diff --git "a/cluster/279.jsonl" "b/cluster/279.jsonl"
new file mode 100644--- /dev/null
+++ "b/cluster/279.jsonl"
@@ -0,0 +1,48 @@
+{"text": "Pilot studies are often used to transition therapies developed using animal models to a clinical setting. Frequently, the focus of such trials is on estimating the safety in terms of the occurrence of certain adverse events. With relatively small sample sizes, the probability of observing even relatively common events is low; however, inference on the true underlying event rate is still necessary even when no events of interest are observed. The exact upper limit to the event rate is derived and illustrated graphically. In addition, the simple algebraic expression for the confidence bound is seen to be useful in the context of planning studies. While pilot studies may vary in the fundamental objectives, many are designed to explore the safety profile of a drug or a procedure ,2. Often\u03b1 (the Type I error rate) and \u03b2 (the Type II error rate) may be inappropriate since the objective of the research is not to provide definitive support for one treatment over another [In the context of pilot studies, traditional levels of  another . For exa\u03b2) is of less practical importance in a single arm, non-comparative  pilot study since the results would almost always require confirmation in a controlled trial setting. Shih et al [Similarly, power % confidence interval is to be generated for \u03c0 and an estimate of the sample size, n, is desired. Denote X as the number of patients sampled who experience the adverse event of interest. Then, the probability of observing x events in n subjects follows the usual binomial distribution. Namely,For ease of presentation, assume the pilot study will involve \u03c0u as the upper limit of the exact one-sided 100 \u00d7 (1 - \u03b1)% confidence interval for the unknown proportion, \u03c0 [\u03c0u is the value such thatDenote rtion, \u03c0 . Then \u03c0ux = 0), equation (1) reduces toA special case of the binomial distribution occurs when zero events of interest are observed. In pilot studies with relatively few patients, this is of practical concern and warrants particular attention. When zero events are realized n = \u03b1.(1 - \u03b1)% confidence interval for \u03c0 isAccordingly, the upper limit of a one-sided 100 \u00d7 (1 - \u03c0u = 1 - \u03b1n1/. \u00a0\u00a0\u00a0 (2)\u03b1)% one-sided confidence interval is .The resulting 100 \u00d7 % confidence that the true rate did not exceed a pre-specified \u03c0, say \u03c00, given that zero adverse events were observed. Using (2), it follows that:Furthermore, one can consider using (2) in other clinically important manners. For instance, an investigator may be planning a pilot study and want to know how large it would need to be to infer with 100 \u00d7  declare that they have no competing interests.RC and RW contributed to the conceptualization, writing and editing of this manuscript."}
+{"text": "Incidence and mortality of human malignant melanoma has risen rapidly over recent decades. Although the notorious resistance to treatment is characteristic for metastatic malignant melanoma, only a few experimental models have been established to study the metastatic cascade or to test new alternative treatment modalities. Thus, new human models are wanted. Here, we describe the metastatic behaviour of seven human melanoma cell lines derived from two primary cutaneous melanomas  and five metastases established from liver (UKRV-Mel-4), skin , pleural effusion (UKRV-Mel-2) and lymph node (MV3). All cell lines were analysed for their capacity to grow in nude mice after s.c. and i.v. administration. M13 cells developed liver metastases spontaneously after s.c. injection, and subsequent passages of M13 and M7 melanoma cells caused liver metastases after i.v. injection, whereas MV3 and WM98-1 gave rise to lung metastases, using the same inoculation route. In contrast, WM 1341, UKRV-Mel-2 and UKRV-Mel-4 grew only very slowly in nude mice after s.c. injection and did not cause any metastases after i.v. or s.c. administration. The pattern of metastases or growth kinetics did not correlate with the interleukin 8 or tumour necrosis factor secretion of cell lines. Adhesion molecules and growth factor receptor expression on the cell lines differed widely, as determined by flow cytometry, with the low metastatic cell lines  demonstrating a marked reduction in VLA-1 and VLA-5 expression compared with the metastatic lines . Expression of pigment-related proteins such as tyrosinase, TRP-1, TRP-2, Melan-A/MART-1, gp100, MAGE1 or MAGE-3 was not associated with growth and metastatic characteristics of the melanoma cell lines analysed. In conclusion, the established human melanoma cell lines exhibited diverse growth behaviour in nude mice in congruence with some early established prognostic markers such as VLA-1 and VLA-5. The xenografts provide good models for further study of metastatic processes as well as for evaluation of alternative treatment modalities including new pharmaceutical drugs and gene therapeutic targeting using tissue-specific gene regulatory elements for gene targeting."}
+{"text": "PTEN-controlled PI3K-AKT-mTOR pathway represents one of the most deregulated signaling pathways in human cancers. With many small molecule inhibitors that target PI3K-AKT-mTOR pathway being exploited clinically, sensitive and reliable ways of stratifying patients according to their PTEN functional status and determining treatment outcomes are urgently needed. Heterogeneous loss of PTEN is commonly associated with human cancers and yet PTEN can also be regulated on epigenetic, transcriptional or post-translational levels, which makes the use of simple protein or gene expression-based analyses in determining PTEN status less accurate. In this study, we used network component analysis to identify 20 transcription factors (TFs) whose activities deduced from their target gene expressions were immediately altered upon the re-expression of PTEN in a PTEN-inducible system. Interestingly, PTEN controls the activities (TFA) rather than the expression levels of majority of these TFs and these PTEN-controlled TFAs are substantially altered in prostate cancer mouse models. Importantly, the activities of these TFs can be used to predict PTEN status in human prostate, breast and brain tumor samples with enhanced reliability when compared to straightforward IHC-based or expression-based analysis. Furthermore, our analysis indicates that unique sets of PTEN-controlled TFAs significantly contribute to specific tumor types. Together, our findings reveal that TFAs may be used as \u201csignatures\u201d for predicting PTEN functional status and elucidate the transcriptional architectures underlying human cancers caused by PTEN loss. PTEN (phosphatase and tensin homologue deleted on chromosome 10) tumor suppressor gene is mutated frequently in human cancers and cancer predisposition disorders PTEN genomic deletion, gene mutations, epigenetic silencing (e.g. silencing by DNA methylation or miRNAs), impaired membrane recruitment (e.g. loss of interaction with MAGI2) or decreased protein stability/activity mediated by various post-translational modification  The Determination of PTEN functional status can be further complicated by the intricate signaling pathways that are regulated by PTEN. Through its lipid phosphatase activity, PTEN regulates PI3K-AKT-mTOR signaling that are involved in downstream transcription machineries, such as NF-\u03baB, FOXO, and p53 PTEN expression using global gene expression profiling in a PTEN inducible system. We further hypothesized that vast target gene expression changes may be controlled by a few key transcription factors (TFs), which can be a more sensitive and accurate \u201csignature\u201d for PTEN status. However, expression levels of these TFs will not always be sufficient to reflect their activity since the activity of a transcription factor (TFA) is controlled by various post-translational modifications as well as co-activator and co-repressor activities. Previous works by us and others have shown that TFA can be best inferred from the transcript levels of its direct target genes, rather than its mRNA level using Network Component Analysis (NCA) To decipher functional status of PTEN and PTEN-controlled signaling network, we first analyzed the transcriptional targets which are immediately regulated by PTEN (see Pten null mouse embryonic fibroblasts (MEFs). We found that the activities of these PTEN-controlled TFs are significantly altered in prostate cancer mouse models. Furthermore, the TFAs of these TFs show enhanced sensitivity and specificity when used to predict PTEN status in human prostate, breast and brain tumors, as compared to the gene expression-based analysis.In this study, we identified 20 TFs whose activities are immediately altered upon the reexpression of PTEN re-expression, an inducible system was generated in which PTEN expression can be controlled in a doxycycline-dependent manner in the Pten null \u0394loxp/\u0394loxpPten cells L/LPten is a Pten WT line and isogenic to \u0394loxp/\u0394loxpPten). Consistent to our previous study, re-expression of PTEN was able to suppress the gene expression of p90MDM2 isoform without significant change in p76MDM2 isoform as previously reported (To identify transcription factors whose expressions or activities are directly regulated by reported  [21].PTEN re-expression by comparing gene expression levels 1 and 2 days after doxycycline (20 \u00b5g/mL) treatment with those before the treatment  are up regulated and 216 (61.4%) are down regulated by PTEN re-expression. Next we analyzed global gene expression alterations immediate following We reasoned that the PTEN-inducible genes must be regulated by the key transcription factors whose activities are controlled by PTEN. Therefore, we investigated PTEN immediately controlled TFs via network component analysis (NCA) in which the activities of TFs (TFAs) are deduced based on expression of their target genes. Different from conventional gene expression analysis, which focuses on statistically significant changes of individual genes, NCA deduces TFAs based on the concordant variations of all, rather than individual target genes, and that does not require the analyzed gene expressions to be statistically significant PTEN re-expression  while LEF1 expression level remained constant  analysis. c-MYC target genes BCAT1, CDK4, EIF4E, and SHMNT1 were selected because (1) their proximal promoter regions contain c-MYC consensus binding sequence (CACGTG), which is conserved between human and mouse; and (2) the control strengths by c-MYC were highly significant based on NCA analysis . Interestingly, hi-c-Myc shares 13 TFAs changes with Pten null or Pten null and mAKT1 models, of which seven are concordantly regulated, including Ar, Creb1, Hoxc8, Elk1, Smad1, Hif1\u03b1, Stat6 and c-Myc  PTEN deficiency frequently occurs in these cancers As shown in PTEN-controlled TFA patterns can also be used as signatures to separate PTEN negative from PTEN positive breast cancers  altered in the PTEN negative group in all three cancers. STAT6 TFA is decreased while the others TFA are increased in the PTEN negative group. The degree of overlap of the tumor type-specific PTEN-controlled TFAs is summarized by a Venn diagram in Given that the PTEN-controlled TFA signatures are associated with PTEN status in prostate, breast and brain tumors, we next asked if a particular subset of the transcription factors play more important role in each individual tumor type. To this end, we first compared each TFA between PTEN positive and negative samples, identified by both IHC/CN and TFA-based analysis. We further investigated the possible interactions among the TFAs by examining pair wise correlation coefficients of inferred TFAs across patient tumors in each tissue type. The absolute correlation coefficients between the pairs are illustrated in In this study we used NCA and its complementary trimming algorithm to reveal 20 TFs that immediately respond to the expression of PTEN in a PTEN inducible system. We found that the PTEN immediate responsive gene-based TFA signatures are more accurate and sensitive than either cancer-based TFA or gene expression-based analyses in predicting PTEN functional status in human cancers. These TFA-based signatures, therefore, provide readout of transcription factor activity even if their mRNA levels do not change, and help to overcome the complexity of multifactorial post-transcriptional PTEN signaling pathway regulations. Since mRNA profiles are currently measureable in clinical settings, our TFA-based signatures provide new rationales for stratifying patients according to their PTEN functional status and for monitoring treatment outcome in PI3K-targeted therapies.Saccaramyces cerevisiaeOur study testifies to the power of combining traditional genetic and biochemical approaches with mathematic algorithms in deciphering complicated transcription regulatory networks. NCA complements other classical bioinformatics methods, such as Principal Component Analysis (PCA) and Independent Component Analysis (ICA). In contrast to PCA and ICA, NCA utilizes biochemical constraints, i.e., the relationship between transcription factors and their regulated genes, rather than statistical or mathematical constraints in data deconvolution. This means if target genes of a certain TF concordantly altered their expressions, even though at the subtle levels upon stimulation, its NCA-derived TFA will show significantly changes. Besides, NCA also detangles effects of multiple TFs regulating a same gene. TFA profiles are more robust and reliable in representing the real activities than the expression of a TF specific target gene which may not be expressed in all tissues. This explains why TFA-based signatures are more reliable than gene-based signatures in predicting PTEN status in different tumor types. NCA has been used to reveal biological relevant network structure and regulatory dynamics in bacteria A shortcoming of NCA is that it depends on the information of TF and target gene relationship. For instance, although FOXO activity is known to be regulated by PTEN controlled PI3K/AKT pathway, FOXO TFA cannot be derived in PTEN inducible system because its target gene expression values are not available in the database we used. Nevertheless, the results obtained from our analyses are quite robust.Pten null mouse exhibit concordant alterations in their activities when the PTEN downstream AKT/mTOR pathway is manipulated genetically or pharmaceutically by the mTOR inhibitor rapamycin. This result implies that PTEN controls TFAs through its phosphatase activity by regulating the PI3K/AKT/mTOR pathway, which is known for regulating activities of several TFs including NF-\u03baB hi-c-Myc and Pten null or mAKT1 prostate cancer models in their associated prostate cancer-associated TFAs. It is worthy to note that c-MYC target genes that are perturbed by PTEN expression involve the regulation of cell growth, cell metabolism, and protein synthesis Although PTEN is not a TF, it can regulate TFAs through either phosphatase-dependent or -independent mechanisms. In the prostate cancer mouse models, the majority of TFs perturbed in the Our study reveals common and cancer tissue type-specific regulation of TFAs by the PTEN tumor suppressor. The six common PTEN-controlled TFAs including c-MYC most likely play an essential role in tumor development caused by PTEN loss and their activity may serve as surrogate markers for determining PTEN functional status and measuring response to targeted therapy. Other tissue-type-specific regulated TFAs may help us understand PTEN's tissue-specific function. The PTEN-controlled TFAs deduced by NCA, therefore, will aid in stratifying cancer patients according to PTEN functional status and in deciphering the complicated transcription regulatory networks controlled by the PTEN tumor suppressor. Although targeting transcription factors with small molecules remains challenging, recent works by Bradner and colleagues on selective inhibitions of BET bromodomains PTEN-inducible mouse Pten\u0394loxp/\u0394loxp MEF cells Total RNAs were extracted using RNeasy Mini kit (Qiagen). RNAs were reverse-transcribed by oligo(dT) primer using Superscript RT-PCR kit (Invitrogen), according to the manufacturer instructions. PCR reaction was performed under the following conditions: 94\u00b0C for 3 min; 94\u00b0C 30 Sec; 58\u00b0C for 30Sec; 72\u00b0C for 30 Sec for 40 cycles; and 72\u00b0C for 10 min, using iQ SYBER Green Supermix Kit from Bio-Rad. Chromatin immunoprecipitations were modified from the EZ- ChIP (Upstate) protocol using antibodies: anti-c-Myc  anti-LEF1 . The percentage of the bound DNA was quantified against the original DNA input using real time PCR analysis (Biorad). Primer sequences used for ChIP are as follows: AATCCGCTAGGTCGCGAGT; BCAT-3\u2032: AGCAAGACCTGGGGCAGTBCAT-5\u2032: TTACACTCTTCGCCCTCCTC; CDK4-3\u2032: ATGTGACCAGCTGCCAAAGCDK4-5\u2032: CAGGGCCAAACGGACATA; EIF4E-3\u2032: CAATACTCACCGGTTCGACAEIF4E-5\u2032: GCAGAGTGCACCTTCCTGA;SHMNT1-5\u2032: GTGCCACCAGTCCCAGACSHMNT1-3\u2032:GGGATAGCAAGCATCCAGAG;WISP1-5\u2032:  CCTTCATGACACGTGAAAGCWISP1-3\u2032:All the array datasets were downloaded from public domains, and were MIAME compliant. Mouse and MEF expression data was available through NCBI's Gene Expression Omnibus (GEO) with accession IDs GSE29010 and GSE1413, and normalized by RMA method. Human expression data sets were downloaded from GEO and other public domains see . If a geNCA is built based on log-linear model in which gene expression ratios are log-linearly proportional to activity ratios of their regulators. In the NCA pre-processing steps, expression data sets from single channel Affymetrix arrays were set in log ratios comparing the conditions of interest  to the references . Biological repeat arrays were averaged first before calculating the log ratios to filter out extreme value of log-ratio.We used the network structure information provided by Transcriptional Regulatory Element Database (TRED) from Cold Spring Harbor Laboratory Cluster 3.0 was used for the unsupervised hierarchical clustering analysis using TFAs/gene expression. The similarity between samples was represented by the cosine (or un-centered correlation) metric. Complete linkage was used to clusters samples. In the heatmap of prostate data the TFAs are colored code based on their relative values to the respective averages of normal samples to illustrate the direction of TFA variation to normal prostate tissue.In each human cancer dataset, Pearson correlation coefficient between each pair of TFAs was calculated. The unsupervised hierarchical clustering analysis was then used to rearrange the order of TFAs in the matrix of the absolute correlation coefficients.Whole-cell extraction was described detail in Figure S1Validation of PTEN-inducible systems. (A) Restoration of PTEN expression suppressing the expression of the p90 isoform, but not p76 isoform of MDM2 in PTEN inducible PC3 cells. (B) PTEN re-expression does not change the c-MYC, STAT6 and c-JUN total protein levels but does alter the ratio of phosphor-c-JUN to total c-JUN. Numbers indicate the relative ratio of phosphorylated to total protein, or the levels of c-Myc protein, with the PTEN null state defined as unity.(TIFF)Click here for additional data file.Figure S2Heatmap of TFAs changes deduced from gene expression profiles in PTEN inducible MEFs and prostate cancer mouse models. Heatmap showing PTEN-controlled TFAs that are significantly altered in PTEN-inducible MEF tissue culture cells; and a set of prostate cancer-related TFAs that are significantly altered during tumorigenesis in murine prostate cancer models, but not by re-expression of PTEN in the PTEN-inducible MEF system (Rapa: Rapamycin treatment).(TIF)Click here for additional data file.Figure S3The PTEN-control TFA-based unsupervised clustering analysis. Unsupervised clustering analysis, based on PTEN-controlled TFAs, was used to classify human tumor samples. (A) the first and (B) the second (NKI) breast cancer data sets and in (C) brain cancer dataset. In the first breast tumor data set (A), PTEN-controlled TFA-based unsupervised clustering yields a clustering pattern of tumor PTEN negative status (Group 1). As for the second breast cancer data set the dendrogram also illustrates the association of PTEN-negative Group 1 with poorly differentiated, ER-negative and basal-like phenotype.(TIF)Click here for additional data file.Figure S4NCA-inferred TFAs significantly altered in human breast cancer based on PTEN IHC. Log10-transformed t-test p values for each TFA between samples of different IHC-based PTEN status. The graph shows the 45 TFs with the highest log10-transformed p-values. The p-values >0.1 of the other 25 TFs are not shown. The dashed line (p\u200a=\u200a1e-4) indicates the threshold value for selecting the TFA-based PTEN-IHC-derived signatures used in the analysis in (TIF)Click here for additional data file.Table S1List of PTEN immediately controlled genes in MEFs.(XLS)Click here for additional data file.Text S1Supporting Information.(DOC)Click here for additional data file."}
+{"text": "In particular, a new method for direct and real-time visualization of the Cd uptake by the roots in the culture was first realized in this work.Rice is a major source of dietary intake of cadmium (Cd) for populations that consume rice as a staple food. Understanding how Cd is transported into grains through the whole plant body is necessary for reducing rice Cd concentrations to the lowest levels possible, to reduce the associated health risks. In this study, we have visualized and quantitatively analysed the real-time Cd dynamics from roots to grains in typical rice cultivars that differed in grain Cd concentrations. We used positron-emittingjaponica type) showed rapid saturation curves, whereas three high-Cd accumulating cultivars (indica type) were characterized by curves with a peak within 30 min after107Cd supplementation, and a subsequent steep decrease resulting in maintenance of lower Cd concentrations in their roots. This difference in Cd dynamics may be attributable to OsHMA3 transporter protein, which was recently shown to be involved in Cd storage in root vacuoles and not functional in the high-Cd accumulating cultivars. Moreover, the PETIS analyses revealed that the high-Cd accumulating cultivars were characterized by rapid and abundant Cd transfer to the shoots from the roots, a faster transport velocity of Cd to the panicles, and Cd accumulation at high levels in their panicles, passing through the nodal portions of the stems where the highest Cd intensities were observed.Imaging and quantitative analyses revealed the different patterns in time-varying curves of Cd amounts in the roots of rice cultivars tested. Three low-Cd accumulating cultivars (This is the first successful visualization and quantification of the differences in whole-body Cd transport from the roots to the grains of intact plants within rice cultivars that differ in grain Cd concentrations, by using PETIS, a real-time imaging method. Since then, the contamination of rice by Cd has been monitored to prevent it from being distributed to consumers in Japan, in accordance with the Food Sanitation Act established in 1969 in Japan. Nevertheless, the Cd contamination of rice is still a serious threat to Japanese people and other populations in the world that consume rice as a staple food, because rice is a major source of dietary intake of Cd. Understanding how Cd is taken up by rice roots and subsequently transported to rice grains is necessary for reducing Cd concentrations in rice as much as possible, thus diminishing the risk that Cd poses to human health.Cadmium (Cd) has an important impact on agriculture, as the excessive consumption of Cd from contaminated food crops can lead to toxicity in humans. High-dose Cd exposure is particularly toxic to the kidney and leads to renal proximal tubular dysfunction . In Japa1B-ATPase transporter OsHMA3, which is involved in Cd sequestration in root vacuoles [Arabidopsis thaliana [OsHMA2 in yeast have suggested that this gene is a good candidate for the control of Cd xylem loading in rice [Plant roots are the first entry point for Cd uptake from soil solutions, and the transport processes of Cd into the roots have been well reviewed from the viewpoints of physiological and genetic studies . A dose-vacuoles ,10. Xylethaliana ,12. In r in rice . The pro in rice ,14. Tana in rice  estimate in rice  collecte109Cd has been widely used to visualize Cd distribution within plant tissues [109Cd and115mCd) supplementation at the early ripening stage, and lesser amounts of Cd were distributed to grains, whereas the lowest levels of Cd were present in the leaves. However, only the static distribution of Cd at a given moment can be obtained by autoradiography. In recent years, the positron-emitting tracer imaging system (PETIS) has been employed to study various physiological functions in intact, living plants [52Fe [52Mn [62Zn [107Cd tracer and PETIS. The movement of Cd in the aerial part of rice (cultivar Nipponbare) in the vegetative and reproductive stages was captured as serial images, and various parameters (e.g. transport velocity in the shoot) were analysed quantitatively. However, a method for direct imaging of the underground parts, which should provide valuable information about the root uptake, remained to be developed because of interference by the highly radioactive culture solution.In general, radioisotope tracers are useful tools for analysing the spatial distribution or temporal change in the amount of a substance in the plant body. tissues ,18. For  tissues  observedg plants ,20. Thists [52Fe ,52Mn [22Mn [62Zn . RecentlMn [62Zn  establisIn this study, we employed PETIS in our two objectives: to realize direct observation of Cd uptake by the roots in the culture solution, and to characterize clearly the differences in Cd dynamics from the culture to the grains between the high- and low-Cd accumulating cultivars.107Cd dynamics , which were classified as having markedly high Cd concentrations in their grains and shoots (herein collectively referred to as \"high-Cd indica cultivars\"), the amounts of Cd in the roots peaked within 30 min of exposure to107Cd, and the subsequent decreases in Cd were monitored until the 5 h point  with lower Cd concentrations in their grains and shoots (herein collectively referred to as \"low-Cd japonica cultivars\"), the amounts of Cd in the Nipponbare and Sasanishiki roots plateaued or increased slightly after peaking at approximately 1 h. A delayed Cd peak was observed in the Koshihikari roots. In this study,107Cd was supplied only at the beginning of the imaging, and almost all of the107Cd in the culture solution was absorbed by the roots within approximately 5 h in all cultivars  and ROI-2 (leaf sheaths and leaf blades) are shown in Figure 107Cd supplementation and increased dramatically up to 10 h, particularly for the high-Cd indica cultivars. The amounts of Cd in ROI-1 were significantly higher in the high-Cd indica cultivars than in the low-Cd japonica cultivars up to 36 h. After 10 h, the amounts of Cd reached plateaus for all cultivars, but slight decreases were found in the high-Cd indica cultivars. Unlike the accumulation patterns of Cd in ROI-1, the amounts of Cd in ROI-2 (leaf sheaths and leaf blades) continued to increase linearly until the end of the experiment. There was an approximately 3-fold difference in the amount of Cd between the high-Cd indica cultivars and the low-Cd japonica cultivars.Figure japonica rice cultivars accumulated in their roots, whereas only 60-70% of the Cd in the indica rice cultivars was distributed in their roots. In the shoot parts, Cd accumulated at the shoot base in the highest proportions; this accounted for approximately 15-20% of the total Cd in the plant body for the high-Cd indica cultivars, whereas it was less than 10% for the low-Cd japonica cultivars. On the other hand, the proportions of Cd in the shoot base were approximately 50% of those in the total shoot and did not differ greatly between cultivars. In the leaves (leaf sheaths and leaf blades), Cd was mostly distributed in the younger leaves, that is, the 4th and 5th leaves, suggesting that Cd moves preferentially to new leaves after moving from the roots to the shoot bases.After the PETIS experiment, autoradiography was performed to obtain static distributions of Cd for each plant part at the vegetative stage  use of a root box with flat, shallow compartments, allowing detectors to focus on the roots; 2) use of a simple nutrient solution to avoid competition between Cd and other minerals at adsorptive sites in roots; and 3) ensuring application of adequate radioisotope activity for the quantitative measurements by taking into consideration the dynamic range of the PETIS. These technical improvements first enabled direct visualization of real-time Cd dynamics in the whole plant body, that is, from roots to grains.We applied the improved system to analyse the time-varying distribution of Cd to characterize the differences in Cd dynamics in rice cultivars varying in grain Cd concentrations.japonica cultivars showed gentle saturation curves, whereas three high-Cd indica cultivars showed a drastic drop  supply in this study, and this could be considered as a kind of pulse feed experiment. The curves obtained would naturally be different from those of roots with continuous Cd supply. The point is that the pulse feed experiments provide snapshots  of dynamics and the result with continuous feed could be described as their integration. In fact, the results from this study agreed well with our previous results obtained from the rice genotypes grown continuously in the Cd-polluted soil [japonica cultivars than in the high-Cd indica cultivars.This difference most probably depends on whether the rice plant inherently conserves the functional OsHMA3, which is a membrane transporter protein involved in Cd storage in root vacuoles. All high-Cd vacuoles ,10,28. Ovacuoles . This trs Figure  suggeststed soil ; root Cd107Cd had a strong presence in the non-elongated stems at the shoot bases  was found to be slightly faster than that for Koshihikari. However, the differences in the Cd transport velocity between genotypes were likely to be small. Instead, a remarkable difference (approximately 5-fold) was observed in the slopes of Cd accumulation to panicles. Therefore, this result indicates that the differences in root Cd dynamics also influence the Cd concentration of the long-distance Cd transport to panicles in rice cultivars.The Cd accumulation pattern of the neck node for the high-Cd accumulator BIL48 plants corresponded well to that of the node at the shoot base, showing the characteristic steep and linear increase, and subsequent plateau pattern of Cd accumulation Figures  and 4c. s Figure . Fujimak107Cd was supplied to the genotypes with emerged ears  supply might be a description of the Cd dynamics in rice at the vegetative and heading stages after water drainage in the paddy fields.In paddy fields, rice is mostly grown under submerged conditions in which bioavailable Cd is limited because of the rise in soil pH and decrease in the redox potential. Midseason drainage in Japanese paddy fields is widely recommended at the vegetative stage to avoid the root rot induced by continuous soil reduction. In addition, early drainage after panicle emergence is often practised in paddy fields to facilitate machine harvesting. Thus, rice is not continuously exposed to high bioavailable Cd in the soil, and the PETIS data obtained by a limited Cd  consisting of three indica rice cultivars  with markedly high Cd concentrations in their grains and shoots, and another three major japonica cultivars from Japan  with lower Cd concentrations in their grains and shoots [4)2SO4, 0.36 mM Ca (NO3)2\u00b74H2O, 0.54 mM MgSO4\u00b77H2O, 0.18 mM KNO3, 0.18 mM KH2PO4, 40 \u03bcM Fe(III)-EDTA, 18.8 \u03bcM H3BO3, 13.4 \u03bcM MnCl2\u00b74H2O, 0.32 \u03bcM CuSO4\u00b75H2O, 0.3 \u03bcM ZnSO4\u00b74H2O, and 0.03 \u03bcM (NH4)6Mo7O24\u00b74H2O. Kimura B solution has been widely used for growing rice plants [For the experiments conducted at the vegetative seedling stage, we used six rice cultivars  for 24 h before the start of the107Cd supplementation experiment. The solution was continuously aerated, and the surface levels were set a few centimetres below the boundaries between the shoot bases and roots by automatically supplying fresh solution from the reservoir tank as the plants took up the water. Purified107Cd and nonradioactive Cd at concentrations of 0.1 \u03bcM were simultaneously supplied as carriers to the 0.5 mM CaCl2 solution in which the plants were grown. Plants were placed in the mid-plane between the two opposing detector pairs of the PETIS apparatus . A pair of annihilation \u03b3-rays emitted from the decaying positrons was detected simultaneously, and the emission point was then determined as the middle point of the two incident points. Repeated determinations of the emission points reconstructed a static image of the tracer distribution. One frame, which is the unit of time required to obtain one static image with sufficient quality, was set to 4 min, and 540 (36 h) frames were collected to yield serial time-course imaging. The detectors were set at the roots, non-elongated stem bases (shoot bases), and panicles to monitor the dynamics of Cd in each part. The typical size of the FOV in the detector head was 12 cm in width and 19 cm in height, and the spatial resolution was approximately 2 mm. All PETIS experiments were conducted in a growth chamber at 30\u00b0C and 70% humidity, with continuous light at a density of 400 \u03bcmol m-2 s-1.The PETIS imaging experiments were conducted following the method of Fujimaki et al.  with modi et al. . Finallyhttp://rsb.info.nih.gov/ij). Because the ROI can be selected freely from the image data using this software, the radioactivity of107Cd over time within each ROI was extracted from the data. A time-course curve of Cd accumulation within the ROI indicated the amounts of total Cd, consisting of the sums of radioactive and nonradioactive Cd. All PETIS experiments were conducted two or three times, and the representative data are shown in this paper.To determine Cd dynamics in the plant body qualitatively and quantitatively, the dataset obtained from the PETIS apparatus was reconstructed using the NIH Image J 1.42 software . This isotope has a longer half-life (461 days) than107Cd (6.5 h), and it was absorbed by the plants during the PETIS experiments but not detected by the PETIS apparatus because it is not a positron emitter. After sufficient decay of107Cd within the test plants, they were separated into several parts and set on imaging plates  in cassettes. After a few days of exposure, the imaging plates were scanned using a bio-imaging analyser  to obtain the autoradiographic images for examining109Cd distribution in the plant bodies. The Cd concentrations in each plant part were determined with a well-type gamma counter .In the production process of1, NS, and SF initiated and coordinated the study. SI1, MI, TA, and MK prepared the experimental plants and participated in the PETIS imaging. NS, SIT, SI2, NK, and SF produced the107Cd tracers and carried out the PETIS imaging. NS and SIT processed the imaging dataset obtained by the PETIS. SI1 drafted the manuscript with the assistance of NS and SF. All authors discussed the results and commented on the draft manuscript, and read and approved the final manuscript.SI107Cd dynamics in the roots of six rice cultivars at the vegetative stageAnimation film of.Click here for file107Cd transport into shoots of six rice cultivars at the vegetative stageAnimation film of.Click here for fileAutoradiography of detached parts of plants at the vegetative stage 36 h after Cd supplementation. A, Nipponbare. B, Koshihikari. C, Sasanishiki. D, Choko-koku. E, Jarjan. F, Anjana Dhan.Click here for file107Cd accumulation in the panicles of Koshihikari and BIL48 at the grain-filling stageAnimation film of.Click here for file"}
+{"text": "A large amount of data supports the view that PTEN is a bona fide tumor suppressor gene. However, recent evidence suggests that derailment of cellular localization and expression levels of functional nonmutated PTEN is a determining force in inducing abnormal cellular and tissue outcomes. As the cellular mechanisms that regulate normal PTEN enzymatic activity resolve, it is evident that deregulation of these mechanisms can alter cellular processes and tissue architecture and ultimately lead to oncogenic transformation. Here we discuss PTEN ubiquitination, PTEN complex formation with components of the adherens junction, PTEN nuclear localization, and microRNA regulation of PTEN as essential regulatory mechanisms that determine PTEN function independent of gene mutations and epigenetic events. This inhibits PI3K downstream targets, mainly PKB-Akt [PTEN (phosphatase and tensin homolog deleted on chromosome ten)/MMAC (mutated in multiple advanced cancers) has been identified simultaneously by two research groups as a candidate tumor suppressor gene located at 10q23 and encoding 403 amino acids [ PKB-Akt \u201310. It s PKB-Akt \u201315. So f PKB-Akt . By virt PKB-Akt . PTEN co PKB-Akt , and dow PKB-Akt . Exogeno PKB-Akt , but the PKB-Akt  also ind PKB-Akt \u201323.In tumor tissue, proper function of PTEN acts as a tumor suppressor primarily through the ability to suppress proliferation and decrease cell survival. The frequent loss of PTEN function, through deletion, mutations, and/or decreased expression, is observed in hereditary cancers as well as sporadic cancers . In manyIn the absence of germline and monoallelic mutations, PTEN protein levels have been found to be progressively lost during cancer progression . A numbeThe relevance of downregulated PTEN protein levels, as opposed to a complete loss of PTEN, is best observed in mouse models where PTEN is genetically manipulated \u201337. In mIn some cancers, like nonsmall cell lung carcinoma (NSCLC), where PTEN expression is reduced or lost in 55%\u201374% of patients, genetic alteration such as loss of heterozygosity and epigenetic silencing were not good predictors of PTEN protein levels , 30. Wit\u03b2, have been reported to phosphorylate PTEN [NEDD4 ubiquitin-ligase activity, which downregulates PTEN protein levels, is enhanced by the small endosomal PY-motif containing membrane proteins Ndfip1 and Ndfip2 . This suate PTEN . In lighCalcium-dependent homophilic binding of the adhesion protein E-cadherin is vital for the cell-cell interaction found in epithelial tissue, while loss of E-cadherin expression is associated with transformation and metastatic cancers \u201355. It h\u03b1- and \u03b2-catenin, PTEN, PI3K, and E-cadherin [\u2212/\u2212 cells by the overexpression of MAGI-2 or by expressing an E-cadherin-\u03b1-catenin fusion protein. [\u03b2-catenin in a nonmalignant mammary acini model in laminin-rich extracellular matrix. In this model, either inhibition of E-cadherin function or reduction of PTEN protein levels abrogated acini organization and proliferation control suggesting that PTEN roles in cell adhesion and proliferation may be interconnected [MAGI (membrane-associated guanylate-kinase inverted) family members are multidomain scaffolding proteins with multiple sites for protein interaction. There are multiple splice variants of MAGI; MAGI-1a, MAGI-1b, MAGI-2, and MAGI-3, where each is expressed in a tissue-specific manner. MAGI proteins are part of a PDZ subfamily of proteins called MAGUK (membrane-associated guanylate kinases). Members of this family, including MAGI-2 and -3, were shown to directly bind PTEN in yeast two-hybrid screens , 69, 70.cadherin . In thiscadherin , 59. Indcadherin , 72 and cadherin . PTEN leprotein. . Our preonnected . The sur\u03b2-catenin is part of the cadherin-catenin complex and indirectly connects E-cadherin to the cytoskeleton. Studies have suggested that \u03b2-catenin negatively regulates PTEN transcription by blocking early growth response gene 1 (Egr1) [\u03b2-catenin at the plasma membrane. Thus, \u03b2-catenin cannot translocate to the nucleus and inhibit Egr1 transcription, the effect of which is continued PTEN transcription. Additionally, PTEN is protected in the signalosome from proteosomal degradation, resulting in sustained PTEN protein levels in the cytosol and subsequently negative regulation of the PI3K/AKT pathway. Loss of E-cadherin expression in cancer causes disruption of the signalosome, thus freeing \u03b2-catenin and PTEN from the MAGI scaffolding protein. The net effect of this is the proteosomal degradation of PTEN and the inhibition of PTEN transcription by \u03b2-catenin that has translocated to the nucleus.1 (Egr1) . Egr1 ha1 (Egr1) . Taken tThe existence of nuclear PTEN was reported in a number of cell models including primary neurons and endothelial cells , myoepit+2-regulated interaction and the binding was specific between the C2 PTEN domain and the calcium binding motif (EF-hand pair) of MVP [+2/calmodulin-dependant protein kinase) mediated activation of AMPK \u03b11/2 can bypass the inhibition of PTEN nuclear entry achieved with mTOR/S6K downregulation [The absence of a \u201ctrue\u201d nuclear localization signal within PTEN has led to a number of alternative mechanisms for nuclear entry of PTEN . One mec) of MVP . Other m) of MVP . Phospho) of MVP , 93\u201398. ) of MVP . Finallygulation  and thusIn seminal work, the functional significance of nuclear PTEN with regard to proliferation and cell cycle control has been revealed . In thisMicroRNAs (miRNAs) are short 18\u201325 nucleotide long noncoding RNAs involved in posttranscriptional regulation of gene expression . They nein vivo mouse model in which miR-21 was knocked out. This increased the expression of several miR-21 target genes including PTEN [In 2007, Meng et al. reported overexpression of miR-21 in human hepatocellular cancer using miRNA microarray assay . Inhibiting PTEN . In conting PTEN . Recent ing PTEN .MicroRNAs other than miR-21 have been shown to be involved in various biological events and disease through PTEN regulation. For instance, MiR-214 is involved in cell survival  and cellThere is ample evidence that the full functionality of PTEN is modulated by alternative mechanisms beyond gene mutations and epigenetic processes. For instance a number of tissue-specific cancers strongly associate with PTEN deregulation at the gene expression level, changes in PTEN posttranslational modifications, miss-guided PTEN subcellular localization, and PTEN-specific microRNA upregulation. Determining whether these alternative mechanisms are causal or a consequence of tumor initiation and progression or whether they produce tissue-specific effects is still an ongoing area of important research. Clinically, as PTEN-regulating pathways become fully resolved, essential factors will arise, hopefully providing new targets for the development of novel and effective anticancer therapies and diagnostic tools."}
+{"text": "PTEN is a lipid and protein phosphatase that regulates a diverse range of cellular mechanisms. PTEN is mainly present in the cytosol and transiently associates with the plasma membrane to dephosphorylate PIP3, thereby antagonizing the PI3-Kinase signaling pathway. Recently, PTEN has been shown to associate also with organelles such as the endoplasmic reticulum (ER), the mitochondria, or the nucleus, and to be secreted outside of the cell. In addition, PTEN dynamically localizes to specialized sub-cellular compartments such as the neuronal growth cone or dendritic spines. The diverse localizations of PTEN imply a tight temporal and spatial regulation, orchestrated by mechanisms such as posttranslational modifications, formation of distinct protein\u2013protein interactions, or the activation/recruitment of PTEN downstream of external cues. The regulation of PTEN function is thus not only important at the enzymatic activity level, but is also associated to its spatial distribution. In this review we will summarize (i) recent findings that highlight mechanisms controlling PTEN movement and sub-cellular localization, and (ii) current understanding of how PTEN localization is achieved by mechanisms controlling posttranslational modification, by association with binding partners and by PTEN structural or activity requirements. Finally, we will discuss the possible roles of compartmentalized PTEN in developing and mature neurons in health and disease. Phosphatase and tensin homolog located on chromosome 10 (PTEN) was originally characterized as a tumor suppressor that can inhibit proliferation, migration, cell growth, and apoptosis in a number of different cells. Subsequently it became apparent that, in addition to its role as a tumor suppressor, PTEN has many roles in the central nervous system (CNS) during the different stages of brain development and in adulthood. PTEN is highly expressed in neurons  domains, to recognize and bind this lipid on the plasma membrane. As suited for a second messenger, PIP3 is also subject to tight regulation by specific phosphoinositide phosphatases. PTEN is one of the most important phosphatases because it directly antagonizes the PI3K reaction by its 3-phosphatase activity and dephosphorylates PIP3 back to PIP2. In this sense, PTEN represents a brake built into PI3K signaling and its absence or dysfunction results in the constitutive and unregulated elevation of the signaling output of PI3Ks. Alternatively, PIP3 can be dephosphorylated by type II phosphoinositide 5-phosphatases like SH2-domain containing inositol 5-phosphatases 1 and 2 (SHIP1 and SHIP2) /H(+) exchanger regulatory factors) or \u03b2 -arrestins, which recruit PTEN to growth factor receptors  sensors to study the role of PIP3 at the synapse compartment, Ueda and Hayashi showed that PIP3 is primarily enriched in spines and not in dendritic shafts .A recent study demonstrated the presence of PTEN at the endoplasmic reticulum (ER) with apparent specific enrichment in mitochondria-associated membranes (MAMs) , the GTPase Ran, or the protein PNUFTS (a nuclear targeting subunit of PP1) may have a function in transporting or sequestering PTEN to the nucleus  , refers to a collection of clinically distinct syndromes molecularly defined by germline PTEN mutations. These include Cowden syndrome (CS), Bannayan-Riley-Ruvalcaba syndrome (BRRS), Proteus syndrome (PS), and Proteus-like syndrome (PSL) Eng, . CS is aThe majority of PTEN missense mutations found in PHTS occur in the phosphatase domain of PTEN Eng,  and mostThe PTEN-associated neurological deficits frequently observed in this group of syndromes are macrocephaly, developmental delay, and mental retardation. Ataxia, tremor, and epilepsy have been also reported   results in increased neural stem cells proliferation, enlarged cell size, and brain enlargement . This PTEN cKO model recapitulates many of the late-onset morphological and behavioral abnormalities associated with autistic symptoms as these mice exhibit macrocephaly, neuronal hypertrophy, and deficits in hippocampus-based social and cognitive behavior, hypersensitivity to sensory stimuli, anxiety, and epileptic seizures  and long-term depression (LTD)  under basal conditions , the knock down of PTEN rescued disease associated defects in axon length, increased survival and restored growth cone sizes  is the second most prevalent neurodegenerative disorder after Alzheimer's. It is characterized by progressive loss of dopaminergic neurons in the substantia nigra pars compacta. Earlier studies provided links for PTEN's involvement in the pathogenesis of PD by virtue of its indirect and direct interactions, respectively, with two prominent PD-associated genes, PINK1 and DJ-1. However, more recent studies utilizing primarily neuron subtype-specific PTEN cKO mice have suggested diverse roles for PTEN and the Akt/mTOR pathway in dopaminergic neurons. It has been shown, for instance, that inhibition of PTEN in dopaminergic cell lines significantly inhibits the neuronal death caused by 1-methyl-4-phenylpyridinium (MPP+), an established in vivo. Interestingly, although PTEN-deficient dopaminergic neurons show no alteration at the axon terminal, concomitant deletion of PTEN and Atg7 results in a exacerbation of the axon terminal size seen in Atg7 deficient neurons in the absence of any degeneration phenotype (Inoue et al., A specific requirement for PTEN in the regulation of axon terminal morphology of dopaminergic neurons has been uncovered in neurons deficient in an essential macroautophagy component, Atg7 (Inoue et al., In conclusion, an overall protective effect against neuronal death has been demonstrated when PTEN is deleted or inactivated in dopaminergic neurons, which is likely to reflect a generalized response due to activation of the PI3K/Akt/mTOR signaling pathway.Numerous specific modes of PTEN functions have been identified that are restricted to diverse subcellular compartments and involved in mediating a plethora of cellular responses. It has become increasingly clear that PTEN functions are not exclusively restricted to targeting phosphoinositides in membranous compartments; instead, PTEN specific cellular responses also involve its protein phosphatase activity or, no phosphatase activity at all. On one hand, PTEN inhibition has become a potentially attractive therapeutic intervention in certain settings. Yet, on the other hand, PTEN activation could be beneficial in other conditions. So far, chemical compounds that can act as PTEN inhibitors have been shown to substantially corroborate findings from studies utilizing deletion and silencing approaches. In principal, rational design of chemical compounds or peptides to shift, or prevent PTEN's localization to a specific subcellular compartment, to alter binding to a prominent protein partner, or to impose specific structural conformations on PTEN are plausible. Furthermore, the implications of using PTEN itself as an exogenous factor are only now beginning to be appreciated. In this review, we have attempted to detail some of the roles of PTEN that are, or may turn out to be involved, in mediating cellular responses in the developing, the mature, as well as the diseased neuron. No doubt, the interplay between the mechanisms that coordinate subcellular targeting in the context of controlling enzymatic activity will require detailed attention and have to be further explored.The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest."}
+{"text": "Loss of phosphatase and tensin homologue (PTEN) function evaluated by loss of PTEN protein expression on immunohistochemistry (IHC) has been reported as both prognostic in metastatic colorectal cancer and predictive of response to anti-EGFR monoclonal antibodies although results remain uncertain. Difficulties in the methodological assessment of PTEN are likely to be a major contributor to recent conflicting results.We assessed loss of PTEN function in 51 colorectal cancer specimens using Taqman\u00ae copy number variation (CNV) and IHC. Two blinded pathologists performed independent IHC assessment on each specimen and inter-observer variability of IHC assessment and concordance of IHC versus Taqman\u00ae CNV was assessed.Concordance between pathologists (PTEN loss vs no loss) on IHC assessment was 37/51 (73%). In specimens with concordant IHC assessment, concordance between IHC and Taqman\u00ae copy number in PTEN loss assessment was 25/37 (68%).Assessment PTEN loss in colorectal cancer is limited by the inter-observer variability of IHC, and discordance of CNV with loss of protein expression. An understanding of the genetic mechanisms of PTEN loss and implementation of improved and standardized methodologies of PTEN assessment are required to clarify the role of PTEN as a biomarker in colorectal cancer. Survival for patients with metastatic colorectal cancer (mCRC) has improved significantly over the past 15 years, largely due to improved systemic treatment options-6. In adPTEN is an important negative regulator of PI3K/AKT pathway and controls cell proliferation, survival and angiogenesis. Loss of PTEN function leads to persistent activation of the PI3K pathway and has been observed in breast, prostate, glioblastoma, endometrial and colon cancers,13. LossSeveral crucial factors make testing and interpretation of PTEN difficult. Loss of PTEN function results from several genetic mechanisms including small scale PTEN gene mutations , allelic loss at chromosome 10 and epigenetic silencing via hypermethylation of the PTEN promoter region. PTEN geFurther complicating the situation, the frequency of loss of PTEN expression increases from progression from normal colonic mucosa to adenoma, primary CRC and ultimately metastasis. The resClearly the role of PTEN is more complex than KRAS gene mutation where a single identifiable mechanism (activating mutation), largely concordant between primary and secondary tumours, confers near complete resistance to anti-EGFR MoAbs. Understanding this complexity is central to interpreting the current literature relating to PTEN and its potential role as a predictive biomarker. Recently reported cohorts of mCRC patients receiving anti-EGFR MoAbs have used PTEN loss of IHC expression to report loss of PTEN function. While this represents the functional outcome of several genetic mechanisms of PTEN loss, IHC relies on subjective interpretation and has the potential for inter reporter variation. Furthermore there is variability over the definition of 'loss of PTEN\u2019 based on IHC scoring. In the largest cohort of mCRC patients, PTEN loss was defined as no staining in any cells at any intensity, while oOur group undertook an analysis of PTEN status in the AGITG MAX study of mCRC patients to identify the rate of inter-observer variability in IHC assessment and the rate of discordance between IHC and PCR assessment of PTEN status.The MAX study design and eligibility criteria have been reported previously.The primary objective of this Phase III randomized trial was to evaluate the effect of adding bevacizumab to capecitabine (with or without mitomycin C) on progression free survival (PFS) among patients receiving first line chemotherapy for mCRC. Four hundred and seventy-one patients were enrolled between July 2005 and June 2007. We have used the TaqMan\u00ae Copy Number Assay  to assess for PTEN allelic loss and have previously reported that loss of PTEN copy number was not prognostic nor predictive of outcome in the MAX trial cohort. In thisFormalin-fixed, paraffin-embedded (FFPE) samples of tumor tissue from archival specimens collected at the time of diagnosis were retrieved from storage at hospital pathology departments. For Copy Number PCR, genomic DNA was extracted from FFPE tissue sections with the use of the QIAamp DNA FFPE tissue kit . Manual micro-dissection was performed on samples with less than 80% malignant cells when visualized by microscopy. The same tissue blocks were used to make tissue microarrays (TMAs) and were assessed for PTEN expression by IHC. Researchers who assessed PTEN IHC expression were blinded to the PCR results.Immunohistochemical staining was carried out on TMAs using the PTEN monoclonal antibody 6H2.1  that has been used previously-36. EssePTEN, at cytoband 10q23.31a, location Chr.10:89727445 on NCBI build 37 (Life Technologies). The assay is a duplex PCR for the PTEN gene and the reference gene, RNaseP , set up according to the supplier\u2019s protocol and run on the Rotorgene 6000 real time PCR instrument . The results are calculated as a ratio relative to a 2-copy control using the 2-\u2206\u2206Ct method (Rotorgene software), and multiplied by 2 to give the copy number. We tested DNA from colon cancer cell lines to determine the reproducibility of the assay and to select cell lines to use as copy number controls. HT29 (ATCC) is known to have 3 copies of chromosome 10 as determined by spectral karyotyping and comparative genomic hybridization[The PTEN TaqMan\u00ae copy number assay  was performed using 10 ng DNA in quadruplicate PCR. The primers provided in the assay were entirely within exon 9 of dization. For theFifty-nine tumor specimens were analysed for loss of copy number by Taqman\u00ae and for loss of protein expression by IHC. Eight samples were found to contain no tumor tissue and were excluded from further analysis..Two blinded pathologists assessed 51 specimens independently for PTEN protein expression with IHC. Pathologist JC assessed 29/51 (57%) as having PTEN expression loss, while pathologist AR assessed 17/51 (33%) as having loss of PTEN expression. Concordance between pathologists on final IHC assessment (PTEN loss/no loss) was 37/51 (73%), indicating in 14/51 (27%) of specimens there was discordance in the final assessment of IHC PTEN loss  had \u22641.5 copy number and were thus classified as PTEN loss.\u00ae PCR concordance analysis. Fifteen specimens had PTEN loss on IHC of which 10 (67%) also had PTEN allelic loss on Taqman\u00ae PCR. Seventeen specimens had PTEN allelic loss on Taqman\u00ae PCR of which 10 (58%) had PTEN loss on IHC. Fifteen specimens had preserved PTEN on both IHC and Taqman\u00ae PCR analysis. Overall concordance between IHC and Taqman\u00ae copy number in PTEN loss assessment was 25/37 (68%)  whether protein expression is reduced and whether such reduction confers a growth advantage is unknown. Sood et al. also demonstrated monoallelic PTEN dysfunction (by mutation or promoter methylation) resulted in loss of protein expression in only 38% of samples, while biallelic inactivation resulted in loss of PTEN expression in 80% of cases. Ali et In our cohort 25% of cases without PTEN allelic loss demonstrated complete absence of PTEN expression on IHC. These findings confirm alternative genetic mechanisms, beyond allelic loss, are responsible for loss of PTEN protein expression. Several authors have undertaken more comprehensive analysis of PTEN status on CRC specimens and provide an important insight into the often coexisting genetic mechanisms of PTEN dysfunction. Goal et al. demonstrated hypermethylation of the PTEN promoter region occurred in 10/132 (7.6%) sporadic CRC specimens, with a higher rate (19.1%) in microsatellite unstable CRCs. PTEN mutations coexisted in 4/10 (40%) of hypermethylated PTEN specimens. Eighty percent of patients with promoter hypermethylation had reduced (+1) or loss of PTEN protein expression and in the 3 cases of complete loss of PTEN staining, promoter hypermethylation coexisted with PTEN mutation or allelic loss. PerroneAlternatively, focusing on loss of protein expression at least represents the functional outcome of any such genetic insult. We have demonstrated the current limitations of IHC for this purpose. In our cohort, IHC assessment of PTEN loss by two pathologists was 33% and 57%, with overall concordance of 73%. As this was designed as a validation subset we did not ask the two pathologists to discuss the results that were not concordant, nor seek a further opinion, methods commonly described in papers reporting PTEN IHC aimed at reducing the apparent discordance rate. In all Overall the current literature highlight the difficulty in accurately measuring PTEN function to date; measurement of a single genetic insult, while minimizing inter-observer variability, does not capture the often coexisting mechanisms required for biallelic inactivation. The use of IHC, while potentially a better measure of PTEN function, is observer dependent and there remains a lack of consensus on optimal methodology and scoring.Given the limitations of PTEN assessment discussed here, it is not surprising reports of the predictive value of PTEN as a biomarker in CRC remain conflicting,17,27,31The lack of standardization in assessing loss of PTEN function appears to have contributed significantly to the conflicting results from retrospective cohort studies. Further elucidation of PTEN as a potential biomarker for colorectal cancer relies on defining PTEN loss of function and standardizing analytical methods and scoring systems. Future studies assessing PTEN function may be better served by obtaining a more comprehensive analysis of PTEN function by assessing PTEN mutation, hypermethylation of PTEN promoter, PTEN allelic loss and protein expression on each specimen. An alternative approach may be to explore improved methods of measuring reduced protein expression beyond IHC, given reduced or absent protein expression should reflect the functional outcome of PTEN loss irrespective of the genetic mechanism. Immuno-PCR may provide an option of combining the protein-specific capability of antibodies with the objective quantification of real-time PCR. This wiCNV: Copy number variation; CV: Coefficient of variability; EGFR: Epidermal growth factor receptor; FFPE: Formalin-fixed, paraffin-embedded; FISH: Fluorescent in situ hybridization; IHC: Immunohistochemistry; mCRC: Metastatic colorectal cancer; MoAbs: Monocloncal antibodies; PTEN: Phosphatase and tensin homologue; TMAs: Tissue microarrays; VEGF: Vascular endothelial growth factor.The authors declare that they have no competing interest.CH drafted the manuscript. JH conceived the study and coordinated all laboratory aspect of the study. VB participated in the design of the study and assisted with writing of manuscript. JW was involved in performing the DNA isolation and copy number PCR. NT contributed to trial conception and design as well as assisting with manuscript preparation. JC undertook the immunohistochemistry of the specimens and contributed to study design. AR undertook the immunohistochemistry of the specimens and contributed to study design. CL undertook data analysis and statistical analysis. TP conceived the study and participated in its design and coordination of all aspects of the study including drafting of the manuscript. ART designed study and assisted with manuscript. All authors read and approved the final manuscript.The pre-publication history for this paper can be accessed here:http://www.biomedcentral.com/1471-2407/14/128/prepub"}
+{"text": "Patients with severe burn injury experience a rapid elevation in multiple circulating proinflammatory cytokines, with the levels correlating with both injury severity and outcome. In animal models, accumulations of these cytokines have been observed in remote organs, including the heart, brain and lungs. However, data are lacking regarding the long-term levels of cytokines in the heart following severe burn injury and also how infusion of parenteral estrogen, a powerful anti-inflammatory agent, would affect these levels. Using a rat model, we studied the effects of a full-thickness third-degree burn on cardiac levels of IL-6 and TNF\u03b1 over 45 days with and without 17\u03b2-estradiol infusion.n = 8); (2) Placebo (no treatment) burn group (n = 80); and (3) E2 (estrogen treatment) burn group (n = 80). Groups 2 and 3 had 40% TBSA third-degree dorsal burns, early fluid resuscitation and, 15 minutes post burn, 0.5 mg/kg intraperitoneal estrogen (Group 3) or placebo (Group 2). From each group of 80, eight animals were sequentially sacrificed  at one of 10 respective time points: 0, 0.5, 1, 2, 4, 6, 8, 18, 24 hours and day 7 post burn (at day 7 only for the eight shams). The markers were measured by ELISA method.A total of 168 male rats were assigned randomly to one of three groups: (1) Sham burn  group  more comparable with the estradiol group (70 pg/mg), and significantly less than the placebo animals (332 pg/mg). Similarly, IL-6 levels in the sham animals (70 pg/mg) were comparable with the estradiol group (86.5 pg/mg), and significantly less than the placebo group (730 pg/mg), even at 45 days post burn.Following severe burn injury in an animal model, an early single dose of estrogen can decrease the prolonged let alone the early onset of cardiac inflammation. Based on these data, clinical studies of estrogen infusions should be seriously entertained as estrogen may not only be an inexpensive, simple adjunctive therapy in burn management, it may also obviate the need for many subsequent interventions altogether and even diminish mortality."}
+{"text": "This is followed by a systemic surge in these markers and correlated with subsequent multiorgan failure (MOF). In animal models, this response can be somewhat blunted by early debridement, but such early intervention is not usually feasible in most clinical settings. As estrogen is a powerful anti-inflammatory/anti-apoptotic agent, we tested parenteral 17\u03b2-estradiol (En = 168) were assigned randomly to one of three groups: (1) sham (no) burn (n = 8); (2) burn given placebo (n = 80); and (3) burn given E2 (estrogen). Groups 2 and 3 had 40% TBSA third-degree dorsal burns, early fluid resuscitation and 0.5 mg/kg i.p. estrogen (or placebo) 15 minutes post burn. From each group of 80, eight animals were sequentially sacrificed  at one of 10 time points as follows: 0.5, 1, 2, 4, 6, 8, 18 and 24 hours and 7 days (7 days only for the eight shams).Male rats (In placebos, very high levels of cytokines appeared almost immediately in the echars and circulation, persisting 7 days post burn. In the estrogen group, cytokines, including tissue and circulating IL-6, the greatest predictor of MOF, remained suppressed at all time points, even day 7 Figure .Early single-dose parenteral estrogen can dramatically suppress both the local and systemic massive proinflammatory responses in severe burns. Based on these data, estrogen may not only be an inexpensive, simple, adjunctive therapy in burn management, it may obviate the need for many subsequent interventions altogether."}
+{"text": "Severe burn patients are often noted to have subsequent neurocognitive problems. Experimentally, we have found striking, prolonged elevations of inflammatory markers in the brain  even when the injury occurs in a remote anatomic location. This neuroinflammatory response can also be significantly blunted by a single post-burn dose of estrogen. Sonic hedgehog (SHH), an important signaling protein found in the brain, controls and directs differentiation of neural stem cells, influencing brain regeneration and repair by generating new neurons throughout life. As estrogens not only blunt inflammation but also exert an influence on a variety of stem cells, we hypothesized that 17\u03b2-estradiol (E2) might affect levels of SHH in the post-burn rat brain.n = 44) were assigned randomly into three groups: controls/no burn (n = 4); burn/placebo (n = 20); and burn/E2 (n = 20). Burned rats received a 40% 3\u00b0 TBSA dorsal burn, fluid resuscitation and one dose of E2 or placebo  15 minutes post burn. Eight animals from each of the two burn groups (burn/placebo and burn/E2) were sacrificed at 24 hours and at 7 days, respectively (sham group at 7 days only), with four each of the two burn groups sacrificed at 45 days. Brain tissue samples were analyzed by ELISA for SHH.Male rats  as compared with the placebo-treated burned animals (<700 pg/mg) and controls (<300 pcg/mg). See Figure Early, single-dose estrogen administration following severe burn injury significantly elevated levels of SHH in brain tissue. This finding may represent an extremely novel and important pathway for both neuroprotection and neuroregeneration in burn patients."}
+{"text": "Staphylococcus aureus, the disease impact of chromosomally integrated prophages on virulence is well described. However, the existence of extra-chromosomal prophages, both plasmidial and episomal, remains obscure. Despite the recent explosion in bacterial and bacteriophage genomic sequencing, studies have failed to specifically focus on extra-chromosomal elements. We selectively enriched and sequenced extra-chromosomal DNA from S. aureus isolates using Roche-454 technology and uncovered evidence for the widespread distribution of multiple extra-chromosomal prophages (ExP\u03a6s) throughout both antibiotic-sensitive and -resistant strains. We completely sequenced one such element comprised of a 43.8 kbp, circular ExP\u03a6 (designated \u0424BU01) from a vancomycin-intermediate S. aureus (VISA) strain. Assembly and annotation of \u0424BU01 revealed a number of putative virulence determinants encoded within a bacteriophage immune evasion cluster (IEC). Our identification of several potential ExP\u03a6s and mobile genetic elements (MGEs) also revealed numerous putative virulence factors and antibiotic resistance genes. We describe here a previously unidentified level of genetic diversity of stealth extra-chromosomal elements in S. aureus, including phages with a larger presence outside the chromosome that likely play a prominent role in pathogenesis and strain diversity driven by horizontal gene transfer (HGT).In  S. aureus. Integrated prophages encode S. aureus-specific toxins such as Panton-Valentine leukotoxin (PVL) and staphylococcal enterotoxin A Escherichia, Bacillus, Halomonas, Chlamydia, and Borrelia species S. aureus.Chromosomally integrated prophages are known to play key roles in the pathogenicity and virulence of Borrelia burgdorferi, B31, contained 12 different plasmidial prophages, , while Chlamydia pneumoniae contained only one B. burgdorferi and C. pneumoniae is attributed to evolutionary pressure on their smaller genomes to remove all non-essential DNA B. burgdorferi because of its higher copy number prophages combined with its small chromosome, allowing for the identification and sequencing of these additional, smaller, genetic elements. Thus, plasmidial prophages might not be as rare as this study indicated, but rather difficult to identify. Additional evidence also suggests that lysogeny in the environment favors the plasmidial form. B. anthracis strains isolated worldwide have nearly identical chromosomal prophage sequences, yet up to 20% of isolates encode a diverse array of additional inducible phages B. anthracis phages  with significant roles in the adaptive behavior of the pathogen A report by Casjens in 2003 showed the existence of only two plasmidial prophages in over 80 published bacterial DNA sequences among diverse species S. aureusS. aureus phages \u03a6s80b and \u03a6s84b could integrate into the chromosome of S. aureus strain s64c but remained plasmidial or solely extra-chromosomal in S. aureus strain 8325\u20134. Thus, the S. aureus host cell determined the extra-chromosomal state of these prophages: episomal in S. aureus s64c, and plasmidial in 8325\u20134. In strain s64c, this extra-chromosomal state was reported as \u2018transient\u2019, where the integrated and extra-chromosomal states could switch during serial passages \u03c3H, was found to directly affect integration and excision of S. aureus phages; sigH deletion from the S. aureus genome caused an increase in the episomal state of the phage \u22125) in the bacterial population that they cannot be detected using current sequencing techniques.In this study we term transient phages as \u2018episomal\u2019, and those existing solely in the cytoplasm as \u2018plasmidial\u2019. Two previous reports have examined extra-chromosomal prophages in Streptococcus pyogenes chromosomal island in an M1 serotype (SpyCIM1), can integrate at a specific site in the chromosome during stationary phase of growth, blocking transcription of a mismatch repair gene, mutL, thereby increasing the mutation rate. During exponential growth however, SpyCIM1 excises and replicates in the extra-chromosomal compartment of the cell, enabling mutL transcription E. coliBacillus subtilisClostridium difficileEnterococcus faecalis V583 S. aureus ExP\u03a6 is unclear, these studies suggest it will likely have an important role in cellular processes.MGEs in both the integrated and circularized states can have major effects on the bacterial cell. For example, a phage-like MGE in S. aureus has been biased toward sequencing the bacterial chromosome; not surprisingly, smaller, low-copy, extra-chromosomal elements (like ExP\u03a6) would have been overlooked unless specifically isolated S. aureus may be a transient event and therefore potentially difficult to detect due to extremely low-copy numbers. In this study, we developed a method to effectively enrich extra-chromosomal DNA that includes low-copy number episomal and/or plasmidial ExP\u03a6s and other extra-chromosomal elements from S. aureus. In addition, a NGS approach was used to achieve extremely high coverage and delineate genetic diversity of MGEs. Our results revealed naturally present and potentially widespread ExP\u03a6s in virulent and antibiotic-resistant strains of S. aureus. ExP\u03a6s were shown to be either episomal or plasmidial. The complete genomic sequence of one extra-chromosomal S. aureus phage \u0424BU01 from a VISA strain, was assembled and annotated, and found to contain scn, chp, sak, and sep IEC virulence genes associated with \u03b2-hemolysin containing phages S. aureus pathogenesis.Next-generation sequencing (NGS) in Staphylococcus aureus strains were cultured in Bacto Brain Heart Infusion  and incubated at 37\u00b0C. S. aureus from freezer stocks were revived on BHI agar plates and incubated for 16 to 24 hrs. One to two-day-old single colonies were inoculated into BHI broth and grown overnight (12\u201315 hrs). Cultures were then diluted 1\u2236100 in 150 mL BHI and grown to an OD600 of 0.6 to 0.9. Cultures were then centrifuged at 4,000 RPM for 20 minutes at 4\u00b0C. Cell pellets were used immediately or stored overnight at \u221220\u00b0C.Bacterial strains used in this study are described in Table S1 in S. aureus cell pellets were resuspended in 12 mL of the QIAGEN  Resuspension Buffer  supplemented with 200 \u00b5g lysostaphin from Staphylococcus simulans , 800 ng of PlySs2 lysin 2O at 65\u00b0C.g for 30 min or as needed at 4\u00b0C. The centrifugation force was kept below 5000\u00d7g to prevent shearing of large plasmids . When needed, samples under a total volume of 100 \u00b5l were concentrated further by Speedvac (Thermo Scientific Savant) set at low drying rate. Samples were stored at \u221220\u00b0C and shipped overnight on ice to the sequencing facility. Samples treated with Plasmid-Safe linear DNase were incubated for 2\u20134 hrs at 37\u00b0C with 1 \u00b5l 25 mM ATP, 2.5 \u00b5l 10\u00d7 Reaction Buffer and 1 \u00b5l (10 U) Plasmid-Safe Linear DNase (25 \u00b5l reaction volume). Heating at 70\u00b0C for 30 min then inactivated the linear DNase.DNA was separated by electrophoresis at 50 V for 60 min on a 0.7 % Agarose, 1X, TAE gel. DNA was stained with ethidium bromide, and visualized under ultraviolet transillumination on an Alpha Imager HP . Total DNA was estimated by measuring final concentrations of extra-chromosomal DNA preparations using Thermo Scientific  NanoDrop 1000, software version 3.1.0. If needed, samples were concentrated using Amicon Ultra 0.5 mL 30,000 MWCO centrifugal units ; centrifuged at 2000\u00d7et al. 2005 De novo assembly of sequences was performed using Roche gsAssembler Newbler at default settings. Final assemblies were submitted to Genbank with the following accession numbers: \u03a6BU01, KF831354; pBU108a, KF831355; pBU108b, KF831356; and pBU108c, KF831357.\u2018Whole-genome sequencing\u2019 (WGS) on extra-chromosomal DNA samples was performed using the Roche-  454 Sequencing Genome Sequencer FLX as described in Margulies http://www.nibi.nih.gov/BLAST). Bacteriophage gene identification was performed using BLASTP analysis. Homologies found in the GenBank database were based on greater than 50 percent identity Contigs generated by Roche gsAssembler Newbler resulting from the Roche-454 sequencing runs were identified as plasmid, bacteriophage, chromosome, or miscellaneous MGE by BLASTN analysis comparing to GenBank database 5\u2032-CCTGTTGCTTGGGTAACTGTATC-3\u2032 and 5\u2032-AATGGCAGAAAGTGGCTGG-3\u2032 for identified bacteriophage in the NRS19 strain and primers 5\u2032TGCCATTGTGATGAGGAGGG-3\u2032 and 5\u2032-GCAACGCAGATTGTTTGAGTG-3\u2032 for the identified bacteriophage of the NRS26 strain. These PCR products were purified with QIAquick PCR Purification Kit # 28106 and labeled for use as a Southern blot probe using Biotin DecaLabel DNA Labeling Kit . DNA transferred to nylon membrane was pre-hybridized and hybridized based on standard Southern blot procedures Aliquots of 200\u2013400 ng extra-chromosomal DNA were separated (50 volts for 60 min) on a 0.7 % agarose, 1X TAE gel. Invitrogen  SYBR Safe DNA gel stain (# S33102) was added to the gel at a 1\u223610,000 dilution. DNA was treated and transferred from gel to Positively Charged Nylon Transfer Membrane  using standard Southern blot procedures et al. 2000 S. aureus cultures were grown overnight, then diluted 1\u2236100 in BHI, and 10 mL samples were taken at 6, 8, and 24hrs. Samples of \u03c6BU01 were also taken at an OD600 of 0.12, 0.65, 1.3, 2.0 and 2.5 (24 hrs). Samples were concentrated to an adjusted OD600 of 5.0\u201310.0. Cultures were added to Lonza  SeaPlaque GTG low melting agarose (# 50111) and allowed to solidify. Samples were treated in 0.75 % agarose disks with 100 \u00b5g/mL RNase A, 50 \u00b5g/mL lysostaphin, 1 mg/mL lysozyme, and 25 \u00b5g/mL PlySs2 for 5 hrs. Agarose disks were then treated with 1 mg/mL proteinase K for 17 hours and overnight with SmaI. DNA was separated by pulse-field electrophoresis for 23 hours at 6.0 V/cm. Gel was stained with ethidium bromide for 30 min and destained in dH20 for 30 min.Pulsed field gel electrophoresis was performed with a modified procedure from Chung De novo assembly of the sequence contigs was performed using MacVector assembly (without template) with the PHRAP assembly algorithm, default settings Primers were designed based on preliminary mapping of the contigs to the reference genome  was spotted on BHI soft-agar overlays  of S. aureus reporter strains NRS77, RN4220, and Newman , 0.002% (w/v) gelatin). Prior to verification of bacteriophage DNA by PCR, bacteriophage samples were treated with 2 \u00b5l DNase  at 37\u00b0C for 30 min. DNase in the bacteriophage samples was inactivated by incubation at 75\u00b0C for 10 min.Phage induction with mitomycin C was performed following a modified protocol described by Cao 2O, and stained with 2% 0.2 \u00b5m filtered uranyl acetate. Excess solution was wicked away and grids were allowed to dry at least 30 min before visualization. Grids were examined on the JEOL 100CX transmission electron microscope using AMT V600 software (Advanced Microscopy Techniques) and images captured at 33,000x and 50,000x magnification.PEG-precipitated phage samples as described above were visualized at The Rockefeller University Electron Microscopy Resource Center. Briefly, 10 \u00b5L of sample was spotted on glow discharged 200-mesh copper grids with carbon film  and incubated for 2.5 min. Grids were then washed 2x in ddHPCR amplicons for Southern analysis, primer walking for sequence gap closure, and for verification of the presence of free phage particles in culture supernatants were all generated using NRS19 extra-chromosomal DNA preparation as template. Two DNA polymerases were used: (1) Taq PCR Master Mix  and (2) Phusion DNA Polymerase . The reaction condition for the Taq polymerase were as follows: (1) 95\u00b0C for two min; (2) 95\u00b0C for 30 sec; (3) appropriate annealing temperature for 30 sec; (4) 72\u00b0C for one min per kb; (5) repeat steps two through five 29 times; (6) 72\u00b0C for 10 min; and (7) 4\u00b0C indefinitely. The reaction conditions used for the Phusion polymerase were as follows: 1) 98\u00b0C for 30 sec; (2) 98\u00b0C for 10 sec; (3) appropriate annealing temperature for 30 sec; (4) 72\u00b0C for 30 sec per kb; (5) repeat steps two through five 29 times; (6) 72\u00b0C for 10 min; and (7) 4\u00b0C indefinitely. Following PCR, DNA was separated by electrophoresis at 100 V for 20 min on a 1.5 % agarose gel, run in 0.5 X TAE buffer. DNA was stained with EtBr, and visualized under ultraviolet transillumination on a Cell Biosciences  Alpha Image HP.Staphylococcus NARSA strains (Table S1 in S. aureus phage genomes S. aureus (VISA), three of seven methicillin-resistant S. aureus (MRSA), and three of five methicillin-sensitive S. aureus (MSSA) extra-chromosomal DNA samples possessed phage genes (S. aureus (VRSA) strains (VRS2 and VRS3a) and the one vancomycin-intermediate S. epidermidis (VISE) strain (NRS53). Thus, Roche-454 based sequencing of S. aureus extra-chromosomal DNA revealed evidence of the possible widespread existence of ExP\u03a6s for the first time in natural isolates of these human pathogens.Extra-chromosomal DNA from 24 ge genes . Phage DS. aureus strains in more detail to categorize the MGEs found in our sequencing data. From BLASTN sequence analysis, all S. aureus extra-chromosomal contigs could be categorized as either plasmid, phage, or in some cases chromosomal DNA , in that the fewer the number of contigs, the lower the score. Assemblies with large numbers of contigs, such as that of NRS26 (1993 contigs) and NRS145 (500 contigs), generally had higher Q39 scores , possibly indicating that either the depth of coverage was relatively low, or the presence of more than one genomic species. This could occur with either low-level chromosomal contamination or the presence of multiple phages.Each extra-chromosomal DNA fraction was prepared as described in S. aureus \u0424NM3 phage genome (Siphoviridae family of phages. The assembled circular sequence of \u0424BU01 and Southern blot identification of a Plasmid-Safe (a DNase specific for linear DNA) treated sample of NRS19 , was determined by primer walking on PCR-amplified extra-chromosomal phage DNA . Using ae genome . The pree genome  were usee genome ; PCR#1. of NRS19  providedBacillus anthracis) S. aureus.  or linear  and NRS26 . These eThe efficacy of the linear DNase is shown in a control study that removed sheared, contaminating chromosomal DNA from an extra-chromosomal DNA sample , and NRS26 by pulsed-field gel electrophoresis (PFGE)  . Primerss (PFGE) . After 1s (PFGE) . Howevers (PFGE) , suggestS. aureus strains NRS19 and NRS26 were treated with mitomycin C S. aureus reporter strains; controls without mitomycin C treatment were negative. Polyethylene glycol-precipitated phage preparations were first treated with DNase to remove any host chromosomal DNA not contained within the phage particles. Phage particles were then disrupted, and the released DNA was used as template in PCR. DNA extracted from mitomycin C-induced culture supernatants of NRS19 (which includes \u03a6BU01) and NRS26 was subjected to PCR analysis. Primers bdu211, bdu212 and bdu215, bdu216 described above were used to determine if ExP\u03a6 DNA could be detected in the induced phage fraction. The primers specific for the ExP\u03a6s of NRS19 and NRS26 detected the presence of phages from both strains , then \u0424BU01 DNA should represent approximately 0.0078% of the extra-chromosomal DNA sample. Thus, \u0424BU01 is represented in our extra-chromosomal sample at a nearly 100-fold higher percentage  and NRS109 (MSSA) represent two such samples. Since these strains did not appear to contain ExP\u03a6s, we were curious if they contained integrated prophage. Upon treatment with mitomycin C, we could induce phage from NRS24, which plaqued on S. aureus strain RN4220 . The lack of any extra-chromosomal phage contigs in the prophage-positive strains NRS24 and NRS109 indicates that the extra-chromosomal phage DNA of strains NRS19 and NRS26 are not the result of spontaneous excision but rather more stable, potentially plasmidial forms.In addition, some of the extra-chromosomal S. aureus strains identified several putative, phage-encoded virulence factors with the potential to be horizontally transferred to other bacteria , and Bacillus cereus plamidial-prophage pE33L54 contains multiple integrases Vibrio parahaemolyticus is 92% identical to integrated VHML phage. The replication of linear plasmidial-phages requires a replication protein (RepA), an origin of replication (ori), a protelomerase (Tel), and a telomere resolution site. Both Vp58.5 and VHML phage contain these elements. Therefore the presence of single genes such as integrases, is not a reliable indicator of whether a bacteriophage can integrate or is solely excised S. aureus.However, an integrase does not always determine the fate of plasmidial and integrated bacteriophages. g to reduce potential shearing of large DNA elements. Furthermore, Roche-454 sequencing was selected as it generated DNA sequencing read lengths longer than other NGS platforms de novo assembly of contig sequences of low-copy DNA elements.Extra-chromosomal DNA from nine VISA, seven MRSA, two VRSA, one VISE and five virulent MSSA strains were isolated and screened for ExP\u03a6s using Roche-454 sequencing  containing a region of 98% percent identity with a query coverage of 83%. \u0424NM3 is a defective \u03b2-haemolysin (hlb) converting phage essential to the virulence of S. aureus Newman strain sea, sak, chp, and scn), the CHIPS gene responsible for reduction in neutrophil recruitment, phage structural genes, and an integrase gene (tyrosine recombinase family XerC). \u0424NM3 is unique in that it does not encode an excisionase, and primarily remains integrated within the chromosome \u0424BU01 shares sequence homology to several phages, including S. aureus MGEs that may be identified in this analysis include phages, plasmids, transposons, S. aureus pathogenicity islands (SaPIs), and staphylococcal cassette chromosomes (SCCs), all of which may be transferred horizontally between staphylococci Extra-chromosomal isolations separated by electrophoresis contained multiple bands  and 4 in\u22124, while \u03c611 in the same host has an excision rate closer to 10\u22122. In the same study, \u03a6SA2mw had excision rates over 10\u22122 in NCTC8325, yet under 10\u22123 in host strain MW2 \u22124 are within the label of \u201cspontaneous excision\u201d, with a range of 10\u22124 to 10\u22125. However, rates of 10\u22122 represent a two-log increase and potentially occur in 1% of the population. Based on our calculations, we predict that at a minimum, the episomal phages identified by our technique would excise at a rate of 10\u22122 or greater  into S. aureus recipient strains mec elements in the extra-chromosomal sequencing results. Therefore, it is plausible that MGEs detected in this study, including ExP\u03a6s, could be transferred by phage transduction.Integrated phages can be vertically transferred from mother to daughter cells, passing on the phage's genetic information, associated virulence factors, and transcriptional regulators that can have important effects on the bacterial cell. The extra-chromosomal form provides multiple DNA copies of the phage, yet its relevance in vertical and HGT is currently overlooked. While the rate at which ExP\u03a6s are transferred is unclear, it is possible that they could mediate their own transfer or be transferred by helper phages or other elements. Transduction by phage plays a pivotal role in S. aureus are needed before categorizing these genetic elements as true plasmidial prophages. The mechanism for the replication of \u03a6BU01 is presently unclear, however, a putative DnaD replication protein is encoded on \u03a6BU01. DnaD replication proteins have been found in S. aureus phages B. subtilisS. aureus phage DNA replication modules Further studies on the replication of ExP\u03a6s in S. aureus. These elements may play a major role in bacterial virulence and human disease, as they encode multiple S. aureus virulence determinants. Perhaps their presence as multiple ExP\u03a6 is beneficial by allowing for increases in gene dosage as a result of accumulative higher expression levels. Importantly, ExP\u03a6s could potentially facilitate the dissemination of these virulence factors through transduction or in tandem with another MGE. Understanding the biology of these elements and their contribution to pathogenesis will pave the way for better epidemiology, diagnostics, and therapeutics for S. aureus. Furthermore, the approach described here can also easily be extended to reveal the cytoplasmic DNA elements of other bacterial pathogens.In conclusion, it is clear that advances in NGS have allowed for cost effective whole genomic sequencing of a number of organisms, leading to the sequencing of more 10,000 bacterial genomes and several thousand phage genomes to date File S1Supplementary Figures and Tables.(DOCX)Click here for additional data file.File S2Preliminary alignments of 454 sequencing contigs identified as bacteriophage DNA.(DOCX)Click here for additional data file."}
+{"text": "Functional magnetic resonance imaging (fMRI) studies have revealed group differences in the frontal area between the subcortical vascular cognition impairment (SVCI) patients and the controls. However, most of the existing research focused on average differences between the two groups, and therefore had limited clinical applicability. The aim of our study was to investigate whether inter-regions functional connectivity of the dorsal frontal cortex (DFC) can be used to discriminate the SVCI from the controls at the level of the individual. Thirty-two SVCI patients and 32 demographically similar healthy individuals underwent resting-state functional magnetic resonance imaging. The DFC, derived from a prior atlas, was divided into 10 clusters. Features based on DFC were obtained through functional connectivity analysis between pairs of DFC. A nonlinear kernel support vector machine was used for classification and validated using 8-fold cross validation. An excellent classification accuracy was obtained from both the left and the right DFC functional connectivity . These findings shed further light on the pathogenesis of SVCI and showed promising classification performance using machine learning analysis based on DFC fMRI data, which may be useful for the differentiation of SVCI. Subcortical vascular cognition impairment (SVCI) is characterized by executive dysfunction, which was consistently thought to be associated with the dysregulation in frontal-subcortical loop . In thesFunctional MRI, especially the resting-state fMRI provides us a promising viewpoint to explore the function alteration of SVCI. However, in our daily life, the SVCI patients are prone to be ignored, especially during the early stages, due to the subtle clinic symptom or obscure onset. Therefore, it is necessary to find an objective biomarker, which could be used to assist the diagnosis of SVCI and to improve the accuracy. Multivariate pattern analysis (MVPA) is a promising and potentially powerful data-driven tool in clinical research that permits the differentiation of patients from healthy controls at individual subject level . The mosThus, in the present study, we aim to examine DFC functional connectivity maps in differentiating SVCI patients from healthy controls and to find out which side of the DFC brain functional connectivity contribute more to the discrimination. We also sought to examine the relationship between identified group differences in DFC region and behavioral measures of cognition.Demographic and clinical characteristics for all of participants are shown in Table The classification results indicated that the final correct classification rate of the training data set was 45.38% using the right DFC discriminating functional connections, while the classification rate in the left DFC was up to 75.07% Table . Receivet test.Voxel-based morphometry (VBM) results are shown in Table There was a positive correlation between CAMCOG-C and the strength of functional connectivity (area 46-pre-SMA) in the left DFC . We also found a trend for a positive relationship between praxis function and the connectivity between area 8d and area 9/46d   in the study, the obtained classifier was only specific to the current data and not general enough. Future investigations with large database and the integration of functional connectivity with other neuroimaging methods will be needed to confirm these preliminary findings.in vivo. Twenty-three healthy controls were recruited from either the spouses of patients or recruited via advertisement. All subjects performed a neuropsychological battery assessment, including CAMCOG-C, MMSE, ADL and CDR Clinical dementia rating to evaluate the function of episodic memory, attention, psychomotor speed, executive function, visuo-spatial skills and emotion respectively.Thirty-two right-handed SVCI patients and 32 age-matched controls were enrolled in our study. Each subject provided written informed consent, and this study was approved by the Institutional Review Board of the first affiliated hospital of Anhui medical university Subcommittee on Human Studies. Patients with SVCI met the previous criteria . ExclusiFunctional imaging data were acquired using a 3.0 T GE Signa HDxt MRI scanner . At the beginning of the resting scan, the participants were asked to keep their eyes closed without falling asleep and relax. Resting state images were obtained using echo-planar imaging (EPI) sequence . A 3D high-resolution T1-weighted anatomical images were also acquired using an inversion recovery fast spoiled gradient-recalled echo pulse sequence .t test, p>0.05). Moreover, to remove possible effects, six head motion parameters and the mean time series of gray matter, white matter and cerebrospinal fluid signals were introduced as covariates into the random effects model. A component-based noise correction method (Comp Cor) was also employed to reduce physiological and other noise artifacts [Functional connectivity analysis was performed on the MATLAB platform using the correlated and anticorrelated brain networks (CONN) Toolbox . The mairtifacts . A tempohttp://www.rbmars.dds.nl/CBPatlases.htm). It was noted that the DFC anatomical scheme appeared similar in both hemispheres according to a previous study [Ten subregions of the DFC in each hemisphere were defined in standard MNI space using the previous criteria, and then registered into each individual subject's MRI using FSL. We selected the DFC template as the ROI, which consists of 10 clusters Figure . The resus study .Regional mean time series were obtained for each individual by averaging the fMRI time series over all voxels in each ROI. Pearson's correlation coefficients were calculated between the time courses of ROI and ROI, and a 10\u00d710 symmetric correlation matrix were yielded, which contained normalized z-scores for each subjects. Results of exploratory analyses were considered significant if clusters survived family wise error (FWE) correction p<0.05.To assess the influence of gray matter on functional connectivity, we analyzed our data for structural differences in ROIs between the groups using statistical parametric mapping (SPM) software and VBM toolbox. Structural MRI data processing was performed using VBM and the diffeomorphic anatomical registration using exponentiated Lie algebra (DARTEL) registration method, which has been reported in a previous study . In addiConnectivity matrices for each individual were converted to a feature vector containing 45 unique ROI-to-ROI connections (10\u00d79/2).SVM is one of the most powerful classification algorithms in terms of predictive accuracy. In this study, SVM-based classification method adopted radius bases function (RBF) as a kernel function because of its suitability for nonlinear mapping, few parameters and low numerical difficulty. A grid search algorithm was used to optimize the two parameters of SVM: \u03b3, width of the RBF, and C, an input parameter for the SVM algorithm. The detailed description of the application of RBF kernel SVM in MRI data has been introduced in previous studies \u201322. DuriTo estimate the performance of the classifiers, 8-fold cross-validations were used. The performance of each classifier can be quantified using sensitivity (SS), specificity (SC) and generalization rate (GR) ROC curves were used to quantify the sensitivity and specificity of the classifier . The AUCTo assess the statistical significance of the observed classification accuracy, permutation tests were then employed to estimate the probability of obtaining GR higher than those obtained using the correct labels by chance . We randTo identify the relationship between the strength of functional connectivity in DFC and the clinical scores in SVCI, the average strength of functional connectivity in the left and right DFC was extracted separately and correlated with the cognitive scores for all patients using Pearson's correlation analysis. Only the functional connectivity that differed significantly between groups was included in this analysis.This study used a MVPA method, which is based on functional connectivity pattern, to distinguish individuals with SVCI from the controls. The final model gave promising classification results with prediction accuracies from 45.38% to 75.07%. We proposed that functional connectivity within the DFC provided great potential for SVCI patient discrimination."}
+{"text": "For the past 20\u00a0years, the Ontario child welfare sector has made significant legislative and policy changes. Changes to legislation and policy can impact the public and sector\u2019s response to child maltreatment and inform identified trends. Using an investigative taxonomy of urgent protection and chronic need this paper examines the shift in the nature of investigated maltreatment over time.Data from five cycles of the Ontario Incidence Studies of Reported Child Abuse and Neglect  were used. Provincial incidence rates were calculated by dividing the weighted estimates by the child population 15\u00a0years of age and under and then multiplying by 1000 in order to produce an annual incidence rate per 1000 children. Investigations were divided into urgent  and chronic . Tests of statistical significance were calculated to assess changes in subtypes between cycles.Between 1993 and 2013, the rate of child maltreatment related investigations completed in Ontario has increased from 20.48 per 1000 children to 53.27 per 1000 children. Overall there has been a decline in the incidence of urgent investigations from 9.31 per 1000 child maltreatment investigations in 1993 to 5.94 per 1000 maltreatment investigations in 2013. There has been a fourfold increase in the incidence of chronic investigations from 11.18 per 1000 child maltreatment investigations in 1993 to 47.33 per 1000 maltreatment investigations in 2013.The nature of child protection work using the urgent-chronic taxonomy shows a dramatic shift in the types of concerns identified without a corresponding shift in the way families are assessed for need. The provision of a forensic investigation to all families does not distinguish between urgent safety concerns and needs that may require prolonged engagement. Effective service provision requires more precision in our response to these diverse concerns. Three children, ages 7, 9 and 11 are observed alone on public transit by a concerned citizen and a child welfare authority is contacted with an allegation that the children are not being provided with appropriate supervision. The next day, the same child welfare authority is contacted by a cousin of a woman who has been assaulted by her husband, worried that their teenager has witnessed the assault. The following day a teacher calls with a concern that a 2\u00a0year old sibling of one of her students is being left home alone when the mother walks her pupil to school in the morning. Each of these referrals to the child protection agency is judged to meet the threshold for investigation and while the number of \u201ccollaterals\u201d interviewed may vary in each case, each family will receive a visit and an interview, the worker will complete a risk assessment and assess the child\u2019s safety. There will be a determination about whether a child has been maltreated and whether the family needs ongoing child welfare services. The assessment of maltreatment varies across provinces and is determined by the clinical judgement of the investigating worker based on the balance of probabilities of whether the child has been maltreated.Similar to other Canadian Provincial and Territorial statutes, safety and well-being are central and equal considerations within Ontario child welfare legislation . TypicalThe Ontario Incidence Study of Reported Child Abuse and Neglect (OIS) is the only source of aggregated provincial data on reported child maltreatment and provides an opportunity to explore possible changes in the incidence of reported child abuse and neglect over time. Reported child abuse and neglect in the province of Ontario doubled between 1998 and 2003; from a rate of an estimated 27.42 investigations per 1000 children to a rate of 53.56 per 1000 children in 2003. Since 2003, the rate of investigated maltreatment has remained consistent with the latest estimate in 2013 indicating that 53.27 investigations per 1000 children were conducted [Changes to legislation and policy can impact the public and sector\u2019s response to alleged child maltreatment and inform identified trends. The increase in the incidence of investigations in Ontario is believed to be driven by the broadening of the child welfare mandate and the inclusion of children\u2019s exposure to intimate partner violence, as well as those who were at future risk of maltreatment , 9. GreaIn 2006, further policy reform was initiated through the Ontario Child Welfare Transformation Agenda (Transformation Agenda), which included a more balanced approach to practice that protected children while also promoting their well-being and supporting families . The TraIn 2009, the Commission to Promote Sustainable Child Welfare (the Commission) was established to better understand the impact of the Transformation Agenda, and to develop and implement further changes to improve the child welfare sector , 15. A sDespite significant policy and legislative changes that have occurred in Ontario over the last 20\u00a0years, there are concerns with traditional child welfare service models that emphasize child safety, and the ability of the sector to meet the complex, chronic needs of children and families served , 11, 19.The objective of this research is to determine rates at which child welfare authorities investigate maltreatment using the urgent-chronic taxonomy in Ontario to identify trends over time. A detailed analysis of investigative trends in Ontario by applying the urgent-chronic taxonomy can help to increase our understanding of how the child welfare system has been responding to population, policy and practice changes, and to its dual mandate of promoting safety and well-being.Data from the five OIS cycles were analyzed to explore trends in the investigative taxonomy of urgent-chronic need. Each of the five cycles of the Ontario Incidence Study of Reported Child Abuse and Neglect (OIS) utilized a multi-stage sampling design . The firThe final stage of sampling includes identifying children investigated as a result of maltreatment concerns. In each of the five OIS cycles, estimates of the provincial annual rates of maltreatment investigations in Ontario were derived by applying a regionalization and annualization weights. Estimates for each of the cycles do not include incidents not reported to Ontario child welfare authorities, cases that were screened out and were not fully investigated, new reports on cases that were opened, and cases that were only investigated by police . For grerisk only investigations.Data for each of the OIS cycles is collected directly from investigating child welfare workers in each of the sampled organizations using a three-page standardized data collection instrument, the maltreatment assessment form. This instrument is completed at the conclusion of the investigation and collects clinical information that is routinely gathered by child welfare workers during the course conducting the investigation, including caregiver, child, case, and short-term service dispositions. In 2008, the maltreatment assessment form was amended to include investigations that were conducted which focused not on an event of maltreatment that alleged or suspected but rather assessed the risk to the investigated child of future maltreatment or SPSS Statistic version 23 was used to conduct the analyses. Provincial incidence rates were calculated by dividing the weighted estimates by the child population 15\u00a0years of age and under and then multiplying by 1000 in order to produce an annual incidence rate per 1000 children.The population for Ontario children is based upon the appropriate Census data for the study cycle. The Census is conducted by Statistics Canada every 5\u00a0years.First, the overall investigation rate for investigations in Ontario in each of the five OIS cycles  was compared over time. Next, we examined the change in the rates of investigations using the urgent-chronic taxonomy across cycles of the OIS. Investigations were classified as urgent or other maltreatment-related investigations or assessments (i.e. chronic need) by using the taxonomy developed by Trocm\u00e9 and colleagues [Statistical significance was calculated to examine whether there had been a change in the incidence from the previous OIS cycle. Tests of significance were produced using WesVar 5.1 software.Figure\u00a0Table\u00a0As shown in Table\u00a0Overall there has been a decline in the incidence of urgent investigations from 9.31 per 1000 child maltreatment investigations in 1993 to 5.94 per 1000 maltreatment investigations in 2013. As a proportion of all investigations, those of an urgent nature have declined from 45% of all investigations in the OIS-1993 to 11% of all investigations in the OIS-2013.The nearly doubling of the rate of child maltreatment investigations in Ontario between 1998 and 2003 is reflected in some of the trends in the subtypes of chronic investigations. Physical abuse investigations for children 4\u00a0years of age and older went from a rate of 8.15 per 1000 investigations in 1998 to 13.29 per 1000 investigations in 2003, returning to 8.46 per 1000 investigations in 2008 and 9.28 per 1000 investigations in 2013. A very similar pattern is seen in the rate of neglect investigations for children 4\u00a0years of age and older.In 1993, emotional maltreatment was investigated in only .91 per 1000 investigations. In 1998 there was a twofold increase to 2.15 per 1000 investigations and the rate of investigated emotional maltreatment continued to increase in 2003 to 7.70 per 1000 investigations. In 2008, there was a statistically significant decline in investigated emotional maltreatment to 3.37 per 1000 investigations. In 2008 one in three investigations focused on risk of future maltreatment (17.52 per 1000 investigations). In 2013 this proportion declined to one in five investigations (11.63 per 1000 investigations), although this decline was not statistically significant. Children exposed to intimate partner violence were not identified in 1993; in 2013 it had the highest incidence of investigations, 13.28 per 1000 investigations.Overall there has been a fourfold increase in the incidence of chronic investigations from 11.18 per 1000 child maltreatment investigations in 1993 to 47.33 per 1000 maltreatment investigations in 2013. As a proportion of all investigations, those of a chronic nature have increased from 55% of all investigations to 89% of all investigations.The rate of child maltreatment related investigations completed in Ontario since 1993 has gone from 20.48 per 1000 children to 53.27 per 1000 children. Two decades of policy and legislative changes have resulted in a dramatic change in the type of situation that child protection workers are routinely faced with. The overall increase in child maltreatment investigations in Ontario is difficult to interpret; for instance, the rate of child homicides has remained fairly consistent in Ontario for several decades . OntarioUrgent cases are investigations where the child has sustained harm serious enough to require medical treatment; there is an allegation of sexual abuse or there is a concern of physical abuse or neglect for a child under the age of four. The rate of urgent cases has both declined by nearly half (from 9.31 per 1000 investigations in 1993 to 5.94 investigations in 2013) and in proportion to the overall composition of investigations. The findings in this paper of a decline in reported sexual abuse investigations is consistent with a steady decline in sexual abuse since the 1990s in the United States , 30 and The Ontario child welfare legislation specifically includes situations where a child has been harmed or is at risk of being harmed, consistent with an emerging body of research that show chronic, unaddressed maltreatment results in behavioural, emotional, cognitive and health issues , 32, 33.Despite the changing nature of the type of maltreatment reported and investigated in Ontario, the response by the system is nearly identical to the investigation procedures. The concerns with a traditional or child protection response to maltreatment often considered adversarial and intrusive has led some jurisdictions in the United States and Canada to develop and implement a formal differential or alternative response to children and their families . This rerisk only in 2008 makes comparisons across cycles challenging. For example, the variation in reported emotional maltreatment investigations is likely to have been impacted by the inclusion of risk only investigations in 2008 as the chronic nature of these situations may be similar.The OIS collects information directly from the investigating worker and the data collected are not independently verified. The study only examines the case until the point of initial assessment\u2014the data are not able to describe the longer term impact of the events described. The data do not include children who are only reported to the police, known to a community member or never disclose their abuse or neglect. There have been procedural and study definitional changes over time that reflect changes in legislation and procedures, in particular allowing workers to describe investigations as Data from the Ontario Incidence Studies of Reported Child Abuse and Neglect describe a child protection system that expanded rapidly between 1998 and 2003 and since then has consistently investigated five and a half percent of children 15\u00a0years of age and under for a child maltreatment-related concern. The nature of child protection work using the taxonomy developed by Trocm\u00e9 and colleagues ["}
+{"text": "In this paper an  There has been a recent interest in adaptive algorithms to handle sparsity in various signals and systems  that seeks to minimize the sum of squares of residuals on all of the variables in the equation instead of minimizing the sum of squares of residuals on only the response variable. Golub and Van Loan introduced the TLS problem to the field of numerical analysis  and the adaptive filter n(k) is the measurement noise. In this context, the goal of an adaptive algorithm is to identify the system by minimizing the cost function defined byIn the sparse system identification problem of interest, the system observes a signal represented by an M-th order M-th order sparse system, most estimation algorithms exploit non-zero coefficients of the system to obtain performance benefits and/or a computational complexity reduction (Gu et\u00a0al. Especially, we call In TLS, we assume a given unknown system that both the input and output are corrupted by noise. The system should be estimated from the noisy observation of the input and the output Fig.\u00a0. In thisFor TLS solution, the augmented data vector is considered as:n Davila  and Choin Davila , the TLSk-th time step. The subgradient of We adopt the modified cost function by the addition of a penalty function. This penalty function can be chosen to reflect a priori knowledge about the true sparsity system.and Tanc . We adopmentclasspt{minimaand Tanc .17\\documThe proposed algorithm needs a solution in  as well Stirling . The req-RTLS in \u201317, \\docdures in \u201317 need In this experiment, we follow the experiment scenario in Eksioglu and Tanc . The tru\u03b3k using . The \\dovalue in  is takenand Tanc , that isand Tanc  with theThe proposed algorithm needs the inversion of the covariance matrix as  in orderentclass1pt{minimaIn Fig.\u00a0Table\u00a0In this paper, we propose an"}
+{"text": "Metastatic rectal cancer requires a multidisciplinary and individualized approach.The authors describe a case report of a 48-year-old man with recurrence of rectal adenocarcinoma that underwent multimodal treatment, which included chemotherapy with biologic agents, cytoreduction surgery with hyperthermic intraperitoneal chemotherapy, and radiotherapy with improvement in progression-free survival and overall survival. Peritoneal carcinomatosis from colorectal cancer (CRC) represents a group of patients with metastatic disease associated with poor prognosis.1In metastatic setting, chemotherapy (CTX) eventually with association of biologic agents is the standard of care, with improvement in progression-free survival and overall survival (OS). More recently, there is evidence that cytoreductive surgery combined with hyperthermic intraperitoneal CTX can prolong patients\u2019 life with CRC and peritoneal carcinomatosis.An otherwise healthy, 43-year-old male, with an Eastern Cooperative Oncology Group performance status (ECOG PS) of 0, was admitted in our institution in September 2012 with a recurrence of rectal adenocarcinoma.Out of our institution, in October 2011, he underwent laparoscopic anterior resection for rectal adenocarcinoma; pathologic stage was pT3N0M0 (6 nodes isolated without disease); no neo or adjuvant therapy was made.One year later, the patient underwent urgent exploratory laparotomy for intestinal occlusion; a colostomy was made and the diagnosis of peritoneal metastasis was confirmed. Mutational status of the RAS complex was wildtype.In our institution, after re-staging with computed tomography (CT) and positron emission tomography\u2013computed tomography (PET\u2013CT), both suggesting local recurrence and pelvic tumor implants Fig. , the casHe received 12 cycles of 5-fluorouracil (5-FU), plus irinotecan, plus leucovorin (FOLFIRI) scheme with bevacizumab, without relevant toxicity and with partial response on CT scan and PET\u2013CT .In June 2013, CS/HIPEC (mitomycin 80\u200amg) was performed. The peritoneal cancer index was 11, with apparent complete cytoreduction. There were no postoperative complications. PET\u2013CT was performed with no evidence of disease, and therefore, no complementary CTX was done.Six months later, patient was admitted to the hospital with lumbar pain. An ultrasound and a CT scan only presented right hydronephrosis with no apparent disease recurrence; a percutaneous nephrostomy was made. PET\u2013CT was carried out and revealed increased uptake on the presacral level, suggesting local recurrence Fig. .After discussion on an MDT, it was decided preoperative concomitant chemoradiation therapy (CRT) with subsequent exploratory laparotomy associated with intraoperative radiotherapy (RT). Patient received 5-FU as radiosensitizer till March 2014.Eight weeks later, on the exploratory laparotomy, it was identified presacral recurrence and peritoneal carcinomatosis; it was made the resection of the presacral lesion and the reimplantation of the ureter into the bladder, but no intraoperative RT was performed, due to peritoneal disease. The histopathological report confirmed the pelvic recurrence, with positive margins (R1), and the presence of adenocarcinoma in a parietocolic recess.Patient restarted CTX with the same scheme, 12 cycles, until March 2015, with complete response on CT and PET\u2013CT. MTD suggested a second-look laparotomy, but since he was completely asymptomatic without evidence of disease, it was decided to keep close vigilance.In June 2015, he repeated PET\u2013CT Fig. , which rPatient started second-line treatment with 5-FU, oxaliplatin, and leucovorin (25% reduction of 5-FU) with bevacizumab. CT scan after 6 cycles demonstrated new disease progression and started third-line CTX with FOLFIRI  plus cetuximab. On April of the current year, patient had new peritoneal disease progression and was admitted in our center with acute bowel occlusion and treated with conservative measures, but unfortunately he get worse and died 3 weeks later.3About half of the patients with CRC will have disease recurrence as peritoneal metastasis, and 10% of these will have isolated peritoneal disease.This case represents an example of metachronous peritoneal metastasis from primary rectal cancer and describes a multimodal and individual approach.4 One thing is for sure: with the insufficient lymph nodes samples, at least adjuvant treatment should have been discussed.Regarding the treatment options undertaken, some considerations should be made. First, was this patient a candidate for neoadjuvant treatment at diagnosis instead of upfront surgery? If the tumor was a clinical T3 and/or positive for nodal disease, it should have; with neoadjuvant CRT the rates of local recurrence can be <6%.5 Our patient was selected for its young age, excellent PS, no progression under CTX, and disease evaluated for complete resection, which also meet Go\u00e9r\u00e9 criteria.Second, this patient with peritoneal disease at recurrence was selected for CS/HIPEC. But which patients should be candidates to undergo a CS/HIPEC approach? We don\u2019t know; Go\u00e9r\u00e9 and colleagues published possible eligible criteria: ECOG (\u22641), low peritoneal cancer index, absence of progression under CTX, no extra peritoneal metastasis , and no evidence of biliary or ureteral obstruction.Moreover, peritoneal carcinomatosis is found in advanced stage in most of the patients, due to absence of symptoms and because it is difficult to detect by imaging in early stage, which also make more challenging to achieve a complete resection.6Currently, there are phase II trials that support second-look surgery in patients with colon cancer at high risk for local recurrence or peritoneal metastases.7Based on this rationale, Ripley et al designed a trial to evaluate if mandatory second-look surgery with CS/HIPEC would prolong OS compared with the standard of care (surveillance) in patients who have undergone curative surgery and show no evidence of disease, but who were at high risk for developing peritoneal carcinomatosis from CRC.These high-risk patients were described as having limited and synchronous peritoneal disease completely resected with the primary tumor, ovarian metastases, tumor perforation, T4 lesions, and emergency presentation with bleeding and obstruction.The results of this study are still awaited, and at present, we do not have strong evidence-based data, so the authors do not recommend this proactive treatment strategy in rectal cancer.8 This pressure application improves tumor drug uptake, and positive results with PIPAC with low-dose cisplatin and doxorubicin for patients with platin-resistant recurrent ovarian and gastric cancer have been published.10 In addition, a retrospective analysis presented the results of PIPAC with oxaliplatin in colorectal peritoneal metastasis.11 Objective tumor responses were observed in 71% of the patients (12 of the 17 patients), with minimal adverse effects, and mean survival after first PIPAC of 15.7 months. Further studies are necessary to evaluate the possible role of this strategy in CRC with peritoneal carcinomatosis.Another promising approach in management of peritoneal carcinomatosis is delivering CTX into the peritoneal cavity as a pressurized normothermic aerosol via laparoscopy, known as PIPAC .12We would like to emphasize the patient long survival, despite the poor prognosis and life expectancy <6 months estimated, in the presence of recurrence as peritoneal disease.13Nowadays, the standard of care in the management of patients with metastatic CRC is the addition of biologic agents to CTX backbones as it is associated with improved OS that ranges to 25 to 28 months.14Our patient received FOLFIRI/bevacizumab with significant imagiologic response on PET-fluorodeoxyglucose (FDG), so it was decided to restart the same CTX after second relapse. Several CT scans were negative for presence of disease so we chose PET-FDG for disease evaluation, mostly for 2 reasons: it provides a good overall accuracy in detecting peritoneal carcinomatosis, and helps in the selection of patients for surgery; however, our experience is important only when the implants are of great dimension.In conclusion, we highlight that patients treatment should be performed in experienced centers, in a multidisciplinary setting, in order to carefully select the mostly adequate approach for each patient.None.The authors declare no conflicts of interest."}
+{"text": "Previously, we reported that Zika virus (ZIKV) causes ocular complications such as chorioretinal atrophy, by infecting cells lining the blood-retinal barrier, including the retinal pigment epithelium (RPE). To understand the molecular basis of ZIKV-induced retinal pathology, we performed a meta-analysis of transcriptome profiles of ZIKV-infected human primary RPE and other cell types infected with either ZIKV or other related flaviviruses . This led to identification of a unique ZIKV infection signature comprising 43 genes (35 upregulated and 8 downregulated). The major biological processes perturbed include SH3/SH2 adaptor activity, lipid and ceramide metabolism, and embryonic organ development. Further, a comparative analysis of some differentially regulated genes  revealed that ZIKV induced their expression relatively more than dengue virus did in RPE. Importantly, the pharmacological inhibition of ABCG1, a membrane transporter of cholesterol, resulted in reduced ZIKV infectivity. Interestingly, the ZIKV infection signature revealed the downregulation of ALDH5A1 and CHML, genes implicated in neurological  and ophthalmic (choroideremia) disorders, respectively. Collectively, our study revealed that ZIKV induces differential gene expression in RPE cells, and the identified genes/pathways  could potentially contribute to ZIKV-associated ocular pathologies. It is increasingly clear that ZIKV infection has broad implications beyond microcephaly, because infants born with congenital ZIKV have pathology in their eyes, ears and limbs5. Consequently, there has been significant interest in understanding the pathogenesis of ZIKV in various diseases. Because of clinical studies linking ZIKV to ocular abnormalities, primarily in the retina of infants and adults (uveitis)6, and our laboratory interests in innate retinal defense to microbial infections, we initiated host-pathogen interaction studies of ZIKV in the eye. In our recent study7, we reported for the first time that (1) ZIKV causes retinal lesions in mouse eyes with a clinical presentation  resembling some of the features of ZIKV-associated ocular pathology described in humans; (2) cells lining the blood-retinal barrier (BRB), the retinal vascular endothelium and RPE were permissive to ZIKV replication and expressed receptors for its entry; and\u00a0(3) ZIKV induces retinal cell death and evokes innate retinal inflammatory and antiviral responses both in vitro and in vivo. These findings led us to postulate that being a blood-borne pathogen, ZIKV must overcome the BRB to gain access to the eye and cause retinal abnormalities, a key manifestation of ZIKV infection in the eye6. Moreover, three recent studies also support our findings by demonstrating the permissive nature of retinal endothelium and RPE to ZIKV infection10.The emergence of Zika virus (ZIKV) in both endemic and non-endemic regions of the world has been accompanied by an unprecedented rise in the spectra of ZIKV-associated diseases11. We hypothesized that ZIKV might have a specific infection signature that distinguishes it from other flaviviruses. In this study, we generated a transcriptome profile of ZIKV-infected human primary RPE cells and performed a meta-analysis12 of transcriptome profiles of cells infected with other flaviviruses to gain insights in understanding the molecular mechanisms of ZIKV pathogenesis. Given the non-availability of vaccines against ZIKV, the results of this study will lead to the identification of novel pathways and/or drug targets to prevent ZIKV infection and its associated ocular complications.Since RPE constitutes the outer BRB, the specific contribution of RPE in ZIKV-induced retinal pathology such as chorioretinal atrophy remains to be elucidated. Similarly, upon infection, how ZIKV modulates innate antiviral responses and cell signaling in RPE for its own survival (replication) is currently unknown. Because ZIKV is closely related to other members of the Flaviviridae family such as dengue virus (DENV), West Nile virus (WNV), and Japanese encephalitis virus (JEV), an important question is why only ZIKV, but not other pathogenic flaviviruses, causes congenital diseases and associated complicationshttps://www.ncbi.nlm.nih.gov/geo/)  Table\u00a0 and normTranscriptome profiling was performed on uninfected control and ZIKV-infected (48 and 96\u2009hrs) human primary RPE cells Fig.\u00a0 using ulThe comparison of ZIKV-infected and uninfected samples at 48\u2009h and 96 h identified 633 and 1,198 significantly differentially expressed genes respectively, with a P value\u2009<\u20090.01 and at least a 2-fold change, with 452 genes being commonly associated with ZIKV infection at both time points Fig.\u00a0. Among tNext, we compared the transcriptome profiles of ZIKV-infected RPE with ZIKV-infected human neural progenitor cells (hNPCs). This led to the identification of a signature comprising 601 genes (484 upregulated and 117 downregulated) that were specifically dysregulated in ZIKV-infected RPE cells Fig.\u00a0. These dFurther pathway analysis of genes that are specifically downregulated only in ZIKV-infected RPE cells revealed significant enrichment in EIF2 signaling, antiproliferative role of TOB in T cell signaling, mTOR signaling, paxillin signaling and FAK signaling pathways Fig.\u00a0. On the To gain further insight into system-level perturbations and to identify key molecules associated with ZIKV Infection in RPE cells, we performed a systems biology-oriented analysis on the genes that are differentially expressed in RPE cells after ZIKV infection. The regulatory analysis revealed strong activation of immune and inflammatory responses, mediated through activation of TNFSF10, IFNB1, IL6, STAT2, TLR2, DDX54 (RIG-I), NLRC5, and IRF7, indicating that the RPE response to ZIKA infection is dominated by genes involved in inducing cytokines, chemokines, and type I interferons Fig.\u00a0. On the 7, further validating systems biology prediction.The comparative analysis of ZIKV-infected RPE and hNPC signatures identified 115 common genes that were dysregulated consistently across both cell types . Out of 115 genes, 99 were upregulated, and 16 were downregulated Fig.\u00a0. FurtherThe meta-analysis of ZIKV signatures from different cell types (RPE versus hNPCs) was not sufficient to identify genes or pathways that are specifically linked to ZIKV infection or pathogenesis, because this analysis only revealed genes and pathways linked to general antiviral responses. To identify genes specifically dysregulated by ZIKV in addition to the generalized antiviral response, we performed a comparison of the ZIKV meta-signature with transcriptome signatures from other flaviviruses closely related to ZIKV, i.e., JEV, WNV, and DENV. Of the ZIKV meta-signature 115 genes Fig.\u00a0, 72 geneGene ontology enrichment analysis on ZIKV core signature genes revealed multiple biological processes related to SH3/SH2 adaptor activity, lipid and ceramide metabolism (P\u2009<\u20090.05) Fig.\u00a0. FurtherFurther interactive network analysis was performed on core ZIKV dysregulated genes to identify key regulators that are crucial for ZIKV pathophysiology. The interactive network was generated using the co-expression information of genes based on a Pearson correlation from the transcriptome profile of ZIKV and other viruses that cause neurological diseases. The network was constructed using highly correlative interactions of genes . Since these networks are scale-free and undirected in nature, their topological properties reveal the impact of weak and strong connections measured based on \u201cdegree of centrality.\u201d Our results showed significant enrichment of networks controlling immune, inflammation, and metabolic functions, mirroring the result of the GO analysis. Key nodes were isolated based on the degree of centrality ranking, and the top 10 key nodes included ALDH5A1, SIX4, ABCG1, TNFSF10B and CHML from the ZIKV core signature Fig.\u00a0. To furtAfter meta-analysis and systems biology-led predictions of the ZIKV infection signature, we sought to determine whether other flaviviruses also modulate the expression of identified key molecules. First, we show that similar to ZIKV, human primary RPE cells are permissive to DENV Fig.\u00a0. Second,Among the genes predicted to be downregulated, qRT-PCR validation revealed that both ZIKV and DENV reduced the expression of ALDH5A1 and CHML in infected cells. While no significant difference was observed in downregulation of the CHML gene in ZIKV- versus DENV-infected cells, ALDH5A1 levels were drastically reduced by ZIKV compared to DENV at both time points 48 and 96 hrs post-viral challenge Fig.\u00a0. These r15. In addition to mRNA  because its expression has been demonstrated in the retina, including RPE cellsRNA Fig.\u00a0, we confRNA Fig.\u00a0. Our resRPE Fig.\u00a0. In cont19. This prompted the WHO to initially declare ZIKV as a public health emergency of international concern. Our interest in studying ZIKV pathogenesis emanated from clinical reports linking ZIKV with ocular complications such as uveitis21, acute maculopathy22, pigmentary retinopathy, and chorioretinal atrophy26. These clinical findings highlight that macular and chorioretinal disease can significantly impact visual outcomes in ZIKV-infected infants and adults. However, it is not yet clear whether congenital ocular complications are directly caused by ZIKV or are secondary to microcephaly27. To investigate whether ZIKV can directly affect the health of the retina, the primary target of ZIKV in the eye, we recently developed a mouse model of ZIKV-induced chorioretinal atrophy and demonstrated that cells lining the BRB and the retinal pigment epithelium (RPE) are highly permissive to ZIKV7.The most recent outbreak of ZIKV in Brazil and other South American countries featured unexpectedly severe neurological manifestations that were not observed in prior ZIKV or other related flavivirus outbreaks7 and other studies10 could create a portal for ZIKV entry to the eye from the fenestrated choroidal capillaries. To investigate the molecular mechanisms of ZIKV pathogenesis in RPE cells, here we performed transcriptome analysis of ZIKV-infected human primary RPE cells using a highly sensitive RNA sequencing approach. Consistent with the previous study of WNV-infected RPE cells28, our data also suggest the predominance of pathways regulating innate antiviral responses. These include interferon signaling, as indicated by upregulation of type-I IFNs, and the production of antiviral molecules, such as MX1, ISG15, OAS2, and CXCL10. Other pathways significantly upregulated in ZIKV-infected RPE were cytosolic pathogen recognition receptors like RIG-I, and\u00a0activation of IRFs by cytosolic pattern recognition receptors and Toll-like receptors (TLRs), which play an essential role in recognition of viral RNAs, resulting in the modulation of IFN signaling. Indeed, our recent study showing ZIKV-induced antiviral innate responses in retinal endothelial cells and RPE, including induced expression of RIG-I and TLR37, validates the transcriptome data obtained here. In addition to TLR3, unexpectedly, we observed the induction of TLR2 and TLR9, suggesting that these innate receptors might also be involved in recognition of ZIKV. The pathway analysis of genes that are specifically down-regulated in ZIKV-infected RPE showed significant enrichment in EIF2 signaling, mTOR signaling, paxillin signaling, and FAK signaling pathways, indicating the induction of cellular stress-related signals.Because RPE maintains the outer BRB and shields the neuroretina from blood-borne pathogens, RPE cell death as reported by our30 and current studies, meta-analysis after uniform normalization and preprocessing can provide a valid comparative analysis to identify most robust genes associated with pathophysiology. We normalized all the datasets and performed outlier analysis independently on all the studies to ensure that the studies are at the same normalized values and contain no outliers. Moreover, we have confirmed our meta-analysis findings using qRT-PCR analysis of identified key genes.To identify the universal set of genes associated with ZIKV pathogenesis, we performed a comparative analysis of our transcriptome data with publicly available transcriptome data of other cell types infected by ZIKV. First, we compared our data with transcriptome data of ZIKV-infected human neural progenitor cells (hNPCs) from two other studies after uniform pre-processing and analysis. This led to the identification of 115 common genes that are dysregulated  consistently across both cell types (the ZIKV meta-signature). The most dysregulated pathways were linked to interferon production, ER stress, and defense response to viruses. This meta-analysis of ZIKV signatures from different cell types  was unable to distinguish genes or pathways specifically linked to ZIKV pathogenesis from those of the common antiviral response. To further identify genes that are specifically dysregulated by ZIKV in addition to the generalized antiviral response, we performed a comparison of the ZIKV meta-signature of 115 genes with transcriptome signatures from DENV, JEV, and WNV. This meta-analysis led to the identification of a unique signature of 43 genes referred to as the ZIKV core signature, which is dysregulated upon ZIKV infection but not by the other flaviviruses tested. While the meta-analysis significantly reduces experimental efforts and assists in identifying the genes associated with a\u00a0specific infection signature, the availability of only limited\u00a0transcriptome datasets from similar cell types and/or time points  validated ACBG1 expression both at mRNA and protein levels in ZIKV-infected RPE cells, and (2) that pharmacological inhibition of ACBG117 resulted in reduced ZIKV infectivity, whereas cholesterol supplementation increased ZIKV infectivity in RPE cells. Viruses subvert cholesterol homeostasis using multiple mechanisms34. For example, DENV increases intracellular cholesterol levels by LDL uptake and promoting the activity of HMG-CoA reductase35, while herpes simplex virus 1 alters cholesterol trafficking36. Because host cell lipids and cholesterol play an essential role in various stages of viral replication, including entry, uncoating, genome replication, assembly, and release37, further studies should investigate how ZIKV infection of RPE alters chorioretinal cholesterol homeostasis38 and whether cholesterol transporters contribute to retinal pathology in vivo, using ABCG140 or ABCA113 (another cholesterol efflux transporter) knockout mice.The gene ontology (GO) analysis of upregulated genes in the ZIKV core signature identified enrichment in multiple biological processes related to SH3/SH2 adaptor activity, lipid metabolism, and ceramide metabolism. This is consistent with the studies showing\u00a0that WNV and DENV use ceramide differentially during their replication cycles41. Under inflammatory conditions, SH2B3/LNK counteracts leukocyte adhesion to endothelial cells by inhibiting VCAM-1 expression42. Endothelial cells lining the retinal blood vessels are the major regulatory interface for the trafficking of hematopoietic cells into the retina and provide an innate barrier to viral pathogens44, including ZIKV9. In response to inflammatory stimuli such as TNFA, activated endothelial cells highly express SH2B345, which negatively regulates integrin signaling via inhibition of the integrin-linked kinase, thereby restricting endothelial cell adhesion and migration. SH2B3 also regulates integrins and cell motility in other cell types, such as platelets and megakaryocytes47. Our data showing induced expression of SH2B3 in ZIKV-infected retina/retinal cells indicates that ZIKV may employ SH2B3 to evade the immune system by attenuating the inflammatory response and infiltration of innate immune cells to the site of infection. The mechanism of SH2B3 modulation of the innate antiviral response to promote ZIKV replication needs further investigation, e.g., by inhibiting the SH2B3 activity or the use of Lnk\u2212/\u2212 knockout mice.Another key regulator gene identified was SH2B3, originally characterized as LNK, a negative regulator of multiple cytokine signaling pathways, and which is associated with an increased risk of myocardial infarction48. Epilepsy is present in about half of affected individuals49. Studies in Aldh5a1\u2212/\u2212 mice revealed that multiple metabolites associated with gamma-aminobutyric acid (GABA) metabolism , 4,5-dihydro hexanoate) and oxidative stress are significantly increased in multiple organs/tissues50. Myelin and lipid abnormalities in the cortex and hippocampus are also implicated in the pathophysiology of Aldh5a1\u2212/\u2212 mice51. Based on our findings demonstrating ZIKV-induced downregulation of the ALDH5A1 gene, we postulate that a reduction in ALDH5A1 enzyme activity would increase endogenous GHB and GABA levels, and therefore contribute to neurological manifestations of ZIKV infection such as microcephaly and Guillain-Barr\u00e9 syndrome in adults52. Further studies should address whether ZIKV indeed triggers SSADH and determine the underlying mechanisms. Another gene downregulated by ZIKV was CHML, which is linked to an ocular disorder called Choroideremia (CHM)53, a slowly progressing X-linked retinal disease characterized by degeneration of the choroid, the RPE, and the neural retina54. In both human and mouse eye, CHML and Rab escort-protein-1 (REP-1) are expressed throughout the retina in multiple cell types including RPE54. The CHML gene encodes REP-1, an essential player in the geranylgeranylation of Ras-related GTPases, which are Rab proteins involved in intracellular trafficking of vesicles in endocytic and exocytic pathways55. To determine whether ZIKV-infected RPE has impaired phagocytic function, we performed phagocytic uptake of fluorescent beads and observed no significant difference in infected versus uninfected control cells (data not shown). Silencing of REP-1 in RPE cells does not affect outer photoreceptor segment (POS) internalization but delays POS protein clearance and increases the secretion of inflammatory mediators56. The alteration of the activity of Rab proteins, including REP-1, in regulating endocytosis could be an important factor in the pathogenesis of diseases caused by intracellular pathogens55. Further studies are warranted to elucidate the function of the role of CHML in ZIKV and other flavivirus infections. The fact that\u00a0ALDH5A1 and CHML, two key molecules significantly associated with the stability of the ZIKV network,\u00a0are found in both ZIKV core and extended set of genes, indicates their importance in ZIKV-induced pathophysiology  -dependent succinic semialdehyde dehydrogenase (SSADH) enzyme. In humans, SSADH deficiency is a rare autosomal recessive metabolic disorder affecting \u03b3-aminobutyric acid degradation and is characterized by developmental delay, cognitive impairment, expressive language deficit, and mild ataxiaIn summary, to our knowledge, this study is the first to reveal the molecular signature of ZIKV infection, contributing to better understanding of ZIKV pathogenesis. By performing RNA sequencing on ZIKV infected human\u00a0primary\u00a0RPE cells and performing innovative comparative analysis of ZIKV transcriptome profiles with other flaviviruses, we identified the involvement of novel pathways unknown to play a crucial role in ZIKV pathogenesis. Moreover, in the wake of rapidly spreading ZIKV infection and lack of treatment options, the identified genes/pathways specifically perturbed by ZIKV infection could allow the rational design of therapeutic strategies to treat or prevent ZIKV infection and its complications.\u2122Bulletkit\u00ae media as per manufacturer\u2019s instruction (Lonza). Vero cells (ATCC CCL-81) and Aedes albopictus clone C6/36 cells (ATCC CRL-1660) were cultured in DMEM, and EMEM media supplemented with 10% FBS, 10\u2009\u00b5g/ml L-glutamine, and 1% penicillin and\u00a0streptomycin solution as per manufacturer\u2019s recommendation. ZIKV Virus (ZIKV) strain PRVABC59, NR-50240, originally isolated from human blood in Puerto Rico in December 2015, and DENV type 2 strain NR12216 were obtained through BEI Resources, NIAID, NIH. This ZIKV strain is 97\u2013100% genetically similar to the current ZIKV strain circulating in Brazil57. ZIKV and DENV were propagated in ATCC CCL-81 Vero cells and ATCC CRL-1660 C6/36 cells respectively, and titers were determined by plaque assay. RPE cells were infected with ZIKV and DENV at MOI\u00a0of 1 for the\u00a0indicated time points as described previously7. For ABCG1 functional studies, Pr. RPE cells were treated with a pharmacological inhibitor of ABCG1, Benzamil (50\u2009\u00b5M) , and cholesterol-water soluble (10\u2009\u00b5M)  1\u2009h before ZIKV challenge.Human primary retinal pigmented epithelial (RPE) cells  were cultured in RtEGM7. Briefly, cells were infected with ZIKV PRVABC59 and DENV NR12216 for the\u00a0indicated time points. Following infection, ZIKV/DENV infected, and uninfected control cells were fixed overnight with 4% paraformaldehyde in PBS at 4\u2009\u00b0C. Following rinse\u00a0with PBS cells were incubated with primary mouse monoclonal antibody 4G2 (1:100)  overnight at 4\u2009\u00b0C. Following removal of the primary antibody, the cells were washed extensively with PBS and incubated for 1\u2009h with anti-mouse Alexa Fluor 594-conjugated secondary antibody (1:200) at room temperature. Finally, the cells were extensively washed with PBS, and the slides were mounted in Vectashield anti-fade mounting medium containing DAPI  and visualized using fluorescence microscope .For immunostaining procedures, primary\u00a0RPE cells were cultured in a four-well chamber slide  and infected with ZIKV and DENV at MOI\u00a0of\u00a01 and immunostained for anti-flavivirus group antigen 4G2 as described previouslyTo understand the molecular mechanism of ZIKV infection, RNA derived from ZIKV-infected, and uninfected human primary RPE cells were subjected to next-generation sequencing to generate deep coverage RNA-Seq data. For each treatment group, sequencing was performed on at least two biological replicates. Sequencing libraries of Poly(A)-selected mRNA were generated from the double-stranded cDNA using the Illumina TruSeq kit, as per the manufacturer\u2019s protocol. Library quality control was checked using the Agilent DNA High Sensitivity Chip and qRT-PCR. High-quality libraries were sequenced on an Illumina HiSeq. 2500. To achieve comprehensive coverage for each sample, we generated ~30 million paired-end reads from each sample.58. The quality of the reads with checked using FastQC program that provides a very comprehensive estimate of sample quality based on read quality, read length, GC content, uncalled based, the ratio of bases called, sequence duplication, adaptor and PCR primer contamination59. These high quality clean reads were aligned against human genome using Tophat2 algorithm that uses bowtie2 aligner (http://tophat.cbcb.umd.edu/)60. We used hg19 human genome assembly as a reference genome for alignment. Gene expression measurement was performed from aligned reads by counting the unique reads using the HTSeq-count function in HTSeq algorithm61. The features with low read counts were filtered out using counts per million approach. The filtered read count-based gene expression data was normalized using voom approach, which estimates the mean-variance relationship of the log-transformed gene count data and generates a precision weight for each gene expression62.The raw sequencing data were processed to remove any adaptors, PCR primers and low-quality transcripts  using\u00a0the Trimmomatic program63. LIMMA estimates the differences between uninfected and infected samples by fitting a linear model and determining the significance of differences in gene expression by applying empirical Bayes moderated-t-statistics. The differentially expressed genes were identified based on absolute fold change and raw P value. Genes were considered significantly differentially expressed if the P value was <0.01 and absolute fold change >1.5. The unsupervised analysis was performed using principal component analysis (PCA) using prcomp library in R, which projects multivariate data objects onto a lower dimensional space while retaining as much of the original variance as possible.The differentially expressed genes were identified from normalized sequencing data using a linear model microarray analysis software package )64. The read count-based gene expression data were normalized on the basis of library complexity and gene variation using the R package EdgeR65. The normalized count data were compared among groups using a negative binomial model to identify differentially expressed genes. The differentially expressed genes were identified based on multiple tests corrected P value and fold change. Genes were considered significantly differentially expressed if the P-value was <5% false discovery rate (FDR) and absolute fold change >1.5. Heatmaps of differentially expressed genes were generated using heatmap.2 or complex heatmap packages in R66. In heatmaps, clustering of genes was performed using Hclust function in R using Euclidean distance, and complete linkage parameters on gene-wise scaled data. The scaled data was generated using \u201cnormalize\u201d function of SOM package in R.To further establish the transcriptome alterations associated with ZIKV infection in different cell types and model systems, we performed a meta-analysis. For the meta-analysis, RNA sequencing or microarray data were obtained from public repositories, namely the GEO database Table\u00a0. The rawThe meta-signature of ZIKV was generated by comparing the results of our study with other two published studies Table\u00a0. The com67. The normalized data were generated using original Affymetrix CDF files. After rigorous quality control analysis and log (base 2) transformation of normalized data, the differential analysis was performed using LIMMA approach63. The mapping of Affymetrix probes to gene symbols and entrez IDs was performed using the biomaRt package in R68. The genes that were significantly dysregulated by different viral infections were identified by comparing uninfected and infected samples using LIMMA63. The genes with absolute fold change >2 and P-value\u2009<\u20090.05 FDR were considered significantly differentially expressed in this analysis. The comparison of the ZIKV meta-signature with transcriptome signatures from different viruses was performed on the basis of gene symbols using Venn diagram approach. The genes that were selectivity dysregulated in ZIKV-infected samples but not in other virus-infected samples were considered as the ZIKV core transcriptome signature.To further identify molecular changes associated with only ZIKV infection, we also performed a comparative analysis of the ZIKV transcriptome with transcriptomes of other closely related flaviviruses such as DENV, WNV, and JEV. The raw transcriptome datasets for other viruses were obtained from the\u00a0GEO database Table\u00a0. After q69. DAVID is an online implementation of the EASE software that produces a list of over-represented categories using jackknife iterative re-sampling of the Fisher exact probabilities. P values are assigned to each category based on enrichment. Smaller P values reflect increasing confidence in over-representation. The GO categories with P values\u2009<\u20090.05 and comprising at least 2 genes were considered significant. The GO enrichment analysis was performed both on meta-signature and core signatures of ZIKV infection to understand the key biological processes that are affected by ZIKV infection.To identify the over-represented GO categories in host altered genes by ZIKV infection, we used the biological processes and molecular functions enrichment analysis available from the database for annotation, visualization and integrated discovery (DAVID)Ingenuity pathway analysis  was used to identify the pathways that are significantly affected by genes specifically associated with ZIKV infection. This software consists of functions, pathways and network models derived by systematically exploring the peer-reviewed the scientific literature. A detailed description of IPA analysis is available at the Ingenuity Systems\u2019 website (http//www.ingenuity.com). It calculates a P value for each pathway according to the fit of users\u2019 data to the IPA database using one-tailed Fisher exact test. The pathways with P values\u2009<\u20090.05 were considered significantly affected.70 was used to identify the cascade of upstream transcriptional regulators that can explain the observed gene expression changes due to ZIKV infection. The analysis helps in identifying first which transcription regulators are significantly affected by the infection and then\u00a0determining whether they are activated or inhibited. The activation or inhibition of transcriptional regulators was determined on the basis of overlap among our data with activation or inhibition signatures of key regulators. The significance of overlap was determined using the one-tailed Fisher exact test.Regulatory module analysis71. The topological analysis was performed on the network to identify nodes critical for network stability. We performed topological analysis using the degree of the node of centrality parameter, which is a standardized measure to calculate a number of edges connected to each node72.To define master regulators that are perturbed by genes associated with ZIKV infection, we performed an interactive network analysis. Co-expression-based interactive networks were developed from normalized expression matrix data from ZIKV studies  and an\u00a0extended group of viruses  causing neurological diseases. For co-expression analysis, network analysis returns pairwise gene interactions, Pearson R values (t-static), P values and Bonferroni-adjusted P values. We restricted interactions building with a P value\u2009<\u20090.01 to identify high confidence hub genes that regulated the network. The topological network parameters were calculated using cytoNCA package in CytoscapeTotal RNA was extracted from mock-treated and ZIKV/DENV-infected RPE cells using RNeasy Mini kit , per the manufacturer\u2019s instructions. An aliquot of the same RNA was used for RNAseq analysis and another aliquot for gene validation studies by qRT-PCR. For qRT-PCR, cDNA was synthesized using 1\u2009\u00b5g of total RNA using a Maxima first strand cDNA synthesis kit, as per the manufacturer\u2019s instructions (Thermo Scientific). The cDNA was amplified using gene-specific PCR primers. qRT-PCR was conducted in a StepOnePlus\u2122 Real-Time PCR system (Applied Biosystems). Integrated DNA Technologies synthesized all the primers. The quantification of gene expression was determined via the comparative \u0394\u0394CT method. Gene expression data in the test samples were normalized to the endogenous reference \u03b2-actin level and were reported as fold change relative to \u03b2-actin gene expression. All assays were performed in triplicate and repeated at least twice. The data are presented as the mean\u2009\u00b1\u2009SD, and statistical analysis was performed using Student\u2019s t-test or one-way ANOVA followed by post hoc test using GraphPad Prism 7.02 .Supplementary Information"}
+{"text": "The Zika virus (ZIKV) is a recently emerged mosquito-borne flavivirus that, while typically asymptomatic, can cause neurological symptoms in adults and birth defects in babies born to infected mothers. The interactions of ZIKV with many different pathways in the human host ultimately determine successful virus replication and ZIKV-induced pathogenesis; however, the molecular mechanisms of such host-ZIKV interactions have just begun to be elucidated. Here, we summarize the recent advances that defined the mechanisms by which ZIKV antagonizes antiviral innate immune signaling pathways, with a particular focus on evasion of the type I interferon response in the human host. Furthermore, we describe emerging evidence that indicated the contribution of several cell-intrinsic mechanisms to an effective restriction of ZIKV infection, such as nonsense-mediated mRNA decay, stress granule formation, and \u201creticulophagy\u201d, a type of selective autophagy. Finally, we summarize the recent work that identified strategies by which ZIKV modulated these intrinsic antiviral responses. Flaviviridae, which is comprised of enveloped viruses with a positive sense, single-stranded RNA genome [Aedes aegypti mosquito vector is the primary route of ZIKV circulation, its ability to transmit through a vertical and sexual route makes this virus unique amongst the other mosquito-transmitted flaviviruses that cause diseases in humans [Zika virus (ZIKV) is a member of the A genome . Other mA genome . While tn humans ,4,5.Since its discovery in 1947, ZIKV infection in humans has been historically linked to sporadic cases of self-limiting symptoms such as fever, rash, and conjunctivitis . After aZIKV has a broad cell tropism in vitro, infecting human skin cells, such as dermal fibroblasts and epidermal keratinocytes; human myeloid cells, such as dendritic cells (DCs) and macrophages; and human progenitor cells of neuronal, placental, and testicular origin . In ordeImportantly, there is no approved vaccine or specific antiviral treatment available for ZIKV infection to date. Current drug design efforts primarily aim to target ZIKV proteins with enzymatic activities that are essential for virus replication, such as NS3 and NS5, while progress towards a ZIKV vaccine has been challenging due to the potential risk of neurological side effects and antibody-dependent enhancement of infection, a phenomenon that is best-characterized for DENV infection ,24,25,26In this review, we summarize recently described roles of the mammalian antiviral type I interferon (IFN) system in restricting infection by ZIKV and related flaviviruses, as well as the molecular mechanisms by which these viruses evade the type I IFN response. Furthermore, we highlight recent work that showed that several host cell-intrinsic pathways play important roles in ZIKV restriction that, in turn, are modulated by ZIKV-encoded proteins. A detailed understanding of the mechanisms that ZIKV uses to evade or suppress host intrinsic or innate antiviral pathways might provide novel avenues for the development of antiviral drugs against ZIKV.transducer and activator of transcription factor 1 and 2 (STAT1 and STAT2) and results in the upregulation of many antiviral factors, generally known as IFN-stimulated genes (ISGs) [Early defense against viral pathogens is exerted by the innate immune system, which is comprised of pattern-recognition receptors (PRRs) that serve to detect conserved features of invading pathogens, universally called pathogen-associated molecular patterns (PAMPs) . While ms (ISGs)   mice [IFNAR as well as STAT2\u2013/\u2013 mice were more susceptible to ZIKV infection and showed more severe ZIKV-associated pathology, compared to WT mice [IFNAR1\u2013/\u2013 mice led to severe fetal growth restriction and fetal demise, compared to control mice [ZIKV replication has been shown to be inhibited by type I IFNs in several human cell types and in mouse models. For example, ZIKV replication was reduced in primary skin fibroblasts that were pre-treated with IFN-\u03b1 or IFN-\u03b2, compared with cells that remained untreated . MoreoveWT) mice . Similar WT mice ,34. In arol mice ,36. CollIFIT1-3, RSAD2/Viperin, and OAS1 in primary human DCs [IFN-\u03b2 and several ISGs , compared to mock infection [Restriction of ZIKV infection is mediated by a collection of ISGs, which are transcriptionally upregulated by IFNAR signaling in response to infection. ZIKV infection was shown to induce the expression of the ISGs uman DCs . Furthernfection . Anothernfection . TogetheIFN-\u03b1/\u03b2 gene expression and subsequent upregulation of ISGs are triggered by an ensemble of PRRs following sensing of the invading pathogen. At least three major classes of PRRs contribute to the effective detection of flaviviruses\u2014(1) toll-like receptors (in particular TLR 3 and 7), which sense viral RNA within the endosome; (2) retinoic acid-inducible gene I (RIG-I)-like receptors (RLRs) such as RIG-I itself and melanoma differentiation-associated protein 5 (MDA5), which recognize RNA species in the cytoplasm; and (3) cyclic GMP\u2013AMP synthase (cGAS), which detects cellular dsDNA that is mislocalized during flavivirus infection [nfection ,40,41,42nfection . Upon acnfection . cGAS, wnfection . Signalinfection .Endosomal TLRs, such as TLR3 and TLR7, are critical for innate detection of flavivirus infections, evidenced by work from many groups (reviewed in detail in ). For exSimilar to other flaviviruses, ZIKV RNA is believed to be sensed by endosomal TLR3 and TLR7, which are abundantly expressed on several cells relevant for ZIKV infection, including monocytes and DCs. Stimulation of monocyte-derived macrophages with a TLR7/8 agonist restricted ZIKV replication by inducing expression of several ISGs . AdditioRIG-I\u2013/\u2013 or MDA5\u2013/\u2013 mouse embryonic fibroblasts (MEFs), although at differing time points after infection [MAVS\u2013/\u2013 mice revealed enhanced WNV replication and viral-induced lethality due to increased inflammation in the brain [MAVS\u2013/\u2013 mice were shown to be highly susceptible to DENV (serotype 2) infection and showed delayed IFN-\u03b1 and IFN-\u03b2 production [Sensing of flaviviruses within the cell by the cytoplasmic sensors MDA5 and RIG-I has been well-characterized in the context of WNV and DENV infection. For example, WNV infection was enhanced in both nfection . Similarnfection . Infectihe brain . Similaroduction .RIG-I and MDA5, although silencing of these sensors did not significantly affect ZIKV replication in these cells [RIG-I and MDA5 transcript and protein expression following ZIKV infection, and treatment with a RIG-I agonist derived from HCV RNA restricted ZIKV replication [RIG-I\u2013/\u2013, MDA5\u2013/\u2013, and MAVS\u2013/\u2013 human trophoblast cells\u2014a cell type of the placental barrier\u2014with the most enhanced replication observed in MAVS\u2013/\u2013 cells [IFN-\u03b2 gene expression was reduced in RIG-I\u2013/\u2013 and MDA5\u2013/\u2013 trophoblast cells, and completely abolished in MAVS\u2013/\u2013 cells [IFN-\u03b2 and several ISGs following ZIKV infection and, accordingly, enhanced the viral titers. Furthermore, silencing of both RIG-I and MDA5 strongly enhanced ZIKV replication in this cell type [MDA5-deficient cells, reporter activation was strongly reduced in cells that lacked RIG-I or MAVS [The critical role of RLRs in ZIKV sensing and restriction has also been demonstrated by several studies. ZIKV-infected primary human skin fibroblasts transcriptionally upregulated se cells . Similarlication . Further/\u2013 cells . Accordi/\u2013 cells , suggestell type . Experimell type . Moreove or MAVS . ZIKV RN or MAVS . These sIFN-\u03b2 induction in \u2013/\u2013cGAS THP1 (human monocytic) cells and peripheral blood mononuclear cells [\u2013/\u2013STING human fibroblasts and that ZIKV actively antagonizes STING within the cGAS pathway [In addition to RNA sensors, the cGAS-STING signaling axis has been shown to detect and restrict flaviviruses ,42,59. Mar cells . Further pathway .In summary, recent studies have demonstrated that TLRs, RLRs, and the cGAS-STING pathway play an important role in innate immune sensing and control of the ZIKV infection. These sensors likely act together within the infected cell to detect a combination of ZIKV-derived PAMPs and host-derived molecules, or act in a cell type-specific manner. Thus, determining the relative contribution of these innate immune sensors to IFN/ISG induction and ZIKV restriction in different cell types and tissues will be important. Studies in knockout mice lacking specific sensors, especially TLRs, would provide important insight into the contribution of these sensors to ZIKV restriction and pathogenesis. Along these lines, the precise PAMPs recognized by PRRs during ZIKV infection are largely unknown. For example, it has not been fully established whether cGAS senses mtDNA during ZIKV infection, or perhaps other host DNA species. Moreover, the precise mechanism(s) whereby ZIKV induces cGAS-PAMPs during infection have not yet been elucidated, which will be an exciting avenue for future research.Flaviviruses have evolved many mechanisms for antagonizing the host\u2019s type I IFN response during infection . These mA critical step in the activation of RIG-I is its Lys63-linked ubiquitination, mediated by the ubiquitin E3 ligase TRIM25 (and other E3 enzymes), which ultimately leads to RIG-I oligomerization and its binding to the adaptor protein MAVS . The sfRGiven that the cGAS-STING axis also effectively restricts flavivirus infection ,42,59, iGiven the recent emergence of ZIKV as a human pathogen, innate immune evasion strategies mediated by this virus are not as well-understood as those utilized by other mosquito-borne flaviviruses. Whereas antagonism of the TLR sensing pathways by ZIKV remains largely elusive, recent studies uncovered some of the mechanisms by which ZIKV inhibits the RLR-MAVS and cGAS-STING pathways, or their shared downstream signaling proteins TBK1 and IRF3.Several studies have found that overexpression of specific ZIKV NS proteins inhibits IFN-\u03b2 promoter activation stimulated by ectopic expression of RIG-I 2CARD, which is constitutively-active, and/or stimulated by RIG-I agonists in HEK293T cells ,77,78,79Recent work showed that ZIKV is able to counteract RIG-I- and MDA5-mediated innate immunity by disrupting the interactions of both RLRs with their respective scaffold proteins, 14-3-3\u03b5 and 14-3-3\u03b7 . PreviouWith the knowledge of species-specific DENV-mediated antagonism of the cGAS-STING pathway , Ding etIFN-\u03b2 expression [In addition to viral antagonism of PRRs or their adaptor proteins, ZIKV NS proteins were shown to inhibit innate immune signaling at the level of TBK1 and IRF3, as well ,79,81. Epression . NS1 andpression . LikewisDownstream of TBK1 phosphorylation and oligomerization, ZIKV NS5 was found to interact with both TBK1 and its activating binding partner TRAF6 in an overexpression context, resulting in a reduction of the TBK1\u2013TRAF6 interaction. However, the functional consequence of this competitive binding on IFN induction was not investigated . In a seIn regards to IRF3 antagonism by ZIKV, it was found that the ectopic expression of full-length ZIKV NS5 reduced TBK1 and MAVS-mediated phosphorylation of ectopically-expressed IRF3 at Ser-396 in HEK293 cells . LikewisIn summary, several NS proteins of ZIKV have been reported to antagonize IFN production. However, many of these antagonism strategies are yet to be confirmed during native ZIKV infection, and their relevance for effective virus replication and immune evasion has to be tested in vivo. Studies investigating these IFN-antagonistic mechanisms in suitable mouse infection models might reveal cell-type- or tissue-specific roles for individual NS proteins, and provide important insight into ZIKV-mediated pathogenesis. Moreover, it will be important to evaluate the relative contribution of the proposed evasion mechanisms to IFN antagonism by ZIKV, potentially through generating mutant recombinant viruses in which specific ZIKV-host interactions are ablated.While many studies have focused on NS protein-mediated IFN antagonism, our understanding of the role of the recently identified and characterized ZIKV sfRNAs  in modulFurthermore, although type I IFNs are the primary IFNs secreted by a wide variety of cells, several cell types, including trophoblasts of the placental barrier, have been shown to secrete type III IFNs (IFN-\u03bb) to control the ZIKV infection . Therefotransducer and activator of transcription factor 1 and 2 (STAT1 and 2), inducing their dimerization and subsequent assembly with IRF9 into the multimeric protein complex IFN-stimulated gene factor 3 (ISGF-3) [After production and secretion from the infected cell, IFN-\u03b1/\u03b2 binds IFNAR1/2 to activate receptor-associated kinases Janus kinase (JAK) and tyrosine kinase 2 (TYK2) . These k(ISGF-3) . ISGF-3 (ISGF-3) . ISGs en(ISGF-3) . Other I(ISGF-3) . In turnBesides antagonizing signaling that leads to IFN gene expression, flaviviruses have evolved many mechanisms to suppress signaling downstream of IFNAR1/2 activation. At the level of entry, WNV and likely also other flaviviruses induce the expression of suppressors of cytokine signaling (SOCS) 1 and 3 after binding to and activating TAM (Tyro3/Axl/Mer) receptors on dendritic cells; this ultimately results in SOCS1/3-mediated inhibition of JAK1 and further downstream signaling ,86. WNV ISG15, IFIT1, and IFIT2 in response to IFN-\u03b2 treatment, as compared to mock infection [ISG15 and OAS1 gene expression triggered by exogenous addition of IFN [Viperin/RSAD2 and IFIT1 during ZIKV infection, following poly(I:C) stimulation. Interestingly, cells of neural and placental origin also showed a reduced ISG response during ZIKV infection, compared to poly(I:C) stimulation, with the expression of Viperin/RSAD2 being particularly diminished. Since overexpression of Viperin reduced ZIKV titers and, inversely, Viperin/RSAD2\u2013/\u2013 MEFs showed enhanced ZIKV permissiveness, the dampening effect of ZIKV on Viperin/RSAD2 gene expression is likely a mechanism of immune evasion [ZIKV infection has been shown to modulate innate immune signaling downstream of IFN production. For example, ZIKV infection of A549 cells has been associated with down-regulated expression of ISGs including nfection . Likewisn of IFN . Further evasion .More specifically, ZIKV has been shown to antagonize IFNAR-induced signaling through a variety of mechanisms that include (1) JAK1 degradation, (2) inhibition of STAT1 and STAT2 phosphorylation, and (3) STAT2 degradation. The protein abundance of JAK1 was found to be reduced during ZIKV infection of the A549 cells, both in the absence and presence of IFN stimulation . FurtherDownstream of JAK1, STAT1 and STAT2 must be phosphorylated in order to activate the expression of ISGs. In A549 cells and human DCs, ZIKV infection diminished the pools of endogenous phosphorylated STAT1 and STAT2 (p-STAT1/2), at residues Tyr-701 and Tyr-689, respectively, in the presence and absence of exogenous IFN treatment . LikewisUBR4\u2013/\u2013 cells, suggesting a unique mechanism of STAT2 inhibition by ZIKV NS5 [PDLIM2\u2013/\u2013 Huh7.5 cells were more resistant to HCV, DENV, and ZIKV infection than parental cells [PDLIM2 resulted in less efficient IFN-\u03b1-mediated STAT2 degradation; however, STAT2 degradation during flavivirus infection was not investigated in PDLIM2\u2013/\u2013 cells [Similar to DENV, ZIKV has been shown to degrade human\u2014but not mouse\u2014STAT2 via its NS5 protein. Grant et al. found that ZIKV infection resulted in an MOI-dependent reduction in endogenous STAT2 protein abundance in Vero cells . EctopicZIKV NS5 . Of noteZIKV NS5 ,77  cells. When CHME3 cells were treated with an Axl antagonist, ZIKV infection resulted in enhanced nfection . Of notetagonist . On the  and MxA . These r and MxA . HoweverSeveral recent studies have reported on additional host pathways implicated in ZIKV restriction and, in turn, mechanisms whereby ZIKV is able to modulate these pathways. Below, we summarize the current data describing an important role for the cellular stress response, nonsense-mediated mRNA decay (NMD), and selective autophagy during ZIKV infection.The cellular stress response induces the accumulation of dynamic cytoplasmic aggregates called stress granules (SGs), which are comprised of stalled mRNA-bound translation pre-initiation complexes and several protein factors . During Recent studies have provided evidence for ZIKV-mediated modulation of the NMD machinery. NMD is a cytoplasmic RNA surveillance pathway that functions to recognize and degrade aberrant RNAs (predominantly mRNAs) by recruiting Up-frameshift Protein 1 (UPF1) to nucleate assembly of the NMD machinery on target mRNAs . SeveralWith regards to flaviviruses, HCV infection has been shown to cause accumulation of canonical NMD RNA targets, mediated by binding to and sequestering of the NMD component WIBG by the HCV core protein . SimilarAutophagy is a tightly-regulated cellular process wherein cytoplasmic materials are targeted for lysosomal degradation in a non-selective or selective manner . MechaniThe role of autophagy during flavivirus infection is also multi-faceted, playing both proviral and antiviral roles during the viral lifecycle. For example, knockdown of autophagy machinery resulted in reduced HCV replication, correlated with enhanced IFN and ISG signaling in HCV-infected hepatocytes . DENV (sAtg16L1, suggesting that ZIKV might utilize autophagy to cross the placental barrier [Like other flaviviruses, ZIKV infection has been shown to induce autophagy in a variety of permissive cell types, including human skin fibroblasts , fetal n barrier . CollectWhile non-selective autophagy has been shown to be required for certain stages of the ZIKV lifecycle ,119,120,In summary, these studies provided evidence that stress granule formation, NMD, and reticulophagy have antiviral activity against ZIKV, and as such, ZIKV antagonizes these host processes to promote its replication. While the mechanistic details of viral targeting by these intrinsic pathways as well as of viral evasion, thereof, are currently not well-understood, the recent findings should stimulate more detailed investigation into these novel ZIKV-host interactions.Since the emergence of ZIKV as an epidemic threat in 2015, impressive progress has been made in identifying and understanding ZIKV-mediated evasion of host antiviral pathways. While many viral mechanisms of innate immune antagonism have been elucidated, most studies have focused on those mediated by direct actions of ZIKV NS proteins. However, there is much to be discovered regarding potential host factors involved in these inhibitory mechanisms, as well as other means for evasion, such as ZIKV sfRNA-mediated antagonism of innate and intrinsic immunity. Interestingly, the majority of innate immune molecules antagonized by ZIKV have been previously shown to be targeted by related viruses, such as DENV and WNV. Along these lines, although the molecular mechanisms of ZIKV-mediated inhibition of the type I IFN response still need to be further elucidated, current data suggests that many of the evasion strategies are conserved among mosquito-transmitted flaviviruses. Since ZIKV infection in humans shows unique pathological features, it is expected that ZIKV has evolved unique innate evasion mechanisms, which will be an exciting avenue for future research. In particular, investigation of the combined role of type I IFN evasion and additional antiviral pathways that ZIKV is known to subvert, such as type III IFN production, might more clearly define the physiology of ZIKV infection at a molecular level. Furthermore, recent data have indicated that the activation of stress granule formation, NMD, and reticulophagy play an antiviral role during ZIKV infection. Additionally, elucidating the precise mechanisms by which these cellular pathways suppress ZIKV replication and contribute to the ZIKV-induced pathogenesis will be an exciting question in this emerging field. Importantly, whether ZIKV directly antagonizes these pathways as a means to subvert their antiviral activities, or whether ZIKV co-opts these cellular pathways to promote its replication is still not clearly understood. Moreover, it will be interesting to define whether these intrinsic pathways show cell-type- or viral strain-specific effects. Understanding the mechanisms of innate and intrinsic antiviral pathways in restricting ZIKV might identify potential molecular targets for therapeutic intervention of ZIKV infection. Elucidating novel host defense responses to ZIKV will stimulate research into the mechanisms of how ZIKV, in turn, evades or hijacks these pathways."}
+{"text": "The replication efficiencies of ZIKV-MY and ZIKV-Natal in A549 and Vero cells were similar, while ZIKV-MY replicated more efficiently in wild-type (WT) and IFNAR\u2212/\u2212 mouse embryonic fibroblasts. Viremias in IFNAR1\u2212/\u2212 dams were similar after infection with ZIKV-MY or ZIKV-Natal, and importantly, infection of fetal brains was also not significantly different. Thus, fetal brain infection does not appear to be a unique feature of Brazilian ZIKV isolates.The recent emergence of Zika virus (ZIKV) in Brazil was associated with an increased number of fetal brain infections that resulted in a spectrum of congenital neurological complications known as congenital Zika syndrome (CZS). Herein, we generated  Flavivirus of the Flaviviridae family [Zika virus (ZIKV) belongs to the genus e family , which ie family . ZIKV ise family .Phylogenetically, ZIKV strains are categorized into either African or Asian lineages , with moA central question associated with the ZIKV epidemic in Brazil (and in French Polynesia) is whether the virus strains involved had acquired mutations that enhanced their ability to cause CZS ,18. Seve\u2212/\u2212 mouse model, we previously demonstrated that the Brazilian isolate  was capable of causing fetal infection and congenital malformations [\u2212/\u2212) dams and were both capable of causing fetal brain infections.We previously generated the contemporary Asian lineage isolate ZIKV-Natal from sequence data obtained directly from the brain tissue of an aborted ZIKV-infected human fetus during the 2015 Brazilian outbreak ,23. Usinrmations . Herein,rmations . We showThe ZIKV-MY (strain P6-740) isolate whose sequence was used in this study was reported to be passaged six times in suckling mouse brains, once in baby hamster kidney (BHK) cells, once in C6/36 cells, twice in Vero cells, and five times in Vero E6 cells (GenBank accession number KX694533). Six dsDNA fragments covering the entire viral sequence a were pu\u2212/\u2212 MEFs (44) were infected with passage 1 of C6/36-derived stock of ZIKV-MY, ZIKV-Natal, or ZIKV-Natal/MY-prME viruses at the indicated multiplicity of infection (MOI), and 200 \u00b5L of culture supernatant was collected from each sample well at the indicated times post-infection. Three independent experiments were conducted for each cell line. Viral titers were determined by standard plaque assay on Vero cells, as previously described [Vero (CCL-81), A549 (ATCC CCL-185), wild-type mouse embryonic fibroblasts (MEFs), and IFNARescribed .\u2212/\u2212 mice on a C57BL/6J background were provided by Dr P Hertzog  [\u2212/\u2212 mice (between 10\u201320 weeks old) were infected s.c. at the base of the tail with 100 \u00b5L of medium at a dose of 104 CCID50 as described [\u2212/\u2212 mice, infection with either ZIKA-MY or ZIKV-Natal did not result in any overt morbidity. Mice were euthanized with CO2.IFNAR1stralia)  and bredescribed . Mating All mouse work was conducted in accordance with the \u201cAustralian code for the care and use of animals for scientific purposes\u201d, as defined by the National Health and Medical Research Council of Australia. Animal experiments and associated statistical treatments were reviewed and approved by the QIMR Berghofer Medical Research Institute animal ethics committee .50) assays for viremia and tissue titers were undertaken as described [ZIKV cell culture infectious dose, 50% endpoint  were purchased from Integrated DNA Technologies a. The fi3 pfu/mL) (\u2212/\u2212 MEF), ZIKV-MY replicated more efficiently than ZIKV-Natal  e. Even iKV-Natal f. To ascKV-Natal . In bothKV-Natal . The bet\u2212/\u2212 mice were infected with ZIKV-MY or ZIKV-Natal at E12.5 of gestation, and viremias were determined daily for five days post-infection. No statistically significant differences in mean viremias were observed after infection with the two viruses in either pregnant or non-pregnant mice (IFNAR1ant mice a. Viremiant mice a. The prant mice b\u2013h.p = 0.077 Kolmogorov\u2013Smirnov test). Placental titers were about 0.8 logs higher for ZIKV-MY than for ZIKV-Natal infection . Following ZIKV infection, placenta and fetuses often form highly deformed indistinguishable masses, as described previously [p = 0.045, Kolmogorov\u2013Smirnov test) in ZIKV-MY- than in ZIKV-Natal-infected dams (Groups of pregnant mice were infected with ZIKV-MY or ZIKV-Natal at E12.5 of gestation and euthanized at E17.5, with fetuses and placentas collected. The viral tissue titres in fetal heads obtained from dams infected with ZIKV-MY or ZIKV-Natal were not significantly different (eviously . Viral tted dams c. These \u2212/\u2212 mice, with similar efficiency to the 2015 Natal isolate from Brazil. Both ZIKV-MY and ZIKV-Natal also generated indistinguishable viremia and viral loads in a panel of organs tested. Thus, the propensity for congenital infection does not appear to be a unique feature of contemporary Brazilian ZIKV strains.Herein, a 1966 Malaysian isolate of ZIKV was generated de novo directly from a published sequence and was shown to cause fetal brain infection in pregnant IFNAR1in vivo characterization of ZIKV virulence. Because of the inability of ZIKV to degrade murine STAT2 [\u2212/\u2212 C57BL/6 as a congenital infection model [The use of mice as a ZIKV animal model remains the main practical approach for ne STAT2 , IFN reson model . In otheon model ,32,33,34on model  did compA potential limitation of our study is that the Malaysian isolate generated herein was derived from the sequence of an isolate that had undergone six passages in suckling mouse brain . PotentiIn conclusion, our results argue that ZIKV has an intrinsic ability to cause congenital infection, irrespective of the sequence evolution that has been documented in recent years."}
+{"text": "Aedes spp mosquitoes that has caused outbreaks of fever and rash on islands in the Pacific and in the Americas. These outbreaks have been associated with neurologic complications that include congenital abnormalities and Guillain-Barr\u00e9 syndrome (GBS). The pathogenesis of ZIKV-associated GBS, a potentially life-threatening peripheral nerve disease, remains unclear. Because Schwann cells (SCs) play a central role in peripheral nerve function and can be the target for damage in GBS, we characterized the interactions of ZIKV isolates from Africa, Asia and Brazil with human SCs in comparison with the related mosquito-transmitted flaviviruses yellow fever virus 17D (YFV) and dengue virus type 2 (DENV2). SCs supported sustained replication of ZIKV and YFV, but not DENV. ZIKV infection induced increased SC expression of IL-6, interferon (IFN)\u03b21, IFN-\u03bb, IFIT-1, TNF\u03b1 and IL-23A mRNAs as well as IFN-\u03bb receptors and negative regulators of IFN signaling. SCs expressed baseline mRNAs for multiple potential flavivirus receptors and levels did not change after ZIKV infection. SCs did not express detectable levels of cell surface Fc\u03b3 receptors. This study demonstrates the susceptibility and biological responses of SCs to ZIKV infection of potential importance for the pathogenesis of ZIKV-associated GBS.Zika virus (ZIKV) is a re-emerged flavivirus transmitted by  Flavivirus and is related to other mosquito-borne flaviviruses, including dengue, yellow fever, West Nile, Japanese encephalitis and Spondweni viruses1. Aedes spp. mosquitoes are the main vectors for ZIKV, yellow fever virus (YFV) and all four types of dengue virus (DENV) but ZIKV can also be transmitted through infected semen and from mother to fetus4. ZIKV was first isolated from primates in Uganda in 1947, from Aedes africanus mosquitoes in 19485 and from a febrile man working in Uganda in 19636. For the next five decades sporadic cases of benign, self-limiting acute illness characterized by fever, headache, myalgia and rash were identified in Asia and Africa9.Zika virus (ZIKV) is a plus-strand enveloped RNA virus that belongs to the genus 10. Subsequent outbreaks beginning in October 2013 and continuing throughout 2014 were recognized across Oceania in four groups of Pacific islands: French Polynesia, Easter Island, the Cook Islands, and New Caledonia with 8,750 reported cases11. In May 2015, locally acquired ZIKV disease was recognized in Brazil12 followed by rapid spread through the Americas and Caribbean islands with accompanying reports of neurological complications and congenital malformations including microcephaly15.The first recognized large outbreak of human ZIKV infection occurred in 2007 on the Pacific island of Yap, in the Federated States of Micronesia16. During the ZIKV outbreak in South America, 66 of the 68 patients with GBS in Colombia had symptoms compatible with ZIKV infection before the onset of GBS17 and in Martinique, a prospective study determined that the incidence rate of GBS during the 2016 ZIKV outbreak was 4.52 times that of prior years18. In 2016, the World Health Organization officially recognized ZIKV as a cause of GBS and microcephaly19.The first association of ZIKV infection with Guillain-Barr\u00e9 syndrome (GBS) was a retrospective study of the French Polynesian outbreak where there was a 20-fold increase in GBS incidence and all of the 42 patients hospitalized with GBS had anti-ZIKV antibody20. The most common subtypes of GBS are acute motor axonal neuropathy (AMAN) and acute inflammatory demyelinating polyneuropathy (AIDP), differentiated by the site of immune-mediated injury21. In AMAN, membranes of the nerve axon are the primary targets of cross-reactive anti-ganglioside antibodies while in AIDP the Schwann cell (SC)-produced myelin sheath is the target for damage but the relative roles and specificities of antibody and cellular immune responses are unclear20.GBS, a potentially life-threatening peripheral nerve disease, is characterized by a rapid onset of bilateral weakness progressing to paralysis that may be accompanied by sensory symptoms. GBS typically occurs 1\u20133 weeks after an infectious disease postulated to trigger a pathogen-specific immune response that cross-reacts with peripheral nervous system (PNS) antigensin silico comparison of the ZIKV protein sequence with human proteins has identified shared peptides22, there is no evidence of disease-relevant cross reactivity so the pathogenesis of ZIKV-associated GBS remains unclear. The electrophysiological findings from the French Polynesian GBS cases were reported to be compatible with the AMAN subtype of GBS, but the typical AMAN-associated anti-ganglioside antibodies were rarely detected16. In Colombia, nerve-conduction studies and electromyography were consistent with the AIDP subtype of GBS17 and the electrophysiologic findings from Martinique were also consistent with AIDP further suggesting that SCs were the target for ZIKV-associated damage18.Several studies have sought to determine the type of GBS associated with ZIKV infection. Although 23 and can initiate and regulate local immune responses25. For instance, SCs can be induced to express MHC class I and II molecules, inflammatory cytokines , chemokines  and nitric oxide synthase (iNOS) in response to damage or toll-like receptor (TLR) stimulation29. Induction of cytokines, chemokines and cell surface immunoregulatory proteins by infection of SCs could promote development of potentially damaging virus- or host cell-specific immune responses.SCs develop from neural crest cells, are the myelinating glial cells of the PNS and play a central role in peripheral nerve function, maintenance and repair. The SC myelin sheath enables saltatory conduction of action potentials by large diameter axons but SCs also ensheath and maintain axons that are not myelinated. In response to nerve injury SCs can trans-differentiate into a proliferating cell capable of secreting inflammatory mediators that enhance macrophage-mediated myelin removal32. To evaluate the potential for direct ZIKV-induced peripheral nerve damage, we assessed the susceptibility of immortalized\u00a0primary human Schwann cells (hSCs)33 to infection with strains of ZIKV from Africa, Asia and Brazil. Infection with ZIKV was compared to infection with flaviviruses YFV 17D and DENV2 that are less commonly associated with GBS35. All strains of ZIKV and YFV, but not DENV2, replicated well in hSCs and induced innate responses and cytopathic effect.Because GBS is associated with ZIKV infection and often occurs when symptoms of ZIKV infection are still present and ZIKV RNA is detectable, it has been postulated that GBS might be directly associated with ZIKV infection of peripheral nerve cells or the immune response to viral antigens expressed by these cellse.g. S100B), transcription factors , cell surface receptors (e.g. p75NTR), chemokines (e.g. CCL2) and neurotrophic factors  and can myelinate axons in vitro36, but have not been evaluated for susceptibility or response to virus infection. To determine susceptibility of hSCs to flavivirus infection, cells were incubated (MOI\u2009=\u20095) with YFV 17D, DENV2 and three strains of ZIKV: 1968 Nigeria, 2014 Thailand and 2015 Brazil  chosen to represent the historical shifts of ZIKV as it moved from Africa to Asia and finally the Americas37. Supernatant fluids, collected from 0 to 120\u2009h after infection, were analyzed by plaque assay -1 were upregulated after infection with both YFV and ZIKV with the greatest response induced by YFV. However, IFN \u03b21 protein production was detectable only in ZIKV Fortaleza-infected cells (119\u2009\u00b1\u200918.9\u2009pg/ml at 72\u2009h)  protein at 24 and 36\u2009h were similar, but at 48 and 72\u2009h ZIKV Fortaleza-infected cells produced more IFN\u03bb1  is an important regulator of cell susceptibility to infection. To determine the responses of hSCs to ZIKV Fortaleza and YFV 17D infection, which had similar levels of replication and similar response Fig.\u00a0. Levels \u2009h) Fig.\u00a0. ZIKV inN\u03bb1 Fig.\u00a0. At 48\u2009h40, were induced only by ZIKV. Expression of TNF\u03b1 mRNA was induced in both ZIKV and YFV-infected hSCs. The NLRP3 inflammasome protein mRNA was induced by YFV, but only transiently by ZIKV. Therefore, ZIKV Fortaleza and YFV infections induced overlapping, but distinct innate immune responses in hSCs.To determine whether ZIKV or YFV upregulates hSC expression of other innate response gene mRNAs, levels of mRNAs for representative innate cytokines interleukin (IL)-6, IL-23A and tumor necrosis factor (TNF)-\u03b1 as well as inflammasome protein NLRP3 were measured , CLEC5a and mannose receptor (MR) and the phosphatidyl serine receptors T-cell immunoglobulin and mucin domain (TIM)-1 and TAM receptors Tyro3 and AXL45. To begin to identify factors that may facilitate flavivirus infection of hSCs, we analyzed expression of mRNAs for protein receptor families reported to mediate entry ; MR, a receptor for DENV46 that colocalizes with MHC class II during phagocytosis by SCs47; C-type lectin CD20949; and TIM1 and TAM receptors50. We also assessed the modulation of receptor expression during culture and infection. HSPG2 and ICAM-1 mRNA expression increased during culture of hSCs, but this was not affected by ZIKV infection. MR mRNA expression showed a transient increase at 24\u2009h in both infected and uninfected cells. There was little change and no effect of infection on expression of CD209, TIM1, AXL or Tyro3. The intercellular cell adhesion molecule (ICAM-1) a cell surface receptor that can be up regulated by IFN\u03b3, IL1\u03b2 and TNF\u03b1 in SCs51 showed increased mRNA expression during culture but was not modulated by ZIKV infection.Like other flaviviruses, ZIKV probably can use multiple receptors for host cell attachment, clathrin-mediated endocytosis, pH-dependent membrane fusion and entry52, but levels of mRNA were not modulated by ZIKV infection. Several types of junctional specializations are formed in myelinating SCs between membrane lamellae, act as autotypic junctions and are disrupted during infection of retinal epithelial cells54. In addition, claudin 1 interacts with the prM protein of DENV to facilitate entry56. Therefore, we assessed expression of mRNAs for claudins (CLDN) 6 and 9, occludin (OCLN) and zona occludens (ZO)-1. CLDN9 was up regulated in ZIKV-infected hSCs, but other junctional protein mRNAs were not affected by infection.Because SC responses to injury can affect peripheral nerve function we also assessed the effect of ZIKV infection on expression of several response-relevant protein mRNAs Fig.\u00a0. Galecti61. SCs in peripheral nerves have been reported to express Fc\u03b3RII and Fc\u03b3RIII63. To determine whether immortalized hSCs express Fc\u03b3R mRNAs and whether expression is modulated by infection, we assessed the levels of Fc\u03b3RIc, Fc\u03b3RIIb or Fc\u03b3RIIIa mRNAs before and after ZIKV infection  IFIT1 and MX1, as previously described for ZIKV infection of A549 respiratory epithelial cells and glomerular podocytes68. The IFN\u03b2 and ISG response to YFV was greater than to ZIKV, perhaps reflecting the ability of ZIKV to reduce type I IFN induction and NS5 to degrade STAT2 required for IFN signaling82.Flaviviruses can activate pathogen recognition receptors RIG-I, MDA-5, TLR3 and TLR7 to induce expression of IFN and cytokine genes83. Both ZIKV and YFV-infected cells showed significant increases in IL-29 (IFN\u03bb1) mRNA at 48\u2009h although larger amounts of both IFN\u03b2 and IFN\u03bb proteins were produced by ZIKV-infected cells than YFV-infected cells perhaps because of better viability  infection86. HEV can replicate in neural cells and virus is often detectable at the onset of GBS, but tropism for SCs has not been examined87. Our study of the relationship between ZIKV and GBS, specifically examining hSCs, suggests that GBS could be mediated by pathogen-specific antibodies/T cells or a direct viral effect on SCs rather than cross-reactive antibodies to host proteins/lipids. However, pathologic evaluation of the limited tissue available has not detected ZIKV in peripheral nerves of patients dying with ZIKV-associated GBS89. The understanding that ZIKV can replicate within hSCs and induces a cellular response that this study demonstrates facilitates a better understanding of the role of ZIKV and GBS in the most recent epidemic.The mechanism(s) of ZIKV-induced GBS is not understood. Speculated mechanisms include: Antibody dependent enhancement with DENV sera, an immune mediated mechanism inducing damage through molecular mimicry, cellular mediated inflammation and demyelination induced by complement and macrophage activation, and a direct viral pathogenic effect36. hSCs were grown in Dulbecco\u2019s modified Eagle\u2019s medium  supplemented with 0.2% glucose, 2mM L-glutamine, 10% heat-inactivated fetal bovine serum (FBS), 2\u2009\u00b5M forskolin, penicillin (100\u2009U/ml) and streptomycin (100\u2009\u00b5g/ml) at 37\u2009\u00b0C in 5% CO2. Vero cells (American Type Culture Collection) were grown in DMEM with 10% FBS, 2mM L-glutamine, penicillin and streptomycin at 37\u2009\u00b0C in 5% CO2. C6/36 Aedes albopictus cells (American Type Culture Collection) were grown in DMEM supplemented with 10% FBS and minimal essential amino acids, at 28\u2009\u00b0C in 5% CO2. Cell viability was determined by trypan blue exclusion.Human SCs, a cell line derived from 60\u201380\u2009day fetal sciatic nerves and immortalized with SV40 large T antigen and human telomerase reverse transcriptase have been previously described and were obtained from Ahmet Hoke 90 diluted 1:2000 in 5% milk followed by horse radish peroxidase-conjugated goat anti-mouse IgG (KPL) diluted 1:3000 in 5% milk for 1\u2009h. Foci were developed with KPL TrueBlue Peroxidase Substrate (Sera Care). For plaque assays, cells were overlaid with 0.6% Bacto Agar in Modified Eagle Medium , incubated for 5 days, fixed with 10% formaldehyde in PBS and stained with 0.2% crystal violet in 20% ethanol.YFV (17D), DENV2 (NGC) and ZIKV strains 2014 Thailand (SCV0127/14) and 2015 Brazil  were obtained from Anna Durbin . ZIKV strain 1968 Nigeria (IBH 30656) was obtained from Andrew Pekosz . All virus stocks were grown in C6/36 mosquito cells. Stocks and supernatant fluids from infected cells (MOI\u2009=\u20095) were assayed on Vero cells by focus-formation for DENV and YFV and by plaque-formation for ZIKV. Samples serially diluted in DMEM plus 1% FBS were incubated with Vero cell monolayers for an hour. For focus-forming assays, cells were overlaid with 1% methylcellulose in Optimem (Gibco) with 2% FBS, 2\u2009mM glutamine, 50\u03bcg/ml gentamicin (Sigma Aldrich) and incubated for 3 days. Cells were fixed with 80% methanol for 10\u2009min, blocked with 5% nonfat milk for 10\u2009min and incubated for 1\u2009h with pan-flavivirus mouse 4G2 monoclonal antibody hSCs were infected with three strains of ZIKV, YFV and DENV (MOI\u2009=\u20090.1). At different times after infection the supernatant fluid was removed and 50\u03bcl of MTT reagent  in DMEM was added. After 2\u2009h 50\u03bcl lysis buffer  was added and incubated for 4\u2009h. Readings at 570\u2009nm were used to calculate the percentage of viable infected cells compared to mock-infected cells.hSCs grown on poly-L-lysine-coated cover slips were infected with the three strains of ZIKV, DENV2 and YFV at a MOI of 5. At 24\u201396\u2009h after infection, cells were fixed with 4% formaldehyde, permeabilized with 0.2% triton X 100 in PBS, and blocked with 5% normal goat serum in PBS. The cells were incubated with pan-flavivirus 4G2 primary antibody (1:1000 in PBS) for 1\u2009h followed by anti-mouse IgG Alexafluor594 (Invitrogen). Nuclei were stained with DAPI. Images were captured using a Zeiss Axio Imager M2 microscope and analyzed using Volocity software. Numbers of infected and uninfected cells in three fields were counted to determine percentages of cells infected for each virus.\u2212\u2206\u2206ct.hSCs infected with ZIKV Fortaleza and YFV (MOI\u2009=\u20095) were collected in RLT buffer at 0, 12, 24, 48, and 72\u2009h after infection in triplicate. RNA was isolated from cell lysates using the RNeasy Plus Mini Kit (Qiagen) and quantified using a Nanodrop-1000 spectrophotometer. cDNA was synthesized using the High Capacity cDNA Reverse Transcription Kit (Applied Biosystems) on an Applied Biosystems 2720 thermal cycler with an RNA concentration of 500\u2009ng/\u00b5l in a 20\u2009\u00b5l total reaction volume. qPCR was performed with the Promega GoTaq qPCR Master Mix for Dye-Based Detection using gene-specific oligonucleotide primers for SYBR Green-based measurements or Applied Biosystems TaqMan probes  and IL-29 (IFN\u03bb1) was measured using the Human IL29 Uncoated ELISA kit (Invitrogen) according to the manufacturer\u2019s instructions. Supernatant fluids from 3 independent infections were tested and data are presented as pg per ml or OD at 450\u2009nm. Assay range was 50 to 4000\u2009pg/ml for IFN\u03b2 and 15.6 to 1000\u2009pg/ml for IL-29. The limit of detection is marked as the OD value obtained for lowest concentration of assay range.hSCs were collected in ice cold PBS and live/dead staining (Invitrogen) was done on ice for 30\u2009min in the dark. Cells were stained with FITC-conjugated mouse antihuman CD64 , CD32 , CD16  and mouse IgG1  for 1\u2009h on ice and analyzed on a FACSCanto flow cytometer. Histograms were plotted to determine mean fluorescence intensity.Data were compared using two-way ANOVA and are presented as mean +/\u2212 standard deviation. P\u2009<\u20090.05 was considered significant. All statistical analyses were performed with GraphPad Prism 5."}
+{"text": "Primary human brain microvascular endothelial cells (BMECs) were productively infected by all studied ZIKV strains at MOI 0.01, and were analyzed by plaque assay, immunofluorescence for NS1 protein, and qRT-PCR at 2 and 6 days post-infection (dpi). Compared to mock-infected controls, expression level of ZO-1 was significantly upregulated in ZIKV-H-infected BMECs, while occludin and claudin-5 levels were significantly downregulated in BMECs infected by all three studied viral strains. Interestingly, BMEC permeability was not disturbed by ZIKV infection, even in the presence of a very high viral load (MOI 10). All studied ZIKV strains productively infected wild-type C57BL/J mice after intravenous infection with 107 PFU. Viral load was detected in the plasma, spleen, and brain from 1 to 8 dpi. Peak brain infection was observed at 2 dpi; therefore, TJ protein expression was assessed at this time point. Claudin-5 was significantly downregulated in ZIKV-U-infected animals and the BBB integrity was significantly disturbed in ZIKV-H-infected animals. Our results suggest that ZIKV penetrates the brain parenchyma early after infection with concurrent alterations of TJ protein expression and disruption of the BBB permeability in a strain-dependent manner.The blood\u2013brain barrier (BBB) selectively regulates the cellular exchange of macromolecules between the circulation and the central nervous system (CNS). Here, we hypothesize that Zika virus (ZIKV) infects the brain via a disrupted BBB and altered expression of tight junction (TJ) proteins, which are structural components of the BBB. To assess this hypothesis,  Flaviviridae family of viruses. These viruses have significant neuroinvasive characteristics and are regarded as neurotropic  disrupt the complex structural and functional architecture of the central nervous system (CNS). In addition, several neurological disorders are often associated with autoimmune mechanisms initiated by a viral infection, such as Guillain-Barr\u00e9 syndrome . Neurotrrotropic .Zika virus is an enveloped, mosquito-borne flavivirus, containing a single-stranded positive-sense RNA genome . Two maiin vivo and in vitro models of ZIKV-infection.In recent years, ZIKV has been recognized as the cause of severe neurological disorders, such as Guillain-Barre syndrome in adults  and micrAedes albopictus clone, mosquito cells) and Vero cells  were obtained from the American Type Culture Collection (ATCC). C6/36 cells  were cultured in Dulbecco\u2019s Modified Eagle Medium (DMEM) containing GlutaMAX (Thermo Fisher Scientific) and supplemented with 10% fetal bovine serum (FBS) (Thermo Fisher Scientific) at 28\u00b0C with 5% CO2. Vero cells (ATCC CCL-81) were cultured in DMEM containing GlutaMAX (Thermo Fisher Scientific) and supplemented with 10% heat-inactivated fetal bovine serum (FBS) (Thermo Fisher Scientific) at 37\u00b0C with 5% CO2. Primary human BMECs  were cultured in pre-coated plates with Attachment Factor (Cell Systems) and with Cell Systems Medium, pre-formulated with 10% serum and supplemented with CultureBoost containing animal derived growth factors (Cell Systems), at 37\u00b0C with 5% CO2.C6/36 cells . Virus was tittered by plaque assay using Vero cells with a 0.7% agarose overlay. Foci of plaques were detected at 3 dpi, following fixation with 10% paraformaldehyde solution and staining with 1% crystal violet.Zika virus strains R103451 , PRVABC9 , and MR 766  were obtained from ATCC and propagated in C3/36 mosquito cells at a multiplicity of infection (MOI) of 0.01. Supernatants were collected three to four days post-infection (dpi), clarified by centrifugation at 1,000 \u00d7 7 plaques forming units (PFU) of ZIKV-H, ZIKV-PR, ZIKV-U, or vehicle . After animals were euthanized, whole blood was collected via cardiac puncture, followed by perfusion with normal saline. Brain and spleen tissue were harvested, snap frozen in liquid nitrogen, and stored at \u201380\u00b0C. Whole blood samples were centrifuged at 1,000 \u00d7 g for 10 min to obtain plasma and stored at \u201380\u00b0C.All animal procedures were approved by the University of Miami Institutional Care and Use Committee (IACUC) in accordance with the National Institutes of Health (NIH) guidelines. Male and female C57BL/6J mice (aged 10\u201312 weeks) were purchased from Jackson Laboratory and randomly assigned to various ZIKV infection groups. Mice were anesthetized intraperitoneally with a mixture of ketamine (100 mg/kg body weight) and xylazine (5 mg/kg body weight), then injected intravenously via retro-orbital venous sinus with 100 \u03bcL of 108 to 101 viral copies) and the mouse housekeeping gene hemoglobin beta chain complex (HBB) (108 to 101 gene copies), as previously described by our group . Total RNA was also isolated from 400 \u03bcL of tissue homogenates  or 100 \u03bcL of cell culture lysates, using RNeasy tissue kit (Qiagen). RT-qPCR of plasma and tissue total RNA samples was performed using primers specific for all ZIKV strains evaluated in the present study (5\u2032-CCG CTG CCC AAC ACA AG-3\u2032 and 5\u2032-CCA CTA ACG TTC TTT TGC AGA CAT-3\u2032), probe (5\u2032-6FAM-AGC CTA CCT TGA CAA GCA GTC AGA CAC TCA A-IABkFQ-3\u2032) (Integrated DNA Technologies), and the qScript XLT 1-Step RT-qPCR ToughMix (Quantabio) reaction mix in a 7500 Real-Time PCR System (Thermo Fisher Scientific). RNA absolute quantification per cell was achieved by fitting to serially diluted standard curves of plasmids containing the target region of ZIKV  with freshly added protease inhibitors (Thermo Fisher Scientific) and filtered through a 300 \u03bcm nitrocellulose mesh filter (EMDMilipore). Then, 26% dextran  in isolation buffer was added to the filtered brain homogenate, mixed, and centrifuged at 5,800 \u00d7 g for 20 min at 4\u00b0C. The supernatant was removed, pellets were resuspended in isolation buffer, and filtered through a 120 \u03bcm nitrocellulose mesh filter (EMDMilipore). Filtered homogenates were then re-pelleted by centrifugation  and re-resuspended either in 200 \u03bcL of radioimmunoprecipitation assay (RIPA) buffer (Thermo Fisher Scientific) supplemented with protease inhibitors for immunoblotting, or in PBS for RNA sequencing.Mouse brain microvessels were isolated as previously described . BrieflyProtein fractions from cell culture lysates and isolated brain microvessels were extracted with RIPA buffer supplemented with protease inhibitors and 1% Triton X-100 to inactivate ZIKV. Protein concentrations were measured by Pierce BCA Protein Assay Kit (Thermo Fisher Scientific). The proteins (20 \u03bcg/well) were loaded on sodium dodecyl sulfate (SDS) polyacrylamide 4\u201320% ready gels (BioRad) and electrotransferred to a nitrocellulose membrane using a transfer pack system (BioRad). The blots were probed overnight at 4\u00b0C with the following primary antibodies: rabbit anti-ZIKV NS-1 , rabbit anti-Claudin-5 , rabbit anti-ZO-1 , and rabbit anti-Occludin   in 5% BSA in TBS-T, overnight at 4\u00b0C. Then, the samples were incubated with conjugated secondary anti-rabbit antibody (Licor)  in 5% BSA in TBS-T, for 1 h at room temperature. The blots were washed three times in TBS-T for 5 min after each incubation step. Membranes were imaged in the Licor CLX imaging system and signal quantification was performed using ImageStudio 4.0 software. The GAPDH housekeeping gene was used as a reference.Immunostaining was performed on primary human BMECs cultured on 8-well chamber slides (Thermo Fisher Scientific). Upon 80% confluency, cells were infected with different strains of ZIKV  at MOI 0.01 for 48 h. After the incubation period, cells were carefully washed twice with PBS and fixed with 4% paraformaldehyde solution. Fixed cell monolayers were permeabilized with 0.1% Triton-X solution in PBS, followed by blocking with 4% bovine serum albumin (BSA) in PBS for 1 h at room temperature. Chamber slides were incubated overnight at 4\u00b0C with rabbit antibodies against the ZIKV NS-1 protein  (diluted 1:100 in 4% BSA in PBS). Anti-rabbit Alexa-594 secondary antibody (diluted 1:500 in 1% BSA in PBS) (Thermo Fisher Scientific) and Hoechst  (Thermo Fisher Scientific) were used for detection of ZIKV NS-1 protein and cell nuclei, respectively. Imaging was performed on an Olympus FluoView 1200 confocal microscope with a 60\u00d7 oil immersion lens and analyzed using ImageJ software.In vitro endothelial permeability assays were performed in 6-well 0.4 \u03bcm pore transwell plates (Corning). Primary human BMECs were seeded at 2 \u00d7 105 cells per insert in appropriate media, which was changed every 48 h, and transendothelial electrical resistance (TEER) measurements were acquired daily (data not shown). Five days after seeding, cells were inoculated with different strains of ZIKV at MOI 10, diluted in the appropriate media, in quadruplicates. At 2 dpi, media was replaced with Hanks balanced salt solution in both chambers, and fluorescently tagged dextran  of 10 kDa or 20 kDa was added to the upper chamber at a final concentration of 0.5 mg/mL. Fluorescent marker translocation was analyzed after 90 min of incubation by transferring 100 \u03bcL aliquots from the lower chamber to a 96-well plate and reading fluorescence at 485 nm (Ex) and 525 nm (Em).In vivo BBB permeability assays were performed using sodium fluorescein (NaF) as described before . Proteins were precipitated with 100% trichloroacetic acid  overnight at 4\u00b0C. After the incubation period, samples were centrifuged at 10,000 \u00d7 g, 15 min, at 4\u00b0C and supernatants were harvested and mixed with 0.05 M sodium tetraborate buffer. A NaF standard curve was prepared by serially diluting 0.01% NaF in saline at a 1:2 ratio, and a total of 12 NaF concentrations were used. NaF fluorescence was measured in a fluorescent plate reader . Protein levels were measured by the Pierce BCA Protein Assay Kit for normalization of NaF fluorescence.d before , 2016. BA total of 32 animals were infected with different strains of ZIKV  or vehicle to characterize the impact of infection on transcriptome of brain microvessels. Each group was composed of 8 animals, 4 males and 4 females. Animals were sacrificed at 2 dpi and whole brain tissue was submitted for microvessel isolation, as described above and elsewhere . Total Rt test with significance value at p < 0.05.Experimental treatments were compared pairwise with control treatments using two-way ANOVA, followed by Dunnett\u2019s multiple comparison test of Student\u2019s 8 ZIKV RNA copies/mL were detected in both supernatants and cell lysates. The viral burden reached a peak at 4 dpi (approximately 1010 ZIKV RNA copies/mL in the supernatants and cell lysates), and at 6 dpi viral load decreased to the levels found at 2 dpi, the effect that was accompanied by cell detachment as assessed by microscopy, suggesting loss of cell viability (data not shown).We hypothesized that ZIKV, as other neuropathogenic viruses, invades the CNS by disrupting the BBB. Therefore, our first approach was to verify the infectivity of different strains of ZIKV in BMECs, the main component of the BBB. Primary human BMECs were cultured on 6-well plates, and when 80% confluency was reached, cells were infected with ZIKV-H, ZIKV-PR, ZIKV-U at MOI of 0.01, in quadruplicates, or exposed to media only (mock-infected control). The inoculum was left in contact with the cells for 2 h to allow viral adsorption, carefully washed with PBS, and then replaced with fresh uninfected media. Cell culture supernatants and cell lysates were collected at 2, 4, and 6 dpi, and submitted to RNA extraction. ZIKV levels were assessed by RT-qPCR in cell culture supernatants and BMEC lysates  were performed with BMECs infected with ZIKV-H at MOI 0.01 and 1; however, no alteration of BMEC barrier integrity was detected; therefore, the subsequent experiments were performed at MOI 10 to ensure that all cultured cells were infected. Control cultures were exposed to medium only. Then, media in the apical compartment of the transwell system was replaced with medium containing fluorescently tagged dextran of either 20 kDa or 10 kDa  at MOI 0.01 and lysed in RIPA buffer at 2, 4, and 6 dpi . The expin vitro analyses, we next evaluated the impact of ZIKV infection on BBB permeability and TJ protein expression in vivo. In order to assess the kinetics of ZIKV infection, immunocompetent C57BL/6J male mice were infected with 107 PFU of ZIKV-PR or vehicle and euthanized at 1 dpi (n = 4), 2 dpi (n = 4), 4 dpi (n = 4), 6 dpi (n = 4), and 8 dpi (n = 4). Systemic infection was verified by the presence of ZIKV RNA in spleen tissue homogenates and plasma samples by ZIKV-specific RT-qPCR. In brain tissue homogenates, ZIKV RNA levels peaked at 2 dpi  per group  were infected intravenously with 103 to 1.2 \u00d7 105 copies/mL in ZIKV-H-infected animals, from 8.3 \u00d7 103 to 0.8 \u00d7 105 copies/mL in ZIKV-PR-infected animals, and from 0.3 \u00d7 103 to 3.7 \u00d7 105 copies/mL in ZIKV-U-infected animals  compared to ZIKV-PR (1.6 \u00d7 104 copies/106 cells) and ZIKV-U (1.5 \u00d7 103 copies/106 cells); however, the differences were not significant . These data suggest that immunocompetent mice are a feasible model to study ZIKV infection, including neuroinfection.Brain infection was detected in 3 out of 6 mice infected with ZIKV-H or with ZIKV-PR, and in 5 out of 6 mice infected with ZIKV-U. Mean levels of ZIKV RNA showed tendency to be slightly lower in ZIKV-H-infected animals  per group were infected with ZIKV-H, ZIKV-PR, and ZIKV-U for 48 h. Mock-infected animals were included as negative controls. As illustrated in p-values, between mock-infected and ZIKV-infected animals. In addition, p = 2.4 \u00d7 10\u201326). The Xist gene ensures X-chromosome inactivation in female placental mammals, and therefore its expression is expected to be low in male animals. Gene expression related to BBB function was not significantly changed in microvessels isolated from ZIKV-infected animals as compared to mock-infected controls. However, the analysis revealed upregulation of genes involved in immune responses against viral infection, such as Ddx60 (p = 1.2 \u00d7 10\u201324), Dhx58 (p = 8.8 \u00d7 10\u201345) and Nlrc5 (p = 5.4 \u00d7 10\u201345). In addition, IFN-related immune response genes, such as Zbp1 (p = 6.8 \u00d7 10\u201344) and genes of the Oas , H2-Q , Irf , and Stat  families were upregulated in microvessels of ZIKV-infected animals. Interestingly, the gene Rnf213 was significantly upregulated in ZIKV-infected animals (p = 3.9 \u00d7 10\u201346). Rnf213 encodes a type Zn-finger protein involved in mediating protein-protein interactions and has been reported as a susceptibility gene for Moyamoya disease, a vascular disorder of intracranial arteries (p = 3.0 \u00d7 10\u201328). The expression of Lgals3bp is upregulated in the context of HIV-1 and HCV infections, and its expression is associated with upregulation of IL-2, IL-6, granulocyte-macrophage colony-stimulating factor (GM-CSF), and TNF-\u03b1, contributing to an antiviral state . Interestingly, one gene related to neurogenesis signaling pathway and one gene related to cell differentiation signaling pathway  were significantly downregulated in ZIKV-infected animals, as compared to mock-infected animals .Regarding the mostly downregulated genes, ribosomal protein encoding genes were significantly downregulated in ZIKV-infected animals, compared to mock-infected animals   . These s (PE243) , i.e., a (PE243) .in vivo were shown to be transient and regulated by the interaction of the host with viral factors, such as pathogen-associated molecular patterns   occurred only among animals infected with the Honduras strain. In addition, a clear trend between the presence of the neuroinfection and increased BBB permeability was observed in mice infected with ZIKV-H but not ZIKV-U or ZIKV-PR, indicating strain-specific effects  . Recentl effects . The par process .Interestingly, when we evaluated the expression of TJ proteins after ZIKV infection, significant changes starting at 2 dpi, and at a physiologically relevant dose (MOI 0.01) were observed . Expressin vivo analyses of TJ protein expression in ZIKV-infected brains agree with in vitro data. In ZIKV-H-infected animals, all TJ proteins analyzed tended to be upregulated. In ZIKV-PR infected animals, a tendency in the upregulation of ZO-1 and occludin expression was evident in mock-infected brains; however, a reverse trend was observed in infected brains. Regarding infection with ZIKV-U stains, TJ proteins were downregulated in infected brains, achieving statistical significance only for claudin-5. Overall, the pattern of the observed changes suggests specific responses from the BBB during neuroinfection by individual strains of ZIKV. However, the kinetics of TJ alterations may depend not only on different viral strains but be individually tuned for individual TJ proteins. It also should be noted that modulation of the BBB permeability is frequently regulated by transient phosphorylation/dephosphorylation of TJ proteins and not their overall expression levels  in accordance with the National Institutes of Health (NIH) guidelines.AL designed and performed all the experiments, analyzed the data, and wrote the manuscript. IA and LB contributed to generation of the data. NE-H and MN conceived and designed the studies. MT conceived and designed the studies, and wrote the manuscript.The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest."}
+{"text": "It has been known for more than a century that, in adult vertebrates, the maintenance of taste buds depends on their afferent nerves. However, the initial formation of taste buds is proposed to be nerve-independent in amphibians, and evidence to the contrary in mammals has been endlessly debated, mostly due to indirect and incomplete means to impede innervation during the protracted perinatal period of taste bud differentiation. Here, by genetically ablating, in mice, all somatic (i.e. touch) or visceral (i.e. taste) neurons for the oral cavity, we show that the latter but not the former are absolutely required for the proper formation of their target organs, the taste buds. Taste buds are onion-shaped clusters of 60\u2013100 taste receptors and support cells, embedded in epidermal papillae and distributed in a punctate pattern in the tongue and soft palate epithelia. They sense nutrients in the oral cavity and transmit taste information to the termini of sensory neurons, through conventional  and non-Neurog1 and Neurog2. As early as day 9.5 of embryonic development (E9.5), the knockout of Neurog1 blocks neuronal differentiation in the trigeminal, superior and jugular ganglia  from, presumably, visceral or somatic sensory fibers, respectively (which thus navigate to their target independently of each other)  of the anterior tongue and soft palate are innervated by somatic sensory neurons (for touch and pain) located in the trigeminal ganglion and visceral sensory neurons (for taste) located in the geniculate ganglion . The cir ganglia  which ha neurons . In eachh other) . In doubthe head , all nerthe head .sonic hedgehog (Shh), after a diffuse phase throughout the oral epithelium, resolves around E12.5 into a punctate pattern corresponding to taste placodes, which also start expressing Prox1 and high levels of Sox2  \u2014  in both wild type and Neurog1/2 KO  \u2014 , and theand Hes6  were swiand Hes6 . All thee palate . Expressnockouts . Betweenog1/2 KO . Thus, fog1/2 KO .\u00a0The sinog1/2 KO . Howeverexplants  and see  stalled , corrobonockouts . A similurog2 KO , which lurog2 KO . Therefosenchyme , also diCK8, spanning the height of the oral epithelium, to different extents in different locations. From this developmental stage on, we will designate these taste bud anlagen, irrespective of their size and degree of maturation, as \u2018CK8-positive (CK8+) cell clusters\u2019. In the palate, they almost reach their mature size and structure by E18.5  in the palate  and their cross-sectional area  so that the overall area occupied by CK8+ cells was 80% smaller than in wild types  for the normal pregnancy of C57BL/6 mice). The degree of atrophy was even more pronounced at E20.5 than at E18.5, due to a decrease in the number of CK8+ cell clusters (now 89% fewer than in wild type) and a stagnation of their average size (while their wild type counterparts had enlarged), so that the total area occupied by CK8+ cells in the soft palate was smaller by 96% relative to wild type , we devised a second genetic strategy to prevent visceral innervation of the soft palate. We found that ablating the transcription factor Foxg1, expressed in epibranchial placodes , but for the constitution, maintenance or proliferation of the pool of progenitors required for bud formation, possibly reminiscent of the role of parasympathetic nerves in the organogenesis of salivary glands , a hallmark of taste cell progenitors  (At E20.5 (P2), many palatal taste buds in wild types are fully mature and probably functional . In lineel Kcnq1   , togethes Sox2+) . We coul+ cell clusters of aneural oral epithelia resembled, by their small size yet expression of terminal differentiation markers, those induced by ectopic expression of Shh  or 4% paraformaldehyde (PFA)-perfused pups (at P0 (E18.5) and P2 (E20.5)) were fixed in 4% PFA overnight at 4\u00b0C, and the tongue or palate was dissected out. For cryostat sections, tissues were embedded in 7% gelatine/15% sucrose and sectioned at 20 \u03bcm. For vibratome sections, tissues were embedded in 3% agarose (in PBS) and cut at 100 \u03bcm.Immunohistochemical reactions were done with the Vectastain Elite ABC Kits  and color revealed by DAB .For anti-Pkd2l1 and anti-Sox2 immunoreactions, light fixation was required with 4% PFA at 4\u00b0C for 3 hr.Hes6 (obtained from Ryoichiro Kageyama), Ascl1 (obtained from Fran\u00e7ois Guillemot), Shh (obtained from Andrew McMahon) and Sox2 (obtained from Dr. Robin Lovell-Badge).Antisense RNA Probes used were Foxg1Cre (BF-1) KO (Cre in the Foxg1 locus. RRID:MGI:5806112BF-1) KO : a knockNeurog1 KO  solution (Delvosteron: NaCl (0.9%)=1:1) was injected subcutaneously in each pregnant mouse. Pups were surgically delivered on day 20.5 of embryonic development.Proligestone (Delvosteron) was used to prolong the gestation of + cell clusters, one cryosection out of two through the entire soft palate was analyzed in Neurog1 and Neurog2 KO embryos, wild types serving as controls. This raw number was used as an estimate of the number of CK8+ cell clusters in the palate, without multiplying by two and performing the Abercrombie correction. Indeed, all the clusters we counted in the wild type spanned the whole height of the epithelium and/or had a visible pore, de facto excluding objects that would be tangentially sectioned. This amounts to a systematic loss of \u2018caps\u2019, an important source of errors in the Abercrombie correction (For the quantification of CK8rrection . Our metrrection  would be+ clusters (if there were less than 10), or up to ten (if there were more) were imaged, for the wild type in 2 to 3 sections around the midline of the soft palate (where taste buds were the densest), for the mutants, in one out of two sections throughout the palate. Confocal imaging was performed on a Leica SP5 microscope or a LSM 880 Airyscan Zeiss microscope. The surface occupied by each CK8+ cluster was automatically outlined and measured with the Fiji software, and the mean cross-sectional area was calculated for each genotype. To calculate the entire surface occupied by CK8+ cell clusters on alternate sections of one half of soft palate, the mean value of the calculated surfaces of CK8+ cell clusters was multiplied by the raw, uncorrected number of CK8+ clusters. Statistical analysis was performed using unpaired two-tailed t-test. Results are expressed as mean\u00a0\u00b1\u00a0SD. All graphs were performed with GraphPad Prism software. For the reason that we did not count \u2018caps\u2019 of wild type CK8+ clusters (see above), the decrease in total area is likely underestimated.For each genotype, all CK8 In the interests of transparency, eLife includes the editorial decision letter and accompanying author responses. A lightly edited version of the letter sent to the authors after peer review is shown, indicating the most substantive concerns; minor comments are not usually included.eLife. Your article has been reviewed by Marianne Bronner as the Senior Editor, a Reviewing Editor, and three reviewers. The following individual involved in review of your submission has agreed to reveal their identity: Igor Adameyko (Reviewer #3).Thank you for submitting your article \"Taste bud formation depends on taste nerves\" for consideration by The reviewers have discussed the reviews with one another and the Reviewing Editor has drafted this decision to help you prepare a revised submission.As you will see, all of the reviewers were impressed with the significance and novelty of your work, but each reviewer also had specific and useful comments for improving the manuscript. Specifically, there are suggestions relate to the quantification of the data (reviewers 1 and 2), the over-simplification of the Title and Abstract (reviewers 2 and 3), and the Discussion section .I am including the three reviews at the end of this letter. I appreciate that the reviewers' comments cover a range of suggestions for improving the manuscript. We trust that most of these can be accommodated in a reasonable period of time. We look forward to receiving your revised manuscript.Reviewer #1:This is a nifty short report on genetic ablation of either somatosensory or visceral sensory neurons and the effects on development of taste buds. The work is generally clear and well-written and offers a modicum of new information on the neural dependency of the sensory end organs for taste.A major obstacle to clarity in this work is the lack of a clear definition of how the authors use the term \"Taste buds\". As the MS describes, development in this system proceeds from non-innervated placodes through some intermediate stages culminating in a mature taste bud. The terminology used in this work seems inconsistent, sometimes referring to the intermediate stages as \"taste anlage\", but never clearly defining the term. Does a taste anlagen contain elongate, differentiated taste cells? When does a small collection of elongate taste cells become a \"taste bud\"? For example, Figure 2 shows elongate differentiated taste cells in Neurog2 KO animals, but the caption suggests that taste buds do not form in this KO line. Since the bar graphs of this figure report on number of taste buds observed, it is essential that the authors define what structure was counted as a taste bud. If in fact the authors are counting as taste buds these small collections of differentiated elongate cells, then they should be correcting for the sampling bias comparing larger objects to smaller objects in histological sections, e.g. by Abercrombie correction. If not, this is essential. Crucial for this calculation is the section thickness and the spacing between sections in relation to the size of the objects being studied. For example, if the section thickness is 15um and the object is 50um in depth, then each object is guaranteed to be counted twice if alternate sections are measured. Conversely, in the same set of sections a 10um object will be counted only once giving the impression that there are twice as many large objects as small objects when in fact, there would be equal numbers.Also missing from this report is any mention of the development of taste bud primordia (placodes?) in vitro - a situation entirely devoid of innervation. This would seem highly relevant to this paper. Relevant references:Mbiene, Maccallum and Mistretta, 1997.Mistretta et al., 2003.Hall, Bell and Finger, 2003.Ozdener et al., 2006.Reviewer #2:Understanding the role of innervation in taste bud development is complicated by the normal occurrence of taste buds in the palate and different parts of the tongue, with taste cells maturing at different rates in each of these locations. Fan et al. exploited their genetic models to dissect the involvement of nerves in taste bud formation at different stages and in distinct locations.Developmental defects in these mouse mutants include the absence of neurons that normally innervate the taste buds, and these unique neuronal knockouts therefore can be used to assess whether nerves are required in taste bud development. The authors showed that at early stages when nerves are just about to establish contacts with their peripheral targets, the circumvallate placode at the posterior of the tongue is unique in its nerve dependence for expression of certain early genes and for taste bud formation. Expression of some of the same genes during development of non-taste palatal placodes or lingual placodes giving rise to taste buds of the fungiform papillae in contrast remains largely unaffected. Nerves thus participate in taste bud formation at specific developmental windows that vary by location. This variation in nerve dependence for formation of distinct taste bud populations raises questions as to the choice of title, which understates the complexity of taste bud dependence on innervation.Sox2 associated with progenitor cells. However, sample numbers and quantification of these observations were not provided in the current manuscript. A revision of the manuscript is recommended before acceptance for publication. Please see below for specific questions and suggestions.It would be helpful if the authors could provide an overview describing taste bud development and maturation at each location and at distinct developmental stages. Using the Neurog2 knockout alone in palatal taste bud development, a previously unappreciated early involvement of nerves in taste bud maintenance was noted. The authors showed morphological defects in the number of K8+ cells and reduced proliferation and reduced expression of 1) The Abstract and Title do not include any reference to the complexity of nerve involvement in formation of taste buds at different locations and developmental stages.2) Does circumvallate atrophy occur in the Neurog2 single knockout, as was noted for the Neurog1/2 double KO?3) Please report the number of mutant animals examined in Figure 1.Sox2Sox2+ progenitor cells and proliferative status as indicated by Ki67+. Additional time points at E16.5 and E17.5 would also be informative.4) One of the most interesting aspects of the paper is mutant effects on progenitor cells, however, more samples are needed to quantify Reviewer #3:This focused and strong study answers an important biological question addressing the importance of innervation in initial development of taste buds and putting the regeneration of taste buds into an ontogeny-like framework. The authors provide a clear and straightforward answer in the form of a short report.I have very few comments:1) I think that the abstract slightly over-exaggerates the real conclusions: not all taste buds depend on the nerve presence in their development.https://www.ncbi.nlm.nih.gov/pmc/articles/PMC4197660/2) It should be very briefly discussed why different taste buds demonstrate differential preferences for the specific visceral sensory nerves during their development. Why the embryonic environment is permissive for some buds that are not innervated at all in case of a double Neurog1/2 KO? Can it be connected to the extraordinary high levels of Shh in developing rugi of the palate? This would fit the results described in the paper from Linda Barlow lab: 3) In Figure 2\u2014figure supplement 1: In case of Neurog2 KO, Tuj1+ green fibers are very proximal to the CK8 staining and the location of forming taste bud. Are those nerves the remaining touch afferents? They stay in place in Neurog2 KO, although they do not support the development of fungiform papillae. It will be good if the authors clarify this in a figure legend for pedagogical purposes.4) Can it be that nerve-associated cells (SCPs and Schwann cells) play a key role in signaling to the developing taste buds, and not the neurons, which support them ? Worth discussing in one or two phrases.Overall, this is a good report that requires only some tuning of the text. Reviewer #1:This is a nifty short report on genetic ablation of either somatosensory or visceral sensory neurons and the effects on development of taste buds. The work is generally clear and well-written and offers a modicum of new information on the neural dependency of the sensory end organs for taste.A major obstacle to clarity in this work is the lack of a clear definition of how the authors use the term \"Taste buds\". As the MS describes, development in this system proceeds from non-innervated placodes through some intermediate stages culminating in a mature taste bud. The terminology used in this work seems inconsistent, sometimes referring to the intermediate stages as \"taste anlage\", but never clearly defining the term. Does a taste anlagen contain elongate, differentiated taste cells? When does a small collection of elongate taste cells become a \"taste bud\"?Shh or CK8 spans 3 and 2 of these phases, respectively, and their restriction to future taste bud cells is progressive. As for terminal differentiation markers , the onset of their expression is not precisely known. So, to the question \u201cWhen does a small collection of elongate taste cells become a \"taste bud\"?\u201d there is, in our opinion, no rigorous answer.The referee rightly points to the lack of clear-cut transition during taste bud formation. Indeed, we don\u2019t know of any morphological criterion or global gene expression event that sharply demarcates the three canonical stages of taste bud formation: \u201cplacode\u201d, \u201cpapilla\u201d , and \u201ctaste organ\u201d (i.e. a papilla equipped with a mature taste bud). The expression of + cells at E18.5 or later, \u201cCK8+ cells clusters\u201d whether they are mature taste buds, immature taste buds , or taste buds which are atrophic in the mutants, to any extent. This common term reflects the fact that all such formations are not distinguished by dichotomous morphological or gene expression criteria, but distributed on a gradient of sizes (and we quantify the sizes).This said, to homogenize the nomenclature as requested, we now call any group of elongated CK8+ cells between E16.5 and 18.5, before they are clearly elongated or grouped in onion shaped structures, all the more so, since we show that some of these cells  never become taste cells.This leaves undefined the nature of CK8Nevertheless, we have kept the word \u201ctaste bud\u201d in the title of the paper and figures and in the Discussion section, because a large majority of CK8+ clusters have vanished in the mutants and the remaining ones are abnormally small, so that, despite the lack of definition of the exact moment where a collection of CK8+ cells qualifies as a \u201ctaste bud\u201d, we feel justified in saying that \u201ctaste bud formation requires taste nerves\u201d [see responses to criticisms of the title below].For example, Figure 2 shows elongate differentiated taste cells in Neurog2 KO animals, but the caption suggests that taste buds do not form in this KO line. Since the bar graphs of this figure report on number of taste buds observed, it is essential that the authors define what structure was counted as a taste bud.+ cell clusters\u201d in the legend and in the figure. And we counted all CK8+ cell clusters (down to single cells when that occurred in the mutants).See explanation above. We have now replaced \u201ctaste buds\u201d by \u201cCK8If in fact the authors are counting as taste buds these small collections of differentiated elongate cells, then they should be correcting for the sampling bias comparing larger objects to smaller objects in histological sections, e.g. by Abercrombie correction. If not, this is essential. Crucial for this calculation is the section thickness and the spacing between sections in relation to the size of the objects being studied. For example, if the section thickness is 15um and the object is 50um in depth, then each object is guaranteed to be counted twice if alternate sections are measured. Conversely, in the same set of sections a 10um object will be counted only once giving the impression that there are twice as many large objects as small objects when in fact, there would be equal numbers.We do not think that the Abercrombie correction, which was devised to count cell nuclei in a volume of tissue, is appropriate for the comparison of very different objects between a wild type and mutant condition, particularly because of the indirect estimate of H (the height of the object perpendicular to the plane of section) and the \u201clost caps\u201d effect We now make this reasoning explicit in the Material and methods section: in the following way:+ cell clusters in the palate, without multiplying by two and performing the Abercrombie correction. Indeed, all the clusters we counted in the wild type spanned the whole height of the epithelium and/or had a visible pore, de facto excluding objects that would be tangentially sectioned. This amounts to a systematic loss of \u201ccaps\u201d, an important source of errors in the Abercrombie correction . Our method makes it next to impossible that clusters (with an average width of 28\u03bcm(E18.5) and 38\u03bcm (E20.5)) would be counted more than once on alternate 20\u03bcm sections. On the other hand, a few clusters were probably lost, if they were centered on one of the uncounted section. The accuracy of our method is verified by the fact that we found the same number of clusters at E20.5 and E18.5 despite the 36% increase in average diameter, and also that we found (not shown) the same number of clusters on alternate 30\u03bcm sections (as opposed to 20\u03bcm).\u201d\u201cThis raw number was used as an estimate of the number of CK8In any case, this raw number is the only one relevant to the calculation of the total volume occupied by CK8+ cells, that we estimate through the proxy of the total surface occupied by CK8+ cells on the sections we count (one 20\u03bcm section out of two). The total surface occupied by taste cells is the total number of patches of CK8+ cells seen on sections, multiplied by the average size of the patches. If two patches on two sections happened to correspond to the same \u201cCK8+ cell cluster\u201d, it would be a realistic reflection of the fact that this cluster is big and occupies a large volume . This is biologically the most important figure. If the number of CK8+ clusters was unchanged in the mutants, but their size decreased on average by 98%, the conclusion of our paper, i.e. that \u201ctaste bud formation depends on taste nerves\u201d would remain unchanged.Also missing from this report is any mention of the development of taste bud primordia (placodes?) in vitro - a situation entirely devoid of innervation. This would seem highly relevant to this paper. Relevant references:Mbiene, Maccallum and Mistretta, 1997.Mistretta et al., 2003.Hall, Bell and Finger, 2003.Ozdener et al., 2006.We did cite the first paper, historically, to show that fungiform papillae develop in tongue explants. As requested, we have now added the following citation:, Maccallum and Mistretta, 1997 and Hall, Bell and Finger, 2003. And we added Mistretta et al., 2003 on the topic of the CV papilla, making explicit that we find, like her, that Shh is switched on in the CV placode, but leaving implicit the contradiction of her claim that CV papilla formation is nerve independent . On the other hand, it is not easy to see how the taste cell culture system described by Ozdener et al., 2006 informs about nerve dependency in vivo.Reviewer #2:[\u2026] It would be helpful if the authors could provide an overview describing taste bud development and maturation at each location and at distinct developmental stages.The circumvallate placode is unique in its dependency on nerves for subsequent papilla formation, but not for taste bud formation, which are just as dependent as in other papillae. To help conceptually disentangle the two issues, we now show, the absence of taste buds in the neonatal circumvallate organ (as expected since the organ itself does not form) .Using the Neurog2 knockout alone in palatal taste bud development, a previously unappreciated early involvement of nerves in taste bud maintenance was noted. The authors showed morphological defects in the number of K8+ cells and reduced proliferation and reduced expression of Sox2 associated with progenitor cells. However, sample numbers and quantification of these observations were not provided in the current manuscript. A revision of the manuscript is recommended before acceptance for publication.We do not document \u201cmaintenance\u201d but appearance.Please see below for specific questions and suggestions.1) The Abstract and Title do not include any reference to the complexity of nerve involvement in formation of taste buds at different locations and developmental stages.The \u201ccomplexity\u201d (which is rather an asynchrony) is in the development itself, not in the requirement for nerves in that development. The development of taste buds is not synchronous at every place  and their demise at different stages in the absence of nerves simply reflects that.The only true \u201ccomplexity\u201d, not encapsulated by the Title or the Abstract, is that the CV organ depends on nerves, not only for its resident taste buds but also for the papilla itself. In other words, it depends on the nerves even more than other taste organs. The title does not include this additional feature, but remains perfectly true, concerning taste buds.We think that one virtue of our title (and of the paper), is precisely to simplify a field \u2014 which has become replete, over decades, with appearances of complexities and special cases, quantification of partial phenotypes, at different phases, in different locations, etc. \u2014 by encapsulating the fact that no complete, mature taste bud forms in the absence of nerves. This most important message would be jeopardized by the addition of what is basically a bonus, the idiosyncrasy of the circumvallate papilla .2) Does circumvallate atrophy occur in the Neurog2 single knockout, as was noted for the Neurog1/2 double KO?Neurog2 KO looks exactly like the double Neurog2/Neurog1 knock out. This is now stated in the text as: \u201cA similar phenotype was obtained in single Neurog2 KO , which lack a petrosal ganglion .As requested, we now show in a new supplementary figure that the 3) Please report the number of mutant animals examined in Figure 1.Two animals were used for each probe. This is now stated in the legend.+ progenitor cells and proliferative status as indicated by Ki67+. Additional time points at E16.5 and E17.5 would also be informative.4) One of the most interesting aspects of the paper is mutant effects on progenitor cells, however, more samples are needed to quantify Sox2Sox2Sox2+ cells and Ki67 cells in mutants and wild type ad E18.5, and add this data to Figure 4. On a pilot experiment (that we do not show), we could not see any difference at E16.5.As requested, we now counted Reviewer #3:This focused and strong study answers an important biological question addressing the importance of innervation in initial development of taste buds and putting the regeneration of taste buds into an ontogeny-like framework. The authors provide a clear and straightforward answer in the form of a short report.I have very few comments:1) I think that the abstract slightly over-exaggerates the real conclusions: not all taste buds depend on the nerve presence in their development.+ cell clusters in the mutants are the same, from animal to animal. We believe that our short and clear abstract reflects the findings that we describe, without exaggeration, and that the field will benefit from that clear message [see response to referee #2]. Nevertheless, we softened the abstract as requested, it now reads \u201cwe show that the latter but not the former are absolutely required for the proper formation of their target organs, the taste buds\u201d, leaving room for the formation of very rudimentary, atrophic organs.It is not clear to us what are the taste buds that the referee has in mind that would not depend on nerves. Unless the referee means that our statement would be justified only if the disappearance of taste cells was by 100% as opposed to 96%? Also, we have no indication that the atrophic residual CK82) It should be very briefly discussed why different taste buds demonstrate differential preferences for the specific visceral sensory nerves during their development.papilla shows a specific dependency that other papillae don\u2019t.Taste buds per se don\u2019t demonstrate differential preferences (see response to referee#2). Only the circumvallate https://www.ncbi.nlm.nih.gov/pmc/articles/PMC4197660/Why the embryonic environment is permissive for some buds that are not innervated at all in case of a double Neurog1/2 KO? Can it be connected to the extraordinary high levels of Shh in developing rugi of the palate? This would fit the results described in the paper from Linda Barlow lab: We do not see true \u201ctaste buds\u201d (i.e. CK8+ clusters which would not be atrophic) in the mutants. The relationship of the atrophic residual taste buds  to the ectopic ones in the Barlow paper is made explicit in the text. .3) In Figure 2\u2014figure supplement 1: In case of Neurog2 KO, Tuj1+ green fibers are very proximal to the CK8 staining and the location of forming taste bud. Are those nerves the remaining touch afferents? They stay in place in Neurog2 KO, although they do not support the development of fungiform papillae. It will be good if the authors clarify this in a figure legend for pedagogical purposes.Neurog1 and Neurog2 knockout at E16.5, the epithelium of the tongue and of the soft palate retained nerve fascicles at regularly spaced locations (corresponding to the taste organs) from, presumably, visceral or somatic sensory fibers, respectively (which thus navigate to their target independently of each other)\u201d. As requested, we have now added the following sentence in the legend of Figure 1\u2014figure supplement 1: \u201cSince Neurog2 KO have lost the geniculate, but keep the trigeminal ganglion, the residual innervation of taste organs in these mutants correspond to the somatic (touch and pain) fibers\u201d.In the original main text we wrote: \u201cIn each single 4) Can it be that nerve-associated cells (SCPs and Schwann cells) play a key role in signaling to the developing taste buds, and not the neurons, which support them ? Worth discussing in one or two phrases.As requested we now mention this possibility in the text as follows: \u201cThis specificity [of nerve fiber type] makes less likely the possibility, that we cannot exclude however, that the nerve associated cells (Schwann cell precursors and Schwann cells) have the inducing role, rather than the nerve fibers themselves.\u201d"}
+{"text": "Public health guidelines suggest that physical activity can be accumulated in multiple short bouts dispersed through the day. A synthesis of the evidence for this approach is lacking.Our objective was to undertake a systematic review and meta-analysis to examine if exercise interventions consisting of a single bout of exercise compared with interventions comprising the same total duration, mode, and intensity of exercise accumulated over the course of the day have different effects on health outcomes in adults.Six electronic databases were searched (Jan 1970\u201329 August 2018). Two authors identified studies that evaluated the effects of a single bout of exercise compared with the same intensity, total duration, and mode of exercise accumulated in multiple bouts over the course of a day, in community-dwelling adults. Risk of bias was assessed using the Cochrane Collaboration tool. Pooled effects were reported as standardised mean differences (MDs) and 95% confidence intervals (CIs) using a random effects model.I2\u2009=\u20090%; five studies, 211 participants). In subgroup analyses, accumulating >\u2009150\u00a0min of weekly exercise in multiple bouts per day resulted in small effects on body fat percentage  compared with 150\u00a0min of exercise amassed via single continuous bouts per day. There was a decrease in low-density lipoprotein (LDL) cholesterol with accumulated versus continuous exercise . No differences were observed for any other blood biomarker .A total of 19 studies involving 1080 participants met the inclusion criteria. There were no differences between accumulated and continuous groups for any cardiorespiratory fitness or blood pressure outcomes. A difference was found in body mass changes from baseline to post-intervention in favour of accumulated exercise compared with continuous .The online version of this article (10.1007/s40279-019-01145-2) contains supplementary material, which is available to authorized users. Globally, approximately one quarter of adults 23.3%) are failing to meet current recommendations for physical activity . Since 13.3% are Acute responses to physical activity have been observed during and in the hours following a single bout of physical activity . Reductin\u2009=\u20097). Furthermore, the majority of included studies relied on self-reported measures of exercise , which may have impacted the reliability of comparisons ; (2) body fatness (e.g. body fat percentage); and (3) cardiovascular risk factors (e.g. blood pressure and blood lipids) measured using standard techniques. Secondary outcomes included psychological/psychosocial parameters , other anthropometric measures (e.g. lean mass and waist-to-hip ratio), and objectively measured physical activity and sedentary behaviour derived from accelerometers. We also recorded adverse events and adherence to exercise programmes.Our primary outcomes included (1) cardiorespiratory fitness , with contrast analysis revealing statistical increases in the control group, but not in the two exercise conditions. Eguchi et al. [p\u2009<\u20090.05) in both accumulated and continuous exercise groups compared with control, but no differences between exercise groups. In the same study, no statistical differences in 2-h insulin were observed between exercise groups or control.Additional blood biomarker outcomes not included in the meta-analysis were as follows: One study  showed mer study  found noer study  observedi et al.  found noi et al.  found stI2\u2009=\u200927% and 0.68, 95% CI 0.03\u20131.32, I2\u2009=\u20090%). However, no statistical differences in vigour subscale scores were found. Only one of these studies included a control group, so accumulated exercise versus control comparisons were not possible. Similarly, both studies prescribed an exercise dose of 150\u00a0min (both 5\u00a0days of 3\u2009\u00d7\u200910-min bouts), so no subgroup analysis by exercise dose was possible. Only Osei-Tutu and Campagna [In meta-analyses involving only 41 participants in two studies , 37 thatCampagna  reportedp\u2009=\u20090.034) at mid-intervention, and greater improvements in self-efficacy among accumulated bout exercisers compared with control (p\u2009=\u20090.001) at the end of the 12-week intervention. However, the effect on self-efficacy was similar between the two exercise patterns. Murphy et al. [p\u2009<\u20090.05) only. The third trial [d\u2009=\u20090.40 in both cases).Three trials , 33, 38 rd trial  reportedp\u2009=\u20090.046), whereas no differences were found within or between accumulated and continuous exercise bout groups. In the second trial, Asikainen et al. [p\u2009=\u20090.021).Two trials , 38 compn et al.  measuredn et al.  also obsNo statistical differences were found for daily energy intake  or percentage of daily energy intake from fat between accumulated and continuous exercise, accumulated exercise and control, or any subgroup analysis by exercise dose. In one study  that didp\u2009=\u20090.008). In the same trial, however, no between-group differences were observed in the proportion of participants reaching the maximum score on the one-leg standing balance test. Finally, walking time on the UKK 2-km Walk Test increased statistically in both exercise groups when compared with the control group (p\u2009<\u20090.001). Similarly, Shiau et al. [p\u2009<\u20090.05) in maximal strength (via 1\u00a0RM bench press), anaerobic performance (via 30-s Wingate test), and blood lactate response to anaerobic exercise (30-s Wingate) after a 12\u00a0week accumulated (three bouts of one set of each exercise per session for 3\u00a0days/week) or continuous (three sets of each resistance exercise per session for 3\u00a0days/week) resistance training intervention, but no statistical between-group differences. DeBusk et al. [Asikainen et al.  reportedu et al.  reportedk et al.  reportedk et al.  reportedThis is the first meta-analysis considering the effects of splitting a continuous bout of exercise into shorter bouts of the same intensity and overall duration dispersed throughout the day. The majority of the studies included (16 of 19) were small (<\u200930 participants), and therefore, probably did not have sufficient power to detect changes in some outcomes. Pooling the weighted data in this analysis increases the power to detect such changes. The findings suggest that accumulating exercise in short bouts (at least 10\u00a0min) over the course of the day produces similar effects on a range of health-related outcomes, including cardiorespiratory fitness, blood pressure, lipids, and glucose metabolism, to performing the same exercise in one continuous bout. This strengthens the evidence base for current physical activity guidelines which suggest that short bouts are equivalent to longer continuous bouts.Within our analysis, there is evidence from a small number of studies that accumulated bouts of exercise produce slightly more favourable changes in body mass and LDL cholesterol than continuous bouts of the same intensity and total duration. The mechanisms underlying potential differences in these effects on body mass have not been well elucidated. It is plausible, however, that the acute increase in metabolic rate induced by exercise  results Accumulated exercise has often been promoted as a more palatable way of meeting physical activity recommendations. This suggestion is intuitively appealing given that time is often cited as a barrier to achieving sufficient daily physical activity . Howevern\u2009=\u200912/19) of the studies comparing the effects of continuous and accumulated exercise. This may reflect both the accessibility of walking in terms of cost, skill requirement and acceptability among participants but it is also likely to be because unlike many other forms of exercise, walking can be easily incorporated into daily life. It is unlikely that someone choosing swimming or another facility-based exercise or one which requires a change of clothing would choose to split a continuous daily bout into multiple shorter bouts. This underscores the utility of walking as a flexible mode of exercise eminently suitable for helping people meet current physical activity guidelines. Of note is the predominance of female participants in the trials included in this study. This contrasts with the trends towards male participation in other exercise trials [Walking was the mode of activity employed in most  definition) . Many ofOur analysis suggests that splitting a continuous bout of exercise into shorter bouts of equivalent total duration dispersed over the course of a day does not alter its potential to evoke physiological effects likely to provide health benefit. Moreover, for weight loss, the fractionalisation of a single exercise bout into multiple bouts spread across the day may provide greater benefit. These findings provide further evidence that bout length, at least when bout duration is greater than 10\u00a0min, is not a determinant of the health effects associated with regular exercise.Supplementary material 1 (DOCX 13 kb)Supplementary material 2 (DOCX 18 kb)Supplementary material 3 (DOCX 27 kb)Below is the link to the electronic supplementary material."}
+{"text": "Neurospora crassa. Here we provide evidence indicating that czt-1 is allelic to acr-3, a previously described locus that we now found to harbor a point mutation in its coding sequence. This nonsynonymous amino acid substitution in a low complexity region of CZT-1/ACR-3 caused a robust gain-of-function that led to reduced sensitivity to acriflavine and staurosporine, and increased expression of the drug efflux pump abc-3. Thus, accumulating evidence shows that CZT-1 is an important broad regulator of the cellular response to various antifungal compounds that appear to share common molecular targets.Fungal infections have far-reaching implications that range from severe human disease to a panoply of disruptive agricultural and ecological effects, making it imperative to identify and understand the molecular pathways governing the response to antifungal compounds. In this context, CZT-1 (cell death-activated zinc cluster transcription factor) functions as a master regulator of cell death and drug susceptibility in  Human fungal infections have been, until recently, a largely underestimated public health problem with dramatic worldwide ramifications. Superficial skin infections occur in approximately a quarter of the world\u2019s population, and invasive fungal infections, while less incident, are associated with high mortality rates\u2014about 1.5 million people every year ,3. In adNeurospora crassa, are of great importance due to the wide availability of genetic tools, such as targeted gene deletion strain collections and the accumulation of strains obtained over the years by classical forward genetics methodologies [Theoretically, most human fungal infections are relatively easy to treat provided that access to antifungal drugs is assured. However, a restricted number of drug options against fungal infections are available, including polyene (amphotericin B), echinocandin and azole drugs ,5. The sdologies .N. crassa response to staurosporine involves well-defined alterations in the levels of cytosolic calcium, a process mediated by a putative transient receptor potential (TRP) channel at the plasma membrane and regulated by phospholipase C [N. crassa response to staurosporine is largely controlled by the Zn2Cys6 binuclear cluster transcription factor CZT-1 [czt-1 is allelic to acr-3, a locus that had been described in a mutant N. crassa strain obtained decades ago by random mutagenesis and that exhibits increased resistance to the fungal growth inhibitors acriflavine and malachite green [czt-1 results in gain-of-function and is the likely cause for the enhanced tolerance to acriflavine of the acr-3 strain. This report expands the importance of CZT-1 as an important regulator of susceptibility to antifungal compounds.Staurosporine is a natural bacterial alkaloid, protein kinase inhibitor and prototypical anticancer drug that has been customarily used as a cell death inducer in various organisms, including fungi . The N. lipase C , as welllipase C . At the or CZT-1 . Here wete green . We showN. crassa was performed on Vogel\u2019s minimal medium with 2% sucrose (plus 1.5% agar for solid medium). Asexual spores were obtained by growing strains in glass tubes with slanted medium for one week until full sporulation was evident. Mutant strains were obtained from the Fungal Genetics Stock Center [acr-3 mutant was obtained using a routine sequencing methodology [6 cells/mL were grown at 26 \u00b0C in liquid VMM for 7 h; RNA was then isolated using the ZR Fungal/Bacterial RNA MicroPrep kit (Zymo Research), used for cDNA preparation using the SuperScript First-Strand Synthesis System kit (Life Technologies) and the relative expression of abc-3 in different strains using actin (NCU04173) as the reference gene was obtained using the 2Ct\u2212\u0394\u0394 calculation method from mixes containing previously described primers [Routine cultivation of k Center . The genhodology . Radial hodology . Stauros primers  and SYBRN. crassa has resulted in a collection of strains displaying morphological and developmental phenotypes that has been complemented with a genetic map of more than 1000 phenotypic markers and hundreds of other features like telomeres, centromeres, nucleolus organizer region, translocations, inversions and duplications [N. crassa mutant FGSC1215 (acr-3 mat-a) was generated by UV light-based random mutagenesis and exhibits increased resistance to acriflavine [acr-3 (acriflavine resistant-3) is one of seven loci in N. crassa associated with altered tolerance to this drug [The application of classical forward genetics methodologies in ications . More reications . The N. iflavine ; acr-3 , FGSC1209 (acr-3 mat-A) or FGSC875 (acr-1 mat-a) [acr-3 mutant was czt-1; czt-1 is also located in the genomic region previously identified to contain the acr-3 locus. In fact, czt-1 and abc-3 are adjacent to each other and CZT-1 is a transcriptional regulator of abc-3 [czt-1 (NCU09974) in FGSC1215 (acr-3) revealed a C>T non-synonymous mutation in its coding sequence  . Thus, wof abc-3 ,13. Targsequence A. Two tr domain\u201d . It willacr-3 mutant grew slightly slower than the wild type  were almost ineffective against both mating type strains of acr-3  [2Cys6 proteins are fungal specific, constitute the largest family of transcription factors in N. crassa [In summary, we report here that the CU05733) . Zn2Cys6. crassa  and have. crassa ,21,23. A. crassa  and acri. crassa  and prot. crassa . Further"}
+{"text": "Glycine max L.) has been used as a traditional medicine because its seed coat contains various natural phenolic compounds such as anthocyanins. The objective of this study was to reveal the genetic variation in the agricultural traits, phytochemicals, and antioxidant activity of 172 Korean black soybean landraces (KBSLs) and establish a relationship among them. The evaluation of three agricultural traits , six phytochemicals , and four antioxidant activities , 2,2\u2032-azino-bis-(3-ethylbenzothiazoline-6-sulfonic acid)(ABTS), ferric-reducing antioxidant power (FRAP), and the total polyphenol content (TPC) of 172 KBSLs were analyzed in 2012 and 2015. The agricultural traits, phytochemicals, and antioxidant activities of the 172 KBSLs showed wide variation among the accessions and years. In correlation analysis, the agricultural traits and phytochemicals showed positive and negative correlations with phytochemicals and antioxidant activity, respectively. The principal component analyses result indicated that phytochemicals accounted for most of the variability in the KBSLs. In clustering analysis, the 172 KBSLs were classified into four clusters. These results could lead to expanding the knowledge of the agricultural traits, phytochemicals, and antioxidant activity of the KBSLs, which are valuable materials for the development of new soybean varieties.Black soybean ( Glycine max L. Merr.) is widely cultivated and consumed throughout the world as grains, tofu, and soy milk [Soybean  were evaluated. The aim of this study was to reveal the genetic variation in 172 KBSLs to provide information on KBSLs which are valuable as a functional food crop and/or a new dietary ingredient.A total of 172 KBSLs were obtained from the National Agrobiodiversity Center of the Rural Development Administration (RDA), Republic of Korea. Each accession was sown with 20 seeds on May 25, 2012, at Suwon  and on May 27, 2015, at Jeonju . Standard RDA soybean management practices were applied for the cultivation. Days to 50% flowering  and days to maturity  of each KBSL were observed during cultivation, and 100-seed weight (SW) was measured after harvest. The harvested seeds were refrigerated at \u221220 \u00b0C until they were retrieved for analyses.In order to analyze the anthocyanin content in each KBSL, the hand-peeled seed coats (100 mg) of 172 KBSLs were mixed with 15 mL of 1% HCl in 99% MeOH for 24 h at 4 \u00b0C in the dark. After centrifugation at 13000 rpm for 10 min, each specimen was filtered through a 0.45 \u00b5m syringe filter and analyzed with an Agilent 1260 Infinity HPLC system . The analysis was performed using a Waters XSelect HSS Cyano XP system . The HPLC conditions were as follows: solvent A, 0.1% TFA/H2O; solvent B, 0.1% TFA/CH3CN; gradient, 5% (B) for 0.3 min, 20% (B) for 6.0 min, 95% (B) for 8.0 min, and 5% (B) for 10 min; column temperature, 40 \u00b0C; and flow rate, 0.5 mL/min. The filter detector was set at 520 nm .To analyze the isoflavone content in each KBSL, 100 mg of each sample (whole seeds) was added to 2 mL of 80% MeOH and incubated with sonication for 1 h. The sample in each tube was hydrolyzed using 150 \u00b5L of 2N NaOH. After mixing for 10 min, the solutions were neutralized with 50 \u00b5l of glacial acetic acid. The sample was centrifuged for 5 min at 3000 rpm, and the collected supernatant was then filtered using a 0.45 \u00b5m syringe filter prior to analysis with an Agilent 1260 Infinity HPLC system (Agilent Technology). The analysis was performed using a Proshell 120 SB-C15 . The HPLC conditions were as follows: solvent A, 0.1% TFA/H2O; solvent B, 0.1%TFA/CH3CN; gradient, 10% (B) for 0.35 min, 10%\u201330% (B) in 3.96 min, held at 30% (B) for 0.36 min, and re-equilibrated at 10% (B) for 1.8 min; column temperature, 30 \u00b0C; and flow rate, 0.58 mL/min. The filter detector was set at 254 nm .To compare antioxidant activities in 172 KBSLs, 2,2-diphenyl-1-picrylhydrazyl (DPPH), 2,2\u2032-azino-bis-(3-ethylbenzothiazoline-6-sulfonic acid) (ABTS), ferric-reducing antioxidant power (FRAP), and total polyphenol content (TPC) assays were performed using previous methods described by Lee et al. . To anal50 were converted to 1/IC50 before clustering analysis. Integration of the antioxidant capacity results derived from different chemical methods was used to calculate the relative antioxidant capacity index (RACI) [All the data collected from three replicate experiments were expressed as the mean \u00b1 standard deviation. Duncan\u2019s multiple-range test and correlation analyses were used to determine the differences between the 172 KBSLs using SPSS Statistics 20 . The DPPH results expressed as ICx (RACI) . Hierarcx (RACI) . PAST3 sx (RACI) . p < 0.001) and experimental years (p < 0.001), whereas the DM was only significantly different between the accessions (p < 0.001) (There were variations in the 172 KBSLs in days to 50% flowering (DF), days to maturity (DM), and 100-seed weight (SW) in 2012 and 2015 . The DF < 0.001) .p < 0.001), the experimental years (p < 0.001), and the interaction between year and accessions (p < 0.001), whereas the C3G content was different between black soybean accessions (p < 0.001) and the interaction between year and accessions (p < 0.001) (The content of three anthocyanins (delphinidin-3-O-b-D-glucoside (D3G), cyanidin-3-O-b-D-glucoside (C3G), and petunidin-3-O-b-D-glucoside (Pt3G)) and isoflavone aglycones  was measured in the 172 KBSLs . Among a< 0.001) .p < 0.001), experimental years (p < 0.001), and the interaction between year and accessions (p < 0.001). In the three isoflavone aglycones, the contents of daidzin, glycitin, and genestin were 14.1 to 108.7, 0.8 to 43.2, and 15.6 to 115.6 mg/100 g dried seeds in 2012 and 4.6 to 81.0, 0.4 to 19.9, and 5.2 to 56.7 mg/100 g dried seeds in 2015, respectively. The three isoflavone contents were significantly different between the black soybean accessions (50) in 2012 and 16.4 to 154.6 (IC50) in 2015, with average values of 90.3 and 59.5 (IC50), respectively, among the accessions evaluated , experimental years (p < 0.001), and the interactions between years and accessions (p < 0.01), respectively, whereas the ABTS activity was significantly different between black soybean accessions (p < 0.01) and the interaction between year and accessions (p < 0.01). In the results of RACI, IT178047 was the highest (2.21), followed by IT274457 (1.64), IT178132 (1.52), and IT177807 with the lowest value (\u22121.49)  .p < 0.001); D3G and Pt3G, r = 0.267 (p < 0.001); C3G and Pt3G, r = 0.287 (p < 00.01)) and isoflavones ; daidzin and genestin, r = 0.554 (p < 0.001); glycitin and genestin, r = 0.362 (p < 0.0001)). Between the anthocyanins and antioxidants, C3G showed correlations with DPPH , ABTS , TPC , and FRAP . D3G showed correlations with DPPH , ABTS , and FRAP , whereas Pt3G was not corrected with antioxidant activities. Among the isoflavones, only genestin showed a positive correlation with ABTS activities . Among the agricultural traits, the DF and DM showed correlations with anthocyanins, isoflavones, and antioxidant activity, whereas the SW was only correlated with isoflavones. The correlations between agricultural traits, phytochemicals, and antioxidant activities are shown in PCA using the agricultural traits, phytochemicals, and antioxidant activities of 172 KBSLs indicated that five principal components (PCs) with eigenvalues >1 could explain 73.94% of the total variance . The firThe first two PCs are plotted in The 172 KBSL were classified into four clusters according to their agricultural traits, phytochemicals, and antioxidant activities . ClusterIn this study, the agricultural traits, phytochemicals, and antioxidant activity of 172 KBSLs were evaluated to identify their potential as new breeding materials. The results showed that the 172 KBSLs had wide variations in agricultural traits, phytochemicals, and antioxidant activity. Hoisington et al.  suggesteMany methods measuring antioxidant activity have been developed and used to determine the antioxidant capacity of plant extracts because they use relatively standard equipment and can deliver fast and reproducible results . In thisThe DF was positively correlated with anthocyanins, genestin, and antioxidant activities. Phommalath et al.  reportedThe black soybeans exhibited high levels of antioxidant activity because of their high concentrations of phenolic compounds . In addiGenetic variability is important to the success of a breeding program . Therefo"}
+{"text": "Staphylococcus aureus (SA) based on specific aptamer and catalysis of dsDNA-SYBR Green I (SG I) complex. SA specific aptamer was immobilized on a 96-well plate by hybridization with the capture probe anchored on the plate surface through streptavidin-biotin binding. In presence of SA, the aptamer was dissociated from the capture probe-aptamer duplex due to the stronger interaction between the aptamer and SA. The consequent single-strand capture probe could be hybridized with a three-way junction (TWJ) probe. With the presence of SG I, the dsDNA-SG I complex catalyze the oxidation of 3,3\u2032,5,5\u2032-tetramethylbenzidine (TMB) under photo-irradiation, producing sensitive photo-catalyzed colorimetric response to SA. Under the optimal conditions, the proposed method could directly detect SA with the limit of detection (LOD) at 81 CFU mL\u22121 in PBS buffer in 5.5\u2009hours, which demonstrated the sensitive and fast quantification of target pathogenic bacteria. The method showed weak colorimetric signal to Escherichia coli and Pseudomonas aeruginosa, indicating the high specificity for SA. In addition, the method can simultaneously detect 96 samples which can be used for high throughput analysis. The designed method may become a powerful tool for pathogenic microorganisms screening in clinical diagnostics, food safety and environmental monitoring.To develop a high throughput colorimetric biosensor for detection of  Staphylococcus aureus (SA) is the most common pathogen that causes a wide range of human infections. It is the major cause of bacteremia, infective endocarditis as well as skin and soft tissue infection and device-related infections1. Rapid identification of SA in the early stages of infection is important for reducing high mortality. However, the conventional culture method, known as \u201cgold standard\u201d for bacterial detection, usually requires 3\u20135 days incubation. It also needs at least 12\u2009hours of growth on solid media to complete the identification2. Time consuming and insensitive are common problems with these methods.3, polymerase chain reaction (PCR)4, surface plasmon resonance biosensor5, electrochemical biosensor6 and so on. Despite improvements, these methods still require sophisticated equipment, complex sample preparation and long-term blood culture, which limit their use in clinical applications7. Besides, false positive results often occur in PCR detection8. Therefore, the development of a new platform that can distinguish SA in a short time is highly desired.Various methods which can shorten the detection time and increase the sensitivity have been used for bacterial detection, including enzyme-linked immunosorbent assay (ELISA)et al.2 has strong binding affinity to the bacteria. The TWJ DNA nanostructure used in the assay for signal amplification is another high light of the study. In recent years, as an enzyme-free amplification method, more and more attention has been paid to the self-assembly of nanostructures, which are molecules spontaneously combine into stable, well-defined aggregates under equilibrium conditions9. Among them, TWJ composed of three complementary oligonucleotide branches has become an extremely important building block for constructing DNA structure and dynamic assembly. Meanwhile, the TWJ strategy has obvious advantages, including simple probe design, economical biosensor manufacturing and excellent signal amplification. Therefore, it opens broad prospects for applications in biosensing and bioanalysis11.In this study, an aptamer-based high throughput colorimetric biosensor for detection of SA was devised. The SA specific aptamer, reported by Y.S. Xu 12. Compared with G-quadruplex-based DNAzyme14, peroxidase mimicking nanozyme15, and HRP17, which also have similar catalytic activity for TMB oxidation, the dsDNA-SG I proposed here offers several distinct advantages, such as simple and universal, label-free, visual sensing, suitable for convenient biosensor designs, etc.X. F. Zhang etal reported a new discovery that the dsDNA-SG I complex possessed photocatalytic activity, which could catalyze the oxidation of oxidase substrates TMB with dissolved oxygen under photo-irradiationIn this study, for the first time, we designed an aptamer-based photo-irradiation colorimetric biosensor for detection of SA.By using this method, a new platform which can distinguish SA in a short time with selectivity and sensitivity has been achieved. The TWJ DNA nanostructure exhibited excellent signal amplification effect through self-assembly, and the dsDNA-SG I complex possessed photocatalytic activity, which made the method more specific and simpler. In addition, this analysis is a high throughput analysis which can be used to detect 96 samples at once. Compared with other reported methods, our biosensor has such advantages, include fast speed and more sensitive and specific. So, it may be a powerful tool for SA screening in clinical diagnostics.DNA oligonucleotides were synthesized and purified by Sangon Inc. . Their sequences are listed in Table\u00a0\u22121. The concentration was estimated by calculating the average number of CFU.The strains of SA were cultured with Luria-Bertani medium at 37\u2009\u00b0C for 24\u2009hours, and then we diluted the SA suspension using 0.1\u2009M PBS buffer to obtain an appropriate optical density value of about 0.5 at 600\u2009nm. After that, the bacterial solution was serially diluted and inoculated onto the solid medium for 24\u2009hours at 37\u2009\u00b0C to quantify the CFU mL2HPO4, 50\u2009mM citric acid, pH 5.0) to the final concentration 5.0\u2009\u00b5g\u2009mL\u22121. Then add 200\u2009\u00b5L of the coating solution to each well. The plates were closed in a humidified box and incubated at 35\u2009\u00b0C overnight.Streptavidin was diluted in the coating buffer  were added to combine with the capture probe. After incubated at 37\u2009\u00b0C for 90\u2009minutes, 30\u2009\u03bcL SYBR Green I (1:100) was embed in the dsDNA for 30\u2009minutes, and then washed with PBS buffer. At last, 50\u2009\u03bcL TMB (200\u2009mg/L) and 20\u2009\u03bcL 10% HAn overview of the high throughput colorimetric biosensor for detection of SA based on TWJ DNA nanostructure and the catalysis of dsDNA-SG was illustrated in Fig.\u00a010.Compared to a single oligonucleotide branch, the TWJ nanostructure composed of three mutually complementary oligonucleotide branches  can carry more SG I. Then the dsDNA-SG I complex catalyze oxidation of TMB under LED photo-irradiation. The catalytic color will further increase and the sensitivity will be improved. Meanwhile, the TWJ strategy also simplified probe design and biosensor fabrication, as well as excellent signal amplification. Thus, it opens a promising avenue for applications in biosensing and bioanalysis4 CFU mL\u22121. With the increasing incubation time, the absorbance increased and tended to a steady value at 120\u2009minutes. Prolonged incubation time did not increase the signal response obviously. So, 120\u2009minutes was identified as the optimal incubation time. The effect of TWJ hybridization time for capture probe and P1/P2/P3 probe was also studied in the time range from 30 to 120\u2009minutes.  and Pseudomonas aeruginosa (PA) were tested under the same experimental conditions as those for SA. The concentrations of the test bacteria were 104 CFU mL\u22121. To further prove the identification ability of this method, mixtures of microorganisms  were also tested in the meantime. Each bacterium and the mixtures of microorganisms were tested for three times. The results were shown in Fig.\u00a0E. coli) were only as low as the blank, but the SA and microorganisms\u2019 mixtures had obvious absorbance responses, indicating that the colorimetric biosensor had a good specificity and identification ability for the detection of SA.To prove the specificity of the biosensor, two bacterias, 7 CFU mL\u22121. Each concentration was tested for three times. The absorbance responses of the biosensor to different SA concentrations were shown in Fig.\u00a0\u22121 in real milk samples. In addition, the method can complete the detection in 5.5\u2009hours. Compared with traditional culture methods (3\u20135 days), this method is simple, fast, with higher sensitivity and specificity, showing the potential as a pragmatic tool for SA detection in real samples.In order to prove the proposed colorimetric biosensor can detect SA in actual samples sensitively and specifically, the cultured SA were inoculated into milk at a concentration of 0 to 10Staphylococcus aureus has been successfully developed. The biosensor shows wide linear range, low detection limit, high specificity, and could be used for detection of SA in real samples. Importantly, the application of TWJ DNA nanostructure and photo catalytic activity of dsDNA\u2013SG I complex not only amplifying the detection signal, but also shortening the detection time. The method provided a direct sensing platform for detection of SA and the whole analytical process can be finished in 5.5\u2009hours. The bioassay strategy could be used to develop other assay method for pathogenic bacteria and would become a powerful tool for pathogenic microorganism screening in clinical diagnostics, food safety, biothreat detection and environmental monitoring.Aptamer-based high throughput colorimetric biosensor for direct detection of"}
+{"text": "Correction to: Implement Sci Commun (2021) 2:6https://doi.org/10.1186/s43058-020-00105-6Following publication of the original article , the autThis affiliation has been added to Rinad S. Beidas in the author list and the original article  has been"}
+{"text": "Thus, a variety of mechanisms have been proposed for the selective catalytic oxidation of various hydrocarbons including light alkanes, olefins, and simple aromatics by the biological metalloproteins and their biomimetics either in their homogeneous or heterogeneous platforms. Most studies involving these metalloproteins are Fe or Cu monooxygenases. The pathways carried out by these metalloenzymes in the oxidation of C\u2013H bonds invoke either radical reaction mechanisms including Fenton's chemistry and hydrogen atom transfer followed by radical rebound reaction mechanism or electrophilic oxygenation/O-atom transfer by metal-oxygen species. In this review, we discuss the metal oxide nano-catalysts obtained from metal salts/molecular precursors  that can easily form in situ through the oxidation of substrates using H2O2(aq) in CH3CN, and be facilely separated from the reaction mixtures as well as recycled for several times with comparable catalytic efficiency for the highly selective conversion from hydrocarbons including aromatics to oxygenates. The mechanistic insights revealed from the oxy-functionalization of simple aromatics mediated by the novel biomimetic metal oxide materials can pave the way toward developing facile, cost-effective, and highly efficient nano-catalysts for the selective partial oxidation of simple aromatics.The process of selective oxy-functionalization of hydrocarbons using peroxide, O To further examine the production of benzyl hydroperoxide, the treatment of PPh3 can further assist for its quantification . However, with slow addition of H2O2(aq), ~45% sp3 C\u2013H bond oxidation products were observed, and the ratios for benzyl hydroperoxide, benzaldehyde, and benzyl alcohol were identified to be 18, 25, and 2%, respectively .Molecular iron complexes including polycyclic cage-like compounds, biomimetic model complexes, and encapsulated within zeolite cages have been shown with high catalytic activity in the oxidation of hydrocarbons including alkanes and aromatics   and rela(2O2(aq) . These p(2O2(aq) , and ele(2O2(aq)  study. Iectively . Neverth2H0, 1]toluene for its oxidation catalyzed by Fe(ClO4)2 catalyst using H2O2 in CH3CN exhibited high NIH-shift ratios of 83\u201386%  in CH3CN  using Cu(ClO4)2 , and better selectivity for p-BQ (77%), than other volumes of water  using two structural models of copper oxide and trinuclear copper cluster model (Cu2.8O4.6), respectively, can both give reasonable fits of Rfit = 0.027 and 0.15%, respectively -peroxo)Cu2+ (Cu\u2013Cu distance ~3.6 \u00c5) that can potentially reach an equilibrium of a Cu3+(\u03bc-O)2Cu3+ structure 2Cu3+ can exhibit much lower activation energy for a facile oxo-transfer toward the inert C\u2013H bond  C\u2013H bonds of toluene via the formation of arene oxide intermediate followed by an NIH rearrangement process.The EPR spectrum of copper oxide nanoparticles at 298 K indicated an isotropic signal, reminiscent of a previous study of pMMO with trinuclear copper cluster feature , and acetic acid were used as co-catalysts to prompt the oxidation reactions. We recently reported a unique vanadium nanorod (Vnr) catalyst  assists in accumulating more redox active centers ) and commercial V2O5  as an oxidant displayed 68% 18O-enriched PhOH; however, there was negligible enrichment using 2 and 18O2. The results implicate H2O2(aq) as the essential oxidant for OAT mediated by the vanadium oxygenated species.ectively . In addi2 adsorption\u2013desorption isotherms and XRD studies reveal the porous structure and crystalline feature of these catalysts that formed from the core metal oxide with the organic linker as a framework. These three catalysts similarly possessed mesoporous structure in a pore size range of 1.5\u201330 nm and BET surface area of each was in the range of 20\u201330 m2/g that can be essential for catalytic activation of the small aromatic compounds. The mesopore structure of the catalysts has a type of slit-like pore formed by the effect of substrate (benzene/toluene) acting as template while preparing in situ  with additional H2O proportions in CH3CN  orientation that can be crucial for the related additional activities  to the Fe/Cu perchlorate and VCl3 in CH3CN for the selective oxidation of simple aromatics  or benzyl alcohol/benzaldehyde (sp3 C\u2013H bond oxidation). This indicates that, in the presence of organic residues including CH3CN, benzene, and/or toluene, the oxidant of H2O2(aq) can not only accumulate HO\u00b7/HOO\u00b7 but is also essential for the self-assembly of the heterogeneous metal-oxide hybrid catalyst formation with active metal oxygenated species.Overall, the study provides an efficient strategy that accumulates active Fe, Cu, and V oxide species of organic\u2013inorganic hybrid nano-catalysts, respectively, through the addition of 35% H3CN is a polar solvent that can be miscible with polar H2O2 and H2O as well as the non-polar aromatic substrates, leading to oxygenate formation. When the metal salts dissolved in the reaction mixtures of aromatics, the free Cu/Fe/V ions presumably coordinate with CH3CN serving as a ligand to form metal complexes  in CH3CN without any additional substrates  can occur and are essential to assist the metal oxide polymerization/formation.CH2O2(aq) is the cause of further oxidation of initially formed phenols and the appearance of tar  in CH3CN catalyzed by the metal oxide nano-catalysts can give rise to reactivity from the specific FeIV = O species on poly-iron oxo clusters (Enami et al., 4+/V5+ redox sites stabilized by PCA (Wanna et al., via the arene oxide intermediates (Guroff et al., In addition, it has already been known that catalytic aromatic hydroxylation with H2O2/O2, in a heterogeneous platform, can drive selective oxidation of simple aromatics such as benzene and toluene. Furthermore, these unique catalysts effectively tuned sp2vs. sp3 C\u2013H bond hydroxylation of toluene and achieved selective double oxidation of benzene to p-BQ. In many cases, the reaction mechanism proceeds significantly through OAT process via the formation of the arene oxide intermediate, although the free radicals that initiated oxidation of C\u2013H bond also participate. These nano-catalysts prepared in situ and composed of organic\u2013inorganic hybrid exhibited recyclable properties, controlled selectivity, higher activity, and were greener than their bulk oxide counterparts, which make them potentially promising for large-scale application.In summary, highly dispersed active Fe, Cu, and V nano-catalysts with HWW, DJ, NT, and RR conducted the research of catalytic oxidative conversion of simple aromatics. WW, DJ, NT, RR, and Y-FT carried out the identification and characterization of the metal oxide materials. SY organized the research. WW, DJ, NT, and SY wrote the paper. All authors contributed to the article and approved the submitted version.The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest."}
+{"text": "In terms of the absolute number, the SWRO feed water after DAF\u2013UF supports 1.5 \u00d7 106 cells/mL, which is 1.25 times higher than after DMF\u2013CF. This corresponds to the higher cleaning-in-place (CIP) frequency of SWRO with DAF\u2013UF compared to DMF\u2013CF as pre-treatment, indicating that the BGP method has an added value in monitoring the biofouling potential in SWRO systems.Measuring the bacterial growth potential of seawater reverse osmosis (SWRO) feed water is an issue that is receiving growing attention. This study developed and demonstrated the applicability of the flow-cytometry (FCM)-based bacterial growth potential (BGP) method to assess the biofouling potential in SWRO systems using natural microbial consortium. This method is relatively fast (2\u20133 days) compared to conventional bioassays. The effect of the potential introduction of nutrients during measurement has been studied thoroughly to achieve the lowest measure value of about 45,000 cells/mL, which is equivalent to about (10 \u00b5g-C glucose/L). The BGP method was applied in two full-scale SWRO plants that included (i) dissolved air flotation (DAF) and ultra-filtration (UF); (ii) dual-media filtration (DMF) and cartridge filter (CF), which were compared with the cleaning frequency of the plants. A significant reduction (54%) in BGP was observed through DAF\u2013UF as pre-treatment (with 0.5 mg Fe Biofouling in seawater reverse osmosis (SWRO) systems remains the major challenge for its cost-effective operation ,2,3,4,5.Pseudomonas fluorescens Pl 7 bacteria for a period of 14 days [Spirillum sp. NOX together with Pl 7 [(Flavobacteriumjohnsoniaestrain A3) was introduced to utilize polysaccharides and proteins [A promising online detection of biofouling was attempted using a membrane fouling simulator (MFS)  and biof 14 days  and lateith Pl 7 ,12. Lateproteins , but stiproteins . Ross etproteins  showed tVibrio fischeri and Vibrio harveyi, respectively. These methods are very fast\u20141 h for the Weinrich method and 1\u20133 days for the Jeong method. The use of a single bacterial strain allows normalization of the yield based on a carbon source, enabling conversion of bacterial growth to a carbon concentration. However, a challenge of using the single strain is it may not reflect broader substrate utilization. These methods also cannot use natural bacteria as not all indigenous bacteria have the property of bioluminescence. Therefore, it is of great importance to develop a BGP method using natural consortium bacteria, which provide reliable information regarding biofouling potential in SWRO systems. In seawater, Weinrich et al.  and Jeondirect method and ATP filtration method are 0.3 ng-ATP/L, 0.06 ng-ATP/L, respectively. \u00ae Green I  [Dixon et al.  and QuekMO, USA) ,25.\u00ae Green I and Propidium Iodide (PI). The dye PI penetrates bacterial cells with disrupted membranes while SYBR\u00ae Green I can bind the nucleic acid of both live and dead bacterial cells [7 cells/mL) and, if exceeded, the sample needs to be diluted. Moreover, the effect of salinity on bacterial count using FCM needs to be studied, otherwise the result of bacterial shock while diluting the samples may underestimate the BGP results. FCM can distinguished the live and dead bacterial cells by staining with SYBRal cells . Recentlal cells  and Farhal cells  publisheal cells ,27. MoreVerify the reproducibility and effect of salinity while enumerating marine bacterial cells using FCM;Verify the effect of the introduction of nutrients that might originate from chemicals and/or bottles during BGP method;Develop a calibration curve and the LOD of the measurement using both artificial and natural seawater using glucose as substrate;Measure bacterial growth potential along the pre-treatment train of an SWRO desalination plant using an indigenous bacterial consortium.The objective of this article is to further develop and demonstrate the applicability of using the FCM-based BGP method to assess the biofouling potential in the pre-treatment and feed of SWRO systems using natural consortium bacteria. The following aspects have been investigated and are described in this article: All the glassware/vials/caps were first washed with lab detergent , rinsed three times with Milli-Q water, soaked overnight in 0.2 M HCl solution and again rinsed with Milli-Q water, and were air-dried. Finally, all the glassware/vials were heated in a muffle furnace at 550 \u00b0C for 6 h to remove all traces of organic material while the caps were bathed in 100 g/L sodium persulfate solution at 60 \u00b0C for 1 h and then rinsed with Milli-Q water and air-dried.2CO3, NaHCO3, CaCl2.2H2O, KCl, Na2SO4, MgCl2.6H2O, NaCl) in Milli-Q water  of collected seawater from the North Sea  was added to the vial containing 20 mL of sample. Samples were then incubated at a temperature of 30 \u00b0C [0) from the maximum bacterial count (Nmax) during the incubation period. The net bacterial growth was considered as an indicator for BGP. The protocol involves filtration of a sample (V > 60 mL) through 0.22 \u00b5m PVDF filters to remove large particles and bacteria from seawater samples. Before the sample filtration, a 0.22 \u00b5m filter was flushed with Milli-Q water to remove the released carbon from the filter. The choice of the 0.22 \u00b5m filtration approach for the BGP test was based on the comparative study made with different approaches. The 0.22 \u00b5m filtered seawater sample (20 mL) was transferred into clean vials (in triplicate). A volume of 200 \u00b5L  using artificial seawater . The ASWThe possible contamination that might originate from the bottles and chemicals used during the preparation of blank  and its contribution to the BGP measurement was demonstrated considering the following three scenarios. For each scenario, the BGP was measured and compared. Scenario 1: ASW  was prepared using salts NaCl, MgCl2.6H2O, Na2SO4, CaCl2.2H2O, KCl, NaHCO3, Na2CO3 and tested for the condition below to foresee the effect of bottle and chemical contamination on BGP.-No heating of bottle and chemicals;-Heating of bottle  and no heating of chemical;-Heating of bottle and chemical (NaCl only) at 550 \u00b0C, 6 h.Scenario 2: ASW  was prepared using salts, NaCl only, to minimize the effect of chemical contamination from other salts. In this case, both the bottle and NaCl were heated at 550 \u00b0C, 6 h.Scenario 3: ASW  was prepared using salts, NaCl and NaHCO3. The chemical NaHCO3 was added to maintain the buffer capacity of the ASW. In this case, both the bottle and NaCl were heated at 550 \u00b0C, 6 h.In all cases, heating of NaCl was only considered due to its higher melting point > 550 \u00b0C. To demonstrate the effect of salinity while enumerating seawater bacteria using FCM, the ASW  and 100 \u00b5g/L of P (NaH2PO4). The BGP was measured using the protocol as described in The BGP method was calibrated using glucose as substrate in both ASW and natural seawater samples. A glucose concentration that ranged from 0 to 2000 \u00b5g-C glucose/L was added in both water samples. All the samples were then spiked with a fixed concentration of 500 \u00b5g /L of The BGP method was applied to monitor the bacterial growth potential along the treatment process trains of full-scale desalination plants located in the Middle East. The raw seawater of both of the SWRO plants comes from open intakes and has similar characteristics to raw seawater properties. Some basic water quality parameters were salinity (69\u201371 mS/cm), TDS (~50 g/L), turbidity (4\u201310 NTU), water temperature (22\u201330 \u00b0C).2SO4 in both plants. The coagulant (FeCl3) was continuously dosed in both plants at a concentration of 0.5 ppm of FeCl3 before DAF and 0.8 ppm of FeCl3 before DMF. The de-chlorination was performed before the SWRO unit by dosing Na2S2O5 (sodium metabisulfite). The dosing pump for Na2S2O5 was controlled based on the oxidation-reduction potential (ORP) value, which was set to a level of 250 mV. The general scheme of the plants included: (i) dissolved air flotation/ultrafiltration/reverse osmosis (DAF\u2013UF\u2013RO) and (ii) dual media filtration/cartridge filter/reverse osmosis (DMF\u2013CF\u2013RO) as shown in Brief specifications and operating conditions of the two plants are presented in As illustrated in 2 = 0.99) between the percentage of seawater and live bacterial cell concentrations was observed, with a percentage deviation that ranged from 0.6% to 9.1%. Furthermore, the effect of salinity when seawater bacteria were stained with fluorescence staining dye SYBR\u00ae Green I (SG) and Propidium Iodide (PI) and enumerated using FCM was performed. As illustrated in 2.6H2O, Na2SO4, CaCl2.2H2O, KCl, NaHCO3, and Na2CO3.3, where NaCl and bottle were heated at 550 \u00b0C for 6 h) showed the live net bacterial growth approximately to the level of 43,000 \u00b1 12,000 cells/mL, which is approximately 92% lower than in sample A. While compared to the net bacterial growth in sample C and D, we observed no substantial difference despite the fact that in sample D no chemicals that constitute calcium and magnesium were added. Previous studies suggested that potassium, magnesium, and calcium are also essential elements required for the growth of marine bacteria [3, where chemical (NaCl) and bottle were heated at 550 \u00b0C for 6 h, substantially reduced the effect of nutrients that originate from chemicals and bottles during BGP measurement.The consortium of bacteria proliferated to approximately 600,000 \u00b1 65,000 cells/mL in sample A . The higher growth in this sample was attributed to the introduction of nutrients originated from chemicals and bottles used during the preparation of ASW samples. To prove this, another test was performed with sample B , which revealed that the live net bacterial growth was approximately 16% lower compared to that measured in sample A. Furthermore, a test performed with sample C  showed substantial reduction (90%) in live net bacterial growth. The result illustrates that heating of the major salt (NaCl) and bottle in a muffle furnace at 550 \u00b0C for 6 h substantially reduced the effect of nutrients originated from bottle and chemicals added to prepare ASW on BGP measurements. As shown in bacteria ,31. As wglucose/L is as shown in 2 > 0.95 for substrate concentration ranging from 0 to 2000 \u00b5g-Cglucose/L in both ASW and natural seawater. While for lower range (0\u2013100 \u00b5g-Cglucose/L), R2 = 0.88 was observed  and Spirillum sp. NOX (1.2 \u00d7 107 CFU/\u00b5g acetate-C) [The result of BGP calibration performed with ASW and natural seawater and fortified with 0\u20132000 \u00b5g-Cobserved . The speetate-C) . glucose/L. The measured LMV for the BGP method was slightly lower than 10 \u00b5g-C acetate/L, a threshold value beyond which the biofouling is expected in freshwater [glucose/L. The higher measured ECC could be attributed to the occurrence of algal blooms in the seawater where the sample was collected. Using the calculated specific bacterial yield and the net bacterial growth, the equivalent carbon concentration (ECC) was calculated according to Equation (1) in both ASW and natural seawater . AccordiBiofouling potential was measured and compared over the treatment process trains of two desalination plants, which included DAF\u2013UF\u2013RO and DMF\u2013CF\u2013RO using the FCM-based BGP method. As illustrated in 3 coagulant and followed by ultrafiltration. Moreover, in terms of an absolute number of bacterial growth, the SWRO feed water after DAF and UF supports 1.5 \u00d7 106 cells/mL, which is 1.25 times higher than in SWRO feed water of DMF\u2013CF, as illustrated in Furthermore, the pre-treatment option DAF\u2013UF showed a reduction of 54% in net bacterial growth, while it was only 40% by DMF\u2013CF. This could be due to the higher removal of the biodegradable organic matter in dissolved air flotation operated with 0.5 mg/L of FeClNevertheless, other water quality parameters measured for SWRO feed water of the DAF\u2013UF\u2013RO and DMF\u2013CF\u2013RO schemes during the time of the study showed very low fouling potential, as shown in As illustrated in -An FCM-based BGP method for seawater using natural microbial consortium as inoculum was developed and applied in full-scale SWRO plants. The developed method was relatively fast (2\u20133 days) to monitor the biofouling potential of pre-treatment and SWRO feed water.-The percentage deviation on the reproducibility of the FCM measurement was below 10% and the variation in the FCM-based BGP method was approximately <5% and <20% when the method was applied for ASW and natural seawater, respectively.-3, where bottles and NaCl were heated at 550 \u00b0C for 6 h. With this approach, the lowest measured value of the FCM-based BGP method was approximately 10 \u00b5g-Cglucose/L.The effect of nutrients on the BGP method that originated from the bottle and chemicals was substantially reduced by 92% when blank (ASW) was prepared using NaCl and NaHCO-2 ~ 0.9) between carbon concentration (0\u20132000 \u00b5g-Cglucose/L) and live net bacterial growth, in both artificial and natural seawater.The FCM-based BGP method showed good linear correlation (R-3+/L), while it was 40% with DMF\u2013CF (with 0.8 mg Fe3+/L).The method was applied to measure the bacterial growth potential through pre-treatment trains of two SWRO desalination plants in the Middle East. A significant reduction (54%) in bacterial growth potential was noticed through DAF\u2013UF as pre-treatment (with 0.5 mg Fe-The absolute number of bacterial growth supported by the SWRO feed water after DAF\u2013UF was approximately 1.25 times higher than SWRO feed water after DMF\u2013CF. This corresponds to the higher CIP frequency of SWRO with DAF\u2013UF as pre-treatment, suggesting that the FCM-based BGP method is a promising tool for measuring the biofouling potential in SWRO feed water. However, more experiments are required to develop a sound relationship between the BGP and the pressure drop increase in SWRO plants."}
+{"text": "Rationale: Idiopathic and heritable pulmonary arterial hypertension (PAH) are rare but comprise a genetically heterogeneous patient group. RNA sequencing linked to the underlying genetic architecture can be used to better understand the underlying pathology by identifying key signaling pathways and stratify patients more robustly according to clinical risk.Objectives: To use a three-stage design of RNA discovery, RNA validation and model construction, and model validation to define a set of PAH-associated RNAs and a single summarizing RNA model score. To define genes most likely to be involved in disease development, we performed Mendelian randomization (MR) analysis.Methods: RNA sequencing was performed on whole-blood samples from 359 patients with idiopathic, heritable, and drug-induced PAH and 72 age- and sex-matched healthy volunteers. The score was evaluated against disease severity markers including survival analysis using all-cause mortality from diagnosis. MR used known expression quantitative trait loci and summary statistics from a PAH genome-wide association study.Measurements and Main Results: We identified 507 genes with differential RNA expression in patients with PAH compared with control subjects. A model of 25 RNAs distinguished PAH with 87% accuracy  in model validation. The RNA model score was associated with disease severity and long-term survival (P\u2009=\u20094.66\u2009\u00d7\u200910\u22126) in PAH. MR detected an association between SMAD5 levels and PAH disease susceptibility .Conclusions: A whole-blood RNA signature of PAH, which includes RNAs relevant to disease pathogenesis, associates with disease severity and identifies patients with poor clinical outcomes. Genetic variants associated with lower SMAD5 expression may increase susceptibility to PAH. Blood transcriptomic profiles in pulmonary arterial hypertension have been examined in small limited studies indicating their potential utility in differentiating patients from control subjects and by clinical phenotypes.This study represents the most comprehensive analysis of whole-blood RNA profiles in pulmonary arterial hypertension and identifies and validates a signature that both differentiates patients from control subjects and stratifies patients by clinical risk and severity. Genetic analyses (Mendelian randomization) indicate potential causal roles for some genes including the TGF-\u03b2 signaling molecule SMAD5.Pulmonary arterial hypertension (PAH) is associated with vasoconstriction and occlusion of distal pulmonary arteries, characterized by endothelial damage, smooth muscle and fibroblast proliferation, and inflammation. Increased pulmonary vascular resistance leads to right heart failure, with survival rates estimated at 52\u201375% at 5 years, even with modern-day therapy . The ratTranscriptome profiling through RNA sequencing permits a comprehensive analysis of gene expression in tissue samples. Whole-blood RNA analysis offers an alternative \u201cliquid biopsy\u201d to lung biopsy, which carries a high risk in PAH, and can be performed sequentially. This approach can also investigate immune mechanisms in PAH that have recently been highlighted . PreviouThe aim of this study was to characterize gene pathways associated with PAH and to assess their association with disease heterogeneity, specifically in terms of disease severity and outcomes including response to vasodilators and mortality, and genetic background. We compare gene expression in whole-blood samples from 359 patients with idiopathic, heritable, or drug-induced PAH from the UK PAH Cohort study with 72 age- and sex-matched healthy volunteers without any cardiac or respiratory disease as control subjects. Using equal distribution of samples into a three-stage design, we identified reproducible RNA expression differences by RNAseq. Two distinct computational approaches were used to estimate white blood cell (WBC) fractions and thus account for the potential effect of different cell numbers on gene transcript levels across samples. A predictive statistical model that combined gene expression differences performed well at identifying patients with PAH in a separate case\u2013control analysis. The RNA-based score was also associated with disease severity and clinical outcomes . Enrichment of genetic variants that determine the levels of PAH RNAs was detected, implicating these RNAs in the pathogenesis of the disease.Comprehensive methods are included in the online supplement.www.ipahcohort.com). In each case, diagnosis was confirmed by right heart catheterization following established international guidelines (see online supplement for further details). Genomics data were obtained from a published PAH genome-wide association study  were recruited from expert centers across the UK as part of the PAH Cohort study , RNA validation (n\u2009=\u2009120), and model validation (n\u2009=\u2009119). Each of these three groups was then compared with an independent set of age- and sex-matched healthy volunteers as control subjects  were analyzed using Salmon v0.9.1 . Differential expression analysis was performed using edgeR v3.22.5 (P\u2009<\u20090.05) directionally consistent in the initial analyses and meeting false discovery rate (FDR) multiple test corrections  in the combined analysis were taken forward. Five hundred seven genes meeting these criteria were considered to generate a model to distinguish PAH from control subjects. Subset selection of RNAs that best distinguish PAH in combination was performed by least absolute shrinkage and selection operator (LASSO) regression analysis, using the glmnet v2.0-18 package from CRAN, with k-fold cross-validation (k\u2009=\u200910) selecting the largest value of lambda such that error is within 1 SE of the minimum. This produces an RNA score from a linear weighted combination of the mRNAs identified by the LASSO analysis. Receiver operating characteristic analysis was performed using the pROC v1.14.0 package from Bioconductor  and World Health Organization (WHO) functional class  and by cardiac biomarkers .david.ncifcrf.gov) and Ingenuity Pathway Analysis (IPA) using in-built FDR corrections for multiple tests.Functional annotation and enrichment of the genes associated with PAH was performed using DAVID (Mendelian randomization (MR) analysis using all independent genome-wide significant whole-blood expression quantitative trait loci (eQTL) from two published studies , 16 and P\u2009<\u20090.05) between PAH and control subjects with directional concordance in both discovery and validation analyses . All 507 genes were included after accounting for multiple testing . None were associated with exposure to the main PAH therapies (see online supplement for further details). These included RNAs in pathways relevant to PAH; for example, SMAD5 (mothers against decapentaplegic homolog-5), encoding a downstream mediator of signaling of BMPR2 . All real-time quantitative PCR measurements correlated significantly with RNAseq quantification .A set of differentially expressed RNAs relevant to PAH pathobiology were selected for validation of RNAseq quantification by real-time quantitative PCR, namely, n\u2009=\u2009119 patients with PAH and n\u2009=\u200924 control subjects) and demonstrated an area under the curve of 0.868  . The model was then tested in an independent validation set (1\u20130.945) . The optWe next examined whether the RNA model was also associated with patients with the poorest outcomes, using all 359 patients. The optimum cutoff (1.910) for identifying PAH nonsurvivors with the LASSO model separated patients with PAH into low- and high-risk groups in survival analysis  and E3.To determine which of the 25 transcripts in the model were responsible for the association with survival, we tested each transcript for associations with all-cause mortality during follow-up. After FDR correction for multiple testing, three intronic long noncoding RNAs  were associated with survival in all the patients with PAH analyzed and cutoffs distinguished high- and low-risk patient subgroups .P\u2009=\u20090.008; P\u2009=\u20095.10\u2009\u00d7\u200910\u22124; P\u2009=\u20098.7\u2009\u00d7\u200910\u22125).To further characterize the RNA signature, we analyzed its association with three clinical measures of disease severity\u2014WHO functional class, exercise capacity , and cardiac biomarkers (BNP or NT-proBNP). We found a significant difference in RNA scores between patients in different WHO functional classes  was consistently lower in PAH.Three hundred seventy-two out of the 507 top dysregulated genes from the current RNAseq study were present in the lung tissue microarray study and 161/372 (43%) were also directionally consistent. Forty-one out of 161 (25%) genes were nominally significant and 26 met FDR corrected significance (Table E9). Only one gene was found to be dysregulated in patients with PAH across all three studies: AMD1, the only gene in common between the current RNAseq study, the recent lung tissue microarray study and the gene expression meta-analysis, was part of the top IPA gene network .Of the 507 RNAs found to be differentially expressed in PAH, 435 were present in the functional annotations in DAVID. Enrichment of DNA-binding TFs (transcription factors), such as HIF1\u03b1 (hypoxia-inducible factor 1\u03b1) and KLF10 (Kr\u00fcppel-like factor 10), and many zinc finger\u2013containing TFs was observed compared with a background of the genes detected (Table E10). The Ingenuity Knowledge Base mapped 505/507 transcripts. Double-stranded DNA repair, T-cell receptor, PI3K signaling in B lymphocytes, the role of JAK family kinases in IL6-type cytokine signaling and hypoxia signaling were among the top canonical pathways identified by IPA . SESN1 (Sestrin-1) and SMAD5, reached nominal significance using eQTL in both data sets  was associated with an 8.5% reduction in the risk of developing PAH . SMAD5 levels were similarly reduced in patients with PAH with and without pathogenic BMPR2 variants , supporting the observation that impaired signaling in the BMPR2 pathway is more common in PAH than rare mutations in BMPR2 suggest. The PAH RNA model score was similarly elevated in patients with PAH with and without pathogenic BMPR2 variants .The SMAD5 are more common in patients with PAH.Here we report an RNA signature that separates idiopathic and heritable PAH from healthy individuals. The signature also stratifies patients according to disease severity and risk of early death, adding plausibility to its association with PAH. Several of the discriminating mRNAs encode TFs, including SMAD5, HIF-1\u03b1 and KLF10. MR analysis to integrate genomic data and identify underlying pathogenic signaling pathways revealed that genetic variants associated with lower expression levels of SMAD5 encodes an intracellular transcriptional modulator that is activated by ligand binding of BMPR2, the most common genetic risk factor in heritable PAH (MR is a powerful tool for separating cause from consequence, as an individual\u2019s genetic status predates the development of PAH. We harnessed genetic data from a published international genome-wide association study  and infoable PAH . SMAD5 aable PAH . SMAD5 aable PAH , which mable PAH . Novel table PAH \u201325. WholAMD1 was the only gene consistently dysregulated in both these studies and our data set, with lower levels in PAH samples in all three studies. AMD1 encodes a key enzyme controlling the supply of decarboxylated S-adenosylmethionine for polyamine biosynthesis and is regulated by several mechanisms, including increased protein degradation in the presence of elevated polyamines and the inhibition of mRNA translation by spermidine and spermine (AMD1 expression in patients with PAH may be in part due to negative feedback from elevated polyamines. These data contrast with observations in hypoxic rodents. Amd1 expression is increased in hypoxic animals, and both AMD1+/\u2212 mice and mice treated with the AMD1 inhibitor, SAM486a, were partially protected from the development of hypoxic PH (ATP13A3 with PAH (We were able to externally validate our findings with a meta-analysis of published PAH blood transcriptome studies  and a PAspermine . We havespermine . Reducedpoxic PH . Interespoxic PH . This miwith PAH .Many of the transcripts that passed robust statistical evaluation in this study are novel. We identified three specific long noncoding RNAs that are reduced in PAH and associated with poor outcomes. These transcripts are not well studied, and their role in regulating lysosomal proton pump protein ATP6V0E2, protein tyrosine phosphatase PTP4A2, or small nuclear ribonucleoprotein-associated protein N remain to be established. Their association with survival selects these out as worthy of further investigation. In addition to suggesting biological relevance, the association of the RNA model, developed to distinguish PAH from control subjects, with survival and disease severity in patients with PAH suggests that the differences observed could be useful to identify patients who may require a more aggressive treatment strategy, such as upfront triple therapy . This stThere is considerable interest in developing a biochemical test to identify patients with PAH who respond well to calcium antagonists that would supersede the current test, namely, an acute vasodilator challenge while undergoing cardiac catheterization. In contrast to previous reports, we were unable to demonstrate the association of a peripheral transcript signature to vasoresponder status, including previously studied RNAs . A stren+ T cells in patients with PAH, consistent with previous reports (One of the limitations of sampling whole blood to derive transcripts is that samples comprise a mixed population of cells. We used established deconvolution methods to correct for potential confounding in RNA expression analysis. In support of the validity of this approach, we noted altered numbers of regulatory T cells and CD8 reports , 31, alt reports .This study does not assess the role of post-translational modifications in the pathogenesis of PAH, which could add further information to the circulating transcriptome. It is important that further mechanistic studies consider the role of the genes highlighted in this study in the tissues of primary interest, namely, the lung and heart. The study design included more patient samples than control subjects to account for the higher heterogeneity typically observed in patient populations. This heterogeneity is observed in the overlap in box plots of individual RNA levels or scores between subsets of patients with PAH and control subjects and emphasizes the importance of using any molecular markers in combination with best practice clinical assessments. We chose to use LASSO regression modeling not only as it is known to perform well in these kinds of data sets but also because it is widely applied and often easier to interpret than other methodologies. Another consideration is that the patients studied here were prevalent cases. Moreover, all the patients recruited had a clinical diagnosis of idiopathic, heritable, or drug-induced PAH. It would be of interest to sample patients with other presentations of PAH and other cardiopulmonary diseases to better understand the clinical utility of our RNA signature.In summary, we report a whole-blood RNA profile that distinguishes patients with PAH from healthy control subjects and reflects disease severity. Integration with genomic data suggests that SMAD5 is important in the development of PAH, prioritizing restoration of normal SMAD5 function as a target for therapeutic intervention."}
+{"text": "Artemisia absinthium, Hypericum spp., Linum usitatissimum, Quercus robur). The four study regions located in Northern and Southern Eastern Europe did not present similar ethnoveterinary knowledge trajectories. Bukovinian mountain areas appeared to hold a living reservoir of ethnoveterinary knowledge, unlike the other regions. Setomaa  and Dzukija showed an erosion of ethnoveterinary knowledge with many uses reported in the past but no longer in use. The current richness of ethnoveterinary knowledge reported in Bukovina could have been developed and maintained through its peculiar geographical location in the Carpathian Mountains and fostered by the intrinsic relationship between the mountains and local pastoralists and by its unbroken continuity of management even during the Soviet era. Finally, our results show some patterns common to several countries and to the veterinary medicine promoted during the time of the Soviet Union. However, the Soviet Union and its centralized animal breeding system, resulted in a decline of ethnoveterinary knowledge as highly specialized veterinary doctors worked in almost every village. Future research should examine the complex networks of sources from where farmers derive their ethnoveterinary knowledge.Over the last century in the European context, animal production has been transformed by the dynamics of centralization and decentralization due to political and economic factors. These processes have influenced knowledge related to healing and ensuring the welfare of domestic animals. Therefore, our study aimed to document and compare current and past ethnoveterinary practices, and to identify trajectories in ethnoveterinary knowledge in study regions from both northern and southern Eastern Europe. In the summers of 2018 and 2019, we conducted 476 interviews, recording the use of 94 plant taxa, 67 of which were wild and 24 were cultivated. We documented 452 use reports, 24 of which were related to the improvement of the quality or quantity of meat and milk, while the other 428 involved ethnoveterinary practices for treating 10 domestic animal taxa. Cattle were the most mentioned target of ethnoveterinary treatments across all the study areas, representing about 70% of all use reports. Only four plant species were reported in five or more countries ( In many societies, livestock significantly contribute to human food security by providing several important food products, other valuable goods , agricultural inputs , and services . However, over the last century in the European context, animal production has been transformed by dynamics of centralization and decentralization , 2. ThesAnimal breeding involves maintaining animal health and welfare. Scholars have found that the knowledge related to healing and ensuring the welfare of domestic animals has been largely abandoned in industrialized areas of Europe , while iThe use of plants for veterinary practices is well-studied in some regions of Eastern Europe. For instance, in Ukraine several scholars have investigated this topic e.g., \u201313], foc, foc13)]Within this framework, our study aimed to document and compare current and past ethnoveterinary practices, and to identify trajectories in ethnoveterinary knowledge in rural borderland areas of eight countries from northern and southern Eastern Europe, namely Finland, Russia, Estonia, Lithuania, Poland, Belarus, Ukraine, and Romania. We further discuss what factors may have contributed to the persistence/erosion of ethnoveterinary knowledge in Eastern Europe.In the summers of 2018 and 2019, we conducted semi-structured interviews in four regions in eight countries that are home to nine main ethnolinguistic groups .Bukovina is a historical region of the Austro-Hungarian Empire that has been split between Romania and Ukraine since 1940. It is inhabited by several ethnic groups including Jews, Ukrainians, Poles, Romanians, and Hutsuls. Bukovina is partially occupied by the North-Eastern Carpathians which reach an altitude of 1,651 m a.s.l. We conducted our research among Hutsuls living in the Carpathian villages of the upper Suceava Valley in Romania and Putyla Rayon in Ukraine and among Romanians living in the pre-Carpathian hills of Straja (Romania) and Storozhenets and Glybotskyi district in Ukraine. Both in Ukraine and in Romania, most of the interviewees rely on family farming.Dzukija is a historical and cultural region located in the borderlands of Poland, Lithuania, and Belarus. This border area has long been a crossroads for trading routes and has been subject to a series of changes in national status. It is now mainly inhabited by Lithuanians and Poles. It is characterized by plain and hilly rural areas and is currently experiencing a remarkable rural emigration. Soils throughout the studied region are sandy and of little agricultural value. We conducted interviews among Lithuanians living in several villages of August\u00f3w and Sejny counties of Podlaskie Voivodeship (Poland), \u0160al\u010dininkai district of Vilnius County (Lithuania), and Hrodna, Voranava, and A\u0161miany districts of Hrodna Region (Belarus).Karelia is a historical region currently divided between Finland and the Russia. Agricultural lands occupy only a small percentage of its territory, which is mainly covered by forests, a crucial resource for the local economy , 23. In Setomaa is a region located at the Estonian-Russian border inhabited by speakers of the Seto and Russian languages. After WWII, the largest part of the formerly united historical Setomaa was incorporated into the Russian Soviet Federative Socialist Republic and remained there even after Estonia regained independence. Since the twentieth century, rapid alterations to the environment  have led to the disappearance of some native plants  and the The research was part of a wider study, namely the ERC-funded DiGe project, aiming to understand the mechanisms of change in ethnobotanical knowledge that occur among cross-border minorities when a dominant group tries to modify this knowledge. The four regions were selected in order to give an overall comparative picture of the current and past uses of plant-based ethnoveterinary remedies in Eastern Europe , 2. We cIn Finnish Karelia, interviewees were also identified in advance through various social networks as it was not always possible to approach them directly. We consider this sample robust given the fact that saturation was reached after about 10\u201315 interviews per country.http://en.herbariumle.ru/)].Before each interview, prior informed consent was obtained following the Code of Ethics of the International Society of Ethnobiology . Upon coWhen possible, interviews were recorded upon the interviewee's approval and transcribed in the local language; in the few cases when recording was refused, we took notes. Later, we entered this information in English into an Excel spreadsheets organized as detailed use reports (DUR) of plant-based remedies, where each row contained the country and ethnic community of the interview, its code, the scientific name of the plant, its local name, the part used, when it was used, the mode of preparation, and its use. Botanical taxa were classified using World Flora Online (2021). The botanical families were classified according to the Angiosperm Phylogeny Website .The research protocol was approved by the Ethics Committee of Ca' Foscari University of Venice.In the four regions where this study was conducted, we recorded the use of 94 plant taxa, 67 of which were wild and 24 were cultivated, from 189 interviewees. We documented 452 use reports, 19 of which were related to the improvement of the quality or quantity of meat and milk, while the other 428 involved ethnoveterinary practices for treating 10 domestic animal taxa. Out of the 476 interviews we conducted in the four study regions, 189 reported ethnoveterinary uses. Below, we focus first on ethnoveterinary knowledge related to cattle as about 70% of the use reports concerned cattle illnesses .Cattle were the most mentioned target of ethnoveterinary treatments across all the study areas. We recorded the use of 55 plants belonging to 25 families , 2 for tArtemisia absinthium, Hypericum spp., Linum usitatissimum, Quercus robur).Only four species were reported in five or more countries (The majority (61%) of the DUR were currently in use, while 39% referred to past uses. However, excluding the Bukovinian Carpathian area (our Ukrainian and Romanian case studies), the proportion of currently used DUR drops to 12%, while the remaining 88% refers to past ethnoveterinary uses. Indeed, as illustrated in Rumex spp. (reported in four countries across three regions), Hypericum spp. , and Quercus robur . In regard to the reproductive system, the most common issues involved calving and the use of postpartum supplements. The most utilized plant for treating the reproductive system was Linum usitatissimum, mentioned in four countries and three regions. Among the listed plants some  could potentially have negative effects on animals. While no interviewee explicitly mentioned possible adverse side-effects, they were not assessed, being out of the scope of this article.The digestive and reproductive systems were the most common targets of ethnoveterinary remedies . For thePicea abies (three regions), Quercus robur (three regions), and Urtica dioica (two regions). The livestock most commonly treated with ethnoveterinary remedies were pigs (39 DURs), which were mainly mentioned in Russian Karelia and Russian Setomaa. As in cattle, the most widely treated illness was diarrhea, primarily in pigs. Also, five plant taxa  were used, especially in Dzukija, as feed supplements (13 DURs).Excluding cattle, we documented 130 DURs related to 44 plant taxa belonging to 28 botanical families that were used for treating nine animal taxa, including pigs, honeybees, sheep, turkeys, chickens, geese, horses, dogs, and cats. Only three species were found to be used in four countries: Urtica dioica, which was reported by six people in Bukovina for improving milk quality and by one interviewee in Lithuania for improving pork meat quality.In addition to ethnoveterinary remedies, we also recorded the use of 19 DURs referring to ten plant taxa for improving the quality of milk, meat, and in one case pig bristles . More thOut of the 476 interviews we conducted in the four study regions, 189 interviewees reported ethnoveterinary uses . SpecifiWe recorded different attitudes regarding the use of plants for treating animals . InterviIn the Dzukija region, older respondents reported the loss of ethnoveterinary knowledge as a reason for turning to official veterinary medicine: \u201cThere are no more people who know the right herbs and remedies. Now there are veterinarians. If someone needs something, they turn to veterinarians\u201d (Belarusian Lithuanian woman born in 1946). Informants from both the Belarusian and Lithuanian sides of Dzukija noted that state-sanctioned veterinary medicine appeared with the advent of the Soviet state and the formation of kolkhozes [~1950]. On the Polish side, older Lithuanian interviewees mentioned that they mainly healed animals with drugs (Polish Lithuanian woman born in 1929).At the same time, although the older generation of interviewees living on the Belarusian and Lithuanian sides of the Dzukija region is characterized by a lack of trust in official medicine, the middle and younger generations prefer medicines over medicinal herbs. For example, a middle-aged female respondent noted that it is better to treat cows with drugs, not herbs. For her, using chemicals is a more reliable option (Lithuanian woman living in Belarus woman born in 1954).Artemisia absinthium), \u010dystacie\u0142 (Chelidonium majus). And I carried these bottles to the kolkhoz\u201d (Lithuanian woman living in Belarus woman born in 1941).Among the respondents who worked on kolkhoz between the 1950s and 1990s, some noted that they used home remedies for the kolkhoz animals: \u201cI worked on the farm, raised calves, and none of them died. I made bottles for them at home. There were pa\u0142yn .In Russian Karelia and Setomaa, the decision to call a veterinary service (instead of treating livestock using plant-based remedies) was sometimes perceived as a matter of time, as one veterinary doctor mentioned, \u201cYou know, when I started working, there were already antibiotics [\u2026]. But even at the beginning of my work [in the late 1970s], in fact, they did not pay much attention to folk remedies. Well, maybe because this is a longer path to recovery, whereas one needs the result immediately. After all, they use more modern ones here\u201d (Russian Seto woman born in 1939). This was also confirmed by a retired kindergarten nanny: \u201cAnd as with pills, you call a doctor, because it is fast for calves, yeah, for calves. Quicker with them, because herbs are too slow\u201d . Conversely, in Romania, some older interviewees were skeptical about official veterinary medicine: \u201cTeas of In the Soviet Union, it was not difficult to receive veterinary consultations . However, some interviewees also reported that \u201cthere were specialists, but at home, you were mostly on our own\u201d (Russian Karelian man born in 1950). Contrastingly, another interviewee stated, \u201cCattle were not treated at home, only by a veterinarian. In the old days, there were very good veterinarians. Only the veterinarian treated animals\u201d (Russian Karelian man born in 1929). Indeed, during Soviet times there was a veterinary doctor working in every large village with kolkhoz who helped locals to treat cattle. An Estonian Seto woman born in 1938 narrated: \u201cAnimals had flax seeds after calving, but otherwise, if something was wrong, we had to call the vet.\u201dIn Finnish Karelia, an interviewee claimed that in the 1950s, \u201cVeterinarians were not used as the nearest veterinarian was 35 km away. There was someone among the people, who was familiar with these problems, and he/she was called only if there was some illness and you were unsure of what you should do\u201d .Our interviewees from the four regions often mentioned the deep connection they have or had with their livestock. For instance, in Russian Karelia, an Ingrian-Russian woman (born in 1954) mentioned, \u201cWe had goats, sheep, yes. well, at that time it was kind of necessary, because living was not very. how to say?\u2013easy. Therefore, we kept them,\u201d stressing the role livestock played in guaranteeing food security.Also, a Russian woman, born in 1966, living in Karelia reported using human food for feeding animals: \u201cThey just subsidized bread very, very much. [\u2026] My Karelian grandmother fed all her cattle with bread. It was cheaper than growing potatoes and buying grain from a sovkhoz. And my dad, having a car, every day brought her two loaves, four loaves, of bread. It was a strange idea of our household, but bread was subsidized, and the rest was not.\u201dIn Romania, a Hutsul interviewee (Romanian Hutsul woman born in 1961) clearly explained the nexus between \u201ceating in a healthy way and livestock breeding. When asked about any possible product she could give animals to produce more milk she exclaimed, \u201cAh, no, I do not give them anything. Well, to be precise, sometimes a bit of bran, when animals come in at night and in the morning when milking, but otherwise, grass. Here we eat healthily.\u201d It is worth noting how \u201cwe\u201d includes both humans and animals, as a whole, and therefore if animals eat healthily humans will as well.Salix sp. twigs consecrated on Palm Sunday. They placed these twigs on the barn door to protect animals. Both Seto and Russian people recalled drawing a black cross with charcoal above the barn door, on baptism day, to protect animals.In the Dzukija region, however, among the villagers, there is often a reasonably practical approach: \u201cWe did not contact anyone. If an animal lives, it lives. Nothing was treated. As the old then died\u201d (Lithuanian woman living in Belarus woman born in 1939). We recorded a profound respect for livestock. Many respondents said that, for example, a cow is a very clever animal that knows what to eat and what not to eat. At the same time, the respondents remembered many instances of using herbal remedies in various rituals related to the prevention of diseases in livestock. In particular, the tradition of blessing animals with a palm bouquet has survived to this day: \u201cAnd also animals were smoked with that Easter Palm. Yes, if they got sick then they did it\u201d (Lithuanian woman living in Lithuania born in 1938). Setos used Gymnocarpium dryopteris] [\u2026] which is good for the evil eye as well. [\u2026] Especially for animals, we used to collect it, if someone casts the evil eye, you smoke it, and it was a medicine\u201d (Lithuanian woman living in Lithuania born in 1939).It should also be noted that a large number of our respondents' recollections concerned the use of various plants for the treatment and prevention of culture-bound illnesses in domestic animals, such as fright and the evil eye: \u201cFor fright, there is uro\u010dnikas . It was a difficult period then\u201d . This was also confirmed by an elder Finnish Karelian woman who remembers that whipped cream from the only cow remaining was an important resource: \u201cI remember, in the 1970s, when it was decided that we would be left with one cow. At that time, cream was skimmed from milk and whipped as whipped cream.\u201d Another participant commented, \u201cIt was not considered a farm if there was no cow\u201d (Russian Karelian man born in 1928). In addition, a retired Karelian seamstress (born in 1954) living in the Russia mentioned that cattle disappeared because \u201cthe mowing was very bad, and it was necessary first to give hay to the sovkhoz, and therefore my parents got rid of the cows.\u201d This issue of the lack of hay was also mentioned by a Karelian forestry specialist: \u201cIt was torture to keep a cow. When I was in elementary school, my father had a MAZ lorry. Mowing was not allowed then, and they drove in the direction of Interposiolok to steal hay; they mowed on the side of the road and returned with it at night\u2013either to the neighbors or to our own farm. They helped each other, dried. they dried hay, we dried hay, and that's all. so. and lived\u201d (Russian Karelian woman born in 1948).Among other more recent changes, a Seto interviewee claimed, \u201cAnd now you can list the cow in the Red Book, only a few cows remain. So, there are no animals to treat actually\u201d (Russian Seto man born in 1943). An Estonian Seto woman, born in 1938, commented, \u201cI had three cows, and for a short time also four. When the Estonian state started, it destroyed all the cows, no one needed milk anymore. Milk churn stands were lost.\u201d A younger Estonian Seto man (born in 1953) explained his point of view, referring to the current availability of state jobs: \u201cThere were those \u201cstate\u201d works , and, on top of them, people had their own animals and farmland. But have you seen that now no one raises animals like cows or pigs at all? Pigs can't be kept anymore, because that bastard plague (African swine fever) is here.\u201d In Ukraine, an older Romanian woman explained, \u201cI do not have a cow now, but I had one. I have had it for many years, but now I am old, weak and I really cannot keep it.\u201dA couple of Romanian Hutsuls reflected upon our question regarding agricultural changes in the last few decades: \u201cAgriculture has changed since our youth. It has changed a lot [\u2026]. Now they make much more hay, but the grass lasts, which in the past did not happen because everyone here had livestock, much more than now since there are no animals, because milk is paid almost nothing, and so why keep a cow if the milk\u2026 [is paid nothing]\u201d . However, they also proudly stated, \u201cMilk here is natural, from flowers, cows graze on flowers and also eat hay. The milk is fatty, it is good.\u201d Finally, a Romanian teacher living in Romania claimed, \u201cI have had livestock, but my children have left, parents have passed away, and working and caring for animals is hard, so I gave it up,\u201d and then she continued counting the number of livestock in the village: \u201cFor instance, my grandparents had a lot of livestock, sheep and cows, and in summer they used to go to the mountain pastures, but now I think that in the entire village only five people go to the mountains. Also, the animals are few: we had about 50 animals, the same number as our neighbors, but now, in all the area, there are barely 10.\u201dIn the Dzukija region, the respondents noted that cows grazed everywhere in the village in the recent past [1980\u20131990s]. \u201cAnd only this year locals killed the last cow\u201d (Lithuanian woman living in Belarus woman born in 1939). Now, mostly older people keep at the most chickens, although, in comparison with the past, they had a rather large farm. Thus, a respondent from the Belarusian side of Dzukija noted that in her youth, she and her husband kept three cows, three pigs, a horse, a lot of chickens, geese, and sheep, and now she only has three chickens (Lithuanian woman living in Belarus woman born in 1946).The most evident difference in livestock keeping was in Poland, where the Lithuanian minority are larger-scale farmers. They still keep many animals and sell the milk to the state. In Communist times, farming in Poland was nationalized only to a small degree. Just a small proportion of food production was state based, while the majority remained in private hands. This also meant that private farming in Poland was highly fragmented, as the state did not encourage mergers and land acquisition.Our results showed that the four study regions located in Eastern Europe do not present similar ethnoveterinary knowledge trajectories. Bukovinian Romanians and Hutsuls appear to hold a living reservoir of ethnoveterinary knowledge, unlike the other regions as summarized in polonyna (summer pastures) or send their animals out with other shepherds. However, long-term (pacific) coexistence of Hutsuls with other ethnic groups, could have facilitated the sharing of their knowledge of animal breeding  among Romanians living in neighboring pre-Carpathian areas. Therefore, the mountainous nature of the area could be a key element in the resilience of ethnoveterinary knowledge, which has also been confirmed by the intrinsic relationship found between pastoralists and European mountains  and andpolons  and hass [e.g., . Other dSuch everyday practices in animal breeding (milking and cheese-making) are still currently present and so is the veterinary knowledge connected to them. Indeed, as observed by Warchalska-Troll and Troll , CarpathIn Karelia, agriculture has been marginalized, especially in terms of the area where hay is still cut and the number of natural pastures, due to the declining number of cattle and the intensification of dairy farming \u201345. We cIn Setomaa  and Dzukija, we recorded more uses, but mainly in the past. We can say that, in these territories, livestock were quite important in the recent past, but their importance has declined in the last few decades [e.g.,  for BelaThe process of knowledge erosion may be occurring as a result of different socio-economic changes. First, in both regions, the aging of the rural population has contributed to the abandonment of small-scale livestock breeding \u201353. SecoIn addition, some local drivers of decline of ethnoveterinary knowledge can be identified. For instance, in Russian Setomaa, one possible driver could be related to the drastic political and economic changes in the region. Indeed, during Soviet times, animal husbandry accounted for a relevant proportion of food production by ruble value, while after 1991 livestock herds declined precipitously and the number of livestock raised by households continues to decline , 58. AlsLinum usitatissimum and the wild Hypericum spp., Quercus robur, Alnus spp, and Rumex spp. were reported across several countries. As five out of the eight studied countries were part of the Soviet Union, we compared our field data against the uses recommended in three popular veterinary medicine books published in 1919 (Gurin), 1988 (Rabinovich), and 2007 (Korobov), representing the commonly used remedies in Imperial Russia, as well as during the Soviet and post-Soviet periods. Finally, we traced the possible sources of veterinary knowledge related to those plants listed in Bloshenko et al.  that were used in the cycle of fabric production from flax. Older informants could remember bringing flaxseed to the commonly accessible mills to produce flaxseed oil.We found that the seeds of athogens . These uathogens , Rabinovathogens , and Korathogens , althoug in rats  due to t in rats . Gurin , but they traced such a use back to the medieval European medicinal tradition. The use of Quercus robur was also recorded in Gurin . Although it was not explicitly stressed by our interviewees, we can see that some of our findings reflect the official medicinal and veterinary recommendations of the Soviet Union, possibly through the formation of veterinary specialists who actually treated the animals. The recommendations themselves relied on veterinary knowledge derived partially from ethnoveterinary knowledge that underwent scientific tests, so the local uses supported by the official veterinary medicine had a greater chance for survival.Future research should investigate the heterogeneous trajectories that ethnoveterinary knowledge takes under different drivers of change to pastoral systems, and the complex networks of sources from where farmers derive their ethnoveterinary knowledge. Additionally, it would be interesting to evaluate the effects of the use of plant-based ethnoveterinary remedies in accordance with current legislation in Europe.The original contributions presented in the study are included in the article/The studies involving human participants were reviewed and approved by Ca' Foscari University of Venice Ethics Committee. Written informed consent for participation was not required for this study in accordance with the national legislation and the institutional requirements.GM, GV, and RS conceived the study. NK, VK, OB, RS, RK, JP, NS, and GM gathered the data. RS, AP, and GV supervised the study. GM analyzed the data with the help of the co-authors. GM drafted the first version of the manuscript which was then reviewed, edited, and approved by OB, RK, VK, NK, JP, NS, AP, GV, and RS. All authors contributed to the article and approved the submitted version.This project has received funding from the European Research Council (ERC) under the European Union's Horizon 2020 research and innovation programme (grant agreement No. 714874).The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest.All claims expressed in this article are solely those of the authors and do not necessarily represent those of their affiliated organizations, or those of the publisher, the editors and the reviewers. Any product that may be evaluated in this article, or claim that may be made by its manufacturer, is not guaranteed or endorsed by the publisher."}
+{"text": "Exosomes (or extracellular vesicles) are known to mediate intercellular communication and to transmit molecular signals between cells. Molecules carried by exosomes have their own molecular roles in affecting surrounding and distant environment, as well as recipient cells. Molecular components of exosomes can be used as cancer biomarkers for diagnosis and prognosis, being promising therapeutic targets for the interruption of cellular signals. Therefore, the understanding of the molecular compositions and their functional indications of exosomes has the potential to help doctors to diagnose and monitor diseases and to allow researchers to design and develop potential targeted therapies. This review aims to provide a comprehensive protein and lipid characterization of lung cancer exosomes and to explore their molecular functions and mechanisms regulating physiological and pathological processes. This organization offers informative insight for lung cancer diagnosis and treatment.Exosomes participate in cell\u2013cell communication by transferring molecular components between cells. Previous studies have shown that exosomal molecules derived from cancer cells and liquid biopsies can serve as biomarkers for cancer diagnosis and prognosis. The exploration of the molecules transferred by lung cancer-derived exosomes can advance the understanding of exosome-mediated signaling pathways and mechanisms. However, the molecular characterization and functional indications of exosomal proteins and lipids have not been comprehensively organized. This review thoroughly collected data concerning exosomal proteins and lipids from various lung cancer samples, including cancer cell lines and cancer patients. As potential diagnostic and prognostic biomarkers, exosomal proteins and lipids are available for clinical use in lung cancer. Potential therapeutic targets are mentioned for the future development of lung cancer therapy. Molecular functions implying their possible roles in exosome-mediated signaling are also discussed. Finally, we emphasized the importance and value of lung cancer stem cell-derived exosomes in lung cancer therapy. In summary, this review presents a comprehensive description of the protein and lipid composition and function of lung cancer-derived exosomes for lung cancer diagnosis, prognosis, and treatment. Extracellular vesicles (EVs) and exosomes mediate cell\u2013cell communication within the tumor microenvironment and regulate signaling pathways in their target cells ,2. ExosoThe diagnostic and therapeutic potential of exosomes allows for exosomes to possess multiple clinical applications . SeveralAccording to the World Health Organization (WHO), cancer is one of the leading causes of death, and lung cancer is the most common cause of cancer death, accounting for 1.8 million deaths in 2020 ,46. TherExosomes play an important role in cancer progression, and therefore the identification of crucial molecular targets involved in exosome-mediated cell signaling is expected to facilitate tumor growth and advancement . MoreoveCancer cells are abnormal cells that rapidly grow in an uncontrolled manner. These rapidly dividing and uncontrolled cells eventually form a mass of abnormal tissue and tumors. Tumors, stromal cells, and the extracellular matrix (ECM) form a tumor microenvironment that is suitable for tumor growth. Tumors are heterogeneous because they are composed of several cell types, including cancer cells and cancer stem cells (CSCs) . Cancer Cells within the tumor microenvironment can directly engage in crosstalk with each other through cell\u2013cell contact, as well as indirectly through cell-secreted soluble factors and cell-derived vesicles . Direct Exosomes have been reported to be derived from several types of body fluids  and cell types  . ExosomeThe formation of ILVs (and subsequently MVBs) is driven by the endosomal sorting complex that is required for transport (ESCRT)-dependent and/or ESCRT-independent mechanisms . The ESCCells internalize exosomes via several routes: endocytosis, macropinocytosis, phagocytosis, and membrane fusion . The endLung cancer samples can be obtained from cancer cell lines and cancer patients. For cancer cell lines, cell culture medium (serum-free medium or exosome-depleted medium) has been used for exosome extraction. For cancer patients, liquid biopsies, such as blood, urine, and saliva, can be sampled, and plasma or serum can be further separated from blood. Cell-released exosomes can then be extracted from cell culture conditioned medium and patient biopsies. On the basis of their physicochemical and biochemical properties, exosomes can be isolated via ultracentrifugation-based platforms , size-based platforms , immunoaffinity-based platforms, polymer-based platforms, and microfluidics-based platforms . GuideliExosomes are cell-derived vesicles, which implies that the composition of the exosomes reflects the composition of the cells from which they are derived; therefore, the exosomal protein composition can vary by cell source . The incThe composition of exosomal proteins reflects the encapsulation of proteins originating from the cytosol and membranes of donor cells. A common set of proteins is carried in most exosomes, regardless of their cellular origin ,95,96. CIn addition to the common set of proteins, certain proteins can be found in cell type-specific exosomes. Omics data provide an overview of molecular profiles, which helps to characterize the molecular functions and mechanisms of the regulation of biological processes. Proteomics enables a comprehensive and systematic search for protein profiles. Furthermore, exosomal protein characterization has been performed with many body fluids and cell types. An extensive proteomic characterization of exosomes released from breast cancer cells  has led to the identification of proteins related to cancer cell growth, progression, migration, metastasis, and immune evasion . Ji et aSeveral exosomal proteins of lung cancer have also been characterized. We summarized the proteins that were identified in exosomes from lung cancer cell lines and patient biopsies, including plasma, serum, urine, saliva, bronchoalveolar lavage (BAL) fluid, pleural effusion, pericardial effusion, and tumor tissue. We not only included all of the major proteins identified in the original literatures but also highlighted some minor proteins mentioned in their original papers. Minor proteins could also be potential biomarkers for lung cancer. Moreover, multimarker combinations are valuable for classification prediction and could be options in addition to single markers for cancer diagnosis. Exosomal proteins and protein combinations are comprehensively organized to display their sample sources and potential applications for lung cancer . The sigFourteen proteins  were expressed in exosomes of the mouse lung cell line 3LL (Lewis lung carcinoma) with and without heat-stressed treatments . Heat stEGFR was found in microvesicles (MVs) from the human cancer cell line A431 (skin epidermoid carcinoma), as well as from A459 (lung carcinoma) and DLD-1  cell lines . ThroughAREG has been shown to be enriched in exosomes from two lung cancer cell lines (CRL-2868 and A549) and enriched in exosomes from a prostate cancer cell line (PC3) and a breast cancer cell line (MDA-MB-231), compared to their original cells . AREG haEighteen proteins  have been identified in exosomes from the serum samples of lung cancer patients, including adenocarcinoma (AC) and squamous cell carcinoma (SCC) . On the EV arrays, which represent a new application of protein microarrays printed by customized capturing antibodies, have been developed to capture and detect exosomes from unpurified samples, including plasma and cell culture supernatants . EV arrahttps://www.hprd.org/) (accessed on 27 December 2021), Park et al. found 264 MV proteins were derived from lung tissue, and 67 out of them were commonly identified in all three patients, including ANXA4, AQP1, RAS proteins, and CEACAM6. This study explored a pool of MV proteins and suggested that they could be diagnostic biomarkers and therapeutic targets. Several proteins were identified to be significantly enriched in exosomes from A549 cells (NSCLC cell line) and HCC827 cells (NSCLC cell line), compared to exosomes from HBE4 cells  [https://tcga-data.nci.nih.gov/) (accessed on 27 December 2021) data analysis, an OS prediction suggested that HGF is a promising biomarker for late stage cancer or poor prognosis. Further experiments showed that sEV-HGF could activate the HGF/c-Met signaling pathway to promote cancer cell metastasis. Exosomes released from A549 lung cancer cells under four treatment conditions  had different degrees of impact on target cells  [A proteomic analysis showed the potential to discover diagnostic and prognostic biomarkers for lung cancer ,124,125.ll line) . Proteinll line) . Via thell line) . Comparill line) . When lull line) . ProteinTGF-\u03b2 and IL-10 were expressed in exosomes of NCI-H1688 cells (SCLC cell line) and NCI-H2228 cells (NSCLC cell line) . When coVIM, an intermediate filament protein, has been found in exosomes from PC14 (nonmetastatic) and PC14HM (highly metastatic) lung cancer cell lines . Both thThirteen proteins  were enriched in plasma-derived EVs of lung AC patients, with concordant expression in EVs of lung AC cell lines  . The comTim-3 and galectin-9 have shown significantly elevated expression in plasma-derived exosomes of NSCLC patients  and lung SCC patients (compared to lung AC patients) . Both exThe expression of LBP in serum-derived exosomes from NSCLC patients was observed to be significantly higher than that in exosomes from healthy individuals . FurtherBoth AHSG and ECM1 have been shown to have significantly higher expression in serum-derived exosomes of NSCLC patients than in those of healthy individuals and were proposed to be diagnostic biomarkers for NSCLC . The diaNineteen proteins  were more than fivefold more highly expressed in exosomes of NCI-H838 cells (NSCLC cell line) than in the cellular membrane of NCI-H838 cells . These pIntegrins \u03b13 and \u03b21 have been shown to be expressed in exosomes from four lung AC cell lines  and one NSCLC patient pericardial effusion sample . This stLRG1 has been detected in exosomes from urine samples of NSCLC patients without chemotherapy . The proThe protein expressions of HLA-class I, BAGE, PD-L1, and annexin-A2 have been shown to be elevated in exosomes from BAL fluids of smokers and NSCLC patients, compared to the expression in exosomes of healthy individuals . In theiPD-L1 has been found in exosomes from melanoma cells, as well as from lung  and breast (MDA-MB-231) cancer cells . MoreoveThe expression levels of seven proteins ) were found to be significantly increased in serum-derived EVs of lung cancer patients, including AC, SCC, and small cell lung cancer (SCLC) . FurtherKRAS mutation), H1299 (with the neuroblastoma RAS (NRAS) mutation), PC9 (with the EGFR mutation), H1650 (with the EGFR mutation), and H522 (with the TP53 mutation), but they were not identified in exosomes from human pulmonary alveolar epithelial cells (HPAEpiCs), thus indicating that the five proteins were lung cancer exosome-specific proteins [TUBA1C, GAPDH, KRT25, GCC2, and POTEKP were collectively identified in exosomes from five NSCLC cell lines, including A549  were detected in serum samples from NSCLC patients and healthy individuals . RNA expProteins in lung cancer-derived exosomes are diagramed to illustrate promising usage as diagnostic and prognostic biomarkers or therapeutic targets for lung cancer therapy .Exosomes perform their communication effects by transmitting their molecular cargo from donor cells to recipient cells . TherefoA well-known protein classification system known as PANTHER organized protein classes on the basis of protein functions and included proteins associated with each class ,152. In Proteins and their functions are briefly summarized according to the following classes: (1) tetraspanin family proteins , (2) exosome formation-/secretion-required proteins , (3) chaperones , (4) structural proteins , (5) cell\u2013microenvironment interactors , (6) enzymes and enzyme modulators , (7) signaling proteins , and (8) immunoregulatory proteins .Within the tetraspanin family, CD9, CD63, and CD81 are commonly used as exosome markers. Tetraspanins, which are membrane proteins with four transmembrane domains, are known to possess multiple functional roles in several biological processes, such as cell adhesion, fusion, signaling, and trafficking . EvidencRABs, which are in the GTPase family, are known to modulate membrane trafficking, with roles in endocytosis, exocytosis, and exosome secretion ,165. AnnSeveral types of enzymes  and enzAlthough some proteins were not assigned to suitable protein classes according to the PANTHER classification system, they still have important molecular functions involved in several biological processes. For example, GRB2 is a pivotal protein in signal transduction . Upon thExosomes are released by the fusion of MVBs with the cell membrane, thus rendering exosome lipid-enriched membrane structures. Exosome release relies on not only proteins but also lipids that participate in exosome biogenesis and secretion . AlthougThe lipid bilayer membrane of exosomes contains various lipids to maintain exosome structure and to protect the protein and nucleic acid contents . ExosomaLipidomic profiles can reveal the lipid landscape of exosomes. For instance, Llorente et al. quantified 277 lipid species in the membranes of PC-3 cells (human prostate cancer cells) and in the exosomes they release, and they found that glycosphingolipids, SM, cholesterol, and PS were highly enriched in PC-3 cell-derived exosomes, which demonstrated a particular pattern of lipid sorting into these exosomes . NotablyIn a lung cancer study, Fan et al. explored the lipid profiles of blood plasma exosomes and distinguished 39 normal donors and 91 NSCLC patients (including 44 patients in early stage cancer and 47 patients in late stage cancer) . Lipid fThe membrane component SM helps to maintain membrane integrity and stability and is enriched in lipid rafts that help to regulate cellular signaling . DynamicCancer tumors grow in a complicated tumor microenvironment with multiple types of cells, such as cancer cells, CSCs, cancer-associated fibroblasts (CAFs), immune cells, and other normal cells . ConventAs CSCs play important roles in tumor recurrence and drug resistance, they may transmit crucial signaling to other cells via exosomes. EV-mediated crosstalk between CSCs and molecules in the tumor microenvironment can influence the fate of normal and tumor cells, thereby regulating solid tumor progression . HoweverSeveral exosomal miRNAs from various CSCs  have been found . A few mExosomes are cell\u2013cell communicators within the tumor microenvironment. The molecular cargo carried by exosomes represents the content of the cells of origin and shows functional potential for cancer cell-mediated signaling. The identification of the molecular components of exosomes can help to pinpoint a cell\u2013cell communication mechanism and may eventually lead to the identification of potential diagnostic and prognostic biomarkers for cancer detection and disease staging.This review presents current potential exosomal proteins and lipids for the development of lung cancer detection, diagnosis, treatment, prognosis, and follow-up monitoring. We organized lung cancer-derived exosomal proteins and lipids from the available literature, regardless of sample source. Exosomes were isolated and purified from various lung cancer sample sources, including lung cancer cell lines and liquid biopsies, such as blood (plasma and serum), urine, and saliva.Evidence has shown that exosomal protein and lipid cargos contain components necessary for exosome formation, structural components related to the cytoskeleton, and signaling molecules for intercellular communication and regulation. Proteins participate in several biological processes through different pathways and networks to regulate other molecules and to exert their own molecular functions. Enzymes and enzyme modulators help substrates to transform to active or inactive forms to control molecular transformation and metabolism during bioactive signaling. Structural proteins maintain cell structure and are packaged into exosomal cargo; they may also play versatile functional roles in mediating receptor dynamics and organization. Moreover, tetraspanin family proteins play multiple roles in the regulation of several biological processes, thus leading to changes in tumor cell growth, invasiveness, and metastatic capacity. Exosome formation-/secretion-required proteins participate in the process of exosome biogenesis and release and are involved in exosome internalization into target cells. Additionally, cell microenvironment interactors coordinate cell interactions and communication with the external environment to form a suitable niche for cell adhesion and migration. Signaling proteins transmit signals to target cells to modulate recipient cell molecular networks and can consequently affect their cellular behavior. Furthermore, chaperones protect proteins from misfolding and are important to cancer development and progression. In summary, several pathways are involved in transmitting signals from donor cells to recipient cells via exosomes, including the endocytic pathway; endosomal sorting- and transportation-related interaction pathways for cargo packaging and exosome release; exosome- and microenvironment-related pathways that promote cell adhesion and targeting; and pathways involved in exosome uptake that enable signal transduction and the promotion of enzymatic activity within target cells. In contrast, lipids not only play structural roles in maintaining exosomal membrane structure but also serve functional roles in exosome biogenesis and uptake, as well as signal modulation. The lipid bilayer membrane structure of exosomes functions as a protector of exosomal protein and nucleic acid contents.Although exosomes can be released from multiple types of cells within the tumor microenvironment, it is challenging to discriminate the original cell source of exosomes. The CSC subpopulation contributes to tumor progression and is an important source of exosomes. Nevertheless, to the best of our knowledge, after a comprehensive literature review, few or no studies have discussed the proteins and lipids of lung CSC-derived exosomes. The exploration of proteins and lipids, as well as miRNAs, in lung CSC-derived exosomes for lung cancer therapy is still an unmet need. Accordingly, we highlighted the importance of CSCs and CSC-derived exosomes in cancer therapy and listed feasible strategies to obtain CSCs for exosome study.Cancer cells and CSCs transmit tumor cell signals by packaging essential molecular components into exosomes that are carried to target cells and the tumor microenvironment, wherein the delivered exosome components can change cellular behavior and form an educated niche suitable for tumor growth and progression. Therefore, the characterization of the molecular components and functions of cancer cell- and CSC-derived exosomes helps to understand exosome-associated molecular mechanisms and to discover potential drug(s) for blocking cancer cell- and CSC-derived molecular signals.In summary, we elaborated on the comprehensive protein and lipid composition and function of lung cancer-derived exosomes. Exosomal molecules could be potential diagnostic and prognostic biomarkers and therapeutic targets for drug development. This review provides a molecular foundation for future studies and applications in exosome-based cancer diagnosis, prognosis, and treatment, especially for lung cancer."}
+{"text": "Lung cancer is one of the most common malignant tumours worldwide. however, emerging immunotherapy and targeted therapies continue to show limited efficacy. In the search for new targets for lung cancer treatment, exosomes have become a major focus of research. Exosomes play an important role in the tumour microenvironment (TME) of lung cancer and affect invasion, metastasis, and treatment responses. This review describes our current understanding of the release of exosomes derived from different cells in the TME, the effects of exosomes on T/Tregs, myeloid-derived suppressor cells, tumour-associated macrophages, dendritic cells, and natural killer cells, and the role of exosomes in the endothelial\u2013mesenchymal transition, angiogenesis, and cancer-associated fibroblasts. In particular, this review focuses on the potential clinical applications of exosomes in the lung cancer microenvironment and their prognostic and diagnostic value. Lung cancer is one of the most commonly diagnosed cancer and the leading cause of cancer deaths in both sexes combined , despiteTo find effective treatments and overcome low immunotherapy efficiency and drug resistance, increasing research has focused on the lung cancer microenvironment. The vasculature, immune and inflammatory cells, extracellular matrix (ECM), and cancer-associated fibroblasts (CAFs) are major components of the tumour microenvironment (TME), which is recognised as a target-rich landscape for the development of novel agents in lung cancer , 5. InteAmong these functional mechanisms, exosomes carrying large amounts of information and molecules play an important role in intercellular communication and are indispensable mediators of various processes in the TME . ExosomeExosomes transport proteins (cytosolic and transmembrane proteins), lipids, and nucleic acids  to target cells, thus regulating their behaviour \u201310. ExosExosomes form by inward budding in the plasma membrane, and are classified as early and late endosomes, known as multivesicular bodies. Numerous intraluminal vesicles form by the invagination of multivesicular body membranes. Exosome release is regulated by a number of genes and proteins. For example, miR-134 and miR-135b precisely regulate YKT6 expression in lung cancer cells, which in turn controls exosome release . FurtherExosomes can be ingested by a variety of cells in the TME and exert functions via proteins, nucleic acids, and other substances. First, the recognition of exosomes requires membrane protein interactions. CD169 recognises exosomes and mediates the immune response to exosome antigens. The adhesion of B cell-derived and DC-derived exosomes is CD169-dependent . After rTumour-associated macrophages (TAMs) have been linked to lung cancer cell initiation, progression, and metastasis in the TME . The keyDendritic cells (DCs) play an essential role in the regulation of tumour-specific immune responses. DC-based immunotherapy is unsatisfactory due to the poor immunogenicity of cancer cells and low uptake efficiency of antigens, even though DCs are the most potent antigen-presenting cells . Lung tuNatural killer (NK) cells are independent, non-specific immune cells. They can directly kill tumour cells without MHC restriction to the target . However+CD25+Foxp3+ T regulatory cells (Tregs) and functional alterations of T lymphocyte subsets in the TME are critical for the immune escape of lung cancer cells [+ na\u00efve T lymphocytes incubated with tumour-derived exosomes from mutant KRAS+/+ NSCLC cells induce Foxp3+ Treg generation by phenotypic switching. Foxp3 regulates Treg functions [The proportion of CD4er cells . Lung caer cells . PD-L1-mer cells , 51. In er cells . The traer cells . Epidermer cells . The oncunctions . This counctions .Myeloid-derived suppressor cells (MDSCs) are divided into the following two groups: M-MDSCs, which are morphologically similar to monocytes, and PMN-MDSCs, which resemble polymorphonuclear cells . MDSCs rZEB1 mRNA is a major EMT transcription factor in mesenchymal cells in NSCLC. Oncogenic exosomes derived from mesenchymal NSCLC cells can transfer chemoresistance and mesenchymal phenotypes to recipient cells by ZEB1 mRNA in exosomes [Epithelial-mesenchymal\u00a0transition\u00a0(EMT) is a key mechanism for initiating lung cancer cell invasiveness and metastasis . Exosomeexosomes . These rexosomes . Exosomaexosomes . Increasexosomes . These rCDH1 encoding E-cadherin and VIM encoding Vimentin [hTERT mRNA has been detected in exosomes isolated from sera of patients with lung cancer. The transfer of exosomal telomerase from cancer cells into fibroblasts may contribute to alterations in the TME [Cancer-associated fibroblasts (CAFs) are a major cellular component of TME in most solid cancers. Lung cancer cells can transform the phenotype of fibroblasts via exosomes and related factors. Exosome-associated miR-142-3p promotes the transformation of lung fibroblast cells to CAFs via TGF-\u03b2 signalling . InteracVimentin . In termVimentin , 70 are Vimentin . In addiVimentin , 73. Sim the TME .Various studies have evaluated the role of hypoxia during interactions between immune cells and EMT components. Lung cancer-derived exosomes increase under hypoxic conditions and play a critical role in angiogenesis. miRNAs in lung cancer cell-derived exosomes have important functions under hypoxic conditions . ExosomaThe premetastatic TME (pre-metastatic niche) in lung cancer is an important cause of induction of metastasis. Primary lung cancer-derived exosomal RNAs promote neutrophil recruitment by activating TLR3 in lung epithelial cells via the NF-kB and MAPK pathways . TGF-\u03b2 hTable The progression of multidrug resistance is the major obstacle to maintain effectiveness of chemotherapy in lung cancer . The TMEExosomes in the TME may be novel diagnostic and therapeutic targets for NSCLC. YKT6 in lung cancer cells regulates exosome release. A clinical study has shown that in NSCLC, YKT6 in tumour samples is associated with a shorter disease-free survival and overall survival .Various lncRNAs have been identified as promising therapeutic targets. MiR-96 is a candidate serum biomarker and therapeutic target for NSCLC. Melanoma differentiation-associated gene-9 (MDA-9)/Syntenin is another therapeutic target for lung adenocarcinoma; this locus promotes cancer invasion and metastasis as a key regulator of Slug and Slug-mediated EMT . NSCLC cBCL2L1 could be a useful biomarker for poor survival in patients with lung adenocarcinoma [Exosomes are promising tools for tumour diagnosis and treatment , 8. Micrarcinoma . A largearcinoma . Exosomaarcinoma . Anotherarcinoma . High learcinoma . Exosomearcinoma , 107.Table Liquid biopsy is a diagnostic procedure that describes information about cancer-derived substances obtained from blood sample. The sample information of the liquid biopsy mainly comes from: circulating tumour cells (CTCs) of blood sample, circulating cell-free DNA (cfDNA) released into the blood from tumour cells and normal cells and cell-free RNA (cfRNA) enriched in exosomes from tumour cells . It makePD-L1 in serum exosomes can be used as a quantitative factor for tumour PD-L1 status, which may be helpful in predicting the clinical outcome of anti-PD-1 therapy in NSCLC patients . With thFunctional studies of non-coding RNAs and proteins in exosomes provide new insights into reshaping the TME. In terms of clinical application, a large number of non-coding RNAs and proteins have been found in exosomes, which are expected to become an indispensable tool for the diagnosis and prediction of lung cancer in clinic. However, there remains a lack of clinical studies with large samples to provide evidence support. It is particularly important to identify the precise components that act key roles in tumour processes. Ongoing experimental and clinical studies of exosomes may provide new ideas for improvement of TME and treatment of lung cancer."}
+{"text": "Using this system, we demonstrated that both JEV RP9 and SA14-14-2 are able to cross the BBB without disrupting it at early times post viral addition. Furthermore, we find that almost 10 times more RP9 infectious particles than SA14-14 cross the model BBB, indicating this BBB model discriminates between the virulent RP9 and the vaccine SA14-14-2 strains of JEV. Beyond contributing to the understanding of early events in JEV neuroinvasion, we demonstrate this in vitro BBB model can be used as a system to study the viral determinants of JEV neuroinvasiveness and the molecular mechanisms by which this flavivirus crosses the BBB during early times of neuroinvasion.Japanese encephalitis virus (JEV) is the major cause of viral encephalitis in South East Asia. It has been suggested that, as a consequence of the inflammatory process during JEV infection, there is disruption of the blood-brain barrier (BBB) tight junctions that in turn allows the virus access to the central nervous system (CNS). However, what happens at early times of JEV contact with the BBB is poorly understood. In the present work, we evaluated the ability of both a virulent and a vaccine strain of JEV  to cross an  Flaviviruses such as Japanese encephalitis virus (JEV) are arthropod-borne viruses (arbovirus) that are transmitted through the bite of an infected mosquito and may cause serious human diseases [diseases . JEV is diseases . About 3diseases , as welldiseases , 6. Althdiseases , suggestFlavivirus population is not clonal, but rather a mix of multiple viral genomic species (aka quasispecies) [JEV has a positive-sense RNA genome encoding a single polyprotein flanked by two untranslated regions (UTR) at the 5\u2019 and 3\u2019 ends. This polyprotein is co- and post-translationally cleaved into three structural proteins  involved in viral particle assembly and antigenicity and seven non-structural proteins  involved in genome replication, viral particle assembly and evasion of innate immunity [species) , 9.in vivo in murine and simian models. Expression levels of tight junction proteins involved in maintaining BBB functions such as occludin, claudin-5 and zonula occludens 1 (ZO-1) are significantly decreased in symptomatic JEV-infected mice, suggesting physical disruption of the BBB [JEV is a neuroinvasive and neurovirulent virus. It is associated with neuroinflammation of the central nervous system (CNS) , and dis the BBB . It seem the BBB  and that the BBB \u201313, whic the BBB . Vesicul the BBB , but it In contrast to virulent JEV strains such as RP9, the vaccine strain SA14-14-2 was shown to be essentially non-neuroinvasive and non-neurovirulent in weanling ICR mice, but is still highly neurovirulent in neonates. The JEV SA14-14-2 genome contains 57 nucleotide differences positioned along the genome when compared to the parental strain SA14, leading to 25 amino-acid substitutions . MutatioAlthough encephalitis incidents have occurred after vaccination with the SA14-14-2 JEV strain, no virus could be recovered from them . Whetherin vitro. hCMEC/D3 monolayers displays good restricted permeability to paracellular tracers and retains most of the transporters and receptors present on in vivo BBB [The BBB is the physical and physiological barrier between the brain and the blood compartments in vertebrates, and it is comprised of a network of different cell types including the brain microvascular endothelium along with pericytes, astrocytes, microglia and the basement membrane . Severalvivo BBB . Accordivivo BBB , 26.in vitro human BBB model consisting of hCMEC/D3 human endothelial cells cultivated on permeable supports above SK-N-SH human neuroblastoma cells to evaluate and compare the ability of both a virulent and a vaccine strain of JEV  to cross this BBB model.In the present study, we used an Cercopithecus aethiops monkey kidney Vero cells were maintained at 37\u00b0C in DMEM supplemented with 5% FBS. Aedes albopictus mosquito cells C6/36 were maintained at 28\u00b0C in Leibovitz medium (L15) supplemented with 10% FBS.Human endothelial cells hCMEC/D3 , were ma\u00ae (JEV SA14-14-2) vaccine was kindly provided by Dr. Philippe Dussart , and reconstituted with 500\u03bcL of DMEM. Two hundred and fifty \u03bcL of reconstituted vaccine were used to infect Vero cells for 7 days. Viral supernatants were collected and used to infect C6/36 cells cultivated in EndoGro medium supplemented with 2% FBS. Both JEV RP9 and SA14-14-2 viral supernatant stocks were collected 3 days after infection and the infectious titer was determined in Vero cells by focus-forming assay (see below).A molecular cDNA clone of JEV genotype 3 strain RP9 was kindly provided by Dr. Yi-Ling Lin . This plFlavivirus E protein were purchased from the ATCC , and a highly-purified antibody preparation was produced by RD Biotech . Mouse monoclonal anti-JEV NS5 antibody was kindly provided by Dr. Yoshiharu Matsura [Mouse hybridomas producing the monoclonal antibody 4G2 anti- Matsura . Horsera4/well) were seeded on 12-well Transwell\u00ae permeable inserts  in EndoGro medium supplemented with 5% FBS and placed at 37\u00b0C for 5 days. SK-N-SH cells (2.105/well) were seeded in 12-well tissue culture plates in EndoGro supplemented with 2% FBS. Permeable inserts containing hCMEC/D3 cells were then transferred in these culture plates and medium was replaced by EndoGro medium supplemented with 2% FBS. Aliquots of virus were diluted the next day in 50\u03bcL of EndoGro medium supplemented with 2% FBS, heated at 37\u00b0C and then added to the cells. Cells were incubated at 37\u00b0C until collection.hCMEC/D3 cells (5.105/well). Ten-fold dilutions of virus samples were prepared in DMEM and 200\u03bcL of each dilution was added to the cells. The plates were incubated for 1h at 37\u00b0C. Unabsorbed virus was removed and 800\u03bcL of DMEM supplemented with 0.8% carboxymethyl cellulose (CMC), 5 mM HEPES buffer, 36 mM sodium bicarbonate, and 2% FBS were added to each well, followed by incubation at 37\u00b0C for 48h for JEV RP9 or for 72h for JEV SA14-14-2. The CMC overlay was aspirated, and the cells were washed with PBS and fixed with 4% paraformaldehyde for 20 min, followed by permeabilization with 0.1% Triton X-100 for 5 min. After permeabilization, the cells were washed with PBS and incubated for 1h at room temperature with anti-E antibody (4G2), followed by incubation with HRP-conjugated anti-mouse IgG antibody. The assays were developed with the Vector VIP peroxidase substrate kit  according to the manufacturer\u2019s instructions. The foci were then counted in each well manually. The viral titers were expressed in focus-forming units (FFU) per milliliter.Vero cells were seeded in 24-well plates  supplemented with 10 mM of HEPES buffer, 1 mM of sodium pyruvate and 50\u03bcM of LY . The culture medium inside the Transwell\u00ae inserts was replaced with 500\u03bcL of HBSS buffer containing 50\u03bcM of LY. Cells were incubated at 37\u00b0C for 10 min. Permeable inserts were then transferred in culture well containing 1.5 mL of HBSS buffer and incubated at 37\u00b0C for 15 min. They were then transferred in culture well containing 1.5 mL of HBSS buffer and incubated at 37\u00b0C for 20 min. Concentrations of LY in the wells were determined using a fluorescent spectrophotometer . The emission at 535 nm was measured with an excitation light at 485 nm. The endothelial permeability coefficient of LY was calculated in centimeters/min (cm/min), as previously described [LY dye migration through the BBB monolayers was performed as previously described , 26. Briescribed .5) were seeded on coverslips in 24-well tissue culture plates in EndoGro medium supplemented with 5% FBS. After 5 days, cell medium was replaced with 1 mL of EndoGro medium supplemented with 2% FBS. SK-N-SH cells (105) were seeded on coverslips in 24-well tissue culture plates in DMEM supplemented with 2% FBS. Aliquots of virus were diluted in 200\u03bcL of medium and added to the cells. Plates were incubated for 1h at 37\u00b0C. Unabsorbed virus was removed and 1mL of EndoGro or DMEM supplemented with 2% FBS was added to the cells, followed by incubation at 37\u00b0C until collection.hCMEC/D3 cells . The slides were examined using a fluorescence microscope (EVOS FL Cell Imaging System).4/well) were seeded on 12-well Transwell\u00ae insert filters in EndoGro medium supplemented with 5% FBS for 5 days. SK-N-SH cells (2.105/well) were seeded in 12-well tissue culture plates in EndoGro supplemented with 2% FBS. Transwell\u00ae containing hCMEC/D3 cells were then transferred in these culture plates and medium was replaced by EndoGro medium supplemented with 2% FBS. Cells were incubated at 37\u00b0C. At 24h post-contact, total RNA of hCMEC/D3 cells were extracted using NucleoSpin RNA kit  following the manufacturer\u2019s instructions. Two hundred ng of total RNA were used to produce cDNA using the SuperScript II Reverse Transcriptase  according to the manufacturer\u2019s instructions. Quantitative PCR were performed on 2\u03bcL of cDNA using SYBR Green PCR Master Mix  according to the manufacturer\u2019s instructions. The CFX96 real-time PCR system (Bio-Rad) was used to measure SYBR green fluorescence with the following program: an initial PCR activation at 95\u00b0C (10 min), 40 cycles of denaturation at 95\u00b0C (15s) and annealing-extension at 60\u00b0C (1 min). Results were analyzed using the CFX Manager Software (Bio-Rad) gene expression analysis tool. GAPDH was used as the reference gene. Primers used in gene expression studies are listed in hCMEC/D3 cells  following the manufacturer\u2019s instructions.Total RNA from JEV BBB-crossing samples was extracted using NucleoSpin\u00aeRNA kit  according to the manufacturer\u2019s instructions. The number of JEV RNA copies present in BBB-crossing samples was determined by RT-qPCR using TaqMan\u00ae Fast Virus 1-Step Master Mix kit  according to the manufacturer\u2019s instructions. The forward and reverse primers (Sigma-Aldrich\u00ae) were t test, Mann-Whitney test and ANOVA test corrected with Tukey method for multiple comparisons were used to compare experimental data. GraphPad Prism 7 was used for these statistical analyses. The significance level for our data was set to 5% or less (P \u22640.05).Unpaired two-tailed in vitro model to study JEV neuroinvasion should consist of two main components: 1) a cell monolayer mimicking the BBB, and 2) a brain tissue-derived cell line permissive to JEV. Based on our previous work [in vitro BBB model can be used as a tool to study the neuroinvasiveness of JEV.A basic ous work , we chos10 less at 24 and 48 hpi respectively, Independent reports have found that neuroblastoma-derived SK-N-SH cells are susceptible to both the virulent JEV RP9 strain and the SA14-14-2 attenuated strain , 35. To In order to examine the susceptibility of our hCMEC/D3 BBB model to JEV infection, the cells were grown 6 days on coverslips to allow the BBB to form, and then inoculated with either the RP9 or SA14-14-2 JEV strain . As evidIt has been suggested that JEV infects brain tissue cells as a consequence of a preceding inflammatory process which in turn leads to disruption of the BBB and viral neuroinvasion , 37. Our10 higher when a MOI of 10 was used in comparison to a MOI of 1  to cross the BBB at early times post-addition. We have shown that both JEV RP9 and SA14-14-2 are able to cross the BBB without disrupting it at 6 hpi. Our finding corroborates in vivo studies that have demonstrated that JEV is able to get access to the CNS and establish a primary infection without the preceding need of BBB leakage [In this study, we have used an  leakage , 37.in vivo in mice and monkeys [in vitro BBB model and JEV strains with different neuroinvasive capabilities(such as the ones used in this work) would be useful to identify which cellular mechanisms might be \"hijacked\" by these pathogens to cross the BBB.Moreover, the fact that both JEV RP9 and SA14-14-2 strains crossed the BBB without infecting BBB endothelial cells, or disrupting the barrier, also suggests that the pathway JEV uses to cross the BBB is either a transcellular one, through the endothelial cells, or paracellular, between the endothelial cells. These observations are consistent with other studies conducted  monkeys , 16, 41.Interestingly, although our specific infectivity data suggest that JEV RP9 infectious particles crossed the BBB more efficiently than those of the vaccine strain JEV SA14-14-2, comparison of hCMEC/D3 cell transcriptomes from BBBs that were exposed for 6h to either JEV RP9, SA14-14-2 or no virus showed no significant difference in the levels of gene expression . This suggests that an immediate or early cellular response is unlikely to be responsible for the differential BBB crossing of JEV RP9 versus JEV SA-14-14-2 particles we observed. Instead, we suspect specific viral factors to be at play, for example, interaction of the viral particle with a strain-specific cellular surface receptor for viral entry. Other considerations to pursue such as full characterization of the viral particles that are able to cross the BBB including, by deep-sequencing of their RNA genomes, and an electron microscopic examination of the endothelial cells forming the BBB after contact with either virus, could help to shed significant light on this intriguing difference.Interestingly, we found that hCMEC/D3 were permissive to both RP9 and SA14-14-2 strains only when the BBB formation was not completed. BBB formation induces changes in cell conformation, which can then lead to the relocation of cell receptors between BBB cells . Differein vitro model to characterize viral determinants of JEV neuroinvasiveness as well as a tool to study the molecular mechanisms by which these pathogens cross the BBB.In conclusion, our study demonstrates that both a virulent and a vaccine strain of JEV are able to cross a BBB model without disruption at early times post viral addition. This BBB formed by human endothelial cells represents a useful discriminant"}
+{"text": "We present a systematic framework to study the threshold contributions of the differential rapidity distribution for the production of any number of colorless particles in the hadronic colliders. This has been achieved based on the universality structure of the soft enhancements associated with the real emissions, along with the factorization property of the differential cross section and the renormalization group invariance. In this formalism, we present a universal soft-collinear operator to compute the soft virtual differential cross section for a generic  The upcoming era of high energy physics will confront a huge boom of data driven by the upgraded run of the Large Hadron Collider (LHC). The High-Luminosity LHC will also come into effect in a few years of time. In order to fully exploit the increased quantity of data which will not only help to detect a rare phenomena but also improve the precision, an enhanced amount of effort by the theoretical physicists will be called for. In improving theoretical precision, the higher order quantum chromodynamics (QCD) and electroweak (EW) corrections play an important role. Among different observables, since the differential cross-section allows a wider range of comparisons with the experimental data, over the past few decades several attempts have been made to incorporate the higher order QCD and EW radiative corrections to this observable. The topic of this article is concerning the differential cross-section with respect to rapidity, in particular, we address the question of computing the higher order QCD corrections to this observable for any generic process at a hadron collider with all the final state particles as colorless.Despite its high importance, unlike the inclusive cross-section, the differential rapidity distribution and its radiative corrections are computed only for a limited number of scattering processes. The rapidity distributions in Drell-Yan and of the scalar Higgs boson were computed to next-to-next-to-leading order (NNLO) QCD in Refs.\u00a0, 2 and , respect in Ref.\u00a0. Shortly in Ref.\u00a0 in the fn denotes the number of final state colorless particles. We show that combining the virtual matrix element that captures the process dependence, the universal soft part and mass-factorization kernel in an elegant way, we can calculate the SV differential rapidity distribution for any generic Needless to say, achieving a full QCD correction to any order is not easy and with increasing perturbative order, the complexity level increase substantially which often prevents us from achieving it. In absence of the full QCD correction, it is often desirable to find an alternative method averting the full complexity to capture the dominant contribution. In this article, we discuss such a method, called soft-gluon or soft-virtual (SV) approximation. In the soft limit, the momenta of all the real emission diagrams are assumed to be infinitesimally small which leads to an all order exponentiation of this contribution. In Refs.\u00a0, 8, a foIn the literature, several results for the rapidity resummation employing different methods are available. In Ref.\u00a0, followi in Ref.\u00a0 of Drellmentclasspt{minima in Ref.\u00a0, which i in Ref.\u00a0, 8, 14 r in Ref.\u00a0, the mergoal of this article is to present the formal methodology of computing threshold rapidity corrections including NSV terms for any generic process of Over the past decade, the formalism  for the  In Ref.\u00a0, the obs in Ref.\u00a0 by incor in Ref.\u00a0, 18, 76.hilation . The thrhilation  and Drelhilation  are alsoons, see \u201333 for mons, see , 35, 77,The paper is organized as follows: in section\u00a0n-number of colorless particles in hadron collisions within the framework of perturbative QCD. Our prescription that we will develop subsequently to capture this contribution is within the scope of QCD improved parton model where the collinear divergences factorize to all orders in strong coupling constant n-number of colorless particles, denoted as X, we represent an inclusive hadronic state. z, are respectively defined as the ratios of invariant mass square of the final state to the square of hadronic (S) and partonic  that take part in the scattering at the partonic level as W. The remaining delta functions reflects the momentum conservation and also the rapidity of final state invariant mass system as defined by  contribution. In addition, we also discuss how the current formalism can be extended to study the next-to-soft virtual (NSV) contribution. In order to define the soft limit for the rapidity distribution, we choose to work with a set of symmetric scaling variables y and z, the n-number of final state colorless particles, the partonic coefficient function does, in fact, depend on the Mandelstam variables constructed out of all the independent external momenta which is concisely denoted through W with respect to the variables W satisfiesThe scattering matrix element or equivalently the partonic differential distribution can be perturbatively expanded in powers of strong coupling constant q2,y) in  can be rIn this section, we setup a framework to compute the soft-virtual corrections to the rapidity distribution to all orders in strong coupling constant. The infrared safe SV rapidity distribution can be obtained by combining the ultraviolet (UV) renormalized virtual matrix elements with the soft gluon contribution and performing appropriate mass factorization to get rid of initial state collinear singularities.It is well-known that the combined soft and collinear divergences, conveniently denoted as infrared (IR), in virtual matrix elements factorize from the corresponding UV renormalized part to all orders in perturbation theory and thereby in dimensional regularization we can writein Refs.\u00a0\u201338. For  in Ref.\u00a0 and subs in Ref.\u00a0. For sca in Ref.\u00a0 which wa in Ref.\u00a0. An all  in Ref.\u00a0, 44. An  in Ref.\u00a0. We provBefore moving further, we wish to iterate a well-known fact. For processes involving only conserved operator, such as Drell-Yan, the coupling constant renormalization is sufficient to get rid of all the UV divergences. However, for other processes, such as the Higgs boson production in heavy quark effective theory, an additional renormalization which often called the operator renormalization is needed. This is a property inherent to the operator itself.In order to get the infrared safe and finite differential rapidity distribution, we need to combine the UV renormalized virtual matrix element to the real emission contributions in the soft limit and perform mass factorization which ensures the removal of collinear singularities arising from the initial state colored particles. Therefore, the universal nature of IR divergences in virtual matrix element implies that the combined contribution from the real emission diagrams and mass-factorization kernels must exhibit the same universality. By employing the criteria of universal IR structure and imposing the finiteness property of the rapidity distribution, we develop the prescription to compute the rapidity distribution under SV approximation for any generic In this article, we extend the prescription, which was introduced for the Sudakov type process in Ref.\u00a0, to the mentclasspt{minimak-th order UV renormalized matrix element of the underlying partonic level process The pure virtual contribution is captured through the form factor aa\u00afsv in  becomes mentclass2pt{minimN of this relation we getgg are related by simple scaling of quadratic Casimirs. This essentially signifies the universality of the real emission in the soft limit i.e. it is independent of the details of the process, it solely depends on the nature of the external partons. Needless to say, it is also quark flavour blind. The relation in  and finite (fin) parts as\u0393aa\u00af,fin, can be rmentclasspt{minimaur loops \u201356 in QCur loops , 42 fromur loops , 58 throur loops 26\\documein Refs.\u00a0\u201361.We present the new results of imension \u201356 alongimension \u201366. The in Refs.\u00a0, 68 whicin Refs.\u00a0\u201366. For in Refs.\u00a0, 69 and in Refs.\u00a0. MoreoveIn Online Resource, the explicit expressions of all the anomalous dimensions including the QCD y, for the production of n-colorless particles which also paves the way for a wider range of comparisons with the experiments. Earlier we have seen that there exists an operator, differential soft-collinear operator, which embeds the universality of all the soft enhancements associated with the soft gluon emissions in the production of n-colorless particles in the hadronic collision. The universality lies in the fact that the operator, Here in this section, we develop the resummation formalism for the differential distribution with respect to the rapidity variable }Sd,I in , for thez and rapidity variable y and then the threshold limit is taken only for z, but for rapidity variable y only delta \\documentn-colorless particles in the final state.We have also observed that the coefficients t}DdI in  is exprerelation . Hence w differential soft-collinear operator for the NSV terms turns out to be process dependent. To the end, we have shown that both SV and NSV logarithms can be systematically summed up to all orders both in Having obtained the results for the SV part of coefficient functions, namely hilation  and deeprocesses . Later trocesses . We consument}as , 35. In n-colorless particles. We restrict ourselves to the diagonal coefficient functions (dCFs). For the diagonal channels, it is straightforward to show that the NSV terms in dCFs arise only from diagonal partonic sub processes and diagonal part of mass-factorization kernels. The pure virtual part of the partonic sub-processes does not contain any NSV terms and hence can be factored out from them. Hence, in the mass factorization formula, we need to keep both SV as well as NSV terms in N space. To end, we obtaindifferential soft-collinear operatork by studying the dimensionally regularised Feynman integrals that contribute partonic cross sections in fixed order perturbation theory. We know that z space result in the case of SV part [In the following, we apply the same formalism to study the NSV logarithms present in the rapidity of a state of rd order , 54. Receduce to  with theithms in , 39) an ann-cologiven in , 54 and  SV part , 16, 19  time in , that arained in  using thained in  and alsoained in . For theained in  using thwith the  for termfound in . The genve loops \u201373. The found in . For comz space result for coefficient functions expressed in the integral representation in  initiated processes. For the NSV, we find that a part of the soft-collinear functions is partially determined by universal anomalous dimensions and the remaining part depends on the underlying hard process. However, for a given process, the resummed results either in z or In summary, thanks to the remarkable simplification of mass factorised formula for the rapidity distribution for diagonal channels and the knowledge of logarithmic structure of differential soft-collinear distribution and the mass factorization kernels from fixed order results, we can systematically resum both SV and NSV terms in n-number of colorless particles in the hadronic collision within the realm of perturbative QCD.In today\u2019s era reducing the theoretical uncertainties remain one of the main motivations for higher order radiative corrections. It is also particularly relevant for constraining beyond SM scenarios and validation of the SM itself. Among several observables, differential cross-sections allow a wider range of comparisons with the experiment and hence several attempts were made in the past for better theoretical understanding of the same. In this article, we restrict ourselves to the discussion of differential rapidity distribution for the production of y, for the production of n-colorless particles in the hadron collider. The infrared structure of rapidity distribution which was earlier studied in Ref.\u00a0[N-th Mellin moment of the differential distribution has a relation with its inclusive counterpart in the limit goal of this current article is to present the general structure for the SV differential rapidity distribution up to Through this publication, we intend to present a systematic framework for the study of soft-plus-virtual corrections to the differential distribution with respect to the rapidity variable  in Ref.\u00a0 for Suda through . The mern-colorless final states, one merely requires the form factor corresponding to the hard process under study provided the soft-collinear distribution for Sudakov type process is known. We present the analytical results for the fixed order up to In summary, in order to obtain the fixed order as well as resummed prediction for the differential rapidity distributions of a generic"}
+{"text": "The multifunctional role of the human skin is well known. It acts as a sensory and immune organ that protects the human body from harmful environmental impacts such as chemical, mechanical, and physical threats, reduces UV radiation effects, prevents moisture loss, and helps thermoregulation. In this regard, skin disorders related to skin integrity require adequate treatment. Lipid nanoparticles (LN) are recognized as promising drug delivery systems (DDS) in treating skin disorders. Solid lipid nanoparticles (SLN) together with nanostructured lipid carriers (NLC) exhibit excellent tolerability as these are produced from physiological and biodegradable lipids. Moreover, LN applied to the skin can improve stability, drug targeting, occlusion, penetration enhancement, and increased skin hydration compared with other drug nanocarriers. Furthermore, the features of LN can be enhanced by inclusion in suitable bases such as creams, ointments, gels , lotions, etc. This review focuses on recent developments in lipid nanoparticle systems and their application to treating skin diseases. We point out and consider the reasons for their creation, pay attention to their advantages and disadvantages, list the main production techniques for obtaining them, and examine the place assigned to them in solving the problems caused by skin disorders. Skin diseases cause significant discomfort to millions of people around the world daily. Various studies show that between 30 and 70% of the world\u2019s population suffers from skin diseases . In mostThis review focuses on the recent advances of lipid-based nanosystems in the treatment of skin disorders. We discuss the most common types of lipid-based nanocarriers researched for dermal drug delivery and used for the treatment of skin disorders by incorporation into appropriate dosage forms, namely: Nanovesicular carriers, lipid nanoparticulate carriers, microemulsions, and nanoemulsions. The considered compositions are intended principally for local treatment and are an attempt to reflect the current picture of development in this field.The skin is the largest metabolically active organ of the human body. Its vital functions include protection from external environmental threats, vitamin D synthesis, and the maintenance of the body\u2019s dynamic balance ,8,9. MorIn short, the skin consists of three main layers\u2014epidermis, dermis, and hypodermis (subcutaneous fat tissue) .The superficial part of the skin is called the epidermis. In essence, it is a laminar, squamous corneal epithelium composed mostly of two types of cells: Keratinocytes and dendritic cells (antigen-presenting cells) .The epidermis consists of five layers\u2014the stratum corneum, stratum lucidum, stratum granulosum (granular ply), stratum spinosum (spinous ply), and stratum germinativum  . No bloostratum corneum (SC) (10\u201320 \u00b5m), plays a fundamental role as the body\u2019s first and main physical skin barrier from external menaces [The outermost sublayer of the epidermis, named  menaces ,20,21. I menaces . The SC  menaces . The strThe permeation of matter through the SC is possible primarily through passive diffusion in three ways: Transcellular (the bulk of flux), intercellular, and appendageal ,25,26. FKeratinocytes, melanocytes (melanin producers), Merkel cells (sensory receptors), and Langerhans cells (immunocompetent cells) are epidermal formations\u2014essential for the skin\u2019s vitality . In addiThe skin can be affected by various pathological changes, i.e., inflammatory, neoplastic, traumatic, hormonal, degenerative, and even hereditarily determined . InfectiIn practice, most of the skin disorders are complicated, polygenic, and multifactorial . This inThe human skin creates a vast opportunity for drug delivery application. In general, dermal  and transdermal skin drug delivery can be differentiated. Dermal delivery is the application of the drug directly at the place of action\u2014on the skin\u2019s surface. Transdermal drug delivery is an alternative, painless, and non-invasive approach used to deliver drugs for therapeutic use .Many conventional topical preparations are intended for topical delivery of the drug and not for systemic action. This skin preparation delivers a concentrated amount of the active ingredient for absorption via the application layer . In addiSome of the commonly used therapeutic solutions are listed in For chronic inflammatory skin diseases, a topical treatment is often not too efficient. Therefore, more efficacious medicinal products (MP) are given systemically, where they can be immunosuppressive, and their long-term usage is not recommended as they suppress the affected area .A large part of therapeutic indications is treated by MP, which are intended for topical administration . These MThe barrier function of the targeted biologic membrane provides a significant challenge for optimal therapy. The efficacy of drug delivery and the therapeutic effect depend mainly on the diffusion affinity of the drug substance and the interaction between the excipients of the formulation and the membrane components. Therefore, the conducive balance between potency and deliverability has to be ensured through the design and development of a delivery system to reach optimum therapeutic levels at the site of infection .Biologics have become increasingly popular as a targeted treatment. Biologics are products composed of sugars, proteins, nucleic acids or complex combinations of these substances. Several biologics that target specific subgroups of cells in the skin have been tested .Empirical experience shows that conventional topical preparations suffer from certain limitations and are compromised in patient compliance, safety, and efficacy of therapy . AgainstAn inventive strategy for improving the penetration of molecules through the epidermal barrier is the application of nanocarriers due to the advantage of their lipophilicity, which mediates the passage through the intact lipid layer. The use of lipid nanoparticles in dermal formulations provides several benefits: Chemical protection of the incorporated drug molecules, application to the skin of labile drug substances, improved bioavailability of drugs, and the ability for better release by provision penetration and retention in the skin .Lipid-based nanosystems have proven to be suitable for dermal carriers due to their biocompatibility, efficient delivery of active ingredients, and stability. In addition, their enhanced surface leads to the improved penetration of active ingredients .Lipid-based drug delivery systems (LBDDS) are formulations containing a dissolved or suspended drug substance in lipidic excipients . LBDDS aLiposomes  are considered to be the first generation of nanovesicular carriers. They are small artificial vesicles of the spherical shape created from cholesterol and natural, non-toxic phospholipids with an enclosed inner aqueous core . There aThe second generation of nanovesicular carriers\u2014transfersomes were developed in 1992 by Cevc et al. They are modified liposomes with an average diameter below 300 nm and contain an edge activator that makes transfersomes nearly eight times more flexible than the conventional liposomes ,86,87. EThe usefulness of different lipid vesicles prompted researchers to experiment with modifications to give them specific structural or application properties . HoweverAnother nanovesicular carrier widely used for dermal drug delivery is called niosomes, with an average particle size between 50 and 200 nm . These aPsoriasis is a skin disorder characterized by impaired epidermal differentiation, commonly treated by systemic methotrexate, an effective cytotoxic drug. Abdelbary and Abou Ghaly generated topical methotrexate-loaded niosomes for the influence on psoriasis . A thin-Perez et al. prepared ultra-deformable liposomes containing amphotericin B to treat cutaneous fungal infections and leishmaniasis . LiposomGarg et al. developed ethosome-based nanohydrogel formulations of methoxsalen to effectively treat vitiligo with enhanced topical delivery . The foracne vulgaris include:propionibacterium acnes bacteria in pilosebaceous units of the skin;The proliferation of Local inflammation .The two main processes that are typical for propionibacterium acne [\u00ae.Traditional topical anti-acne compositions mainly cause burning, erythema, photosensitivity, scaling, and bacterial resistance . In 2008ium acne . The eth\u00ae [Acyclovir has been investigated for the topical treatment of viral infections for more than four decades . In 1999\u00ae . Recentl\u00ae . The surIn the experimental work, Babaie et al. prepared lidocaine-loaded nanoethosomes for penetration into the deep strata of the skin with a particle size around 100 nm . IncreasIn 2005, Godin et al. developed an ethosomal system for the dermal delivery of antibiotics to improve their penetration through the SC and the bacterial membrane/cell wall ,143. In A report by Cosco et al. represented the formation of transfersomes for the combined delivery of resveratrol and 5-fluorouracil. The co-encapsulation of the drugs synergistically improved their anti-cancer activity on skin cancer cells .Solid lipid nanoparticles (SLN), as well as nanostructured lipid carriers (NLC), are extensively employed in cutaneous delivery systems. Since their creation in the nineties, lipid nanoparticles (SLN and NLC) are well known by the research and pharma technology community. Easily available raw materials, relatively simple production methods, biocompatibility, and non-toxicity as their advantages over other colloidal carriers can be mentioned as the main reasons for this .Therefore, these two types of lipid nanoparticles\u2014SLN and NLC, are classified according to their structure. First, SLN are developed with a composition of solid lipids only. Then, to upgrade to SLN, NLC were created by representing a mixture of solid and liquid lipids, with a predominant solid lipid .\u00ae from Dr. Rimpler GmbH  and Nanobase\u00ae from Yamanouchi  [The dermal use of SLN and NLC is proving to be one of the most convenient for therapeutic and cosmetic purposes, despite various applications to date. Lipid nanoparticles are aqueous dispersions with low viscosity for successful direct application to the skin, which implies their incorporation in semisolid systems based on SLN or NLC. One of the first successful administered and marketed products based on NLC is Cutanova, Japan) .Generally speaking, SLN are nanometric colloidal carriers composed of a solid lipid core with an incorporated active pharmaceutical ingredient(s) (API) and a surfactant-stabilized shell ,178,179.The second generation of lipid nanoparticles\u2014NLC, are composed of a mixture of solid lipids and liquid lipids in the nanocore, usually in a ratio of 7:3 to 9:1 . This leHot homogenization\u2014the lipids are heated above their melting point;Cold homogenization\u2014takes place at low temperatures and is suitable for hydrophilic and temperature-sensitive API ,187.The literature describes a significant number of production methods and many different combinations of lipids to obtain SLN and NLC. Nevertheless, the most common technique used today is high-pressure homogenization (HPH). The procedure is divided into two stages:Other commonly used techniques are: Sonication/ultra-sonication ,189, memIn dermal applications, SLN and NLC create a thin hydrophobic monolayer during skin contact, which has a pointed occlusive effect that settles the API penetration and prevents water loss from the skin .When applied topically, the lipid nanoparticles interact with the sebum and specific skin lipids, provoking a change in the natural arrangement of corneocytes. As a result of this interaction, the encapsulated molecules are released, and their penetration into the lower layers of the epidermis and dermis is potentiated, depending on their lipophilicity, of course .Okonogi and Riangjanapatee formulated NLC loaded with lycopene through a hot HPH. It has been found that the NLC with the highest concentration of lycopene had the slowest release rate and better antioxidant activity .In another study, Shrotriya et al. reported the development of SLN loaded with resveratrol (entrapment efficiency of 86\u201389%) to treat irritant contact dermatitis (chronic skin disorder with eczematous injuries). The composition was realized by incorporation into a Carbopol gel and showed increased antioxidant activity compared with a conventional resveratrol gel .Furthermore, Montenegro et al. designed a novel Idebenone (IDE)-loaded NLC containing tocopheryl acetate (VitE) as a liquid component to obtain a synergic effect between IDE and VitE .Pivetta et al. formulated NLC with thymol for the local treatment of inflammatory skin diseases (entrapment efficiency of 89%). The NLC were incorporated into a gel and showed anti-inflammatory activity and healing of induced psoriasis in mice .Gad et al. reported the encapsulation of chamomile oil in SLN for the local treatment of wounds. The composition contained stearic acid and chamomile oil and was prepared by the method of hot homogenization. Wound reduction was shown in the topical application in rats .Butani et al. developed a stable SLN system, containing amphotericin B with an enhancing antifungal activity (entrapment efficiency of 94%). The formulation indicated higher drug permeation and drug accumulation in the skin than the conventional gel in rats. A solvent diffusion technique was used for the preparation of the SLN .NLC, for the treatment of candidiasis with Mediterranean essential oils and clotrimazole, were designed by Carbone et al. As a result, they are obtained as a stable NLC, without an initial burst effect and with prolonged release of clotrimazole, as well as an enhanced antifungal activity .Tretinoin-loaded NLC with anti-aging and anti-acne activities were reported by Ghate et al. The hot melt probe sonication and hot melt microemulsion methods were used to prepare the NLC. The tretinoin-loaded NLC in Carbopol gels showed no irritation or erythema after the application in rats .Malik and Kaur developed the azelaic acid-loaded NLC, prepared by the melt emulsification and ultra-sonication method (entrapment efficiencies greater than 80%). NLC were incorporated into aloe-vera-based Carbopol hydrogels and demonstrated a deeper skin penetration than the commercial product (Aziderm 10%). Furthermore, the in vivo experiment in mice showed a higher effect of NLC incorporated into a gel than the plain drug suspended in the gel .In general, microemulsions and nanoemulsions are dispersion systems composed of two immiscible liquid phases that can penetrate deeper levels of the skin . EvidencIt has been found that microemulsions are spontaneously formed, transparent, and isotropic thermodynamically stable dispersion systems. The composition of the droplets is carried out by the precise mixing of volumes of immiscible liquids  and the interfacial film of stabilizing surfactants at specific pressures and temperatures . Short aOil-in-water (O/W) microemulsion;Water-in-oil (W/O) microemulsion;Bicontinuous microemulsion .Three various structural types of microemulsions can be formed:Nanoemulsions typically contain 20\u2013500 nm large droplets and have a different appearance depending on their size. Traditionally, they are stabilized by surfactants and do not change in the long term . HoweverThe clobetasol propionate- and calcipotriol-loaded nanoemulsion gel for the topical treatment of psoriasis is reported, developed, and optimized by Kaur et al. The spontaneous emulsification method was used for the preparation. Compared with the other commercial MP , the nanRecently, Rajitha et al. reported the preparation of loaded nanoemulsion based on chaulmoogra oil, which is based on the self-emulsification method. Compared with the conventional methotrexate solution, the nanoemulsion showed enhanced skin permeation and retention of methotrexate in the deep skin layers .\u00ae cream, the optimized microemulsion-loaded hydrogels showed higher in vitro flux values, higher release rate, and higher in vitro antifungal activity against Candida albicans [In another study, Coneac et al. reported the development of microemulsion-loaded hydrogels for the topical delivery of fluconazole. Nonionic surfactants have been used to stabilize the microemulsions, which then were incorporated in Carbopol gels. Compared with the conventional hydrogel and Nizoralalbicans .Two nanoemulsion systems for the dermal application of natural or synthetic mixtures of pentacyclic triterpenes, with an anti-inflammatory effect, were reported by Alvarado et al. . Slightl\u00ae) [In another study, Goindi et al. reported an ionic liquid-in-water microemulsion formulation that can solubilize etodolac, a poorly water-soluble anti-inflammatory drug. An effective permeation profile, as well as anti-arthritic and anti-inflammatory activities are evaluated in vivo in different models compared with a marketed formulation of etodolac (Proxym gel\u00ae) .Lv et al. reported the preparation of essential oil-based microemulsions for topical application in order to improve the solubility, photostability, and skin permeation of quercetin. First, self-micro emulsifying DDS were prepared and then formed microemulsions. The microemulsions protected quercetin from degradation in an alkaline environment and under UV radiation. In these formulations, the in vitro skin permeation study on rats showed 2.5\u20133 times enhanced permeation capacity of quercetin compared with the conventional aqueous solution .To optimize the percutaneous absorption of lidocaine and prilocaine, Negi et al. formed nanoemulsions using the high-shear mixing method followed by the HPH. The optimized nanoemulsion systems showed higher permeation rates and permeability coefficient values in parallel with the marketed cream and were further incorporated into a Carbopol hydrogel. In addition, the nanoemulsions and the nanoemulsion gel had a stronger anesthetic effect in vivo than the commercial product .\u00ae for the accompanying therapy of skin carcinomas. Different preparation methods were used. The technique, combining a single-phase in-version temperature homogenization method with ultrasonication, produced a stable Tocomin\u00ae-loaded nanoemulsion, which demonstrated an exceeding cytotoxic profile against two human cutaneous carcinoma cell models [In the last few years, Pham et al. developed a nano-emulsification approach to optimize the incorporation of Tocominl models .The size of Global Topical Drug Delivery Market was estimated at USD 95.08 billion in 2020 and expected to reach USD 101.10 billion in 2021 and USD 140.01 billion by 2026. The current market situation  for the topical skin products, shows domination of generic products\u2014about 74% of all the approved topical products are generic equivalents of reference medicines (RLD). According to the collected data, gels, creams, ointments, lotions, and solutions dominate the market for both topical reference and topical generic products. The available semi-solid, solid, and liquid topical products contain different combinations of surfactants, oils, water, colloidal, and solid ingredients in solutions or dispersions .Specific needs of skin, affected by inflammation, acne, or infections require adequate drug therapy with appropriate topical dosage forms. For example, the adhesive patch can provide a sustained and controlled release, while the gel can provide a faster and more intense action. On the other hand, some topical dosage forms may not be most suitable for application to certain areas of the skin, around the eyes, for example .One of the most important considerations in the development of the topical dosage forms is the patient need. The second consideration is the drug\u2019s physicochemical properties. In general, regulatory procedures for the registration of topical products are slow, as clinical equivalence studies  involve a high number of participants, require time and significant costs to ensure a sufficiently objective assessment of the final therapeutic effect. Technological or cost problems are among the reasons for additional difficulties in the implementation of promising dermatological products .Precise delivery across the skin and to certain skin strata, depending on the final target;Successful elimination of lipid nanomaterial toxicity threats in topical medical formulations and cosmetics;Ensuring improved permeation and low skin irritability as a result of the use of lipid nanocarriers;Improved cutaneous release of incorporated API with a broad spectrum of physiological and physicochemical properties.It can be generalized that the main challenges in the development of cutaneous lipid nanometric delivery systems include:Lipid nanoparticulate DDS can be employed intensively for the delivery of phytomedicines intended for topical administration. The approach can be promising in this regard, considering the difficulties in their delivery which is caused by their physicochemical properties.The formulation of phytopreparations with lipid nanoparticles would find a useful application in nanomedicine at the desired targeted delivery, for example, in cancer treatments.Skin disorders represent a progressively emerging clinical public health problem. Treatment strategies based on conventional formulations are non-specific and can lead to considerable systemic toxicity. The progressive approach of the use of lipid nano-formulations as skin drug delivery systems can provide an incomparable prospect for the application of highly competent and safe treatments with the improved benefit-risk ratio.The use of lipid nanoparticlulate DDS is favored recently due to the GRAS status of the excipients. Lipid nanocarriers can effectively protect the API from degradation on the skin\u2019s surface, increase their concentration gradient in the upper skin layers, and enable gradual release. Lipid nanoparticles for topical application could be formulated with the high content of lipid matrix or dispersed in different foundations.Lipid nanosystems provide a promising, flexible platform for the safe, effective, and biocompatible topical delivery of the API, as they do not cause cytotoxicity or morphological changes in the skin layers. The interest shown by pharmaceutical scientists, in the development of lipid nanoparticle delivery systems, may offer a future that provides sufficiently efficient lipid nanoparticle products for needy users."}
+{"text": "Adrenomedullin (AM) has high expression in the spinal cord. In this study, we investigated the expression of AM and its receptor components, including calcitonin receptor-like receptor (CLR) and receptor activity modifying proteins (RAMPs) in dorsal root ganglion (DRG) and spinal motor (SM) neurons. Furthermore, the effects of AM on cAMP/cAMP response element-binding protein (CREB), AKT/glycogen synthase kinase-3 beta (GSK-3\u03b2) signaling pathways, and expressions of brain-derived neurotrophic factor (BDNF) and neurotrophin-3 (NT-3) were evaluated. Rat embryonic DRG and SM neurons were isolated, purified, and cultured. Real-time PCR was used to assess expressions of AM, CLR, and RAMPs. cAMP levels, p-CREB, BDNF, and NT-3 were determined using an enzyme-linked immunosorbent assay. p-AKT and p-GSK-3\u03b2 levels were determined by western blotting. Real-time PCR showed expressions of AM, CLR, RAMP2, and RAMP3 in both DRG and SM neurons. AM increased cAMP accumulation and p-CREB levels in DRG and SM neurons. AM increased p-AKT and p-GSK-3\u03b2 in DRG, but not SM neurons. AM significantly increased BDNF expression in both DRG and SM neurons. There was also an increase in NT-3 level in both DRG and SM neurons, which is statistically significant in SM neurons. These results showed both DRG and SM neurons are targets of AM actions in the spinal cord. An increase in BDNF expression by AM in both DRG and SM neurons suggests the possible beneficial role of AM in protecting, survival, and regeneration of sensory and motor neurons.  However22\u201352 -8. Anima22\u201352 , formali22\u201352 , capsaic22\u201352 , suggest22\u201352 . cAMP/pr22\u201352 , stimularalgesia . Brain-derived neurotrophic factor (BDNF) and Neurotrophin 3 (NT-3) are members of the neurotrophins family, essential for the growth, differentiation, and survival of neurons via activating tropomyosin receptor kinase receptors. BDNF is normally expressed in DRG neurons as well as sensory and motor neurons of the spinal cord. BDNF expression increases in the DRG and sensory neurons in response to various nociceptive stimuli, suggesting its role in pain processing . Motor nTo the best of our knowledge, no study has addressed the expression of AM and its receptor components, including CLR and RAMPs in the motor neurons of the spinal cord, yet. Herein, we evaluated and compared the expression of AM, CLR, and RAMP2-3 in dissociated rat DRG and motor neurons. We also investigated the effects of AM on the activation of cAMP/CREB and AKT/GSK-3\u03b2 pathways in both DRG and motor neurons and the expression of BDNF and NT-3. ChemicalsRat AM and AM 22-52 were obtained from Bachem Americas, Inc. . All chemicals and western blot materials used in this study were obtained from Sigma-Aldrich, Santa Cruz, and Abcam. ELISA kit was obtained from Promega.Animalsad libitum under a 12 hr light/dark cycle. On day 14\u00a0rats were decapitated after CO2\u00a0inhalation.\u00a0All experimental protocols were performed in accordance with the National Institutes of Health Guide for Care and Use of Laboratory Animals and were approved by the Medical and Research Ethics Committee of the Shiraz University of Medical Sciences, Shiraz, Iran. Female Sprague-Dawley rats, weighing 200\u2013250 g (n=120), were provided by the Laboratory Animal Center of Shiraz University of Medical Sciences, Shiraz, Iran. Rats were mated, and detection of the vaginal plaque was considered the first day of pregnancy. Rats were housed 4 to a cage in transparent cages (59\u00d738\u00d720 cm) and received water and food Isolation and culture of embryonic rat DRG and SM neurons et al.  and uridine at a final concentration of 20 mM for 72 hr. Anti-\u03b2 III-tubulin  monoclonal fluorescent antibody and DAPI staining were used to determine the purity of the DRG neurons . Three distinct cellular layers  were separated  and uridine at a final concentration of 20 mM for 72 hr  t values of two genes were calculated as the percentage or fold difference compared with control.The expression of AM, CLR, RAMP2, and RAMP3 was measured using quantitative real-time PCR. Briefly, total RNA from DRG and SM neurons were extracted, using BIOZOL-RNA; RNA extraction reagent , and the cDNA was synthesized by a cDNA Synthesis Kit , using the manufacturers\u2019 instructions. SYBR Green Real-time PCR  was conducted to determine gene expressions of AM, CLR, RAMP2, RAMP3, and \u03b2-Actin, using specific primers . Each gecAMP assay \u221211 to 10\u2212 6 M) in the presence or absence of AM receptor antagonist (AM 22-52) for 10 min before terminating the reaction by adding ice-cold ethanol (100%). The cells treated with adenylyl cyclase activator, forskolin (1 \u03bcM), served as the positive controls. The cAMP level was measured by a specific ELISA kit  and in accordance with the manufacturer\u2019s instructions.To evaluate AM\u2019s effect on cAMP accumulation , DRG andQuantification of phosphorylated-CREB (p-CREB) in DRG and SM neuronsThe aforementioned protocol  was used to determine AM\u2019s effect on the level of p-CREB/CREB. Briefly, DRG and spinal cells were incubated with AM (25 nM) for 20 min. The p-CREB (Ser133) level was assayed in the cell lysate by DuoSet IC Phospho-CREB (S133) ELISA kit (R&D Systems). Western blot \u00b0C for 5\u202fmin, the proteins (20 \u00b5g) were separated by 12.5% SDS\u2013polyacrylamide gel electrophoresis (SDS-PAGE) and transferred to nitrocellulose membranes. Non-fat dry milk (5%) and TBST  were used as blocking buffer (1 hr at room temperature). Incubation with primary antibodies was performed overnight at 4 \u00baC. HRP-conjugated secondary antibody  was applied for 2 hr at room temperature. Washing with 1\u00d7TBST was performed before adding primary and secondary antibodies. Enhanced chemiluminescence (ECL) reagent (ab133406) was finally added to the membranes for 5\u202fmin. The ChemiDoc TM MP System  was used to visualize the bands. Protein expression was estimated by the dosimetry software Image Lab (Bio-Rad).Western blotting was used to detect AKT , p-AKT (Ser 473) , GSK-3\u03b2 , and p-GSK-3\u03b2 (Ser 9) . \u03b2-Tubulin  was used for normalization. The protocol was conducted as previously reported . NP40 lyEnzyme-linked immunosorbent assayBDNF and NT3 concentrations were measured using ELISA kits . Total protein was measured by the Bradford method. Results were normalized to the total protein concentration.Statistical analysispost hoc analysis. Differences were considered significant at P<0.05. pro-BDNF protein expression\u2019s densitometric data were analyzed using the Mann Whitney U test, and P<0.05 was considered a significant difference between the groups. EC50 antagonist/EC50 agonist was calculated by plotting sigmoidal concentration-response curves. The pA2 values were calculated by log[antagonist] - log(EC50 antagonist/EC50 agonist - 1).Graph pad Prism program  and SPSS software (version 21) were used for statistical analysis. Data are presented as mean \u00b1 SEM. Differences between groups were assessed by ANOVA followed by the Student-Newman-Keuls Purification and culture of DRG and spinal motor neurons . To prepare DRG neurons\u2019 culture, DRGs were isolated from rat embryos  in DRG and SM neurons. The data revealed expressions of AM, CLR, and RAMP-2 and -3 in both neurons . No signCharacterization of AM receptors using the cAMP assay50=85.76 nM) and SM neurons (EC50=103.3 nM). The peak of cAMP levels was observed at 1 \u03bcM AM, which were 16.6 and 9.5 times higher than the basal levels in DRG and SM neurons, respectively , an adenylyl cyclase activator, significantly elevated cAMP accumulation in both DRG (54.04\u00b10.7) and SM neurons (53.62\u00b145). AM increased cAMP accumulation dose-dependently in both DRG   and p-GSThe effects of AM on BDNF and NT3 expression in DRG and spinal motor neurons To investigate the effects of AM on expression of BDNF and NT3, DRG and SM neurons were treated with AM (25 nM), and the levels of these proteins were measured using specific ELISA methods. The result of ELISA showed a significant increase in the BDNF protein level in both DRG and SM neurons after treatment with AM (25 nM) . There w50=85.76 nM) and SM neurons (EC50=103.3 nM) in a manner that was sensitive to antagonistic effects of AM22-52, suggesting receptor-mediated AM effects. Furthermore, the p-CREB level increased in response to AM treatment, suggesting the cAMP/CREB signaling pathway\u2019s possible role in AM-mediated effects in both DRG and SM neurons. An increase in phosphorylated AKT/GSK-3\u03b2 following AM treatment suggests that this pathway might also be involved in AM effects in DRG neurons but not in SM neurons. The expression of BDNF increased in both DRG and SM neurons following treatment with AM. As far as we know, this is the first report on AM expression and function in the SM neurons. In the present study, the data revealed expression of AM and its receptor components, CLR and RAMP-2 and -3, in both DRG and spinal motor neurons. Dose dependently, AM increased cAMP accumulation in both DRG  and p-CREB level in the DRG neurons. Similarly, AM increased cAMP accumulation (EC50=103.3 nM) and p-CREB level in the SM neurons. These effects were antagonized by AM22-52, a selective antagonist for AM receptors  and SM neurons (EC50=103.3 nM), suggesting the presence of various kinds of receptors with different affinities for AM in DRG and SM neurons. Finally, although the expression of AM receptor components was not significantly different at the mRNA level in the DRG and SM neurons, however, the expression of these components may differently be regulated at the protein and post-translational levels in the DRG and SM neurons, leading to formation of AM receptors with various affinities that activate various signaling pathways. It was reported that activation of the AKT/GSK-3\u03b2 signaling pathway contributes to the protective effects of AM against apoptosis induced by several conditions, such as hypoxia-induced apoptosis in mesenchymal stem cells , lipopolBNDF and NT3 are normally expressed in both DRG and SM neurons , 48. OurOur findings revealed expression of AM and its receptor components in both DRG and SM neurons. Moreover, AM increased cAMP and p-CREB accumulation in both DRG and SM neurons. AM also induced phosphorylation and inactivation of GSK-3\u03b2 in DRG, but not SM neurons. Finally, AM induced BDNF expression in both DRG and spinal motor neurons. Considering the known activities of BDNF, AM can serve as a protective and surviving factor for both DRG and SM neurons."}
+{"text": "Further, we show that MRGPRX2-containing macropinosomes undergo resolution by a mechanism that involves dynamin and LC3, giving rise to the incorporation of both LC3 and MRGPRX2 into the SGs. SP then promotes the acidification of the LC3-associated SGs, presumably by stimulating their fusion with lysosomes. Taken together, our results reveal a unique mode of MRGPRX2 trafficking that complements endocytosis and involves macropinocytosis, autophagic machinery-assisted macropinosome resolution and receptor delivery to the SGs.MRGPRX2, the human member of the MAS-related G protein coupled receptors (Mrgprs), serves as the cellular target of human mast cells (MCs) for innate ligands, including neuropeptides and antimicrobial peptides. In addition, MRGPRX2 also functions as the receptor for multiple FDA-approved drugs. As such, MRGPRX2 is a mediator of MC responses in neurogenic inflammation, host defense and pseudoallergy. We analyzed the spatiotemporal patterns of MRGPRX2 following its binding of the neuropeptide substance P (SP). Herein, we show that MRGPRX2 internalizes  Taken tIn particular intriguing are the responses of a subset of MCs to a variety of ligands, including neuropeptides, antimicrobial peptides and toxins, that share commonly only their positive charge , 10. MC The cellular functions of G protein coupled receptors (GPCRs) are tightly linked with their cellular positioning. Internalization and post-endocytic trafficking may terminate GPCR signaling or may prolong or diverse it \u201318. Ther\u00ae 488 Goat Anti-Rabbit IgG H&L  and secondary Alexa Fluor\u00ae 647 Goat Anti-Mouse IgG H&L (cat no. ab150115) were from Abcam . Substance P (cat no. S6883), pitstop2 (cat no. SML1169) and saponin (cat no. S4521-25G) were purchased from Sigma-Aldrich . Cytochalasin D (cat no. 1233), dynasore (cat no. 2897) and EIPA (cat no. 3378) were from Tocris Bioscience . Tetramethylrhodamine (TRITC)- labeled 70 kDa dextran was purchased from Thermo Fischer Scientific .Anti-human MRGPRX2 antibody (cat no. 359002) and anti-HA.11 Epitope Tag antibody (cat no. 901513) were from Biolegend . Anti-syntaxin 3 antibody (cat no. ab133750), secondary Alexa Fluorhttp://n2t.net/addgene:21073; RRID : Addgene_21073) and LC3-EGFP-mRFP (ptfLC3) was a gift from Dr. R. Pinkas Kramarski , originally a gift from Dr. Tamotsu Yoshimori . Lifeact-GFP was a gift from Dr. B.-Z. Shilo  and pcDNA3-EGFP-Rac1-T17N was a gift from Dr. Gary Bokoch . pcDNA3-EGFP was a gift from Dr. J. Silvio Gutkind .The following expression plasmids were used in this study: Neuropeptide Y (NPY)\u2013mRFP and NPY Venus were a gift from Dr. U. Ashery , NPY-CFP was a gift from Dr. P. Blinder, . pEGFP-LC3 was a gift from Dr. A. Ashkenazi , originally a gift from Tamotsu Yoshimori  supplemented with 10% FBS , 2 mM L-Glutamine , 100 \u03bcg/mL streptomycin and 100 U/mL penicillin, 12.5 U/mL nystatin  and 1 mg/mL of G418 . LAD-2 cells  were cultured in StemPro-34  supplemented with 1x StemPro-34 Nutrient, 2 mM L-Glutamine , 100 U/mL penicillin and 100 \u03bcg/mL streptomycin , and 100 ng/mL hSCF .RBL cells stably expressing N-terminally tagged hemagglutinin (HA) human MRGPRX2 (RBL-MRGPRX2) were generated as previously described . Cells w7) were transfected with 30-50 \u00b5g cDNA by electroporation at 300\u00a0V for 20 ms, using an ECM 830 electroporator . The cells were immediately replated in either 24-well (1 x 105 cells/well) tissue culture dishes for confocal imaging or in 6-well (0.2 x 106\u00a0cells/well) tissue culture dishes for flow cytometry experiments containing growth medium and used within 20-24\u00a0h after transfection.Transient transfection of RBL-MRGPRX2 cells was performed as previously described . Briefly5 cells/well) were incubated with 0.1 mg/mL of TRITC- labeled 70 kDa dextran  in Tyrode\u2019s buffer  for the desired time periods, without or with 10 \u00b5M SP, in 24-well dishes at 37\u00b0C and 5% CO2. Where indicated, cells were preincubated for 30 minutes (min), prior to SP trigger, with vehicle or with the indicated inhibitor(s). Cells were washed three times with ice-cold PBS and fixed for 20\u00a0min at room temperature (RT) with 4% paraformaldehyde  followed by permeabilization for 15\u00a0min with 0.1% Triton X-100, 5% FBS, and 2% BSA diluted in PBS. Subsequently, cells were labeled with mouse anti-HA (1:100 dilution) antibody for 1 hour (h) at RT, followed by three washes and a 1-h incubation with Alexa Fluor\u00ae 647 Goat Anti-Mouse IgG H&L secondary antibody (1:500 dilution).RBL-MRGPRX2 cells (1 x 105) or LAD-2 (6 x 105) cells were stimulated at 37\u00b0C and 5% CO2, in Tyrode\u2019s buffer for the desired time periods. Cells were then washed three times with ice-cold PBS containing 0.5% BSA and 2 mM sodium azide (FACS buffer) followed by fixation in 4% paraformaldehyde for 15\u00a0min at RT. For analyses of cell surface MRGPRX2, cells were stained for 30\u00a0min at RT with anti-human MRGPRX2 antibody (1:300 dilution). Cells were subsequently washed three times and stained with Alexa Fluor\u00ae 647-conjugated Goat Anti-Mouse IgG H&L secondary antibody (1:2000 dilution) for 30\u00a0min at RT, in the dark. For total receptor expression, cells were washed and fixed for 15\u00a0min at RT with 4% paraformaldehyde. Cells were subsequently washed and permeabilized with 0.1% saponin and 10% FBS containing PBS for 15\u00a0min at RT, after which the cells were washed and stored in the permeabilization buffer overnight at 4\u00b0C. The permeabilized cells were then stained for 30\u00a0min at RT with anti-human MRGPRX2 antibody (1:300 dilution), washed three times with the permeabilization buffer and stained with the secondary antibody as above. Cells were washed three times with FACS buffer and analyzed by flow cytometry using a CytoFLEX LX flow cytometer . A minimum of 10,000 cells was acquired per sample. Cells were gated on single cells and were additionally gated on GFP-positive cells in experiments involving transient transfection with either dominant negative (DN) Rac1-GFP or control GFP. Data was analyzed using the FlowJo\u2122 Software Version 10 .RBL-MRGPRX2 cells were washed three times in Tyrode\u2019s buffer to remove dead, non-adherent cells. RBL-MRGPRX2 (5 x 105) and LAD-2 (0.6 x 105) cells grown on untreated (RBL-MRGPRX2) or fibronectin  coated (LAD-2) 12-mm round glass coverslips  were washed three times in Tyrode\u2019s buffer, the cells were stimulated as indicated in the same buffer at 37\u00b0C and 5% CO2. The cells were subsequently washed three times with ice-cold PBS and fixed for 20\u00a0min at RT with 4% paraformaldehyde  in PBS. Fixed cells were permeabilized for 15\u00a0min at RT with 0.1% Triton X-100, 5% FBS, and 2% BSA diluted in PBS. Cells were then incubated for 1\u00a0h at RT with the desired primary antibodies followed by three washes and a 1-h incubation with the appropriate secondary antibody (1:500 dilution). After washing, cells were mounted in mounting medium  and analyzed with a Leica SP5 or SP8 TCS laser scanning confocal microscope  equipped with a HyD detector and a \u00d763 oil/1.4 NA objective or a Zeiss LSM 710 confocal microscope equipped with a 63 x1.4 oil Plan-Apochromat objective. Colocalization analysis of NPY-CFP with immunostained MRGPRX2 was quantified as the Manders\u2019 correlation coefficient with Costes\u2019 automatic threshold using the JaCoP plugin of the extended ImageJ version Fiji . One-way analysis of variance (ANOVA) with repeated measures followed by Dunnett\u2019s post-test or Student\u2019s or Welch\u2019s t-test was used for comparing means, respectively according to the statistic requirements. Results were considered significant when P values were smaller than 0.05.Given the profound differences between the human MRGPRX2 and its rodent orthologs, we used the RBL-MRGPRX2 cells , that stFurther analysis of the first phase of MRGPRX2 internalization in RBL-MRGPRX2 cells revealed that MRGPRX2 endocytosis was sensitive to pitstop2, an inhibitor of both clathrin-dependent endocytosis and clathrin-independent and Arf6-dependent endocytosis , 27 Fig, signifiCell surface expression of MRGPRX2 was also reduced by dynasore, an inhibitor of dynamin, that executes membrane fission events  , a commonly used probe for measuring macropinocytosis , and comocytosis , 33  mutant of Rac1 [i.e. Rac1(T17N)], a key player of actin rearrangements during macropinocytosis , 35, on We have previously shown that early endosomes fuse with the SGs in MCs , thus prTo further decipher the connection between macropinocytosis and MRGPRX2 trafficking to the SGs, we tested the impact of dynasore, that inhibits endocytosis, on the cellular distribution of MRGPRX2 in the LC3-GFP-expressing cells. Consistent with its profound impact on the macropinosomes\u2019 size (-/NPY+) may still contain LC3-GFP, the fluorescence of which is quenched  and the inhibition of its targeting to macropinosomes by either EIPA or expression of DN Rac1, both known inhibitors of macropinocytosis , and grant 2017182 by the United States\u2013 Israel Binational Science Foundation (to RS-E). PL-H was supported through The American Association of Immunologists Careers in Immunology Fellowship Program. This work was also supported by National Institutes of Health grant R01-AI124182 (to HA).The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest.All claims expressed in this article are solely those of the authors and do not necessarily represent those of their affiliated organizations, or those of the publisher, the editors and the reviewers. Any product that may be evaluated in this article, or claim that may be made by its manufacturer, is not guaranteed or endorsed by the publisher."}
+{"text": "Vaccination is the most effective intervention to prevent influenza. Adults at risk of complications are among the targets of the vaccination campaigns and can be vaccinated with different types of quadrivalent influenza vaccines (QIVs). In the light of assessing the relative immunogenicity and efficacy of different QIVs, a systematic review was performed. Randomized controlled trials conducted in adults aged 18\u201364 years until 30 March 2021 were searched through three databases . Twenty-four RCTs were eventually included. After data extraction, a network meta-analysis was not applicable due to the lack of common comparators. However, in the presence of at least two studies, single meta-analyses were performed to evaluate immunogenicity and efficacy; on the contrary, data from single studies were considered. Seroconversion rate for H1N1 was higher for standard QIVs, while for the remaining strains it was higher for low-dose adjuvanted QIVs. For seroprotection rate, the recombinant vaccine recorded the highest values for H3N2, while for the other strains, the cell-based QIVs achieved better results. In general, standard and cell-based QIVs showed an overall good immunogenicity profile. Nevertheless, as a relative comparative analysis was not possible, further research would be deserved. Influenza is a major cause of disease burden globally . WorldwiTwo influenza A subtypes (A/H1N1 and A/H3N2), and two antigenically and genetically distinct B lineages (B/Victoria and B/Yamagata) are the current seasonal influenza strains circulating since 1985. Both influenza A subtypes and both B lineages co-circulate, and their frequency distribution varies widely by season and geographic region .Influenza vaccination is the most effective intervention available to prevent influenza infection and its complications and represents a major public health initiative .The Advisory Committee on Immunization Practices (ACIP) recommends influenza vaccination to all people aged 6 months and older, without any contraindications .As influenza viruses rapidly mutate, and the prophylactic effects of vaccination wane over time, vaccine formulations are updated each year in compliance with the World Health Organization (WHO) and Committee for Medicinal Products for Human Use (CHMP) recommendations (in the EU) ,5.Up to 2012, influenza vaccines have been produced to protect against three different seasonal influenza viruses, namely A/H3N2, pandemic A/H1N1, and one out of the two influenza B lineages .The first quadrivalent influenza vaccines (QIVs) were licensed in the US in 2012 ,8. CurreEven if it is challenging to compare the immunogenicity and efficacy of different types of influenza vaccines , there aTogether with children aged 6 months\u20135 years, pregnant women, and the elderly, the adult population also represents a target group of influenza vaccination [In adulthood, inactivated QIVs have already been compared with inactivated trivalent influenza vaccines (TIVs) with respect to immunogenicity and safety . NeverthThe systematic review was conducted in accordance with the Preferred Reporting Items for Systematic Review and Meta-Analyses 2020 (PRISMA 2020) guidelines  and regiA comprehensive literature search was carried out from databases\u2019 inception up to 30th March 2021. Medline, Scopus and Cochrane Central Register of Controlled Trials databases were used to identify all the original articles investigating the immunogenicity or the efficacy of any QIV in people aged from 18 to 64 years. The medical subject headings (MeSH) and key words used for the search are reported in the Evaluated any QIV compared to placebo or TIV or another QIV in adults aged 18\u201364 years;Adopted a randomized controlled trial (RCT) study design that compared two or more groups, one of which receiving any QIV as intervention;Issued results on immunogenicity, in terms of seroconversion (SCR) or seroprotection rate (SPR), and efficacy, in terms of laboratory-confirmed influenza.Two authors  screened the articles on the basis of titles and abstracts first, using Rayyan. Any double publication of a study was recorded and thereafter removed. Full texts of potential eligible papers were then obtained and checked for final inclusion according to the inclusion and exclusion criteria. Articles were included if they met the following criteria:The SCR was defined as the percentage of participants with either a pre-vaccination HI titer <10 and a post-vaccination HI titer \u226540, or a pre-vaccination HI titer \u226510 and a 4-fold increase in hemagglutination inhibition (HI) antibodies titer after vaccination. The SPR was defined as the percentage of participants with a HI titer \u226540. If the same study was reported in several publications, we selected the most recent publication. Reviews and meta-analyses were excluded. Disagreements were resolved by discussion or in consultation with a third author (CdW or MC).For each included study, two authors  independently carried out data extraction and quality assessment. From each included study, the following information was extracted: first author\u2019s last name, year of publication, trial status, country, study population, population characteristics , participants in the experimental and control arms (number and characteristics), type of intervention, type of control, study endpoints with definition, and results for each endpoint stratified by influenza strains . Data on immunogenicity and efficacy, referring only to adult populations, were extracted from per protocol populations. For studies with missing or incomplete information, authors were contacted. If attempts to contact authors were not successful, such studies were excluded from the quantitative analyses. If raw data were not available, they were calculated from the percentages reported in the study.The study quality was assessed through the Cochrane Risk of Bias Tool (RoB-Tool 2)  by two aThe NMA was carried out using the Markov Chain Monte Carlo engine WinBUGS free software if the assumption of transitivity was satisfied . In the Results were reported as percentage with 95% confidence intervals (95% CI); the width and potential overlaps of 95%CI were considered to elaborate on the comparisons among QIVs.2) method [2 was <25%, and the fixed-effect model was then applied. In case of moderate (25\u201350%) and high heterogeneity (>50%), the random-effect model was used.Meta-analyses were performed using StatsDirect statistics software version 3, and a fixed- or random-effect model was used to pool data based on the assessment of heterogeneity. Heterogeneity was measured using Cochran-Q test and inconsistency index (I) method ,20. An i) method . Low hetFrom the literature search through Medline (n = 518), Scopus (n = 1090) and Cochrane (n = 757) databases, and after removing duplicates n = 930), we identified 1435 records for title and abstract screening . Among t, we idenAmongst the included studies, all RCTs have been completed. Eleven studies 45.8%) were published between 2011 and 2016 ,30,31,32.8% were As far as the intervention was concerned, 14 studies (58.3%) assessed the standard-dose egg-based QIVs ,41,43,44The control arm received the analogous TIV except for two studies on recombinant QIVs that compared it with the standard-dose egg-based QIVs ,35, and All the studies evaluated the SCR. The serological outcome was determined by HI assay at 21\u201328 days after vaccination. The SPR was evaluated in most studies, excluding Dunkle et al.   and reported by only two studies ,45. The Nineteen studies (79.2%) had a low risk of bias ,41,43,45The assumption of transitivity was not satisfied and the NMA was not applicable.As far as the meta-analysis of immunogenicity and efficacy endpoint was concerned, 14 studies on the standard-dose egg-based QIV, and 2 on the cell-based QIV were considered for both SCR and SPR. For the latter, two studies on the live attenuated QIV were also considered for meta-analysis. For other QIVs, data extracted from single studies were reported . The comThe SCR for strains A/H1N1 ranged from 5% for live attenuated QIVs to 65% for standard-dose egg-based QIVs, whereas values for A/H3N2 ranged from 5% for live attenuated QIVs to 66% for low-dose adjuvanted QIVs; for B/Yamagata strain, SCR ranged from 9% for live attenuated QIVs to 79% for low-dose adjuvanted QIVs; eventually, for B/Victoria strain, SCR ranged from 10% for live attenuated QIVs to 65% for low-dose adjuvanted QIVs. Looking at the 95%CI, it can be observed that standard-dose egg-based, low-dose adjuvanted, cell-based, recombinant and intradermal QIVs showed similar SCRs with respect to both A strains, apart from cell-based QIVs with respect to H3N2 that showed a lower immunogenicity. With respect to B lineages, results are less conclusive, but it appears that overall low dose adjuvanted QIVs showed a better profile with respect to B Yamagata.Regarding SPR, values ranged from 25% to 98% for A/H1N1, respectively, for live attenuated and cell-based QIVs, and from 26% to 100% for A/H3N2, respectively, for live attenuated and recombinant QIVs. As for B lineage, the lowest values of SPR were observed for recombinant QIV and plant-derived QIV, namely 68% for B/Yamagata and 41% for B/Victoria. The highest values were attained by the cell-based QIVs (99% for B/Yamagata and 98% for B/Victoria). Looking at the 95%CIs, cell-based and recombinant QIVs showed similar SPR with respect to A/H1N1. Low-dose adjuvanted QIVs added to them regarding A/H3N2. With respect to B lineages, low-dose adjuvanted and cell-based QIVs showed similar results. Additionally, the standard-dose egg-based QIVs showed similar results as compared to them with respect to B/Yamagata.With respect to laboratory-confirmed influenza, for plant-derived QIVs, the attack rate in the vaccine group was 4.5% (215/4812), and in the placebo group it was 7.3% (251/4812), with an absolute vaccine efficacy of 38.8% (95%CI 17.9\u201348.7) to prevent influenza caused by any strain and of 35.1% (95% CI 17.9\u201348.7) to prevent influenza caused by vaccine-matched strain. Regarding the recombinant QIV, in the 50\u201364-year-old subgroup, the attack rate was 1.7% for the recombinant QIV group, and 2.9% for the standard QIV control group, leading to a relative vaccine efficacy of 42% (95% CI 15\u201361).Influenza continues to be a major public health problem worldwide, and current influenza vaccines remain a valuable public health tool to counter it.In this regard, the CDC estimated that influenza vaccination averted 60,500 deaths in the United States between the 2010\u20132011 and 2019\u20132020 seasons .In Europe, it is estimated that seasonal influenza vaccination prevents an annual average of 1.6\u20132.1 million cases of influenza, 45,300 to 65,600 hospitalizations, and 25,200 to 37,200 deaths .QIVs have currently replaced TIVs in several countries, but national immunization advisory technical groups do not generally make specific recommendations for the preferential use of one over other. Nevertheless, the assessment of their relative immunogenicity and efficacy could be useful to inform decisions.Our systematic review and meta-analysis collated together immunogenicity and efficacy data of different QIVs. The analysis of data issued by included RCTs basically showed that QIVs have different immunogenicity. In particular, differences can be observed among QIVs in terms of SCR and SPR against the same vaccine strain, but also within the same QIV, with respect to different endpoints and vaccine strains.In general, live attenuated QIVs did not show good immunogenicity, whereas standard-dose egg-based QIVs showed better SCR, and cell-based QIVs showed better SPR for all four strains. In addition, the recombinant QIV induced high SPR for A/H3N2. Actually, the development of vaccines based on recombinant protein and viruses grown on cell lines has been pursued to overcome the problem of mismatch between vaccine and circulating strains, which mostly regards H3N2 strains  and is dIt is known that SCR and SPR are considered by regulatory agencies to decide upon market authorization of influenza vaccines. In fact, the relationship between HI antibody titer and clinical protection has been well-established. In healthy adults, a serum HI titer \u226540 is associated with a >50% reduction in influenza infection or disease and is considered as a surrogate correlate of protection ,50. ThisAccording to the results of our systematic review, and considering that an HI titer \u226540 is considered the best available parameter for predicting protection from influenza infection, it can be said that the cell-based QIVs showed the best immunogenicity profile even though other QIVs, with the exception of the live attenuated, also achieved high SPR with some differences across strains. However, considerations should be given to the criticalities of the evaluation of immunogenicity, such as the low sensitivity to B strains and the high degree of interlaboratory variability . FurtherAs a matter of fact, since 2017, new CHMP guidelines recommended the measurement of neutralizing antibodies in addition to the HI titer and encouraged the assessment of broader immune responses through anti-neuraminidase antibodies, antibody kinetics, and cell-mediated immunity . This isBeyond the assessment of immunogenicity, efficacy and effectiveness data on laboratory-confirmed influenza and influenza-related clinical endpoints could further provide evidence for the relative comparison of QIVs. In this regard, a recent retrospective study assessed the relative effectiveness of cell-based QIVs, compared to the standard egg-based QIVs, among people aged 4\u201364 years in the United States during the 2019\u20132020 influenza season. Results showed that cell-based QIVs were significantly more effective than standard-dose egg-based QIVs in preventing influenza-related and respiratory-related hospitalizations/emergency room visits .In discussing the results of our systematic review, several limitations should be taken in consideration. The most important is represented by the potential heterogeneity among studies due to different influenza seasons and different participants\u2019 history before vaccination. Another relevant aspect is that all the included studies were conducted in the Northern Hemisphere, and this might limit the generalizability of results. Furthermore, even though HI antibody responses were commonly assessed at 21 days post-vaccination, in a few studies, they were assessed at 28\u201330 days post-vaccination.Among the strengths of our systematic review, the following could be included: the search was performed on the most relevant databases, and the selection of studies and data extraction was performed by taking appropriate measures to prevent potential errors. Therefore, selection bias can be ruled out. Furthermore, included studies were mostly at a low risk of bias, and this enables us to consider their results robust.To the best of our knowledge, this is the first study that collates immunogenicity data of the different QIVs that are either in use or under study for the immunization of the adult population. Although a relative comparison among QIVs was not possible, the assessment of SCR and SPR and their 95%CI provides an overview of their respective potentiality in adulthood."}
+{"text": "Tympanometry plays a fundamental role in the identification of middle ear alterations, which are frequent in the population with cleft lip and palate.do a retrospective analysis of the otoscopy and tympanometric exams of infants with cleft lip and palate who were not operated. Retrospective study.we analyzed 273 charts from infants with cleft lip and palate whom, from March 1996 to April of 2002 underwent pneumatic otoscopy and tympanometry with a 226 Hz probe.We did not find statistical significance in the otoscopic and tympanometric findings considering ears and genders. We observed 84% of alterations in otoscopy  and 65% in tympanometric curves (B/38%), A/36.5%, As/21%, C/4% and Ad/0.5%).female and male infants with cleft lip and palate did not differ as far as otoscopic and tympanometry findings are concerned. All types of tympanometric curves were present, and types A and B were the most frequent ones. Ear drum opacification was the most frequent otoscopic finding. Pneumatic otoscopy identified a larger number of alterations when compared to conventional tympanometry. Studies have reported that children with craniofacial anomalies, especially those with cleft lip and palate, have a high incidence of middle ear alterations.5During decades, tympanometry has been a broadly accepted method to assess middle ear functionConsidering the fundamental role played by tympanometry in the identification of middle ear alterations, which have a high incidence in the population with cleft lip and palate, we thought it was necessary to carry out a retrospective study of tympanometric findings in infants with this congenital malformation in order to help characterize the person's audiologic profile.The goal of this study is to carry out a retrospective analysis of the results of otoscopic and tympanometric exams in infants with cleft lip and palate that were not operated.After proper approval by the Ethics in Research Committee (protocol # 140/2005UEPCEP), we carried out a retrospective study of 300 medical charts from infants with a unilateral trans-foramen cleft in the left incisive toothFrom the medical charts we studied data associated with gender, surgical condition, results from tympanometric and otoscopic exams and patient's age at the time of the exams.For the tympanometry, we used the Grason Stadler Middle Ear Analyzer version 2 impedanciometer. The immittance tone frequency was of 226Hz . The tympanometric measures were automatically carried out by the equipment at a speed of 50 deca-Pascals per second (daPa/s). The type of tympanometric curve followed the classification proposed.For the pneumatic otoscopic exams, we used the Heine otoscope (Diagnostik-Otoskope K 100).The exams (tympanometric and otoscopic) were carried out one day before the lip surgery.The otoscopic findings were classified in: without alteration, when through the otoscopy we saw an intact tympanic membrane ; and with alteration, when there was fluid in the middle ear, opacification, retraction and immobility of tympanic membrane during inflation.Tympanometric curves were classified in normal and altered. It was normal when the A-curve was obtained, and altered for the other types found .The data obtained was organized in Tables to facilitate analysis and presentation. We used the chi-squared statistical treatment for the data. The significance level adopted was 1% (p < 0.01).The random choice of medical charts showed that 27 infants had already been submitted to some surgical procedure and were taken off the study, thus making up a study group of 273 infants (546 ears), being that 161 (59%) were males and 112 (41%) were females.The age of the infants at the time of the exams varied between 3 and 5 months.The statistical study did not show significant statistical difference between the genders (p=0.13763) and ears (p=0.58783) for otoscopic findings, as well as for tympanometric curves (p=0.45534) and (p=0.52375), respectively.,,,The results from this study show that tympanic membrane opacification, with or without other alterations, had the higher incidence (83.4%) in the population with cleft lip and palate that we studied. Such otoscopic finding was also noticed in other papers published in the literature.Melker and Harris et al. studied and support the usefulness of pneumatic otoscopy as a low cost and adequate diagnostic tool able to predict the presence of fluid (effusion) in the middle ear, and ear drum positionIn eighty-seven ears (16%) of this present study, no alteration was determined by otoscopy, which can reflect lack of middle ear effusion.In regards of tympanometric exams, 38% (209 ears) of type-B tympanometric curves were identified by tympanometry with a low frequency probe in the present study with infants from three to five months of age with cleft lip and palate and who were not operated. This type of tympanogram is a strong evidence of otitis media with effusionAndrews et al. also identified a type-B curve in 83% of 40 infants with 3 months of age who had cleft palate, however using tympanograms obtained from a high frequency probe.,However, type-A tympanograms, indicating normal middle ear function were also found in 36.5% of the population sampled in the present investigation. An incidence of 64.1% of type-A tympanometric curve was reported by Namyslowski and Kubik in a study carried out with 85 children with cleft palate, using tympanometry with the 226HZ probe.Type As is a curve that presents a reduced maximum compliance peak, seen in middle ears with some fluid or with ossicle fixation, which partially reduces mobilitySeen in only 4% of the infants in our sample, the type-C tympanometric curve, not usually found in patients with cleft lip and palateHarris et al. proved that the types As and C tympanogram curves may be associated with normal middle ear function, as well as the presence of fluid. They also reported that some children with normal low frequency tympanograms had abnormal results found by the multifrequency probe, resulting from monomeric tympanic membranes or mechanical disorders in the middle ear.A low incidence (0.5%) of the type Ad tympanometric curve was seen in our study. In the literature surveyed, this type of alteration was not reported in infants with cleft palate and lip.,,Looking at It is important to highlight that for the tympanometric findings obtained in this study, we used conventional tympanometry, in other words, a low frequency probe (226HZ). Thus, it is highly important to continue this study by making a comparative analysis using the multifrequency probe for tympanometry, to help characterize the audiologic profile of the population sampled, thus contributing to identify the most effective method to be used in the auditory evaluation of infants with cleft lip and palate in their first years of life.Male and female infants with cleft lip and palate were not different in their tympanometric curves, or in their otoscopic findings. All types of tympanometric curves were present, and type A was the most frequently found. Tympanic membrane opacification was the most frequent otoscopic finding. Pneumatic otoscopy identified a greater number of alterations when compared to conventional tympanometry."}
+{"text": "Gestational diabetes mellitus (GDM) plus rectus abdominis muscle (RAM) myopathy predicts long-term urinary incontinence (UI). Atrophic and stiff RAM are characteristics of diabetes-induced myopathy (DiM) in pregnant rats. This study aimed to determine whether swimming exercise (SE) has a therapeutic effect in mild hyperglycemic pregnant rats model. We hypothesized that SE training might help to reverse RAM DiM. Mild hyperglycemic pregnant rats model was obtained by a unique subcutaneous injection of 100\u00a0mg/kg streptozotocin (diabetic group) or citrate buffer (non-diabetic group) on the first day of life in Wistar female newborns. At 90\u00a0days of life, the rats are mated and randomly allocated to remain sedentary or subjected to a SE protocol. The SE protocol started at gestational day 0 and consisted of 60\u00a0min/day for 6\u00a0days/week in a period of 20\u00a0days in a swim tunnel. On day 21, rats were sacrificed, and RAM was collected and studied by picrosirius red, immunohistochemistry, and transmission electron microscopy. The SE protocol increased the fiber area and diameter, and the slow-twitch and fast-twitch fiber area and diameter in the diabetic exercised group, a finding was also seen in control sedentary animals. There was a decreased type I collagen but not type III collagen area and showed a similar type I/type III ratio compared with the control sedentary group. In conclusion, SE during pregnancy reversed the RAM DiM in pregnant rats. These findings may be a potential protocol to consider in patients with RAM damage caused by GDM.  GDM can cause damage to the skeletal muscle and extracellular matrix (ECM) health and function, i.e. maternal hyperglycemic myopathy4. Maternal GDM leads to long-term pelvic floor muscle (PFM) dysfunction and urinary incontinence (UI)7, having pregnancy specific-urinary incontinence as a risk factor5. It is unknown how this link occurs4 and how swimming\u00a0exercise (SE)\u00a0may alleviate this damage in mild hyperglycemic pregnancy (MHP).Gestational diabetes mellitus (GDM) is known as a serious global health problem11. The latter characteristics mimic those found in human hyperglycemic-associated PFM and RAM myopathy and are considered a profile of skeletal muscle injury caused by GDM during pregnancy in humans\u00a013. Despite these observations, the link between GDM and maternal hyperglycemic myopathy remains largely unexplored and without an effective treatment\u00a014.Rat models of MHP also revealed myopathy of the PFM and rectus abdominis muscle (RAM) induced by diabetes (DiM). DiM\u00a0characterized by muscle atrophy, a shift in the maternal fiber type composition, increased collagen deposition, and higher collagen type I/III ratio\u00a018. However, different exercise patterns improve maternal glucose control in some but not all pregnant women with GDM\u00a021. Thus, lifestyle interventions during pregnancy alone may not be sufficient to decrease the risk of developing GDM-associated alterations in maternal health\u00a027.Exercise has beneficial impacts on maternal glycaemia control and several lifestyle interventions have clarified mechanisms underlying GDM for preventing or minimizing this disease\u2019s associated complications\u00a027. In addition, SE and resistance training influence the gastrocnemius and soleus muscles myopathy in rat models of type 2 diabetes mellitus (T2DM)29. However, there is limited evidence describing the effect of SE on diabetic myopathy in GDM\u00a030. There are no studies revealing whether the exercise intervention during pregnancy recovers the muscle damage associated with GDM, even considering the regenerative skeletal muscle fibers potential\u00a031.Considering that pregnant women should avoid high-impact exercises with the risk of falling and with the risk of abdominal trauma, SE is considered ideal for pregnant women. Also, SE in a low-moderate intensity is effective in promoting glycemic control and preventing GDM\u00a0The aim of this study was to determine whether SE has a therapeutic effect in MHP rats model resulting in attenuation of RAM DiM. We hypothesized that SE training would mitigate RAM DiM, thus reversing the RAM injury. A potential reversal of RAM DiM by SE may improve the handling of maternal hyperglycemic myopathy in women that developed GDM.The experimental design included three control groups, i.e., non-diabetic sedentary (NDsed), non-diabetic exercised (NDex), and diabetic sedentary allowing the analysis of the SE intervention in DiM in the authentic study group: the diabetic exercised (Dex). The OGTT showed that Dsed and Dex groups had two or more blood glucose measurements\u2009>\u2009140\u00a0mg/dl. These data confirm that the generation of MHP rats model was efficient, including the animals in the experimental groups. The aquatic exercise practice during pregnancy did not promote changes in blood glucose levels  displays similar fiber area and diameter, slow-twitch, fast-twitch fiber area and diameter, total collagen area and type I/III collagen ratio compared to NDsed group Figs.  and 3.We investigated whether swimming exercise (SE) would alter the RAM DiM\u00a0in rats. This preclinical study of SE started on the first day in MHP rats detailed the reversal of RAM skeletal atrophic and stiff muscle through an integrative morphological, ultrastructural and extracellular matrix (ECM) assessment. The main findings of the present study are as follows: first, the RAM DiM was confirmed, demonstrated by lower total muscle area and fiber diameter and increased type I collagen and type III collagen deposition in Dsed compared with NDsed group. These findings were already reported by our group. Second, SE during the whole pregnancy in MHP rats model reversed the RAM skeletal atrophy through an increase in fiber area and diameter, slow-twitch fiber area and diameter, fast-twitch fiber area and diameter in Dex group compared with NDsed group; and reduction in type I collagen area and type I/III collagen ratio compared with Dsed. Also, the similarity in total collagen area, type I collagen area and type I/III collagen ratio with NDsed rats were demonstrated. The close resemblance between RAM morphological, and ECM profile of MHP rats model submitted to SE (Dex group) and NDsed, suggest that SE since the beginning of pregnancy reversed the DiM. These findings support the hypothesis that DiM is inhibited by 21\u00a0days of SE training program through the entire pregnancy. Indeed, SE training plays a critical role in the reversion of DiM. It may be a sufficient duration and intensity to induce recovery of morphological changes in skeletal muscle.32. The underlying mechanism linking GDM and long-term UI seems to be diabetic myopathy, characterized\u00a0by loss of muscle mass and strength\u00a034. Many clinical and experimental studies have associated both type 1 and type 2 diabetes to muscle structural changes, including a reduction in myofiber and myofibrilar diameter, reduced muscle mass\u00a033, reduced muscle fiber size\u00a035, and decreased capacity to repair from damage\u00a033.Women who develop GDM are more likely to develop type 2 diabetes and UI later in life10 and in urethral striated muscle\u00a09, either in women or in rats\u00a011. These structural harms may be related to functional changes as well as a decline in muscle strength and increased fatigability, which contributes to decreased physical capacity\u00a035. Therefore, this damage to muscles involved in urinary continence may contribute to increased incidence of PS-UI, a predictor of long-term UI in previous GDM women\u00a05. These findings allow us to adopt MHP\u2019 rats model for studying the effects of SE on the RAM fiber-ECM structure, as it mimics GDM in women\u00a011. Therefore, further study is necessary to elucidate the influence of exercise types and duration on the muscle fiber cross-sectional area of MHP rats' skeletal muscle.MHP\u00a0rats is an experimental model that induces structural changes including reduced muscle area and increased slow-twitch fiber in pregnant rats in RAM\u00a037.SE started at the first day of pregnancy in MHP rats may be considered a preclinical study being developed as a prevention strategy of hyperglycemia in pregnancy for long-term UI. Our intention was for longer-lasting interventions leading to significant downstream impact in promoting long-term women\u2019s health. The goals of this early intervention program in pregnancy are related to improving future maternal health in GDM women, one of the United Nation\u2019s Eight Millennium Development Goals (MDGs)\u00a037. However, there are few studies evaluating the impact of hyperglycemia in pregnancy on structural muscles damage involved in urinary continence. This study tested the hypothesis that SE daily, since the beginning of pregnancy in MHP rats could act as a protective non-pharmacological intervention, so we studied its effects on RAM muscle looking at the reversal of muscle atrophy and stiffness.Pregnancy is the center of a program established by the International Federation of Gynecology and Obstetrics (FIGO) in the Non-Communicable Disease (NCD)\u2014as early as possible but focusing on the first-trimester and follow-up post-pregnancy for mother and offspring, leading to prevent NCD. Pregnancy, in particular the first trimester, receive not only substantial attention but also many points of intervention, from pre-conception to postpartum\u00a038. The results of this study revealed that SE daily, since the beginning of pregnancy in MHP\u00a0rats, reverses the muscle atrophy caused by the maternal hyperglycemia environment. In short, these findings indicated that SE could reverse muscle atrophy in MHP rats, back into the NDsed group profile. In contrast, sarcomeres disruption areas were observed in both diabetic groups, which means that exercise had no impact on this parameter. Previous results demonstrate that RAM exposed to a hyperglycemic environment is characterized by a decrease in the number and area of the fast fiber and an increase in the number of slow fibers\u00a010. In our study, daily SE during all pregnancy had an effect not only on increasing fast-twitch fiber area and diameter but also on slow-twitch fiber area and diameter of RAM muscle in both exercised groups.Increased muscle fiber cross-sectional area, fiber area and diameter in RAM of diabetic pregnant rats after 21\u00a0days of SE is similar to the reported after 8\u00a0weeks of aerobic training\u00a039. Different SE modalities increased diameter of both slow-twitch and fast-twitch fibers on gastrocnemius and soleus muscles in the type 2 diabetes animal model\u00a028. Thus, the high slow-twitch fiber area and diameter in the RA muscle of both exercised groups regardless of diabetes and high fast-twitch fiber area and diameter in diabetic exercised rats could be attributed to physiological adaptations from aerobic exercise during the whole pregnancy. Consistent with previous studies, we demonstrated that SE training during the whole pregnancy induces an increase not only in the cross-sectional area and slow-twitch fiber, but also the fast-twitch fiber\u00a041. Indeed, SE applied in this study showed a significant reversal of muscle atrophy in pregnant hyperglycemic rats.The present study shows that both exercised groups regardless of diabetes had increased fast-twitch fiber area and diameter. These findings support the possibility that DiM model is inhibited by exercise training\u00a029. Conversely, the fast and slow-twitch fiber area and diameter increase may be related to improved muscle endurance, possibly caused by mitochondrial biogenesis and increased mitochondrial enzymes activities. These findings enhance aerobic capacity and provide muscle contraction with less energy expenditure and greater oxygen uptake\u00a042.Exercise training plays an important role in the mitigation of muscular atrophy in DiM. Coherent with previous studies, a resistance training protocol enhanced muscle strength on extensor digitorum longus muscle, gastrocnemius and soleus muscles of male diabetic rats, improving muscle physical and motor function, minimizing the deleterious effect of diabetes on muscles43. In prior translational studies in rats, it was shown that diabetes during pregnancy results in damaged extracellular matrix (ECM) and urethral striated muscle suggestive of the high long-term UI prevalence in women\u00a09. Other studies examined the relationship between ECM components (particularly collagens) and diabetes, PFDs and pregnancy, although few comparative data are available\u00a018. The results in the present study show that SE\u00a0in MHP rats did not reduce the total collagen area compared with the three other groups. However, SE in MHP rats decreases type I collagen area to similar levels of non-diabetic sedentary group and maintain high levels of type III collagen similar to SE MHP and SE\u00a0non-diabetic group. The decrease in collagen type I/III ratio in SE-MHP suggests the reversal of a stiff into a soft healthy skeletal muscle. Our findings complement the results of four previously experimental studies, either in RAM or PFM\u00a043 indicating a complete muscle remodeling. It confirms the importance of this biological approach in DiM. This changeover in collagen type I/III ratio in\u00a0SE in\u00a0MHP favors normal soft RAM muscle, with likely normalization of biomechanical properties in muscles involved in urinary continence. All these changes allow suggesting SE for assessment as a potential treatment for maternal UI injured by the maternal hyperglycemic environment.The urethral extracellular matrix also plays a role in the mechanism of urinary continence\u00a044. Further studies should address this fundamental mechanism. This study as a preclinical model in the obstetrical area, the maternal-placental and fetal (MPF) unit needs to be carefully considered. Although we conducted this experiment by using the same swimming protocol established previously\u00a047, the whole MPF unit analysis was not performed. Thus, our successful results with SE in MHP rats environment may be analysed with caution to be considered in GDM women. Also, the present study has limitations regarding the experimental diabetes induction, which represents GDM blood glucose levels, but occurred before pregnancy\u00a049. In addition, the guidelines recommend that pregnant women should exercise at least 150\u00a0min/week or 30\u00a0min/day most days of the week\u00a025. Also, specific analysis of aerobic capacity and muscle function should be explored.Although this set of results related to SE in mitigating the negative effects of the maternal hyperglycemic environment on DiM\u00a0in the transformation into a soft health muscle, the molecular regulations of this gain muscle mass is unclear. It was suggested that distinct mechanisms regulate skeletal muscle mass recovery and hypertrophy\u00a0In conclusion, hyperglycemia exerts an impact on DiM generating an atrophic and stiff muscle. SE intervention training during whole pregnancy in rats imposes a positive influence on DiM\u00a0being capable of reversing this muscle atrophy and transforming a stiff into a soft healthy skeletal muscle. Therefore, these findings of reversal myopathy suggest that SE training during the whole pregnancy may play a therapeutic role in regulating the damages caused by the maternal hyperglycemic environment and may be considered as a potential treatment for RAM damage caused by GDM.4. According to the requirement to develop innovative treatments for DiM, this translational project was developed.This current project corresponds to the translational part of the Diamater Study, a cohort Thematic Project with the financial support of S\u00e3o Paulo Research Foundation (FAPESP 2016/01743-5), a state research foundation in Brazil. The Diamater cohort project has been developed to investigate biomolecular muscle profiles as predictors for long-term urinary incontinence in women with Gestational Diabetes Mellitus\u00a0All animal experiments were approved by the Institutional Animal Care and Use Committee, Faculdade de Filosofia e Ci\u00eancias, S\u00e3o Paulo State University (UNESP), in accordance with the Brazilian Council for Control of Animal Experimentation (CONCEA) (protocol number 007/2016). The study is reported in accordance with the ARRIVE guidelines.Female and male Wistar rats obtained from ANILAB were housed in a facility with constant temperature (22\u2009\u00b1\u20092 \u02daC) and humidity 55\u2009\u00b1\u20095%) on a controlled 12\u00a0h light\u201312\u00a0h dark cycle with food and water ad libitum, in individual plastic cages during all experimental protocol. The experimental sequence is shown in Fig.\u00a05\u2009\u00b1\u20095% on47. To induce MHP rats\u2019 model, newborn female Wistar received in the first day of life subcutaneously injection of STZ (Sigma\u00ae) diluted in citrate buffer (0.1\u00a0mol/l pH 4.5) in a dose of 100\u00a0mg/kg. Non-diabetic rats received subcutaneous injection of citrate buffer (0.1\u00a0mol/l pH 4.5)\u00a050. All female newborn rats were maintained with their mothers until the end of the lactation period (21\u00a0days). After this period, the mother rats were euthanized by sodium thiopental injection(Thiopentax\u00ae\u201480\u00a0mg/kg). The female newborns were maintained until adulthood. Fasting blood glucose level was determined in adult life, and used for inclusion or exclusion criteria in the study. Diabetic animals should present blood glucose level between 120\u00a0mg/dl and 300\u00a0mg/dl, and non-diabetic animals blood glucose level\u2009<\u2009120\u00a0mg/dl\u00a051.The\u00a0MHP\u00a0model is the same as previous reports\u00a0At approximately day 90 of age, four diabetic and non-diabetic female rats were housed overnight with one adult male rat. The presence of spermatozoa in the vaginal smear was considered gestational day 0\u00a0[52]. After, rats were housed in individual cages until 21\u00ba\u00a0day of pregnancy.On gestational day 0, female rats were randomly allocated into four experimental groups according to sedentary lifestyle or swimming exercise: Non-Diabetic Sedentary (NDsed) (n\u2009=\u200913), Non-Diabetic Exercised (NDex) (n\u2009=\u200913), Diabetic Sedentary (Dsed) (n\u2009=\u200913) and Diabetic Exercised (Dex) (n\u2009=\u200913).\u00a0Dex is the study group and the other three  are control groups.47 and considered to be a moderate intensity exercise protocol\u00a045. The exercised animals were exposed to water daily temperature 31\u2009\u00b1\u20091\u00b0C for 6\u00a0days/week, from gestational day 0 until gestational day 20 on a pool at a depth of 40\u00a0cm at the water. The first training session started with 20\u00a0min, progressively increasing 10\u00a0min/day until 60\u00a0min. The sedentary rats were exposed to water daily for 15\u00a0min, at a depth of 10\u00a0cm at water temperature 31\u2009\u00b1\u20091\u00a0\u00b0C for 6\u00a0days/week, from gestational day 0 until gestational day 20, aiming not to promote physiological adaptations from exercise practice.The swimming exercise protocol was based on previous studies\u00a050. Fasting glycemia and at 10, 20, 30, 60 and 120\u00a0min after administration of an intragastric glucose solution (0.2\u00a0g/mL) in a dose of 2.0\u00a0g/kg were measured. Diabetes diagnosis was confirmed with two or more blood glucose measurements\u2009>\u2009140\u00a0mg/dL\u00a051.On gestational day 17, an OGTT was performed to confirm the glucose intolerance in diabetics\u00a02. Then, a C-section was performed and fetuses and placentas were separately analyzed in different projects.At the end of pregnancy  the dams were euthanized by sodium thiopental injection . An abdominal incision was performed for RAM sample collection. The lower third on the right side of RAM\u00a0was exposed, dissected, and removed for integrative morphological analysis. The fragments had approximately 0.25 cmThe samples obtained were selected into separate parts according to methodological procedures. The integrative morphological analysis is composed by morphological, morphometric, immunohistochemistry and ultrastructural RAM analysis.\u00ae/BX41TF coupled with DP25-4 digital c\u00e2mera). The photographs were obtained with cell Sens Ver 1.18 Olympus Corporation\u00ae software.For morphological and morphometric analysis, RAM samples were immersed for 24\u00a0h in neutral 10% buffered formaldehyde, transferred to 70% alcohol and maintained at room temperature and then embedded in paraffin. The 4-\u00b5m-thick sections were cut in microtome (Reichert-Jung model 820) and fixed on microscope glass slides stained with Hematoxylin & Eosin (H&E) and Picrosirius Red.\u00a0H&E-stained slides were used to observe the general morphology of the RAM. Picrosirius Red-stained slides were analyzed with the color-segmentation method to determine the red (collagen) and yellow (muscle fiber) -stained tissue in the same section and used to determine muscle, fiber and collagen area and fiber diameter. The slides were analyzed in a light microscope (Olympus Corporation\u00ae) image analysis software (20\u2009\u00d7\u2009magnification).For morphometric analysis of muscle and collagen area, 40 sections/group  were selected. For morphometric analysis of fiber area and diameter, 100 muscle fibers/group were selected. All analyzes were performed using CellSens Dimension Version 1.16 . After washing, the sections were incubated with bovine serum albumin solution (BSA 3%) for 1\u00a0h. The sections were incubated overnight at 4\u00a0\u00b0C with primary antibodies against myosin heavy chain, slow  and fast  muscle fibers, type I Collagen  and type III Collagen . After incubation, the sections were washed three times for five minutes with PBS and incubated with secondary antibodies for 1\u00a0h 30\u00a0min . For staining, the sections were incubated with diaminobenzidine for 1\u00a0min and hematoxylin for 10\u00a0min. The slow-twitch and fast-twitch muscle fibers, and type I and III Collagen were analyzed using a light microscope  and 40 sections/group  were selected to quantify the fiber type area and collagen type area. Also, each muscle fiber was manually selected  and fiber type area and diameter were quantified using CellSens Dimension (Olympus Corporation\u00ae) Version 1.16 image analysis software (20\u2009\u00d7\u2009magnification). The fiber type area was quantitatively determined, as described previously10.Immunohistochemical analysis was used to stain slow-twitch and fast-twitch muscle fibers and type I and III collagen. For immunohistochemistry (N\u2009=\u20095 samples/group), the samples were immersed for 24\u00a0h in neutral 10% buffered formaldehyde, transferred to 70% alcohol and maintained at room temperature and then embedded in paraffin. The 4-\u00b5m-thick sections were cut in the microtome. Sections were deparaffinized and incubated with antigenic recovery for 35\u00a0min in a pressure cooker. Endogenous peroxidase was blocked using H, the RAM tissues obtained to ultrastructural analysis (3 samples/group) were cut into small strips and immediately immersed in\u00a0Karnovsky\u00a0fixative for 3\u00a0h at room temperature and transferred to the refrigerator to post-fixation in 1%\u00a0osmium tetroxide for 24\u00a0h and afterward, the samples were embedded in epoxy resin. Ultra-thin sections were obtained at a longitudinal orientation and stained sections were examined using transmission electron microscopy using .As previously describedGraphPad Prism\u00ae v.8.0 software was used to analyze the data. Data are expressed as mean\u2009\u00b1\u2009standard deviation (SD). Comparisons of measurements among groups were performed by two-way ANOVA followed by Tukey\u2019s multiple comparison tests. For all statistical comparisons, p\u2009<\u20090.05 was considered statistically significant."}
+{"text": "Rehmannia glutinosa Libosch and differentiation induction potential of some substances purified from this herbal, it finds difficult to seek research that investigated the effect of hot water-extracted R. glutinosa Libosch (RGE) on proliferation and cardiogenic differentiation of mesenchymal stem cells, even though it has commonly been used for a long time because of its function as a restorative and as a critical role in cardiovascular treatment in traditional.Vietnamese medicine tried and tested certain bioactive compounds from plants to increase the rate of tissue immunomodulation, regeneration, and differentiation. Although there are many research papers discovered about phytochemicals of Our research indicated that RGE has many predicted bio-pharmacological effects, and the RGE is demonstrated that it is non-toxic to UC-MSCs (IC50 = 1274 ppm). It also stimulates the proliferation and migration of UC-MSCs at various concentrations, especially at the RGE concentration of 50 ppm, during four days of treatment. On the other hand, the RGE can induce the cardiac pre-differentiation process from the fifth day to the fifteenth day after treatment, which was proven through both molecular and cellular (morphology evidence) levels like the up-regulation of GATA4, Nkx2.5, cTnT \u03b1-MHC, Desmin genes; the expression of Desmin protein, the appearance of two-nuclei cells, connecting process of adjoining cells, the cytoplasmic striations.The RGE could either stimulate proliferation\u2013migration of MSCs or induce the cardiac pre-differentiation process. This extract can be classified as non-toxic to the UC-MSCs. Rehmannia glutinosa Libosch (RG) is a carbohydrate-rich plant in the family of Scrophulariaceae and is a famous folkloric medicinal plant in Vietnam. Research works in the past revealed that RG contains many components in its extract [R. glutinosa Libosch on mesenchymal stem cells even though residents of Eastern countries often use RG with a form like crude extract instead of using the purified individual components. Moreover, there is a tendency, which is more and more popular in research, to use the plant extract for proliferating and differentiating on the MSCs with the various promising outputs from many different plants such as Glycyrrhiza glabra, Rhizoma Drynariae, Foeniculum vulgare [ extract , which i extract , hypogly extract , anti-se extract , cardiov extract , heart f extract , and tum extract . We can  extract ,9; and o extract ; on neur extract . There i vulgare , so the in vitro or in vivo. In this day and age, they have been used for various clinical trials for dealing with many kinds of sickness, especially the MSCs use for treating COVID-19 recently [Besides, although the use of bone marrow-derived mesenchymal stem cells (BMSCs) has been popular in research and clinical studies, umbilical cord mesenchymal stem cells (UC-MSCs) can become an alternative source to BMSCs due to non-invasive collection protocol and easy accessibility. They have also emerged strongly to the attractive therapy for many diseases because of their abundant sources, self-renewal ability, immunoregulation ability, differentiation into different kinds of mature cells or functional cells, and even non-mesodermal cell types either recently \u201314. Sincthe vivo microenvironment when using MSCs or tumor-forming when embryonic stem cells are used [in vitro from stem cells in the last decades, despite the differentiation into function cardiomyocyte from MSCs is controversial due to the failure in the majority of researches in the past, especially when scientists use herbal plant for differentiation purpose [Cardiovascular disease-related mortality accounts for the most significant percentage of deaths world-wide. The critical reason for this situation is that cardiomyocytes' s insufficient capacity to proliferate and regenerate themselves. As a result, following a cardiac attack, these resident cells are replaced by fibroblasts and non-contractile scar tissue, resulting in heart muscle tissue contractile dysfunction and heart failure. A variety of techniques are used to address this issue, including allogeneic heart transplantation and stem cell transplantation. However, stem cell transplantation therapy has certain drawbacks, such as organ trapping and spontaneous differentiation in are used . With th purpose ,17.HowevThe roots of RG were collected between January and February 2020 from Thanh Hoa, Vietnam. The sample was identified by Dr. Nguyen Viet Thang (Hue University), and the voucher specimen is deposited in the Sub-department of Applied Biology, Department of Biology, College of Sciences, Hue University (voucher number \u2013 D06).The RGE was carried out using Jane C-J Chao's procedure  was modiThe total carbohydrate content in RGE was determined by a phenol-sulfuric acid assay using glucose as a standard.Briefly, 100 mg RG powder and 5 mL of 2.5 N HCl were boiled in a water bath for 3 h for hydrolyzing, followed by cooling. After solid sodium carbonate was added for neutral, the solution's volume was made up to 100 mL and centrifugation. Three experiment tubes were set by 0.1 mL sample and 0.9 mL water; 0.2 sample and 0.8 mL water; 1 mL water (blank). Next, 5 mL of 96% sulphuric acid was added to each tube and shaken after 10 min. After that, these tubes were incubated at 25\u201330 \u00b0C for 20 min, and the colors were read at 490 nm. Finally, the sample's total carbohydrate content was calculated using the standard graph ,19.The RGE after extraction and storage in the above condition was split into 3 mL in a tube for GC\u2013MS analysis.The RGE was tested by the drug, cosmetic, and food quality control center of Thua Thien Hue province (HueQC). The composition was analyzed by the Gas Chromatography-Mass Spectrometry method (GC\u2013MS).Umbilical cords were collected from Hue Central Hospital with the approval of the Research Ethics Committee of Hue Central Hospital and transported to the Stem cells Laboratory, Department of Biology, College of Sciences, Hue University in 0.9% normal saline containing 100 U/mL penicillin and 100 mg/mL streptomycin at 4 \u00b0C with written consents of mothers and families.2 sections. These fractions were rinsed with PBS and subsequently suspended in StemMACS\u2122 MSC Expansion Media Kit XF . Incubation was performed at 37 \u00b0C in a humidified atmosphere containing 5% CO2, and the medium was replaced every three days. The morphology of UC-MSCs was followed with Olympus CKX31SF inverted microscope .Initially, blood vessels were removed in saline, and the umbilical cords were sliced into 1\u20132 cm2.When the cell population's confluence reached around 80%, the cells were trypsinized, counted, and re-seeded into culture dishes at a density of approximately 1000 cells/cmFor CFU-F culturing at passage 2\u20133, the cells were seeded at a density of 100 cells per well. Colony-forming unit-fibroblast (CFU\u2013F) was stained with Giemsa solution and counted by ImageJ.The attached cells from passage culture were detached by trypsin digestion, washed in PBS, and reacted with FITC-conjugated or PE-conjugated monoclonal antibodies  against human CD34, CD45, CD73, CD90, and CD105 for 30 min in the dark at room temperature. The cells were washed twice in PBS, and at least 10000 events were collected with FACSCanto . The data were analyzed with FlowJo software.in vitro differentiation assay and assay to determine the induction of the proliferation - migration of UC-MSCs.The UC-MSCs at passage 3 were treated with RGE for primary assays, including This treatment divided the UC-MSCs population into three groups by various concentrations of RGE such as 50 ppm, 100 ppm, 150 ppm, respectively, R1, R2, R3 groups.2 incubator with 5% CO2 at 37 \u00b0C for 24 h for growth.Cell cytotoxic assay was performed for testing the cytotoxicity of the RGE against UC-MSCs. Initially, UC-MSCs were re-suspended with the fresh medium and counted. After that, UC-MSCs were seeded on a 96-well plate at the density of 10,000 cells/well and incubated in a COThe viability rate of UC-MSCs was evaluated through Trypan blue assay like afore-research . After tFinally, the online software named Quest GraphTM IC50 Calculator  , was useFor proliferation analysis, UC-MSCs were passage cultured in StemMACS\u2122 MSC Expansion Media Kit XF . Cells were visualized using an Olympus CKX31SF inverted microscope (4\u00d7 objective lens) and images were captured . Cell number was assessed and compared using automated cell identification methods. This method already is demonstrated that it was sensitive enough to accurately detect both more minor changes in cell numbers and a more comprehensive range of cellular densities than spectrophotometric analysis of crystal violet-stained cells . Accordi//Convert Image to 8-bitrun(\"8-bit\");//Remove Noiserun(\"Despeckle\");//Adjust Brightness and ContrastsetMinAndMax;run(\"Apply LUT\");//Apply Phansalkar Local Thresholdrun;setAutoThreshold(\"Default\");//Watershedrun (\"Watershed\");//Count Objects (i.e. Cells)run;For migration analysis, UC-MSCs were passage cultured to gain 70% confluence before a scratch assay was performed as described by previous research . BrieflyUC-MSCs population after induction was evaluated with similar assays to our previous research paper , includiBriefly, the shape index can measure cellular morphology . This inEquation:ImageJ software was used to figure out the proportion of cells that were directed to alignment and orientation through \u03b8 angle ,29. Thiswww.ncbi.nlm.nih.gov/tools/primer-blast/). All reagents and primers were purchased from PHUSA Biochem Company, Vietnam.The total RNA extraction was performed using InviTrap\u00ae Spin Universal RNA Mini Kit , according to the manufacturer's instructions. Reverse transcription was reacted by Promega GoScript (TM) Reverse Transcriptase (Promega Corporation) and random hexamer primers to form first-strand with RNA templates. cDNA was diluted with Nuclease free water. Subsequently, PCR reactions used PHUSA Taq_500 and specific primers . These pInitially, UC-MSCs were fixed with methanol for 10 min at \u221220 \u00b0C, washed three times with PBS, followed by incubating at 4 \u00b0C. Primary antibodies, which were incubated with the cell for 1.5h at 37 \u00b0C, were diluted before (1:100). The next step was 30 min incubation with secondary antibody (diluted 1:200). Slides were taken photo by using diaminobenzidine substrate and counterstaining with hematoxylin.All data is shown as mean +standard deviation (SD), and differences between samples were determined by Student's t-test. One-way ANOVA, Turkey's HSD post-test among selected pairs of groups were also analyzed and performed with R software for Mac OS. Values with a p < 0.05, p < 0.01, p < 0.001 were considered statistically significant.Data from the phenol - sulfuric acid method was used for making a standard linear curve by glucose content. Forward, carbohydrate concentrations in the samples were calculated based on the standard curve .From the inferred carbohydrate content given in The GC\u2013MS spectrum was presented in Several bioactive compounds from these plants have a specific role as bioactive mediators in regulating the rate of cell division and differentiation. In these compounds, most of them resemble afore-research, which is guanosine , methyl The cultured UC-MSCs population displayed a typically homogeneous fibroblast-like morphology . This ceAfter 3\u20135 days of culture, cells begin to divide and form small colonies around the original cell. From 7 to 10 days, CFU-F clusters form with a cell count greater than 50 cells per colony and its diameter more than 1 mm. Then, staining with Giemsa and counting with ImageJ software. The number of colonies constantly increased from the primary culture to the fourth passage .From the result was given by Quest GraphTM IC50 Calculator , the cytThe result about the rate of cell viability after treatment indicated the statistically significant difference between treated cell viability (cell group treated with RGE of concentration from 200 ppm to 6400 ppm) and cell viability in the control group . We deteThe cell number was counted by ImageJ software revealed the power of RGE on proliferation stimulation by all three various concentrations . At the The reduction of wound area when treating with RGE reflects this extract's ability to stimulate the migration and proliferation of UC-MSCs. Results this assay displayed through photomicrograph  and ImagInitially, the ability of RGE to induce the cardiogenic pre-differentiation from UC-MSCs was exhibited through the morphological changes traced by shape index and the orientation of the cell population after treatment. This work revealed that the shape index of the treated UC-MSCs constantly falls in the period after treating with RGE, for details from around 0.75 at the 0 days to approximate 0.25 at the 18 day under treating . This ouBesides the result, which was quantitated by ImageJ software, the morphology of UC-MSCs was also visualized and shown in On the contrary, the orientation of the UC-MSCs population did not change during this assay. This result showed through the random distribution of \u03b8 angles from 10\u00b0 to 90\u00b0 of all cell groups GATA4, Nkx-2.5, cTNT, \u03b1- MHC, Desmin. GAPDH was reference genes and used as internal reference controls for normalizing these bands for semi-quantitative by ImageJ software. The semi-quantitative analysis result revealed the expression of the five above genes and the silence of \u03b1- cardiac actin gene.After performing the RT \u2013 PCR assay, the photos of electrophoresis were captured for analyzing these concerned bands . AccordiFollowing the verified upregulation of some cardiac-specific mRNA, the result of differentiation was confirmed on the specific protein expression. Due to our laboratory's condition, we proved the expression of Desmin by immunocytochemistry, which is a particular protein of cardiac muscle tissue. This assay indicated that the RGE-treated groups after treatment expressed Demin protein, while cells in the control group did not display Desmin .Initially, these results regarding the tests on the phytochemicals of RGE revealed that RG is a carbohydrate-rich plant and has many different bioactivities that were predicted through the components in RGE obtained in GC-MSs result and other previous publications. Among these predicted effects pharmacologically, it is easy to guess that this extract has positive effects on the mesenchymal stem cells because MSCs play a prominent role in the recovery process of many diseases. Thus, unsurprisingly we discovered that RGE in this research could not have the cytotoxicity effect on the UC-MSCs population. This result about the cytotoxicity is contrary to a previous result that RGE can have cytotoxicity effect on a cancer cell line .All the tested RGE concentrations not only are safe for the growth of UC-MSCs but also have proliferation \u2013 migration stimulation effect on the UC-MSCs. Significantly, the RGE concentration of 50 ppm displayed the most potent stimulation ability on proliferation and migration. These results were confirmed through the scratch assay and the cell counting assay, and these results are also similar to previous publish that RG can stimulate the proliferation of cells ,48. HoweAfter that, for investigating the cardiogenic differentiation, the cell population after treatment was evaluated the morphology and the orientation of the whole population from the fifth day after treatment. It is clear that from the fifth day, the morphology of the cell has significant changes, which is become more elongated and turn to tubule-shaped from the fibroblast-shaped and spindle-shaped of MSCs, which were display through the photos and the reduction in the shape index and this results also is the same with many previous cardiogenic differentiation researches . BesidesAlthough the alignment is the main specific character of the mature heart muscle tissue, either this differentiation strategy or common differentiation strategy, which is 5-azacytidine use, had limited due to failure in making the alignment . BesidesGATA4 and Nkx-2.5 mRNA, which is similar to other published data [GATA4 and Nkx-2.5 mRNA at a low level [Nkx-2.5, cTNT, \u03b1- MHC, Desmin. Among these, GATA4 and Nkx-2.5 are early markers and were shown to modulate specific genes during the early-stage development of cardiogenic differentiation [Nkx2.5 and GATA4 clears the path to access these promoters for active transcription [From the results of PCR assay, it is evident that our UC-MSCs population do not express the hed data , while sow level . This contiation . Thus, tcription .cTnT, \u03b1- MHC were also up-regulated in all three treated groups. The semi-quantitative results revealed the high expression of these markers compared to the expression of both GAPDH as control and other early markers. We also performed the PCR reaction to indicate the expression of Desmin mRNA during treatment. Unfortunately, in this work, although 5 out of 6 surveyed specific genes as either soon marker or later marker upregulated under RGE treatment, the last later marker is \u03b1- cardiac- actin was not expressed at any cell groups. This lack of expression can bring surprise due to the \u03b1- cardiac- actin one primary marker responsible for gathering muscle proteins and coordinating contractile reaction in the mature heart muscle tissue. This gene's silence can prove the failure in differentiation into functional cardiomyocytes from UC-MSCs by using bioactive compounds form RG [cTnT, \u03b1- MHC, GATA4, Nkx-2.5, Desmin could be confirmations of differentiation into cardiomyocyte-like cells [Besides, some mature myocardial markers like  form RG . Howeverke cells .R. glutinosa Libosch in this research has a large proportion of carbohydrate contents and has diverse pharmacological effects are predicted from the result of GC\u2013MS. This extract is categorized as non-toxic to UC \u2013 MSCs with IC50 value is 1274 ppm. All the tested concentrations of RGE can stimulate the proliferation\u2013migration process during the initial four days of treatment and induce the cardiogenic differentiation from the fifth day of treatment, which is demonstrated through the reduction in shape index, some specific morphology , the local orientation, the expression of specific genes , and the expression of Desmin protein.The hot water-extracted"}
+{"text": "We aimed to investigate the relation between the time intervals of the flow velocity waveform of ductus venosus (DV-FVW) and cardiac cycles. We defined Delta A as the difference in the time measurements between DV-FVW and cardiac cycles on the assumption that the second peak of ductus venosus (D-wave) starts simultaneously with the opening of the mitral valve (MV). As well, we defined Delta B as the difference of the time measurements between DV-FVW and cardiac cycles on the assumption that the D-wave starts simultaneously with the closure of the aortic valve (AV). We then compared Delta A and Delta B in the control and fetal growth restriction (FGR) groups. In the control group of healthy fetuses, Delta A was strikingly shorter than Delta B. On the other hand, in all FGR cases, no difference was observed. The acceleration of the D-wave is suggested to be generated by the opening of the MV under normal fetal hemodynamics, whereas it precedes the opening of the MV in FGR. Our results indicate that the time interval of DV analysis might be a more informative parameter than the analysis of cardiac cycles. Fetal growth restriction (FGR) caused by placental dysfunction is a challenging disease, and the appropriate timing of delivery in FGR cases is still controversial because it requires a balance between the risks of prolonged exposure to hypoxemia, which may lead to fetal demise, and the risks of prematurity to adapt to dramatic changes in respiratory and cardiocirculatory circumstances ,2,3,4. IIn the progression of fetal deterioration, a Doppler evaluation of the fetal venous system, including ductus venosus (DV), plays a pivotal role in close fetal monitoring ,6. DV-PITo elucidate these advantages of DV-FVW assessment, we aimed to conduct a meticulous investigation regarding the relation between the time intervals of DV-FVWs and fetal cardiac cycles, based on the clinical question as to whether the D-wave is generated at the timing of the opening of the atrioventricular valve.A cross-sectional study was performed on 60 normal fetuses, as a control group, from 25 to 33 gestational weeks at Osaka Metropolitan University Hospital, from December 2020 to February 2022. The fetuses showed normal morphology, and estimated fetal weights were within \u00b11.5 SD of the normal mean, according to local reference ranges, in all cases .n = 23) were also retrospectively analyzed at both Osaka Metropolitan University Hospital and Osaka City General Hospital from April 2011 to November 2021. FGR was defined as an estimated fetal weight (EFW) < \u22122.0 SD of the local reference range and with an elevated umbilical artery PI > 95th percentile of the reference range [FGR fetuses  and just above the mitral valve (MV)  and (iii) and that between (ii) and (iv); Delta B was defined the sum of each absolute value of the difference between (i) and (v) and that between (ii) and (vi).p < 0.05 was considered statistically significant.We compared Delta A and Delta B in the control and FGR groups. We also divided both groups into two sub-groups at examination: at \u2264 28 + 6 gestational age (GA) and >28 + 6 GA. We used the SPSS statistics version 20 for statistical analysis . Comparisons between the control and FGR groups were performed using the Mann\u2013Whitney U-test, and Out of the 45 FGR cases, 3 cases were excluded during the study period: 1 case had a ventricular septal defect that was diagnosed postnatally, 1 showed fetal tachycardia, and 1 case resulted in fetal demise. All parameters were obtained from 23 of the total FGR cases. The decision for delivery was made based on a non-reassuring fetal status judged by cardiotocography, and all FGR cases were delivered by cesarean section. Sixteen cases in the FGR group were included from a previous study . Table 1The measurements of cardiac parameters in the control and FGR groups are shown in The present finding that Delta A was apparently shorter than Delta B in normal fetuses suggests that the acceleration of the D-wave is generated simultaneously by the opening of the MV under normal fetal hemodynamics. In contrast, in the FGR group, no difference was observed between Delta A and Delta B, and this result suggests that the acceleration of the D-wave starts before the opening of the MV. Furthermore, in contrast, Delta A was significantly increased in those severe FGR cases which necessitated the early termination of pregnancy.We previously demonstrated the systolic/diastolic time ratios of DV-FVWs and cardiac cycles, using similar methods as those in the FGR study, and the most significant decrease in systolic/diastolic ratios was observed in the DV-FVWs in severe FGR cases . FurtherTo mention, theoretically, ventricular relaxation and high atrial pressure lead to the opening of the MV, thus accelerating venous forward velocities in the D-wave ,14, and Based on the findings in the present study, representative alterations in Doppler measurements of DV-FVWs and cardiac cycles are shown in Efforts for the understanding of complexities in multifactor-derived DV-FVWs have been undertaken by some investigators and from other perspectives. The nadir between the S-wave and the D-wave, the starting point of the acceleration of the D-wave, has been investigated via Doppler examination using blood flow velocity. Turan et al. studied the blood flow patterns of the DV-FVWs in fetuses at risk for cardiac dysfunction and speculated that the velocity of the nadir between the S-wave and the D-wave (they named this trough the \u2018v-wave\u2019) reflects ventricular relaxation and holodiastolic filling . Later, The limitations of the present study are that the data were retrospectively obtained from FGR fetuses and that it was not possible methodologically to obtain precise, simultaneous measurements of both DV-FVWs and cardiac parameters. Furthermore, the low statistical power might have had some effects on the results of the comparison of cardiac parameters such as ICT, ET, IRT, and MPI. The present study also lacks any speculation as for the pathogenesis of preeclampsia, which has substantial effects on fetal growth and placental function ,23. HoweWe revealed that the acceleration of the D-wave may be generated simultaneously with the opening of the MV in physiological circulation, while, in contrast, the acceleration of the D-wave will start during the isovolumetric relaxation period in severely growth-restricted fetuses, thus suggesting that the alteration in time intervals of DV-FVWs will reflect not only cardiac cycles, but also pathophysiological systemic changes in FGR cases. We believe that the time interval analysis of DV-FVWs may provide a more comprehensive insight into the pathophysiological conditions of severe FGR fetuses."}
+{"text": "Corynebacterium glutamicum is a bacterium widely employed in the industrial production of amino acids as well as a broad range of other biotechnological products. The present study describes the characterization of C. glutamicum proteoforms, and their post-translational modifications (PTMs) employing top-down proteomics. Despite previous evidence of PTMs having roles in the regulation of C. glutamicum metabolism, this is the first top-down proteome analysis of this organism. We identified 1125 proteoforms from 273 proteins, with 60% of proteins presenting at least one mass shift, suggesting the presence of PTMs, including several acetylated, oxidized and formylated proteoforms. Furthermore, proteins relevant to amino acid production, protein secretion, and oxidative stress were identified with mass shifts suggesting the presence of uncharacterized PTMs and proteoforms that may affect biotechnologically relevant processes in this industrial workhorse. For instance, the membrane proteins mepB and SecG were identified as a cleaved and a formylated proteoform, respectively. While in the central metabolism, OdhI was identified as two proteoforms with potential biological relevance: a cleaved proteoform and a proteoform with PTMs corresponding to a 70\u00a0Da mass shift. Corynebacterium glutamicum is an industrial workhorse capable of producing a broad range of biomolecules from a large pool of substrates1 and is currently the best option for production of L-alpha amino acids2. Amino acid production represents a multi-billion dollar market3, with an annual production of approximately 10 million tons worldwide2, with l-glutamate and l-lysine corresponding to 3.3 million tons/year and 2.2 million tons/year, respectively2. Besides amino acid production, C. glutamicum is also utilized in other biotechnological processes, such as the production of heterologous proteins4, organic acids5, carotenoids, isobutanol6, polymers7, and more recently, its potential in bioremediation processes has been investigated8.The bacterium 9. In C. glutamicum, the importance of PTMs was investigated previously revealing the crucial effect of oxoglutarate dehydrogenase inhibitor (OdhI) phosphorylation in the production of l-glutamate11. More recently, mass spectrometry proteomics of C. glutamicum showed the influence of l-glutamate-producing conditions on the succinylation and acetylation of C. glutamicum metabolic proteins, including OdhI12.Recent developments in proteomics have demonstrated the importance of post-translational modifications (PTMs) in several species of bacteria13. As a consequence of protease digestion, the information from several protein regions can be lost in bottom-up approaches, including PTMs. Furthermore, in this approach protein identity is inferred based on peptide identification, and this may cause ambiguity in cases in which peptides may belong to more than one protein13. In contrast, the top-down approach allows the identification of the full sequence of proteins. Moreover, analysis of intact forms of proteins permits the identification of proteoforms, defined as different forms of proteins derived from the same gene14. Such proteoforms can be generated by amino acid residue substitution, proteolytic cleavage, alternative splicing, and several types of PTMs15. Furthermore, different proteoforms of the same protein can have different function and affect biological processes of an organism16. The power of top-down proteomics has been applied to other bacteria17. For instance, top-down proteomics of Escherichia coli and the identification of proteoforms has been performed18. Despite the evidence of the relevance of PTMs in C. glutamicum metabolism, no top-down proteomic studies have been published to date. Here we carried out the first top-down proteomics analysis of C. glutamicum, using a precursor tolerant approach to identify and reveal PTMs and proteoforms.There are currently two main proteomics approaches that are referred to as bottom-up and top-down. Briefly, in the bottom-up approach proteins are cleaved by a protease  and the subsequent peptides are analyzed by mass spectrometry, whilst in the top-down procedure, proteins are examined in their intact forms19.As expected, a wide range of proteoform molecular masses could be seen in the pre-fractionated intracellular proteins, but GELFrEE was efficient in separating large proteoforms from smaller forms Fig.\u00a0A. FractiC. glutamicum generated 5127 proteoform spectrum matches (PrSMs), providing the identification of 1125 different proteoforms related to 273 different proteins , \u221218\u00a0Da , and 32\u00a0Da . Interestingly, the proportion of E. coli identified peptide spectrum matches (PSMs) with -18\u00a0Da (3.8%) and 32\u00a0Da (0.8%) \u0394m were very similar to those found in this study. In contrast, the proportion of PSMs identified with 16\u00a0Da (24%) \u0394m in E. coli was greater than in C. glutamicum. However, it is worth mentioning that the high number of PrSMs identified with 15\u00a0Da \u0394m (6.11% of modified PrSMs) may be caused by miss identification of the 16\u00a0Da \u0394m, as will be further discussed in the next topics.Some of the most frequent \u0394m identified here were also reported as highly present in Proteins identified with \u0394m were analyzed using the String Cytoscape app, after clustering proteins according to their interaction nodes, each cluster was submitted to overrepresentation analysis and the most representative terms were related to different gene ontology terms such as protein-containing complexes, electron transfer activity and CYTH domain , pyrimidine metabolism, transmembrane helix, biosynthesis of secondary metabolites and thioredoxin domain. Moreover, eight ribosomal PrSMs presented two \u0394m, indicating the presence of at least two concomitantly occurring PTMs , and persulfide . The 28\u00a0Da mass shift may also correspond to di-methylation . Despite being difficult to differentiate between formylation and di-methylation, the higher number of \u0394m close to 27.99\u00a0Da and 27.98\u00a0Da . The presence of SDS artifacts was also reported in an intact proteomic analysis of E. coli, and suggested to be caused by incomplete removal of the detergent25. Regarding the \u221218\u00a0Da \u0394m, it may result from dehydration events and was predominantly identified in serine residues  represented by the blue lines in the protein sequence is shown, and it can be seen that the mass shift is localized to a very narrowed region of three amino acid residues, due to the several b-ions contained in this region.Secretion system protein (SecG) Fig.\u00a0A and lar27. Both the SecG and MscL formylated PrSMs mentioned above were identified with the presence of N-terminal methionine. This suggests a possible mechanism of degradation of membrane proteins, including some with promising biotechnological applications. For example, the SecG protein is part of the Sec protein export pathway. There is a growing interest in the capacity of C. glutamicum to express and secrete heterologous proteins of biotechnological interest28. Furthermore, MscL and MscS are mechanosensitive channels, known for reacting to osmotic stress. Another mechanosensitive channel of C. glutamicum  plays a major role in l-glutamate efflux29.The 28\u00a0Da mass shift near the protein N-terminus of these proteins suggests the presence of N-terminal formylation  in the identified proteoforms. Recent evidence has suggested the N-terminal formylation of methionine as a signal for protein degradation. This mechanism has been hypothesized as a quality control of protein translation in bacteria30. Furthermore, according to pfam (https://pfam.xfam.org/), mepB has a domain belonging to the M23 metallopeptidase family (MEROPS) [130\u2013226]. A well characterized member of MEROPS is the LytM protein from Staphylococcus aureus, a metallopeptidase involved in autolysis31. It was demonstrated that cleavage in the N-terminal chain causes its peptidase activity to be activated32. Moreover, MEROPS proteins have specificity to peptidoglycan polyglycine regions, some with suggested cell wall metabolism activity33. In agreement, the C. glutamicum mepB gene was described as part of the MtrAB regulon, a two component system implicated in osmoregulation and cell wall metabolism control34. Although it is not clear whether mepB is secreted or membrane bound, it has been suggested that its activity would occur extracitoplasmically30. Considering this, C. glutamicum mepB may have an important role in cell wall metabolism and/or heterologous protein secretion integrity, and its activity is likely regulated by cleavage of its N-terminal.Top-down proteomics is efficient in identifying cleaved proteoforms. For example, mepB, a membrane protein related to the metalloendopeptidase Q8NS24) was identified by a portion of its sequence with precursor mass of 14.464\u00a0kDa. This mass corresponds to the loss of 97 amino acid residues from its N-terminal region  cycle is an important step in l-glutamate production by C. glutamicum. It is well established that the decrease of 2-oxoglutarate dehydrogenase complex (ODHC) activity occurs in conditions that induce l-glutamate production37. Furthermore, ODHC activity was found to be regulated by the phosphorylation status of oxoglutarate dehydrogenase inhibitor . Thus, the phosphorylated proteoform of OdhI is unable to interact with ODHC, whilst, unphosphorylated OdhI interacts with ODHC inhibiting 2-oxoglutarate conversion to succinyl-CoA11  and dehydration (\u0394m\u2009=\u2009\u221218\u00a0Da). Conversely, two proteoforms were identified with potential biological relevance: one of them with N-terminal cleavage of three residues and another one with \u0394m of 70\u00a0Da . In the present study, the exact site of the modification resulting in the 70\u00a0Da mass shift in OdhI could not be identified due to the complexity of the spectra and limited fragmentation by MS/MS. Therefore, other modifications such as 5 methyl group additions (14\u00a0Da), and acetylation (42\u00a0Da) followed by formylation (28\u00a0Da) could not be excluded. As aforementioned, ODHC inactivation arises from the interaction of unphosphorylated OdhI and the OdhA subunit of ODHC. The T14 OdhI phosphorylation inhibits this interaction, resulting in ODHC activation10. OdhI has a fork-head associated (FHA) domain responsible for the recognition of a phosphothreonine residue. Furthermore, this domain is the region that interacts with the OdhA subunit of ODHC, resulting in its inactivation. Moreover, it was demonstrated that the phosphorylation of the OdhI threonine residue causes drastic changes in its conformation, leading to an auto inhibition of its function, consequently activating ODHC39. More recently, it was reported that K142 succinylation also affects the OdhI\u2013ODHC interaction, hampering the inhibition of ODHC with impacts on C. glutamicuml-glutamate production40.Recently, the 70\u00a0Da mass shift was identified in the GM-CSF heterologous expressed protein in 40, we investigated such a modification in addition to N-terminal formylation (27.9949\u00a0Da\u2009+\u200942.0106\u00a0Da) as a possible cause of production of the 70\u00a0Da OdhI proteoform. However, these modifications resulted in a considerable loss of matched fragment peaks (data not shown). Therefore, it is improbable that this was the source of such a mass shift. Moreover, the suggested region for the 70\u00a0Da \u0394m is near to the known T14 phosphorylation site of OdhI, consequently raising the question if it could affect its interaction with ODHC. OdhI phosphorylation at T14 is mainly catalyzed by C. glutamicum PknG10. Considering the recognition capacity of the OdhI FHA domain of its phosphothreonine and the close location of this phosphorylation site with the 70\u00a0Da \u0394m proteoform, this modification may affect OdhI inhibition of ODHC, resulting in its activation or inactivation .Another protein with relevance to the glutamate production process is the heavy-metal-associated domain (HMA) containing protein . Its corresponding transcript was identified as up-regulated in a series of glutamate overproduction conditions, however its function in this process remains unclear42. To clarify C. glutamicum HMADP function, the Q8NL68 protein sequence was blasted against the UniprotKB reference proteomes plus Swiss-Prot database with default parameters in Uniprot, resulting in similarity to copper chaperone and heavy metal transport/detoxification proteins  and lysine (K47) near C51. Moreover, the C51 is the resolving residue and was suggested to be very important in the catalytic process of this peroxiredoxin46.Two oxidations of cysteines result in the formation of sulfinic acid, which is an irreversible modification and signal for protein degradation47. Therefore, there is a good chance that the peroxiredoxin protein of C. glutamicum undergoes oxidative modifications which could regulate its activity and integrity. Furthermore, the suggested modification by a ONE peroxidation suggests a possible role of this protein in cell membrane repair.Less common \u0394m values were observed in a peroxiredoxin (Q8NMS6). One proteoform with a mass shift of 154\u00a0Da was identified and N-terminal acetylation was also detected , described as thiol-disulfide isomerase and thioredoxins, was identified by two proteoforms, both with N-terminal cleavage of 26 amino acid residues. Interestingly, one proteoform was identified with approximately \u22122\u00a0Da mass shift in a region near two cysteines  and pre-culture was performed overnight in tryptic soy broth under 170\u00a0rpm agitation at 30 \u00b0C. Afterwards, the pre-culture was used to inoculate three flasks containing CGXII media 49 [start optical density (OD)\u2009=\u20091.0]. The samples were grown for 36\u00a0h under 170\u00a0rpm agitation at 30 \u00b0C. Growth measurements were assessed by OD600 using a spectrophotometer CLARIOstar .C. glutamicum cultures were harvested and centrifuged at 12,000\u00d7g for 10\u00a0min at 21 \u00b0C. Pellets were washed with CGXII medium minus glucose, by resuspending the pellet and centrifuging at 12,000\u00d7g for 10\u00a0min at 21 \u00b0C. Cells were then resuspended in lysis buffer , followed by physical disruption through maceration in liquid nitrogen. After maceration, the solution was centrifuged at 20,000\u00d7g for 15\u00a0min at 21 \u00b0C to separate insoluble particles, and the supernatant with soluble intracellular proteins was stored at \u221280 \u00b0C until further use. Proteins were then quantified by Qubit\u2122 (Invitrogen). A pooled sample was prepared using equal protein quantities of each replicate and 500\u00a0\u00b5g of the pooled sample was fractionated by Gel-eluted Liquid Fraction Entrapment Electrophoresis\u2014GELFrEE50, using a homemade cartridge with 12% resolving gel and 4% stacking gel. First, the sample was diluted in sample buffer 2\u00d7 , then it was submitted to electrophoresis using a running buffer  and a constant current of 10\u00a0mA. Fractions were collected according to time (in minutes) after bromophenol blue elution (0\u00a0min). Subsequent collections were as follows: 1, 2, 3, 4, 5, 7, 9, 11, 13, 15, 20, 25, 30, 45, 60, 75, 90, and 120\u00a0min. The molecular mass range of proteins from each fraction was assessed by SDS-PAGE51. GELFrEE fractions were then submitted to methanol/chloroform/water precipitation for SDS removal52. Briefly, four volumes of methanol were added to the fractions, followed by addition of 1 volume of chloroform and 3 volumes of water, with 30\u00a0s of vortexing subsequent to the inclusion of each solution. After water addition and vortex, the solutions were submitted to centrifugation at 20,000\u00d7g for 10\u00a0min at 21 \u00b0C, resulting in the formation of two layers, with proteins floating between them. Then, the superior layer was removed, with care to prevent disturbing the protein pellet, and 3 volumes of methanol were added, followed by gentle mixing and centrifugation at 20,000\u00d7g for 10\u00a0min at 21 \u00b0C. Subsequently, the supernatant was discarded, followed by a second wash with 3 volumes of methanol as described before, and the resulting pellet was dried in a laminar flow bio-hood. After drying, pellets were resuspended in 5% acetonitrile and 0.1% formic acid and stored in \u221280 \u00b0C before LC\u2013MS/MS.m/z, using a dynamic exclusion duration of 30\u00a0s. Source-induced dissociation (SID) was used with 15\u00a0eV in MS1 and the first MS2, whilst for the second most intense ion, it was set to 35\u00a0eV. Resolutions were 240,000 and 120,000 for MS1 and MS2, respectively. The mass spectrometry proteomics data have been deposited to the ProteomeXchange Consortium via the PRIDE53 partner repository with the dataset identifier PXD038038.Three technical replicates of GELFrEE fractions 0, 1, 2, 3, 4, 5, 7, 9 and 11 were submitted to top-down analysis on a nano-UHPLC Dionex Ultimate 3000 system coupled to Orbitrap Elite\u2122 mass spectrometer  (LC\u2013MS/MS). Analytical  and trap  columns packed with PLRPS 1000 A, 5\u00a0\u00b5M  were used for reverse phase separation. In the analytical column a tip of approximately 1\u00a0cm was pulled using a P-2000 instrument , to be used as emitter in the mass spectrometer. Both columns were kept at room temperature, controlled at approximately 22 \u00b0C. Samples were loaded using a flowrate of 3 \u00b5L/min for 10\u00a0min, under the isocratic condition of 5% Acetonitrile and 0.1% formic acid, then a gradient under flow of 0.230 \u00b5L/min was used to elute proteoforms from the column for MS analysis. The gradient was composed of solutions A (formic acid 0.1%) and B  and was created by: 5% B (0\u201310\u00a0min), 20% B (10\u201355\u00a0min), 55% B (55\u201360\u00a0min), 85% B (60\u201380\u00a0min) and 5% B (80\u201390\u00a0min). Acquisitions were made during the 90\u00a0min gradient in positive mode, and the top-2 most abundant ions were fragmented by stepped high-energy collisional dissociation (HCD) applying normalized collision energy of 25, using two steps, with collision energy width of 10, resulting in two separated fragmentations of ions with normalized collision energy of 20 and 30, and analysis of all resulting fragments together in the Orbitrap. Isolation width of precursors was 25\u00a054. Identification and characterization of proteoforms were done using the TopPic suite software tool, version 1.455. Briefly, spectra were deconvoluted using TopFD with default parameters followed by identifications against a C. glutamicum ATCC 13032 reference proteome (11-2020), obtained from UniProt (https://www.uniprot.org/). Two mass shifts between \u2212500\u00a0Da and 500\u00a0Da were allowed in the identification and the N-terminal forms were set as \u201cNONE\u201d (No modifications), \u201cNME\u201d , \u201cNME-ACETYLATION\u201d , and \u201cM-ACETYLATION\u201d . A false discovery rate strategy was adopted with a decoy database, resulting in the identification of only proteoforms with FDR below 1% at the proteoform spectrum matches (PrSMs) level. Proteoform characterization and annotation were followed by visual interpretation of TopMSV21 files. Detected proteins\u2019 MW evaluation and retention times were performed using VisioProt-MS56.Thermo raw files were converted to MzML format using the MSConvert tool57 and ggplot258. Briefly, the number of identified mass shifts (\u0394m) was counted and the frequency of the most common \u0394m were defined based on rounded values. Then, the number of amino acid residues modified by each \u0394m was defined. Functional annotation and overrepresentation analysis were performed using the String Cytoscape app60, and DAVID61. Visual interpretation of DAVID overrepresented terms was also carried out using R computer language through the creation of a bubble plot with the tools present in ggplot2.Proteoforms identification data were analyzed in R 4.0.2 (R Core Team 2020) using the packages tidyverseSupplementary Figures.Supplementary Table 1.Supplementary Table 2.Supplementary Table 3."}
+{"text": "Depression has major consequences for the entire family, among them emotional distress, disrupted daily routine and social damage caused by negative stigmas. The aim of this study was to explore the retrospective experiences of young adults who lived with a sibling with depression while they were adolescents. The present study adopted a qualitative-phenomenological approach. The research participants were recruited via purposive sampling on social networks across Israel from May to September 2022. Semi-structured interviews were conducted with 21 participants aged 18\u201329 who lived with a sibling with depression during their adolescence. Data collection continued until saturation of concepts was reached. The results underwent thematic analysis. Three themes emerged from the qualitative analyses: 1) \u201cI felt like I was living in a minefield\u201d: Adolescence while living with a sibling with depression; 2) \u201cOne step forward and two steps back\u201d: Siblings\u2019 coping strategies; 3) \u201cMy parents were not there for me when I needed them\u201d: Participants\u2019 experiences with their parents during their adolescence. The research findings indicate that adolescents who grew up with a sibling affected by depression had to cope with an acute family crisis, whose serious ramifications required emotional and social support. Mental health professionals and counselors working within educational institutions and the broader community should provide support and intervention for adolescents who have siblings struggling with depression. This intervention may take the form of individual or group therapy that aims to foster a sense of belonging and help affected individuals. Creating a supportive environment that meets the needs of the affected siblings is also crucial in addressing this issue effectively. Depression is a common and serious psychiatric disorder that finds expression in depressed mood, loss of pleasure and interest, feelings of emptiness, sleep disruptions, and loss of appetite . DepressNot only does depression affect the individual sufferer. It also affects the entire family. Young adults who lived with a sibling with depression are themselves at increased risk for distress and mental illness \u201310. ReseLiving in the same house as a sibling with depression is liable to have a negative impact on an individual\u2019s emotional well-being, produce feelings of distress and anxiety, and cause the individual to perceive of the sibling as a burden \u201310. The Adolescents living with a sibling with depression are themselves at high risk of developing depression. There are several explanations for this, including genetics, similar life experiences, parental resources devoted to caring for the sibling with depression, and family climate . BarnettDespite its resemblance to adolescence, the period of emerging adulthood is marked by unique features that define it as a separate developmental state. Unlike adolescents, young adults have already reached physical and sexual maturity. They are legally responsible for their actions and can therefore decide what to do, where to work, and where to live. Yet unlike mature adults, they are not yet stable financially, personally, or professionally . SeveralMany studies have examined the experiences of adolescents with depression and the perspectives of their parents , 19. YetThe study was conducted according to the qualitative phenomenological approach, which attempts to obtain an in-depth understanding of the studied phenomenon by entering the world and experiences of the participants . The appTwenty-one young adults who lived with a sibling with depression while they were adolescents participated in the study. The participants, who ranged in age from 18\u201329 years old, all grew up in the same house as a sibling with depression . Most of the participants were single (90.47%) and none had children of their own. Inclusion criteria were: 1) lived in the same house with a brother or sister with depression when they were adolescents; 2) between the ages of 18 and 29 years old; 3) lived at home during adolescence (not at boarding schools); 4) biological siblings from the same two parents . These inclusion criteria were used to create a homogeneous group and reduce intervening variables. Exclusion criteria were: 1) brother or sister with a history of psychosis; 2) participants currently exhibiting suicidal intent or severe depression because of concerns about the adverse effects of the interview process; 3) participants who identified themselves as having depression .The research participants were recruited via purposive sampling on social networks  across Israel. Young adults who grew up with siblings with depression were examined. Participants responded to a letter posted on social media by sending an email with their details. After receiving a comprehensive explanation about the general research aims, interviewees signed an informed consent form. For the interview, they also were required to submit a medical record documenting their sibling\u2019s history of depression during their own period of adolescence. Three participants who did not submit a medical document testifying to their sibling\u2019s depression were eliminated from the study.The interviewers (IL and ML) were both females. IL is a psychotherapist (PhD) and ML holds a master\u2019s degree in educational counselling. Both are experienced in conducting qualitative research. Prior to conducting the interviews, the interviewers reflected on the identities, social locations, assumptions, and life experiences they brought to the research endeavor and contemplated their interactions with the interviewees. The interviews took place between May and September 2022 and were conducted via the Zoom platform to minimize personal contact during the COVID-19 pandemic. The interviews lasted about one hour, on average.All interviews were recorded and transcribed verbatim. The interviews were conducted in Hebrew, and the transcripts were translated into English. Each translation was verified by two native speakers, one of whom is a professional translator. Once theoretical saturation was reached , no additional interviews were conducted.The qualitative data in this study were collected by means of in-depth, semi-structured interviews. The interviews were conducted based on an interview guide that included significant key areas but were flexible enough to allow a dialogue to develop between the interviewer and the interviewee, as well as to facilitate meaningful self-expression  Table 2Table 2.audio recordings. Phase six entailed describing the themes and the underlying story describing how the phenomenon was experienced and adding illustrative quotations [The data collected in the interviews were analyzed thematically in six phenomenological phases . In Phasotations .This study was approved by the Ethical Review Board of the Oranim College Research Ethics Committee, Israel) No. 117/2022) and conformed to the Declaration of Helsinki . InformeAnalysis of the interviews yielded three themes that shed light on the experiences of the research participants as adolescents growing up with a sibling with depression .The research participants described the period before their sibling was diagnosed with depression as \u201cfoggy\u201d. During this period, they felt a lack of clarity and confusion regarding their sibling\u2019s condition. Some of the participants mentioned their difficulty in understanding their sibling\u2019s emotional distress. Often, they accused their sibling of disrespecting their parents, acting like a crybaby, exaggerating things or trying to attract attention. Others felt that their sibling was suffering but they had no way to help. The research participants described their complicated feelings during that period, particularly their anger, frustration, helplessness, and loneliness. After the depression diagnosis, the participants stated they were able to identify depressive symptoms in their sibling, such as social problems, diminished sharing and fewer emotional discussions, a tendency toward seclusion at home, suicidal thoughts and self-harm, profound sadness or loss of meaning in life. In most cases, the depressive symptoms identified after the diagnosis worsened with time, and the research participants\u2019 sense of distress increased accordingly.When my sister came home from the army, all she did was cry, repeatedly state how bad things were for her, tell us that the other girls in the course did this or that to her and she couldn\u2019t find any friends there\u2026. For me this was just that she is a drama queen, she exaggerates everything, that\u2019s how it started\u2026 at some point I really began to be angry with her because it was impossible to talk to her .Some of the participants felt that their sibling\u2019s illness was an existential state of emergency that generated a storm at home. Participants described a situation in which they, as adolescents, experienced ups and downs in their lives but were forced to repress these due to the centrality of their sibling\u2019s illness. Batia, 20 years old, describes her frustration because her brother\u2019s pain did not leave any room for the rest of the family to cope with their problems. Indeed, a hierarchy of challenges emerged, and she felt she was at the bottom of the ladder:I felt like I was living in the middle of a huge minefield. I remember times when I felt I was not allowed to get angry, not allowed to feel insulted, not allowed to feel anything, because other people have things so much worse. I remember when my brother broke up with his last serious partner, and he just didn\u2019t come home, and it was as if\u2026. no one else was allowed to have any problems in life because his situation was so difficult .Within the storm and huge family crisis, many of the participants felt they had to remain constantly on alert. They felt they had to enlist themselves to help with the family crisis, even at the price of self-sacrifice and self-nullification. These participants put aside their personal commitments and desires, including social connections, hobbies, or attention from their parents. Doing this exacted a steep emotional price from them, and they experienced negative emotions such as anxiety, stress, and sadness. Yet nevertheless, the research participants felt they had no choice but to do their part.When my sister was receiving outpatient care, she was at home all the time and needed supervision all the time. Someone always had to be with her and keep her occupied. On many occasions she would lock herself in the bathroom or in her room and my parents would cry \u2026 that was always so chaotic, with everyone crying and screaming because they were convinced she would never come out. As the person who was closest in age to her, I was always the one who had to deal with her, take her places, stay with her .A significant number of research participants witnessed behaviors such as self-harm, verbal and physical violence directed towards them or their parents, and hospitalization in psychiatric wards. These situations led to intense fear, worry, stress, anxiety, instability, and insecurity within their own homes. The research participants did not know how to handle the reactions of their siblings, who were required to perform various actions even when they were struggling with depression. The unexpected responses surprised the research participants, causing them panic and shock.During a youth movement trip, I began telling my sister how I felt about her condition, but she showed me her cuts, silencing me. I felt hurt and scared by her actions because this was the first time I had witnessed her self-harming behaviour. I was upset but tried to reassure her by asking her whether she would hurt herself again .Participants in the study viewed their sibling\u2019s illness as an existential crisis, creating turmoil at home and resulting in feelings of emotional distress, frustration, and loneliness. They described their adolescence as a time of suppressed emotions due to the importance of their sibling\u2019s illness. Amidst this family turbulence, many felt a constant need to be on alert and were willing to put the family\u2019s needs above their own, even at the cost of personal sacrifice.In the midst of the storm and the great rift, many of the siblings felt they needed to remain constantly vigilant and ready to act. They felt they had to mobilize themselves to help the family, even at the cost of sacrificing their personal needs. These participants reported that their sibling\u2019s illness \"came at their expense\u201d. They described pushing aside personal obligations and wishes, including social relationships, hobbies, or attention from their parents. Their sibling\u2019s condition exacted many personal costs from them, including damaging their social relationships and eliciting negative feelings such as sadness, stress, pressure, and anger. Still, the research participants felt they had no choice but to carry out their obligations to the family.During the periods my sister was treated as an outpatient, she was always at home and always had to be supervised. I always had to be with her and keep her occupied. On many occasions she would lock herself up, lock herself in the shower, or lock herself in the room and my parents would cry\u2026. Because I\u2019m the closest to her in age, I tried to be with her because she always really trusted me and was very attached to me. So I always kept her occupied and stayed with her. Many times I would take her to the beach or I would just stay with her at home, trying to find things we had in common .The participants stated that their relationship with their siblings during that period was not reciprocal but rather focused on the sibling with depression. They took care of their sibling, devoted emotional resources and time, tried to engage the sibling in conversation, and showed concern for or physically protected their sibling. In contrast, the affected sibling was engrossed in his/her own world and was not emotionally available to pay attention to what was happening in the world of the research participants:I was totally there. I was fully engrossed, in action mode. I didn\u2019t ask too many questions. Apparently I understood there really wasn\u2019t anyone to talk to. It was an emergency situation\u2026 I often sat beside her all night long, I engaged in guided imagery, lots of discussions, I was totally drawn in and devoted myself totally, and afterwards I was totally drained .Other participants, in contrast, reported that their sibling\u2019s difficulties frightened them to the point of avoidance. As young adults they recognized their sibling\u2019s condition made them feel unwanted, rejected and sometimes even in the way at home. They expressed fears that society would assign a negative label to them because of their sibling\u2019s illness. Hence they spent many hours at the homes of friends and relatives and devoted lots of time to demanding sports activities or hobbies. They defined their relationship with their sibling as \u201cnonexistent\u201d, possibly due to repression resulting from having trouble seeing their sibling in this situation. Despite the lack of communication between the siblings, the research participants reported feelings of guilt, anger, fear, helplessness, and distress when thinking about their sibling.At home they saw me as a guest, someone who comes home on weekends and holidays. I also wasn\u2019t so involved in what was going on at home, certainly not in the lives of my siblings. As a child it was very difficult to communicate with my sibling on a certain level, I didn\u2019t have the tools for that .Many participants felt the need to prioritize their family\u2019s well-being over their own personal needs, sacrificing social relationships and hobbies. The illness of their sibling often led to strained social connections and feelings of sorrow and stress. Nevertheless, they saw their responsibilities towards their family as inescapable. On the other hand, some participants reacted to their sibling\u2019s challenges with fear and avoidance. Internal feelings of rejection and concerns about societal stigmatization drove them to find solace with friends or immerse themselves in intense hobbies.The young adult research participants reported that when they were adolescents, their sibling\u2019s depression was a factor in how close they felt to their parents, whether they were able to share experiences with their parents, and whether they could rely on their parents for support. Some of the participants described how they lost the positive and significant relationship they had with their parents before their sibling\u2019s illness. Nili, age 28, reported that she had a good relationship with her parents before the onset of her sister\u2019s illness. Yet after her sister began experiencing symptoms of depression, Nili said that her parents focused all their energy on her sister, leaving her feeling neglected. She recalled that \u201cthey no longer seemed really interested in me\u201d.According to Ido, before the onset of his sister\u2019s depression he had many problems in elementary school and relied on his parents to help him solve them. When his sister\u2019s depression began to emerge and as it escalated, Ido stopped \u201ccausing problems\u201d or asking for his parents\u2019 help. In retrospect he described himself during high school as \u201ca remote and easy kid that my parents did not need to deal with very much\u201d. The feeling that the parents are not available or attentive to their needs came up in other interviews as well. For most of the participants, their relationship with their parents was marked by feelings of rejection, disappointment, and abandonment. Most noted that they yearned for a deeper, more inclusive, and more meaningful relationship with their parents. The research participants did not want to disappoint or make things any harder for their parents, who already were so sad and in so much pain, so they tried to please them and win their love. They tried to be \u201cperfect children\u201d and to avoid behavior or situations that might make their parents uncomfortable. Sarah commented on the need to meet her parents\u2019 expectations and maintain an external image of being problem-free, even though inside she was struggling with many difficulties. She behaved this way to satisfy her parents:I excel and am wonderful and do everything I should, so that on the outside there is no reason to be ashamed of me, as opposed to\u2026 A brother with depression is something to hide, but about me they can brag all the time .Some of the participants reported that they tried to assume parental roles at home, such as watching their sibling, taking him/her to treatments, or doing all sorts of chores to make things easier for their parents. This desire to please their parents was typical of many of the research participants and caused them fatigue and burnout:On the weekends I would come home from university and spend lots of time there doing things my mother never had time for, like cleaning the house, taking the dog for a walk, doing laundry, anything that my mother could never find time for because she was busy with my sister 24/4 .Participants also had to cope with the challenge posed by their parents\u2019 request that they conceal their sibling\u2019s condition from people outside the family. Sometimes the parents directly asked them \u201cto hide\u201d, while in other cases the participants extrapolated this from their parents\u2019 behavior. Hence, the participants were left alone to cope with difficult incidents and complex experiences, without being allowed to share their feelings and receive support from those around them. For many this led to isolation and sadness.They always told me not to tell anyone. I remember that my mother insisted that I keep this a secret, and also my father\u2026 It was also clear to me from their behavior and their language that this is what was expected of me. Today I understand how much this lack of communication, these scare tactics, influenced me .Many participants noted a deterioration in their positive relationships with their parents after their sibling\u2019s illness. They felt rejected, disappointed, and abandoned. Many expressed a longing for a deeper connection with their parents and aimed to be the \u2019perfect child\u2019 to please them, even amidst feelings of neglect. Additionally, they faced the challenge of keeping their sibling\u2019s condition a secret, as requested by their parents.The effects of depression are not limited to the afflicted individual, for they also extend to the individual\u2019s siblings. Young adults living in the same household with a sibling with depression are at increased risk of emotional distress, reduced social status, diminished self-esteem, and negative stigmatization of their family \u201310, 12. The participants in the current study reported feeling guilty as a result of their sibling\u2019s behavior and inability to function, as well as anger, confusion, and instability. They described their adolescence as a period of constant tension, anger, and worry. The findings of this study are in line with the findings of previous studies describing the difficulties experienced by siblings living with a brother or sister with a chronic illness or mental health condition , 27, 28.Some of the participants in the current study reported that despite the difficult situation at home, they felt they must help the family, even if it meant relinquishing their own needs. Other participants, in contrast, chose to stay away and avoid the stormy atmosphere at home. Indeed, the participants adopted two main approaches to cope with this complex situation: merging or avoidance. Merging entails enlisting oneself to the benefit of the sibling with depression to the point of self-nullification, while avoidance involves cutting oneself off and distancing oneself from the sibling. The merging pattern helped the participants feel useful and valuable in helping cope with the distressful situation at home, but on the other hand it also had a negative impact on their personal lives.The findings of the present study demonstrate a consistent pattern reflecting the significance of the term \"family burden\" in characterizing the adverse impact on individuals who care for family members living with mental illness . Family In contrast, participants in the current study who adopted the avoidance pattern avoided communicating with their sibling with depression and sometimes even distanced themselves from the entire family in order not to be flooded emotionally. Participants who chose to cut themselves off from their sibling with depression expressed a fear that society would assign negative labels to them because of their sibling\u2019s illness. The research literature contains abundant evidence showing that the individual with mental illness is not the only one who must cope with negative stigmas. Rather, a negative label is often affixed to the entire family in what is known as \u201cstigma by association\u201d , 43, sucIn our study, participants indicated that their relationship with their parents changed after their sibling became ill. The sibling\u2019s difficulties made their parents less available to them and resulted in feelings of neglect, disappointment, loss, and pain. These findings are in line with other research evidence showing that parents\u2019 lack of availability due to the illness of one of their children has a negative impact on the other children in the home , 28, 31.Moreover, the research participants reported having trouble witnessing their parents\u2019 difficulties, which caused them deep pain and sorrow. They invested major efforts to bring their parents some degree of pleasure, to make things easier for them, and to spare them further pain. The research participants noted that they sought to please their parents in an attempt to compensate them. The findings of the current study reinforce previous findings indicating that quality of parental emotional support acts as a mechanism safeguarding the mental health of the siblings of those with mental health issues , 28, 44.Some of the features of the research participants\u2019 relationships with their parents are reminiscent of the experience of losing someone close. This type of loss includes profound feelings of extinction, destruction, and loss. The parents and family members of someone with mental illness experience significant losses that engender grief . Such grThe strength of this study lies in the fact that it is a qualitative study focusing on participants who lived with a sibling with depression during their adolescence. The interview format allowed for a more detailed and in-depth investigation of the participants\u2019 perceptions and perspectives, thus adding more information to previous findings regarding this phenomenon. This format led to the creation of a homogeneous group of individuals who lived with siblings with depression, in contrast to studies that examined different mental disorders or combined siblings and parents of the affected individual. Another strength lies in the age of the participants (18\u201329). The period of emerging adulthood has been the focus of very few studies in this context. Another major advantage of the qualitative approach is that the inquiry is broad, allowing the participants to raise issues that matter most to them. The current study sheds light on several important themes, such as the emotional effects experienced by the participants, their coping patterns that range from closeness to avoidance, and their longing for the relationship they had with their parents before their sibling\u2019s illness emerged.This study also has several limitations. First, due to its qualitative nature, causal relationships could not be determined. Second, the sample comprised a small cohort of siblings in Israel, so that the results cannot be generalized to other population groups. Third, the data emerging from interviews conducted via Zoom may not be as rich as data emerging from face-to-face interviews. Nevertheless, face-to-face interviews were assessed as less beneficial because they required restrictions in the sampling process given the geographical spread of the participants. Fourth, this study focused on the siblings of people with depression. We created a homogeneous group using inclusion and exclusion criteria. At the same time, because the level of the siblings\u2019 depression was not examined in the study, the intensity of the illness may have differed.Further research is needed to address the potential cultural, ethnic, gender, and age differences in the siblings\u2019 experiences. The long-term experience of the research participants would be a valuable avenue to explore in the future.The findings of this study shed light on the experiences of adolescents who grew up with a sibling affected by depression. The participants felt confused, helpless, and anxious due to changes at home. Some described witnessing their sibling\u2019s withdrawal, self-inflicted injuries, and turmoil at home. The participants described having to repress their own problems as teenagers and feeling lonely due to the unstable home situation. Young adults who lived with a sibling with depression during their adolescence reported that their sibling\u2019s condition brought about changes in their routine and forced them to adjust their behavior to cope with the new situation. Some adopted merging behaviors and attempted to protect their sibling, while relinquishing their own personal desires. Others adopted avoidance coping patterns marked by evasion and escape and tried to conceal their sibling\u2019s condition from others. After the sibling\u2019s illness emerged, the participants distanced themselves from their parents. They felt their parents were no longer available for them and therefore avoided asking for help or sharing their negative experiences.The results of this study suggest that improving our understanding of adolescents who grew up with a sibling with depression may result in more positive and supportive relationships, highlighting the need to consider not only the patient with depression but also the siblings who are emotionally and behaviorally affected. Our findings indicate that intervention and policy approaches in educational settings and in the community are crucial in addressing these issues. Specifically, solutions are needed that can reduce the burdens on siblings by providing them more flexible and tolerant support. To build on the insights gained from the current study, future research should adopt a triangulation approach by conducting follow-up studies that examine the perspective of the sibling with depression as well as provide a more comprehensive understanding of their experiences. Additionally, considering various characteristics of the affected sibling and the entire family, such as age, gender, culture, and single parent status, could provide important context for understanding the impact of depression on siblings. Another recommendation for further research is to interview siblings at different ages and use various qualitative methods, such as diaries and videos, to gain a deeper understanding of their experiences. Lastly, gathering both quantitative and qualitative data at the same time may offer a more complete understanding of the impact of depression on siblings\u2019 emotional well-being and coping patterns."}
+{"text": "We have simulated BiCoO Multiferroic materials, which combine broken space inversion symmetry with time inversion symmetry, have become one of the fastest growing research topics . Two or BiCoOansition ,8,9. Sucaterials . By optiplitting . BiCoO3 factants . The Ne\u00b43\u2212xBiCoO3. Due to  texture ,15.On the other hand, the properties of thin films could be prominently affected by epitaxial strain derived from lattice mismatch between a thin film and the underlying substrate . In thisy, and We conducted first-principles calculations by the Vienna Ab initio Simulation Package (VASP) with projector augmented wave (PAW) pseudopotentials based on the density functional theory (DFT) ,18. The ous work ,22,23,24d NaNbO3 ,25,26.i and the corresponding displacement of atom i along the direction i runs over all the atoms in the unit cell. The structural symmetry of strained epitaxial phases are determined by the use of the FINDSYM program [The ferroelectric polarization is computed by means of Berry phase ,28. One  program .t < 1) is inconsistent with BaTiOThe perovskite BiCoOe factor ,(5)t=(rc radii) ,33, respAnalogous to the typical ABOeriments . Bi atomWe first calculate the evolution in the total energy with the in-plane lattice parameter for the low-energy states. The ground state is a bstrates  can provLet us now turn our attention to the phase transition from the ed BiFeO3, i.e., tansition ,38, can ubstrate . Moreovea are equal to 3.72, 4.03, 4.18, and 4.47 \u00c5, respectively, which are redefined by the FINDSYM program.As the strain continues to increase, the y-axis.Note that the orientation of ferroelectric polarization tends to tilt away from the out-of-plane in the transition of At the same time, the pyramidal CoO5 in the otations ). With that Ref.  also repThe Nulations ,41 by coa) and (b) and presents a direct comparison between our theoretical predictions and the measured transition temperatures. Hence, we employ the conventional value of 4.8 eV for UThe calculated Neratures ,42. The We also solve the Hamiltonians to obtain TIn summary, we have used density functional theory calculations to investigate misfit strain-induced structural phase transition in epitaxial (001) BiCoO"}
+{"text": "Transport of Miro1/TRAK by kinesin-1 is not affected by Ca2+. Instead, we demonstrate that the microtubule docking protein syntaphilin induces resistive forces that stall kinesin-1 and dynein-driven motility. Our results suggest that mitochondrial transport stalls by Ca2+-mediated recruitment of syntaphilin to the mitochondrial membrane, not by disruption of the transport machinery.Mitochondrial transport along microtubules is mediated by Miro1 and TRAK adaptors that recruit kinesin-1 and dynein-dynactin. To understand how these opposing motors are regulated during mitochondrial transport, we reconstitute the bidirectional transport of Miro1/TRAK along microtubules in vitro. We show that the coiled-coil domain of TRAK activates dynein-dynactin and enhances the motility of kinesin-1 activated by its cofactor MAP7. We find that TRAK adaptors that recruit both motors move towards kinesin-1\u2019s direction, whereas kinesin-1 is excluded from binding TRAK transported by dynein-dynactin, avoiding motor tug-of-war. We also test the predictions of the models that explain how mitochondrial transport stalls in regions with elevated Ca The mechanisms of microtubule-based mitochondrial transport remain poorly understood. Here, the authors show that the mitochondrial TRAK adaptors activate the dynein-dynactin complex, enhance the motility of kinesin, and can scaffold both motors to control bidirectional transport. In neurons, mitochondria are distributed to distal regions where ATP and Ca2+ buffering are in high demand, such as synapses and axonal branches1. Mitochondrial transport is essential for axonal growth and branching, maintaining action potentials, and supporting synaptic transmission1. Aged and dysfunctional mitochondria need to be transported back to the cell body for degradation2. Defects in mitochondrial transport are associated with a variety of neurodegenerative disorders, including Parkinson\u2019s disease1.Mitochondria are cellular power plants that generate most of the ATP needed for many biochemical reactions and have a high capacity to buffer cytosolic Ca3. Miro1 is composed of two GTPase domains and two EF-hands that bind Ca2+. Miro1 is localized to the outer mitochondrial membrane through its transmembrane domain5, and is coupled to the C-terminus of the trafficking of kinesin-binding (TRAK) adaptors6. The N-terminal coiled-coil domain of TRAK1 and TRAK2 recruit\u00a0kinesin-1 and dynein-dynactin7, which transport mitochondria towards the plus- and minus-ends of microtubules (MTs), respectively9. Co-immunoprecipitation studies showed that TRAK1 recruits both dynein and kinesin whereas TRAK2 primarily interacts with dynein7. TRAK1 was found to be enriched in the axons of cultured neurons, while TRAK2 was found mainly in dendrites7, suggesting that these adaptors have nonredundant roles in mitochondrial trafficking.Early genetic screens identified the mitochondrial Rho GTPases Miro1 and Miro2 as essential factors regulating mitochondrial transport and quality control13. The complex transport properties of mitochondria are primarily driven by Miro1, TRAK adaptors, motors, and other associated factors1, but little is known about how these components control directionality and pausing\u00a0of mitochondria. In vitro reconstitution studies showed that TRAK1 binds and activates kinesin motility14. TRAK2 was also shown to recruit both kinesin and dynein and regulate their activity in cell extracts15, but the underlying mechanism of how TRAK facilitates the activation and coordination of these opposing motors and mediates the transport of Miro1 is not well understood.Live cell imaging studies showed that mitochondria exhibit rapid anterograde and retrograde transport, interspersed with infrequent pausing and directional switching in axons and dendrites1. Studies in cultured neurons demonstrated that mitochondrial transport stalls when local Ca2+ concentrations are elevated8. Yet a rise in the cytosolic Ca2+ concentration fails to halt mitochondrial transport when an EF-hand mutant of Miro1 is expressed in neurons and other cell types17, indicating that Miro is the Ca2+ sensor that facilitates this process. However, the mechanism by which Ca2+ binding to Miro1 prevents motors from driving mitochondrial transport remains controversial18. The \u2018motor detachment\u2019 model proposes that Ca2+ binding to Miro1 decouples kinesin from TRAK5. In the \u2018Miro-binding\u2019 model, Ca2+ binding causes Miro1 to directly interact with the kinesin motor domain and inhibits its motility17. These models do not explain how elevated Ca2+ concentration also stops the retrograde mitochondrial transport driven by dynein. In addition, the knockdown of both Miro1 and Miro2 does not completely suppress Ca2+-induced arrest of mitochondria in neurons19, suggesting that the Ca2+-mediated arrest may function independently of the transport machinery. Recent studies in mouse models proposed an alternative model, in which a mitochondrial docking protein, syntaphilin (SNPH) anchors mitochondria to MTs in axons18. SNPH is recruited to mitochondria in response to sustained neuronal activity and elevated Ca2+ levels18. This model is supported by the observations that overexpression of SNPH completely abolishes mitochondrial transport in both directions and that increasing cytosolic Ca2+ fails to arrest mitochondrial transport in axons of SNPH knock-out neurons20. The \u201cengine-switch and brake\u201d model proposes that SNPH inhibits kinesin through direct molecular interactions and serves as a brake by anchoring mitochondria to MTs20. The predictions of these models could not be directly tested in vitro due to the lack of reconstituted assays from purified components.In mature neurons, two-thirds of mitochondria are docked to MTs2+-mediated stalling of mitochondrial transport. Miro1 stably interacts with kinesin/TRAK, and the motility of this complex is unaffected by excess Ca2+. However, static anchoring by SNPH is sufficient to stall kinesin or dynein motility. These results provide insight into the regulation of mitochondrial transport.In this study, we investigated the role of Miro1 and TRAK in the recruitment and activation of dynein and kinesin motility using in vitro reconstitution. We show that TRAK1 and TRAK2 activate dynein-dynactin motility. TRAK1 also increases the kinesin landing rate onto MTs but the MT-associated protein MAP7 is required to stimulate robust kinesin motility. TRAK1 or TRAK2 can simultaneously recruit dynein-dynactin and kinesin and these complexes are exclusively transported to the plus-end of MTs by kinesin. In comparison, kinesin does not colocalize to the TRAK adaptors transported to the minus-end by dynein/dynactin, demonstrating that TRAK coordinates the activity of opposing motors to avoid futile tug-of-war. We also distinguished between the predictions of the existing models of Ca22. Sequence alignments with established dynein adaptors confirmed that TRAK1 and TRAK2 contain the CC1 box that binds the dynein light-intermediate chain (LIC)23 and the Spindly motif that interacts with the pointed-end of dynactin24  led to robust activation of dynein-dynactin motility towards the MT minus-end , and -TRAK21\u2013400 (DDT21\u2013400) complexes  were comparable to that of dynein-dynactin assembled with BicD adaptors in vitro27 and the retrograde transport speed of mitochondria (300\u2013900\u2009nm\u2009s\u22121) in vivo12  resulted in only occasional motility  binds to TRAK11\u2013360, and to a lesser extent TRAK21\u2013360  complexes on MTs  of full-length TRAK1, but we observed little to no increase in kinesin landing rate by the addition of 20-100\u2009nM TRAK11\u2013360, suggesting that TRAK alone is insufficient to trigger robust activation of kinesin motility  about 1.5-fold compared to the no TRAK condition, while we did not observe a significant increase in the presence of 5\u2009nM TRAK21\u2013360  and full-length (TRAK11\u2013953 and TRAK21\u2013914) TRAK constructs with kinesin on MTs   Fig.\u00a0. Collect0%) Fig.\u00a0.14. We also observed MT binding of 150\u2009nM TRAK11\u2013360 and a TRAK1 construct containing the coiled coils and part of the C-terminal domain (TRAK11\u2013532) in the absence of kinesin. However, the affinity of TRAK for MTs was weak and we could not detect MT binding of TRAK11\u2013360, TRAK11\u2013532, or full-length TRAK1 when TRAK concentration was lowered to 20\u2009nM  at low TRAK concentrations  colocalizers moving along the MT . If the direction of DDKT is determined by mechanical competition, we expected DDKT11\u2013400 complexes assembled with KIF5B\u03941\u2013336 to move towards the minus end. However, the addition of excess KIF5B\u03941\u2013336 only resulted in more than a 5-fold reduction in DDT11\u2013400 landing rate  or full-length TRAK constructs  co-precipitated with Miro1  complexes that walk along the MTs  were similar to DDT11\u2013532 only  or excess (2\u2009mM) Ca2+  of TRAK1 was sufficient to co-precipitate with kinesin7. Based on the structures of dynein-dynactin assembled with BicD or Hook family adaptors48, this entire region is expected to run from the pointed to the barbed end of dynactin in active DDT complexes. If kinesin has a smaller footprint on TRAK, it may block some of the pairwise interactions required for the formation of the active DDT complex, but not fully inhibit the binding of dynein and dynactin to the rest of this coiled-coil. In comparison, activation of the DDT complex may block the entire kinesin binding site, and thereby, exclude kinesin from motile DDT complexes. Alternatively, TRAK may coordinate motor binding through a registry shift of its coiled coils, as proposed for the BicD2 adaptor49. These possibilities could be best distinguished by future cryo-electron imaging of reconstituted DDKT complexes at near-atomic resolution.The motility of DDKT complexes was markedly different from the reconstituted kinesin-3/Hook3/dynein-dynactin complex2+ arrest mitochondrial transport. We first tested whether Miro1 dissociates from or inhibits the KT complexes in the presence of excess Ca2+. The assembly and motility of the KTM complexes were unaffected by increased Ca2+ levels, which is incompatible with both \u2018motor detachment\u2019 and \u2018Miro binding\u2019 models17. Our results indicate that Ca2+ binding to Miro1 does not directly disrupt the machinery that transports mitochondria, and thereby Ca2+-mediated docking of mitochondria might occur upstream of the motor transport machinery 50, Armadillo repeat-containing X-linked (Armcx) 1 and 352, and mitochondrial fusion proteins MFN1 and MFN2 have been shown to interact with the Miro1/TRAK complex, and knockdown of these factors led to defects in mitochondrial transport46. The in vitro reconstitution assay we developed provides an experimental platform to investigate the molecular mechanism of how these factors regulate mitochondrial transport.We note that our results do not discount the role of Miro1 to coordinate the arrest of mitochondrial transport. Miro1 may serve as the primary factor that facilitates CaKIF5B; amino acids 1\u2013963, clone ID 8991995) was obtained from GE Dharmacon and fused to GFP-SNAPf at its C terminus. The phi mutant of the dynein-1 heavy chain (DHC) was co-expressed by fusing the coding sequence to the pDyn2 plasmid containing genes encoding IC2C, LIC2, TCTEX1, LC8, and ROBL1, as described26. The list of constructs used for each dataset is given in Supplementary Table\u00a0The constructs expressing the phi-dynein mutant (SNAP\u2013DHC R1567E-K1610E), full-length TRAK1, and full-length TRAK2 were provided in a pACEBac1 vector backbone by A.P. Carter . The sequences encoding full-length or truncated versions of human TRAK1 and TRAK2 were cloned into the pOmniBac vector. All constructs contained an N-terminal His6-ZZ tag followed by a TEV protease cleavage site for protein purification and a C-terminal SNAP-tag or GFP fusion for labeling and imaging purposes. A cDNA for full-length human kinesin  and frozen in liquid nitrogen. Three frozen brains were broken into pieces and blended in a blender in the presence of homogenization buffer supplemented with four EDTA protease-inhibitor tablets per 500\u2009mL (Roche), 1.6\u2009mM PMSF, 1\u2009mM DTT, and 0.1\u2009mM ATP. The brain lysate was gently stirred for 30\u2009min at 4\u00b0C until completely thawed and was then spun in a JLA 8.1 fixed angle rotor (Beckman Coulter) at 8,000 r.p.m. for 45\u2009min at 20 \u00b0C. The supernatant was collected and further clarified using a Type 45\u2009T.i. rotor (Beckman Coulter) at 45,000 r.p.m. for 50\u2009min at 4\u00b0C. The supernatant was then filtered with a glass-fiber filter (Sartorius), followed by a 0.45 \u03bcm filter (Milex Millipore). The sample was loaded into a SP-Sepharose column (Cytiva) pre-equilibrated with SP buffer  using an Akta FPLC (Cytiva). The column was washed with 4 column volumes of SP buffer in the presence of 3\u2009mM KCl followed by elution using a linear gradient up to 250\u2009mM KCl. Fractions collected from the first major peak were pooled, filtered using a 0.22 \u03bcm filter (Milex Millipore), then loaded onto a MonoQ 16/10 column (Cytiva) pre-equilibrated with MonoQ buffer . The column was washed with 10 column volumes of MonoQ buffer followed by elution using a linear gradient up to 150\u2009mM KC1 in 1 column volume, a second linear gradient up to 350\u2009mM KCl in 10 column volumes, and a third linear gradient up to 1\u2009M KCl in 1 column volume. The peak dynactin fractions located at approximately 38 mS cm\u22121 were then pooled and concentrated to a volume of about 3\u2009mL and loaded onto a G4000SW 21.5/600 column (Tosoh Bioscience) equilibrated with GF150 buffer  for gel-filtration. The dynactin peak collected, pooled, and concentrated to approximately 2\u2009mg\u2009mL\u22121 using an 0.5\u2009mL 100\u2009kDa MWCO filter unit (Millipore). 2\u2009\u03bcL aliquots were then flash frozen in liquid nitrogen and stored at \u221280 \u00b0C.Native dynactin was purified from pig brains (Yosemite Foods)280 using Nanodrop 1000 (Thermofisher).The phi mutant of dynein, KIF5B, MAP7, and truncated TRAK1, and TRAK2 constructs were purified from baculovirus-infected SF9 cells (UC Berkeley Cell Culture Facility). Briefly, cell pellets were resuspended in a lysis buffer (see below) supplemented with cOmplete Protease Inhibitor Cocktail (Roche) and lysed using a dounce homogenizer (Wheaton) (20 strokes with loose plunger followed by 20 strokes tight plunger). The cell lysate was clarified by centrifugation at 186,000\u2009g for 45\u2009min, incubated with IgG Sepharose (Cytiva) for 2\u2009hr at 4\u2009\u00b0C, applied to a gravity flow column, and washed extensively with a TEV wash buffer (see below). The protein-bead complexes were then treated with TEV protease  at 12\u2009\u00b0C overnight. The mixture was then centrifuged at 4000\u2009g for 5\u2009min and the supernatant was concentrated using an Amicon Ultra 0.5\u2009mL spin column (EMD Millipore). Protein concentration was determined by measuring the OD, IgG beads were washed with a kinesin TEV wash buffer , and the protein was concentrated using 100\u2009K MWCO spin filter. MAP7 purification was performed using a MAP7 lysis buffer  and MAP7 TEV wash buffer . MAP7 was concentrated using a 50\u2009K MWCO spin filter. Truncated TRAK constructs were purified in the presence of high salt, glutamic acid, and arginine to improve solubility , and protein was concentrated using a 50\u2009K MWCO spin column. Full-length TRAK1 and TRAK2 were purified from HEK 293\u2009F GNTI-/- cells (UC Berkeley Cell Culture Facility) using polyethyleneimine  transfection of the pcDNA and the TRAK purification procedure described above.Different buffer conditions were used for each protein preparation. Cells expressing dynein were lysed in a dynein lysis buffer , IgG beads (Cytiva) were washed with a dynein TEV wash buffer  and the protein was concentrated using a 100\u2009K molecular weight cut-off (MWCO) spin filter (EMD Millipore). For kinesin purification, the cells were lysed in a kinesin lysis buffer 1\u2013592 (Miro11\u2013592-SNAP-psc-StrepII) was purified using Miro lysis buffer  supplemented with 1x protease inhibitor cocktail (Roche) and lysed using a dounce homogenizer. The lysate was clarified by centrifugation at 65,000\u2009g for 45\u2009min, incubated with Streptactin Sepharose beads (IBA) for 2\u2009hr at 4\u2009\u00b0C, applied to a gravity flow column, and washed extensively with Miro wash buffer . The protein was then eluted from beads with 3\u2009mM desthiobiotin and concentrated using a 50\u2009K MWCO spin column (EMD Millipore).Miro11\u2013473 was purified from BL21(DE3) E. coli cells (UC Berkeley QB3 MacroLab). Briefly, cell pellets were resuspended in SNPH lysis buffer  supplemented with 1x protease inhibitor cocktail (Roche) and lysed using a tip sonicator (Branson) for 2\u2009min. The lysate was clarified by centrifugation at 65,000\u2009g for 45\u2009min, incubated with IgG Sepharose beads for 2\u2009h at 4\u2009\u00b0C, applied to a gravity flow column, and washed extensively with SNPH wash buffer . The protein-bead complexes were then treated with TEV protease at 4\u2009oC overnight. The mixture was then centrifuged at 4000\u2009g for 5\u2009min and the supernatant was concentrated using a 50\u2009K MWCO spin column (EMD Millipore).SNPH4, 1\u2009mM EGTA, pH 7.0). Samples were then diluted 1:2 in MB supplemented with 100\u2009mM NaCl, 1\u2009mg\u2009ml\u22121 BSA, and 1\u2009mM DDT and incubated on ice for 2\u2009h to facilitate complex formation. 10% of samples were collected for input lanes and then washed 3x with the MB buffer including supplements. Samples were then resuspended into LDS sample buffer (Invitrogen), boiled for 10\u2009min at 95 oC, and run on an SDS-PAGE gel. Imaging was performed on a GE Typhoon FLA fluorescence imager.For each sample, 10\u2009\u00b5g of each protein construct was pre-mixed on ice for 5\u2009min and then added to 15\u2009\u00b5L of GFP-Trap beads (Chromotek) that were pre-washed with the MB buffer  followed by incubation for 30\u2009min at room temperature in the presence of 1\u2009\u03bcM Sfp phosphopantetheinyl transferase (Addgene #75015)to catalyze protein labeling.Proteins were labeled with fluorescent probes before they were eluted from the affinity columns. For SNAP labeling, IgG bead slurry (Cytiva) was concentrated to 5\u2009mL, followed by the addition of 5 nmol of either BG-LD555 or BG-LD655 dye (Lumidyne), followed by incubation for 1\u2009h at 4\u2009\u22121 BSA-biotin (Sigma) was introduced into the flow chamber, which was then washed with MB buffer supplemented with 1\u2009mM DTT, 10\u2009\u03bcM taxol, 1.25\u2009mg\u2009ml\u22121 casein (Sigma) and 0.5% pluronic (MBCT). MBCT was additionally supplemented with 0.2% methylcellulose and 50 nM K-Acetate for DDKT motility assays and dynein motility assays with TRAK11\u2013532. The chamber was then incubated with 20\u2009\u00b5l 1\u2009mg\u2009ml\u22121 streptavidin (NEB) in MBCT and washed with 40\u2009\u00b5l MBCT. For imaging dynein motility, fluorescently-labeled dynein, dynactin, and a cargo adaptor (TRAK1 or TRAK2) were mixed at a 1:5:20 molar ratio in MB for TRAK11\u2013400 and TRAK21\u2013400 and a 1:3:10 molar ratio for TRAK11\u2013532, respectively. Miro11\u2013592, dynein, dynactin, and TRAK11\u2013532 were mixed at a 1:3:10:30 molar ratio, respectively, in the presence of 1\u2009\u03bcM Lis1. For imaging kinesin motility, kinesin, a cargo adaptor (TRAK1 or TRAK2), MAP7, and Miro11\u2013592 were mixed at a 1:3:3:3 molar ratio, respectively, in MB buffer. For imaging both dynein and kinesin simultaneously, dynein, dynactin, kinesin, and a cargo adaptor were mixed at a 1:3:1:1 (TRAK1) or 1:5:1:1 (TRAK2) ratios, respectively, in MB buffer with the stated concentration of MAP7. The mixtures were incubated on ice for 10\u2009min and diluted 30-fold in MBCT. Finally, the mixture was diluted 10-fold in the stepping buffer (MBCT supplemented with 0.1\u2009mg\u2009ml\u22121 glucose oxidase (Sigma), 0.02\u2009mg\u2009ml\u22121 catalase (Sigma), 0.8% D-glucose, and 1\u2009mM Mg\u00b7ATP) and introduced into the chamber. Motility was recorded for 5\u2009min. For assays including Miro11\u2013592, 0.1\u2009mg\u2009ml\u22121 biotin-BSA was also included in the stepping buffer for surface passivation.To immobilize biotinylated MTs to the coverslip, 1\u2009mg\u2009ml\u22121, Covance) was flown into an assay chamber and incubated for 3\u2009min. The chamber was washed with 30\u2009\u03bcl MB supplemented with 1\u2009mM DTT, 10\u2009\u03bcM taxol, and 1.25\u2009mg\u2009ml\u22121 casein. For kinesin-driven MT gliding, 10\u2009\u03bcl of 2.5\u2009nM GFP-tagged kinesin was subsequently added to the chamber. In the case of DDT-driven MT gliding, 10\u2009nM dynein, 10\u2009nm dynactin, and 10\u2009nM GFP-TRAK21\u2013400 were incubated in MB on ice for 10\u2009min in the presence of 1\u2009\u00b5M Lis1, and 10\u2009\u03bcl of this mixture were added to the chamber. After 2\u2009min incubation, the unbound motor was removed by washing the chamber with 30\u2009\u03bcl MB. For experiments with SNPH, 10\u2009\u03bcl of SNPH1\u2013473-sfGFP was added to the chamber at the indicated concentration for 2\u2009min followed by a 30\u2009\u03bcl MB wash. Then, 10\u2009\u03bcl of 200\u2009nM Cy5-labeled MTs were flown to the chamber and allowed to bind the kinesin- or DDT-decorated surface for 4\u2009min. The chamber was then washed with 60\u2009\u03bcl MB. Lastly, 10\u2009\u03bcl of imaging buffer  was flown into the chamber to initiate gliding motility.Rabbit monoclonal anti-GFP antibody  through a Nikon TIRF Illuminator, and their fluorescent emissions were filtered through a notch dichroic filter and 525/40, 585/40, and 655/40 bandpass emission filters (Semrock), respectively. Multicolor fluorescence imaging was performed using the time-sharing mode in MicroManager. Videos were recorded at 2-4\u2009Hz.Fluorescence imaging experiments were performed using a custom-built multicolor TIRF setup equipped with a Ti-Eclipse inverted microscope body, a 100X magnification 1.49\u2009N.A. apochromat oil-immersion objective (Nikon), a perfect focusing system, and an electron-multiplied charge-coupled device camera  with an effective pixel size of 160\u2009nm after magnification. Alexa488/GFP, LD555, and LD655 probes were excited with fiber-coupled 0.05\u2009kW\u2009cm54. Videos were analyzed in ImageJ. Kymographs were generated by plotting segmented lines along the MTs using a custom-written ImageJ macro. The processive movement was defined and analyzed as described previously27. Complexes that exhibited diffusive movement, ran for less than 250\u2009nm, and paused for more than 1\u2009s were excluded from velocity analysis. For two-color imaging, the fluorescence channels were overlaid in ImageJ to generate a composite image. Colocalization events were manually scored in kymographs. For two-color imaging of a motor and a cargo adaptor (TRAK1 or TRAK2), processive motility events observed in the cargo adaptor channel that did not colocalize with a motor were still included in the velocity analysis.Coiled-coil prediction scores of human TRAK1 and TRAK2 were calculated from the NPS@ server using the algorithm of Lupas et al.11\u2013400 and DDT21\u2013400 complexes were assembled with 1\u2009\u00b5l of 0.84\u2009mg\u2009ml\u22121 dynein, 1\u2009\u00b5l of 1.7\u2009mg\u2009ml\u22121 dynactin, and 1\u2009\u00b5L of 0.22\u2009mg\u2009ml\u22121 TRAK11\u2013400 or 0.1\u2009mg\u2009ml\u22121 TRAK21\u2013400 in MB for 5\u2009min at 4\u00b0C. The protein mixture was then added to 700\u2009nm diameter polystyrene beads (Invitrogen) coated with a polyclonal GFP antibody (Covance) and incubated for 10\u2009min. Similarly, KT11\u2013400 complexes were assembled with 1\u2009\u00b5l of 0.05\u2009mg\u2009ml\u22121 biotinylated kinesin-ybbR and 1\u2009\u00b5l of 0.1\u2009mg\u2009ml\u22121 TRAK11\u2013400 before being added to 700\u2009nm diameter streptavidin-coated beads (Spherotech). Flow chambers were first decorated with Cy5-labeled sea urchin axonemes in MB. The motor-bead mixture was introduced to the chamber in the imaging buffer. To ensure that more than ~95% of beads were driven by single motors, the protein mixture was diluted before incubating with beads such that a maximum of 30% of beads exhibited activity when brought into contact with an axoneme.DDT55. Briefly, motor-coated beads were trapped with a 2\u2009W 1,064-nm laser beam (Coherent) focused on the image plane using a 100X magnification 1.49\u2009N.A. apochromat oil-immersion objective (Nikon). Cy5-labeled sea urchin axonemes were excited with a 633-nm HeNe laser (JDSU Uniphase), imaged using a monochrome camera (The Imaging Source), and moved to the center of the field of view using a locking XY stage . The trapped bead was lowered to the surface of the axonemes using a piezo flexure objective scanner . Bead position relative to the center of the trap was monitored by imaging the back-focal plane of a 1.4\u2009N.A. oil-immersion condenser (Nikon) on a position-sensitive detector (First Sensor). Beam steering was controlled with a pair of perpendicular acousto-optical deflectors (AA Opto-Electronic). For calibrating the detector response, a trapped bead was rapidly raster-scanned by the acousto-optical deflector and trap stiffness was derived from the Lorentzian fit to the power spectrum of the trapped bead. The spring constant was set to ~0.04 pN nm\u22121 for DDT11\u2013400 and DDT21\u2013400, and ~0.08 pN nm\u22121 for KT11\u2013400 experiments.Optical trapping experiments were performed on a custom-built optical trap microscope set-up controlled using Labview 2017 softwareCustom MATLAB software was used to extract stall forces and stall times from raw traces. First, raw traces were downsampled from 5,000\u2009Hz to 250\u2009Hz. Stall events were defined as a stationary period of a motor at forces above 2.5 pN lasting a minimum of 100\u2009ms, followed by snapping back of the bead to the trap center. The stall force was defined as the mean force in the last 20% of the stall event. The stall time was defined as the interval the bead spent at a force of at least 80% of the stall force. All stall events were plotted and manually reviewed to confirm the accuracy of the reported values.n) and statistical analysis methods are clearly stated in the figure legends. Representative data are shown from independently repeated experiments.At least two independent repetitions were performed to obtain any given result. The number of replicates (Further information on research design is available in the\u00a0Supplementary InformationDescription of Additional Supplementary FilesSupplementary Movie 1Supplementary Movie 2Supplementary Movie 3Supplementary Movie 4Supplementary Movie 5Supplementary Movie 6Supplementary Movie 7Reporting Summary"}
+{"text": "Legal, controlled, and regulated access to high-quality data from academic hospitals currently poses a barrier to the development and testing of new artificial intelligence (AI) algorithms. To overcome this barrier, the German Federal Ministry of Health supports the \u201cpAItient\u201d  project, with the goal to establish an AI Innovation Environment at the Heidelberg University Hospital, Germany. It is designed as a proof-of-concept extension to the preexisting Medical Data Integration Center.The first part of the pAItient project aims to explore stakeholders\u2019 requirements for developing AI in partnership with an academic hospital and granting AI experts access to anonymized personal health data.We designed a multistep mixed methods approach. First, researchers and employees from stakeholder organizations were invited to participate in semistructured interviews. In the following step, questionnaires were developed based on the participants\u2019 answers and distributed among the stakeholders\u2019 organizations. In addition, patients and physicians were interviewed.The identified requirements covered a wide range and were conflicting sometimes. Relevant patient requirements included adequate provision of necessary information for data use, clear medical objective of the research and development activities, trustworthiness of the organization collecting the patient data, and data should not be reidentifiable. Requirements of AI researchers and developers encompassed contact with clinical users, an acceptable user interface (UI) for shared data platforms, stable connection to the planned infrastructure, relevant use cases, and assistance in dealing with data privacy regulations. In a next step, a requirements model was developed, which depicts the identified requirements in different layers. This developed model will be used to communicate stakeholder requirements within the pAItient project consortium.The study led to the identification of necessary requirements for the development, testing, and validation of AI applications within a hospital-based generic infrastructure. A requirements model was developed, which will inform the next steps in the development of an AI innovation environment at our institution. Results from our study replicate previous findings from other contexts and will add to the emerging discussion on the use of routine medical data for the development of AI applications.RR2-10.2196/42208 Considering the current and future challenges in health care, such as lack of health care workers and global health, artificial intelligence (AI) is regarded as one possible part of a solution to address these problems -4. WhileThe topic of AI in health care has recently received a significant amount of attention in research, policy making, and in the general population -8. HowevAnother uncertainty pertains to the perspective of patients regarding the use of their medical data for AI development. Aitken et al  conducteIt is plausible to assume that the preferences and opinions derived from previous research could vary between different cultural contexts and between the general population and current patients. To the authors\u2019 knowledge, there are no previously reported findings on patient perceptions of data usage for AI research in Germany.pAItient project , which has the objective to establish an AI innovation environment as a proof-of-concept extension of the already existing Medical Data Integration Center . Personally, I would much rather like to see a result for the patient or in patient care.PG1_1, Transcript position 68In the anonymous survey, participants from groups 1 and 3 rated patents as one of their second lowest or least important goal, respectively. Interview participants from private companies emphasized achieving business goals .Survey participants were asked to rate their approval to the goals derived from the interviews on a slider ranging from 0% to 100%. All statements concerning intellectual property (IP) were assigned to this theme. IP was seen as a risk that has to be managed to be able to access data.I think at the moment \u2013 this topic [IP] is not as urgent, because lack of data is such a big problem and many AI-developers will take this risk, many risks, to access data.PG1_2, TP28In general, interviewees had the opinion that the institution that designed the algorithm is entitled to IP. They were in favor of regulating these questions via contracts with the institutions providing the data. Considering contracts, licensing options were viewed unfavorably because they provide only temporary access. While IP was a topic of lower importance, differing IP regulations were seen as a measure to compare data-providing institutions with each other.Another aspect that was discussed in the interviews concerned data processing and in what kind of IT infrastructure the data derived from the hospital should be analyzed, trained, and validated. Researchers from group 1 highly favored having the data easily accessible within their own infrastructure. Yet, they were also accepting of the idea to access data through remote access options. Necessary antecedents for this approach were a good UI and a stable connection. Advantages of this option were the ability to view the data within their original system architecture and that no exchange of sensitive patient data would be necessary.If that works well, the UI, the stability \u2013 and you can also get enough information about the data, so you are able to decide how to build your model. In that case, I think that makes sense and it would also make a lot of things easier, because you don\u2019t have to exchange data all the time.PG1_3, TP30A possible disadvantage was the risk that a hospital\u2019s technical infrastructure could lack the computing power to train algorithms. To counter this risk, 1 participant suggested to use a smaller subset of the data outside the hospital system and to conduct the validation within the hospital system.Survey participants were asked to indicate if they use or do not use specific hardware and software for the development of AI tools. The results of this question are presented in This question asked interview participants to indicate and explain which data or type of data they typically use for their development processes. They stated that they would ideally work with annotated data and that the preceding annotation workflow should be made transparent to them. The availability of data with high-quality annotation reduces the amount of data needed. Concerning specific use cases, they would also like to access data other than patient data/medical records, for example, data from surgical instruments  and data from external sources .Survey participants were asked to check a box if they typically worked with these kinds of data. A further aspect that was discussed with interview participants was the cooperation with academic hospitals and previously experienced or anticipated advantages and disadvantages of this cooperation. Possible advantages that were mentioned included the availability of high amounts of data, special data , the possibility to test and validate algorithms within a protected environment, and the hospital\u2019s willingness to invest additional effort in research projects. Another advantage was the proximity to a \u201creal environment\u201d in a hospital setting:So [from working with an academic hospital] you don\u2019t only get artificial data or only specific data from special cases but the kind of cases that typically reoccur in a hospital. So, they are from a \u201creal environment\u201d. And the closer you can get to the actual environment, the easier you can develop an application that is able to deliver good results.PG1_3, TP24Survey participants were asked to rate their agreement with the mentioned advantage on a 5-point Likert scale . Besides advantages, potential disadvantages of these cooperations were discussed. Interview participants described bad experiences with extensive bureaucracy, which made getting access to data difficult. Administrative contact persons in the hospitals that they had encountered previously were remembered as anxious to violate data privacy regulations. This observation, in combination with lacking technical knowledge to understand the research proposals, has previously led to uncertainties, delays, and to a \u201cplay it safe\u201d approach regarding research ideas.And the technologies are getting more and more complex. And this uncertainty, which is understandable, can result in a tendency to \u201cplay it safe\u201d. And this can, of course, lead to problems or exhausting processes, at least from a researchers\u2019 perspective, who are always like \u201cthis is great, let\u2019s get started immediately.PG1_2, Pos. 32Sometimes, data sets they had received were not self-evident and consultations with hospital physicians were necessary to work with the data. In addition, data sets they had been offered were hard to use and not in the ideal format . Interviewees also mentioned that the necessity to work within a research study setting introduced further difficulties, such as having to get approval from the ethics committees. Another risk that has to be managed is \u201coverfitting,\u201d which could result from a too strong reliance on data from 1 source.Survey participants were asked to rate their agreement with the mentioned disadvantage on a 5-point Likert scale . This code was assigned to all statements concerning potential areas where academic hospitals could support the participants\u2019 institutions. Interview participants suggested the installation of a platform enabling a quick overview over which algorithms had already been developed or tested at the hospital in question, which groups are working on projects related to AI, and which data are available and could be used for the development of AI tools. The interviewees argued that a platform like this could improve cooperation, innovation, and creativity.To establish an environment to look at data, meta data \u2013 to get a good insight how the data are available, what you can do with them. [\u2026] And you should also be able to see what has already been done, for example, what are the parameters for a deep leaning model somebody has set up. [\u2026] I know this is not easy. But that is how I think a platform like this should work, it should enable a lot of exchange between researchers. [\u2026] This is how you can find new partners for cooperation. You can easily see which group is developing new expertise in which area. And so you can find new people easier.PG1_3, TP36Interviewees also suggested a closer cooperation with clinicians, for example, in finding common goals. Here, clinicians could give more insight into which algorithms or software solutions could make their work easier. Clinicians could also support in the evaluation of newly developed tools to determine whether these are usable and beneficial for clinical practice. At the same time, interviewees would also like to be able to explore data independently. This independent exploration should be supported by platforms with a good UI and characteristics about the provided data should be communicated clearly . In this context, participants suggested the introduction of new tools into the physicians\u2019 workflow, which will allow for the parallel annotation of collected data.Survey participants were asked about their perceived usefulness on a 5-point Likert scale . A total of 6 patients were recruited successfully. One patient withdrew their consent after the interview. Interviewees were asked to fill in a sociodemographic questionnaire. Following the thematic analysis  approachThis code was assigned to all statements concerning AI technologies in general, such as previous knowledge, hopes, and fears. Patients in this sample had high hopes of AI possibly helping in the treatment of their own disease in the future and thus were optimistic about their participation in the study and its aims.I am happy to see that research in this area is happening here. It is tangible. [...] That is also one of the reasons why I chose to participate in this study, I am curious.PG5_2, TP56Although none of the participants in this study said that they themselves had fears or negative perceptions surrounding AI, they recognized the prevalence of these fears within the society:A lot of people have this negative image in their head. Robots are taking over, mankind can\u2019t do anything anymore and is reigned by AI, by a machine. And this image creates fear. That is understandable. [\u2026] But I am very positive towards robots and AI.PG5_1, TP30The interviewees also discussed that these fears and a lack of understanding of AI could lead to misunderstandings and low willingness among other patients to agree to the use of their data.The patients in this sample were also optimistic about the potential use of their medical data for the development of AI tools and mentioned several potential positive effects. Again, they saw a potential to support research and treatment in their disease.I think my treatment data could maybe help patients, who will be affected by the same disease later. So it could help in the actual treatment of this disease.PG5_5, TP8I have stage IV breast cancer and would share as much data as necessary. I would have no problem at all to share personal data or health data and so on. I would see that as an opportunity.PG5_4, TP12Concerning the kind of data that can be shared, they only noted that personal data such as name, phone number, and email address should not be shared. They emphasized that medical data should be shared in a form which does not allow for reidentification. Participants further demanded to be informed about what will happen with the data they shared, why their data will be necessary, and what other organizations will be involved. In general, they supported an option to limit the kind of data that can be shared. However, they also argued that many other patients could lack the necessary knowledge and information to judge these issues. In this context, they also worried that physicians or other contact persons might not have enough time to explain the data-sharing concepts to all their patients, especially patients with lesser previous knowledge.The lack of time for necessary explanations was also mentioned as a reason why the patients in our sample would potentially refuse to share their data. Other reasons included, for example, if there is a risk of reidentification of their data, if the benefit for medical research is not stated clearly, and if the reputation or trustworthiness of the institution they are being treated at is bad.Generally, participants highly valued and trusted the existing data privacy regulations in public institutions. Yet, patients were sceptic toward the involvement of too many different organizations. This was explained by a perceived higher risk of data leaks or misuse when too many players are involved. Skepticism was especially notable toward private companies. Here, participants clearly differentiated between private companies and publicly funded institutions:Public institutions are good. But as soon as private companies are involved, I would like to have transparency and would like to know which companies.PG5_4, TP47On the other side, interviewees stated that having a bigger group with several different organizations also means that research could be done faster and better due to more researchers working on the same questions.Concerning the consent process for data sharing, patients preferred to have a conversation with their physician in which the physician would take time to inform them about the data-sharing process and answer potential questions. In general, the person conducting the consent process should be trustworthy and well informed. Brief, written information should be handed out beforehand, so that patients are able to prepare questions. Participants demanded to be informed about which companies are involved, a very broad overview over what will be done with their data, and how their data will be protected.There has to be a relationship of trust with this person. It is not really relevant whether that is a senior or junior physician or research associate, it just has to be made clear what will happen. And another thing would be important for me \u2013 will the data only go to academic hospitals or will they also be transferred to pharmaceutical companies? And under which conditions?PG5_3, TP48Over the course of the individual interviews, the requirements for consent to data sharing for AI development emerged. Participants stated that they needed to be able to retract their consent. The institution they are sharing their data with has to be trustworthy and their data should not be reidentifiable. If private companies are involved, a medical benefit for patients should be the objective. Finally, patients demanded to receive transparent and comprehensive information beforehand.The General Data Protection Regulation (GDPR) was introduced in 2018 by the European Parliament and Council of the European Union . It inclpAItient project, the results from this study were combined with the findings from participant group 6 (physicians), which were reported by Kamradt et al [To merge the findings from all the studied participant groups within the dt et al . In addiThis model was communicated to all project members. The requirements were operationalized and items relevant to the development of the IT architecture were implemented in the IT concept. This guarantees consideration of these requirements in the long term of the AI innovation environment.pAItient project consortium.The aim of this study was to collect the requirements for the development of AI-based algorithms based on routine medical data within a hospital-based generic infrastructure. Views from different stakeholder perspectives were included in this study, such as patients, physicians, AI researchers, and industry employees. Legal requirements were deduced from the literature. The identified requirements covered a wide range and were inherently conflicting sometimes, even within the stakeholder groups. However, a requirement model was developed, which depicts the identified requirements in 4 different layers. In the center, the most relevant patient requirements for data use were listed . The second layer represents the physicians\u2019 requirements for participating in AI research and development projects  . The thiComparable projects to build infrastructures and networks enabling AI development are ongoing, such as the CHAIMELEON project . HoweverConcerning the findings from interviews with patients, previously reported requirements could be replicated in our sample. McCradden et al  conducteThe importance of respecting patient requirements for data use in AI development is evident, as many studies have shown that patients\u2019 wishes and expectations for the use of their data in health research can differ from researchers\u2019 wishes . Tosoni A limitation for this study is the relatively small sample size. Concerning groups 1-4, this could be explained by a lack of time of potential participants due to a high number of concurrent projects and research activities. To increase the number of potential participants, the survey was translated into English. This led to an improvement in response numbers. The survey results were very homogenous, with mostly high rates of approval. This could imply that the interview participants represented their institutions well, indicating that the results from these groups are plausible despite the small sample size. Nonetheless, the possibility of missing potentially relevant aspects cannot be disregarded.Recruiting patients for the interviews was challenging as well. This could be explained by the complexity of the topics of AI and data use, resulting in a low interest in participation in research . This hapAItient project, another qualitative study is planned at the end of the project to evaluate the AI innovation environment and to revisit the requirements presented in this study.The study presented in this paper led to the identification of necessary requirements for the development, testing, and validation of AI applications within a hospital-based generic infrastructure. A 4-layer model was developed, which will inform the next steps in the development of an AI innovation environment at our institution. Results from our study replicate previous findings from other contexts and will add to the emerging discussion on the use of routine medical data for the development of AI applications. Results will play a major role in the design and implementation of our infrastructure and processes of the AI innovation environment. In the context of the"}
+{"text": "Single-cell transcriptome analysis of zebrafish cells clarifies the signalling pathways controlling skin formation and reveals that some cells produce proteins required for human teeth to acquire their enamel. Related research article Aman AJ, Saunders LM, Carr AA, Srivatsan SR, Eberhard CD, Carrington B, Watkins-Chow D, Pavan WJ, Trapnell C, Parichy DM. 2023. Transcriptomic profiling of tissue environments critical for post-embryonic patterning and morphogenesis of zebrafish skin. eLife12:RP86670. doi: 10.7554/eLife.86670.The largest organ in the vertebrate body, the skin, performs a wide range of roles such as protecting against infection, sensing the environment, and supporting essential appendages such as hair, feathers and scales. It is also beautifully complex.In its postembryonic form, vertebrate skin is formed of three layers \u2013 the epidermis (the outermost layer), the dermis and the hypodermis \u2013 that contain a range of different cell types, each dedicated to a specific function. In zebrafish, for example, some cells create the proteins required for scales to harden and become calcified, while others produce the pigments that give the species its delicate stripe pattern. Despite extensive studies over the past few decades, researchers still do not fully understand how this complexity arises during development. Now, in eLife, David Parichy and colleagues \u2013 including Andrew Aman and Lauren Saunders as joint first authors \u2013 report that they have classified all the major cell types in zebrafish skin, identified a cell type which was previously unknown, and dissected some of the signalling networks that are essential for development .The researchers \u2013 who are based at the University of Virginia, the University of Washington and the National Human Genome Research Institute \u2013 started by using single-cell transcriptomic analysis to study 35,114 post-embryonic zebrafish skin cells. This approach allowed Aman et al. to establish the \u2018RNA profile\u2019 of each individual cell, showing which genes it expresses, and at what level, at a given time.One of the most interesting findings to emerge from this work was the identification of a group of epidermal cells which expressed genes coding for proteins that are necessary for the formation of enamel . As humaTo better understand the molecular mechanisms underpinning skin development, Aman et al. applied their approach to cells from various zebrafish mutants . In animpdgfaa. Further in vivo work showed that over-expressing this gene in fish with low levels of thyroid hormone partially re-established a normal stratification of the dermis, but did not alter how scales were created. Together, these findings should open new opportunities for understanding and treating human skin diseases.Finally, Aman et al. examined the role of the thyroid hormone on skin development, as this chemical messenger has been implicated in a range of human skin conditions. To do so, they examined the RNA profiles of skin cells from zebrafish in which the thyroid gland had been removed . This anThis work illustrates how single-cell transcriptomic profiling can detect rare cell types, infer cell fate trajectories, and identify relevant signalling networks. On its own, however, this method may fall short of capturing the exquisite details of skin development, such as how differentiated skin cells influence the behavior of neighbouring basal stem cells, the way that appendages instruct the growth of nerve projections and blood vessels, or the fact that tension can trigger skin cells to divide without replicating their DNA . Only stZebrafish skin may seem less sophisticated than ours at first glance, but Aman et al. have undoubtedly demonstrated that there is much to discover beneath its surface. Developmental biologists can glean valuable insights from looking into it more closely. Given the evolutionary connection between teeth and scales, and now the shared presence of ameloblast-like cells in zebrafish and humans, it may even become possible to unravel why scales, but not human teeth, can regrow throughout life. While it is probably a wild guess, it is fascinating to imagine that one day we may be able to regenerate human teeth thanks to findings made in a toothless little fish."}