory bowel disease (IBD) has never been more important, especially with rising incidence of IBDThe IBD-REFER criteria are technically precise in the differentiation of known IBD patients from other gastrointestinal (GI) clinic patients without IBD, with relative ease of use. Each major criterion, for which only one element is required for referral, can be obtained from the patient\u2019s stated history. The minor criteria, of which two are required for referral, are a mix of individual and family history, as well some laboratory criteria , which can also be easily obtained or are frequently already available. Notably, additional specialized testing like fecal calprotectin, imaging, or endoscopy are not part of the criteria, adding to the attractiveness of these criteria for ease of use. However, even in the external validation cohort of consecutive patients seen within a GI clinic, the same issues of recall and confirmation bias apply for patients with known diagnoses. Furthermore, the non-IBD controls in this cohort were carefully whittled down from 85 to 50 patients by excluding patients with specific other diagnoses, e.g. celiac disease and lactose intolerance, including 21 (25%) excluded for having additional other diagnoses. This was done with good intention to select an appropriate non-IBD comparison group, but potentially dilutes the true external validity should IBD-REFER be applied in its intended setting; for example, patients presenting to primary care with GI complaints. The performance of the IBD-REFER criteria in a more real-world setting, such as primary care or GI clinic patients without a known diagnosis, is unknown.4 In contrast, despite the availability of multiple GI bleeding scores , these are infrequently used in routine clinical practice. Arguably, this is because such scores predict mortality or re-bleeding, but are less helpful with decision making regarding the overall need for (e.g. to obtain a diagnosis) or relative timing of endoscopy. Such decisions are often the result of reliance on clinical judgement and experience within the local healthcare environment. Viewing the IBD-REFER criteria though this lens, the determination of who is likely to have IBD can be re-interpreted as clinical judgement; particularly the major criteria which are elements of patient history that would normally trigger a high degree of suspicion of IBD. In short, the IBD-REFER criteria seem to represent an attempt to quantify sound clinical judgment; perhaps making it most useful for those who have had less exposure to the diagnosis and care of patients with IBD.Finally, there are arguments and points of view to consider that apply to the use of any clinical tool. First is that many similar tools exist, including for other GI conditions, but few are used in routine clinical practice. This is probably due to a combination of usefulness in real-world situations, ease of use, and reliance on objective criteria. This likely explains the ubiquitous use of the Model for End Stage Liver Disease (MELD), consisting only of three common lab values, with use extending from its initial purpose of predicting survival after transjugular intrahepatic portosystemic shunt (TIPS), to now being central for liver transplant organ allocation, as well as predictive of alcoholic hepatitis survival and preoperative mortality.In summary, the IBD-REFER criteria were rigorously developed with sound methodology, are easy to apply, and have excellent performance characteristics. However, significant limitations to its use include significant reliance on historic recall over objective findings. Additionally, validation was performed on persons with known IBD vs non-IBD diagnoses, and therefore subject to biases that potentially limit external, real-world performance. A prospective investigation of the IBD-REFER criteria in primary care or undiagnosed GI referral patients, with randomization to a comparison group that undergo clinical judgement/usual care, would be of great interest."]}
-{"representative": "Intestinal parasitic infections pose a grave threat to human health, particularly in tropical and subtropical regions. The traditional manual microscopy system of intestinal parasite detection remains the gold standard procedure for diagnosing parasite cysts or eggs. This approach is costly, time-consuming (30 min per sample), highly tedious, and requires a specialist. However, computer vision, based on deep learning, has made great strides in recent years. Despite the significant advances in deep convolutional neural network-based architectures, little research has been conducted to explore these techniques\u2019 potential in parasitology, specifically for intestinal parasites. This research presents a novel proposal for state-of-the-art transfer learning architecture for the detection and classification of intestinal parasite eggs from images. The ultimate goal is to ensure prompt treatment for patients while also alleviating the burden on experts. Our approach comprised two main stages: image pre-processing and augmentation in the first stage, and YOLOv5 algorithms for detection and classification in the second stage, followed by performance comparison based on different parameters. Remarkably, our algorithms achieved a mean average precision of approximately 97% and a detection time of only 8.5 ms per sample for a dataset of 5393 intestinal parasite images. This innovative approach holds tremendous potential to form a solid theoretical basis for real-time detection and classification in routine clinical examinations, addressing the increasing demand and accelerating the diagnostic process. Our research contributes to the development of cutting-edge technologies for the efficient and accurate detection of intestinal parasite eggs, advancing the field of medical imaging and diagnosis. Intestinal parasitic infections have significant implications for public health worldwide, particularly in developing and underdeveloped countries. According to the World Health Organization, infectious and parasitic diseases affect approximately 24% of the global population, and in 2020, preventive chemotherapy was administered to 836 million children globally . These iPreviously, the automation of analyzing intestinal protozoa was limited due to the lack of automatic recognition algorithms for microorganisms under the microscope. However, in recent years, deep learning architectures have revolutionized various machine-learning tasks, particularly in the field of medical image identification and classification. Among these architectures, convolutional neural networks (CNNs) have played a crucial role in significantly improving performance ,7,8. UnlHere, we address the issue of image pre-processing and augmentation for rapid automatic detection and classification in raw parasite images. We have adopted a multi-step routine for data preparation, neural network configuration, model training, and prediction analysis. We applied the You Only Look Once (YOLO) CNN-based model for object detection ,16,17, sWe utilized data augmentation techniques on the source parasite images to generate more regularization and divergence in the training dataset. We attempt to optimize the model by applying an additional dataset and using augmentation and transformation to enhance the results. We were able to accurately detect parasites from a separate test set of microscopic images by using trained YOLOv5 algorithms.Previous efforts in the computational diagnosis of intestinal parasitic infections have primarily focused on improving detection accuracy through hand-engineered feature extraction techniques, which require specialized skills and experts . HoweverIn recent years, the You Only Look Once (YOLO) model for object detection has gained significant attention and has been continuously developed. YOLO directly detects multiple objects by predicting multiple bounding boxes and class probabilities, making it a popular one-stage detection model ,17,28. Whookworm eggs, Hymenolepsis nana, Taenia, Ascaris lumbricoides, and Fasciolopsis buski. These images were obtained from Mulago Referral Hospital, located in Uganda, as well as the IEEE Dataport [https://app.roboflow.com/) (accessed on 17 April 2023). The intestinal parasite dataset used in this research report contains 10\u00d7 magnification microscopic images with a resolution of 416 \u00d7 416 pixels. Five different types of intestinal parasites cysts or eggs collect Dataport ,34. The The images were resized to 416 \u00d7 416 for the YOLOv5 algorithms. Finally, the dataset split into training, validation, and testing in the ratios of 70%, 20%, and 10%, respectively.In a recent study, we employed advanced machine learning techniques, specifically YOLOv5 algorithms, to achieve unparalleled accuracy and efficiency in detecting parasites. These state-of-the-art algorithms allowed us to extract the optimal weights from our extensive dataset of 5393 parasite images, encompassing various resolutions. To enhance our results, we conducted experiments with different variants of the YOLOv5 algorithm and trained our models using both YOLOv5s and YOLOv5l object identification models.We selected these particular models based on their ease of implementation on freely available cloud computing platforms, such as the Google Collaboratory, making them accessible to a wider audience. Additionally, the YOLOv5 models offer a diverse range of pre-written model architectures, each tailored to specific speed and accuracy requirements under different conditions. Our models were trained using a dataset of approximately 950 MB, and the training process took only one hour on a Tesla T4 GPU(China). The learned weights and biases of our models were automatically saved into a PyTorch weights file, simplifying the process of reusing and improving our results.As shown in The YOLOv5 object recognition version was cloned from the Ultralytics YOLOv5 catalogue . The YOLIn conclusion, this groundbreaking study highlights the power of advanced machine learning techniques in addressing real-world challenges. By utilizing state-of-the-art algorithms and leveraging cloud computing platforms, we can enhance our ability to detect and combat diseases more effectively. This study is a promising step towards transforming healthcare outcomes globally and advancing the field of machine learning.The experiment was executed on the Google Colab System as the base environment with a Nividia K80/T4 GPU (Taiwan) at 0.82 GHz/1.59 GHz GPU memory clock and GPU memory of 12 GB/16 GB. This experiment was carried out with models built on PyTorch , which pTo determine the strength of the conducted experiments on the trained YOLOv5 algorithms, Precision, Recall, F1-score, and mAP measures are used for evaluation. The computation methods are provided in Equations (1)\u2013(5).TP, TN, FN, and FP represent True Positive (correct detections), True Negative, False Positive (incorrect detections), and False Negative (missed detections), respectively. The F1-score metric, defined in Equation (3), provides a comprehensive evaluation of the trained model by considering the trade-off between Recall and Precision. In addition to the F1-score, the Average Precision (AP) Equation (4) is employed to showcase the overall performance of the models across different thresholds. The following is shown below:r, and In this context, the abbreviations hookworm eggs, Hymenolepis nana, Taenia, Ascaris lumbricoides, and Fasciolopsis. Our collection spans across continents, with images acquired from the Mulago Referral Hospital in Uganda and the IEEE Dataport.In our pursuit to advance parasite detection, we have gathered a diverse dataset of 5883 images featuring various parasites, including With this dataset, we developed a novel detection algorithm using YOLOv5, with each image in the development dataset meticulously annotated with vibrant rectangular boxes as the ground truth. To further improve the robustness of our model, we applied data aumentation and split our dataset into training and testing sets. As we trained our models, we experimented with various image resolutions and settled on 416 \u00d7 416 pixels to achieve optimal performance.The YOLOv5 algorithms demonstrated improved detection results for intestinal parasites in the test dataset collection. We computed and compared the precision, recall, F1-score, and AP (average precision) of the detected parasites between the YOLOv5s and YOLOv5l models. The training process utilized the SGD optimizer and lasted for 100 epochs, being completed in 1.04 h for YOLOv5l and 0.918 h for YOLOv5s. Additionally, we employed YOLOv5 features to augment the training images by cropping, adjusting the dynamic range, and changing the scale during the training process. YOLOv5 applied image space and color space augmentations within the training dataset, presenting an original image plus three random images each time an image was loaded for training.Initially, we focused on training the \u201cs\u201d and \u201cl\u201d variants of the YOLOv5 model using the training datasets. We selected the weights with the best available scores as the key indicators of the overall training stage. The scores of the trained neural networks exhibited a significant increase in the 20th and 24th epochs for both models, while the corresponding loss decreased refer to . These eAfter applying pre-trained weights to both YOLOv5 models for validation, we obtained results presented in We evaluated the performance of our proposed methods against four state-of-the-art object detection models: single-shot detector (SSD) , Faster hookworm eggs, Hymenolepis nana, Taenia, Ascaris lumbricoides, and Fasciolopsis. These images were sourced from the Mulago Referral Hospital in Uganda and the IEEE Dataport. The researchers developed a novel detection algorithm using YOLOv5 and meticulously annotated each image in the development dataset with vibrant rectangular boxes as ground truth. The dataset was split into training and testing sets, and data augmentation techniques were applied to enhance the model\u2019s robustness. The YOLOv5 algorithms exhibited favorable detection results, with Precision, Recall, F1-score, and AP metrics calculated and compared between the YOLOv5s and YOLOv5l models. Image and color space augmentations were implemented in the training dataset, presenting an original image plus three random images each time an image was loaded for training.This research paper delves into the utilization of advanced deep learning techniques and cloud computing platforms to enhance parasite detection. The study employed a diverse dataset of 5883 images, encompassing various parasites, such as The study trained both the \u201cs\u201d and \u201cl\u201d variants of the YOLOv5 model using the training datasets, and the best weights were selected based on the overall training stage. The scores of the trained neural networks experienced a significant increase in the 20th and 24th epochs for both models, accompanied by a corresponding decrease in loss, indicating that the neural networks started to identify parasite species. However, as the training process extended to 100 epochs, the validation scores gradually declined after the 90th epoch, and the trained neural networks were unable to effectively recognize parasites.Upon applying pre-trained weights to both YOLOv5 models for validation, the trained neural networks exhibited improved recognition of parasite species, demonstrating slightly higher average mAP (0.5), mAP (0.5:0.95), recall, and precision scores. The YOLOv5l model showcased higher accuracy, but it was slower than the YOLOv5s model due to its increased number of layers and parameters. The researchers provided examples of parasite species detection by YOLOv5l models, showcasing their impressive performance while acknowledging significant distortion in the bounding boxes surrounding the detected species. Overall, the findings of the study suggest that the YOLOv5 models are effective in detecting parasite species and offer valuable insights for future research in this field. The research emphasizes the power of advanced machine learning techniques in addressing real-world challenges and improving disease detection and combat.Hookworm, Taenia, and Fasciolopsis buski parasites was outstanding, achieving a score of 0.99. We attribute this success to the distinct characteristics of hookworms and the abundance of hookworm images in our dataset, which facilitated effective data enhancement during training. The mAP values for Ascaris lumbricoides were also commendable, scoring 0.92 for the YOLOv5 algorithms. However, due to the small dataset size and class imbalance, the training model experienced some degree of overfitting. Despite this limitation, our proposed deep learning model for intestinal parasite detection achieved the highest mAP and demonstrated rapid detection and localization of hookworms, Taenia, Fasciolopsis buski, Ascaris lumbricoides, and Hymenolepis nana, with a mAP of approximately 97% and a detection time of 8.5 ms per image. Future work should aim to expand the dataset size and include other intestinal parasites in the analysis to address the overfitting issue associated with small dataset sizes. Additionally, our study contributes to the development of effective deep learning models that can be utilized for identifying intestinal parasitic cysts or eggs in stool examinations.In this study, our main objective was to enhance the performance of two cutting-edge deep-learning architectures, namely, YOLOv5s and YOLOv5l, in the domain of object detection, specifically focused on intestinal parasites. To achieve this, we conducted a comprehensive evaluation of various metrics, including precision, recall, F1-score, and mean average precision. Our assessment was performed on a dataset consisting of 5393 microscopic images of parasites, each with an input image resolution of 416 \u00d7 416. Through systematic analysis of these key parameters, our aim was to optimize the algorithms\u2019 capabilities and improve their accuracy in detecting objects. Our findings revealed that YOLOv5l outperformed YOLOv5s in terms of overall accuracy. However, both algorithms demonstrated excellent performance in recognizing and accurately locating the five types of parasites within the images. Notably, the YOLOv5 algorithms exhibited significantly faster processing times compared to Faser-RCNN  and ResN", "texts": ["Intestinal parasitic infections pose a grave threat to human health, particularly in tropical and subtropical regions. The traditional manual microscopy system of intestinal parasite detection remains the gold standard procedure for diagnosing parasite cysts or eggs. This approach is costly, time-consuming (30 min per sample), highly tedious, and requires a specialist. However, computer vision, based on deep learning, has made great strides in recent years. Despite the significant advances in deep convolutional neural network-based architectures, little research has been conducted to explore these techniques\u2019 potential in parasitology, specifically for intestinal parasites. This research presents a novel proposal for state-of-the-art transfer learning architecture for the detection and classification of intestinal parasite eggs from images. The ultimate goal is to ensure prompt treatment for patients while also alleviating the burden on experts. Our approach comprised two main stages: image pre-processing and augmentation in the first stage, and YOLOv5 algorithms for detection and classification in the second stage, followed by performance comparison based on different parameters. Remarkably, our algorithms achieved a mean average precision of approximately 97% and a detection time of only 8.5 ms per sample for a dataset of 5393 intestinal parasite images. This innovative approach holds tremendous potential to form a solid theoretical basis for real-time detection and classification in routine clinical examinations, addressing the increasing demand and accelerating the diagnostic process. Our research contributes to the development of cutting-edge technologies for the efficient and accurate detection of intestinal parasite eggs, advancing the field of medical imaging and diagnosis. Intestinal parasitic infections have significant implications for public health worldwide, particularly in developing and underdeveloped countries. According to the World Health Organization, infectious and parasitic diseases affect approximately 24% of the global population, and in 2020, preventive chemotherapy was administered to 836 million children globally . These iPreviously, the automation of analyzing intestinal protozoa was limited due to the lack of automatic recognition algorithms for microorganisms under the microscope. However, in recent years, deep learning architectures have revolutionized various machine-learning tasks, particularly in the field of medical image identification and classification. Among these architectures, convolutional neural networks (CNNs) have played a crucial role in significantly improving performance ,7,8. UnlHere, we address the issue of image pre-processing and augmentation for rapid automatic detection and classification in raw parasite images. We have adopted a multi-step routine for data preparation, neural network configuration, model training, and prediction analysis. We applied the You Only Look Once (YOLO) CNN-based model for object detection ,16,17, sWe utilized data augmentation techniques on the source parasite images to generate more regularization and divergence in the training dataset. We attempt to optimize the model by applying an additional dataset and using augmentation and transformation to enhance the results. We were able to accurately detect parasites from a separate test set of microscopic images by using trained YOLOv5 algorithms.Previous efforts in the computational diagnosis of intestinal parasitic infections have primarily focused on improving detection accuracy through hand-engineered feature extraction techniques, which require specialized skills and experts . HoweverIn recent years, the You Only Look Once (YOLO) model for object detection has gained significant attention and has been continuously developed. YOLO directly detects multiple objects by predicting multiple bounding boxes and class probabilities, making it a popular one-stage detection model ,17,28. Whookworm eggs, Hymenolepsis nana, Taenia, Ascaris lumbricoides, and Fasciolopsis buski. These images were obtained from Mulago Referral Hospital, located in Uganda, as well as the IEEE Dataport [https://app.roboflow.com/) (accessed on 17 April 2023). The intestinal parasite dataset used in this research report contains 10\u00d7 magnification microscopic images with a resolution of 416 \u00d7 416 pixels. Five different types of intestinal parasites cysts or eggs collect Dataport ,34. The The images were resized to 416 \u00d7 416 for the YOLOv5 algorithms. Finally, the dataset split into training, validation, and testing in the ratios of 70%, 20%, and 10%, respectively.In a recent study, we employed advanced machine learning techniques, specifically YOLOv5 algorithms, to achieve unparalleled accuracy and efficiency in detecting parasites. These state-of-the-art algorithms allowed us to extract the optimal weights from our extensive dataset of 5393 parasite images, encompassing various resolutions. To enhance our results, we conducted experiments with different variants of the YOLOv5 algorithm and trained our models using both YOLOv5s and YOLOv5l object identification models.We selected these particular models based on their ease of implementation on freely available cloud computing platforms, such as the Google Collaboratory, making them accessible to a wider audience. Additionally, the YOLOv5 models offer a diverse range of pre-written model architectures, each tailored to specific speed and accuracy requirements under different conditions. Our models were trained using a dataset of approximately 950 MB, and the training process took only one hour on a Tesla T4 GPU(China). The learned weights and biases of our models were automatically saved into a PyTorch weights file, simplifying the process of reusing and improving our results.As shown in The YOLOv5 object recognition version was cloned from the Ultralytics YOLOv5 catalogue . The YOLIn conclusion, this groundbreaking study highlights the power of advanced machine learning techniques in addressing real-world challenges. By utilizing state-of-the-art algorithms and leveraging cloud computing platforms, we can enhance our ability to detect and combat diseases more effectively. This study is a promising step towards transforming healthcare outcomes globally and advancing the field of machine learning.The experiment was executed on the Google Colab System as the base environment with a Nividia K80/T4 GPU (Taiwan) at 0.82 GHz/1.59 GHz GPU memory clock and GPU memory of 12 GB/16 GB. This experiment was carried out with models built on PyTorch , which pTo determine the strength of the conducted experiments on the trained YOLOv5 algorithms, Precision, Recall, F1-score, and mAP measures are used for evaluation. The computation methods are provided in Equations (1)\u2013(5).TP, TN, FN, and FP represent True Positive (correct detections), True Negative, False Positive (incorrect detections), and False Negative (missed detections), respectively. The F1-score metric, defined in Equation (3), provides a comprehensive evaluation of the trained model by considering the trade-off between Recall and Precision. In addition to the F1-score, the Average Precision (AP) Equation (4) is employed to showcase the overall performance of the models across different thresholds. The following is shown below:r, and In this context, the abbreviations hookworm eggs, Hymenolepis nana, Taenia, Ascaris lumbricoides, and Fasciolopsis. Our collection spans across continents, with images acquired from the Mulago Referral Hospital in Uganda and the IEEE Dataport.In our pursuit to advance parasite detection, we have gathered a diverse dataset of 5883 images featuring various parasites, including With this dataset, we developed a novel detection algorithm using YOLOv5, with each image in the development dataset meticulously annotated with vibrant rectangular boxes as the ground truth. To further improve the robustness of our model, we applied data aumentation and split our dataset into training and testing sets. As we trained our models, we experimented with various image resolutions and settled on 416 \u00d7 416 pixels to achieve optimal performance.The YOLOv5 algorithms demonstrated improved detection results for intestinal parasites in the test dataset collection. We computed and compared the precision, recall, F1-score, and AP (average precision) of the detected parasites between the YOLOv5s and YOLOv5l models. The training process utilized the SGD optimizer and lasted for 100 epochs, being completed in 1.04 h for YOLOv5l and 0.918 h for YOLOv5s. Additionally, we employed YOLOv5 features to augment the training images by cropping, adjusting the dynamic range, and changing the scale during the training process. YOLOv5 applied image space and color space augmentations within the training dataset, presenting an original image plus three random images each time an image was loaded for training.Initially, we focused on training the \u201cs\u201d and \u201cl\u201d variants of the YOLOv5 model using the training datasets. We selected the weights with the best available scores as the key indicators of the overall training stage. The scores of the trained neural networks exhibited a significant increase in the 20th and 24th epochs for both models, while the corresponding loss decreased refer to . These eAfter applying pre-trained weights to both YOLOv5 models for validation, we obtained results presented in We evaluated the performance of our proposed methods against four state-of-the-art object detection models: single-shot detector (SSD) , Faster hookworm eggs, Hymenolepis nana, Taenia, Ascaris lumbricoides, and Fasciolopsis. These images were sourced from the Mulago Referral Hospital in Uganda and the IEEE Dataport. The researchers developed a novel detection algorithm using YOLOv5 and meticulously annotated each image in the development dataset with vibrant rectangular boxes as ground truth. The dataset was split into training and testing sets, and data augmentation techniques were applied to enhance the model\u2019s robustness. The YOLOv5 algorithms exhibited favorable detection results, with Precision, Recall, F1-score, and AP metrics calculated and compared between the YOLOv5s and YOLOv5l models. Image and color space augmentations were implemented in the training dataset, presenting an original image plus three random images each time an image was loaded for training.This research paper delves into the utilization of advanced deep learning techniques and cloud computing platforms to enhance parasite detection. The study employed a diverse dataset of 5883 images, encompassing various parasites, such as The study trained both the \u201cs\u201d and \u201cl\u201d variants of the YOLOv5 model using the training datasets, and the best weights were selected based on the overall training stage. The scores of the trained neural networks experienced a significant increase in the 20th and 24th epochs for both models, accompanied by a corresponding decrease in loss, indicating that the neural networks started to identify parasite species. However, as the training process extended to 100 epochs, the validation scores gradually declined after the 90th epoch, and the trained neural networks were unable to effectively recognize parasites.Upon applying pre-trained weights to both YOLOv5 models for validation, the trained neural networks exhibited improved recognition of parasite species, demonstrating slightly higher average mAP (0.5), mAP (0.5:0.95), recall, and precision scores. The YOLOv5l model showcased higher accuracy, but it was slower than the YOLOv5s model due to its increased number of layers and parameters. The researchers provided examples of parasite species detection by YOLOv5l models, showcasing their impressive performance while acknowledging significant distortion in the bounding boxes surrounding the detected species. Overall, the findings of the study suggest that the YOLOv5 models are effective in detecting parasite species and offer valuable insights for future research in this field. The research emphasizes the power of advanced machine learning techniques in addressing real-world challenges and improving disease detection and combat.Hookworm, Taenia, and Fasciolopsis buski parasites was outstanding, achieving a score of 0.99. We attribute this success to the distinct characteristics of hookworms and the abundance of hookworm images in our dataset, which facilitated effective data enhancement during training. The mAP values for Ascaris lumbricoides were also commendable, scoring 0.92 for the YOLOv5 algorithms. However, due to the small dataset size and class imbalance, the training model experienced some degree of overfitting. Despite this limitation, our proposed deep learning model for intestinal parasite detection achieved the highest mAP and demonstrated rapid detection and localization of hookworms, Taenia, Fasciolopsis buski, Ascaris lumbricoides, and Hymenolepis nana, with a mAP of approximately 97% and a detection time of 8.5 ms per image. Future work should aim to expand the dataset size and include other intestinal parasites in the analysis to address the overfitting issue associated with small dataset sizes. Additionally, our study contributes to the development of effective deep learning models that can be utilized for identifying intestinal parasitic cysts or eggs in stool examinations.In this study, our main objective was to enhance the performance of two cutting-edge deep-learning architectures, namely, YOLOv5s and YOLOv5l, in the domain of object detection, specifically focused on intestinal parasites. To achieve this, we conducted a comprehensive evaluation of various metrics, including precision, recall, F1-score, and mean average precision. Our assessment was performed on a dataset consisting of 5393 microscopic images of parasites, each with an input image resolution of 416 \u00d7 416. Through systematic analysis of these key parameters, our aim was to optimize the algorithms\u2019 capabilities and improve their accuracy in detecting objects. Our findings revealed that YOLOv5l outperformed YOLOv5s in terms of overall accuracy. However, both algorithms demonstrated excellent performance in recognizing and accurately locating the five types of parasites within the images. Notably, the YOLOv5 algorithms exhibited significantly faster processing times compared to Faser-RCNN  and ResN"]}
-{"representative": "The interplay between adipokines and pancreatic beta cells, often referred to as the adipo-insular axis, plays a crucial role in regulating metabolic homeostasis. Adipokines are signaling molecules secreted by adipocytes that have profound effects on several physiological processes. Adipokines such as adiponectin, leptin, resistin, and visfatin influence the function of pancreatic beta cells. The reciprocal communication between adipocytes and beta cells is remarkable. Insulin secreted by beta cells affects adipose tissue metabolism, influencing lipid storage and lipolysis. Conversely, adipokines released from adipocytes can influence beta cell function and survival. Chronic obesity and insulin resistance can lead to the release of excess fatty acids and inflammatory molecules from the adipose tissue, contributing to beta cell dysfunction and apoptosis, which are key factors in developing type 2 diabetes. Understanding the complex interplay of the adipo-insular axis provides insights into the mechanisms underlying metabolic regulation and pathogenesis of metabolic disorders. By elucidating the molecular mediators involved in this interaction, new therapeutic targets and strategies may emerge to reduce the risk and progression of diseases, such as type 2 diabetes and its associated complications. This review summarizes the interactions between adipokines and pancreatic beta cells, and their roles in the pathogenesis of diabetes and metabolic diseases. Adipokines are a group of signaling proteins produced by the adipose tissue. They play key roles in regulating various physiological processes including energy metabolism, inflammation, insulin sensitivity, and appetite control . DisruptThe pancreatic beta cell plays a critical role in maintaining glucose homeostasis. Beta cells synthesize, store, and release insulin, the hormone that is primarily responsible for lowering blood glucose levels. The dysfunction or loss of beta cells, which can arise due to various factors, including autoimmune attacks, inflammation, or metabolic stress, leads to inadequate insulin production and secretion. This results in elevated blood glucose levels, which is a primary characteristic of diabetes. In type 1 diabetes mellitus (T1DM), an autoimmune process targets and destroys beta cells, leading to an absolute insulin deficiency . In contThe interaction between adipose tissue and pancreatic beta cells, known as the adipo-insular axis, plays a pivotal role in metabolic regulation and the onset of metabolic disorders . The priThis review aims to investigate the relationship between adipokines and pancreatic beta cells, evaluate their roles in metabolic homeostasis, and elucidate their implications in the pathogenesis of metabolic disorders.Diabetes mellitus is a chronic metabolic disease characterized by elevated blood glucose levels, accompanied by defects in insulin secretion, insulin action, or both. Diabetes is classified into four categories: T1DM, T2DM, gestational diabetes (GDM), and specific types of diabetes due to other causes . T1DM an+ (KATP) channels in the plasma membrane that close upon ATP binding, increased ATP production promotes the inhibition of outward K+ flux [2+ channels and Ca2+ influx. The elevation of intracellular Ca2+ triggers the fusion of insulin granules with the plasma membrane, leading to increased exocytosis. Several studies have reported that adipokines affect metabolic intermediates, secondary messengers, enzymes, and channels involved in GSIS in beta cells. Consequently, the adipose tissue can communicate with beta cells and modulate the insulin secretion machinery via adipokines, thereby contributing to the maintenance of energy homeostasis.The essential role of pancreatic beta cells is to secrete the appropriate amount of insulin into the bloodstream in response to blood glucose levels. To achieve this goal, the beta cell has a specialized glucose-sensing machinery and a vesicle trafficking system ,14. Gluc K+ flux . This reT2DM is a multifactorial disease affected by both genetic and environmental factors. Generally, the initial event in the development of T2DM is increased peripheral insulin resistance, which is characterized by a decreased response of the body to insulin. However, not everyone with insulin resistance develops T2DM; concurrent beta cell dysfunction is also necessary ,17,18. IIncreased adiposity and ectopic fat storage are major contributors to insulin resistance in peripheral organs such as the liver, adipose tissue, and muscles. Excess nutrients and metabolic stress alter the pathophysiological characteristics of the adipose tissue, leading to changes in adipokine expression and secretion ,22. AlteLeptin plays a crucial role in energy homeostasis and body weight control as well as in regulating glucose homeostasis. This was discovered in a study on an obese (ob) mouse strain, a genetic model of obesity . The disThe leptin receptor, encoded by the LEPR gene, is a member of the class I cytokine receptor family and exists in several isoforms owing to alternative splicing. The long isoform, often referred to as the functional leptin receptor (Ob-Rb), is the primary isoform that mediates a wide range of biological actions . Beta ce2+ influx [Leptin can directly inhibit GSIS in both rodent and human pancreatic beta cells ,35. Howe+ influx . Moreove+ influx . LIM hom+ influx . TherefoThe protective and harmful effects of leptin on beta cells remain controversial. Leptin prevents fatty acid-induced apoptosis by modulating the expression of the anti-apoptotic gene B-cell leukemia 2 (BCL-2) . SimilarFurthermore, the role of leptin in insulin secretion and beta cell proliferation has been investigated in tissue-specific leptin receptor-knockout (KO) mice. Beta cell- and hypothalamus-specific KO mice exhibit impaired GSIS and an increased beta cell mass . SimilarSeveral studies have investigated the effects of hypothalamic leptin and the sympathetic nervous system on beta cell function. One study found that leptin can directly decrease insulin secretion capacity through sympathetic nervous system activation without significantly affecting beta cell mass . FurtherAdiponectin was first reported by four independent research groups between 1995 and 1996, leading to its initial name under various designations, including Acrp30, AdipoQ, apM1, and GBP 28 ,59,60,61Adiponectin has a complex association with insulin secretion. Several studies have demonstrated a significant influence of adiponectin on insulin secretion ,69. GlobSeveral studies have suggested that adiponectin protects beta cells from glucotoxicity-induced apoptosis and dysfunction by activating the AMPK signaling pathway ,76. AdipAdiponectin plays a significant role in the management of insulin resistance and beta cell function, particularly during pregnancy. Alterations in adiponectin levels are associated with the risk and progression of GDM, and may have implications for the future development of T2DM. Weight gain, particularly fat accumulation, is a critical factor in this. Numerous studies have investigated the association between adiponectin levels and beta cell function in GDM. A longitudinal study focusing on Hispanic women with recent GDM revealed that weight gain, particularly fat accumulation, in conjunction with decreased adiponectin and increased C-reactive protein levels was significantly associated with a decline in beta cell function relative to insulin sensitivity . Other sTwo studies investigated the impact of low adiponectin levels, or hypoadiponectinemia, on GDM and beta cell function during pregnancy using mouse models. The first study reported that adiponectin deficiency led to glucose intolerance, hyperlipidemia, and increased fetal body weight in late pregnancy. These metabolic abnormalities were ameliorated by reintroduction of adiponectin, emphasizing its essential role in managing metabolic adaptations during pregnancy . AnotherApelin, originally isolated from bovine stomach extracts, was identified as an endogenous ligand for an orphan GPCR, the apelin receptor (APJ) . Apelin Resistin was initially identified in murine adipose tissue, which sparked significant interest in its potential roles in human metabolism . This inVisfatin, also known as nicotinamide phosphoribosyltransferase (NAMPT) or pre-B cell colony-enhancing factor (PBEF), was initially characterized as an insulin-mimetic adipokine . The oriAdipsin is a serine protease belonging to the trypsin family that plays a pivotal role in the alternative complement pathway ,116,117.Lipocalin-2 (LCN2), also known as neutrophil gelatinase-associated lipocalin (NGAL), is a member of the lipocalin superfamily. Several studies have reported the expression of LCN2 in adipose tissue ,121,122.Chemerin, also known as tazarotene-induced gene 2 (TIG2) or retinoic acid receptor responder 2 (RARRES2), is an adipokine that regulates adipogenesis and energy metabolism and plays a role in the regulation of beta cell mass and function ,126. CheFGF21, a peptide hormone mainly secreted by the liver, regulates glucose and lipid metabolism as well as insulin sensitivity in various organs, including the liver, pancreas, adipose tissue, and muscle ,132,133.GDF15 is a polypeptide that belongs to the TGF-\u03b2 superfamily and is expressed in various organs, including the liver, adipose tissue, and kidney . In mousTNF-\u03b1 is an inflammatory cytokine that increases in the adipose tissue of obese individuals and contributes to insulin resistance ,146,147.Following the discovery of the first adipokine, leptin, in 1994 , numerouPancreatic beta cells secrete insulin to regulate blood glucose levels. In T1DM, autoimmunity destroys beta cells, leading to insulin deficiency, whereas in T2DM, insulin resistance and beta cell dysfunction result in insulin deficiency. Adipokines affect the GSIS machinery of beta cells. For example, leptin directly inhibits GSIS, whereas adiponectin activates GSIS via an AMPK-independent pathway.In addition, leptin affects insulin secretion through complex mechanisms involving the modulation of potassium channels, intracellular signaling pathways, and the regulation of apoptosis. Although it inhibits insulin secretion under normal physiological conditions, its effects on beta cell survival and proliferation remain controversial. In contrast, adiponectin increases insulin sensitivity and protects beta cells. It stimulates insulin secretion, prevents apoptosis, and promotes beta cell regeneration, particularly during pregnancy.Apelin, resistin, visfatin, and other adipokines also affect beta cell function and insulin secretion. Apelin influences beta cell homeostasis, and its deficiency can lead to impaired glucose metabolism. The effects of resistin on insulin resistance are not fully understood; however, it appears to influence beta cell apoptosis and insulin receptor expression. Visfatin has been shown to have insulin-mimetic properties and is associated with insulin secretion, beta cell proliferation, and cell viability.Adipsin, lipocalin-2, chemerin, FGF21, GDF15, and TNF-\u03b1 also contribute to the complex network of interactions between adipokines and beta cells. These adipokines have been shown to influence beta cell mass, insulin secretion, and overall metabolic regulation. Understanding the intricate relationship between adipokines and pancreatic beta cells provides insights into the development of potential treatment strategies for metabolic disorders such as obesity and diabetes. In conclusion, the adipo-insular axis is a critical regulatory system that maintains metabolic homeostasis through the interplay between adipokines and pancreatic beta cells. Dysregulation of this axis may have significant implications in the onset and progression of metabolic disorders, making it a promising area of research for the development of novel therapeutic interventions.Two authors, J.K. and H.K., independently selected relevant studies from PubMed, MeSH, Scopus, Google Scholar, and Embase. The search strategy incorporated the following keywords or subject headings: adipokine, diabetes mellitus, metabolic disorder, insulin-secreting cells, pancreatic beta cell, insulin, leptin, adiponectin, apelin, resistin, visfatin, adipsin, lipocalin-2, chemerin, FGF21, GDF15, and TNF-\u03b1. The search was restricted to studies published in English. The authors compared and reviewed the reference lists for potential relevance. The authors discussed the articles, and 152 papers were considered relevant to the search criteria and suitable for addressing the research objective.", "texts": ["The interplay between adipokines and pancreatic beta cells, often referred to as the adipo-insular axis, plays a crucial role in regulating metabolic homeostasis. Adipokines are signaling molecules secreted by adipocytes that have profound effects on several physiological processes. Adipokines such as adiponectin, leptin, resistin, and visfatin influence the function of pancreatic beta cells. The reciprocal communication between adipocytes and beta cells is remarkable. Insulin secreted by beta cells affects adipose tissue metabolism, influencing lipid storage and lipolysis. Conversely, adipokines released from adipocytes can influence beta cell function and survival. Chronic obesity and insulin resistance can lead to the release of excess fatty acids and inflammatory molecules from the adipose tissue, contributing to beta cell dysfunction and apoptosis, which are key factors in developing type 2 diabetes. Understanding the complex interplay of the adipo-insular axis provides insights into the mechanisms underlying metabolic regulation and pathogenesis of metabolic disorders. By elucidating the molecular mediators involved in this interaction, new therapeutic targets and strategies may emerge to reduce the risk and progression of diseases, such as type 2 diabetes and its associated complications. This review summarizes the interactions between adipokines and pancreatic beta cells, and their roles in the pathogenesis of diabetes and metabolic diseases. Adipokines are a group of signaling proteins produced by the adipose tissue. They play key roles in regulating various physiological processes including energy metabolism, inflammation, insulin sensitivity, and appetite control . DisruptThe pancreatic beta cell plays a critical role in maintaining glucose homeostasis. Beta cells synthesize, store, and release insulin, the hormone that is primarily responsible for lowering blood glucose levels. The dysfunction or loss of beta cells, which can arise due to various factors, including autoimmune attacks, inflammation, or metabolic stress, leads to inadequate insulin production and secretion. This results in elevated blood glucose levels, which is a primary characteristic of diabetes. In type 1 diabetes mellitus (T1DM), an autoimmune process targets and destroys beta cells, leading to an absolute insulin deficiency . In contThe interaction between adipose tissue and pancreatic beta cells, known as the adipo-insular axis, plays a pivotal role in metabolic regulation and the onset of metabolic disorders . The priThis review aims to investigate the relationship between adipokines and pancreatic beta cells, evaluate their roles in metabolic homeostasis, and elucidate their implications in the pathogenesis of metabolic disorders.Diabetes mellitus is a chronic metabolic disease characterized by elevated blood glucose levels, accompanied by defects in insulin secretion, insulin action, or both. Diabetes is classified into four categories: T1DM, T2DM, gestational diabetes (GDM), and specific types of diabetes due to other causes . T1DM an+ (KATP) channels in the plasma membrane that close upon ATP binding, increased ATP production promotes the inhibition of outward K+ flux [2+ channels and Ca2+ influx. The elevation of intracellular Ca2+ triggers the fusion of insulin granules with the plasma membrane, leading to increased exocytosis. Several studies have reported that adipokines affect metabolic intermediates, secondary messengers, enzymes, and channels involved in GSIS in beta cells. Consequently, the adipose tissue can communicate with beta cells and modulate the insulin secretion machinery via adipokines, thereby contributing to the maintenance of energy homeostasis.The essential role of pancreatic beta cells is to secrete the appropriate amount of insulin into the bloodstream in response to blood glucose levels. To achieve this goal, the beta cell has a specialized glucose-sensing machinery and a vesicle trafficking system ,14. Gluc K+ flux . This reT2DM is a multifactorial disease affected by both genetic and environmental factors. Generally, the initial event in the development of T2DM is increased peripheral insulin resistance, which is characterized by a decreased response of the body to insulin. However, not everyone with insulin resistance develops T2DM; concurrent beta cell dysfunction is also necessary ,17,18. IIncreased adiposity and ectopic fat storage are major contributors to insulin resistance in peripheral organs such as the liver, adipose tissue, and muscles. Excess nutrients and metabolic stress alter the pathophysiological characteristics of the adipose tissue, leading to changes in adipokine expression and secretion ,22. AlteLeptin plays a crucial role in energy homeostasis and body weight control as well as in regulating glucose homeostasis. This was discovered in a study on an obese (ob) mouse strain, a genetic model of obesity . The disThe leptin receptor, encoded by the LEPR gene, is a member of the class I cytokine receptor family and exists in several isoforms owing to alternative splicing. The long isoform, often referred to as the functional leptin receptor (Ob-Rb), is the primary isoform that mediates a wide range of biological actions . Beta ce2+ influx [Leptin can directly inhibit GSIS in both rodent and human pancreatic beta cells ,35. Howe+ influx . Moreove+ influx . LIM hom+ influx . TherefoThe protective and harmful effects of leptin on beta cells remain controversial. Leptin prevents fatty acid-induced apoptosis by modulating the expression of the anti-apoptotic gene B-cell leukemia 2 (BCL-2) . SimilarFurthermore, the role of leptin in insulin secretion and beta cell proliferation has been investigated in tissue-specific leptin receptor-knockout (KO) mice. Beta cell- and hypothalamus-specific KO mice exhibit impaired GSIS and an increased beta cell mass . SimilarSeveral studies have investigated the effects of hypothalamic leptin and the sympathetic nervous system on beta cell function. One study found that leptin can directly decrease insulin secretion capacity through sympathetic nervous system activation without significantly affecting beta cell mass . FurtherAdiponectin was first reported by four independent research groups between 1995 and 1996, leading to its initial name under various designations, including Acrp30, AdipoQ, apM1, and GBP 28 ,59,60,61Adiponectin has a complex association with insulin secretion. Several studies have demonstrated a significant influence of adiponectin on insulin secretion ,69. GlobSeveral studies have suggested that adiponectin protects beta cells from glucotoxicity-induced apoptosis and dysfunction by activating the AMPK signaling pathway ,76. AdipAdiponectin plays a significant role in the management of insulin resistance and beta cell function, particularly during pregnancy. Alterations in adiponectin levels are associated with the risk and progression of GDM, and may have implications for the future development of T2DM. Weight gain, particularly fat accumulation, is a critical factor in this. Numerous studies have investigated the association between adiponectin levels and beta cell function in GDM. A longitudinal study focusing on Hispanic women with recent GDM revealed that weight gain, particularly fat accumulation, in conjunction with decreased adiponectin and increased C-reactive protein levels was significantly associated with a decline in beta cell function relative to insulin sensitivity . Other sTwo studies investigated the impact of low adiponectin levels, or hypoadiponectinemia, on GDM and beta cell function during pregnancy using mouse models. The first study reported that adiponectin deficiency led to glucose intolerance, hyperlipidemia, and increased fetal body weight in late pregnancy. These metabolic abnormalities were ameliorated by reintroduction of adiponectin, emphasizing its essential role in managing metabolic adaptations during pregnancy . AnotherApelin, originally isolated from bovine stomach extracts, was identified as an endogenous ligand for an orphan GPCR, the apelin receptor (APJ) . Apelin Resistin was initially identified in murine adipose tissue, which sparked significant interest in its potential roles in human metabolism . This inVisfatin, also known as nicotinamide phosphoribosyltransferase (NAMPT) or pre-B cell colony-enhancing factor (PBEF), was initially characterized as an insulin-mimetic adipokine . The oriAdipsin is a serine protease belonging to the trypsin family that plays a pivotal role in the alternative complement pathway ,116,117.Lipocalin-2 (LCN2), also known as neutrophil gelatinase-associated lipocalin (NGAL), is a member of the lipocalin superfamily. Several studies have reported the expression of LCN2 in adipose tissue ,121,122.Chemerin, also known as tazarotene-induced gene 2 (TIG2) or retinoic acid receptor responder 2 (RARRES2), is an adipokine that regulates adipogenesis and energy metabolism and plays a role in the regulation of beta cell mass and function ,126. CheFGF21, a peptide hormone mainly secreted by the liver, regulates glucose and lipid metabolism as well as insulin sensitivity in various organs, including the liver, pancreas, adipose tissue, and muscle ,132,133.GDF15 is a polypeptide that belongs to the TGF-\u03b2 superfamily and is expressed in various organs, including the liver, adipose tissue, and kidney . In mousTNF-\u03b1 is an inflammatory cytokine that increases in the adipose tissue of obese individuals and contributes to insulin resistance ,146,147.Following the discovery of the first adipokine, leptin, in 1994 , numerouPancreatic beta cells secrete insulin to regulate blood glucose levels. In T1DM, autoimmunity destroys beta cells, leading to insulin deficiency, whereas in T2DM, insulin resistance and beta cell dysfunction result in insulin deficiency. Adipokines affect the GSIS machinery of beta cells. For example, leptin directly inhibits GSIS, whereas adiponectin activates GSIS via an AMPK-independent pathway.In addition, leptin affects insulin secretion through complex mechanisms involving the modulation of potassium channels, intracellular signaling pathways, and the regulation of apoptosis. Although it inhibits insulin secretion under normal physiological conditions, its effects on beta cell survival and proliferation remain controversial. In contrast, adiponectin increases insulin sensitivity and protects beta cells. It stimulates insulin secretion, prevents apoptosis, and promotes beta cell regeneration, particularly during pregnancy.Apelin, resistin, visfatin, and other adipokines also affect beta cell function and insulin secretion. Apelin influences beta cell homeostasis, and its deficiency can lead to impaired glucose metabolism. The effects of resistin on insulin resistance are not fully understood; however, it appears to influence beta cell apoptosis and insulin receptor expression. Visfatin has been shown to have insulin-mimetic properties and is associated with insulin secretion, beta cell proliferation, and cell viability.Adipsin, lipocalin-2, chemerin, FGF21, GDF15, and TNF-\u03b1 also contribute to the complex network of interactions between adipokines and beta cells. These adipokines have been shown to influence beta cell mass, insulin secretion, and overall metabolic regulation. Understanding the intricate relationship between adipokines and pancreatic beta cells provides insights into the development of potential treatment strategies for metabolic disorders such as obesity and diabetes. In conclusion, the adipo-insular axis is a critical regulatory system that maintains metabolic homeostasis through the interplay between adipokines and pancreatic beta cells. Dysregulation of this axis may have significant implications in the onset and progression of metabolic disorders, making it a promising area of research for the development of novel therapeutic interventions.Two authors, J.K. and H.K., independently selected relevant studies from PubMed, MeSH, Scopus, Google Scholar, and Embase. The search strategy incorporated the following keywords or subject headings: adipokine, diabetes mellitus, metabolic disorder, insulin-secreting cells, pancreatic beta cell, insulin, leptin, adiponectin, apelin, resistin, visfatin, adipsin, lipocalin-2, chemerin, FGF21, GDF15, and TNF-\u03b1. The search was restricted to studies published in English. The authors compared and reviewed the reference lists for potential relevance. The authors discussed the articles, and 152 papers were considered relevant to the search criteria and suitable for addressing the research objective."]}
-{"representative": "Caloric restriction (CR) extends organismal lifespan and health span by improving glucose homeostasis mechanisms. How CR affects organellar structure and function of pancreatic beta cells over the lifetime of the animal remains unknown. Here, we used single nucleus transcriptomics to show that CR increases the expression of genes for beta cell identity, protein processing, and organelle homeostasis. Gene regulatory network analysis link this transcriptional phenotype to transcription factors involved in beta cell identity (Mafa) and homeostasis (Atf6). Imaging metabolomics further demonstrates that CR beta cells are more energetically competent. In fact, high-resolution light and electron microscopy indicates that CR reduces beta cell mitophagy and increases mitochondria mass, increasing mitochondrial ATP generation. Finally, we show that long-term CR delays the onset of beta cell aging and senescence to promote longevity by reducing beta cell turnover. Therefore, CR could be a feasible approach to preserve compromised beta cells during aging and diabetes. Tissues composed of largely post-mitotic cells are expected to be significantly impacted by aging because most cells in these tissues can be remarkably long-lived and as old as the organism itself 4. Because of their longevity, long-lived cells (LLCs) are under an immense pressure to maintain their normal cell function for long time periods to sustain organ function. However, how LLCs achieve and maintain structure and function during adulthood, and whether aging-associated deficits in LLC function in old organisms can be reversed to restore normal tissue function remains largely unknown.Aging is associated with loss of normal cell and tissue function, which are linked to degenerative and metabolic diseases such as Alzheimer\u2019s and diabetes during old age 8. These studies identified that different endocrine cell types in the mouse pancreas are LLCs, including up to 60% of all insulin-secreting beta cells 10. Beta cells secrete insulin in response to increases in blood glucose levels to sustain normal glucose homeostasis for an entire lifetime11. Loss of beta cell insulin secretion can occur during normal aging and is the cause of type 2 diabetes (T2D); this phenotype is linked to compromised expression of transcription factors (TFs) that maintain beta cell identity 14, accumulation of islet fibrosis, inflammation, and ER stress 15, reduced KATP channel conductance16 and loss of coordinated beta cell calcium dynamics 17, impaired beta cell autophagy and accumulation of beta cell DNA damage that triggers beta cell senescence 19. Aging- and T2D-associated impairment of beta cell function are also characterized by an increase in transcriptional noise and re-organization of beta cell gene regulatory networks (GRNs) that normally support beta cell structure-function, including the beta cell ER stress response 20.Using a combination of in vivo stable isotope labelling of mammals (SILAM), correlated and high-resolution electron and multi-isotope mass spectrometry , and protein mass spectrometry pipelines we have identified the tissue distribution of LLCs and of long-lived protein (LLP) complexes in post-mitotic cells 26. These beneficial effects are associated with improved glucose homeostasis due to prolonged fasting and enhanced peripheral insulin sensitivity, enhanced insulin signaling, lower adiposity, enhanced mitochondrial homeostasis and lower ATP generation, increased autophagy, enhanced protein homeostasis and reduced ER stress and inflammation 29. In the pancreas, 20-to-40% CR or CR achieved via TRF are linked to lower islet cell mass in lean mice21, whereas in pre-diabetic mice CR restores normal beta cell secretory function, identity, and preserves beta cell mass33 in a process dependent on activation of beta cell autophagy via Beclin-234. In patients with a recent T2D diagnosis, the efficacy of extreme CR  to reverse T2D depends on the capacity of beta cells to recover from previous exposure to a T2D metabolic state35. However, the mechanisms underlying the adaptation of beta cells to CR and whether CR can delay beta cell aging remains largely unknown.Caloric restriction (CR) and CR-mimicking approaches ) can prolong organismal longevity and delay aging from yeast to non-human primates in vivo and in vitro metabolic phenotyping of beta cell function followed by single cell multiomics and multi-modal high resolution microscopy pipelines  to investigate how CR modulates beta cell heterogeneity and longevity. Our data reveals that CR reduces the demand for beta cell insulin release necessary to sustain euglycemia by increasing peripheral insulin sensitivity. This causes beta cells to undergo a significant reorganization of their transcriptional architecture that promotes a largely post-mitotic and long-lived beta cells with enhanced mitochondrial structure-function while mitigating the onset of aging and senescence signatures. Therefore, our results provide a molecular footprint of how CR promotes beta cell function and longevity to delay aging and that could explain the beneficial effects of CR to the treatment of T2D in humans.We investigated these questions by exposing adult mice to mild CR  for up to 12 months and applied We exposed 8-week-old FVB or mice to 20% CR for 2-months, and quantified in vivo glucose homeostasis mechanisms . As expein vivo, we performed an oral mixed-meal tolerance test (MTT) using a high-carbohydrate nutrient shake . This revealed that CR mice have improved glucose tolerance compared to AL mice, whereas HFD mice were glucose intolerant . These results could be explained by the fact that female mice already have significantly higher peripheral insulin sensitivity than male mice and CR does not further improve insulin sensitivity in relation to AL-fed mice .To quantify the impact of CR on beta cell insulin release and glucose homeostasis tolerant , howevertolerant . Similartolerant \u2013J. The lin vitro. Surprisingly, no significant differences in basal and/or glucose-stimulated insulin release or islet insulin content were observed between diet groups . However, CR beta cells displayed reduced insulin release when challenged with high glucose in combination with the phosphodiesterase inhibitor 3-isobutyl-1-methylxanthine (IBMX) . These results suggested that CR beta cells could have lower glucose-dependent cAMP generation, which is required for amplification of glucose-dependent insulin secretion and incretin signaling37. To test this hypothesis, we repeated the in vivo MTT in AL or CR mice pre-treated with the GLP1 receptor agonist Liraglutide . Pre-treatment with Liraglutide improved glucose tolerance in both groups and sustained higher serum insulin levels after 30 minutes in AL but not in CR mice . Therefore, this data indicates that CR beta cells might have reduced GLP1R signaling in vivo in conditions of meal-induced and transitory hyperglycemia.Next, to measure beta cell insulin release in vitro, we performed dynamic glucose-stimulated insulin secretion assays (GSIS) using isolated islets from male mice exposed to AL, CR, or HFD for 2 months to measure beta cell insulin release Together, these results suggest that CR improves peripheral insulin sensitivity and glucose tolerance in a sex-dependent manner, which decreases the demand for beta cell insulin secretion necessary to maintain normal glucose levels in male mice without significantly affecting glucose-dependent insulin release mechanisms or alpha cell function.in vivo, we applied single nucleus (sn) transposase-accessible chromatin with sequencing (ATAC)- and mRNA sequencing  to investigate the transcriptional architecture underlying the adaptation of beta cells to CR or HFD after 2 months on diet.Given that 2 months of CR was sufficient to trigger significant changes to glucose homeostasis and beta cell insulin secretion Ins1, Ins2), amylin (Iapp), the insulin processing enzyme Pcsk1n, the glucose-6 phosphatase enzyme G6pc2, the beta cell transcription factor (TF) Nkx6\u20131, and down-regulation of the incretin receptor Gipr (Glp1r was not detected) and of the carbohydrate-responsive transcriptional regulator Mlxipl   and nutrient-dependent regulators of autophagy (Tfeb and Tfe3)  and confocal microscopy of islets from CR mice confirmed that ~80% of all CR beta cells have higher levels of Arntl/Bmal and Pdx1 in situ after 2 months on diet . Pathway enrichment analysis of differentially expressed genes and enriched chromatin regions in CR beta cells revealed the up regulation of pathways linked to beta cell identity and function, oxidative phosphorylation (OxPhos), mitophagy, protein processing, degradation, and transport through the endoplasmic reticulum (ER) and Golgi apparatus , and increased expression of stress- and diabetes-associated genes  , where most changes were associated with genes containing TF motifs mapped to circadian rhythm- (pparatus . In contctively) \u2013I.Ins1, Ins2, Mafa), oxidative and anaerobic carbohydrate metabolism  and mitochondrial structure and function (Cytochrome C genes (Cox4-to-8), Vdac1, Tomm20, and Tomm70a), autophagy , lipid metabolism (Hadh), amino acid transport and metabolism , protein folding and response to ER stress  and DNA damage (Nme1) genes (Gck) and increased expression of glucose-6-phosphatase catalytic subunit 2 (G6pc2), which could suggest that these cells have lower glycolytic flux and increased glucose excursion 40. However, this does not appear to be the case since CR beta cells have appropriate glucose-stimulated insulin release dynamics  and their marker genes and chromatin accessibility profiles ). Beta cTogether, these results indicate that CR triggers significant transcriptional and chromatin accessibility changes in most beta cells that enhance cell identity, nutrient metabolism, circadian rhythm regulation, and ER, mitochondria, and protein homeostasis mechanisms.42. Given that CR has limited effects on beta cell chromatin accessibility  that control beta cell gene expression patterns and heterogeneity Pdx1, Nkx-6.1, Mafa, and Foxa2a (12). This approach revealed the expected and positive correlation in the activation of beta cell TFs   from AL, CR, and HFD mice after 2 months on diet. We identified a total of 242 TF enriched in all beta cells, including beta cell identity TFs d Foxa2, 45. In adRunx1\u20133) .Mafa, Nkx6\u20131, Foxo1), protein folding and ER homeostasis , transcriptional regulation of mitochondrial genes (Gabpa/Nrf2 and Gabpb1), NAD metabolism (Sirt6), and glucocorticoid signaling (Nr3c1) genes, which coincides with increased gene expression of some of these markers in CR beta cells  and ER stress response (Atf4) . Similar results were observed for the beta cell proliferation TF Foxp1, and the protein homeostasis TF Crebl2 . Importantly, this beta cell TF target \u201creprogramming\u201d was reflected in the gene expression pattern of genes associated with Mafa and Atf6. Here, these TFs in CR beta cells were linked to the increased expression of several beta cell identity and protein homeostasis genes , the regulator of intra-golgi transport Arf1, the autophagy marker Lamp1, and beta cell identity and function genes Ucn3, Chga, and Nkx6\u20131 .Therefore, CR promotes beta cell identity and homeostasis by upregulating the expression of clusters of genes associated with enhanced beta cell maturation, homeostasis, and function. Moreover, this transcriptional program is likely driven by the increased transcriptional activity of in situ islets using imaging mass spectrometry  to quantify the relative abundance and spatial profile of metabolites in islets from AL and CR mice after 2 months on diet. We chose this approach to minimize changes in cell metabolism that could occur during the islet isolation process. Briefly, fresh mouse pancreases were snap-frozen using a liquid nitrogen bath and placed in histology cassettes prior to MALDI-MS metabolite imaging and data analysis (see methods for details)  . Consecudetails) .m/z: 391.22486, CPA 16:0) and nucleotide cytidine 2\u2019 3\u2019-cyclic phosphate , which is involved in the pyrimidine metabolism pathway. In contrast, islet-enriched metabolites were largely classified as lipids, including cholesterol sulfate (m/z: 465.30443) and phospholipids  .Next, we applied a similar analysis to identify metabolites enriched in AL or CR islets; this identified n=28 ions enriched in AL islets versus n=52 ions enriched in CR islets . Our datTogether, this data shows that CR promotes changes to the overall islet lipid composition and increases the levels of molecules involved in beta cell glucose metabolism and insulin release , and indicates that CR islets could have increased DNA damage response via ADP-ribosylation.12 and DNA damage, both of which are thought to contribute towards beta cell senescence and loss of function during old age 52. We hypothesized CR would prevent the onset of beta cell aging and senescence signatures and to test this hypothesis, we exposed 8-week-old male mice to CR for 12 months  followed by confocal microscopy of mouse pancreases from animals maintained on AL or CR for 2- to 12-months using the DNA damage response marker 53bp1. Here, we observed that CR beta cells have reduced accumulation of 53bp1, thus indicating that these cells accumulate less DNA damage over time (LmnB1 (which is lost in an accelerated model of mouse beta cell senescence 53) and mRNA Fluorescent In Situ Hybridization of p16/Cdkn2a and p21/Cdkn1a genes. We found that CR beta cells have significantly higher LmnB1 levels and reduced in situ expression of p16/Cdkn2a and p21/Cdkn1a  and transcriptional regulators of mitochondrial genes (Gabpa/Gabpb1)  in beta cells from AL or CR mice in situ and found that CR led to significant down-regulation of p-rpS6 in beta cells . This data indicates that mTOR activity is suppressed in beta cells, which would allow beta cells to increase autophagy during CR.Previous data indicates that autophagy is activated by intermitted fasting in HFD-fed mice to maintain beta cell mass and function /Gabpb1) \u20133. Firstta cells . CR signBeclin1, amp1 and  AL mice \u2013L. Autop55. To determine the role and potential targets of beta cell autophagy during CR, we used deconvolution-assisted confocal colocalization microscopy of mouse pancreases stained with antibodies against lysosomes (Lamp 1), insulin granules (Ins), and/or mitochondria (succinate dehydrogenase isoform A (Sdha)). We found no differences in the co-localization between Ins and Lamp1 across diet groups, which means that CR-induced autophagy does not target mature insulin granules . Importantly, CR beta cells have lower levels of Sdha-Lamp1 colocalization (Prkn) in CR beta cells . To validate these results, we performed high resolution scanning electron microscopy (SEM) of beta cells from AL/CR mice after 2 or 12 months on diet to quantify beta cell mature insulin granule and mitochondrial density in individual cells. As expected, we found no differences in beta cell insulin granule content, and we observed higher mitochondrial mass in CR beta cells \u2013 which is likely explained by reduced rates of mitophagy  since its gene expression levels are increased in CR beta cells . p62 targets poly-ubiquitinated (Ub) protein complexes to proteasome and lysosome machineries 56. Confocal microscopy of p62 and Lamp1 revealed that CR increases beta cell p62-vesicle density without affecting the relative co-localization of p62 with lysosomes, thus indicating that these cells undergo a proportional increase in the number of autophagic events and autophagic flux . Moreover, CR beta cells have higher expression of ubiquitin processing and Ub protein degradation genes , including most proteasome subunit genes , thus indicating that CR-induced autophagy in beta cells likely targets poly-ub macromolecules for degradation via the lysosomal and proteasome machineries.Given that CR-induced autophagy in beta cells does not target existing insulin granules or mitochondria, and pathways involved in the degradation of beta cell ER  are not differentially modulated by CR , we decided to measure the protein levels of the adaptor protein p62/Sequestosome-1 ) and higher mitochondrial density  using AL and CR mouse pancreases from our 2-month cohort prepared for SEM ). eTomo provides high-resolution measurements of cellular and mitochondrial structure that can be used to estimate the functional capacity of each mitochondrion to generate ATP and OXPHOS potential from anatomical measurements of mitochondria morphology, cristae number, cristae membrane surface area and density, and type of cristae structure 57. We reconstructed the 3D architecture of individual beta cell mitochondria and the morphology of mitochondrial cristae with an isotropic axial resolution of 1.62nm using 300 nanometer-thick beta cell sections . We estimate that each CR beta cell mitochondria produces ~59,000 ATP molecules/second/mitochondrial volume, which is 14% higher than in AL beta cells . Accordingly, most beta cell MDVs contained membrane-rich cargo that could be seen fusing with lysosomes , while one example fused with the ER. This data suggests that beta cell MDVs are mostly implicated in mitochondrial protein quality control by delivering cargo to the lysosome machinery .While analyzing the eTomo volumes, we noticed the occurrence of vesicle-like structures stemming from the outer membrane regions of beta cell mitochondria that resemble mitochondrial-derived vesicles  microscopy approach  developed previously by us to quantify cell and protein complex age 7. Here, Nitrogen 15 (15N)-labelled animals were created in utero and maintained on 15N-diet until post-natal day 45 (P45). Next, 15N-mice were randomly allocated to AL, CR, or HFD feeding groups using 14N-rich food pellets and maintained on their respective diets for 12 months . Finally, the mice were prepared for MIMS-EM imaging and quantification of cell age based on the amount of 15N retained in the cell nucleus . Importantly, the levels of nuclear 15N in islet and acinar cells were heterogeneous, which is indicative of distinct populations of beta cells with different longevities . We then classified each beta cell as a potential long-lived cell (LLC) or a relatively younger cell according to their nuclear 15N content using cortical neurons as a reference4, and found that up to 80% of all beta cells in CR mice are LLCs  and are implicated as the main causes of T2D 70. CR has been proposed as a feasible approach to combat cardio-metabolic diseases like T2D due to its positive effects on whole body insulin sensitivity that reduce the metabolic demand for insulin release by lowering blood glucose levels. However, here we show that lower insulin release levels occur independently of changes to blood glucose levels. This reduced insulin secretion tone is adequate to maintain euglycemia without triggering hypoglycemic events after meals (even after exposure to incretin receptor agonists). This means that CR promotes a physiological scenario where beta cells \u201crest\u201d due to a significantly lower metabolic demand for insulin secretion. A similar strategy has been proposed for treatment of T1D and T2D, where exogenous insulin and/or the KATP channel opener diazoxide are applied to recover beta cell function (at least temporarily) 72. To understand how a lower metabolic demand affects the heterogeneity of beta cells during CR, we used single nucleus transcriptomics and found that CR promotes activation of beta cell function, identity, and protein and organelle homeostasis pathways. By profiling beta cell chromatin accessibility and TF activity, we show that CR beta cells activate genes with TF motifs targeted by modulators of circadian , beta cell identity (Mafa), and ER stress and cell homeostasis  pathways. These findings are in line with previous studies showing that CR achieved via time-restricted corrects abnormal glucose homeostasis by activating Dbp33, and that the circadian rhythm regulator Bmal is important for maintenance of mature beta cell identity and function73.Increased insulin sensitivity and/or enhanced insulin signaling during CR are linked to increased longevity in several organisms, from worms to humans Bmal and Pdx1 expression as well as increased density of autophagy vesicles marked by p62/Sqstm1, Lc3I-II, and Lamp1 in CR beta cells in situ. Previous studies have shown that CR and CR via TRF restore beta cell function in HFD-fed animals by rescuing gap-junction connectivity and autophagic fluxes 34. In this context, beta cell autophagy is implicated in the degradation of insulin granules and/or mitochondria to protect beta cells from accumulating molecules and/or damaged organelles during pro-inflammatory and metabolic stress conditions 77. In contrast, our studies reveal that CR-induced autophagy in beta cells does not target insulin granules nor the mitochondria; instead, autophagy is involved in the degradation of poly-ubiquitinated substrates delivered to proteasomes and/or lysosomes via p62-positive autophagy vesicles. Importantly, CR prevented the loss of autophagy vesicles during aging, and reduced beta cell senescence signatures53, as evidenced by a reduction in the accumulation of DNA damage and in the expression of beta cell senescence markers p21/Cdkn1a and p16/Cdkn2a, and in the relative increase in nuclear LmnB1 levels.We validated our transcriptomics using light, electron, and mass spectrometry microscopy; first, we found higher 51, which in turn explains the reduced expression of senescence markers 52. Second, using eTomo microscopy, we discovered that CR increases mitochondrial cristae density that translates into a higher potential of each mitochondrion to generate more ATP. Given that insulin release is reduced in CR cells, this increased ATP production may serve as fuel to sustain ATP-demanding processes activated during CR such as protein ubiquitination and degradation in proteasomes, and autophagy 78. Third, the near absence of MDVs in CR beta cells and up regulation of superoxide scavengers Sod1 and Sod2 strongly suggests ROS generation and degradation of mitochondrial proteins is reduced during CR. Furthermore, previous studies show that CR increases mitochondrial bioenergetic efficiency and reduces oxidative stress accumulation in different systems79 (including in humans80), which is linked to increased mitochondrial protein longevity in aged cells81. Reduced accumulation of oxidative damage (in the form of reactive oxygen species (ROS)) and enhanced bioenergetics of CR beta cells could also explain why these cells secrete less insulin during fasting, as dysregulation of ROS and glycolytic signaling are proposed as causes of basal hyperinsulinemia during diabetes 82. Future experiments will focus on measuring mitochondrial energetics under different basal and stimulated conditions to further understand how CR regulates basal insulin secretion while promoting healthier mitochondria homeostasis in beta cells.The reduced levels of mitophagy observed in CR beta cells are expected to contribute (at least in part) to higher mitochondrial density, while the elevated expression of multiple electron transport chain, cellular respiration, and cristae morphology genes suggest that mitochondrial metabolism and homeostasis are optimized in CR beta cells. This hypothesis is supported by three separate lines of observations. First, our MALDI MS metabolomics experiments reveal normal-to-elevated levels of lipids, cAMP, glucose metabolites, and ADP-ribose \u2013 the later which could explain why CR beta cells accumulate less DNA damage15N-SILAM and MIMS-EM we have previously shown that most mouse beta cells are long-lived while the rest constitutes a sub-population of beta cells that proliferates throughout their lifetime 4. Using this same approach, we show that CR prolongs the longevity of beta cells by reducing the turnover rate of the subpopulation of beta cells that is more proliferation prone, while HFD increases beta cell proliferation (as expected). Strikingly, we also found long-lived beta cells in the HFD setting, thus indicating that some beta cells do not proliferate during long periods of hyperglycemia in vivo. Previous studies have shown that proliferation promotes an immature and less functional beta cell phenotype than non-proliferating beta cells 83, which is also supported by the higher levels of beta cell identity and function markers in CR islets. Importantly, this largely post-mitotic state of CR beta cells could also explain the reduced accumulation of DNA damage, as cell proliferation triggers higher accumulation of genetic mutations and replication-dependent stress that can lead to disease and aging 84.Finally, using In conclusion, CR enhances beta cell health and longevity by upregulating cell identity and energy homeostasis mechanisms while delaying beta cell aging. Therefore, these results offer a molecular footprint of how CR affects beta cells to preserve and/or rescue beta cell dysfunction during aging and T2D.65. Therefore, we cannot distinguish between the effects of recurrent and prolonged fasting periods versus reduced daily calorie intake (without fasting) on beta cell function and heterogeneity. Importantly, recent studies show that combining CR with fasting leads to better metabolic and anti-aging effects 65. Our single cell transcriptomics and GRN reconstructions identify likely regulators of the beta cell phenotype described here. Therefore, future experiments will focus on exposing genetic mouse models  to CR. The 15N-SILAM and MIMS-EM experiments add to previous observations of cellular age mosaicism in somatic tissues, including in the pancreas . Like MALDI MS metabolomics and eTomo, this approach is time consuming and financially expensive . Notably, the nuclear 15N measurements of any cell are variable since heterochromatin-rich domains in the sections analyzed are randomly sampled during MIMS-EM. These compartments tend to have higher density of 15N-DNA and yield higher signal intensities versus DNA \u201cpoor\u201d euchromatin domains 4. Nevertheless, our results confirm previous MIMS-EM results, and now show how dietary interventions such as CR can be used to promote a long-lived beta cell phenotype.Our report shows how CR impacts mouse beta cell heterogeneity, including their in vivo function and molecular and aging signatures. In our experimental setup, CR was efficiently achieved by providing a restricted amount of food before the start of the animal\u2019s active phase. By design, this approach potentializes the metabolic impacts of CR (including the periods of prolonged fasting) by activating circadian rhythm mechanisms involved in nutrient metabolism", "texts": ["Caloric restriction (CR) extends organismal lifespan and health span by improving glucose homeostasis mechanisms. How CR affects organellar structure and function of pancreatic beta cells over the lifetime of the animal remains unknown. Here, we used single nucleus transcriptomics to show that CR increases the expression of genes for beta cell identity, protein processing, and organelle homeostasis. Gene regulatory network analysis link this transcriptional phenotype to transcription factors involved in beta cell identity (Mafa) and homeostasis (Atf6). Imaging metabolomics further demonstrates that CR beta cells are more energetically competent. In fact, high-resolution light and electron microscopy indicates that CR reduces beta cell mitophagy and increases mitochondria mass, increasing mitochondrial ATP generation. Finally, we show that long-term CR delays the onset of beta cell aging and senescence to promote longevity by reducing beta cell turnover. Therefore, CR could be a feasible approach to preserve compromised beta cells during aging and diabetes. Tissues composed of largely post-mitotic cells are expected to be significantly impacted by aging because most cells in these tissues can be remarkably long-lived and as old as the organism itself 4. Because of their longevity, long-lived cells (LLCs) are under an immense pressure to maintain their normal cell function for long time periods to sustain organ function. However, how LLCs achieve and maintain structure and function during adulthood, and whether aging-associated deficits in LLC function in old organisms can be reversed to restore normal tissue function remains largely unknown.Aging is associated with loss of normal cell and tissue function, which are linked to degenerative and metabolic diseases such as Alzheimer\u2019s and diabetes during old age 8. These studies identified that different endocrine cell types in the mouse pancreas are LLCs, including up to 60% of all insulin-secreting beta cells 10. Beta cells secrete insulin in response to increases in blood glucose levels to sustain normal glucose homeostasis for an entire lifetime11. Loss of beta cell insulin secretion can occur during normal aging and is the cause of type 2 diabetes (T2D); this phenotype is linked to compromised expression of transcription factors (TFs) that maintain beta cell identity 14, accumulation of islet fibrosis, inflammation, and ER stress 15, reduced KATP channel conductance16 and loss of coordinated beta cell calcium dynamics 17, impaired beta cell autophagy and accumulation of beta cell DNA damage that triggers beta cell senescence 19. Aging- and T2D-associated impairment of beta cell function are also characterized by an increase in transcriptional noise and re-organization of beta cell gene regulatory networks (GRNs) that normally support beta cell structure-function, including the beta cell ER stress response 20.Using a combination of in vivo stable isotope labelling of mammals (SILAM), correlated and high-resolution electron and multi-isotope mass spectrometry , and protein mass spectrometry pipelines we have identified the tissue distribution of LLCs and of long-lived protein (LLP) complexes in post-mitotic cells 26. These beneficial effects are associated with improved glucose homeostasis due to prolonged fasting and enhanced peripheral insulin sensitivity, enhanced insulin signaling, lower adiposity, enhanced mitochondrial homeostasis and lower ATP generation, increased autophagy, enhanced protein homeostasis and reduced ER stress and inflammation 29. In the pancreas, 20-to-40% CR or CR achieved via TRF are linked to lower islet cell mass in lean mice21, whereas in pre-diabetic mice CR restores normal beta cell secretory function, identity, and preserves beta cell mass33 in a process dependent on activation of beta cell autophagy via Beclin-234. In patients with a recent T2D diagnosis, the efficacy of extreme CR  to reverse T2D depends on the capacity of beta cells to recover from previous exposure to a T2D metabolic state35. However, the mechanisms underlying the adaptation of beta cells to CR and whether CR can delay beta cell aging remains largely unknown.Caloric restriction (CR) and CR-mimicking approaches ) can prolong organismal longevity and delay aging from yeast to non-human primates in vivo and in vitro metabolic phenotyping of beta cell function followed by single cell multiomics and multi-modal high resolution microscopy pipelines  to investigate how CR modulates beta cell heterogeneity and longevity. Our data reveals that CR reduces the demand for beta cell insulin release necessary to sustain euglycemia by increasing peripheral insulin sensitivity. This causes beta cells to undergo a significant reorganization of their transcriptional architecture that promotes a largely post-mitotic and long-lived beta cells with enhanced mitochondrial structure-function while mitigating the onset of aging and senescence signatures. Therefore, our results provide a molecular footprint of how CR promotes beta cell function and longevity to delay aging and that could explain the beneficial effects of CR to the treatment of T2D in humans.We investigated these questions by exposing adult mice to mild CR  for up to 12 months and applied We exposed 8-week-old FVB or mice to 20% CR for 2-months, and quantified in vivo glucose homeostasis mechanisms . As expein vivo, we performed an oral mixed-meal tolerance test (MTT) using a high-carbohydrate nutrient shake . This revealed that CR mice have improved glucose tolerance compared to AL mice, whereas HFD mice were glucose intolerant . These results could be explained by the fact that female mice already have significantly higher peripheral insulin sensitivity than male mice and CR does not further improve insulin sensitivity in relation to AL-fed mice .To quantify the impact of CR on beta cell insulin release and glucose homeostasis tolerant , howevertolerant . Similartolerant \u2013J. The lin vitro. Surprisingly, no significant differences in basal and/or glucose-stimulated insulin release or islet insulin content were observed between diet groups . However, CR beta cells displayed reduced insulin release when challenged with high glucose in combination with the phosphodiesterase inhibitor 3-isobutyl-1-methylxanthine (IBMX) . These results suggested that CR beta cells could have lower glucose-dependent cAMP generation, which is required for amplification of glucose-dependent insulin secretion and incretin signaling37. To test this hypothesis, we repeated the in vivo MTT in AL or CR mice pre-treated with the GLP1 receptor agonist Liraglutide . Pre-treatment with Liraglutide improved glucose tolerance in both groups and sustained higher serum insulin levels after 30 minutes in AL but not in CR mice . Therefore, this data indicates that CR beta cells might have reduced GLP1R signaling in vivo in conditions of meal-induced and transitory hyperglycemia.Next, to measure beta cell insulin release in vitro, we performed dynamic glucose-stimulated insulin secretion assays (GSIS) using isolated islets from male mice exposed to AL, CR, or HFD for 2 months to measure beta cell insulin release Together, these results suggest that CR improves peripheral insulin sensitivity and glucose tolerance in a sex-dependent manner, which decreases the demand for beta cell insulin secretion necessary to maintain normal glucose levels in male mice without significantly affecting glucose-dependent insulin release mechanisms or alpha cell function.in vivo, we applied single nucleus (sn) transposase-accessible chromatin with sequencing (ATAC)- and mRNA sequencing  to investigate the transcriptional architecture underlying the adaptation of beta cells to CR or HFD after 2 months on diet.Given that 2 months of CR was sufficient to trigger significant changes to glucose homeostasis and beta cell insulin secretion Ins1, Ins2), amylin (Iapp), the insulin processing enzyme Pcsk1n, the glucose-6 phosphatase enzyme G6pc2, the beta cell transcription factor (TF) Nkx6\u20131, and down-regulation of the incretin receptor Gipr (Glp1r was not detected) and of the carbohydrate-responsive transcriptional regulator Mlxipl   and nutrient-dependent regulators of autophagy (Tfeb and Tfe3)  and confocal microscopy of islets from CR mice confirmed that ~80% of all CR beta cells have higher levels of Arntl/Bmal and Pdx1 in situ after 2 months on diet . Pathway enrichment analysis of differentially expressed genes and enriched chromatin regions in CR beta cells revealed the up regulation of pathways linked to beta cell identity and function, oxidative phosphorylation (OxPhos), mitophagy, protein processing, degradation, and transport through the endoplasmic reticulum (ER) and Golgi apparatus , and increased expression of stress- and diabetes-associated genes  , where most changes were associated with genes containing TF motifs mapped to circadian rhythm- (pparatus . In contctively) \u2013I.Ins1, Ins2, Mafa), oxidative and anaerobic carbohydrate metabolism  and mitochondrial structure and function (Cytochrome C genes (Cox4-to-8), Vdac1, Tomm20, and Tomm70a), autophagy , lipid metabolism (Hadh), amino acid transport and metabolism , protein folding and response to ER stress  and DNA damage (Nme1) genes (Gck) and increased expression of glucose-6-phosphatase catalytic subunit 2 (G6pc2), which could suggest that these cells have lower glycolytic flux and increased glucose excursion 40. However, this does not appear to be the case since CR beta cells have appropriate glucose-stimulated insulin release dynamics  and their marker genes and chromatin accessibility profiles ). Beta cTogether, these results indicate that CR triggers significant transcriptional and chromatin accessibility changes in most beta cells that enhance cell identity, nutrient metabolism, circadian rhythm regulation, and ER, mitochondria, and protein homeostasis mechanisms.42. Given that CR has limited effects on beta cell chromatin accessibility  that control beta cell gene expression patterns and heterogeneity Pdx1, Nkx-6.1, Mafa, and Foxa2a (12). This approach revealed the expected and positive correlation in the activation of beta cell TFs   from AL, CR, and HFD mice after 2 months on diet. We identified a total of 242 TF enriched in all beta cells, including beta cell identity TFs d Foxa2, 45. In adRunx1\u20133) .Mafa, Nkx6\u20131, Foxo1), protein folding and ER homeostasis , transcriptional regulation of mitochondrial genes (Gabpa/Nrf2 and Gabpb1), NAD metabolism (Sirt6), and glucocorticoid signaling (Nr3c1) genes, which coincides with increased gene expression of some of these markers in CR beta cells  and ER stress response (Atf4) . Similar results were observed for the beta cell proliferation TF Foxp1, and the protein homeostasis TF Crebl2 . Importantly, this beta cell TF target \u201creprogramming\u201d was reflected in the gene expression pattern of genes associated with Mafa and Atf6. Here, these TFs in CR beta cells were linked to the increased expression of several beta cell identity and protein homeostasis genes , the regulator of intra-golgi transport Arf1, the autophagy marker Lamp1, and beta cell identity and function genes Ucn3, Chga, and Nkx6\u20131 .Therefore, CR promotes beta cell identity and homeostasis by upregulating the expression of clusters of genes associated with enhanced beta cell maturation, homeostasis, and function. Moreover, this transcriptional program is likely driven by the increased transcriptional activity of in situ islets using imaging mass spectrometry  to quantify the relative abundance and spatial profile of metabolites in islets from AL and CR mice after 2 months on diet. We chose this approach to minimize changes in cell metabolism that could occur during the islet isolation process. Briefly, fresh mouse pancreases were snap-frozen using a liquid nitrogen bath and placed in histology cassettes prior to MALDI-MS metabolite imaging and data analysis (see methods for details)  . Consecudetails) .m/z: 391.22486, CPA 16:0) and nucleotide cytidine 2\u2019 3\u2019-cyclic phosphate , which is involved in the pyrimidine metabolism pathway. In contrast, islet-enriched metabolites were largely classified as lipids, including cholesterol sulfate (m/z: 465.30443) and phospholipids  .Next, we applied a similar analysis to identify metabolites enriched in AL or CR islets; this identified n=28 ions enriched in AL islets versus n=52 ions enriched in CR islets . Our datTogether, this data shows that CR promotes changes to the overall islet lipid composition and increases the levels of molecules involved in beta cell glucose metabolism and insulin release , and indicates that CR islets could have increased DNA damage response via ADP-ribosylation.12 and DNA damage, both of which are thought to contribute towards beta cell senescence and loss of function during old age 52. We hypothesized CR would prevent the onset of beta cell aging and senescence signatures and to test this hypothesis, we exposed 8-week-old male mice to CR for 12 months  followed by confocal microscopy of mouse pancreases from animals maintained on AL or CR for 2- to 12-months using the DNA damage response marker 53bp1. Here, we observed that CR beta cells have reduced accumulation of 53bp1, thus indicating that these cells accumulate less DNA damage over time (LmnB1 (which is lost in an accelerated model of mouse beta cell senescence 53) and mRNA Fluorescent In Situ Hybridization of p16/Cdkn2a and p21/Cdkn1a genes. We found that CR beta cells have significantly higher LmnB1 levels and reduced in situ expression of p16/Cdkn2a and p21/Cdkn1a  and transcriptional regulators of mitochondrial genes (Gabpa/Gabpb1)  in beta cells from AL or CR mice in situ and found that CR led to significant down-regulation of p-rpS6 in beta cells . This data indicates that mTOR activity is suppressed in beta cells, which would allow beta cells to increase autophagy during CR.Previous data indicates that autophagy is activated by intermitted fasting in HFD-fed mice to maintain beta cell mass and function /Gabpb1) \u20133. Firstta cells . CR signBeclin1, amp1 and  AL mice \u2013L. Autop55. To determine the role and potential targets of beta cell autophagy during CR, we used deconvolution-assisted confocal colocalization microscopy of mouse pancreases stained with antibodies against lysosomes (Lamp 1), insulin granules (Ins), and/or mitochondria (succinate dehydrogenase isoform A (Sdha)). We found no differences in the co-localization between Ins and Lamp1 across diet groups, which means that CR-induced autophagy does not target mature insulin granules . Importantly, CR beta cells have lower levels of Sdha-Lamp1 colocalization (Prkn) in CR beta cells . To validate these results, we performed high resolution scanning electron microscopy (SEM) of beta cells from AL/CR mice after 2 or 12 months on diet to quantify beta cell mature insulin granule and mitochondrial density in individual cells. As expected, we found no differences in beta cell insulin granule content, and we observed higher mitochondrial mass in CR beta cells \u2013 which is likely explained by reduced rates of mitophagy  since its gene expression levels are increased in CR beta cells . p62 targets poly-ubiquitinated (Ub) protein complexes to proteasome and lysosome machineries 56. Confocal microscopy of p62 and Lamp1 revealed that CR increases beta cell p62-vesicle density without affecting the relative co-localization of p62 with lysosomes, thus indicating that these cells undergo a proportional increase in the number of autophagic events and autophagic flux . Moreover, CR beta cells have higher expression of ubiquitin processing and Ub protein degradation genes , including most proteasome subunit genes , thus indicating that CR-induced autophagy in beta cells likely targets poly-ub macromolecules for degradation via the lysosomal and proteasome machineries.Given that CR-induced autophagy in beta cells does not target existing insulin granules or mitochondria, and pathways involved in the degradation of beta cell ER  are not differentially modulated by CR , we decided to measure the protein levels of the adaptor protein p62/Sequestosome-1 ) and higher mitochondrial density  using AL and CR mouse pancreases from our 2-month cohort prepared for SEM ). eTomo provides high-resolution measurements of cellular and mitochondrial structure that can be used to estimate the functional capacity of each mitochondrion to generate ATP and OXPHOS potential from anatomical measurements of mitochondria morphology, cristae number, cristae membrane surface area and density, and type of cristae structure 57. We reconstructed the 3D architecture of individual beta cell mitochondria and the morphology of mitochondrial cristae with an isotropic axial resolution of 1.62nm using 300 nanometer-thick beta cell sections . We estimate that each CR beta cell mitochondria produces ~59,000 ATP molecules/second/mitochondrial volume, which is 14% higher than in AL beta cells . Accordingly, most beta cell MDVs contained membrane-rich cargo that could be seen fusing with lysosomes , while one example fused with the ER. This data suggests that beta cell MDVs are mostly implicated in mitochondrial protein quality control by delivering cargo to the lysosome machinery .While analyzing the eTomo volumes, we noticed the occurrence of vesicle-like structures stemming from the outer membrane regions of beta cell mitochondria that resemble mitochondrial-derived vesicles  microscopy approach  developed previously by us to quantify cell and protein complex age 7. Here, Nitrogen 15 (15N)-labelled animals were created in utero and maintained on 15N-diet until post-natal day 45 (P45). Next, 15N-mice were randomly allocated to AL, CR, or HFD feeding groups using 14N-rich food pellets and maintained on their respective diets for 12 months . Finally, the mice were prepared for MIMS-EM imaging and quantification of cell age based on the amount of 15N retained in the cell nucleus . Importantly, the levels of nuclear 15N in islet and acinar cells were heterogeneous, which is indicative of distinct populations of beta cells with different longevities . We then classified each beta cell as a potential long-lived cell (LLC) or a relatively younger cell according to their nuclear 15N content using cortical neurons as a reference4, and found that up to 80% of all beta cells in CR mice are LLCs  and are implicated as the main causes of T2D 70. CR has been proposed as a feasible approach to combat cardio-metabolic diseases like T2D due to its positive effects on whole body insulin sensitivity that reduce the metabolic demand for insulin release by lowering blood glucose levels. However, here we show that lower insulin release levels occur independently of changes to blood glucose levels. This reduced insulin secretion tone is adequate to maintain euglycemia without triggering hypoglycemic events after meals (even after exposure to incretin receptor agonists). This means that CR promotes a physiological scenario where beta cells \u201crest\u201d due to a significantly lower metabolic demand for insulin secretion. A similar strategy has been proposed for treatment of T1D and T2D, where exogenous insulin and/or the KATP channel opener diazoxide are applied to recover beta cell function (at least temporarily) 72. To understand how a lower metabolic demand affects the heterogeneity of beta cells during CR, we used single nucleus transcriptomics and found that CR promotes activation of beta cell function, identity, and protein and organelle homeostasis pathways. By profiling beta cell chromatin accessibility and TF activity, we show that CR beta cells activate genes with TF motifs targeted by modulators of circadian , beta cell identity (Mafa), and ER stress and cell homeostasis  pathways. These findings are in line with previous studies showing that CR achieved via time-restricted corrects abnormal glucose homeostasis by activating Dbp33, and that the circadian rhythm regulator Bmal is important for maintenance of mature beta cell identity and function73.Increased insulin sensitivity and/or enhanced insulin signaling during CR are linked to increased longevity in several organisms, from worms to humans Bmal and Pdx1 expression as well as increased density of autophagy vesicles marked by p62/Sqstm1, Lc3I-II, and Lamp1 in CR beta cells in situ. Previous studies have shown that CR and CR via TRF restore beta cell function in HFD-fed animals by rescuing gap-junction connectivity and autophagic fluxes 34. In this context, beta cell autophagy is implicated in the degradation of insulin granules and/or mitochondria to protect beta cells from accumulating molecules and/or damaged organelles during pro-inflammatory and metabolic stress conditions 77. In contrast, our studies reveal that CR-induced autophagy in beta cells does not target insulin granules nor the mitochondria; instead, autophagy is involved in the degradation of poly-ubiquitinated substrates delivered to proteasomes and/or lysosomes via p62-positive autophagy vesicles. Importantly, CR prevented the loss of autophagy vesicles during aging, and reduced beta cell senescence signatures53, as evidenced by a reduction in the accumulation of DNA damage and in the expression of beta cell senescence markers p21/Cdkn1a and p16/Cdkn2a, and in the relative increase in nuclear LmnB1 levels.We validated our transcriptomics using light, electron, and mass spectrometry microscopy; first, we found higher 51, which in turn explains the reduced expression of senescence markers 52. Second, using eTomo microscopy, we discovered that CR increases mitochondrial cristae density that translates into a higher potential of each mitochondrion to generate more ATP. Given that insulin release is reduced in CR cells, this increased ATP production may serve as fuel to sustain ATP-demanding processes activated during CR such as protein ubiquitination and degradation in proteasomes, and autophagy 78. Third, the near absence of MDVs in CR beta cells and up regulation of superoxide scavengers Sod1 and Sod2 strongly suggests ROS generation and degradation of mitochondrial proteins is reduced during CR. Furthermore, previous studies show that CR increases mitochondrial bioenergetic efficiency and reduces oxidative stress accumulation in different systems79 (including in humans80), which is linked to increased mitochondrial protein longevity in aged cells81. Reduced accumulation of oxidative damage (in the form of reactive oxygen species (ROS)) and enhanced bioenergetics of CR beta cells could also explain why these cells secrete less insulin during fasting, as dysregulation of ROS and glycolytic signaling are proposed as causes of basal hyperinsulinemia during diabetes 82. Future experiments will focus on measuring mitochondrial energetics under different basal and stimulated conditions to further understand how CR regulates basal insulin secretion while promoting healthier mitochondria homeostasis in beta cells.The reduced levels of mitophagy observed in CR beta cells are expected to contribute (at least in part) to higher mitochondrial density, while the elevated expression of multiple electron transport chain, cellular respiration, and cristae morphology genes suggest that mitochondrial metabolism and homeostasis are optimized in CR beta cells. This hypothesis is supported by three separate lines of observations. First, our MALDI MS metabolomics experiments reveal normal-to-elevated levels of lipids, cAMP, glucose metabolites, and ADP-ribose \u2013 the later which could explain why CR beta cells accumulate less DNA damage15N-SILAM and MIMS-EM we have previously shown that most mouse beta cells are long-lived while the rest constitutes a sub-population of beta cells that proliferates throughout their lifetime 4. Using this same approach, we show that CR prolongs the longevity of beta cells by reducing the turnover rate of the subpopulation of beta cells that is more proliferation prone, while HFD increases beta cell proliferation (as expected). Strikingly, we also found long-lived beta cells in the HFD setting, thus indicating that some beta cells do not proliferate during long periods of hyperglycemia in vivo. Previous studies have shown that proliferation promotes an immature and less functional beta cell phenotype than non-proliferating beta cells 83, which is also supported by the higher levels of beta cell identity and function markers in CR islets. Importantly, this largely post-mitotic state of CR beta cells could also explain the reduced accumulation of DNA damage, as cell proliferation triggers higher accumulation of genetic mutations and replication-dependent stress that can lead to disease and aging 84.Finally, using In conclusion, CR enhances beta cell health and longevity by upregulating cell identity and energy homeostasis mechanisms while delaying beta cell aging. Therefore, these results offer a molecular footprint of how CR affects beta cells to preserve and/or rescue beta cell dysfunction during aging and T2D.65. Therefore, we cannot distinguish between the effects of recurrent and prolonged fasting periods versus reduced daily calorie intake (without fasting) on beta cell function and heterogeneity. Importantly, recent studies show that combining CR with fasting leads to better metabolic and anti-aging effects 65. Our single cell transcriptomics and GRN reconstructions identify likely regulators of the beta cell phenotype described here. Therefore, future experiments will focus on exposing genetic mouse models  to CR. The 15N-SILAM and MIMS-EM experiments add to previous observations of cellular age mosaicism in somatic tissues, including in the pancreas . Like MALDI MS metabolomics and eTomo, this approach is time consuming and financially expensive . Notably, the nuclear 15N measurements of any cell are variable since heterochromatin-rich domains in the sections analyzed are randomly sampled during MIMS-EM. These compartments tend to have higher density of 15N-DNA and yield higher signal intensities versus DNA \u201cpoor\u201d euchromatin domains 4. Nevertheless, our results confirm previous MIMS-EM results, and now show how dietary interventions such as CR can be used to promote a long-lived beta cell phenotype.Our report shows how CR impacts mouse beta cell heterogeneity, including their in vivo function and molecular and aging signatures. In our experimental setup, CR was efficiently achieved by providing a restricted amount of food before the start of the animal\u2019s active phase. By design, this approach potentializes the metabolic impacts of CR (including the periods of prolonged fasting) by activating circadian rhythm mechanisms involved in nutrient metabolism"]}
-{"representative": "Great interest and promise are held by human pluripotent stem cell (hPSC) technology to generate functional pancreatic beta cells from diabetic patient-derived stem cells to replace the dysfunctional cells, thereby compensating for insulin deficiency and reducing the comorbidities of the disease and its associated financial and social burden on the patient and society. Beta-like cells generated by most current differentiation protocols have blunted functionality compared to their adult human counterparts. The Ca2+ dynamics in stem cell-derived beta-like cells and adult beta cells are summarized in this review, revealing the importance of proper Ca2+ homeostasis in beta-cell function. Consequently, the importance of targeting Ca2+ function in differentiation protocols is suggested to improve current strategies to use hPSCs to generate mature and functional beta-like cells with a comparable glucose-stimulated insulin secretion (GSIS) profile to adult beta cells.Diabetes mellitus is a chronic disease affecting over 500 million adults globally and is mainly categorized as type 1 diabetes mellitus (T1DM), where pancreatic beta cells are destroyed, and type 2 diabetes mellitus (T2DM), characterized by beta cell dysfunction. This review highlights the importance of the divalent cation calcium (Ca The American Diabetes Association (ADA) has classified diabetes into primarily two categories: type 1 diabetes (T1DM) and type 2 diabetes (T2DM) [Diabetes mellitus, commonly known as diabetes, is a collection of chronic and metabolic disorders typically observed with heightened blood glucose levels over an extended period. Insulin deficiency leading to impaired glucose metabolism is widely deemed to be the mechanism for the onset and effect of the disease ,2. The Is (T2DM) . T1DM iss (T2DM) ,5,6. T2Ds (T2DM) . It is ns (T2DM) . Unhealts (T2DM) . Diabetes (T2DM) ,11,12,13T1DM treatment currently involves controlling glycemia through daily insulin supplementation through insulin injections or insulin pumps with integrated glucose monitors ,15. Alth2+)-dependent process. Therefore, defects in calcium signaling could be one of the underlying reasons for the immature and non-functional phenotypes observed in differentiated hPSC-derived pancreatic beta cells in vitro. In this review, we first describe the role of calcium signaling in pancreatic beta cell function and secondly highlight and summarize recent progress on the implications of impaired calcium signaling in defective insulin secretion in hPSC-derived \u03b2 cells, and consequently, how targeting calcium signaling might be a new and interesting strategy to improve in vitro differentiation into functional hPSC-derived pancreatic beta cells for diabetes therapy. The methods used in this review are as follows: First, we carried out a comprehensive search of peer-reviewed original and review articles using the PubMed database and Google Scholar based on a wide range of key words linking the involvement of calcium signaling in insulin secretion, hPSCs, and diabetes. Secondly, the reference section for each selected article was searched to find additional articles to further develop this review.Recent progress in the field of regenerative medicine has focused on the generation of surrogate and transplantable functional pancreatic beta cells from human pluripotent stem cells (hPSCs) to treat diabetes. Patient-specific pluripotent stem cell (PSC)-derived beta cells, also known as autologous PSC-derived beta cells, would help circumvent the inadequate islet supply and/or allogeneic immune rejection, thereby being an unlimited source of beta cells for diabetes therapy. More importantly, patient-specific stem cell-derived beta cells can also be used in vitro to study diabetes-related mutations such as inherited monogenic diabetes as well as disease progression ,25. To t2+ has a critical function in the controlled release of insulin from beta cells.Systemic glycemia is carefully regulated by the precise production and release of insulin by beta cells. The interplay between blood glucose and numerous other secretagogues such as neurotransmitters, hormones, and other compounds regulates this function ,28. As w2+ into the cell. This wave of Ca2+ triggers insulin exocytosis from secretory granules [In the postprandial state, an elevation of blood glucose is detected by beta cells, which in turn take glucose into the cell through glucose transporters (GLUT1 in humans and GLUT2 in rodents). Glycolysis is triggered as glucose is phosphorylated by glucokinase into pyruvate. Pyruvate thus formed is transported into the mitochondria and enters the tricarboxylic acid (TCA) cycle. A cascade of events in the TCA cycle enhances ATP production. This increase in the ATP/ADP ratio within the cell inhibits ATP-sensitive K+ channels, causing membrane depolarization. L-type calcium channels are opened because of this depolarization, leading to an influx of Cagranules ,30.2+ is due to the influx of extracellular Ca2+, several intracellular organelles, including the endoplasmic reticulum (ER), nucleus, Golgi apparatus, and mitochondria, contribute to the regulation of Ca2+ within beta cells [2+ homeostasis in \u03b2-cells is shown in Although a major share of the intracellular Cata cells ,32. A su2+ store, and effects its release [2+ uptake and release are mainly dependent on inositol 1,4,5-triphosphate receptors (IP3R), ryanodine receptors (RyR), and sarco/endoplasmic reticulum Ca2+-ATPase (SERCA).The endoplasmic reticulum performs crucial functions such as protein folding and lipid synthesis, acts as a Ca release . Endopla2+ from the ER through a positive feedback process named \u201ccalcium induced calcium release\u201d (CICR). An increase in cytosolic Ca2+ triggers the opening of RyRs, which leads to an efflux of Ca2+ from the ER into the cytoplasm. The Ca2+ thus released by the ER facilitates the opening of more RyRs, hence amplifying the ER-dependent Ca2+ release [2+ in human beta cells without compromising GSIS activity [RyR receptors release Ca release . Three i release ,36. Know release ,38. Alth release ,40. Addiactivity . RyR stuactivity ,43.2+ from Ca2+-stores and plays a significant role in the release of Ca2+ from the ER [2+ release from the ER. Heightened cytoplasmic Ca2+ levels achieved by the inhibition of SERCA have been shown to accelerate CICR due to the activation of IP3Rs [2Y1, which promoted ER Ca2+ release through IP3Rs, thereby increasing cytoplasmic Ca2+ levels [2+ release is through the activation of the G-protein-coupled receptor GPR40 by free fatty acids. Fatty acid binding to GPR40 appears to activate the G\u03b1q/11-protein complex, leading to the production of IP3 and subsequent ER Ca2+ release. However, studies have also attributed the production of diacylglycerol as a determining factor in the second phase of insulin secretion [2+ release from the ER [IP3R are IP3-sensitive receptors found on the ER membrane of many cell types, such as the cerebellum, smooth muscles, cardiac and skeletal muscle, as well as beta cells. IP3 is formed by the activation of phospholipase C, which hydrolyzes phosphatidylinositol bisphosphate (PIP2) into IP3 and diacylglycerol. IP3 is capable of mobilizing Cam the ER ,45. Glucm the ER . Studiesof IP3Rs . CICR, iof IP3Rs . In rode+ levels . Anotherecretion ,51,52,53m the ER . Geneticm the ER .2+ released from the ER is sequestered back into the ER lumen through the activity of SERCA pumps in an ATP-dependent manner. This helps maintain a resting cytosolic Ca2+ concentration of 25\u2013100 nM and a high ER Ca2+ concentration (200\u2013500 \u00b5M). Alternative splicing of the genes encoding SERCA generates fourteen different isoforms of SERCA. In beta cells, the predominant isoforms are SERCA2b and SERCA3 [2+ reuptake [Cad SERCA3 ,57,58. Treuptake . The impreuptake . SERCA dreuptake .2+ mobilizing messenger produced by the ADP-ribosyl cyclase CD38 by a base exchange reaction between nicotinamide adenine dinucleotide phosphate (NADP) and nicotinic acid [2+ spiking, proving NAADP to be an influential player in glucose-mediated insulin release [2+ release from acidic compartments such as lysosomes and insulin granules [2+. Their main function is the degradation of macromolecules, but they also play a role in Ca2+ regulation in cells. The nanomolecular concentration of NAADP triggers lysosomal Ca2+ release, while micromolecular NAADP concentrations inhibit Ca2+ release [2+ from the lysosome through two-pore channels (TPCs), particularly TPC2. However, recent studies have questioned TPC2 as the major NAADP receptor and suggested TPC1 as the main NAADP receptor instead. Although TPC1 and TPC2 are both known to show high sensitivity to NAADP, studies on knockout mouse models have revealed conflicting results, confounding the identity of NAADP\u2019s primary target receptor [Nicotinic acid adenine dinucleotide phosphate (NAADP) is a Canic acid . Elevatenic acid ,64. In pnic acid . Inhibit release ,67. The granules . Lysosom release . NAADP ireceptor ,69,70,71receptor .2+ second messenger, cADPR, by the cyclization of beta-nicotinamide adenine dinucleotide. Early studies have suggested that glucose stimulation generates cADPR in pancreatic islets. Follow-up studies by the same group observed that overexpression of CD38 in transgenic mice increased glucose and ketoisocaproate-mediated insulin release, while this effect was impaired in CD38 knockout mice [2+ release from the ER through RyRs. However, evidence suggests that cADPR does not directly interact with RyR, indicating the presence of accessory proteins that act as links between cADPR and RyR. FK506-binding protein 12.6 (FKBP12.6), calmodulin, and GAPDH have been proposed as potential accessory proteins that evoke Ca2+ release by cADPR [2+ from the ER is currently unknown. cADPR has also been shown to trigger Ca2+ influx and subsequent insulin secretion by activating the plasma membrane channel TRMP2 [2+-releasing messenger, its Ca2+ mobilizing effects are controversial since numerous studies have failed to find an action of cADPR in beta cells [Adenylyl cyclases such as CD38 are also responsible for the production of another Caout mice ,74,75. cby cADPR ,77,78,79el TRMP2 . Althougta cells ,81,82. Ita cells . Further2+ influx and insulin exocytosis. A close association between Ca2+ homeostasis and beta cell function has been connected to mitochondrial function [2+ showed impaired insulin response to high glucose challenges, thereby linking the tight regulation of Ca2+ and mitochondrial energy metabolism [2+, namely, pyruvate dehydrogenase, NAD+-isocitrate dehydrogenase, and 2-oxoglutarate dehydrogenase, and serve as crucial factors for insulin release in beta cells. The influx of Ca2+ into the mitochondria is believed to be essential for the stimulation of Ca2+-dependent dehydrogenases of the TCA cycle to control ATP production under increased glucose conditions [Another organelle crucial for effective GSIS is the mitochondria. The major energy-producing mechanism of the mitochondria is the TCA cycle, where the electron transport chain produces ATP. ATP generated by mitochondria promotes plasma membrane depolarization, leading to Cafunction . Studiestabolism ,86. Threnditions ,87,88,892+ entry into the mitochondria occurs in the outer mitochondrial membrane and inner mitochondrial membrane through voltage-dependent anion channels (VDACs) and mitochondrial Ca2+ uniporters (MCU), respectively [2+ uptake, leading to impaired ATP production and insulin secretion. Moreover, the expression of respiratory chain complexes, mitochondrial metabolic activity, and oxygen consumption were also lowered. These studies underlined the importance of MCU-mediated Ca2+ regulation for sustained ATP production and metabolism-secretion coupling in beta cells [2+ uptake and GSIS were impaired [2+ by beta cell mitochondria have been implicated in the tone and frequency of cytosolic Ca2+ oscillations and might perhaps contribute to insulin release pulsatility [2+ has also been linked to the activation of the inner membrane channel, the mitochondrial permeability transition pore (PTP). PTP is believed to perform two distinct roles in beta cells, depending on its activation or inhibition. The activation of PTP is required to promote glucose-dependent insulin secretion, while its inhibition is necessary to protect against glucotoxicity and hypoxia [2+ extrusion from mitochondria is also key to mitochondrial and cell function. Persistent accumulation of Ca2+ in the matrix space can cause Ca2+ overload in the mitochondria, leading to the opening of PTPs and, thereby, initiating cell death signals [2+ homeostasis, Ca2+ extrusion from the mitochondria occurs via the Na2+/Ca2+ exchanger (NCLX) [2+ responses and the rate of GSIS during the first phase of insulin secretion [Caectively ,91. Expeta cells ,93. Simiimpaired . The uptsatility ,95. Mito hypoxia ,96,97,98 signals . To mainr (NCLX) . Studiesecretion .Insulin-positive beta cells are first seen around embryonic day 13.5 in mice and weeks 8\u20139 in humans. During the earlier days of fetal growth, endocrine progenitor cells differentiate into beta cells. However, during the late neonatal stages, beta cells are formed by replication ,103,104.ATP channel-opening drug, reduced the replicative capability of beta cells, thereby suggesting that the requirement for the closure of KATP channels and subsequent depolarization is critical for beta cell replication. Reciprocally, when mice were injected with the KATP channel-blocking drug glyburide, beta cell proliferation was rescued. Therefore, Ca2+ influx appears to play an important role in beta cell replication [2+ and calcium channels in beta cell replication.A study revealed that a signaling pathway linking membrane depolarization was a key factor for beta cell replication in mice. Diazoxide, a Klication . Another2+ concentrations switches on calcineurin, which in turn dephosphorylates NFAT. This leads to the translocation of NFAT into the nucleus and the transcription of multiple genes responsible for beta cell function, glucose sensing, and proliferation [NFATC1, NFATC2, NFATC3, and NFATC4 are present, with NFATC2 and NFATC3 being the most abundant [2+/calmodulin-dependent kinase (CaMK). A study observed that CaMK4 inhibition eliminated beta cell proliferation, whereas constitutively active CaMK4 expression increased beta cell proliferation via a cAMP response element binding protein (CREB) and insulin receptor substrate 2 (IRS-2) mechanism [A known mechanism of beta cell replication is via calcineurin/nuclear factor of activated T-cells (NFAT). Calcineurin/NFAT signaling is central to the regulation of neonatal pancreatic development in mice and human islets. NFATs are activated by the serine/threonine phosphatase, calcineurin. Increasing Caferation ,107,108.abundant . In mousabundant . Interesabundant ,112. Anoabundant . The calabundant ,114. Betechanism .2+ handling and beta cell survival in pancreatic beta cells. High glucose enhances beta cell survival in a Ca2+-mediated manner. In cultured mouse islet beta cells and MIN6 insulinoma cells, a three-fold decrease in apoptosis was found in the presence of high glucose concentrations compared to low glucose concentrations. Blocking of the L-type Ca2+ channel with nifidepine reversed the protective effects of high glucose, suggesting the requirement of Ca2+ influx for beta cell survival at high glucose concentrations [2+ in beta cells, along with an insulin dose-dependent decrease in SERCA2 expression. Prolonged high insulin exposure also triggered apoptosis in beta cells through Caspase-12  and a known mediator of ER stress) and correlated with an increase in intracellular Ca2+. This suggests that prolonged insulin exposure can disrupt ER function and induce apoptosis in beta cells. However, further studies need to be undertaken to deduce the mechanisms of these processes and the interplay between the protective and destructive effects of high glucose and insulin, respectively [2+ depletion-mediated ER stress has been associated with beta cell apoptosis in numerous studies. A study reported that Ca2+ depletion from the ER through dysfunctional SERCA2b, IP3Rs, and RyRs led to beta cell death and suggested a calpain-2-mediated pathway as the mechanism. The authors discussed the possibility of pharmacological modulations of the ER channels as a potential for beta cell survival [2+ depletion and increase cytosolic Ca2+ in beta cells. This led to beta cell death, marked by an increase in caspase-3 and caspase-7 activity levels. In INS-1 cells, cytokine-mediated beta cell apoptosis was inhibited by treating the cells with the calcium-modulating compounds dantrolene and sitagliptin, which restored the function of SERCA and the ER Ca2+ pump and decreased the levels of the pro-apoptotic protein thioredoxin-interacting protein (TXNIP) [2+ homeostasis. Heightened palmitate levels increase oxidative conditions, leading to Ca2+ depletion from the ER, which interferes with chaperones and results in misfolded proteins. This triggers a series of events where cytosolic and mitochondrial Ca2+ homeostasis is disrupted, thereby leading to beta cell apoptosis [A multitude of studies have found a close association between Catrations . A recenectively . Ca2+ desurvival . Inflamm (TXNIP) . Free fapoptosis ,121. 2+ in beta cell survival was seen when CAMK4 was shown to regulate apoptosis. Constitutively active CAMK4 was shown to significantly improve beta cell survival as a reduction in caspase-3 and caspase-7 was observed. Moreover, increased apoptosis was observed in the presence of the dominant negative form of CAMK4. The authors proposed CAMK4 and its association with CREB as the primary mechanisms for improved beta cell survival. The activation of CAMK4 under intracellular Ca2+ elevations led to the upregulation of IRS-2 via CREB, leading to the regulation of beta cell survivability [Calcineurin-dependent mechanisms have also been implicated in beta cell viability. Pharmacological inhibition of calcineurin is necessary to prevent organ transplant rejection and is associated with post-transplant beta cell failure. A study on human islets revealed that beta cell apoptosis was significantly increased in the presence of the calcineurin inhibitor tacrolimus. The mechanism of these effects linked calcineurin to IRS-2 and the phosphoinositide-3-kinase protein kinase B/Akt (PI3K-PKB/Akt) pathway. It was suggested that the effect of calcineurin on IRS-2 was also mediated partly through NFAT . More evvability .2+ and its signaling pathways are critical to the proper function and survivability of pancreatic beta cells. As important as Ca2+ is for beta cell function, survival, and proliferation, it also plays an important role in insulin production and secretion. A plethora of studies have strongly linked Ca2+ dysfunction to diabetes in both human and animal models [As clearly highlighted in the earlier sections of this review, Cal models ,126,127.Abcc8 (\u2212/\u2212Abcc8 mice), a key component of the beta cell KATP channel, showed sustained membrane depolarization, leading to continued elevation of Ca2+ associated with dysfunctional genes involved in Ca2+ transport, signaling, and beta cell maintenance. Additionally, beta cells were observed to dedifferentiate and transdifferentiate into pancreatic polypeptide cells, as seen through the increased expression of the Aldh1a3 gene (a marker for dedifferentiating beta cells). Interestingly, the expression of Aldh1a3 was reduced by treating the cells with Ca2+ channel blockers, solidifying the link between sustained depolarization and beta cell functional and identity loss [2+ influx, and calcineurin signaling that could also be reversed by the normalization of glycemia [HNF1A gene, whose deficiency impaired a network of genes crucial to calcium signaling, GSIS, and beta cell fate. These cells were then target-differentiated into beta cells. Stem cell-derived beta cells from HNF1A knockouts showed a reduction in the SYT13 gene, which is responsible for calcium-regulated granule exocytosis. HNF1A deficiency also showed a developmental bias toward the generation of alpha cells, as an upregulation of glucagon was observed in the knockout cells. The observations from the knockout cells were comparable with those from the induced pluripotent stem cell (iPSC) line with HNF1A-MODY patient-specific mutations (R200Q) [2+ influx. These pools of insulin granules were absent in T2DM donors and INS-1 cells mimicking diabetes, implicating the role of these Ca2+-triggered granules in the loss of rapid first-phase insulin secretion seen in T2DM patients [v\u03b23 (a voltage-gated Ca2+ channel subunit) expression, coupled with impaired calcium signaling and insulin secretion, and these effects were reduced in high-fat diet-induced diabetes in Cav\u03b23 deficient mice. Overexpression of Cav\u03b23 in human islets also showed impaired GSIS [Studies have suggested the deleterious effects of long-term activation of calcium signaling pathways in beta cells. Calcineurin is a vital component of the calcineurin/NFAT pathway, which is critical to beta cell replication. However, chronic depolarization of beta cells increased calcineurin activity, which in turn reduced glucose tolerance, insulin secretion, and beta cell replication in mouse models . Anotherity loss . Anotherglycemia . A more  (R200Q) . High-repatients . Diabetired GSIS ,133.2+ overload was the main mechanism of glucolipotoxicity-mediated apoptosis and dysfunction, which was inhibited by compounds that decreased glucolipotoxicity-mediated Ca2+ influx into the cells [2+ [db/db mice and cultured human islets [2+ stores in INS-1 cells [Glucolipotoxicity is an umbrella term to describe the detrimental effects of elevated glucose and fatty acid levels on beta cell function and survival. Glucolipotoxicity-induced beta cell failure and subsequently T2DM are associated with calcium dysregulation and ER stress, along with other non-calcium-related complications. A phenotypic screening study of compounds showed that glucolipotoxicity stress had a close association with calcium flux modulation and apoptosis. It was suggested that a Cahe cells . The ubihe cells ,137,138.ells [2+ . A phaseells [2+ . Free fan islets ,142. The-1 cells .As discussed in the introduction section above, insulin-secreting beta cells from the pancreatic islet of Langerhans play a crucial role in the body by maintaining glucose homeostasis. It is well established that destruction or loss of beta cell mass leading to a negative impact on effective insulin secretion has emerged as the main pathogenic factor in both T1DM and T2DM . CurrentDirected differentiation protocols are created from an extensive study of the developmental phases of cell types. The conversion of pluripotent stem cells into target cells is achieved by the timely addition of small molecules and growth factors in a stagewise manner that mimics the embryonic development of the desired cell type. The success of the protocol is usually determined by the extent to which these cells mirror their in vivo counterparts with respect to functional maturity and efficiency. Indeed, over the past decade, these strategies have been applied to differentiate human iPSCs and ESCs into pancreatic beta cells and islets. Pioneering work from the Melton laboratory at Harvard University has paved the way for protocols that generate beta cells with moderate efficiency. However, multiple labs have published protocols with more optimized culture conditions for differentiation media and small molecules, with the resulting protocols applicable to multiple iPSC cell lines for improved differentiation efficiency and beta cell functionality ,150,151.2+ concentration, indicating that increased Ca2+ influx is a cellular function required for GSIS. Since evidence has highlighted that Ca2+ dysregulation in beta cells has a key role in diabetes, it is possible that functionally defective Ca2+ dynamics play a key role in the generation of immature and non-functionally differentiated hPSC-derived beta cells in vitro. A study used the human ESC (hESC) cell line H1 to create a seven-stage protocol to generate beta cells. The cells thus obtained expressed key markers of mature beta cells and displayed GSIS capabilities. However, as compared to adult beta cells, the differentiated cells showed reduced amplitudes and a slower time to peak of the Ca2+ signals. Sustained Ca2+ transients were observed even after the glucose stimulation ceased, a marked difference from mature beta cells. Similar effects were seen with respect to insulin release on glucose challenges, in which insulin secretion did not return to pretreatment levels and KCl-mediated insulin release was blunted. Direct depolarization with high KCl concentrations revealed the presence of voltage-gated Ca2+ channels and normal Ca2+ efflux pumps, thereby suggesting that the generated beta-like cells had functional immaturity compared to adult beta cells [2+ into the ER, thereby impairing ER function and thereby Ca2+ homeostasis in beta cells [v subunit gamma 4 (Cav\u03b34) in a CaMKII-mediated manner in controlling beta cell glucose homeostasis [2+ levels and ATP production, leading to impaired GSIS in islets [2+ handling in the differentiating cells and might explain the difficulty in generating beta cells functionally similar to adult human beta cells. One cannot assume that impaired calcium signaling is the major contributor to the formation of immature insulin-producing cells from iPSCs. Impaired expression of genes responsible for potassium channel regulation and mitochondrial function was also found in immature iPSC-derived beta-like cells [Beta cells facilitate GSIS through increased cytosolic Cata cells . Anotherta cells . The autta cells ,156,157.ta cells . A threeta cells . MafA, ata cells ,160,161.ta cells . A receneostasis . Insulineostasis . Anothereostasis . Studiesn islets . Interesn islets . The altke cells ,26. Perh2+ channels in the eBCs. Transcriptome analysis comparing non-enriched clusters and eBCs showed an upregulation of the SCGN gene, which is responsible for calcium sensing. Moreover, genes upregulated in neonatal mouse and human fetal beta cells were seen to be upregulated in the immature beta cells, providing further evidence that immature iPSC-derived beta cells resemble fetal cells more than adult beta cells [Nevertheless, more recent publications have generated beta cells with comparable functionality to human islets by incorporating enrichment and reaggregation of late-stage differentiated beta-like cells for better GSIS functionality ,166. Cel2+ handling in the maturation of beta cells during their development phase in in vitro conditions, suggesting that the calcium signaling pathway is an important puzzle piece in the generation of iPSC-derived pancreatic beta-like cells. Careful considerations need to be made in the differentiation protocols to include small molecules and growth factors in the differentiation media that target the calcium signaling pathways and their components in a timely manner to generate fully functional beta cells in vitro. Current strategies have been built upon accumulating knowledge over the past decade to produce functional beta cells, and more research needs to be performed to generate high-quality iPSC-derived beta cells that resemble human beta cells.Taken together, these studies that compare the differences between iPSC-derived immature beta-like cells and iPSC-derived beta cells functionally closer to human beta cells show the importance of appropriate CaHNF1A gene on the onset of MODY. CRISPR/Cas9 was used to generate HNF1A mutations in the hESC Mel1, which was subsequently differentiated into beta cells. The resulting beta cells were observed to have impaired GSIS and intracellular calcium levels [ATP channel in congenital hyperinsulinism. These cells were target-differentiated into beta cells and used as controls to study the effect of the mutation on beta cell function [WFS1) in IPSCs generated from a patient with Wolfram syndrome. The IPSCs were differentiated into beta cells, and it was observed that the corrected WFS1 IPSC-derived beta cells showed strong dynamic insulin secretion and reversed streptozocin-induced diabetes following transplantation into mice [An important tool to better understand diabetes and its progression is the integration of gene editing technology (CRISPR/Cas9) with stem cell technology. Several studies have reported the use of CRISPR/Cas9 to create stem cell-based disease models of monogenetic diabetes, MODY, and neonatal diabetes, among others, to better understand the mechanisms of disease progression ,169,170.m levels . Moreovem levels . A studynto mice . Thus, C2+ in the functioning of pancreatic beta cells. The role of several Ca2+-handling organelles have been discussed through recent studies, which highlight that the disruption of key Ca2+ pathways could lead to beta-cell dysfunction and thereby play a role in the onset of diabetes. We examined the key advances made in the field of stem cell technology in the study of diabetes. A comparative study of Ca2+ handling characteristics of stem cell-derived beta-like cells and their adult human counterparts was performed, showcasing the pitfalls of the current differentiation protocols and underlining key research strategies targeting Ca2+ dynamics to improve the identity and functionality of directed stem cell differentiation. Massive strides are being made to achieve the goal of generating functional beta-like cells from stem cells. Advances in the efficiency of iPSC differentiation protocols can close the gaps in the structural and functional differences between stem cell-derived pancreatic and human islets. This opens the door to fully using stem cell-derived beta cells for drug screening due to their enhanced kinetics, and the mechanisms of beta cell failure can also be studied, paving the way to greatly improve our knowledge of the intricate aspects of diabetes and its treatment, including transplantation in patients with diabetes [In this review, we emphasize the role of Cadiabetes ,166,172.", "texts": ["Great interest and promise are held by human pluripotent stem cell (hPSC) technology to generate functional pancreatic beta cells from diabetic patient-derived stem cells to replace the dysfunctional cells, thereby compensating for insulin deficiency and reducing the comorbidities of the disease and its associated financial and social burden on the patient and society. Beta-like cells generated by most current differentiation protocols have blunted functionality compared to their adult human counterparts. The Ca2+ dynamics in stem cell-derived beta-like cells and adult beta cells are summarized in this review, revealing the importance of proper Ca2+ homeostasis in beta-cell function. Consequently, the importance of targeting Ca2+ function in differentiation protocols is suggested to improve current strategies to use hPSCs to generate mature and functional beta-like cells with a comparable glucose-stimulated insulin secretion (GSIS) profile to adult beta cells.Diabetes mellitus is a chronic disease affecting over 500 million adults globally and is mainly categorized as type 1 diabetes mellitus (T1DM), where pancreatic beta cells are destroyed, and type 2 diabetes mellitus (T2DM), characterized by beta cell dysfunction. This review highlights the importance of the divalent cation calcium (Ca The American Diabetes Association (ADA) has classified diabetes into primarily two categories: type 1 diabetes (T1DM) and type 2 diabetes (T2DM) [Diabetes mellitus, commonly known as diabetes, is a collection of chronic and metabolic disorders typically observed with heightened blood glucose levels over an extended period. Insulin deficiency leading to impaired glucose metabolism is widely deemed to be the mechanism for the onset and effect of the disease ,2. The Is (T2DM) . T1DM iss (T2DM) ,5,6. T2Ds (T2DM) . It is ns (T2DM) . Unhealts (T2DM) . Diabetes (T2DM) ,11,12,13T1DM treatment currently involves controlling glycemia through daily insulin supplementation through insulin injections or insulin pumps with integrated glucose monitors ,15. Alth2+)-dependent process. Therefore, defects in calcium signaling could be one of the underlying reasons for the immature and non-functional phenotypes observed in differentiated hPSC-derived pancreatic beta cells in vitro. In this review, we first describe the role of calcium signaling in pancreatic beta cell function and secondly highlight and summarize recent progress on the implications of impaired calcium signaling in defective insulin secretion in hPSC-derived \u03b2 cells, and consequently, how targeting calcium signaling might be a new and interesting strategy to improve in vitro differentiation into functional hPSC-derived pancreatic beta cells for diabetes therapy. The methods used in this review are as follows: First, we carried out a comprehensive search of peer-reviewed original and review articles using the PubMed database and Google Scholar based on a wide range of key words linking the involvement of calcium signaling in insulin secretion, hPSCs, and diabetes. Secondly, the reference section for each selected article was searched to find additional articles to further develop this review.Recent progress in the field of regenerative medicine has focused on the generation of surrogate and transplantable functional pancreatic beta cells from human pluripotent stem cells (hPSCs) to treat diabetes. Patient-specific pluripotent stem cell (PSC)-derived beta cells, also known as autologous PSC-derived beta cells, would help circumvent the inadequate islet supply and/or allogeneic immune rejection, thereby being an unlimited source of beta cells for diabetes therapy. More importantly, patient-specific stem cell-derived beta cells can also be used in vitro to study diabetes-related mutations such as inherited monogenic diabetes as well as disease progression ,25. To t2+ has a critical function in the controlled release of insulin from beta cells.Systemic glycemia is carefully regulated by the precise production and release of insulin by beta cells. The interplay between blood glucose and numerous other secretagogues such as neurotransmitters, hormones, and other compounds regulates this function ,28. As w2+ into the cell. This wave of Ca2+ triggers insulin exocytosis from secretory granules [In the postprandial state, an elevation of blood glucose is detected by beta cells, which in turn take glucose into the cell through glucose transporters (GLUT1 in humans and GLUT2 in rodents). Glycolysis is triggered as glucose is phosphorylated by glucokinase into pyruvate. Pyruvate thus formed is transported into the mitochondria and enters the tricarboxylic acid (TCA) cycle. A cascade of events in the TCA cycle enhances ATP production. This increase in the ATP/ADP ratio within the cell inhibits ATP-sensitive K+ channels, causing membrane depolarization. L-type calcium channels are opened because of this depolarization, leading to an influx of Cagranules ,30.2+ is due to the influx of extracellular Ca2+, several intracellular organelles, including the endoplasmic reticulum (ER), nucleus, Golgi apparatus, and mitochondria, contribute to the regulation of Ca2+ within beta cells [2+ homeostasis in \u03b2-cells is shown in Although a major share of the intracellular Cata cells ,32. A su2+ store, and effects its release [2+ uptake and release are mainly dependent on inositol 1,4,5-triphosphate receptors (IP3R), ryanodine receptors (RyR), and sarco/endoplasmic reticulum Ca2+-ATPase (SERCA).The endoplasmic reticulum performs crucial functions such as protein folding and lipid synthesis, acts as a Ca release . Endopla2+ from the ER through a positive feedback process named \u201ccalcium induced calcium release\u201d (CICR). An increase in cytosolic Ca2+ triggers the opening of RyRs, which leads to an efflux of Ca2+ from the ER into the cytoplasm. The Ca2+ thus released by the ER facilitates the opening of more RyRs, hence amplifying the ER-dependent Ca2+ release [2+ in human beta cells without compromising GSIS activity [RyR receptors release Ca release . Three i release ,36. Know release ,38. Alth release ,40. Addiactivity . RyR stuactivity ,43.2+ from Ca2+-stores and plays a significant role in the release of Ca2+ from the ER [2+ release from the ER. Heightened cytoplasmic Ca2+ levels achieved by the inhibition of SERCA have been shown to accelerate CICR due to the activation of IP3Rs [2Y1, which promoted ER Ca2+ release through IP3Rs, thereby increasing cytoplasmic Ca2+ levels [2+ release is through the activation of the G-protein-coupled receptor GPR40 by free fatty acids. Fatty acid binding to GPR40 appears to activate the G\u03b1q/11-protein complex, leading to the production of IP3 and subsequent ER Ca2+ release. However, studies have also attributed the production of diacylglycerol as a determining factor in the second phase of insulin secretion [2+ release from the ER [IP3R are IP3-sensitive receptors found on the ER membrane of many cell types, such as the cerebellum, smooth muscles, cardiac and skeletal muscle, as well as beta cells. IP3 is formed by the activation of phospholipase C, which hydrolyzes phosphatidylinositol bisphosphate (PIP2) into IP3 and diacylglycerol. IP3 is capable of mobilizing Cam the ER ,45. Glucm the ER . Studiesof IP3Rs . CICR, iof IP3Rs . In rode+ levels . Anotherecretion ,51,52,53m the ER . Geneticm the ER .2+ released from the ER is sequestered back into the ER lumen through the activity of SERCA pumps in an ATP-dependent manner. This helps maintain a resting cytosolic Ca2+ concentration of 25\u2013100 nM and a high ER Ca2+ concentration (200\u2013500 \u00b5M). Alternative splicing of the genes encoding SERCA generates fourteen different isoforms of SERCA. In beta cells, the predominant isoforms are SERCA2b and SERCA3 [2+ reuptake [Cad SERCA3 ,57,58. Treuptake . The impreuptake . SERCA dreuptake .2+ mobilizing messenger produced by the ADP-ribosyl cyclase CD38 by a base exchange reaction between nicotinamide adenine dinucleotide phosphate (NADP) and nicotinic acid [2+ spiking, proving NAADP to be an influential player in glucose-mediated insulin release [2+ release from acidic compartments such as lysosomes and insulin granules [2+. Their main function is the degradation of macromolecules, but they also play a role in Ca2+ regulation in cells. The nanomolecular concentration of NAADP triggers lysosomal Ca2+ release, while micromolecular NAADP concentrations inhibit Ca2+ release [2+ from the lysosome through two-pore channels (TPCs), particularly TPC2. However, recent studies have questioned TPC2 as the major NAADP receptor and suggested TPC1 as the main NAADP receptor instead. Although TPC1 and TPC2 are both known to show high sensitivity to NAADP, studies on knockout mouse models have revealed conflicting results, confounding the identity of NAADP\u2019s primary target receptor [Nicotinic acid adenine dinucleotide phosphate (NAADP) is a Canic acid . Elevatenic acid ,64. In pnic acid . Inhibit release ,67. The granules . Lysosom release . NAADP ireceptor ,69,70,71receptor .2+ second messenger, cADPR, by the cyclization of beta-nicotinamide adenine dinucleotide. Early studies have suggested that glucose stimulation generates cADPR in pancreatic islets. Follow-up studies by the same group observed that overexpression of CD38 in transgenic mice increased glucose and ketoisocaproate-mediated insulin release, while this effect was impaired in CD38 knockout mice [2+ release from the ER through RyRs. However, evidence suggests that cADPR does not directly interact with RyR, indicating the presence of accessory proteins that act as links between cADPR and RyR. FK506-binding protein 12.6 (FKBP12.6), calmodulin, and GAPDH have been proposed as potential accessory proteins that evoke Ca2+ release by cADPR [2+ from the ER is currently unknown. cADPR has also been shown to trigger Ca2+ influx and subsequent insulin secretion by activating the plasma membrane channel TRMP2 [2+-releasing messenger, its Ca2+ mobilizing effects are controversial since numerous studies have failed to find an action of cADPR in beta cells [Adenylyl cyclases such as CD38 are also responsible for the production of another Caout mice ,74,75. cby cADPR ,77,78,79el TRMP2 . Althougta cells ,81,82. Ita cells . Further2+ influx and insulin exocytosis. A close association between Ca2+ homeostasis and beta cell function has been connected to mitochondrial function [2+ showed impaired insulin response to high glucose challenges, thereby linking the tight regulation of Ca2+ and mitochondrial energy metabolism [2+, namely, pyruvate dehydrogenase, NAD+-isocitrate dehydrogenase, and 2-oxoglutarate dehydrogenase, and serve as crucial factors for insulin release in beta cells. The influx of Ca2+ into the mitochondria is believed to be essential for the stimulation of Ca2+-dependent dehydrogenases of the TCA cycle to control ATP production under increased glucose conditions [Another organelle crucial for effective GSIS is the mitochondria. The major energy-producing mechanism of the mitochondria is the TCA cycle, where the electron transport chain produces ATP. ATP generated by mitochondria promotes plasma membrane depolarization, leading to Cafunction . Studiestabolism ,86. Threnditions ,87,88,892+ entry into the mitochondria occurs in the outer mitochondrial membrane and inner mitochondrial membrane through voltage-dependent anion channels (VDACs) and mitochondrial Ca2+ uniporters (MCU), respectively [2+ uptake, leading to impaired ATP production and insulin secretion. Moreover, the expression of respiratory chain complexes, mitochondrial metabolic activity, and oxygen consumption were also lowered. These studies underlined the importance of MCU-mediated Ca2+ regulation for sustained ATP production and metabolism-secretion coupling in beta cells [2+ uptake and GSIS were impaired [2+ by beta cell mitochondria have been implicated in the tone and frequency of cytosolic Ca2+ oscillations and might perhaps contribute to insulin release pulsatility [2+ has also been linked to the activation of the inner membrane channel, the mitochondrial permeability transition pore (PTP). PTP is believed to perform two distinct roles in beta cells, depending on its activation or inhibition. The activation of PTP is required to promote glucose-dependent insulin secretion, while its inhibition is necessary to protect against glucotoxicity and hypoxia [2+ extrusion from mitochondria is also key to mitochondrial and cell function. Persistent accumulation of Ca2+ in the matrix space can cause Ca2+ overload in the mitochondria, leading to the opening of PTPs and, thereby, initiating cell death signals [2+ homeostasis, Ca2+ extrusion from the mitochondria occurs via the Na2+/Ca2+ exchanger (NCLX) [2+ responses and the rate of GSIS during the first phase of insulin secretion [Caectively ,91. Expeta cells ,93. Simiimpaired . The uptsatility ,95. Mito hypoxia ,96,97,98 signals . To mainr (NCLX) . Studiesecretion .Insulin-positive beta cells are first seen around embryonic day 13.5 in mice and weeks 8\u20139 in humans. During the earlier days of fetal growth, endocrine progenitor cells differentiate into beta cells. However, during the late neonatal stages, beta cells are formed by replication ,103,104.ATP channel-opening drug, reduced the replicative capability of beta cells, thereby suggesting that the requirement for the closure of KATP channels and subsequent depolarization is critical for beta cell replication. Reciprocally, when mice were injected with the KATP channel-blocking drug glyburide, beta cell proliferation was rescued. Therefore, Ca2+ influx appears to play an important role in beta cell replication [2+ and calcium channels in beta cell replication.A study revealed that a signaling pathway linking membrane depolarization was a key factor for beta cell replication in mice. Diazoxide, a Klication . Another2+ concentrations switches on calcineurin, which in turn dephosphorylates NFAT. This leads to the translocation of NFAT into the nucleus and the transcription of multiple genes responsible for beta cell function, glucose sensing, and proliferation [NFATC1, NFATC2, NFATC3, and NFATC4 are present, with NFATC2 and NFATC3 being the most abundant [2+/calmodulin-dependent kinase (CaMK). A study observed that CaMK4 inhibition eliminated beta cell proliferation, whereas constitutively active CaMK4 expression increased beta cell proliferation via a cAMP response element binding protein (CREB) and insulin receptor substrate 2 (IRS-2) mechanism [A known mechanism of beta cell replication is via calcineurin/nuclear factor of activated T-cells (NFAT). Calcineurin/NFAT signaling is central to the regulation of neonatal pancreatic development in mice and human islets. NFATs are activated by the serine/threonine phosphatase, calcineurin. Increasing Caferation ,107,108.abundant . In mousabundant . Interesabundant ,112. Anoabundant . The calabundant ,114. Betechanism .2+ handling and beta cell survival in pancreatic beta cells. High glucose enhances beta cell survival in a Ca2+-mediated manner. In cultured mouse islet beta cells and MIN6 insulinoma cells, a three-fold decrease in apoptosis was found in the presence of high glucose concentrations compared to low glucose concentrations. Blocking of the L-type Ca2+ channel with nifidepine reversed the protective effects of high glucose, suggesting the requirement of Ca2+ influx for beta cell survival at high glucose concentrations [2+ in beta cells, along with an insulin dose-dependent decrease in SERCA2 expression. Prolonged high insulin exposure also triggered apoptosis in beta cells through Caspase-12  and a known mediator of ER stress) and correlated with an increase in intracellular Ca2+. This suggests that prolonged insulin exposure can disrupt ER function and induce apoptosis in beta cells. However, further studies need to be undertaken to deduce the mechanisms of these processes and the interplay between the protective and destructive effects of high glucose and insulin, respectively [2+ depletion-mediated ER stress has been associated with beta cell apoptosis in numerous studies. A study reported that Ca2+ depletion from the ER through dysfunctional SERCA2b, IP3Rs, and RyRs led to beta cell death and suggested a calpain-2-mediated pathway as the mechanism. The authors discussed the possibility of pharmacological modulations of the ER channels as a potential for beta cell survival [2+ depletion and increase cytosolic Ca2+ in beta cells. This led to beta cell death, marked by an increase in caspase-3 and caspase-7 activity levels. In INS-1 cells, cytokine-mediated beta cell apoptosis was inhibited by treating the cells with the calcium-modulating compounds dantrolene and sitagliptin, which restored the function of SERCA and the ER Ca2+ pump and decreased the levels of the pro-apoptotic protein thioredoxin-interacting protein (TXNIP) [2+ homeostasis. Heightened palmitate levels increase oxidative conditions, leading to Ca2+ depletion from the ER, which interferes with chaperones and results in misfolded proteins. This triggers a series of events where cytosolic and mitochondrial Ca2+ homeostasis is disrupted, thereby leading to beta cell apoptosis [A multitude of studies have found a close association between Catrations . A recenectively . Ca2+ desurvival . Inflamm (TXNIP) . Free fapoptosis ,121. 2+ in beta cell survival was seen when CAMK4 was shown to regulate apoptosis. Constitutively active CAMK4 was shown to significantly improve beta cell survival as a reduction in caspase-3 and caspase-7 was observed. Moreover, increased apoptosis was observed in the presence of the dominant negative form of CAMK4. The authors proposed CAMK4 and its association with CREB as the primary mechanisms for improved beta cell survival. The activation of CAMK4 under intracellular Ca2+ elevations led to the upregulation of IRS-2 via CREB, leading to the regulation of beta cell survivability [Calcineurin-dependent mechanisms have also been implicated in beta cell viability. Pharmacological inhibition of calcineurin is necessary to prevent organ transplant rejection and is associated with post-transplant beta cell failure. A study on human islets revealed that beta cell apoptosis was significantly increased in the presence of the calcineurin inhibitor tacrolimus. The mechanism of these effects linked calcineurin to IRS-2 and the phosphoinositide-3-kinase protein kinase B/Akt (PI3K-PKB/Akt) pathway. It was suggested that the effect of calcineurin on IRS-2 was also mediated partly through NFAT . More evvability .2+ and its signaling pathways are critical to the proper function and survivability of pancreatic beta cells. As important as Ca2+ is for beta cell function, survival, and proliferation, it also plays an important role in insulin production and secretion. A plethora of studies have strongly linked Ca2+ dysfunction to diabetes in both human and animal models [As clearly highlighted in the earlier sections of this review, Cal models ,126,127.Abcc8 (\u2212/\u2212Abcc8 mice), a key component of the beta cell KATP channel, showed sustained membrane depolarization, leading to continued elevation of Ca2+ associated with dysfunctional genes involved in Ca2+ transport, signaling, and beta cell maintenance. Additionally, beta cells were observed to dedifferentiate and transdifferentiate into pancreatic polypeptide cells, as seen through the increased expression of the Aldh1a3 gene (a marker for dedifferentiating beta cells). Interestingly, the expression of Aldh1a3 was reduced by treating the cells with Ca2+ channel blockers, solidifying the link between sustained depolarization and beta cell functional and identity loss [2+ influx, and calcineurin signaling that could also be reversed by the normalization of glycemia [HNF1A gene, whose deficiency impaired a network of genes crucial to calcium signaling, GSIS, and beta cell fate. These cells were then target-differentiated into beta cells. Stem cell-derived beta cells from HNF1A knockouts showed a reduction in the SYT13 gene, which is responsible for calcium-regulated granule exocytosis. HNF1A deficiency also showed a developmental bias toward the generation of alpha cells, as an upregulation of glucagon was observed in the knockout cells. The observations from the knockout cells were comparable with those from the induced pluripotent stem cell (iPSC) line with HNF1A-MODY patient-specific mutations (R200Q) [2+ influx. These pools of insulin granules were absent in T2DM donors and INS-1 cells mimicking diabetes, implicating the role of these Ca2+-triggered granules in the loss of rapid first-phase insulin secretion seen in T2DM patients [v\u03b23 (a voltage-gated Ca2+ channel subunit) expression, coupled with impaired calcium signaling and insulin secretion, and these effects were reduced in high-fat diet-induced diabetes in Cav\u03b23 deficient mice. Overexpression of Cav\u03b23 in human islets also showed impaired GSIS [Studies have suggested the deleterious effects of long-term activation of calcium signaling pathways in beta cells. Calcineurin is a vital component of the calcineurin/NFAT pathway, which is critical to beta cell replication. However, chronic depolarization of beta cells increased calcineurin activity, which in turn reduced glucose tolerance, insulin secretion, and beta cell replication in mouse models . Anotherity loss . Anotherglycemia . A more  (R200Q) . High-repatients . Diabetired GSIS ,133.2+ overload was the main mechanism of glucolipotoxicity-mediated apoptosis and dysfunction, which was inhibited by compounds that decreased glucolipotoxicity-mediated Ca2+ influx into the cells [2+ [db/db mice and cultured human islets [2+ stores in INS-1 cells [Glucolipotoxicity is an umbrella term to describe the detrimental effects of elevated glucose and fatty acid levels on beta cell function and survival. Glucolipotoxicity-induced beta cell failure and subsequently T2DM are associated with calcium dysregulation and ER stress, along with other non-calcium-related complications. A phenotypic screening study of compounds showed that glucolipotoxicity stress had a close association with calcium flux modulation and apoptosis. It was suggested that a Cahe cells . The ubihe cells ,137,138.ells [2+ . A phaseells [2+ . Free fan islets ,142. The-1 cells .As discussed in the introduction section above, insulin-secreting beta cells from the pancreatic islet of Langerhans play a crucial role in the body by maintaining glucose homeostasis. It is well established that destruction or loss of beta cell mass leading to a negative impact on effective insulin secretion has emerged as the main pathogenic factor in both T1DM and T2DM . CurrentDirected differentiation protocols are created from an extensive study of the developmental phases of cell types. The conversion of pluripotent stem cells into target cells is achieved by the timely addition of small molecules and growth factors in a stagewise manner that mimics the embryonic development of the desired cell type. The success of the protocol is usually determined by the extent to which these cells mirror their in vivo counterparts with respect to functional maturity and efficiency. Indeed, over the past decade, these strategies have been applied to differentiate human iPSCs and ESCs into pancreatic beta cells and islets. Pioneering work from the Melton laboratory at Harvard University has paved the way for protocols that generate beta cells with moderate efficiency. However, multiple labs have published protocols with more optimized culture conditions for differentiation media and small molecules, with the resulting protocols applicable to multiple iPSC cell lines for improved differentiation efficiency and beta cell functionality ,150,151.2+ concentration, indicating that increased Ca2+ influx is a cellular function required for GSIS. Since evidence has highlighted that Ca2+ dysregulation in beta cells has a key role in diabetes, it is possible that functionally defective Ca2+ dynamics play a key role in the generation of immature and non-functionally differentiated hPSC-derived beta cells in vitro. A study used the human ESC (hESC) cell line H1 to create a seven-stage protocol to generate beta cells. The cells thus obtained expressed key markers of mature beta cells and displayed GSIS capabilities. However, as compared to adult beta cells, the differentiated cells showed reduced amplitudes and a slower time to peak of the Ca2+ signals. Sustained Ca2+ transients were observed even after the glucose stimulation ceased, a marked difference from mature beta cells. Similar effects were seen with respect to insulin release on glucose challenges, in which insulin secretion did not return to pretreatment levels and KCl-mediated insulin release was blunted. Direct depolarization with high KCl concentrations revealed the presence of voltage-gated Ca2+ channels and normal Ca2+ efflux pumps, thereby suggesting that the generated beta-like cells had functional immaturity compared to adult beta cells [2+ into the ER, thereby impairing ER function and thereby Ca2+ homeostasis in beta cells [v subunit gamma 4 (Cav\u03b34) in a CaMKII-mediated manner in controlling beta cell glucose homeostasis [2+ levels and ATP production, leading to impaired GSIS in islets [2+ handling in the differentiating cells and might explain the difficulty in generating beta cells functionally similar to adult human beta cells. One cannot assume that impaired calcium signaling is the major contributor to the formation of immature insulin-producing cells from iPSCs. Impaired expression of genes responsible for potassium channel regulation and mitochondrial function was also found in immature iPSC-derived beta-like cells [Beta cells facilitate GSIS through increased cytosolic Cata cells . Anotherta cells . The autta cells ,156,157.ta cells . A threeta cells . MafA, ata cells ,160,161.ta cells . A receneostasis . Insulineostasis . Anothereostasis . Studiesn islets . Interesn islets . The altke cells ,26. Perh2+ channels in the eBCs. Transcriptome analysis comparing non-enriched clusters and eBCs showed an upregulation of the SCGN gene, which is responsible for calcium sensing. Moreover, genes upregulated in neonatal mouse and human fetal beta cells were seen to be upregulated in the immature beta cells, providing further evidence that immature iPSC-derived beta cells resemble fetal cells more than adult beta cells [Nevertheless, more recent publications have generated beta cells with comparable functionality to human islets by incorporating enrichment and reaggregation of late-stage differentiated beta-like cells for better GSIS functionality ,166. Cel2+ handling in the maturation of beta cells during their development phase in in vitro conditions, suggesting that the calcium signaling pathway is an important puzzle piece in the generation of iPSC-derived pancreatic beta-like cells. Careful considerations need to be made in the differentiation protocols to include small molecules and growth factors in the differentiation media that target the calcium signaling pathways and their components in a timely manner to generate fully functional beta cells in vitro. Current strategies have been built upon accumulating knowledge over the past decade to produce functional beta cells, and more research needs to be performed to generate high-quality iPSC-derived beta cells that resemble human beta cells.Taken together, these studies that compare the differences between iPSC-derived immature beta-like cells and iPSC-derived beta cells functionally closer to human beta cells show the importance of appropriate CaHNF1A gene on the onset of MODY. CRISPR/Cas9 was used to generate HNF1A mutations in the hESC Mel1, which was subsequently differentiated into beta cells. The resulting beta cells were observed to have impaired GSIS and intracellular calcium levels [ATP channel in congenital hyperinsulinism. These cells were target-differentiated into beta cells and used as controls to study the effect of the mutation on beta cell function [WFS1) in IPSCs generated from a patient with Wolfram syndrome. The IPSCs were differentiated into beta cells, and it was observed that the corrected WFS1 IPSC-derived beta cells showed strong dynamic insulin secretion and reversed streptozocin-induced diabetes following transplantation into mice [An important tool to better understand diabetes and its progression is the integration of gene editing technology (CRISPR/Cas9) with stem cell technology. Several studies have reported the use of CRISPR/Cas9 to create stem cell-based disease models of monogenetic diabetes, MODY, and neonatal diabetes, among others, to better understand the mechanisms of disease progression ,169,170.m levels . Moreovem levels . A studynto mice . Thus, C2+ in the functioning of pancreatic beta cells. The role of several Ca2+-handling organelles have been discussed through recent studies, which highlight that the disruption of key Ca2+ pathways could lead to beta-cell dysfunction and thereby play a role in the onset of diabetes. We examined the key advances made in the field of stem cell technology in the study of diabetes. A comparative study of Ca2+ handling characteristics of stem cell-derived beta-like cells and their adult human counterparts was performed, showcasing the pitfalls of the current differentiation protocols and underlining key research strategies targeting Ca2+ dynamics to improve the identity and functionality of directed stem cell differentiation. Massive strides are being made to achieve the goal of generating functional beta-like cells from stem cells. Advances in the efficiency of iPSC differentiation protocols can close the gaps in the structural and functional differences between stem cell-derived pancreatic and human islets. This opens the door to fully using stem cell-derived beta cells for drug screening due to their enhanced kinetics, and the mechanisms of beta cell failure can also be studied, paving the way to greatly improve our knowledge of the intricate aspects of diabetes and its treatment, including transplantation in patients with diabetes [In this review, we emphasize the role of Cadiabetes ,166,172."]}
-{"representative": "Overweight is a growing problem in dogs worldwide and negative health effects associated with excess body weight are common. The body condition score (BCS) scale is a time- and resource-effective method to assess if a dog is overweight, but its precision among dog owners has been found to vary. The aim of this study was to investigate dog owners\u2019 perceptions of various body compositions in dogs and evaluate if a short education on how to use the 9-point BCS scale might change these perceptions. This study included one survey and one clinical study of Swedish dog owners. In the indirect assessment based on photos, normal-weight dogs were underestimated by three-quarters of dog owners, and about half of the dog owners underestimated overweight dogs. Before receiving the standardized education, one-third of the owners underestimated the body composition of their own dogs, mainly for dogs with excess adiposity. The dog owners responded well to the practical education given and, thereafter, performed assessments comparable to veterinary health care personnel. These results indicate that perception of what an \u201cideal weight\u201d dog should look like is sliding and that the ability to identify overweight dogs might be limited when owners evaluate body composition without previous education.p < 0.0001) and performed as accurately as the veterinary health care personnel (p = 0.99). The results should be verified in the broader dog owner population based on a randomized selection of participants. \u201cWeight blindness\u201d, defined here as an underassessment of normal-weight dogs and an inability to identify overweight dogs, is likely to have a negative impact on canine overweight prevalence. Deeper knowledge about dog owners\u2019 perceptions can inform the development of new strategies to help prevent and manage canine overweight, whereof standardized practical education on BCS assessment is shown here to be one example.Overweight in dogs is an increasing problem, with a prevalence of about 30% in Sweden. To prevent the negative health effects of overweight, it is important to identify and treat canine overweight. Dog owners are essential for such interventions. The aim of this study was to evaluate dog owners\u2019 perceptions of various canine body compositions via indirect assessment based on photos and direct assessment of their own dogs. A second aim was to evaluate the effect of a standardized practical education for dog owners on body condition score (BCS) assessment of their own dogs. The 9-point BCS scale was used, and two study samples were recruited: one was a survey sample where 564 dog owners assessed the BCS of dogs using photos, and one sample was a separate clinical sample where 82 dogs were assessed by their owners and by veterinary health care personnel. The initial BCS assessment by the dog owners in the clinical sample (mean \u00b1 SD) was significantly lower (4.6 \u00b1 1.0) than the BCS assessed by the veterinary health care personnel (5.2 \u00b1 1.1), but the owners improved significantly after receiving the standardized education (5.1 \u00b1 1.0) (both  Canine obesity is highly prevalent and an increasing problem in various countries ,3,4,5,6.Body weight alone is not sufficient to conclude if a dog has an ideal body condition or is under- or overweight as body weight is constituted of both lean and fat mass ,18, and The definition of canine obesity as a disease is a relatively new concept. In 2019, the Global Pet Obesity Statement proposed a uniform classification of canine obesity and emphasized the importance of spreading education on how to use the 9-point BCS scale to accurately assess body condition . It has Dog owners are an important and innate target group for educational efforts not only because they are the everyday caretakers of dogs but also because of the shared lifestyle with their pets ,29,30,31This study included two different study samples of Swedish dog owners: one sample where data were collected through an online survey (\u201csurvey population\u201d), and one sample where dog owners and their respective dog/dogs participated in an experimental study . All human participants in the survey, as in the clinical population, had to be 18 years or older. Both study samples were non-probability samples  based on voluntary participation.An online survey was distributed to Swedish dog owners and was available online through social media for seven days. It contained questions on the responders\u2019 knowledge about the BCS system  The dogs had a BCS of 5\u20138  and were photographed from above in a standardized setting (in the same room and position and by the same photographer).A clinical study that investigated the accuracy of in vivo body condition assessment by dog owners was completed with Swedish dog owners and their dogs, who were recruited through social media from three regions located in southern, middle, and northern Sweden . The participating dog owners participated with one or several dogs. The dogs were allowed to be of any breed, sex, age, neuter status, and health status, but they were obligated to show no signs of aggression whilst being handled by strangers. The clinical study was performed by two veterinary nursing students in their last semester of their Bachelor Veterinary Nursing Program at the Swedish University of Agricultural Sciences, Uppsala. The students had received previous education on BCS assessment and specific BCS calibration with an experienced BCS assessor (J.S.) before data collection. All individual dogs were assessed for BCS three times: two times by their respective owner (before and after the standardized education) and one time by of one of the two students. The students will hereafter be referred to as \u201cveterinary health care personnel\u201d in this publication.The clinical sample\u2019s data collection started with investigating the owners\u2019 perceptions through a direct assessment of their own dogs based on predefined oral descriptions, where the dog owners described the body composition of their dogs as \u201cunderweight\u201d, \u201cslightly underweight\u201d, \u201cnormal weight\u201d, \u201cslightly overweight\u201d, \u201coverweight\u201d, or \u201cobese\u201d. Thereafter, the dog owners received a standardized BCS education where they were shown the 9-point BCS scale from World Small Animal Veterinary Association  in SwediThe data related to dog owners (survey population) or to dog owners and their dogs  were analyzed descriptively as proportions, percentages, and/or by using statistical models.For the survey sample, the expert who had previously performed the in vivo BCS assessment of the dogs in the photos was considered \u201cthe primary investigator\u201d, and the expert\u2019s scores were compared with the indirect assessment based on photos performed by the dog owners (the survey population did not receive any education). Free-text answers in the survey regarding negative consequences for overweight dogs stated by the dog owners were grouped as \u201cthe locomotor apparatus\u201d, \u201cheart- and coronary disease\u201d, \u201cinsulin resistance/diabetes mellitus\u201d, \u201corgan related disease\u201d, \u201cless physically active\u201d, \u201cincreased risk for diseases or injuries\u201d, \u201cshortened lifespan\u201d, \u201creduced quality of life\u201d, and \u201cother negative effects\u201d.For the clinical sample, the veterinary health care personnel were considered to be the primary investigators, and their scores were compared with the direct assessment performed by the owners on their own dogs based on predefined oral descriptions and the owners\u2019 BCS assessment after the standardized education. The predefined oral descriptions were translated into BCS scores for data processing to enable statistical analyses. The translation was made as follows: \u201cunderweight\u201d (BCS = 1.5), \u201cslightly underweight\u201d (BCS = 3), \u201cnormal weight\u201d (BCS = 4.5), \u201cslightly overweight\u201d (BCS = 6), \u201coverweight\u201d (BCS = 7), and \u201cobese\u201d (BCS = 8.5) . The datp < 0.05, and the results are presented as mean \u00b1 SD or mean \u00b1 SEM.For statistical analyses, the software GraphPad Prism  and SAS  were used. All data were normally distributed based on an evaluation of the appearance of residuals in SAS or based on D\u2019Agostino and Pearson omnibus normality test in GraphPad Prism. The level of significance for all statistical analyses was set to For the indirect assessment based on photos, a Chi-square test for trend was used to analyze differences in proportions  among all survey participants and all four dogs shown in the photos . In this analysis, the exact score set by the primary investigator was considered the \u201cequivalent assessment\u201d.A Chi-square test for trend was also used to analyze differences in proportions  between owner age groups  regarding the normal-weight dog (BCS = 5) and the obese dog (BCS = 8). A Chi-square test for trend was also used to analyze differences in proportions  between groups of owners with varying knowledge of the BCS scale (answers were grouped as \u201cYes\u201d or \u201cNo\u201d based on familiarity) regarding the normal-weight dog (BCS = 5) and the obese dog (BCS = 8). In the analyses including the factors \u201cowner age\u201d and \u201cprevious knowledge\u201d, BCSs of 4\u20135 and BCSs of 8\u20139, defined based on the scoring scale of the BCS for normal-weight and obese dogs , were coThe body condition assessments collected from the clinical sample were evaluated using a mixed model random analysis in SAS , where bA Chi-square test for trend was used to analyze differences between the selected explanatory factors: \u201cnumber of previously owned dogs\u201d  and \u201cowner age\u201d . Linear regression analysis was used to analyze the correlation between owner age and number of previously owned dogs as continuous variables.t-tests were used to analyze the effects of dog intrinsic factors, such as age, gender, and neuter status, on BCSs. Linear regression analysis was used to analyze the association between dog age and BCS . Student\u2019s t-tests were used to compare the BCSs of male and female dogs as well as the BCSs of intact and neutered dogs.Linear regression analysis and Student\u2019s In total, 952 dog owners started the online survey and 564 dog owners completed the questionnaire. The respondents were predominantly women (96%), and the most represented age group was 41 to 60 years of age (45%). Upper secondary school (50%) was the most common educational level, and the largest professional categories were human health care (21%) and veterinary health care (12%). The respondents had previously owned (mean \u00b1 SD) 7.0 \u00b1 6.7 dogs (range 1\u201330). Forty percent (224/564) answered \u201cyes\u201d to the question if they knew what the BCS is and what it is used for. Of those respondents with self-perceived knowledge of the BCS, 84% correctly described the term related to body fat content in an open-ended follow-up question. Nine percent described that the term was related merely to body weight, and 7% described that the term was related to overall health. The descriptive statistics of the survey sample are shown in Almost all survey respondents (99%) agreed that being overweight may lead to negative consequences for dogs. In the open-ended follow-up question, the respondents were asked to give a few examples of negative consequences, and 1061 free-text answerers were recorded. The answers were grouped according to type of problem described, and the two largest groups were \u201cjoint problems\u201d (46%) and \u201cheart- and coronary diseases\u201d (23%). The least frequent groups were \u201ca shortened life span\u201d (4%) and \u201ca reduced quality of life\u201d (1%) .p < 0.0001), where the normal-weight dog was the dog that was most commonly underestimated, followed by the slightly overweight dog, while the obese dog was the dog that was most commonly accurately assessed, when compared to the exact in vivo assessment of the same dogs performed by the primary investigator (which was considered the gold standard method in the survey sample) , and about half of the respondents could not identify a slightly overweight (BCS = 6) or an overweight dog (BCS = 7). On the contrary, as many as 71% could correctly identify an obese dog (BCS = 8) with an exact score or higher . Among a sample) .p = 0.0014). In the age group of 61+ years, the dog with a BCS of 5 was given a mean score of 3.5, and 46% assessed the normal-weight dog as being underweight (BCS = 1\u20133). For the obese dog (BCS = 8), the different age groups did not differ in proportion for equivalent assessment or underassessment (p = 0.15). The respondents with no previous knowledge of the BCS scale showed a significantly lower proportion (61%) in terms of equivalent BCS assessment for the normal-weight dog (BCS = 5) compared to the respondents with previous knowledge (77%) (p < 0.0001). For the obese dog (BCS = 8), previous knowledge of the BCS scale did not affect the proportion of equivalent assessment or underassessment (p = 0.15). Within all age groups, having \u201cno previous knowledge\u201d of the BCS scale was numerically more frequent than having \u201cprevious knowledge\u201d (p = 0.09).For the survey respondents, both \u201cage group\u201d and \u201cprevious knowledge\u201d of the BCS scale had an effect on the accuracy of owner perceptions in the indirect assessment based on photos. The respondents aged 61+ years showed a significantly lower proportion (51%) in terms of equivalent BCS assessment for the normal-weight dog (BCS = 5) compared to the other age groups (64\u201375%)  showed systematic patterns in their assessment of their dogs, which were defined as constant under-assessment, equivalent assessment, or over-assessment.The gender distribution is presented in p < 0.0001) . Owners with no previous experience of dog ownership were few and were almost exclusively from the youngest age group, and all owners aged 38\u201355 years had previously owned at least one and up to 12 dogs  of the observations, overestimated their dogs in 4/82 (5%) of the observations, and performed equivalent assessment in 49/82 (60%) of the observations. Of the underestimated dogs, 21/29 (72%) were overweight (BCS = 6\u20137), 6/29 (21%) were of normal weight (BCS = 4\u20135), and 2/29 (7%) were underweight (BCS = 3). Owner perceptions, in terms of the mean BCS based on predefined oral descriptions and no further education, were significantly lower (4.6 \u00b1 1.0) than the BCS assessed by the veterinary health care personnel (5.2 \u00b1 1.1) in the overall comparison ( 0.0001) . An anal 0.0001) a and own 0.0001) b were eq 12 dogs .p < 0.0001) compared to their previous assessment (p \u2265 0.89)  . After tp < 0.0001), and increasing age of the owners showed a weak positive correlation  with increasing number of owned dogs.The tabulation of the two explanatory factors, \u201cowner age groups\u201d and \u201cnumber of previously owned dogs\u201d, is shown in p = 0.02, R-squared = 0.12). Female dogs had a (mean \u00b1 SD) BCS of 5.4 \u00b1 1.0, which did not differ from the BCS of male dogs of 4.9 \u00b11.1 (p = 0.07). Both male and female neutered dogs had a significantly higher (mean \u00b1SD) BCS of 5.7 \u00b1 0.9 compared to intact dogs with a BCS of 5.0 \u00b11.1 (p = 0.006).Of all participating dogs, 30/82 (37%) were assessed as being overweight  and overweight ), 57% was assessed as being of normal weight (BCS = 4\u20135), and 6% was assessed as being underweight (BCS = 2\u20133) by the veterinary health care personnel. There was a weak positive association between dog age and BCS, where the BCS of participating dogs increased with increasing dog age  compared with the other dogs (black). All dogs shown in the photos in the survey were, however, Labrador Retriever dogs of the type for shows, were assessed in vivo by the same primary investigator, and were photographed in a standardized setting. The lighter color could perhaps have contributed to the obese state being more obviously spotted. However, coat color has previously been shown to have no effect on the assessment of BCS when comparing visual assessment using photos to in vivo assessment of the same dogs .The method of visual BCS assessment using photos has been shown to be moderately to highly correlated with in vivo assessment ,41, but In the indirect assessment using photos, dog owners who had no previous knowledge of the BCS scale and/or were of older age were less likely to perform assessment that was equivalent to the primary investigator, especially in the assessment of the normal-weight dog, where the results differed significantly. In fact, 46 percent of the respondents aged 61+ years in the survey assessed the normal-weight dog (BCS = 5) as being underweight (BCS = 1\u20133), thus underestimating the dog with an ideal body condition by two steps or more on the scale, which is a clinically significant amount.In the clinical study sample, overweight dogs were about twice as likely to be underestimated compared to normal-weight/underweight dogs in the pre-educational assessment, a finding that is consistent with other studies investigating the accuracy of BCS assessment among owners evaluating their own dogs ,23,37,38The fact that certain owner-related factors can affect the precision of owner BCS assessments has been confirmed by another study, showing that type of dogs (sport or pet dogs)  may affeThe group of owners with no previous experience of dog ownership was small and did not overlap with the group of owners aged 38\u201355 years, in which all owners had previously owned at least one dog. The oldest participants in the clinical sample differed in their perceptions compared to the veterinary health care personnel before the standardized education. However, owner age as an explanatory factor for accuracy in assessments could possibly be a marker for some other factors not detectable by the current study design. Importantly, it should be emphasized that all dog owners responded to the standardized education given, regardless of age and previous dog ownership experience. Hence, a recommendation is that veterinary health care personnel should take the time during veterinary visits to provide standardized education to their clients.Although exact owner ages were grouped slightly differently between the two study samples, the age groups might be considered comparable as they represent similar life stages of the participants. Even though many dog owners participated in this study as a whole, and participants in the clinical study sample were from three different regions of Sweden, the results do not necessarily represent perceptions of Swedish dog owners at a national level due to the use of convenience sampling based on voluntary participation and non-randomized selection. Another limitation of the study is the unintentional overrepresentation of women, health care professionals, and students from animal-related programs in both study samples. The results were not analyzed with regard to owner gender and education, even though one previous study of owner perceptions of canine body composition has shown that women underestimated body composition to a lower degree than men , a factoThe results from the two study populations evaluating owner perceptions via indirect assessment based on photos and direct assessment of own dogs based on oral instructions suggested they were influenced by some similar factors, i.e., body condition status of the dogs and owner age. This study shows no overlap between the survey and the clinical samples. In future studies, owner perceptions of what an ideal body condition looks like, as evaluated in dogs owned by others and/or from photos, should be investigated and compared to the accuracy of BCS assessment of a dog owned by the participant in the same study population of dog owners. This will lead to a better understanding of the impact of individual perceptions on the accuracy of BCS assessment.The canine overweight prevalence in the clinical sample was 37%, and of those dogs, about two-thirds were slightly overweight, one-third were overweight, and no dog was obese. A prevalence of nearly 40% is slightly higher than previously reported in Sweden ,7 but inIn this study, canine BCS increased with the age of the dogs and neutered dogs had a significantly higher BCS than intact dogs. The fact that these intrinsic dog factors affect BCS has previously been verified in other studies ,45,46,47Both study samples underestimated body condition at assessment when they had no previous education; however, after the standardized practical BCS education given to the dog owners in the clinical sample, these owners performed the BCS assessments equivalent to the veterinary health care personnel overall, regardless of owner age and/or number of previously owned dogs. The standardization of the education is unique to the authors\u2019 knowledge and likely contributed to the significantly improved agreement between the assessments from the dog owners and the veterinary health care personnel. This suggests that a systematic education could be vital for owners\u2019 ability to correctly assess their dogs\u2019 body condition.Other studies have reported no or only little improvement in the accuracy of BCS assessment after using the BCS scale and/or after some training directed to dog owners ,21,22,23We suggest that the concept of \u201cweight blindness\u201d, defined here as an underassessment of normal-weight dogs and an inability to identify overweight dogs, could be introduced as a novel concept. Weight blindness captures the bias underlying the underestimation of canine body condition and is likely to have a negative impact on canine overweight prevalence as owners will not address an unknown problem. In accordance with other studies ,41, we sThe results from the two different study samples indicate that owner perceptions of an \u201cideal body condition\u201d in dogs are sliding and that the ability to identify overweight in one\u2019s own dogs might be limited. We propose a concept called \u201cweight blindness\u201d, which could be successfully reversed with standardized practical education on how to use the 9-point BCS scale. When addressing canine overweight, it should be recognized that not only the body condition of dogs but also owner-related factors might influence owners\u2019 perceptions of different canine body compositions and the accuracy of BCS assessment when there is no previous education. Future studies should preferably investigate perceptions among owner populations based on a randomized selection of participants. Dogs owned by others and/or perceptions based on photos, as well as assessments of one\u2019s own dogs, in the same study population of owners could be used to generate a better understanding of the impact of individual perceptions on the accuracy of BCS assessment.", "texts": ["Overweight is a growing problem in dogs worldwide and negative health effects associated with excess body weight are common. The body condition score (BCS) scale is a time- and resource-effective method to assess if a dog is overweight, but its precision among dog owners has been found to vary. The aim of this study was to investigate dog owners\u2019 perceptions of various body compositions in dogs and evaluate if a short education on how to use the 9-point BCS scale might change these perceptions. This study included one survey and one clinical study of Swedish dog owners. In the indirect assessment based on photos, normal-weight dogs were underestimated by three-quarters of dog owners, and about half of the dog owners underestimated overweight dogs. Before receiving the standardized education, one-third of the owners underestimated the body composition of their own dogs, mainly for dogs with excess adiposity. The dog owners responded well to the practical education given and, thereafter, performed assessments comparable to veterinary health care personnel. These results indicate that perception of what an \u201cideal weight\u201d dog should look like is sliding and that the ability to identify overweight dogs might be limited when owners evaluate body composition without previous education.p < 0.0001) and performed as accurately as the veterinary health care personnel (p = 0.99). The results should be verified in the broader dog owner population based on a randomized selection of participants. \u201cWeight blindness\u201d, defined here as an underassessment of normal-weight dogs and an inability to identify overweight dogs, is likely to have a negative impact on canine overweight prevalence. Deeper knowledge about dog owners\u2019 perceptions can inform the development of new strategies to help prevent and manage canine overweight, whereof standardized practical education on BCS assessment is shown here to be one example.Overweight in dogs is an increasing problem, with a prevalence of about 30% in Sweden. To prevent the negative health effects of overweight, it is important to identify and treat canine overweight. Dog owners are essential for such interventions. The aim of this study was to evaluate dog owners\u2019 perceptions of various canine body compositions via indirect assessment based on photos and direct assessment of their own dogs. A second aim was to evaluate the effect of a standardized practical education for dog owners on body condition score (BCS) assessment of their own dogs. The 9-point BCS scale was used, and two study samples were recruited: one was a survey sample where 564 dog owners assessed the BCS of dogs using photos, and one sample was a separate clinical sample where 82 dogs were assessed by their owners and by veterinary health care personnel. The initial BCS assessment by the dog owners in the clinical sample (mean \u00b1 SD) was significantly lower (4.6 \u00b1 1.0) than the BCS assessed by the veterinary health care personnel (5.2 \u00b1 1.1), but the owners improved significantly after receiving the standardized education (5.1 \u00b1 1.0) (both  Canine obesity is highly prevalent and an increasing problem in various countries ,3,4,5,6.Body weight alone is not sufficient to conclude if a dog has an ideal body condition or is under- or overweight as body weight is constituted of both lean and fat mass ,18, and The definition of canine obesity as a disease is a relatively new concept. In 2019, the Global Pet Obesity Statement proposed a uniform classification of canine obesity and emphasized the importance of spreading education on how to use the 9-point BCS scale to accurately assess body condition . It has Dog owners are an important and innate target group for educational efforts not only because they are the everyday caretakers of dogs but also because of the shared lifestyle with their pets ,29,30,31This study included two different study samples of Swedish dog owners: one sample where data were collected through an online survey (\u201csurvey population\u201d), and one sample where dog owners and their respective dog/dogs participated in an experimental study . All human participants in the survey, as in the clinical population, had to be 18 years or older. Both study samples were non-probability samples  based on voluntary participation.An online survey was distributed to Swedish dog owners and was available online through social media for seven days. It contained questions on the responders\u2019 knowledge about the BCS system  The dogs had a BCS of 5\u20138  and were photographed from above in a standardized setting (in the same room and position and by the same photographer).A clinical study that investigated the accuracy of in vivo body condition assessment by dog owners was completed with Swedish dog owners and their dogs, who were recruited through social media from three regions located in southern, middle, and northern Sweden . The participating dog owners participated with one or several dogs. The dogs were allowed to be of any breed, sex, age, neuter status, and health status, but they were obligated to show no signs of aggression whilst being handled by strangers. The clinical study was performed by two veterinary nursing students in their last semester of their Bachelor Veterinary Nursing Program at the Swedish University of Agricultural Sciences, Uppsala. The students had received previous education on BCS assessment and specific BCS calibration with an experienced BCS assessor (J.S.) before data collection. All individual dogs were assessed for BCS three times: two times by their respective owner (before and after the standardized education) and one time by of one of the two students. The students will hereafter be referred to as \u201cveterinary health care personnel\u201d in this publication.The clinical sample\u2019s data collection started with investigating the owners\u2019 perceptions through a direct assessment of their own dogs based on predefined oral descriptions, where the dog owners described the body composition of their dogs as \u201cunderweight\u201d, \u201cslightly underweight\u201d, \u201cnormal weight\u201d, \u201cslightly overweight\u201d, \u201coverweight\u201d, or \u201cobese\u201d. Thereafter, the dog owners received a standardized BCS education where they were shown the 9-point BCS scale from World Small Animal Veterinary Association  in SwediThe data related to dog owners (survey population) or to dog owners and their dogs  were analyzed descriptively as proportions, percentages, and/or by using statistical models.For the survey sample, the expert who had previously performed the in vivo BCS assessment of the dogs in the photos was considered \u201cthe primary investigator\u201d, and the expert\u2019s scores were compared with the indirect assessment based on photos performed by the dog owners (the survey population did not receive any education). Free-text answers in the survey regarding negative consequences for overweight dogs stated by the dog owners were grouped as \u201cthe locomotor apparatus\u201d, \u201cheart- and coronary disease\u201d, \u201cinsulin resistance/diabetes mellitus\u201d, \u201corgan related disease\u201d, \u201cless physically active\u201d, \u201cincreased risk for diseases or injuries\u201d, \u201cshortened lifespan\u201d, \u201creduced quality of life\u201d, and \u201cother negative effects\u201d.For the clinical sample, the veterinary health care personnel were considered to be the primary investigators, and their scores were compared with the direct assessment performed by the owners on their own dogs based on predefined oral descriptions and the owners\u2019 BCS assessment after the standardized education. The predefined oral descriptions were translated into BCS scores for data processing to enable statistical analyses. The translation was made as follows: \u201cunderweight\u201d (BCS = 1.5), \u201cslightly underweight\u201d (BCS = 3), \u201cnormal weight\u201d (BCS = 4.5), \u201cslightly overweight\u201d (BCS = 6), \u201coverweight\u201d (BCS = 7), and \u201cobese\u201d (BCS = 8.5) . The datp < 0.05, and the results are presented as mean \u00b1 SD or mean \u00b1 SEM.For statistical analyses, the software GraphPad Prism  and SAS  were used. All data were normally distributed based on an evaluation of the appearance of residuals in SAS or based on D\u2019Agostino and Pearson omnibus normality test in GraphPad Prism. The level of significance for all statistical analyses was set to For the indirect assessment based on photos, a Chi-square test for trend was used to analyze differences in proportions  among all survey participants and all four dogs shown in the photos . In this analysis, the exact score set by the primary investigator was considered the \u201cequivalent assessment\u201d.A Chi-square test for trend was also used to analyze differences in proportions  between owner age groups  regarding the normal-weight dog (BCS = 5) and the obese dog (BCS = 8). A Chi-square test for trend was also used to analyze differences in proportions  between groups of owners with varying knowledge of the BCS scale (answers were grouped as \u201cYes\u201d or \u201cNo\u201d based on familiarity) regarding the normal-weight dog (BCS = 5) and the obese dog (BCS = 8). In the analyses including the factors \u201cowner age\u201d and \u201cprevious knowledge\u201d, BCSs of 4\u20135 and BCSs of 8\u20139, defined based on the scoring scale of the BCS for normal-weight and obese dogs , were coThe body condition assessments collected from the clinical sample were evaluated using a mixed model random analysis in SAS , where bA Chi-square test for trend was used to analyze differences between the selected explanatory factors: \u201cnumber of previously owned dogs\u201d  and \u201cowner age\u201d . Linear regression analysis was used to analyze the correlation between owner age and number of previously owned dogs as continuous variables.t-tests were used to analyze the effects of dog intrinsic factors, such as age, gender, and neuter status, on BCSs. Linear regression analysis was used to analyze the association between dog age and BCS . Student\u2019s t-tests were used to compare the BCSs of male and female dogs as well as the BCSs of intact and neutered dogs.Linear regression analysis and Student\u2019s In total, 952 dog owners started the online survey and 564 dog owners completed the questionnaire. The respondents were predominantly women (96%), and the most represented age group was 41 to 60 years of age (45%). Upper secondary school (50%) was the most common educational level, and the largest professional categories were human health care (21%) and veterinary health care (12%). The respondents had previously owned (mean \u00b1 SD) 7.0 \u00b1 6.7 dogs (range 1\u201330). Forty percent (224/564) answered \u201cyes\u201d to the question if they knew what the BCS is and what it is used for. Of those respondents with self-perceived knowledge of the BCS, 84% correctly described the term related to body fat content in an open-ended follow-up question. Nine percent described that the term was related merely to body weight, and 7% described that the term was related to overall health. The descriptive statistics of the survey sample are shown in Almost all survey respondents (99%) agreed that being overweight may lead to negative consequences for dogs. In the open-ended follow-up question, the respondents were asked to give a few examples of negative consequences, and 1061 free-text answerers were recorded. The answers were grouped according to type of problem described, and the two largest groups were \u201cjoint problems\u201d (46%) and \u201cheart- and coronary diseases\u201d (23%). The least frequent groups were \u201ca shortened life span\u201d (4%) and \u201ca reduced quality of life\u201d (1%) .p < 0.0001), where the normal-weight dog was the dog that was most commonly underestimated, followed by the slightly overweight dog, while the obese dog was the dog that was most commonly accurately assessed, when compared to the exact in vivo assessment of the same dogs performed by the primary investigator (which was considered the gold standard method in the survey sample) , and about half of the respondents could not identify a slightly overweight (BCS = 6) or an overweight dog (BCS = 7). On the contrary, as many as 71% could correctly identify an obese dog (BCS = 8) with an exact score or higher . Among a sample) .p = 0.0014). In the age group of 61+ years, the dog with a BCS of 5 was given a mean score of 3.5, and 46% assessed the normal-weight dog as being underweight (BCS = 1\u20133). For the obese dog (BCS = 8), the different age groups did not differ in proportion for equivalent assessment or underassessment (p = 0.15). The respondents with no previous knowledge of the BCS scale showed a significantly lower proportion (61%) in terms of equivalent BCS assessment for the normal-weight dog (BCS = 5) compared to the respondents with previous knowledge (77%) (p < 0.0001). For the obese dog (BCS = 8), previous knowledge of the BCS scale did not affect the proportion of equivalent assessment or underassessment (p = 0.15). Within all age groups, having \u201cno previous knowledge\u201d of the BCS scale was numerically more frequent than having \u201cprevious knowledge\u201d (p = 0.09).For the survey respondents, both \u201cage group\u201d and \u201cprevious knowledge\u201d of the BCS scale had an effect on the accuracy of owner perceptions in the indirect assessment based on photos. The respondents aged 61+ years showed a significantly lower proportion (51%) in terms of equivalent BCS assessment for the normal-weight dog (BCS = 5) compared to the other age groups (64\u201375%)  showed systematic patterns in their assessment of their dogs, which were defined as constant under-assessment, equivalent assessment, or over-assessment.The gender distribution is presented in p < 0.0001) . Owners with no previous experience of dog ownership were few and were almost exclusively from the youngest age group, and all owners aged 38\u201355 years had previously owned at least one and up to 12 dogs  of the observations, overestimated their dogs in 4/82 (5%) of the observations, and performed equivalent assessment in 49/82 (60%) of the observations. Of the underestimated dogs, 21/29 (72%) were overweight (BCS = 6\u20137), 6/29 (21%) were of normal weight (BCS = 4\u20135), and 2/29 (7%) were underweight (BCS = 3). Owner perceptions, in terms of the mean BCS based on predefined oral descriptions and no further education, were significantly lower (4.6 \u00b1 1.0) than the BCS assessed by the veterinary health care personnel (5.2 \u00b1 1.1) in the overall comparison ( 0.0001) . An anal 0.0001) a and own 0.0001) b were eq 12 dogs .p < 0.0001) compared to their previous assessment (p \u2265 0.89)  . After tp < 0.0001), and increasing age of the owners showed a weak positive correlation  with increasing number of owned dogs.The tabulation of the two explanatory factors, \u201cowner age groups\u201d and \u201cnumber of previously owned dogs\u201d, is shown in p = 0.02, R-squared = 0.12). Female dogs had a (mean \u00b1 SD) BCS of 5.4 \u00b1 1.0, which did not differ from the BCS of male dogs of 4.9 \u00b11.1 (p = 0.07). Both male and female neutered dogs had a significantly higher (mean \u00b1SD) BCS of 5.7 \u00b1 0.9 compared to intact dogs with a BCS of 5.0 \u00b11.1 (p = 0.006).Of all participating dogs, 30/82 (37%) were assessed as being overweight  and overweight ), 57% was assessed as being of normal weight (BCS = 4\u20135), and 6% was assessed as being underweight (BCS = 2\u20133) by the veterinary health care personnel. There was a weak positive association between dog age and BCS, where the BCS of participating dogs increased with increasing dog age  compared with the other dogs (black). All dogs shown in the photos in the survey were, however, Labrador Retriever dogs of the type for shows, were assessed in vivo by the same primary investigator, and were photographed in a standardized setting. The lighter color could perhaps have contributed to the obese state being more obviously spotted. However, coat color has previously been shown to have no effect on the assessment of BCS when comparing visual assessment using photos to in vivo assessment of the same dogs .The method of visual BCS assessment using photos has been shown to be moderately to highly correlated with in vivo assessment ,41, but In the indirect assessment using photos, dog owners who had no previous knowledge of the BCS scale and/or were of older age were less likely to perform assessment that was equivalent to the primary investigator, especially in the assessment of the normal-weight dog, where the results differed significantly. In fact, 46 percent of the respondents aged 61+ years in the survey assessed the normal-weight dog (BCS = 5) as being underweight (BCS = 1\u20133), thus underestimating the dog with an ideal body condition by two steps or more on the scale, which is a clinically significant amount.In the clinical study sample, overweight dogs were about twice as likely to be underestimated compared to normal-weight/underweight dogs in the pre-educational assessment, a finding that is consistent with other studies investigating the accuracy of BCS assessment among owners evaluating their own dogs ,23,37,38The fact that certain owner-related factors can affect the precision of owner BCS assessments has been confirmed by another study, showing that type of dogs (sport or pet dogs)  may affeThe group of owners with no previous experience of dog ownership was small and did not overlap with the group of owners aged 38\u201355 years, in which all owners had previously owned at least one dog. The oldest participants in the clinical sample differed in their perceptions compared to the veterinary health care personnel before the standardized education. However, owner age as an explanatory factor for accuracy in assessments could possibly be a marker for some other factors not detectable by the current study design. Importantly, it should be emphasized that all dog owners responded to the standardized education given, regardless of age and previous dog ownership experience. Hence, a recommendation is that veterinary health care personnel should take the time during veterinary visits to provide standardized education to their clients.Although exact owner ages were grouped slightly differently between the two study samples, the age groups might be considered comparable as they represent similar life stages of the participants. Even though many dog owners participated in this study as a whole, and participants in the clinical study sample were from three different regions of Sweden, the results do not necessarily represent perceptions of Swedish dog owners at a national level due to the use of convenience sampling based on voluntary participation and non-randomized selection. Another limitation of the study is the unintentional overrepresentation of women, health care professionals, and students from animal-related programs in both study samples. The results were not analyzed with regard to owner gender and education, even though one previous study of owner perceptions of canine body composition has shown that women underestimated body composition to a lower degree than men , a factoThe results from the two study populations evaluating owner perceptions via indirect assessment based on photos and direct assessment of own dogs based on oral instructions suggested they were influenced by some similar factors, i.e., body condition status of the dogs and owner age. This study shows no overlap between the survey and the clinical samples. In future studies, owner perceptions of what an ideal body condition looks like, as evaluated in dogs owned by others and/or from photos, should be investigated and compared to the accuracy of BCS assessment of a dog owned by the participant in the same study population of dog owners. This will lead to a better understanding of the impact of individual perceptions on the accuracy of BCS assessment.The canine overweight prevalence in the clinical sample was 37%, and of those dogs, about two-thirds were slightly overweight, one-third were overweight, and no dog was obese. A prevalence of nearly 40% is slightly higher than previously reported in Sweden ,7 but inIn this study, canine BCS increased with the age of the dogs and neutered dogs had a significantly higher BCS than intact dogs. The fact that these intrinsic dog factors affect BCS has previously been verified in other studies ,45,46,47Both study samples underestimated body condition at assessment when they had no previous education; however, after the standardized practical BCS education given to the dog owners in the clinical sample, these owners performed the BCS assessments equivalent to the veterinary health care personnel overall, regardless of owner age and/or number of previously owned dogs. The standardization of the education is unique to the authors\u2019 knowledge and likely contributed to the significantly improved agreement between the assessments from the dog owners and the veterinary health care personnel. This suggests that a systematic education could be vital for owners\u2019 ability to correctly assess their dogs\u2019 body condition.Other studies have reported no or only little improvement in the accuracy of BCS assessment after using the BCS scale and/or after some training directed to dog owners ,21,22,23We suggest that the concept of \u201cweight blindness\u201d, defined here as an underassessment of normal-weight dogs and an inability to identify overweight dogs, could be introduced as a novel concept. Weight blindness captures the bias underlying the underestimation of canine body condition and is likely to have a negative impact on canine overweight prevalence as owners will not address an unknown problem. In accordance with other studies ,41, we sThe results from the two different study samples indicate that owner perceptions of an \u201cideal body condition\u201d in dogs are sliding and that the ability to identify overweight in one\u2019s own dogs might be limited. We propose a concept called \u201cweight blindness\u201d, which could be successfully reversed with standardized practical education on how to use the 9-point BCS scale. When addressing canine overweight, it should be recognized that not only the body condition of dogs but also owner-related factors might influence owners\u2019 perceptions of different canine body compositions and the accuracy of BCS assessment when there is no previous education. Future studies should preferably investigate perceptions among owner populations based on a randomized selection of participants. Dogs owned by others and/or perceptions based on photos, as well as assessments of one\u2019s own dogs, in the same study population of owners could be used to generate a better understanding of the impact of individual perceptions on the accuracy of BCS assessment."]}
-{"representative": "The number of grains per panicle is an important factor in determining rice yield. The DST-OsCKX2 module has been demonstrated to regulate panicle development in rice by controlling cytokinin content. However, to date, how the function of DST-OsCKX2 module is regulated during panicle development remains obscure.ABNORMAL PANICLE 1 (ABP1), a severely allele of FRIZZY PANICLE (FZP), exhibits abnormal spikelets morphology. We show that FZP can repress the expression of DST via directly binding to its promotor. Consistently, the expression level of OsCKX2 increased and the cytokinin content decreased in the fzp mutant, suggesting that the FZP acts upstream of the DST-OsCKX2 to maintain cytokinin homeostasis in the inflorescence meristem.In this study, the FZP plays an important role in regulating spikelet development and grain number through mediating cytokinin metabolism.Our results indicate that The online version contains supplementary material available at 10.1186/s12870-023-04671-4. Oryza sativa) is one of the most important cereal crops in the world, providing the main energy for more than half of the world's population [Rice , encodes cytokinin oxidase/dehydrogenase 2 (OsCKX2), which can catalyze the degradation of active cytokinins [OsCKX2 expression has been successfully used in rice breeding practice to increase seed yield [CKX2 through directly binding to its promoter [Cytokinin is a specific hormone that affects plant growth and development, and plays an important role in regulating shoot apical meristem (SAM) in plants , 20\u201322. tokinins . Decreastokinins . Increased yield . Transcrpromoter . ERECTA1promoter . A recenpromoter . HoweverFRIZZY PANICLE (FZP), is involved in the transition from spikelet to floral meristem identity, which contains an APETALA2/ETHYLENE RESPONSE FACTOR (AP2/ERF) domain transcription factor. FZP is an ortholog of the maize transcription factor BD1 [FZP at the transcriptional stage [FZP translational repression by interacting with CUREs in the 3\u2019 UTR of FZP mRNA, leading to changes in the number of secondary branches and the grain number per panicle [The spikelet identity gene, ctor BD1 , 31, 32.al stage . Deletioal stage . In anot panicle . HoweverABNORMAL PANICLE 1 (ABP1) gene, which regulates spikelets development and grain yield in rice. Map-based cloning revealed that ABP1 was identical to FRIZZY PANICLE (FZP). Molecular evidence shows that FZP directly binds to the motif AGCCGCC in the DST promoter that represses its expression. Consequently, the expression level of OsCKX2 was upregulated and the level of cytokinin decreased in the inflorescence meristem of fzp mutant, which reduces the SAM activity and the grain number of per panicle. Our findings reveal that FZP regulates grain number by negatively controlling the function of DST-OsCKX2 module, which provides novel insight into the regulation of cytokinin homeostasis in rice.In this study, we identified an abnormal panicle 1 (abp1) from an EMS-treated mutant pool of the elite indica rice variety YK17 (Zhongjiazao17). The abp1 mutant was similar to the wild type in plant morphology  were constructed. The gene was mapped in the chromosome 7 primarily, and delimited to a 995\u00a0kb region between SSR markers MM0148 and MM3834, which harbors a Frizzy panicle  gene  experiments was in the young panicle (\u2264\u20090.5\u00a0cm) of fzp and wild-type. A total 578 differentially expressed genes (DEGs) were identified, including 161 downregulated and 417 upregulated in fzp  assay, the result showed that FZP could bind to the promotor of DST  assay was conducted by using proDST: LUC as a reporter. In rice protoplasts, effectors 35S: FZP significantly repressed the transcription of the reporter compared with the negative control  controls panicle development by regulating the activities of florescence meristem activity, mutation in TAW1 shows the differentiation of spikelet meristem was delayed, the differentiation time of branch meristem was prolonged, and significantly increases the number of secondary branches and spikelets in rice [RCN1and RCN2 (RICE CENTRORADIALIS) delayed the transition from branch meristem to spikelets meristem, resulting in an increased number of branches and the grains number of per panicle [FZP is involved in the differentiation of spikelets meristem and prevent the formation of axillary meristem, has become a marker gene for the development of spikelet meristem in grasses, several FZP alleles have been cloned, Our results showed that ABP1 is a severely active allele of FZP, grain number per main panicle of abp1 was reduced by 66% compared to wild type, the floral primordia was not differentiated in abp1 panicle but replaced by higher-order branch primordia, and the grains were also smaller than the normal plants  in maize belonged to AP2/ERF family, specifies determinate fates by suppressing indeterminate growth within the spikelets meristem, and which is required for timely conversion of spikelets meristem to floral meristems timely [MULTI-FLORET SPIKELET1 (MFS1) belong to AP2/ERF family, plays an important role in the regulation of spikelets meristem determinacy and floral organ identity, mutation in MFS1 resulted in an extra hull-like organ and an elongated rachilla [FZP also encodes an AP2/ERF-type transcription factor, ERF domain can be divided into three classes according to the amino acid characteristics, FZP belongs to the class II, and transient analysis shows that the class II members usually have transcriptional repressor activity [DST which controlling the number of grains per panicle was significantly up-regulated in fzp by analysis the transcriptome data, and the promoter of DST also contained the cis-acting GCC-box , a highly conserved DNA domain, are a class of plant-specific transcription factors . Previouelopment . A few es timely . Rice MUrachilla . FZP alsactivity . Howeverbox Fig.\u00a0. We revents Fig.\u00a0. Our resOsCKX4 antisense inhibition could increase the panicle size and spikelets number of plants without affecting other agronomic traits [OsCKX11 plays an important role in delaying leaf senescence, increasing seed number, and coordinating source and sink, osckx11 showed significantly increased branching, tillering, and seed number compared to WT [OsCKX family were also checked, the OsCKX3, 4, 8 and 9 were downregulated, which were considered to be the reason why the DHZ content was unchanged in the mutant , an important plant hormone, was first discovered in tobacco tissue culture, CTK are widely involved in regulating plant growth, development and response to the environment, such as promoting cell division, removing apical dominance and shortening the transition time from vegetative growth to reproductive growth . The shoc traits . OsCKX11ed to WT . In thisnt Fig. S. The DSTole Fig.\u00a0F.DST and regulates spikelet development by maintaining cytokinin homeostasis in inflorescence meristem via DST-CKX2 module. Our results indicate that FZP plays a critical role in regulating grain number through mediating cytokinin metabolism.Collectively, our findings indicate that FZP represses the transcription of fzp mutant was identified from EMS-treated seeds of the elite indica rice (Oryza sativa) variety YK17 (Zhongjiazao 17), the mutant stably inherited for multiple generations was applied for further experiments. The F2 mapping populations was derived from a cross between fzp mutant and tropical japonica rice variety D50. All plants were grown under natural conditions in the experimental fields of Zhejiang Academy of Agricultural Science in Hangzhou, China.The fzp were fixed in 2.5% glutaraldehyde solution at 4\u00a0\u00b0C overnight, and the samples were rinsed three times with 0.1\u00a0M, pH7.0 phosphate buffer for 15\u00a0min each time. Then the samples were fixed in 1% osmic acid solution for 2\u00a0h, rinsed the samples three times with 0.1\u00a0M, pH7.0 phosphate buffer for three times. The samples were dehydrated with ethanol solutions of gradient concentrations, and then treated with 100% ethanol twice, 20\u00a0min each time. Drying process was performed in a Hitachi HCP-2  critical point dryer. The samples were subsequently sputter-coated with gold and analyzed using the Hitachi SU-8010 scanning electron microscope .For scanning electron microscopy analysis, the tissue samples collected from YK17 and 2 plants, we delimited the gene to 995\u00a0kb region between MM0148 and MM3834. For the complementation of fzp, the FZP genomic DNA fragment containing 2.6-kb upstream sequences and 1.2-kb downstream sequence was inserted into the pCAMBIA2300 vector using kpnI and xbaI sites. The resulting plasmid was introduced into fzp mutant to generate transgenic plants [To determine the mutated gene, both parents and 20 individuals with the abnormal panicle phenotype were selected for initial linkage analysis. More than 200 simple sequences repeated (SSR) markers evenly distributed on 12 chromosomes of rice were used for preliminary mapping. The mutant control gene was initially located on chromosome 7. Using another 192 Fc plants . All prifzp using Trizol reagent (Life Technologies). The method of RNA extraction from developing seeds was according to a modified SDS-Trizol method [UBQ gene (LOC_Os03g13170) was used as internal control. The relative mRNA level of tested genes was normalized to UBQ and calculated by the 2\u2013DDCT method [Total RNA was extracted from different plant tissues except developing seeds of wild-type and l method . First Sl method . ExperimT method . Primersfzp and wild-type were collected, RNA extraction as previously described. Illumina Hiseq platform was used for sequencing in Novogene (China). Differentially expressed genes (DEGs) were identified as genes with absolute value of log2Fold changed\u2009\u2265\u20091 and q-value\u2009<\u20090.005 using DEGseq. For GO and KEGG analysis, Goseq and KOBAS (2.0) were used. The threshold of corrected P-value\u2009<\u20090.05 was used to identify significantly enriched GO terms and KEGG pathways.Young panicle samples (\u2264\u20090.5\u00a0cm) of \u25e6C in the dark, the GFP signals were observed under a Zeiss LSM510 laser-scanning confocal microscopy . The primers of this experiment were listed in Supplemental Table SThe full-length coding sequence of FZP without stop codon from YK17 was amplified by PCR. Then the PCR product was cloned into pAN580 vector to get the FZP-GFP construct . The fusFZP was amplified and inserted into pB42AD, the DST promoter sequence was inserted into pLacZ2u to generate ProDST: LacZ2u. The plasmids were co-transformed into the yeast strain EGY48, the empty pB42AD in combination with the LacZ reporter constructs were used as negative controls [For yeast one-hybrid assay, the CDS of controls . The traE. coli DE3 cells and purified using MBPSep Dextrin 6FF Chromatography Column  based on the manufacturer\u2019s instructions. For EMSA assays, the probes of DST (62 nt in length) containing a motif AGCCGCC was commercially synthesized and labeled with an EMSA probe biotin labeling kit . Unlabeled DNA oligos were used as competitors. Reaction system was performed in a 10\u03bcL reaction volume which containing 2\u03bcL 5\u2009\u00d7\u2009EMSA/Gel-shift binding buffer, 5\u00a0nmol purified recombinant protein and 2\u00a0nmol biotin-labeled probe. EMSA assays were performed with the chemiluminescent EMSA kit .Full length CDS of FZP was cloned into the Pmal-c2x to fuse with MBP tag, the recombinant protein was then transformed into 35S: NONE as an effector. Total 10\u00a0\u03bcg of plasmid  was used for the transformation in rice protoplast. Protoplast extraction and transformation were performed as previously described [For dual-LUC assay, the 1.2\u00a0kb promoter sequence of DST was amplified and cloned into vector 190LUC as a reporter, and the full-length coding sequences of FZP was inserted into the control vector pescribed . All theFor endogenous cytokinin level assay, 1\u00a0g young panicles (\u2264\u20090.5\u00a0cm) were collected and pooled for measurements. Three biological replications were performed. Quantification of endogenous cytokinin was performed as previously described .Additional file 1. Additional file 2. Additional file 3. Additional file 4.", "texts": ["The number of grains per panicle is an important factor in determining rice yield. The DST-OsCKX2 module has been demonstrated to regulate panicle development in rice by controlling cytokinin content. However, to date, how the function of DST-OsCKX2 module is regulated during panicle development remains obscure.ABNORMAL PANICLE 1 (ABP1), a severely allele of FRIZZY PANICLE (FZP), exhibits abnormal spikelets morphology. We show that FZP can repress the expression of DST via directly binding to its promotor. Consistently, the expression level of OsCKX2 increased and the cytokinin content decreased in the fzp mutant, suggesting that the FZP acts upstream of the DST-OsCKX2 to maintain cytokinin homeostasis in the inflorescence meristem.In this study, the FZP plays an important role in regulating spikelet development and grain number through mediating cytokinin metabolism.Our results indicate that The online version contains supplementary material available at 10.1186/s12870-023-04671-4. Oryza sativa) is one of the most important cereal crops in the world, providing the main energy for more than half of the world's population [Rice , encodes cytokinin oxidase/dehydrogenase 2 (OsCKX2), which can catalyze the degradation of active cytokinins [OsCKX2 expression has been successfully used in rice breeding practice to increase seed yield [CKX2 through directly binding to its promoter [Cytokinin is a specific hormone that affects plant growth and development, and plays an important role in regulating shoot apical meristem (SAM) in plants , 20\u201322. tokinins . Decreastokinins . Increased yield . Transcrpromoter . ERECTA1promoter . A recenpromoter . HoweverFRIZZY PANICLE (FZP), is involved in the transition from spikelet to floral meristem identity, which contains an APETALA2/ETHYLENE RESPONSE FACTOR (AP2/ERF) domain transcription factor. FZP is an ortholog of the maize transcription factor BD1 [FZP at the transcriptional stage [FZP translational repression by interacting with CUREs in the 3\u2019 UTR of FZP mRNA, leading to changes in the number of secondary branches and the grain number per panicle [The spikelet identity gene, ctor BD1 , 31, 32.al stage . Deletioal stage . In anot panicle . HoweverABNORMAL PANICLE 1 (ABP1) gene, which regulates spikelets development and grain yield in rice. Map-based cloning revealed that ABP1 was identical to FRIZZY PANICLE (FZP). Molecular evidence shows that FZP directly binds to the motif AGCCGCC in the DST promoter that represses its expression. Consequently, the expression level of OsCKX2 was upregulated and the level of cytokinin decreased in the inflorescence meristem of fzp mutant, which reduces the SAM activity and the grain number of per panicle. Our findings reveal that FZP regulates grain number by negatively controlling the function of DST-OsCKX2 module, which provides novel insight into the regulation of cytokinin homeostasis in rice.In this study, we identified an abnormal panicle 1 (abp1) from an EMS-treated mutant pool of the elite indica rice variety YK17 (Zhongjiazao17). The abp1 mutant was similar to the wild type in plant morphology  were constructed. The gene was mapped in the chromosome 7 primarily, and delimited to a 995\u00a0kb region between SSR markers MM0148 and MM3834, which harbors a Frizzy panicle  gene  experiments was in the young panicle (\u2264\u20090.5\u00a0cm) of fzp and wild-type. A total 578 differentially expressed genes (DEGs) were identified, including 161 downregulated and 417 upregulated in fzp  assay, the result showed that FZP could bind to the promotor of DST  assay was conducted by using proDST: LUC as a reporter. In rice protoplasts, effectors 35S: FZP significantly repressed the transcription of the reporter compared with the negative control  controls panicle development by regulating the activities of florescence meristem activity, mutation in TAW1 shows the differentiation of spikelet meristem was delayed, the differentiation time of branch meristem was prolonged, and significantly increases the number of secondary branches and spikelets in rice [RCN1and RCN2 (RICE CENTRORADIALIS) delayed the transition from branch meristem to spikelets meristem, resulting in an increased number of branches and the grains number of per panicle [FZP is involved in the differentiation of spikelets meristem and prevent the formation of axillary meristem, has become a marker gene for the development of spikelet meristem in grasses, several FZP alleles have been cloned, Our results showed that ABP1 is a severely active allele of FZP, grain number per main panicle of abp1 was reduced by 66% compared to wild type, the floral primordia was not differentiated in abp1 panicle but replaced by higher-order branch primordia, and the grains were also smaller than the normal plants  in maize belonged to AP2/ERF family, specifies determinate fates by suppressing indeterminate growth within the spikelets meristem, and which is required for timely conversion of spikelets meristem to floral meristems timely [MULTI-FLORET SPIKELET1 (MFS1) belong to AP2/ERF family, plays an important role in the regulation of spikelets meristem determinacy and floral organ identity, mutation in MFS1 resulted in an extra hull-like organ and an elongated rachilla [FZP also encodes an AP2/ERF-type transcription factor, ERF domain can be divided into three classes according to the amino acid characteristics, FZP belongs to the class II, and transient analysis shows that the class II members usually have transcriptional repressor activity [DST which controlling the number of grains per panicle was significantly up-regulated in fzp by analysis the transcriptome data, and the promoter of DST also contained the cis-acting GCC-box , a highly conserved DNA domain, are a class of plant-specific transcription factors . Previouelopment . A few es timely . Rice MUrachilla . FZP alsactivity . Howeverbox Fig.\u00a0. We revents Fig.\u00a0. Our resOsCKX4 antisense inhibition could increase the panicle size and spikelets number of plants without affecting other agronomic traits [OsCKX11 plays an important role in delaying leaf senescence, increasing seed number, and coordinating source and sink, osckx11 showed significantly increased branching, tillering, and seed number compared to WT [OsCKX family were also checked, the OsCKX3, 4, 8 and 9 were downregulated, which were considered to be the reason why the DHZ content was unchanged in the mutant , an important plant hormone, was first discovered in tobacco tissue culture, CTK are widely involved in regulating plant growth, development and response to the environment, such as promoting cell division, removing apical dominance and shortening the transition time from vegetative growth to reproductive growth . The shoc traits . OsCKX11ed to WT . In thisnt Fig. S. The DSTole Fig.\u00a0F.DST and regulates spikelet development by maintaining cytokinin homeostasis in inflorescence meristem via DST-CKX2 module. Our results indicate that FZP plays a critical role in regulating grain number through mediating cytokinin metabolism.Collectively, our findings indicate that FZP represses the transcription of fzp mutant was identified from EMS-treated seeds of the elite indica rice (Oryza sativa) variety YK17 (Zhongjiazao 17), the mutant stably inherited for multiple generations was applied for further experiments. The F2 mapping populations was derived from a cross between fzp mutant and tropical japonica rice variety D50. All plants were grown under natural conditions in the experimental fields of Zhejiang Academy of Agricultural Science in Hangzhou, China.The fzp were fixed in 2.5% glutaraldehyde solution at 4\u00a0\u00b0C overnight, and the samples were rinsed three times with 0.1\u00a0M, pH7.0 phosphate buffer for 15\u00a0min each time. Then the samples were fixed in 1% osmic acid solution for 2\u00a0h, rinsed the samples three times with 0.1\u00a0M, pH7.0 phosphate buffer for three times. The samples were dehydrated with ethanol solutions of gradient concentrations, and then treated with 100% ethanol twice, 20\u00a0min each time. Drying process was performed in a Hitachi HCP-2  critical point dryer. The samples were subsequently sputter-coated with gold and analyzed using the Hitachi SU-8010 scanning electron microscope .For scanning electron microscopy analysis, the tissue samples collected from YK17 and 2 plants, we delimited the gene to 995\u00a0kb region between MM0148 and MM3834. For the complementation of fzp, the FZP genomic DNA fragment containing 2.6-kb upstream sequences and 1.2-kb downstream sequence was inserted into the pCAMBIA2300 vector using kpnI and xbaI sites. The resulting plasmid was introduced into fzp mutant to generate transgenic plants [To determine the mutated gene, both parents and 20 individuals with the abnormal panicle phenotype were selected for initial linkage analysis. More than 200 simple sequences repeated (SSR) markers evenly distributed on 12 chromosomes of rice were used for preliminary mapping. The mutant control gene was initially located on chromosome 7. Using another 192 Fc plants . All prifzp using Trizol reagent (Life Technologies). The method of RNA extraction from developing seeds was according to a modified SDS-Trizol method [UBQ gene (LOC_Os03g13170) was used as internal control. The relative mRNA level of tested genes was normalized to UBQ and calculated by the 2\u2013DDCT method [Total RNA was extracted from different plant tissues except developing seeds of wild-type and l method . First Sl method . ExperimT method . Primersfzp and wild-type were collected, RNA extraction as previously described. Illumina Hiseq platform was used for sequencing in Novogene (China). Differentially expressed genes (DEGs) were identified as genes with absolute value of log2Fold changed\u2009\u2265\u20091 and q-value\u2009<\u20090.005 using DEGseq. For GO and KEGG analysis, Goseq and KOBAS (2.0) were used. The threshold of corrected P-value\u2009<\u20090.05 was used to identify significantly enriched GO terms and KEGG pathways.Young panicle samples (\u2264\u20090.5\u00a0cm) of \u25e6C in the dark, the GFP signals were observed under a Zeiss LSM510 laser-scanning confocal microscopy . The primers of this experiment were listed in Supplemental Table SThe full-length coding sequence of FZP without stop codon from YK17 was amplified by PCR. Then the PCR product was cloned into pAN580 vector to get the FZP-GFP construct . The fusFZP was amplified and inserted into pB42AD, the DST promoter sequence was inserted into pLacZ2u to generate ProDST: LacZ2u. The plasmids were co-transformed into the yeast strain EGY48, the empty pB42AD in combination with the LacZ reporter constructs were used as negative controls [For yeast one-hybrid assay, the CDS of controls . The traE. coli DE3 cells and purified using MBPSep Dextrin 6FF Chromatography Column  based on the manufacturer\u2019s instructions. For EMSA assays, the probes of DST (62 nt in length) containing a motif AGCCGCC was commercially synthesized and labeled with an EMSA probe biotin labeling kit . Unlabeled DNA oligos were used as competitors. Reaction system was performed in a 10\u03bcL reaction volume which containing 2\u03bcL 5\u2009\u00d7\u2009EMSA/Gel-shift binding buffer, 5\u00a0nmol purified recombinant protein and 2\u00a0nmol biotin-labeled probe. EMSA assays were performed with the chemiluminescent EMSA kit .Full length CDS of FZP was cloned into the Pmal-c2x to fuse with MBP tag, the recombinant protein was then transformed into 35S: NONE as an effector. Total 10\u00a0\u03bcg of plasmid  was used for the transformation in rice protoplast. Protoplast extraction and transformation were performed as previously described [For dual-LUC assay, the 1.2\u00a0kb promoter sequence of DST was amplified and cloned into vector 190LUC as a reporter, and the full-length coding sequences of FZP was inserted into the control vector pescribed . All theFor endogenous cytokinin level assay, 1\u00a0g young panicles (\u2264\u20090.5\u00a0cm) were collected and pooled for measurements. Three biological replications were performed. Quantification of endogenous cytokinin was performed as previously described .Additional file 1. Additional file 2. Additional file 3. Additional file 4."]}
-{"representative": "Reherniation and reoperation rates of 4.5%\u201336% are reported in canine patients treated for intervertebral disc herniation (IVDH). Decision\u2010making for surgical reintervention can prove challenging, especially since common postoperative changes are poorly described on MRI. The purpose of this single\u2010center, retrospective, descriptive study was to describe the MRI characteristics of\u00a0the surgical site in dogs treated for thoracolumbar IVDH and presenting for ongoing or recurrent neurological signs. Twenty\u2010one patients were included for a total of 42 MRI studies. Chondrodystrophic breeds, specifically Dachshunds, were overrepresented. Mean number of days between surgery and second MRI was\u00a0335\u00a0(range 2\u20131367). Metallic susceptibility artifacts were seen in seven of 21\u00a0cases\u00a0(33%), but these were limited in extent, spanning on average 1.3 vertebral bodies. In 11 cases, spinal cord compression suspected to be clinically significant was found at the surgical site; the extradural compressive material consisted of intervertebral disc material only, or a combination of intervertebral disc material and hematoma or inflammatory changes in 10 cases, and a displaced articular process and fibrous tissue in one case. The latter is a newly described complication of mini\u2010hemilaminectomies. Paravertebral soft tissue changes and vertebral new bone formation varied according to the postoperative stage at which the patients were imaged. The results of this study supported the use of MRI as a diagnostic modality for spinal imaging following IVDH surgery, and showed that the presence of extradural disc material at a spinal surgical site is common along with various vertebral and paravertebral changes. ECVNEuropean College of Veterinary NeurologyIVDintervertebral discIVDHintervertebral disc herniationIVDMintervertebral disc material1Recurrence of clinical signs affects an estimated 4.5\u201312.3%Residual spinal cord compression is commonly reported following surgery, with variable rates depending on the technique performed.The objectives of this study were therefore to search for a population of dogs having undergone surgery for thoracolumbar IVDH as well as a postoperative MRI, and (1) assess the frequency and diagnostic impact of susceptibility artifacts on postoperative MRI studies; and (2) describe the changes seen at the surgical site on MRIs performed to investigate ongoing or recurrent neurological signs.22.1This was a single\u2010center, retrospective, descriptive study. Records of canine patients seen at the Queen's Veterinary School Hospital (QVSH) between January 2009 and September 2020 were screened. Informed consent was obtained from all owners at the time of admission, and the authors obtained ethical approval from the Cambridge University Ethics & Welfare Committee reference CR553.Criteria for case inclusion were (1) a diagnosis of thoracolumbar IVDH based on MRI findings and surgical confirmation; (2) a postoperative follow\u2010up MRI study was performed due to clinical need ; and (3) all MRI studies included at least T2\u2010weighted (T2W) and T1\u2010weighted (T1W) sagittal and transverse sequences of the surgical site. A radiology resident (A.\u2010L.P.) and a European College of Veterinary Diagnostic Imaging (ECVDI)\u2010certified veterinary radiologist (M.\u2010A.G.) were responsible for final decisions for case inclusion or exclusion, as well as for consensus reviewal of the images.2.2Patients\u2019 records were reviewed by a veterinary radiology resident (A.\u2010L.P.). The following data were recorded: breed (classified as chondrodystrophic or non\u2010chondrodystrophic according to available lists of breeds associated with the FGF4\u201012 and FGF4\u201018 mutationsThe magnetic resonance (MR) images were retrieved and reviewed by the veterinary radiology resident (A.\u2010L. P.) and an ECVDI\u2010certified veterinary radiologist (M.\u2010A. G), using an open source 64\u2010bit medical image viewer . At the time of image review, the two assessors were blinded to patient data and previous imaging reports. The MR images were assessed for susceptibility artifacts compatible with the presence of metallic material (referred to as susceptibility artifacts for the remainder of the study), presence and characteristics of extradural material, and changes to the vertebrae, spinal cord, and paravertebral soft tissues. On the first MRI study of each patient, the degree of degeneration of the herniated IVD was classified as completely degenerate, partially degenerate, or non\u2010degenerate, based on an entirely lost, decreased, or intact T2W hyperintensity of the nucleus pulposus, respectively, and this is illustrated in Figure\u00a033.1Clinical and imaging details for each case are provided in Supporting Information 3.2Duration of neurological clinical signs prior to first presentation ranged between 24\u00a0h and over 180 days (median 6 days). The most common clinical signs included back pain, lethargy, reluctance to walk, paraparesis, paraplegia, and ataxia.The affected spinal segment was the thoracolumbar junction (T10\u2010L3) in 18 patients , and the lumbar spine (L3\u2010L7) in 3 patients .\u00ae Surgairtome Two\u00ae and OralMax\u2122 Pneumatic System, ConMed, Utica, New York) and rongeurs.All patients underwent spinal surgery within 24\u00a0hours of their first MRI. In total, 14  dogs underwent a hemilaminectomy and seven  dogs undervent a mini\u2010hemilaminectomy. All surgeries were carried out by a European College of Veterinary Neurology (ECVN) resident, under the supervision of an ECVN\u2010boarded specialist. Several residents and a total of 10 ECVN specialists were involved, in many different combinations. Although the surgical approaches were grossly standardized for both hemilaminectomies and mini\u2010hemilaminectomies, technical specifications such as the number of muscle detachments and extent of surgical window in the bone were not available from the surgical reports. None of the surgeons involved used subcutaneous fat grafts. To create the vertebral bony window, all surgeons used a high\u2010speed drill . One postoperative MRI was performed using a 1.5 Tesla MR magnet . Besides the required T2W and T1W sagittal and transverse sequences focused on the surgical site, additional sequences were also reviewed when available including T1W dorsal, three\u2010dimensional hybrid contrast enhancement, and dorsal Short Tau Inversion Recovery. The sequences and settings varied between patients (Supporting Information 3.4Pertinent imaging findings of sampled dogs are summarized in Supporting Information 3.5The mean number of days between surgery and second MRI study was 335 (range 2\u20131367 days) days. Eight patients were included in the early postoperative period , and 13 patients in the late postoperative period .3.6Susceptibility artifacts were present in seven cases 7/21, 33%), of which three  cases were classified as moderate and four  cases as marked. An example of each magnitude of signal distortion is available in Figure\u00a01, 33%, oDue to interference from susceptibility artifact at the surgical site, certain patients had to be excluded from the assessed population for the following imaging criteria located at the surgical site: degree of compression of the spinal cord, length of intramedullary T2W hyperintensity, tethering of the spinal cord, bony changes, reduction in volume of the epaxial muscles, change in intensity of the ipsilateral epaxial muscles, and presence of collections of fluid in the paravertebral soft tissues. In some patients with moderate susceptibility artifact, the disruption in signal was lateralized enough to assess the adjacent vertebral canal accurately, and this was taken into account when excluding cases for certain imaging features. Eventually, exclusions from specific imaging features applied to one patient from the early postoperative group (case 20) and four patients from the late postoperative group . Purely imaging\u2010based results are therefore presented out of a total of 7 patients for the early postoperative group, out of 9 patients for the late postoperative group, and out of a total of 16 when both groups are combined.3.7Among the eight patients of the early postoperative group, only one  patient recovered well from the surgery before relapsing (case 13), with the others showing poor post\u2010surgical improvement or even deterioration of their neurological signs. Five  of these patients had evidence of ongoing or recurrent compression of the spinal cord at the surgical site , including case 13, with only one  patient having neurological signs attributed to a disc extrusion distant from the surgical site, and one  patient showing no evidence of spinal cord compression. In one  patient, the MRI was inconclusive due to susceptibility artifact and no second surgery was performed, precluding an accurate diagnosis. In this patient, the surgical site was presumed to be the site of the focal myelopathy responsible for the neurological signs in the absence of other visible lesions in the remainder of the studied spinal segment. In the 5 patients with identified compressive extradural material at the surgical site, this was causing marked, moderate or mild compression of the spinal cord in one, three, and one patients, respectively. Four patients from this group underwent surgical revision of the surgical site and all but one showed improvement of their neurological status after the second surgery.Of the 13 patients that belonged to the late postoperative group, four patients had a poorly diagnostic MRI study at the level of the surgical site due to susceptibility artifact. In this group, 10  patients made a full recovery following surgery and three  patients only made a partial recovery. These three patients showed mild chronic neurological deficits that eventually acutely deteriorated; one had no evidence of ongoing compression at the surgical site and a compressive distant IVDH, 1 had evidence of mild compression at the surgical site only, and one had a compressive distant IVDH with a poorly characterizable surgical site due to localized susceptibility artifact. Of the 10 patients that had recovered fully from the surgery, three had imaging evidence that compression of the spinal cord at the surgical site was the cause of the presenting neurological signs and an additional patient had suspected spinal cord compression at the surgical site in the absence of other visible compressive lesions of this spinal segment. This last patient (case 16) underwent surgical revision of the previous mini\u2010hemilaminectomy site which resulted in removal of a displaced articular facet and fibrous material from the vertebral canal. Of the three patients that recovered fully from initial surgery, then represented in the late postoperative period with clinically significant spinal cord compression at the surgical site by extradural IVDM , two had concurrent IVD fenestration at the time of initial surgery. Finally, six patients were thought to have relapsed due to IVDH at a different disc space, of which two were free of compression at the surgical site, two showed evidence of extradural compression at both the surgical site and a distant disc space, and two had too much susceptibility artifact to characterize the surgical site fully on MRI. The degree of spinal cord compression at the surgical site was deemed to be moderate in one patient, and mild in five patients. Five patients underwent spinal surgery to remove extradural material at a site distant from the previous surgical site, with only one patient undergoing revision of its previous surgical site (case 16).When assessing specifically the central T2W hyperintensity of the intervertebral discs that were not herniated on the first MRI study but herniated on the second study, six were classified as completely degenerate, two as partially degenerate, and one as nondegenerate on the initial MRI.3.8The changes to the vertebrae could not be accurately described in the presence of adjacent susceptibility artifact, and therefore the aforementioned 5 postoperative MRI studies were excluded from the following results.Bony defects were clearly visible without evidence of new bone formation in 10 patients 10/16, 63%); this included all patients  from the early postoperative period, and three patients  from the late postoperative period, up to 839 days after surgery , and hyperplastic vertebral new bone formation was identified in three of 16 patients (19%). These six patients all belonged to the late postoperative group.There was evidence of displacement of a cranial articular facet of L1 following a left\u2010sided T13\u2010L1 mini\u2010hemilaminectomy in two patients imaged within a week of surgery. One of them showed a clearly visible non\u2010compressive displaced articular facet on MRI Figure\u00a0, while t3.9On 13 of the first MRI studies , the spinal cord showed a focal area of T2W hyperintensity that remained T1W isointense, overlying the diseased IVD space. This spanned a length of less than two vertebral bodies in nine cases (43%) and over two vertebral bodies in four cases (19%). Of these four cases, two made a full recovery after the initial surgery, one remained mildly ataxic for 27 months postsurgery, and one developed myelomalacia within days of surgery, highly suspected from the clinical evolution and second MRI and confirmed at postmortem examination.On the second MRI studies, after exclusion of the five cases with susceptibility artifacts, this focal T2W hyperintense region of the spinal cord had increased in length , decreased in length , or remained absent .The increase in length was superior to two vertebral bodies in three cases , equivalent to 1 to 2 vertebral bodies in length in two cases , or inferior to one vertebral body in two cases .Of the nine cases in which either the spinal cord was within normal limits, or the T2W hyperintensity of the spinal cord decreased, one belonged to the early postoperative group and eight to the late postoperative group. Five of these patients had a good clinical outcome, and four were lost to follow\u2010up.Of the 16 follow\u2010up MRI studies that were not affected by susceptibility artifacts, tethering of the spinal cord to the surgical site was present in four 4/16, 25%) studies, all belonging to the late postoperative group. Concurrent attenuation of the CSF and fat columns ipsilateral to the tethering was visible, along with widening of the contralateral CSF column. This is illustrated in Figure\u00a0% studies3.10Unilateral changes in the paravertebral soft tissues were also appreciated in the 16 postoperative MRI studies that were not affected by susceptibility artifacts, both in the early (7 studies) and in the late (9 studies) postoperative groups.Common changes seen in the patients imaged within 14 days of surgery included increased volume of the epaxial muscles over the surgical site, associated with a diffuse to patchy T2W hyperintensity that remained T1W isointense , focal collections of T2W markedly hyperintense, T1W mildly hyperintense to muscle material in the paravertebral soft tissues , and multifocal subcutaneous small rounded signal voids . These changes were never seen in patients imaged later than 14 days after surgery.From 14 days onward, five of nine 56%) patients showed a focal reduction in the volume of the epaxial muscles ipsilateral to the surgery, and these muscles had a similar increased signal intensity on both T2W and T1W sequences when compared to the preoperative studies. A tract of T2W and T1W hyperintense tissue could be identified in two  patients of this group along the spinous process, in the area of the surgical approach. This is also illustrated in Figure\u00a06% patienFinally, a common finding that could be appreciated in all 21 postoperative MRI studies despite the presence of susceptibility artifacts was the presence of thin linear T2W/T1W hypointense subcutaneous tracts in the area of the surgical approach, found in all patients in the early postoperative group (100%), and eight of 13 patients in the late postoperative group (62%).4Findings from this study supported using follow\u2010up MRI of dogs treated for IVDH for characterizing the changes at the surgical site, with only a few occurrences of MRI studies being rendered poorly diagnostic due to susceptibility artifacts. Several of these postoperative changes could also be related to the stage of the postoperative period, with some being more or less common depending on the time elapsed since surgery. Due to the presence of pain or neurological deficits in the patients included in this study, the clinical impact of these changes diagnosed on MRI could not be ascertained. The population included in the present study showed characteristics that were similar to those from other publications on canine IVDH, with chondrodystrophic breeds and more particularly Dachshunds being overrepresented, and most patients being middle\u2010aged (median age of 6 years 2 months old).In 16 of 21 patients (76%) included in this study, metallic susceptibility artifacts were either not present or did not hinder the evaluation of the vertebral canal. This does not support the findings of an earlier study, that speculated that susceptibility artifacts would be common postoperatively and therefore MRI may not be an adequate imaging modality for patients that had undergone spinal surgery.Extradural IVDM at the surgical site was described in 11 patients (5 from the early postoperative group and 6 from the late postoperative group), which represents 52% of the study population. It remains unclear whether this was residual from surgery or newly herniated IVDM. The imaging evidence of persistent extradural compression of the spinal cord alongside the history of clinical deterioration or failure to improve prompted surgical reintervention in all patients which showed compression of the spinal cord at the surgical site during the early postoperative period.The clinical significance of the presence of spinal compression at the surgical site was considered in light of the presence or absence of other spinal lesions. Compression at the surgical site was suspected to be the cause of the neurological signs in 11 of the included patients, in the absence of another site of significant spinal cord compression. Following conclusions from previous studies,Nine patients showed a disc hernia distinct from the initial surgical site on their second MRI. When reviewing the central T2W hyperintensity of these intervertebral discs on the first MRI study of each patient, most  showed some degree of loss of this hyperintensity, indicating degeneration. This is consistent with the pathophysiology of IVD disease and previous publications.Bony defects were more clearly discerned in the early postoperative period, where all patients imaged within 2\u00a0weeks of surgery showed a clearly identifiable gap in the vertebral bone corresponding to the surgical window. Marked vertebral new bone formation was found in three MRI studies , all in the late postoperative period. Interestingly, different degrees of bony defects and new bone formation could be seen in patients imaged at similar postoperative stages, showing that the amount of new bone formation did not necessarily relate to the amount of time elapsed since surgery. From a clinical point of view, the presence of a large amount of new bone formation may complicate the surgical approach if surgical reintervention is required\u2014this was not the case for the included patients.When considering the difference in length of the T2W hyperintense region of the spinal cord between the first and second MRI studies, the five patients in which it increased in length by more than one vertebral body had a poor clinical outcome, whereas the other seven patients for which follow\u2010up was available were associated with good outcomes. Hypotheses as to the cause of this hyperintensity include contusion, edema, and gliosis, depending on the time frame since the insult to the spinal cord occurred\u2014the mechanism that causes this hyperintensity to increase or decrease in length over time is however unknown.Tethering of the cord to the surgical site was found in a quarter of patients with postoperative MRIs free of susceptibility artifacts. All of these four patients belonged to the late postoperative group. It is unclear why some patients developed this feature compared to others, and it is also difficult to estimate the clinical impact of this as at least two of these patients had a good neurological outcome.Unilateral changes in the epaxial muscles were common, and their nature varied depending on the time elapsed since surgery. In all patients imaged within 2\u00a0weeks of surgery, the epaxial muscles over the surgical site were mildly swollen, with a change in signal intensity consistent with inflammation or edema. Collections of fluid in the soft tissues adjacent to the surgical site, thought to be seroma or hemorrhagic fluid, were also common in the 2 weeks postsurgery (86% of cases). Finally, in five patients, multifocal small subcutaneous signal voids were present and thought to be due to subcutaneous emphysema and/or suture material. Soft tissue changes were evaluated subjectively and there was no appreciable difference between the patients that underwent hemilaminectomy and those that underwent mini\u2010hemilaminectomy.After the initial postoperative two weeks, just over half of patients (56%) showed a reduced volume of the operated epaxial muscles compared to the contralateral musculature, occasionally associated with an increase in signal intensity compatible with fatty infiltration. Although no muscle biopsies were performed, possible explanations for this include loss of innervation and/or loss of blood supply, causing muscular atrophy.The T2W and T1W hyperintense tract visible in two patients of the late postoperative group along the spinous process of the operated vertebra were hypothesized to be fatty infiltration in the area of dissection of the epaxial muscles from their bony attachments.Finally, approximately three quarters of the included population (76%) showed a linear tract in the subcutaneous fatty tissues in the area of the surgical approach, of a signal intensity suggestive of fibrosis or scar tissue.Limitations of this study include first of all its retrospective nature, which introduces variables such as non\u2010standardized MRI sequences, and record\u2010keeping. The authors however implemented strict inclusion criteria to mitigate this. Several different combinations of residents and specialists were involved in the surgeries, and although surgical approaches for both hemilaminectomies and mini\u2010hemilaminectomies are standardized to some degree, certain aspects of these techniques will inherently vary with the surgeon involved. Surgical reports did not offer details such as the length of the incision, the number of muscle detachments, and the size of the bony window. All the data were also collected from a single institution, and may therefore be biased by a number of factors such as the clinicians involved, the surgical material used, and the imaging acquisition methods. Case numbers were also small, although still comparable to other studies on the subject. Because several patients were treated conservatively following their second MRI, surgical confirmation was often not available for the findings of the follow\u2010up MRIs. All the patients included in the present study underwent a second MRI due to ongoing or relapsed neurological signs; it is therefore uncertain whether the changes described would be found in patients that recover uneventfully, and to what degree they contributed to the recurrence of neurological signs in our patients. Assessment of bony changes would also potentially have been more accurate on CT than MRI, and therefore further studies using CT to evaluate bony healing and remodeling following spinal surgery may be of interest. Finally, it is also important to consider that the low diagnostic impact of the susceptibility artifacts in this study may only be valid for low\u2010field MRI, as it is less sensitive to local magnetic field inhomogeneities compared to high\u2010field MRI.In conclusion, findings from this sample of dogs indicated that, contrary to what was suggested in a previous study, metallic susceptibility artifacts are uncommon in postoperative low\u2010field MRI studies, and that the disruption caused to the diagnostic quality of the MR images is focally limited to the surgical site. MRI can therefore be considered an adequate modality for patients that require postsurgical spinal imaging, although further studies may be required to extrapolate this finding to high\u2010field magnets. Additionally, this study has also shown that the appearance of spinal surgical sites on MRI is variable, with certain findings increasing or decreasing in prevalence according to the stage of the postoperative period. Additionally, ongoing or recurrent compression\u00a0of the spinal cord at the surgical\u00a0site is common, even in patients that have made a full recovery and present with a late recurrence of clinical signs.Category 1(a)Conception and Design: Peschard, Freeman, Genain(b)Acquisition of Data: Peschard(c)Analysis and Interpretation of Data: Peschard, Freeman, GenainCategory 2(a)Drafting the article: Peschard(b)Revising Article for Intellectual Content: Peschard, Freeman, GenainCategory 3(a)Final Approval of the Completed Article: Peschard, Freeman, GenainCategory 4(a)Agreement to be accountable for all aspects of the work ensuring that questions related to the accuracy or integrity of any part of the work are appropriately investigated and resolved: Peschard, Freeman, GenainThe authors have declared no conflict of interest.Preliminary results were presented at a QVSH meeting on Friday 5th of February 2021. The abstract was presented at the pre\u2010BSAVA EAVDI meeting on Wednesday 24th of March 2021.An EQUATOR network checklist was not used.Supplement 1: Details for individual cases.Click here for additional data file.Supplement 2: Technical parameters used for MRI studies  and number of studies for each MRI sequence used.Click here for additional data file.Supplement 3: Frequencies of the main imaging findings for included dogs, according to the stage of the postoperative period at which the second MRI was performed.Click here for additional data file.", "texts": ["Reherniation and reoperation rates of 4.5%\u201336% are reported in canine patients treated for intervertebral disc herniation (IVDH). Decision\u2010making for surgical reintervention can prove challenging, especially since common postoperative changes are poorly described on MRI. The purpose of this single\u2010center, retrospective, descriptive study was to describe the MRI characteristics of\u00a0the surgical site in dogs treated for thoracolumbar IVDH and presenting for ongoing or recurrent neurological signs. Twenty\u2010one patients were included for a total of 42 MRI studies. Chondrodystrophic breeds, specifically Dachshunds, were overrepresented. Mean number of days between surgery and second MRI was\u00a0335\u00a0(range 2\u20131367). Metallic susceptibility artifacts were seen in seven of 21\u00a0cases\u00a0(33%), but these were limited in extent, spanning on average 1.3 vertebral bodies. In 11 cases, spinal cord compression suspected to be clinically significant was found at the surgical site; the extradural compressive material consisted of intervertebral disc material only, or a combination of intervertebral disc material and hematoma or inflammatory changes in 10 cases, and a displaced articular process and fibrous tissue in one case. The latter is a newly described complication of mini\u2010hemilaminectomies. Paravertebral soft tissue changes and vertebral new bone formation varied according to the postoperative stage at which the patients were imaged. The results of this study supported the use of MRI as a diagnostic modality for spinal imaging following IVDH surgery, and showed that the presence of extradural disc material at a spinal surgical site is common along with various vertebral and paravertebral changes. ECVNEuropean College of Veterinary NeurologyIVDintervertebral discIVDHintervertebral disc herniationIVDMintervertebral disc material1Recurrence of clinical signs affects an estimated 4.5\u201312.3%Residual spinal cord compression is commonly reported following surgery, with variable rates depending on the technique performed.The objectives of this study were therefore to search for a population of dogs having undergone surgery for thoracolumbar IVDH as well as a postoperative MRI, and (1) assess the frequency and diagnostic impact of susceptibility artifacts on postoperative MRI studies; and (2) describe the changes seen at the surgical site on MRIs performed to investigate ongoing or recurrent neurological signs.22.1This was a single\u2010center, retrospective, descriptive study. Records of canine patients seen at the Queen's Veterinary School Hospital (QVSH) between January 2009 and September 2020 were screened. Informed consent was obtained from all owners at the time of admission, and the authors obtained ethical approval from the Cambridge University Ethics & Welfare Committee reference CR553.Criteria for case inclusion were (1) a diagnosis of thoracolumbar IVDH based on MRI findings and surgical confirmation; (2) a postoperative follow\u2010up MRI study was performed due to clinical need ; and (3) all MRI studies included at least T2\u2010weighted (T2W) and T1\u2010weighted (T1W) sagittal and transverse sequences of the surgical site. A radiology resident (A.\u2010L.P.) and a European College of Veterinary Diagnostic Imaging (ECVDI)\u2010certified veterinary radiologist (M.\u2010A.G.) were responsible for final decisions for case inclusion or exclusion, as well as for consensus reviewal of the images.2.2Patients\u2019 records were reviewed by a veterinary radiology resident (A.\u2010L.P.). The following data were recorded: breed (classified as chondrodystrophic or non\u2010chondrodystrophic according to available lists of breeds associated with the FGF4\u201012 and FGF4\u201018 mutationsThe magnetic resonance (MR) images were retrieved and reviewed by the veterinary radiology resident (A.\u2010L. P.) and an ECVDI\u2010certified veterinary radiologist (M.\u2010A. G), using an open source 64\u2010bit medical image viewer . At the time of image review, the two assessors were blinded to patient data and previous imaging reports. The MR images were assessed for susceptibility artifacts compatible with the presence of metallic material (referred to as susceptibility artifacts for the remainder of the study), presence and characteristics of extradural material, and changes to the vertebrae, spinal cord, and paravertebral soft tissues. On the first MRI study of each patient, the degree of degeneration of the herniated IVD was classified as completely degenerate, partially degenerate, or non\u2010degenerate, based on an entirely lost, decreased, or intact T2W hyperintensity of the nucleus pulposus, respectively, and this is illustrated in Figure\u00a033.1Clinical and imaging details for each case are provided in Supporting Information 3.2Duration of neurological clinical signs prior to first presentation ranged between 24\u00a0h and over 180 days (median 6 days). The most common clinical signs included back pain, lethargy, reluctance to walk, paraparesis, paraplegia, and ataxia.The affected spinal segment was the thoracolumbar junction (T10\u2010L3) in 18 patients , and the lumbar spine (L3\u2010L7) in 3 patients .\u00ae Surgairtome Two\u00ae and OralMax\u2122 Pneumatic System, ConMed, Utica, New York) and rongeurs.All patients underwent spinal surgery within 24\u00a0hours of their first MRI. In total, 14  dogs underwent a hemilaminectomy and seven  dogs undervent a mini\u2010hemilaminectomy. All surgeries were carried out by a European College of Veterinary Neurology (ECVN) resident, under the supervision of an ECVN\u2010boarded specialist. Several residents and a total of 10 ECVN specialists were involved, in many different combinations. Although the surgical approaches were grossly standardized for both hemilaminectomies and mini\u2010hemilaminectomies, technical specifications such as the number of muscle detachments and extent of surgical window in the bone were not available from the surgical reports. None of the surgeons involved used subcutaneous fat grafts. To create the vertebral bony window, all surgeons used a high\u2010speed drill . One postoperative MRI was performed using a 1.5 Tesla MR magnet . Besides the required T2W and T1W sagittal and transverse sequences focused on the surgical site, additional sequences were also reviewed when available including T1W dorsal, three\u2010dimensional hybrid contrast enhancement, and dorsal Short Tau Inversion Recovery. The sequences and settings varied between patients (Supporting Information 3.4Pertinent imaging findings of sampled dogs are summarized in Supporting Information 3.5The mean number of days between surgery and second MRI study was 335 (range 2\u20131367 days) days. Eight patients were included in the early postoperative period , and 13 patients in the late postoperative period .3.6Susceptibility artifacts were present in seven cases 7/21, 33%), of which three  cases were classified as moderate and four  cases as marked. An example of each magnitude of signal distortion is available in Figure\u00a01, 33%, oDue to interference from susceptibility artifact at the surgical site, certain patients had to be excluded from the assessed population for the following imaging criteria located at the surgical site: degree of compression of the spinal cord, length of intramedullary T2W hyperintensity, tethering of the spinal cord, bony changes, reduction in volume of the epaxial muscles, change in intensity of the ipsilateral epaxial muscles, and presence of collections of fluid in the paravertebral soft tissues. In some patients with moderate susceptibility artifact, the disruption in signal was lateralized enough to assess the adjacent vertebral canal accurately, and this was taken into account when excluding cases for certain imaging features. Eventually, exclusions from specific imaging features applied to one patient from the early postoperative group (case 20) and four patients from the late postoperative group . Purely imaging\u2010based results are therefore presented out of a total of 7 patients for the early postoperative group, out of 9 patients for the late postoperative group, and out of a total of 16 when both groups are combined.3.7Among the eight patients of the early postoperative group, only one  patient recovered well from the surgery before relapsing (case 13), with the others showing poor post\u2010surgical improvement or even deterioration of their neurological signs. Five  of these patients had evidence of ongoing or recurrent compression of the spinal cord at the surgical site , including case 13, with only one  patient having neurological signs attributed to a disc extrusion distant from the surgical site, and one  patient showing no evidence of spinal cord compression. In one  patient, the MRI was inconclusive due to susceptibility artifact and no second surgery was performed, precluding an accurate diagnosis. In this patient, the surgical site was presumed to be the site of the focal myelopathy responsible for the neurological signs in the absence of other visible lesions in the remainder of the studied spinal segment. In the 5 patients with identified compressive extradural material at the surgical site, this was causing marked, moderate or mild compression of the spinal cord in one, three, and one patients, respectively. Four patients from this group underwent surgical revision of the surgical site and all but one showed improvement of their neurological status after the second surgery.Of the 13 patients that belonged to the late postoperative group, four patients had a poorly diagnostic MRI study at the level of the surgical site due to susceptibility artifact. In this group, 10  patients made a full recovery following surgery and three  patients only made a partial recovery. These three patients showed mild chronic neurological deficits that eventually acutely deteriorated; one had no evidence of ongoing compression at the surgical site and a compressive distant IVDH, 1 had evidence of mild compression at the surgical site only, and one had a compressive distant IVDH with a poorly characterizable surgical site due to localized susceptibility artifact. Of the 10 patients that had recovered fully from the surgery, three had imaging evidence that compression of the spinal cord at the surgical site was the cause of the presenting neurological signs and an additional patient had suspected spinal cord compression at the surgical site in the absence of other visible compressive lesions of this spinal segment. This last patient (case 16) underwent surgical revision of the previous mini\u2010hemilaminectomy site which resulted in removal of a displaced articular facet and fibrous material from the vertebral canal. Of the three patients that recovered fully from initial surgery, then represented in the late postoperative period with clinically significant spinal cord compression at the surgical site by extradural IVDM , two had concurrent IVD fenestration at the time of initial surgery. Finally, six patients were thought to have relapsed due to IVDH at a different disc space, of which two were free of compression at the surgical site, two showed evidence of extradural compression at both the surgical site and a distant disc space, and two had too much susceptibility artifact to characterize the surgical site fully on MRI. The degree of spinal cord compression at the surgical site was deemed to be moderate in one patient, and mild in five patients. Five patients underwent spinal surgery to remove extradural material at a site distant from the previous surgical site, with only one patient undergoing revision of its previous surgical site (case 16).When assessing specifically the central T2W hyperintensity of the intervertebral discs that were not herniated on the first MRI study but herniated on the second study, six were classified as completely degenerate, two as partially degenerate, and one as nondegenerate on the initial MRI.3.8The changes to the vertebrae could not be accurately described in the presence of adjacent susceptibility artifact, and therefore the aforementioned 5 postoperative MRI studies were excluded from the following results.Bony defects were clearly visible without evidence of new bone formation in 10 patients 10/16, 63%); this included all patients  from the early postoperative period, and three patients  from the late postoperative period, up to 839 days after surgery , and hyperplastic vertebral new bone formation was identified in three of 16 patients (19%). These six patients all belonged to the late postoperative group.There was evidence of displacement of a cranial articular facet of L1 following a left\u2010sided T13\u2010L1 mini\u2010hemilaminectomy in two patients imaged within a week of surgery. One of them showed a clearly visible non\u2010compressive displaced articular facet on MRI Figure\u00a0, while t3.9On 13 of the first MRI studies , the spinal cord showed a focal area of T2W hyperintensity that remained T1W isointense, overlying the diseased IVD space. This spanned a length of less than two vertebral bodies in nine cases (43%) and over two vertebral bodies in four cases (19%). Of these four cases, two made a full recovery after the initial surgery, one remained mildly ataxic for 27 months postsurgery, and one developed myelomalacia within days of surgery, highly suspected from the clinical evolution and second MRI and confirmed at postmortem examination.On the second MRI studies, after exclusion of the five cases with susceptibility artifacts, this focal T2W hyperintense region of the spinal cord had increased in length , decreased in length , or remained absent .The increase in length was superior to two vertebral bodies in three cases , equivalent to 1 to 2 vertebral bodies in length in two cases , or inferior to one vertebral body in two cases .Of the nine cases in which either the spinal cord was within normal limits, or the T2W hyperintensity of the spinal cord decreased, one belonged to the early postoperative group and eight to the late postoperative group. Five of these patients had a good clinical outcome, and four were lost to follow\u2010up.Of the 16 follow\u2010up MRI studies that were not affected by susceptibility artifacts, tethering of the spinal cord to the surgical site was present in four 4/16, 25%) studies, all belonging to the late postoperative group. Concurrent attenuation of the CSF and fat columns ipsilateral to the tethering was visible, along with widening of the contralateral CSF column. This is illustrated in Figure\u00a0% studies3.10Unilateral changes in the paravertebral soft tissues were also appreciated in the 16 postoperative MRI studies that were not affected by susceptibility artifacts, both in the early (7 studies) and in the late (9 studies) postoperative groups.Common changes seen in the patients imaged within 14 days of surgery included increased volume of the epaxial muscles over the surgical site, associated with a diffuse to patchy T2W hyperintensity that remained T1W isointense , focal collections of T2W markedly hyperintense, T1W mildly hyperintense to muscle material in the paravertebral soft tissues , and multifocal subcutaneous small rounded signal voids . These changes were never seen in patients imaged later than 14 days after surgery.From 14 days onward, five of nine 56%) patients showed a focal reduction in the volume of the epaxial muscles ipsilateral to the surgery, and these muscles had a similar increased signal intensity on both T2W and T1W sequences when compared to the preoperative studies. A tract of T2W and T1W hyperintense tissue could be identified in two  patients of this group along the spinous process, in the area of the surgical approach. This is also illustrated in Figure\u00a06% patienFinally, a common finding that could be appreciated in all 21 postoperative MRI studies despite the presence of susceptibility artifacts was the presence of thin linear T2W/T1W hypointense subcutaneous tracts in the area of the surgical approach, found in all patients in the early postoperative group (100%), and eight of 13 patients in the late postoperative group (62%).4Findings from this study supported using follow\u2010up MRI of dogs treated for IVDH for characterizing the changes at the surgical site, with only a few occurrences of MRI studies being rendered poorly diagnostic due to susceptibility artifacts. Several of these postoperative changes could also be related to the stage of the postoperative period, with some being more or less common depending on the time elapsed since surgery. Due to the presence of pain or neurological deficits in the patients included in this study, the clinical impact of these changes diagnosed on MRI could not be ascertained. The population included in the present study showed characteristics that were similar to those from other publications on canine IVDH, with chondrodystrophic breeds and more particularly Dachshunds being overrepresented, and most patients being middle\u2010aged (median age of 6 years 2 months old).In 16 of 21 patients (76%) included in this study, metallic susceptibility artifacts were either not present or did not hinder the evaluation of the vertebral canal. This does not support the findings of an earlier study, that speculated that susceptibility artifacts would be common postoperatively and therefore MRI may not be an adequate imaging modality for patients that had undergone spinal surgery.Extradural IVDM at the surgical site was described in 11 patients (5 from the early postoperative group and 6 from the late postoperative group), which represents 52% of the study population. It remains unclear whether this was residual from surgery or newly herniated IVDM. The imaging evidence of persistent extradural compression of the spinal cord alongside the history of clinical deterioration or failure to improve prompted surgical reintervention in all patients which showed compression of the spinal cord at the surgical site during the early postoperative period.The clinical significance of the presence of spinal compression at the surgical site was considered in light of the presence or absence of other spinal lesions. Compression at the surgical site was suspected to be the cause of the neurological signs in 11 of the included patients, in the absence of another site of significant spinal cord compression. Following conclusions from previous studies,Nine patients showed a disc hernia distinct from the initial surgical site on their second MRI. When reviewing the central T2W hyperintensity of these intervertebral discs on the first MRI study of each patient, most  showed some degree of loss of this hyperintensity, indicating degeneration. This is consistent with the pathophysiology of IVD disease and previous publications.Bony defects were more clearly discerned in the early postoperative period, where all patients imaged within 2\u00a0weeks of surgery showed a clearly identifiable gap in the vertebral bone corresponding to the surgical window. Marked vertebral new bone formation was found in three MRI studies , all in the late postoperative period. Interestingly, different degrees of bony defects and new bone formation could be seen in patients imaged at similar postoperative stages, showing that the amount of new bone formation did not necessarily relate to the amount of time elapsed since surgery. From a clinical point of view, the presence of a large amount of new bone formation may complicate the surgical approach if surgical reintervention is required\u2014this was not the case for the included patients.When considering the difference in length of the T2W hyperintense region of the spinal cord between the first and second MRI studies, the five patients in which it increased in length by more than one vertebral body had a poor clinical outcome, whereas the other seven patients for which follow\u2010up was available were associated with good outcomes. Hypotheses as to the cause of this hyperintensity include contusion, edema, and gliosis, depending on the time frame since the insult to the spinal cord occurred\u2014the mechanism that causes this hyperintensity to increase or decrease in length over time is however unknown.Tethering of the cord to the surgical site was found in a quarter of patients with postoperative MRIs free of susceptibility artifacts. All of these four patients belonged to the late postoperative group. It is unclear why some patients developed this feature compared to others, and it is also difficult to estimate the clinical impact of this as at least two of these patients had a good neurological outcome.Unilateral changes in the epaxial muscles were common, and their nature varied depending on the time elapsed since surgery. In all patients imaged within 2\u00a0weeks of surgery, the epaxial muscles over the surgical site were mildly swollen, with a change in signal intensity consistent with inflammation or edema. Collections of fluid in the soft tissues adjacent to the surgical site, thought to be seroma or hemorrhagic fluid, were also common in the 2 weeks postsurgery (86% of cases). Finally, in five patients, multifocal small subcutaneous signal voids were present and thought to be due to subcutaneous emphysema and/or suture material. Soft tissue changes were evaluated subjectively and there was no appreciable difference between the patients that underwent hemilaminectomy and those that underwent mini\u2010hemilaminectomy.After the initial postoperative two weeks, just over half of patients (56%) showed a reduced volume of the operated epaxial muscles compared to the contralateral musculature, occasionally associated with an increase in signal intensity compatible with fatty infiltration. Although no muscle biopsies were performed, possible explanations for this include loss of innervation and/or loss of blood supply, causing muscular atrophy.The T2W and T1W hyperintense tract visible in two patients of the late postoperative group along the spinous process of the operated vertebra were hypothesized to be fatty infiltration in the area of dissection of the epaxial muscles from their bony attachments.Finally, approximately three quarters of the included population (76%) showed a linear tract in the subcutaneous fatty tissues in the area of the surgical approach, of a signal intensity suggestive of fibrosis or scar tissue.Limitations of this study include first of all its retrospective nature, which introduces variables such as non\u2010standardized MRI sequences, and record\u2010keeping. The authors however implemented strict inclusion criteria to mitigate this. Several different combinations of residents and specialists were involved in the surgeries, and although surgical approaches for both hemilaminectomies and mini\u2010hemilaminectomies are standardized to some degree, certain aspects of these techniques will inherently vary with the surgeon involved. Surgical reports did not offer details such as the length of the incision, the number of muscle detachments, and the size of the bony window. All the data were also collected from a single institution, and may therefore be biased by a number of factors such as the clinicians involved, the surgical material used, and the imaging acquisition methods. Case numbers were also small, although still comparable to other studies on the subject. Because several patients were treated conservatively following their second MRI, surgical confirmation was often not available for the findings of the follow\u2010up MRIs. All the patients included in the present study underwent a second MRI due to ongoing or relapsed neurological signs; it is therefore uncertain whether the changes described would be found in patients that recover uneventfully, and to what degree they contributed to the recurrence of neurological signs in our patients. Assessment of bony changes would also potentially have been more accurate on CT than MRI, and therefore further studies using CT to evaluate bony healing and remodeling following spinal surgery may be of interest. Finally, it is also important to consider that the low diagnostic impact of the susceptibility artifacts in this study may only be valid for low\u2010field MRI, as it is less sensitive to local magnetic field inhomogeneities compared to high\u2010field MRI.In conclusion, findings from this sample of dogs indicated that, contrary to what was suggested in a previous study, metallic susceptibility artifacts are uncommon in postoperative low\u2010field MRI studies, and that the disruption caused to the diagnostic quality of the MR images is focally limited to the surgical site. MRI can therefore be considered an adequate modality for patients that require postsurgical spinal imaging, although further studies may be required to extrapolate this finding to high\u2010field magnets. Additionally, this study has also shown that the appearance of spinal surgical sites on MRI is variable, with certain findings increasing or decreasing in prevalence according to the stage of the postoperative period. Additionally, ongoing or recurrent compression\u00a0of the spinal cord at the surgical\u00a0site is common, even in patients that have made a full recovery and present with a late recurrence of clinical signs.Category 1(a)Conception and Design: Peschard, Freeman, Genain(b)Acquisition of Data: Peschard(c)Analysis and Interpretation of Data: Peschard, Freeman, GenainCategory 2(a)Drafting the article: Peschard(b)Revising Article for Intellectual Content: Peschard, Freeman, GenainCategory 3(a)Final Approval of the Completed Article: Peschard, Freeman, GenainCategory 4(a)Agreement to be accountable for all aspects of the work ensuring that questions related to the accuracy or integrity of any part of the work are appropriately investigated and resolved: Peschard, Freeman, GenainThe authors have declared no conflict of interest.Preliminary results were presented at a QVSH meeting on Friday 5th of February 2021. The abstract was presented at the pre\u2010BSAVA EAVDI meeting on Wednesday 24th of March 2021.An EQUATOR network checklist was not used.Supplement 1: Details for individual cases.Click here for additional data file.Supplement 2: Technical parameters used for MRI studies  and number of studies for each MRI sequence used.Click here for additional data file.Supplement 3: Frequencies of the main imaging findings for included dogs, according to the stage of the postoperative period at which the second MRI was performed.Click here for additional data file."]}