diff --git "a/deduped/dedup_0328.jsonl" "b/deduped/dedup_0328.jsonl"
new file mode 100644--- /dev/null
+++ "b/deduped/dedup_0328.jsonl"
@@ -0,0 +1,39 @@
+{"text": "ATP channels consist of Kir6.2 and SUR2A subunits, but the distribution of these (and other KATP channel subunits) is poorly defined. We examined the localization of each of the KATP channel subunits in the mouse and rat heart.Electrophysiological data suggest that cardiac KATP channels.Immunohistochemistry of cardiac cryosections demonstrate Kir6.1 protein to be expressed in ventricular myocytes, as well as in the smooth muscle and endothelial cells of coronary resistance vessels. Endothelial capillaries also stained positive for Kir6.1 protein. Kir6.2 protein expression was found predominantly in ventricular myocytes and also in endothelial cells, but not in smooth muscle cells. SUR1 subunits are strongly expressed at the sarcolemmal surface of ventricular myocytes (but not in the coronary vasculature), whereas SUR2 protein was found to be localized predominantly in cardiac myocytes and coronary vessels . Immunocytochemistry of isolated ventricular myocytes shows co-localization of Kir6.2 and SUR2 proteins in a striated sarcomeric pattern, suggesting t-tubular expression of these proteins. Both Kir6.1 and SUR1 subunits were found to express strongly at the sarcolemma. The role(s) of these subunits in cardiomyocytes remain to be defined and may require a reassessment of the molecular nature of ventricular KATP channel subunit expression patterns in the heart. These results suggest distinct roles for KATP channel subunits in diverse cardiac structures.Collectively, our data demonstrate unique cellular and subcellular K ATP) channels are widely expressed in both excitable and non-excitable tissue types throughout the body. However, differences exist in the functional and pharmacological properties of various KATP channels in different tissues. This functional diversity of KATP channels is also reflected in the cardiovascular system. KATP channels are abundantly expressed in ventricular myocytes, where they are probably best characterized. These channels have a high unitary conductance, are inhibited by ATP in the micromolar range, are blocked by glibenclamide (but not tolbutamide) and opened by pinacidil (and not by diazoxide). KATP channels also exist in the coronary vasculature, where they function to maintain basal coronary blood flow . After centrifugation , an equal volume of 2 \u00d7 Laemmli loading buffer was added to the lysate. Proteins were separated by 10% SDS-PAGE and transferred to Immun-blot PVDF membrane . The membrane was blocked and incubated with primary antibody (see below). As secondary antibodies, we used HRP-conjugated anti-rabbit, anti-mouse IgG  or anti-goat IgG in TBS-Tween for 1 hour and detected using a chemiluminescent substrate .Antibodies (NAF1) were raised against a peptide corresponding to residues 20\u201331 of the Kir6.1 N-terminus (ENLRKPRIRDRLP). There is a high degree of sequence similarity in Kir6.1 subunits between species in this region. We also raised a Kir6.1 antibody (CAF-1) to this peptide in chickens. In each case, a C-terminal cysteine was added for conjugation purposes. Peptides were synthesized and the antibodies were generated commercially . Each of these antibodies were peptide affinity purified. There is sequence similarity (81% identity) between this peptide and the recently-identified human beta-V spectrin. We tested for possible cross-reactivity of NAF-1 with beta-V spectrin using antibodies generously provided by Dr Jon Morrow  and demonstrated that our antibodies had no cross-reactivity with beta-V spectrin  and the goat anti-Kir6.1 R-14 or C-16 C-terminal antibodies . In our hands, the 78A and R-14 antibodies failed to detect Kir6.1 protein in Western blotting of cardiac membrane fractions and did not appear to stain above background in immunohistochemistry assays (not shown).We used a goat anti-Kir6.2 G-16 antibody  and an antibody (76A) developed in Dr Tinker's laboratory against a peptide (DALTLASSRGPLRKRSC) corresponding to a peptide within the Kir6.2 C-terminus (amino acids 357\u2013372).We used a goat anti-SUR1 C-16 antibody  developed to an epitope mapping at the C-terminus and a goat anti-SUR2 C-15 C-terminal antibody . This antibody was initially sold as a pan-SUR2 antibody and was able to detect the SUR2A protein in Western blots of cell lysates from Kir6.2/SUR2A transfected cells, although with less sensitivity compared to SUR2B-transfected cells (data not shown). Currently, the antibody with the same catalog number is sold as being specific to SUR2B. We have not tested recent batches of this antibody for isoform specificity.Other antibodies used for immunolocalization included a mouse monoclonal \u03b1-actin smooth muscle antibody preconjugated to FITC  and a rat monoclonal antibody  raised against ICAM-2 (CD102), which is a cell surface glycoprotein constitutively expressed on vascular endothelial cells.2 fragment donkey anti-rat IgG and a Cy3- or Cy5-conjugated donkey anti-goat IgG .Secondary antibodies used included Cy3-conjugated donkey anti-rabbit IgG, Cy3-conjgated donkey anti-chicken IgY, Cy5-conjugated F(ab')+ channel familyKir = Inward rectifying KSUR = Sulphonylurea receptorATP channel = ATP-sensitive K+ channelKAM, ER and JL carried out the immunohistochemistry experiments. PDC, SH and GL carried out the immunocytochemistry experiments. TN, AM, LP, HY, XT, JPG and AT participated in characterization of the antibodies. WAC, MA and TN participated in the design of the study. WAC conceived the study, participated in study design and coordination, and manuscript preparation. All authors made substantive intellectual contributions to the study, read and approved the final manuscript.NAF-1 antibody does not cross-react with beta V spectrin. COS7L cells have been transfected with Kir6.1 cDNA and cell lystates were subjected to Western blotting with anti-beta V spectrin antibodies or NAF-1 anti-Kir6.1 antibodies.Click here for file"}
+{"text": "ATP) channels that are needed for normal insulin secretion and are targets for drugs that modulate insulin secretion. The KATP channel is composed of two subunits: a sulfonylurea receptor (SUR 1) and an inward rectifying potassium channel (Kir6.2). KATP channel activity is influenced by the metabolic state of the cell and initiates the ionic events that precede insulin exocytosis. Although drugs that target the KATP channel have the expected effects on insulin secretion in dogs, little is known about molecular aspects of this potassium channel. To learn more about canine beta cell KATP channels, we studied KATP channel expression by the normal canine pancreas and by insulin-secreting tumors of dogs.Pancreatic beta cells express ATP-sensitive potassium (KATP channel subunits (SUR1 and Kir6.2) using RT-PCR. Normal canine pancreas expressed SUR1 and Kir6.2 subunits of the KATP channel. The partial nucleotide sequences for SUR1 and Kir6.2 obtained from the normal pancreas showed a high degree of homology to published sequences for other mammalian species. SUR1 and Kir6.2 expression was observed in each of the three canine insulinomas examined. Comparison of short sequences from insulinomas with those obtained from normal pancreas did not reveal any mutations in either SUR1 or Kir6.2 in any of the insulinomas.Pancreatic tissue from normal dogs and tumor tissue from three dogs with histologically-confirmed insulinomas was examined for expression of KATP channels have the same subunit composition as those found in the endocrine pancreases of humans, rats, and mice, suggesting that the canine channel is regulated in a similar fashion as in other species. SUR1 and Kir6.2 expression was found in the three insulinomas examined indicating that unregulated insulin secretion by these tumors does not result from failure to express one or both KATP channel subunits.Canine pancreatic K ATP) channel is a crucial component of the pancreatic beta cell insulin secretion pathway and a target for drugs that modulate insulin secretion. In the endocrine cells of the pancreas, KATP channel is composed of two subunits: a sulfonylurea receptor (SUR 1), which contains two adenine nucleotide binding domains . The partial sequence of canine SUR 1 was found to have a high degree of nucleotide identity with corresponding SUR 1 sequences from humans (93%), rat (93%), and hamster (92%).The results of RT-PCR for SUR1 expression in normal canine pancreas are shown in Figure 6.2 was detected in normal canine pancreas using primers designed against rat Kir6.2 [GenBank:D50581]. These primers amplified a product of expected size (approximately 167 bp) from rat and dog pancreases. Sequence analysis revealed that the PCR product from rat pancreas was 99% identical to the published sequence for Kir6.2, indicating that RT-PCR yielded a specific product. However, these primers did not produce clean, defined bands from canine pancreas (data not shown). To further clarify canine Kir6.2 expression, a second set of primers that were specific for canine Kir6.2 was designed using sequence information contained in the canine genome database [AAEX01017445] contained in the canine genome database [6.2 sequence was verified by repeat sequencing and placed in GenBank [GenBank:AY929390]. The partial sequence obtained for canine Kir6.2 sequence shared extensive identity with Kir6.2 from other species , mouse (90%), and rat (87%). The canine Kir6.2 was also compared to a predicted sequence for canine Kir6.2 [GenBank:XM-542519] that is available in GenBank. The 271 bp Kir6.2sequence from normal canine pancreas has 100% identity with the predicted nucleotide sequence of canine Kir6.2.Expression of Kirdatabase . These pdatabase . The canAAEX0101745 contai6.2 expression. For each insulinoma, subunit expression was determined using the previously described rat SUR 1 and canine Kir6.2 primers. All three insulinomas were found to express the genes for SUR 1 and Kir6.2 .Histologically-confirmed insulinomas from three dogs were analyzed for SUR1 and Kir2 Figure . The ides Figure , panel A6.2 subunits of the KATP channel are expressed in the pancreas of normal dogs. The combination of SUR1 and Kir6.2 comprises the classical beta cell KATP channel and expression of this subunit combination in the normal dog pancreas is consistent with previous reports showing that this same combination of subunits is expressed in the pancreatic beta cells by other species  . A secon project . GAPDH e6.2 in canine pancreas and in a series of three canine insulinomas. GAPDH gene expression was used as an internal PCR control. To prepare RNA, frozen tissue samples were homogenized using a QIAshredder and RNA extracted in Trizol Reagent according to manufacturer's instructions (Qiagen RNeasy Mini Kit). cDNA synthesis was carried out using a mixture (19 \u03bcl) that included total RNA (5 \u03bcg), dNTP 10 mmol/L, random hexamers 100 ng/\u03bcl, RNasin 20 IU and reverse transcriptase  25 IU. The mixture was incubated for 50 min at 42 C according to manufacturer's instructions, after which the reaction was terminated by heating the reaction to 70 C for 15 min.RNA isolation and reverse transcription-polymerase chain reaction (RT-PCR) RT-PCR was performed to determine the expression of SUR1 and Kir2, 1 \u03bcL dNTPs and 18.95 \u03bcL distilled water. PCR cycles for amplification of SUR1 and Kir6.2 were as follows. SUR1: 94 C for 5 min; followed by 35 cycles of 94 C for 0.5 min, 59 C for 0.5 min, 72 C for 1.5 min and then 72 C for 30 min. Kir6.2: 94 C for 5 min; followed by 35 cycles of 94 C for 0.5 min, 58.6 C for 0.5 min, 72 C for 1.5 min; then 72 C for 30 min. Products from the PCR reaction were resolved by electrophoresis on a 1.2% agarose gel and detected with ethidium bromide staining and UV light. The identity of the PCR products was confirmed by sequence analysis performed using an automated ABI 3700 DNA Analyzer .PCR amplification was carried out in 25 \u03bcL reactions that contained: 0.5 \u03bcL template cDNA, 1 \u03bcL of each specific oligonucleotide primer, 0.1 \u03bcL Invitrogen Platinum Taq DNA Polymerase, 2.5 \u03bcL 10\u00d7 buffer, 0.75 \u03bcl MgCl, 1997\u20132005). Semiquantitative analysis was performed by comparing the OD of the SUR1 and Kir6.2 bands to the OD of a reference gene (GAPDH) from the same insulinoma. The ratio of SUR1 (or Kir6.2) to GAPDH provides a semiquantitative basis for comparison of expression levels between different tumors.Optical densities (OD) of PCR bands were determined from gel images using ImageJ software (Rasband, W.S., ImageJ, U. S. National Institutes of Health, Bethesda, Maryland, USA, ATP \u2013 ATP-sensitive potassium channelK6.2 \u2013 inward rectifying potassium channel 6.2KirPHHI \u2013 persistent hypoglycemic hyperinsulinism of infancyOD \u2013 optical densitySUR 1 \u2013 sulfonylurea receptor 1VRD processed the tissues, performed the RT-PCR experiments, and prepared samples for sequencing. EKH participated in primer design, performed some of the RT-PCR experiments and participated in drafting the manuscript. ACK contributed important RT-PCR data. TS conceived and designed the study, drafted the manuscript, and performed sequence comparisons. All authors have read and approved the final manuscript."}
+{"text": "ATP) channels in neurons mediate neuroprotection, they regulate membrane excitability, and they control neurotransmitter release. Because loss of DRG neuronal KATP currents is involved in the pathophysiology of pain after peripheral nerve injury, we characterized the distribution of the KATP channel subunits in rat DRG, and determined their alterations by painful axotomy using RT-PCR, immunohistochemistry and electron microscopy.ATP-sensitive potassium  formed by the Schwann cells. Immunostaining against SUR1 and Kir6.2 colocalized with anti-Caspr at paranodal sites.DRG excised from rats made hyperalgesic by spinal nerve ligation exhibited similar staining against Kir6.2, SUR1 or SUR2 as DRG from controls, but showed decreased prevalence of SUR1 immunofluorescent NF200 positive neurons. In DRG and dorsal roots proximal to axotomy SLI were smaller and showed decreased SUR1 immunofluorescence.ATP channels in rat DRG neuronal somata, peripheral nerve fibers, and glial satellite and Schwann cells, in both normal state and after painful nerve injury. This is the first report of KATP channels in paranodal sites adjacent to nodes of Ranvier and in the SLI of the Schwann cells. After painful axotomy KATP channels are downregulated in large, myelinated somata and also in SLI, which are also of smaller size compared to controls.We identified Kir6.2/SUR1 and Kir6.2/SUR2 KATP channels may have diverse functional roles in neurons and glia, further studies are needed to explore the potential of KATP channels as targets of therapies against neuropathic pain and neurodegeneration.Because K ATP) channels are octamers made of four pore-forming inward rectifiers (Kir) that co-assemble with four regulatory sulfonylurea receptor (SUR) subunits  and Taq DNA polymerase (Roche). The 35 cycles included initial denaturation at 94\u00b0C, 4 min; 94\u00b0C, 10 sec; 56\u00b0C, 30 sec; 72\u00b0C, 2 min; and final extension 72\u00b0C, 10 min. In negative control experiments reverse transcriptase was omitted. PCR products (12 \u03bcl) were separated by electrophoresis on a 1.5% agarose gel stained with ethidium bromide and visualized with a Molecular Imager . The analysis was repeated with neurons dissociated from DRG of three different control rats.Dorsal root ganglia, brain and pancreas from control rats were immediately frozen in liquid nitrogen after removal and stored in -80\u00b0C. After thawing in ice, they were homogenized in 100 \u03bcl lysis buffer . Samples were prepared for SDS-PAGE by 1:1 dilution with Laemmli buffer, and 30 \u03bcg of protein was loaded in each well. Staining with Ponceau S solution was used to verify protein transfer and protein loading to a PVDF membrane. Blots were incubated with 5% non-fatty dry milk (NFDM), 3% bovine serum albumin in 0.1% TBS-T solution for 1 h and then with antibodies (1:200) against SUR1, SUR2, Kir6.2 and Kir6.1, in 1% NFDM overnight at 4\u00b0C. Three 15 min washes in TBS-T followed before staining with each secondary antibody  for 2 h, at room temperature. The ECL-Plus chemiluminescence detection kit was used to detect the antigen-HRP conjugated antibody complex . Each determination was performed 3 times with tissue from different animals.\u00ae OCT, were sectioned (5 or 12 \u03bcm) with a Leica cryostat , plated onto Gatenby's solution subbed slides, and post-fixed in 4% PFA with 4% sucrose. After blocking with 4% normal goat serum for 1 h at room temperature, slides were incubated in polyclonal rabbit antibodies to Kir6.1, Kir6.2 , and SUR1 or SUR2 . Some samples were also co-labeled with antibodies against neurofilament 200  and calcitonin-gene related peptide . The nodes of Ranvier were identified with contactin-associated protein 1 , which is localized in paranodal sites i: cytosolic ATP concentration; DRG: dorsal root ganglion; PBS: phosphate buffered saline; PFA: paraformaldehyde; RT-PCR: reverse transcription-polymerase chain reaction; SDS-PAGE: sodium dodecyl sulfate polyacrylamide gel electrophoresis; PVDF: polyvinylidene fluoride; TBS-T: tris buffered saline -tween20; DAPI: 4',6-diamidino-2-phenylindole; GDB: Gelatin Diphosphate Buffer; FITC: Fluorescein isothiocyanate; BODIPY: boron-dipyrromethene; TEM: transmission electron microscope; DMSO: Dimethyl sulfoxide.The authors declare that they have no competing interests.VZ, MYL, DW and BM carried out the immunohistochemical studies. VZ blindly evaluated the images and performed the measurements using Metamorph and ImageJ. TK carried out the electrophysiological experiments and data analysis. VZ, TK, and GG carried out animal surgery and behavior testing. VZ and MB carried out molecular biology experiments. VZ, MYL and CS conceived the study, and participated in its design and coordination. VZ, CS and QH wrote the manuscript. All authors have read and approved the final manuscript.Supplemental Figure Legend. A. Negative controls for RT-PCR. On negative control experiments, where the reverse transcriptase was omitted, no amplified products appeared at positions corresponding to the expected base pair lengths of 168 (Kir6.2), 182 (SUR1), 110 (Kir6.1), 124 (SUR2) and 315 (18S). B. Positive controls for anti-Kir6.2 antibody (rat brain), anti-SUR1 antibody (rat pancreas), anti-Kir6.1 antibody (rat brain) and anti-SUR2 antibody (mouse cardiac myocyte). All these areas are known to express KATP channels. Bright field images are shown on the right of each image. Additional positive control experiments revealed SUR2 staining in sections from rat aorta (not shown). Nuclei in myocyte are stained by DAPI.Click here for file"}
+{"text": "Trypanosoma cruzi trypomastigotes. A 2000-compound chemical library was screened using a recombinant T. cruzi (Tulahuen strain) expressing \u03b2-galactosidase. Three hits were selected for their high activity against T. cruzi and low toxicity to host cells in vitro: PCH1, NT1 and CX1 . Each of these three compounds presents a different mechanism of action on intracellular proliferation of T. cruzi amastigotes. CX1 shows strong trypanocidal activity, an essential characteristic for the development of drugs against the chronic stage of Chagas disease where parasites are found intracellular in a quiescent stage. NT1 has a trypanostatic effect, while PCH1 affects parasite division. The three compounds also show high activity against intracellular T. cruzi from the Y strain and against the related kinetoplastid species Leishmania major and L. amazonensis. Characterization of the anti\u2013T. cruzi activity of molecules chemically related to the three library hits allowed the selection of two compounds with IC50 values of 2 nM (PCH6 and CX2). These values are approximately 100 times lower than those of the medicines used in patients against T. cruzi. These results provide new candidate molecules for the development of treatments against Chagas disease and leishmaniasis.The development of new drugs against Chagas disease is a priority since the currently available medicines have toxic effects, partial efficacy and are targeted against the acute phase of disease. At present, there is no drug to treat the chronic stage. In this study, we have optimized a whole cell-based assay for high throughput screening of compounds that inhibit infection of mammalian cells by  Trypanosoma cruzi and affects 16 million people in South and Central America. The disease starts with an acute phase where the parasite replicates rapidly and, if it remains untreated, is followed by a chronic phase, which can induce severe pathologies including cardiac insufficiency and megacolon, leading to death. Only two drugs with high toxicity exist to treat the acute phase of the disease and no drug is available for treatment of the chronic stage. We have screened a chemical library containing 2000 compounds to find molecules that inhibit the infection of host cells by T. cruzi in vitro. We found three different families of compounds that inhibit the parasite infection very efficiently, with low toxicity to host cells in vitro. We found that two of the compounds inhibit replication of the parasites, but the third one induces complete disintegration of the parasites inside host cells. This is especially interesting for the development of new drugs against the chronic stage of the disease, where parasites are intracellular and do not replicate actively.Chagas disease is caused by infection with the protozoan parasite  Trypanosoma cruzi. It is endemic in 18 countries of Central and South America, putting 120 million of people at risk, with an estimated 16\u201318 million people currently infected T. cruzi parasites during the acute stage are benznidazole (BZN)  and nifurtimox . These drugs have toxic side effects and are not always effective. There is no drug available to treat the chronic stage of Chagas disease. Though some studies suggest that treatment with either BZN or nifurtimox decreases parasite load and slows disease progression, treatment of the chronic stage with these compounds is not officially recommended Chagas disease or American trypanosomiasis is a devastating disease caused by the trypanosomatid protozoan T. cruzi cases predominate in South America, but as migrant numbers increase in the USA, Canada and Europe, Chagas disease becomes a more widely spread public health problem, especially because BZN and nifurtimox are not approved by the countries' respective regulatory agencies and disease can be transmitted by contaminated blood donations. A need for development of new anti-T. cruzi compounds targeting the acute and/or chronic stages of the disease is therefore urgent.T. cruzi life cycle requires both an insect and a mammalian host. In the latter, the parasite development involves two stages: the amastigote form (intracellular parasites actively dividing within the cytoplasm of infected cells) and the trypomastigote form (free motile parasites that are released upon cell rupture into the blood and are able to infect cells) The Leishmania is a kinetoplastid parasite releated to T. cruzi and the causative agent of leishmaniasis, a disease whose manifestations in humans range from mild cutaneous and mucocutaneous lesions to fatal visceral infections. Among the many species responsible for cutaneous leishmaniasis, L. major of the Old World, is prevalent in Europe, Asia and Africa and L. amazonensis of the New World, extends from Southern Texas in North America to Brazil in South America. These two species diverged from each other 40\u201380 million years ago, leading to significant differences in host-parasite interactions and hence response to drugs Screening libraries of chemical compounds against a standardized highly reproducible simple assay, or high throughput screening (HTS), offers an important tool in accelerating the discovery of new leads against parasitic diseases. This strategy's rationale is based on the assumption that screening of molecules with drug-like properties and highly diverse three-dimensional structures could allow the discovery of attractive new targets.T. cruzi strain expressing the reporter enzyme \u03b2-galactosidase , also named LacZ, from Escherichia coli has been engineered by Buckner et al.Toxoplasma gondii, have been effectively used for screening compounds T. cruzi \u03b2-gal strain induces severe pathology in vivoin vitro similarly to control strains T. cruzi were successfully used to screen compounds for activity against T. cruzi epimastigotes, which is the form found in the intestine of the insect host Leishmania mexicana and Trypanosoma brucei were also tested both on intracellularly replicating T. cruzi \u03b2-gal parasites and on contaminated blood A transgenic T. cruzi \u03b2-gal strain and screened a 2000-compound library to discover new molecules with activity against T. cruzi. We identified three compounds which inhibit intracellular replication of amastigotes in the nanomolar range and low toxicity on mammalian cells.In this study, we have optimized a whole-cell-based assay for HTS using the LLC-MK2 and NIH/3T3 cells were cultivated in DMEM supplemented with 10% FBS, 100 U/ml penicillin, 0.1 mg/ml streptomycin, and 0.292 mg/ml glutamine (Pen-Strep-Glut).T. cruzi parasites from the Tulahuen strain stably expressing the \u03b2-gal gene (clone C4) L. major strain Friedlin V1 (MHOM/JL/80/Friedlin) promastigotes were grown in medium M199 as previously described L. amazonensis IFLA/BR/67/PH8 strain promastigotes were maintained in vitro as previously described 2 and 95% air humidity, unless specified otherwise.Trypomastigotes were obtained from the supernatant of infected cultures harvested between days 5 and 7. To remove amastigotes, trypomastigotes were allowed to swim out of the pellet of samples that had been centrifuged for 7 min at 2500 rpm. T. cruzi parasites were added in a final volume of 200 \u00b5l/well. After 4 days, 50 \u00b5l of PBS containing 0.5% of the detergent NP40 and 100 \u00b5M Chlorophenol Red-\u03b2-D-galactoside (CPRG) (Fluka) were added. Plates were incubated at 37\u00b0C for 4 h and absorbance was read at 590 nm using a Tecan Spectra Mini plate reader.NIH/3T3 cells and parasites were harvested, washed once and resuspended in DMEM supplemented with 2% FBS and Pen-Strep-Glut. DMEM did not contain phenol red to avoid interference with the assay absorbance readings at 590 nM. Different numbers of NIH/3T3 cells were seeded in 96-well plates. After 3 h, compounds were added at the indicated concentrations and mixed by pipetting. BZN tablets  dissolved in DMSO and 4 \u00b5M Amphotericin B solution (Sigma-Aldrich) were used as positive controls. Different numbers of et al.c++3\u03c3c\u2212) / |\u03bcc+\u2212\u03bcc\u2212|] where \u03c3c+\u200a=\u200astandard deviation (SD) of positive control, \u03c3c\u2212\u200a=\u200aSD of negative control, \u03bcc+\u200a=\u200amean of positive control, \u03bcc\u2212\u200a=\u200amean of negative control. Subsequently, the best ratio was used for all growth inhibition assays  1\u22361).To calculate the Z\u2032 factor, we used the formula described by Zhang 50 values, \u03b2-gal activity (Abs590) was plotted against compound concentration for each compound. The IC50 was determined as the concentration at which the activity (absorbance) was half that in the absence of compound. Mean IC50 values are the average of independent experiments performed in triplicate on three different days.To determine ICN\u2032-{[5--2-furyl]methylene}-2-pyridinecarbohydrazide , 2--N-{3-nitro-5-[3-(trifluoromethyl)phenoxy]phenyl}acetamide  and 1-[6-hexyl]-1H-imidazole .Two thousand compounds in dimethyl sulfoxide (DMSO) from the DIVERSet library  were screened at 25 \u00b5g/ml in 96-well plates (80 compounds per plate). Each plate also contained triplicate wells of negative control (no compounds), positive control (4 \u00b5M Amphotericin B) and 1% DMSO (vehicle). Selected hits among the screened compounds include N\u2032-{[5--2-furyl]methylene}nicotinohydrazide (PCH2), N\u2032-{[5--2-furyl]methylene}isonicotinohydrazide (PCH3), 4-bromo-N\u2032-{[5--2-furyl]methylene}benzohydrazide (PCH4), N\u2032-{[5-(3-chlorophenyl)-2-furyl]methylene}-2-pyridinecarbohydrazide (PCH5), N\u2032-{[5-(2-chlorophenyl)-2-furyl]methylene}-2-pyridinecarbohydrazide (PCH6), N\u2032-{[5--2-furyl]methylene}-2-pyridinecarbohydrazide (PCH7), N\u2032-{[5-(3-chloro-4-methoxyphenyl)-2-furyl]methylene}-2-pyridinecarbohydrazide (PCH8), N\u2032-{[5--2-furyl]methylene}benzohydrazide (PCH9), N\u2032-{[5-(2-chlorophenyl)-2-furyl]methylene}nicotinohydrazide (PCH10), N-(3-methoxy-5-nitrophenyl)-2-acetamide (NT2), N-[3-nitro-5-(3-pyridinyloxy)phenyl]-2-acetamide (NT3), N-{3-[(5-chloro-3-pyridinyl)oxy]-5-nitrophenyl}-2-acetamide (NT4), 2--N-[3-(trifluoromethyl)phenyl]acetamide (NT5), N-[2-chloro-5-(trifluoromethyl)phenyl]-2-acetamide (NT6), N-[4-chloro-2-(trifluoromethyl)phenyl]-2-acetamide (NT7), N-[2-chloro-5- (trifluoromethyl)phenyl]-4-butanamide (NT8), 4--N-[2-(trifluoromethyl)phenyl]butanamide (NT9), 1-[5-pentyl]-1H-imidazole (CX2), 1-[4-butyl]-1H-imidazole (CX3), 1-[6-hexyl]-1H-imidazole (CX4), 1-[5-pentyl]-1H-imidazole (CX5) and 1-[4-butyl]-1H-imidazole (CX6). The derivatives PCH2\u2013PCH10 were chosen with >80% similarity to PCH1, NT2\u2013NT9 with >85% similarity to NT1 and CX2\u2013CX6 with >90% similarity to CX1.Chemically related compounds were also ordered from ChemBridge Corporation and include Trypomastigotes were rinsed once and plated in 96-well plates at 100,000/well with the compounds in a final volume of 200 \u00b5l of DMEM without phenol red supplemented with 2% FBS, Pen-Strep-Glut and 100 \u00b5M CPRG. Plates were incubated for 24 h at 37\u00b0C and absorbance was read at 590 nm.Cells (NIH/3T3 or HepG2) were washed and plated at a density of 50,000 cells/well of 96-well plates in 200 \u00b5l and allowed to adhere for 3 h. Twenty-four hour assays were done in DMEM without phenol red supplemented with 10% FBS and Pen-Strep-Glut, while 4-day assays were done in the same medium containing 2% FBS. Drugs were added and mixed. After 1 or 4 days, 20 \u00b5l of Alamar Blue  was added. Plates were incubated for 4 h (HepG2) or 6 h (NIH/3T3) at 37\u00b0C and fluorescence was read using a Labsystems Fluoroskan II plate reader  .50 values, fluorescence was plotted against inhibitor concentration. TC50 was determined as the concentration at which cytotoxicity (fluorescence) was half that in the absence of inhibitor.To determine TCFifty thousand NIH/3T3 cells were seeded on sterile glass coverslips in 12-well plates and allowed to adhere overnight. Five million parasites were added (MOI 100\u22361) and allowed to infect for 2 h in DMEM+2% FBS and Pen-Strep-Glut. Parasites were rinsed out three times with PBS. Infected cells were further incubated and fixed for 15 min with 4% paraformaldehyde at the times indicated.T. cruzi  at 1\u22362000 dilution. After rinsing, an Alexa Fluor\u00ae 488 goat anti-rabbit IgG secondary antibody  was added for 1 h at a 1\u2236800 dilution. DNA was stained with DAPI and coverslips were mounted on Mowiol. To determine the number of parasites per infected cell, between 200 and 300 infected cells per coverslip were scored in triplicate samples using an inverted Olympus IX70 microscope with a 60\u00d7 oil objective. Data are presented as mean\u00b1standard deviation. Images were taken with the same microscope.Fixed cells on coverslips were rinsed with PBS, permeabilized for 15 min in PBS with 0.1% Triton X-100 (Sigma-Aldrich). After blocking for 20 min in PBS with 10% goat serum, 1% bovine serum albumin, 100 mM glycine and 0.05% sodium azide, cells were incubated for 1 h at room temperature with a polyclonal rabbit anti-Adherent bone marrow-derived macrophages were harvested in cold DMEM+0.5 mM EDTA and seeded into an 8-well Lab-Tek II chambered coverglass  at a concentration of 50,000 cells/chamber 24 h before being used for infections.L. major and L. amazonensis parasites were opsonized for 30 min by incubation in DMEM containing 4% BALB/c serum and then allowed to invade macrophages in 200 \u00b5l DMEM supplemented with 10% FBS and Pen-Strep-Glut, at a MOI of 3 parasites per macrophage for 2 h at 33\u00b0C  L. amazonensis and 5 days for L. major. Medium was changed and drugs were added again at the same concentration on day 2 post-infection. Intracellular parasites were assessed after staining with DAPI (3 \u00b5M) by fluorescence microscopy. The total number of amastigotes/500 macrophages was counted in each well. Kruskal-Wallis test was used to analyze the data, followed by a Dunn's post-comparison test.T. cruzi trypomastigotes' infection of host cells. This type of assay would allow for the identification of compounds that inhibit either free extracellular trypomastigotes or intracellularly dividing amastigotes. The primary protocol for \u03b2-gal-expressing T. cruzi trypomastigotes of the Tulahuen strain infecting NIH/3T3 cells Our first goal was to optimize a simple and reliable assay for HTS in 96-well format to quantify The Z\u2032 factor is a statistical parameter used to assess the reproducibility and quality of HTS assays by taking into account the signal dynamic range and the data variation T. cruzi activity, a library of 2000 compounds (DIVERSet from Chembridge Corporation) was screened, initially at 25 \u00b5g/ml in single wells. This library contains compounds from a larger library (EXPRESS-Pick Collection) that are chosen for maximum pharmacophore diversity based on 3D conformation and drug-like properties. We hypothesized that adding test compounds to cells at the same time than parasites would allow the detection of compounds with both anti-free trypomastigotes and anti-intracellular growth activities. Primary screen concentration was 25 \u00b5g/ml, which corresponds to a range of 42 to 112 \u00b5M, based on molecular weights from 223 to 587. The threshold for selecting hits was set as the average of positive controls (Amphotericin B 4 \u00b5M) plus two times the standard deviation. The screening steps are schematically illustrated in To discover new compounds with anti-Our next goal was to select amongst the 70 confirmed hits the best candidates for further investigation. To this aim, compounds with high anti-trypanosomal efficacy and low toxicity to host cells were selected. The anti-trypanosomal activity of the 70 confirmed hits was first tested at six different concentrations from 25 \u00b5g/ml (51\u2013110 \u00b5M depending on compound molecular weight) to 8 ng/ml (16\u201335 nM). In parallel, the toxicity of these compounds was tested in different concentrations with a 4-day assay on NIH/3T3 cells using Alamar Blue (data not shown). Fifty-nine of the 70 hits lost completely their activity at 5 \u00b5g/ml and were discarded.PCH1: N\u2032-{[5--2-furyl]methylene}-2-pyridinecarbohydrazide; NT1: 2--N-{3-nitro-5-[3-(trifluoromethyl)phenoxy]phenyl}acetamide; CX1: 1-[6-hexyl]-1H-imidazole (50) versus anti-trypanosomal activity (IC50). The eight other hits that retained activity at 5 \u00b5g/ml . Under these assay conditions, the IC50 of BZN was found to be 1.15 \u00b5M\u00b10.08 (data not shown), consistent with the value of 1.5 \u00b5M reported by Buckner et al.Precise ICe curves . The mea0 values  of all tin vitro testing of toxicity 50 values are displayed in 50 to IC50 was again over 500 at both time points tested for PCH1 and CX1. The TC50 of NT1 was more than 150-fold greater than its IC50 at 1 day, but decreased to only 40-fold at 4 days.To characterize the toxicity profiles of the three compounds further, cytotoxicity assays were performed with HepG2 cells, a human hepatoma cell line commonly used for 50 was in the micromolar range for all compounds as shown in Our next goal was to determine which stage of parasite development was inhibited by these compounds. To assess if the observed effect of compounds was due to direct lysis of free trypomastigotes before they even invaded cells, we performed a lysis assay in which 100,000 parasites were incubated for 24 h in the presence of increasing concentrations of the selected compounds and the \u03b2-gal substrate CPRG. In this assay, \u03b2-gal activity increases proportionally to the number of parasites that are lysed by the compound, releasing \u03b2-gal in the medium. The ICT. cruzi trypomastigotes was inhibited by each of the compounds. To analyze the effect of the compounds in host cell invasion, we incubated NIH/3T3 cells for 2 h with trypomastigotes at the IC100 concentration. After thorough rinsing, fixation and staining of parasites, we did not find any significant difference with controls (data not shown).We next investigated which stage of host cell infection by 100 concentrations, we incubated cells for 2\u20133 days to allow for amastigote proliferation. In control cells, amastigotes homogenous in size were distributed throughout the cytoplasm of the host cells and kinetoplasts were observed closely apposed to the nucleus of parasites .When the compounds were added 2 days after infection, similar phenotypes were observed: PCH1, NT1 and CX1 on the infection by T. cruzi trypomastigotes of the Y strain. We performed the same development assay and quantified the number of parasites per infected cell for PCH1  was used as a positive control , and 70% for CX1 (p<0.05). To evaluate the effect of these compounds on intracellular L. amazonensis, which resides in large communal phagolysosomes, we repeated this experiment by adding a range of concentrations 2 h post-infection of macrophages for 3 days , 50% for NCT1 (p<0.5), and 70% for CX1 (p<0.5) at 2 \u00b5M.To evaluate the effect of these three compounds on another intracellular kinetoplastid, we tested them against ompounds . We obser 3 days . The numT. cruzi parasite growth and help us identify which parts of the molecules are important for their activity, we tested the activity of compounds chemically related to PCH1, NT1 and CX1 that were commercially available. These compounds were identified using the hit2lead website (https://www.hit2lead.com) and tested for activity against T. cruzi trypomastigote infection. The IC50 values for these compounds were determined and compared to their parental compounds .To assess if chemical modification of the compounds would improve their inhibitory effect on ompounds . We founPCH1, the pyridine nitrogen was varied from ortho (PCH1) to meta (PCH2) and para (PCH3) positions, resulting in 35-fold and >200-fold increases in IC50, respectively. Substitution of the pyridine ring with a para-bromophenyl group as in PCH4 also abolished activity, further reinforcing the importance of an ortho-nitrogen within the ring. Modifications to the chlorophenyl group explored the role of chloride substituents on this ring. Removal of the chloride at the ortho position as in PCH5 did not alter the effect, whereas removal of the meta-chloride as in PCH6 actually resulted in more potent inhibition (IC50\u200a=\u200a2.1 nM). Whereas repositioning the ortho-chloride of PCH1 to the para position as in PCH7 did not affect the effect, replacing this chloride with a methoxy group as in PCH8 gave poorer inhibition (IC50\u200a=\u200a1.6 \u00b5M), indicating that electron-donating and/or steric properties are detrimental at this position. Combinations of modifications to the pyridine and chlorophenyl rings in PCH9 and PCH10 resulted in decreased efficacy; however, comparison of PCH10 to the other meta-pyridine derivative PCH2 again indicates that improved inhibition results from removal of the meta-chloride substituent, as was observed with PCH1 and PCH6.More specifically, for NT1 maintained the 2-nitrotriazole moiety of the parent while containing modifications in the linker, nitrophenyl and trifluorotoluyl groups , removal of the nitrophenyl ring as in NT5 or introduction of another electron-withdrawing substituent as in NT6 and NT7 or increasing the linker length between the nitrotriazole and carboxamide group and placing the trifluoromethyl group of NT8 at the ortho ring position as in NT9. The IC50 values obtained for the modified compounds were all similar, suggesting that a variety of substituents are tolerated.Chemical variations of l groups . These mCX1, analogues CX2\u2013CX6 were assayed for growth inhibition as well . When the positioning of the methyl groups on the chloroxylenol group of CX1 was modified as in CX4, the effect was adversely affected, raising the IC50 to 300 nM. However, variation in the linker length as in CX5 and CX6 again revealed a similar pattern of preference, as the pentyl linked CX5 also displayed the most potency among the 4-chloro-2,6-xylenol series, with an IC50 of 20.5 nM.To explore the importance of the additional substituents and of the positioning of the two aromatic rings of  as well . TruncatT. cruzi, the parasite responsible for Chagas disease. To this aim, we optimized a simple and straight-forward assay that allows the HTS of compounds against T. cruzi replicating within mammalian cells. We tested 2000 compounds from the DIVERSet chemical library. This compound library has been useful to discover inhibitors of matrix metalloproteinase-9 in a whole cell assay New compounds are desperately needed to fight efficiently T. cruzi parasites.After screening the 2000 compounds, 70 confirmed hits (3.5%) were obtained. The rate of hits was relatively high, probably due to two main reasons: (1) the high concentration of compounds used for primary screening (25 \u00b5g/ml) and (2) because any compounds that are toxic to mammalian cells would also be scored as hits in this experimental design, since they would affect the host cells that are required for parasite replication. After a secondary screening to eliminate these false positive hits and select the most effective compounds, three potential candidates  were identified that were active in the nanomolar range at the stage of intracellular replication of the 50 values in the low-nanomolar range and low toxicity on mammalian cells. Although HepG2 cells have a limited drug metabolism activity to assess toxicity of metabolites 50 values in the low-nanomolar range when tested on intracellular replication of parasites, they were only active on free trypomastigotes at higher concentrations that were similar to or above the TC50 on mammalian cells. Therefore, it appears that our screening assay favors the selection of drugs that are effective against intracellular replication of parasites but not active on free trypomastigotes. This is probably a consequence of adding compounds and trypomastigotes simultaneously to host cells, a procedure that would not allow enough time for compounds with activity against free trypomastigotes to prevent completely invasion of host cells.The three hits we selected had ICNT1, has an IC50 of 190 nM on the \u03b2-gal T. cruzi strain. NT1 also displayed activity on the Y strain, but at higher concentrations. Interestingly, when tested against L. major and L. amazonensisNT1 had a dose-dependant anti-leishmanial effect on the intracellular form of the parasites. NTI was potent against L. major and L. amazonensis with an estimated IC50 of \u223c500 nM.One of the compounds that we have investigated, T. cruzi amastigote replication within host cells, but we did not observe amastigote lysis at 2\u20133 days. Its effect might therefore be more trypanostatic than trypanocidal. The toxicity of NT1 on mammalian cells was between 40- and 159-fold depending on the type of mammalian cells and the duration of the cytotoxicity assay. This is a relatively high toxicity and might therefore be an issue for further development of this compound.This compound inhibited NT1 is chemically similar to BZN in that they both contain an acetamide group linked to a nitro-substituted, heteroaromatic five-membered ring . NT1 is also chemically related to the approved anti-fungal agent fluconazole, as it contains a triazole ring, of which fluconazole has two. Fluconazole has an IC50 against T. cruzi in vitro of 8 \u00b5M T. cruzi infection has not been confirmed L. major, although some geographically distinct species such as L. tropica are refractory.NT1 that preserve the nitrotriazole moiety but include a variety of aryl and aryl ether substituents, we found that these variations did not modify strongly the anti-trypanosomal effect. It is therefore likely that the pharmacophore is the nitrotriazole group acting through a non-targeted mechanism, like BZN.Upon testing of chemical analogues of CX1, possesses imidazole and phenyl rings, similar to BZN but without a nitro substituent on the imidazole group and with chloride and methyl groups on the phenyl ring . It is not clear whether CX1 and BZN share the same target in T. cruzi. Comparison of the anti-T. cruzi activity of CX1 and BZN side by side revealed that the IC50 of CX1 is 50 times lower than that of BZN (23 nM versus 1.15 \u00b5M). CX1's dose effect on the Y strain of T. cruzi was similar to the \u03b2-gal-expressing Tulahuen strain, suggesting that the IC50 is close for the two strains. Additionally, intracellular L. major and L. amazonensis are sensitive CX1. Indeed, it significantly reduced the L. major and L. amazonensis parasite burden by 70% at a concentration of 2 \u00b5M, and had estimated IC50 of \u223c500 nM against both pathogens.Another compound identified in the initial screen, CX1in vitro was over 500-fold greater than the IC50 suggesting that this compound may be developed into a therapeutic drug. However, as CX1 is an amphiphilic compound, its cardiotoxicity will need to be evaluated carefully NT1, may be more effective against the acute phase of disease, where parasites replicate rapidly, inducing lysis like CX1 does might be essential for the development of drugs against the chronic stage of Chagas disease, where parasites are found in a quiescent intracellular state.Numerous studies have been performed trying to modify imidazole derivatives to decrease their toxicity profile, which, for compounds such as BZN, is the cause of severe side effects when used for treatment in patients PCH1 is characterized by a central hydrazide moiety that bridges a pyridine ring on the carbonyl side and furan and chlorophenyl rings on the nitrogen end. We observed that the position of the nitrogen in ortho within the ring is crucial for the effect, as well as the removal of the meta-chloride substituent. The hydrazide compound PCH1 induced major changes in amastigote morphology, such as presence of larger amastigotes in which replication of DNA-containing organelles took place, but normal cytokinesis into daughter cells was abnormal. Several compounds that affect epimastigotes replication, such as the vinca alkaloids agents vincristine and vinblastine present a similar phenotype, with formation of giant cells containing multiple nuclei and kinetoplasts PCH1, the parasites retain a normal nucleus/kinetoplast relationship PCH1 however had a trypanolytic effect. Moreover, PCH1 was found to have a deleterious effect on intracellular L. major with an estimated IC50 of \u223c2 \u00b5M and was more potent against L. amazonensis, which replicates in a large communal phagolysosome, with an estimated IC50 of \u223c100 nM. As hydrazide groups are problematic in a compound because of the possibility of release causing toxicity Finally, in vitro, it is now critical to determine their toxicity in animals and their efficacy in vivo to assess their potential as therapeutic agents against Chagas disease and leishmaniasis.In conclusion, HTS assays are a good tool to identify new compounds with anti-kinetoplastid activity. In this study, we found three new compounds, all possessing hydrophobic groups including multiple aromatic rings, at least one of which being nitrogen-substituted. It is apparent that the most important feature of the three highly effective compounds is the presence of hydrophobic, aromatic moieties. However, it is further apparent that electronic effects also serve a critical role. Despite the chemical similarities observed, the different phenotypic changes induced by each compound suggest that they are affecting different pathways in the intracellular parasites. As we have demonstrated their efficacy Alternative Language Abstract S1Translation of the Abstract into Spanish by Ana Rodriguez(0.04 MB DOC)Click here for additional data file.Figure S1(0.11 MB XLS)Click here for additional data file."}
+{"text": "To investigate cardioprotective effect of taurine in diabetic rats.-1, intraperitoneally) dissolved in 0.01 M citrate buffer (pH 4.5) for induction of diabetes, and rats in control and control\u2009+\u2009taurine groups were treated with the same volume citrate buffer. Taurine was orally administered to rats in control\u2009+\u2009taurine and STZ + taurine groups daily for 8 weeks. Rats were examined for diabetic cardiomyopathy by left ventricular (LV) hemodynamic analysis. Myocardial oxidative stress was assessed by measuring the activity of superoxide dismutase (SOD) and the level of malondialdehyde (MDA). Myocardial protein kinase B (Akt/PKB) phosphorylation and heme oxygenase-1 (HO-1) protein levels were measured by Western blot in all rats at the end of the study.Male Sprague-Dawley rats were assigned randomly into four groups of 15 rats: control group, control\u2009+\u2009taurine group, streptozotocin (STZ) group, and STZ + taurine group. Rats in STZ and STZ+ taurine groups were treated by a single injection of STZ (70 mg kgIn untreated diabetic rats, LV systolic pressure, rate of pressure rise, and rate of pressure fall were decreased, while LV end-diastolic pressure was increased, indicating reduced LV contractility and slowing of LV relaxation. The levels of Akt/PKB phosphorylation and SOD activity were decreased and HO-1 protein expression and MDA content increased. Taurine treatment significantly improved LV systolic and diastolic function, and there were persistent increases in activities of Akt/PKB and SOD, and the level of HO-1 protein.Taurine treatment ameliorates myocardial function and heart oxidant status, while increasing myocardial Akt/PKB phosphorylation, and HO-1 levels have beneficial effects on diabetic cardiomyopathy. Diabetes mellitus is a serious medical problem and has become a significant health concern. Diabetic patients can develop a specific cardiomyopathy called diabetic cardiomyopathy (DCM) , which iHeme oxygenase-1 (HO-1) is a ubiquitously expressed stress inducible enzyme that catabolizes heme into bilirubin, carbon monoxide (CO), and iron . The by-Taurine (2-aminoethanesulphonic acid) is the major intracellular free \u03b2-amino acid, which is one of the most abundant free amino acids present in mammalian tissues and blood cells. It is involved in many important biological and physiological functions, such as anti-oxidation, osmoregulation, membrane stabilization, and neurotransmission . TaurineThe aim of this study was to examine whether taurine increases HO-1 expression and ameliorates cardiac failure in type I diabetic cardiomyopathy. We examined left ventricular (LV) hemodynamic function, evaluated myocardial oxidative stress, and myocardial levels of HO-1, connective tissue growth factor (CTGF), and p-AKT in the heart.ad libitum for acclimatization. The animals were housed in stainless steel cages with sawdust bedding. Diabetes was induced by injecting a single dose of streptozotocin (STZ) , as previously described (-1 per day) was administered to the rats in the control\u2009+\u2009taurine and STZ + taurine group, and animals had free access to water after diabetes induction.All animal procedures and experiments were conducted in accordance with the official recommendations of the Chinese Community Guidelines. Male Sprague-Dawley rats, weighting 180-220 g, were provided by the Experimental Animal Center in Wannan Medical College and housed in a standard animal facility under controlled environmental conditions at room temperature, 22\u2009\u00b1\u20092\u00b0C and 12-hour light-dark cycle. Sixty rats were kept for 1 week on balanced ration with water and food escribed . Thirty After eight weeks of drug dosing, rats were anesthetized with sodium pentobarbital (50 mg/kg i.p.). The right carotid artery was cannulated with a Millar miniature catheter and advanced into the aorta to record arterial pressure. The aortic catheter was then advanced into the left ventricle for recording of left ventricular systolic pressure (LVSP), left ventricular developed pressure (LVDP), left ventricular end diastolic pressure (LVEDP), maximum rate of rise/fall of left ventricle pressure (\u00b1dP/dtmax). All pressure data were recorded with MedLab data acquisition system  and fasting blood samples and hearts were collected and investigated on the same day.Estimation of total cholesterol (TC), triacylglycerol (TG), low density lipoprotein (LDL), high density lipoproteins (HDL), creatine kinase (CK), and lactate dehydrogenase (LDH) in the serum was done using appropriate kits on semi auto analyzer by well standardized methods .Heart homogenate  was prepared with 0.1M PBS and centrifuged at 1200 g for 10 minutes. The supernatant was used to determine SOD activity and MDA level with commercially available kits (Nanjing Jiancheng Bioengineering Institute).Heart samples (0.2 g) were lysed and homogenized in 2 mL of lysis buffer  for 30 minutes on ice and cleared by centrifugation at 13\u2009000 g for 15 minutes at 4\u00b0C. Total protein concentration was determined in the supernatant using the Bradford assay . For each lane, equal amounts of protein were mixed with sodium dodecyl sulfate (SDS) sample buffer and boiled for 5 minutes. Samples were separated on a 10% sodium dodecyl sulfatepolyacrylamide gel and transferred to 0.2-\u03bcm nitrocellulose membrane. Nitrocellulose blots were blocked by incubation in TBS-T  containing 5% non-fat milk for 1 hour at room temperature and incubated with a rabbit polyclonal anti-HO-1, AKT/PKB, phospho-AKT/PKB, CTGF, \u03b2-actin antibody  overnight at 4\u00b0C. After 3 washing steps, a secondary anti-rabbit antibody  was added and incubated for 1 hour. After rinsing with wash buffer for three times, the reaction was visualized by DAB . The relative amounts of the bands were quantified by densitometry using image software.P-values of <0.05 were considered significant.Results are expressed as mean\u2009\u00b1\u2009standard error of the mean of the values. Statistical significance for all variables was determined by analysis of variance (ANOVA) followed by a Tukey post hoc analysis by using SPSS, version 16.0 . After STZ administration, animals in STZ and STZ+ taurine groups showed similar levels of hyperglycemia. Diabetic rats treated with or without taurine had significantly lower body weight than controls . Howevertmax. Diabetic rats treated with taurine showed increased LVSP, LVDP, and reduced LVEDP, with a higher left ventricular\u2009\u00b1\u2009dP/dtmax. Untreated diabetic rats had significantly decreased heart rate (HR). Taurine treatment increased HR (Left ventricular hemodynamic parameters were measured in taurine-treated and un-treated control and diabetic groups of rats for assessment of ventricular performance. Un-treated diabetic rats showed a lower left LVSP, LVDP, and a higher LVEDP than control rats . Also, ueased HR .The levels of LDH and CK were significantly higher in untreated diabetic rats than in control rats. However, taurine treatment in diabetic rats markedly reduced the levels of LDH and CK compared with those in untreated diabetic rats .Taurine had a significant effect on lowering triglycerides, cholesterol, and LDL levels and increasing HDL levels in diabetic rats . All theThe content of malondialdehyde equivalents in the heart, which reflects oxidant-induced lipid peroxidation reactions, was significantly increased in diabetic animals . TaurineWestern blot analyses showed an accumulation of HO-1 protein in diabetic rats compared with normal control and normal taurine rats . TaurineDiabetes led to a reduced expression of p-Akt without affecting the levels of Akt and increased expression of CTGF, while taurine partially restored STZ-induced loss of Akt phosphorylation and reduced the expression of CTGF  and 3B.This study showed that diabetes enhanced oxidative stress and impaired cardiac function and that treatment with taurine was beneficial to the hearts of diabetic rats as it restrained the progression of metabolic disorders of diabetes. STZ-diabetic rats showed elevated blood glucose levels. Also, there was a notable increase in the HW/BW ratio, which signifies cardiac hypertrophy. Metabolically, the diabetic heart is characterized by diminished glucose utilization and increased fatty acid oxidation, resulting in lipid accumulation in the myocardium ,6. TauriIncreases in levels of circulating cardiac damage markers, such as CK and LDH, represent a powerful and sensitive predictor of increased cardiac complications . In the Increased oxidative stress and altered antioxidant pool have been found in both clinical and experimental type 1 diabetes . This waAkt is an important downstream effector of insulin signaling, critical for regulation of cardiac growth and survival , while tIn summary, the present findings show that treatment with taurine may attenuate the progressive cardiac dysfunction and myocardial oxidative stress in a murine model of diabetic cardiomyopathy. The beneficial effect of taurine is a result of its inhibition of myocardial oxidative stress processes through its potential autoregenerative antioxidant properties. Evidence indicates that any treatment that is able to modulate oxidative stress and enhance antioxidant would help to delay the onset of DCM in diabetes mellitus. Thus, we suggest further exploration of the role of antioxidant therapy given immediately after the diagnosis of type I diabetes mellitus to reduce the risk of future cardiovascular complications."}
+{"text": "Classical schools like \u201ccladists\u201d and \u201cpheneticists\u201d are recovered but others are not: \u201cgradists\u201d are separated into two blocks, one of them being called here \u201cgrade theoreticians.\u201d We propose new interesting categories like the \u201cbuffonian school,\u201d the \u201cmetaphoricians,\u201d and those using \u201cstrictly genealogical classifications.\u201d We consider that networks are not useful to represent shared ideas at the present step of the study. A cladogram is made for showing who is sharing what with whom, but also heterobathmy and homoplasy of characters. The present cladogram is not modelling processes of transmission of ideas about trees, and here it is mostly used to test for proximity of ideas of the same age and for categorization.The aim of this study is to explore whether matrices and MP trees used to produce systematic categories of organisms could be useful to produce categories of ideas in history of science. We study the history of the use of trees in systematics to represent the diversity of life from 1766 to 1991. We apply to those ideas a method inspired from coding homologous parts of organisms. We discretize conceptual parts of ideas, writings and drawings about trees contained in 41 main writings; we detect shared parts among authors and code them into a 91-characters matrix and use a tree representation to show who shares what with whom. In other words, we propose a hierarchical representation of the shared ideas about trees among authors: this produces a \u201c Historians of Science used to categorize schools of thinking without any formal tools to do it . To produce such categories they had to compare ideas among authors, however, without any clear procedure. The same can be said about systematists, who have been categorizing themselves for long ago into schools like pheneticists, cladists, pattern cladists, synthetists, etc. We chose the idea of \u201ctree\u201d used across two centuries and half by various authors to represent relationships among organisms. Our basic assumption is that the types of relationships (shown as graphs or branching diagrams) used through time have differed, but they themselves are somehow related. This study therefore focuses on the history of the use of trees to represent the diversity of life and applies to ideas about trees a method inspired from coding homologous parts of organisms. We discretized conceptual parts of the tree; we detected shared parts among authors; we coded those parts into a character matrix and we used a tree representation to show who shares what with whom. In other words, we propose a hierarchical representation of the shared ideas about trees among authors: this produces a \u201ctree of trees\u201d  from other authors of different times and places. Scientific ideas can be transferred in a vertical manner from one epoch to another; they can convergently appear at the same time; they can also be \u201chorizontally\u201d transferred in a same epoch from one author to another. When comparing ideas, two questions are then to be considered:Are we able to recognize the same idea through different words, and are we able to avoid the pitfall of using the same words used to express different ideas? This is a problem for every historian of ideas, here we propose to formalize shared ideas, i.e. to make explicit through character coding what is often implicitly accepted;How to express shared ideas in a synthetic and consistent manner? Some ideas are widely shared; others are restricted to a few authors. A hierarchical distribution of sharings among authors is therefore needed, and a most parsimonious tree seems to be suitable because it shows who is sharing what with whom in a hierarchical manner\u2026 but what is the meaning of maximizing consistency among ideas?Here we promote the formalizing step enabled by the parsimony approach to comparison, in a theory-free framework at least at the beginning see .th century was not sampled the same way as the XVIIIth and XIXth. Indeed the explosion of tree reconstruction methods in the second half of the XXth century th century  is considered as the ancestor of all other dogs. The main lines are the first transfers of dogs: to the west, the east, the north, etc. Those transfers produce new dog varieties that are themselves transferred to other countries. Those second lines are much smaller: they do not indicate where dogs have been transferred. As relative coordinates, those lines are to be read as if the card was centered on the firstly-transferred dog, giving to the figure the aspect of an unrooted tree. The table is difficult to understand without Buffon's text, which comes with it.This table is not a tree. However, Buffon describes it with words and concepts that are commonly used to describe trees, even if the tree is never used as a figure. We can study it as a tree-like extension of maps: it describes a tree-like classification of a part of life, dogs.th volume of his Histoire Naturelle, Buffon describes the phenomenon of \u201cdegeneration\u201d, what he explains in terms of mechanisms. There is an \u201calteration\u201d, as a consequence of the influence of climate, of migrations, etc.; but there is also an internal modification of beings with generations.Ending the 14Describing this phenomenon, Buffon depicts a tree, grouping together horses, donkeys and zebras. If this figure is never drawn, its description depicts its branches, its root, its ramifications and the mechanism guiding the elaboration of the tree.This tree is one of the three first occurrences of classificatory trees with a strict methodology, even if it is not drawn but written.Duchesne is a french botanist from Versailles. Working with his father, he concentrates his studies on strawberry plants, which he cultivates. He experiments with hybridization of strawberries and creates a new variety, which he considers to be a new species.Histoire naturelle des fraisiers firstly investigates the notion of species. Then, he classifies strawberry plants following their supposed genealogy.Duchesne's In order to fulfill this classification, Duchesne draws a genealogical tree of strawberry plants. He also investigates the idea of strawberry genus and continues with a description of how to culture strawberries.This tree, one of the three first occurrences of trees of life, is the first drawn one.Elenchus Zoophytorum, written in Latin, is a large study of zoophytes. Before this work, Pallas composes a long introduction in the end of which he describes the shape of life classification as being a tree. He strongly argues against the use of scales of beings. A scale of beings is a linear, unidimensional classification of life, generally ending with mankind at its top. The tree he describes is the first global tree of life, grouping plants, animals, and even minerals on its root. The content of trunk and of the main branches is described, as well as the classificatory mode.Germano-Russian zoologist, Pallas travelled through Europe. His Pallas concludes this introduction by strongly recommending the use of such classificatory trees. Interestingly, this written tree has never been drawn by the author.Histoire Naturelle des oiseaux , the sixteenth volume of his Histoire Naturelle. The scope of this tree is larger than the previous one: there is no more only a few species that are grouped together, but many avian species that are regarded as being from the same family. Buffon elaborates several trees, each one being the grouping of closely related species. Those family links are as much numerous as the bird species are small.If the previous occurrence of a tree depiction in Buffon's works was located at the end of the volume, this one is situated in the introduction of the first volume of his Buffon links this description to the organization of his work. In this study of birds, he prefers their grouping in genera and their global description versus a description of each species following another.Ordines Naturales Plantarum, R\u00fchling describes a classification method inspired from other botanists that he then applies to elaborate a succinct classification.In his At the end of the preface, R\u00fchling describes and draws a tree indicating \u201cquasi-inbred\u201d affinities between plants. But the classification is not an evolutionary one. Furthermore, the author describes his figure as a geographical table. But this figure is rooted; it contains nodes, branches and leaves. Its shape is the one of a tree.Metamorphose der Pflanzen (Metamorphosis of Plants), he studies the affinities between the organs of plants. Those affinities are a metaphor of the affinities and metamorphoses of plants themselves There is a tree-like metaphor of evolution in this work.Better known as a poet, playwright and writer, Goethe has also written a few books and essays about Natural Sciences. In his Experimentation of a new classification of plants\u201d, which is described along with its pitfalls. Augier considers that classificatory tables failed. He then asserts that the only possibility is to classify plants by using a tree that he draws without any evolutionary consideration.French botanist, Augustin Augier elaborates an \u201cThis tree is guided by considerations of values \u2013 from the less perfect to the more perfect, in terms of complexity of organization , through branches \u2013 but also the inclusion and the succession of ranks.Philosophie Zoologique is an epistemological watershed in Life Sciences. In the first part of his work, he describes the mutations of bloodlines along generations of which taxon. Lamarck's theory is the first generalized theory of evolution - even if that word is not yet used in its present meaning. Evolution is seen as a mutation of organs of animals with an increasing complexity of them.Lamarck's In the text, Lamarck describes his concept that the only possible classification of life is onto a scale of beings. But, in the addenda, he draws a tree illustrating the successive states of bloodlines.Barban\u00e7ois is a follower of Lamarck. In a short paper, he more thoroughly investigates the succession of beings. He organizes them onto his own tree that follows, on the same page, Lamarck's one. Barban\u00e7ois makes some modifications in Lamarck's classification.Barban\u00e7ois's second article, published a few months after the previous one does not contain the same tree, but much more a hierarchic key which makes gradations in terms of values within each group. He includes humans in his classification (which Lamarck did not do), splitting them into narrow-minded humans and clever ones.Agassiz writes a five-volumes classification of fossil fishes based on the shape of their scales. There, he draws a tree that represents explicitly the occurrences of fossil species through geological times.Agassiz is not an evolutionist, and he refers to periods of supernatural disappearances and creations of species.Vestiges work offers a history of Earth and Life. The author proposes a series of theories to explain the world and the universe, including various concepts about the evolution of life. Then, he proposes several recommendations about classification of life. Chambers explains evolution in terms of increasing complexity, and draws a tree to illustrate his words.Published anonymously, the The French Academy of Sciences proposed in 1850 a contest to researchers. They had to elaborate a classificatory system aimed at answering three queries: the position of fossils in sedimentary formations; the question of their appearance and disappearance; and relationships between the present shapes of living forms and the previous ones. The proposed system had to be based on one of the main phyla of life, at least one of the animal classes, but preferably treating life as a whole. The idea was not to propose a theory of evolution, but to offer a classification system suitable for all geological periods.The price was awarded to Bronn in 1856, which based his system on the observations of successions of beings in strata since Cuvier and D'orbigny's works. The system he elaborates is not an evolutionary one but is based on times of extinctions and creations. Bronn proposes a classificatory tree-shaped system to illustrate his conclusions.Edward Hitchcock was a geologist. In this work, he presents views on geological facts for the public and his students. This book was moreover destined to a Geology congress.Describing geological data, Hitchcock presents the fossils found in each stratum and then elaborates a classificatory table. This table is then converted into a set of two grouped trees of life, titled \u201cPaleontological chart\u201d. The first one is for animals, the second for plants. Those evolutionary trees are commented with Hitchcock's theory of evolution. In each one, two groups are crowned: Mammalia for animals, with Man on the crown, and Palms for plants.Originally published in the Annals and Magazine of Natural History, Wallace's paper is an attempt to explain the formation of species from other ones. The system given describes the geological, geographical and anatomical arrangement of living forms. The notion of \u201cantitypes\u201d, similar to our \u201cancestor\u201d notion, guides the theoretical principle.To illustrate those ideas, Wallace describes a theoretical figure, openly analogous to a branching tree, which is not drawn.After a study of birds in Southern America, and during another one in the Indian Islands, Wallace begins a classification of bird groups. The finished work is not an evolutionary one but rather an arrangement of groups according to their morphological affinities.In this article, Wallace draws two classificatory unrooted trees of birds.In this founder work for modern biology, Darwin proposes a theory for the evolution of species and their classification. The famous tree from that book functions as a conjecture about the general shape of the genealogical links if the theory is true Albert Gaudry was a paleontology professor at the French National Museum for Natural History, which he directed. In 1866, he published a genealogical classification of Pikermi (Greece) fauna. Benefiting from exceptionally preserved fossils, he attempted to arrange them following Darwin's prescriptions. His tree, considered as the first use of Darwin's one used for classifying, was lauded by Darwin.Gaudry did not consider natural selection to be true, but rather believed in a deistic-guided harmony and regulation.In this early work, Haeckel draws the famous monophyletic tree of life that is divided into three kingdoms following the three domains of study of life: Plants, Animals and Protists.History of Creation, Haeckel studies the history of the theories of evolution and proposes an inventory and a review of modern knowledge in biology. There, he develops his theory of ontogeny, which he links to the phylogeny. Then, defining the term of phylogeny , he performs a phylogenetic classification of life with numerous genealogical trees. Finally, he deals with the place of mankind among living organisms and a racialist classification of humans.In his Anthropogenie is a history of the development of mankind. Haeckel uses the idea of ontogeny, explained by phylogeny, to trace the history of the human bloodline. Organ after organ, he achieves a history of the improvement of the main body parts into evolutionary steps up to the development of mankind.He illustrates his work by a genealogical tree of mankind, divided into a succession of genealogical groups.This German volume was intended for bird-breeders. It presents a treelike classification of extant birds.The Origin of Species is very similar to the first one in its content, many corrections and rewritings have been done since. If the figure of Darwin's tree is exactly the same, the epistemological content of the text has been slightly modified. This is the reason why the first and the last edition of Darwin's Origin of Species have been studied as two different operational taxonomic units.Even if this posthumous last edition of Palais de la D\u00e9couverte.Lucien Cu\u00e9not describes a genealogical tree of animals. Aimed at illustrate a classification of life, this colored figure had a high educational purpose: it was even presented in a French science Museum, the In this article, Cu\u00e9not describes the ideas directing the elaboration of the tree. He lends his own considerations about a direction in evolution and the idea that it is finished: there is no more evolution.Ernst Mayr wrote a treatise about the principles of numerical taxonomy. This one is destined to teachers, biologists, and also amateurs. After a brief history of taxonomy, Mayr elaborates taxonomic procedures from the collection of specimens to the elaboration of taxonomic papers. He describes here the different analysis methods, and includes several trees in order to describe their elaboration. Then, he describes the process of zoological nomenclature following international rules.Teilhard de Chardin, paleontologist and Theologian, wrote two books aimed at explaining the conciliation between scientific knowledge and his personal religious believes. In this first one, written in 1947 and published as posthumous, he writes a history of the Universe. Linking theories in Physics and Biology with personal convictions, he writes an \u201cintroduction to an explanation of the world\u201d and an attempt of general explanation of evolution. Teilhard de Chardin elaborates a theory to accommodate Darwinian natural selection to degrees of higher encephalization given to some species, until a cosmic \u00abomega\u201d point. He represents this theory with several tree drawings.Homo sapiens in nature, among other forms of life. Teilhard de Chardin writes a story of the anthropogenesis in five steps: life in the universe, biosphere, appearance of mankind, expansion step of his \u201cnoosph\u00e8re\u201d and then its compression. More than a study of the past, the author aims at giving an interpretation of the appearance of mankind, and its future in a theological interpretation of life.In this second work, Teilhard de Chardin concentrates his study on mankind as a \u201cphenomenon\u201d. He attempts at assigning the place of In this work, Simpson develops classificatory models. From the original data to the tree and the classification, he gives instructions to proceed. This book is less an essay on classifications than a kind of handbook for students or researchers. There are several kinds of trees illustrating each step of the elaboration of a taxonomic work.How can taxonomists make non-arbitrary groups? Tough they are convinced by evolution, Sokal and Sneath claim the impossibility to find the phylogeny of species. But they advocate for tree-construction methods based on global similarity. Characters are not directly treated as such onto the tree because they have been previously mixed into a pairwise distances matrix. Thus their \u201cphenograms\u201d aren't phylogenies, what is assumed by the authors, but one of the first attempts to mathematize and objectivize the elaboration of taxonomic groups.This work condenses numerous data about vertebrates. Including many paleontological data, it proposes tree-shaped classifications of vertebrates.Sokal's article develops the first principles of numerical taxonomy to match to new computation possibilities given by computers. Sokal develops much more this theory to make it able to classify imaginary animals, the famous \u201cCaminalcules\u201d. Then, he proposes a mathematically and similarity-based ranking method.Grundz\u00fcge einer Theorie der phylogenetischen Systematik\u201d proposes a novel classification method. It aims at reconstructing phylogeny, given as knowable, without the need of inclusion of pre-conceived groups into the procedure. He redefines monophyly, paraphyly and polyphyly and concepts of species and higher taxonomic groups.This English version of Hennig's \u201cHennig's Phylogenetic Systematics has become the basis of modern classifications.Romer explores, in this article, the origin of modern man in a succession of \u201cmajor steps\u201d since a \u201cmetazoan ancestor\u201d. He aims at reconstructing this sequence of selective steps from tunicates to vertebrates and from the rise of a bony structure to the emergence of terrestrial higher vertebrates, and then to primates and mankind.Are amphibians descended from a single common ancestor, or are they a polyphyletic group? In this article, Romer discusses, in terms of emergence of groups from other ones, the development of vertebrates and the search of intermediate forms. From fossils and paleontological data, he elaborates two trees: the first one for vertebrates, the second for tetrapods. Then, he discusses the production of \u201cnatural classes\u201d, descending from a common ancestor.Ten years have passed since Sokal and Sneath's first Numerical Taxonomy. Technology has lead to the appearance of computers in laboratories, enhancing computational possibilities. Epistemological and mathematical novelties have been developed, such as the parsimony algorithm. Above all, Hennig's Phylogenetic Systematics emerged in the English-speaking world and totally remodeled the methodological landscape of Systematics.The authors have corrected and enriched their own considerations. Especially, they develop in this work the idea of \u201cnumerical cladism\u201d and its methodologies.Almost twenty years after the rise of cladism, after ten years of intense debates among the classificatory schools of pheneticists, cladists and synthetists, time has come to write a new history of biology. Mayr writes three books to do so. This one is about Evolution.Well-known for his gradist classifications, Mayr casts a critical eye on other schools. This epistemological work deals about clades, grades, and their representation onto trees.Reconstructing the Past summarizes the most recent methodological discoveries since the Hennigian revolution. From a philosophical and epistemological point of view, it discusses the implementation of the parsimony principle and its achievements. Moreover, it explores the suitability of statistical methodologies for cladistics.Tassy, paleontologist, writes a popularization work about the history of trees of life and their contemporaneous use and elaboration. His critical views about his predecessors enable us to code his own ideas about trees into our matrix.The corresponding list of analyzed sources is therefore the following:Agassiz L (1843) Recherches sur les Poissons Fossiles, tome I. Neuch\u00e2tel: Imprimerie de Petitpierre.Augier A (1801) Essai d'une nouvelle classification des v\u00e9g\u00e9taux conforme \u00e0 l'ordre que la nature parait avoir suivi dans le r\u00e8gne v\u00e9g\u00e9tal. Lyon: Bruyset a\u00een\u00e9 et comp.Barban\u00e7ois CH (1816) Observations sur la filiation des animaux depuis le polype jusqu'au singe. Journal de physique, de chimie, d'histoire naturelle et des arts 82: 444\u2013448.Barban\u00e7ois CH (1816) Observations pour servir \u00e0 une classification des animaux. Journal de physique, de chimie, d'histoire naturelle et des arts 83: 67\u201378.Bronn HG (1861) Essai d'une r\u00e9ponse \u00e0 la question de prix propos\u00e9e en 1850 par l'Acad\u00e9mie des sciences pour le concours de 1853, et puis remise pour celui de 1856. Comptes rendus hebdomadaires des s\u00e9ances de l'Acad\u00e9mie des Sciences, suppl.2: 377\u2013918.Buffon G (1755) Table des chiens et de leurs vari\u00e9t\u00e9s. In: G. Buffon (Ed.) Histoire naturelle, g\u00e9n\u00e9rale et particuli\u00e8re, tome V. Paris: Imprimerie Royale. pp. 311.Buffon G (1766) De la d\u00e9g\u00e9n\u00e9ration. In: G. Buffon (Ed.) Histoire naturelle, g\u00e9n\u00e9rale et particuli\u00e8re, tome XIV. Paris: Imprimerie Royale, 311\u2013374.Buffon G (1770) Histoire naturelle des oiseaux, tome XVI. Paris: Imprimerie Royale.Chambers R (1844) Vestiges of the natural history of creation and other evolutionary writings. 1st ed. Reprinted (1994). In: J. Secord (Ed.) Chicago: University of Chicago Press.Cu\u00e9not L (1940) Un essai d'arbre g\u00e9n\u00e9alogique du r\u00e8gne animal. La Revue Scientifique 78: 223\u2013229.Darwin C (1859) On the origin of species by means of natural selection. John Murray, London. First Edition. Penguin Classics, 1985, London: Penguin Books.Darwin C (1876) On the origin of species by means of natural selection. London: John Murray.Duchesne N (1866) Histoire naturelle des fraisiers. Paris: Didot le Jeune et C.J. Panckoucke.Gaudry A (1866) Consid\u00e9rations g\u00e9n\u00e9rales sur les animaux fossiles de Pikermi. Paris: F. Savy.Goethe JW (1790) Essai sur la m\u00e9tamorphose des plantes. Traduit de l'allemand sur l'\u00e9dition originale de Versuch die Metamorphose der Pflanzen zu erkl\u00e4ren, Gotha par M. Fr\u00e9d\u00e9ric de Gingins-Lassaraz, 1829. Gen\u00e8ve: Barbezat.Haeckel E (1874) Anthropog\u00e9nie. Traduit de l'allemand sur la 2e \u00e9dition de l' Anthropogenie par le Dr Ch. Letourneau, 1877. Paris: C. Reinwald.Haeckel E (1866) Generelle morphologie. Berlin: G. Reimer.Haeckel E (1868) Histoire de la cr\u00e9ation des \u00eatres organis\u00e9s, d'apr\u00e8s les lois naturelles. Traduit de l'allemand sur la seconde \u00e9dition du Nat\u00fcrlichen Sch\u00f6pfungsgeschichte par le Dr CH. Letourneau, 1877. Paris: C. Reinwald.Hennig W (1950) Grundz\u00fcge einer Theorie der phylogenetischen Systematik. Berlin: Deutscher Zentralverlag.Hennig W (1966) Phylogenetic Systematics. Urbana: Univ. of Illinois Press.th edition. New York: Newman and Ivison.Hitchcock E (1853) Elementary Geology with an introductory Notice, 8Lamarck JB (1809) Philosophie Zoologique. Paris: Dentu.Linnaeus C (1758) Systema naturae. Editio Decima. Impensis Direct. Stockolm: Laurentii Salvii.Mayr E (1982) The Growth of biological thought: diversity, evolution and inheritance. Cambridge: Harvard University Press.Mayr E (1953) Methods and principles of systematic zoology. New York: McGraw-Hill.Pallas PS (1766) Elenchus Zoophytorum. Den Haag: Apud Petrum van Cleef.Reichenow A (1882) Die V\u00f6gel der zoologischen G\u00e4rten. Leipzig: L.A. Kittler.Romer AS (1966) Vertebrate paleontology. Chicago: University of Chicago Press.Romer AS (1967) Major steps in vertebrate evolution. Science 158: 1629\u20131637.Romer AS (1973) L'origine des classes de vert\u00e9br\u00e9s. La Recherche 33: 347\u2013361.R\u00fchling J (1774) Ordines naturales plantarum commentatio botanica. Goettingen: Sumtibus vid. Abrah. Vandenhoeck.Simpson GG (1962) Principles of animal taxonomy. New York: Columbia university press.Sober E (1988) Reconstructing the past. Massachusets Institute of Technology Press. Cambridge.Sokal RR (1966) Numerical Taxonomy. Scientific American 215(12): 106\u2013116.Sokal RR, Sneath PHA (1963) Principles of numerical taxonomy. San Francisco: W.H. Freeman.Sokal RR, Sneath PHA (1973) Numerical Taxonomy. San Francisco: Freeman. Anderberg, M. R.Tassy P (1991) L'arbre \u00e0 remonter le temps. Paris: Christian Bourgois.Teilhard de Chardin P (1956) Le groupe zoologique humain. Paris: Albin Michel.Teilhard de Chardin P (1955) Le ph\u00e9nom\u00e8ne humain. Paris: \u00c9ditions du Seuil.Wallace AR (1856) Attempts at a Natural Arrangement of Birds. The Annals and Magazine of Natural History, second series 105: 193\u2013214.Wallace AR (1855) On the Law which has Regulated the Introduction of New Species. Annals and Magazine of Natural History, second series 16: 184\u2013196.Zaluziansky A (1592) Methodi herbariae Libri Tres. Francofurti: E Collegio Paltheniano.The analysis is based on 91 characters. Characters descriptions involve some specific vocabulary, which is explained here.A blob, or a bubble, is a bidimensional baloon. A \u201cbubble tree\u201d, or \u201cromerogram\u201d, is a tree made of such kinds of elementary objects, either linked to one another (e.g. in Romer) or independent (e.g. in Agassiz). Rather than linear branches, \u201cbubble trees\u201d are successions of closed two-dimensionnal shapes.A discontinuity is a gap, lack of continuity between two elements. Those elements can be genealogical links, blobs, groups based on global similarity, or in a chain of beings\u2026 Discontinuities are not \u201cvertical cuts\u201d (below): cuts are lines, not gaps.This axis of a tree represents diversification, i.e. the number of independent lines to the terminal leaves. This number, along this axis, does not increase with hierarchical resolution. An unresolved tree of 7 terminals has a value of 0 in the hierarchical axis and a value of 7 in the diversification axis. A fully resolved tree of 7 terminals has a value of 5 in the hierarchical axis and always a value of 7 in the diversification axis.Groups are basically sets of objects gathered according to a given consistency. Thereby, for example, for phylogenetic systematics, taxa are sets of individuals grouped according to a principle of monophyly.The hierarchical axis of a tree is the one that counts the number of levels of inclusion implied by the various groups (or ranks), i.e. by the hierarchical resolution. An unresolved tree of 7 terminals has a value of 0 in the hierarchical axis and a value of 7 in the diversification axis. A fully resolved tree of 7 terminals has a value of 5 in the hierarchical axis and a value of 7 in the diversification axis.The objects set on leaves are the kind of elementary entities classified. These can be taxa , musical instruments, ideas\u2026 If they are taxa, they can be of several kinds: classes, families, species, populations, or openly one specimen.Properties are attributes, qualities or characteristics of the classified objects.Steps. A step is an evolutionary stage. It generally implies a progression toward a goal, a more complex evolutionary stage.in fine, closer to mankind's abilities.An \u201cevolutionary value\u201d is the quality of something that renders it, line that cuts a tree into \u00abparaphyletic\u201d groups, i.e. a node but not all its descending branches. A vertical cut is not what we call above a \u201cdiscontinuity\u201d. A discontinuity is a gap, not a line.A \u201cvertical cut\u201d is a vertical To allow a better understanding of the ideas that are coded into the character matrix, we classified the 91 characters into five thematic areas:The elements of the tree,The meaning of the tree,The content of the tree,Trees and taxonomy,The methodology employed.Through these five thematic areas, and to facilitate understanding of characters, the characters are themselves grouped into 33 sections. Each of them is a question about the tree.Here we detail each component of the tree, whether they are general  or specific to certain authors . We also code the meaning of the tree root in terms of whether it implies an object or concept. If its meaning is an object, it is either considered as being (or having been) alive or an inert entity . If the root refers to a concept, it is either an initial state of characters or a type.The root is the base of the tree. It is the point from which emerge the first branches and thus all the potential extent of their diversification.Section \u201cMeaning of the root\u201d (Characters 1 to 7). Section \u201cMeaning of the lines\u201d . The term \u201clines\u201d refers to the branches of trees. They represent links between roots, leaves or trunk. Links carry a message: they are the expression of a purely logical relationship among objects or branches bear a content. This content changes along the branch: bloodlines, or gradation (or not) in terms of perfection.Section \u201cMeaning of the internal nodes\u201d (Characters 11 to 14). Nodes are, topologically, the point from where branches emerge. As they are a-dimensional objects, they cannot express any gradation. However, they carry information. As trees express relationships among the various entities of life, nodes can refer to species, races and varieties or groups of larger size. They can also bear concepts: mass extinctions, characters, etc. Finally, nodes are sometimes linked to a notion of ancestor: these two ideas can then be confused and a \u201cconcrete\u201d ancestor be placed at this point.Section \u201cMeaning of the leaves\u201d (Characters 15 to 19). Leaves are, in a tree, objects connected to a line and only one. They are moreover located opposite to the root. In addition, leaves can be related either to current times or past ones. They can explain the end of an evolutionary pathway, its finality or merely its most recent expression. Indeed they can furthermore be the expression of an evolutionary destiny, a teleological apex of evolution, the ultimate ending of a progression. Leaves may symbolize groups or species. They can also consider time, reflecting changes in species and their reasons. Finally, some of authors regard leaves as the only detectable objects.Section \u201cMeaning of vertical cuts\u201d (Character 20). A \u201cvertical cut\u201d is a split between two parts of the tree. If present, they symbolize a break-up between either groups or kingdoms.Section \u201cMeaning of \u201cblobs\u201d (Characters 21 to 22). A \u201cblob\u201d, or a \u201cbubble\u201d, is a swelling in size into the tree. They most often replace branches. As bi-dimensional objects \u2013 branches are uni-dimensional ones \u2013 they so express a second message. Bubbles may thus refer to a numerical quantity of species within a given group over the generations. They may furthermore bear a message of gradation.Section \u201cMeaning of the ancestor\u201d (Characters 23 to 26). With the idea of a chronology in evolution comes the one of the ancestor. This one is narrowly linked to a concept of descent.Section \u201cOrientation of the tree\u201d (Characters 27 to 31). How is the tree to be read? There are rules guiding the reading of the tree, and those one admit an orientation for reading \u2013 basically from the root to the leaves. However, a tree is always drawn in two dimensions and we need here to name the two dimensions. The dimension along which hierarchical levels are embedded into one another can be called the \u201chierarchical axis\u201d . This axSection \u201cDiversification axis of the tree\u201d (Characters 32 to 35). There is a message set on the two axes of the tree, its abscissa and its ordinate. The diversification axis may take various meanings. It may thus symbolize just diversification of species or groups from their common base, but may also illustrate properties or a value gradation in a value system. It may exceptionally be the result of the necessity of nesting different groups into each other . Finally, on the diversification axis may also contain a notion of time (for example in Haeckel).Section \u201cHierarchical axis of the tree\u201d (Characters 36 to 40). This character is independent from the characters 28\u201332. Indeed the meaning given to the diversification axis is independent from the meaning given to the hierarchical axis.Section \u201cWell-marked discontinuities\u201d (Characters 41 to 42). Drawing a tree implies accepting a continuity and a discontinuity in life. A \u201cwell-marked\u201d discontinuity must be identified by an empty space between two branches of the tree. Discontinuities are not splits superimposed to the graph; they are empty spaces into the graph itself. They may appear either horizontally or vertically.What is the tree made for? We will focus on the use of trees for classification.Section \u201cClassificatory aim\u201d (Characters 43 to 44). Has the tree been drawn in order to classify a content? .Section \u201cStatus of the tree's graph\u201d (Characters 45 to 46). As mentioned above, trees can have a theoretical and/or an epistemological status: epistemological trees propose classifications of concrete objects, animals, plants, sharks, etc. On the opposite, a theoretical tree models the shape that a classification might have if the theory about the processes of diversification is true. Trees can be only theoretical, only epistemological, or be a combination of the both.Section \u201cDoes the tree intends to illustrate the natural order?\u201d (Characters 47 to 48). An intrinsic \u201corder of the Nature\u201d is supposed and is what classification is expected to reflect using a tree. Moreover this term \u201cnatural order\u201d must be explicitly mentioned. Note that the link between the order in Nature and classificatory purposes is not unequivocal. For instance, for pheneticists there is a natural  order in Nature however it is not what classification intends to reflect.Section \u201cThe tree is genealogical\u201d (Characters 49 to 50). The tree is theoretically based on a genealogical background: if species do evolve, there thus must be bloodlines, implying kinship. We must define genealogy here. It is a ancestor\u2013descendant relationship between two concrete individuals. However here that relationship can be either thought as merely theoretical or thought by the author as a concrete empirically accessible link.Section \u201cAre Beings steps of a value system?\u201d (Characters 51 to 52). In some authors there can be a value gradation among beings reflecting a value system; for instance gradation in perfection. The notion of perfection is then expressed through various means: roots, branches, bubbles, leaves, clippings, ordinate or abscissa.Section \u201cTeleology: direction in evolution?\u201d (Characters 53 to 54). Is evolution guided by a specific direction or is it the mere product of fortuity?We will focus here on contents of a tree: fossils, kingdoms, ancestors, etc. That's what is carried \u2013 or not \u2013 by the tree which will target our interest.Section \u201cDo fossils belong to the classification?\u201d (Characters 55 to 56). Are fossils taken into consideration, or merely ignored?Section \u201cTrees take into consideration the extinctions of species\u201d (Character 57). Do trees consider the possibility of the complete disappearance of a species?Section \u201cIs the ancestor concrete?\u201d (Characters 58 to 59). A \u201cconcrete\u201d ancestor is an organism, extinct or alive, assigned as the ancestor of a group. Its body, complete or lacunar has been found and a name has been attributed to it.Section \u201cConsideration of time in the tree\u201d (Characters 60 to 61). Larger than the mere genealogy, is there a notion of time carried by the tree? Here we code 1 if time is present whatever the axis .Section \u201cKinship between plants and animals?\u201d (Characters 62 to 63). One of the most recurrent questions in ancient authors is the relationship between plants and animals. It is therefore necessary to examine relationships between the two life's kingdoms that are embedded into our pre-scientific cultural background.Section \u201cAbility to interbreed\u201d (Character 64). In some ancient authors interbreeding is the ability for groups (larger than mere species) to cross one another. A global ability to interbreed is never found. Meanwhile, the question is here to know if interbreeding (including between distant groups) is possible or not.Section \u201cExtent of the tree\u201d (Characters 65 to 66). The tree aims here at studying a larger or a smaller group. Is the group studied the \u201clargest\u201d one, including all beings, or does the tree incarnate only a small part of life? Typically, some authors make a distinction between plants and animals in the applicability of their method, which restrict the extent of the classificatory program. In some works, there are several trees; one for each different part of life.Section \u201cSpecial position assigned to mankind\u201d (Characters 67 to 68). Is mankind set at the top of the tree? Is its place a privileged one? This question is recurrent among authors.Obtaining data and relationships is not an isolated activity. Authors may also create groups.Section \u201cProperties of groups\u201d (Characters 69 to 78). How are groups composed? What are they made of?Section \u201cWhat do classificatory ranks express?\u201d (Characters 79 to 80). How are classificatory ranks and taxonomic \u201carrangements\u201d related?Section \u201cReality given to categories\u201d (Characters 81 to 82). Are the categories given as real, non-arbitrary elements of life, or are they seen as arbitrary concepts? . Although this criterion is, from all, the most recent one, the use of parsimony principle appears as being rich enough to be set in our characters matrix. The use of this principle must be openly asserted.Section \u201cClassification based on presence of characters\u201d (Characters 84 to 85). Is classification based on presence or lack of characters?Section \u201cClassification (i.e. arrangement) by global similarity\u201d (Characters 86 to 87). A classification can also be elaborated according to global similarity.Section \u201cUse of monophyly\u201d (Characters 88 to 89). Monophyly is the property of grouping to an ancestor all its descent and nothing less; to group entities by the mere consideration of bloodlines. If the modern meaning of this term is rather recent, we will here consider the idea of monophyly, whatever its name could be.Section \u201cConsideration of homoplasies\u201d (Characters 90 to 91). Homoplasies are similar character states that have not been inherited from a common ancestor.A concrete form is seen as a being able to reproduce its own kind. Here, this is a concrete being that the author assigns to the root. This is, for example, what Darwin does (0), whereas Hennig does not.Yes\u200a=\u200a0; No\u200a=\u200a1Initial states of characters are a list of components supposed to characterize the object carried by the root. Here, we don't have a concrete being at the root but only a list of some of its properties. On the opposite from the previous character, Darwin does not do so, whereas Hennig does.No\u200a=\u200a0; Yes\u200a=\u200a1An inorganic form, as minerals, is unable to reproduce its own kind. Even if, historically, minerals have sometimes been seen as parts of life, we have distinguished minerals from living beings. Thus, Bronn and Hitchcock see inorganic forms at the \u201croot\u201d of the tree.No\u200a=\u200a0; Yes\u200a=\u200a1As an example, Buffon considers that the being set at the basis of the tree is still alive  whereas, according to Darwin, this species is extinct.Extant\u200a=\u200a0; Extinct\u200a=\u200a1A \u201cvalue\u201d is ideological expression. A value is given according to a value system, most often implicitly. Here a value is some combination of the ideas of perfection and complexity. In the case where the root starts a value gradation, the other entities are then viewed as \u201cdegenerate\u201d, or less perfect than the original entity. Is the taxon at the root seen as more complex and/or more perfect than the others on the tree? Buffon adheres to this idea, whereas Darwin or Lamarck disagrees with it.No\u200a=\u200a0; Yes\u200a=\u200a1In the case where the root starts a value gradation, the other entities are then viewed as more progressive and/or complex than the original entity. Is the taxon at the root seen as less complex and/or less perfect than the others on the tree? Lamarck thinks so whereas Darwin does not.No\u200a=\u200a0; Yes\u200a=\u200a1There is absolutely no gradation in terms of value between the root and the rest of the tree. Darwin adheres to this idea, whereas Chambers disagrees with it.Yes\u200a=\u200a0; No\u200a=\u200a1The link between the two extremities of the line is conveyed by a genealogical process. There is an idea of descent that is set into branches. For instance this idea is not accepted by Pallas or Augier, but it is by Darwin or Haeckel.No\u200a=\u200a0; Yes\u200a=\u200a1A \u201clogical link\u201d is the use of branches in order to represent only a hierarchy. Hierarchies in the form of a tree are used to express the sharing of features, identification keys, etc. Hennig or Agassiz use such links, whereas Buffon or Darwin do not.Yes\u200a=\u200a0; No\u200a=\u200a1Are branches tools to express a value system? In other words, do branches express differences in values among entities? If yes, there are differences between the values of the entities at the beginning and at the end of the branch. Note that trees that depict an overall gradation in value at the scale of the whole tree (character 51) do not necessarily include such a gradation within a single branch: character 10 is not redundant with character 51. As an example, Buffon considers that there is such a gradation whereas Darwin does not see any gradation within branches.No\u200a=\u200a0; Yes\u200a=\u200a1Do internal nodes refer to populations or individuals that are able to interbreed? This is the case with Hennig but not with Haeckel, for example.No\u200a=\u200a0; Yes\u200a=\u200a1Nodes are groups above the mere species level. It can be genera, or higher-ranked groups. If the rank isn't mentioned, a \u201cgroup\u201d is essentially composed of several species. Such groups at nodes give birth to other groups without including them (they are not groups in a cladistic sense). Lamarck or Hitchcock see such groups at nodes, whereas Hennig or Darwin do not.Yes\u200a=\u200a0; No\u200a=\u200a1Nodes are \u201cconcepts\u201d, either a list of characters or a property. A \u201cconcept\u201d may be a hypothetical common ancestor, a reconstructed entity, character states, or a property used in a determination key. Note that the informative content of a node in a phenogram could appear difficult to interpret at the first glance. Clearly the node of a phenogram is made of global similarity, and as such it is a concept. This idea is not accepted by Haeckel, but it is by Sokal and Sneath.No\u200a=\u200a0; Yes\u200a=\u200a1Has the \u201cancestor\u201d been found? Is it a discovered fossil? Gaudry thinks so whereas Darwin does not.No\u200a=\u200a0; Yes\u200a=\u200a1A group at the leaves has an upper rank than the mere species. If the rank isn't specified, a group is basically composed of several species. Darwin considers that species are at the leaves whereas Buffon sees groups on leaves.Groups\u200a=\u200a0; Species\u200a=\u200a1Are leaves set into a time framework? Are they inserted into the chronology? Buffon does not do so, whereas Darwin does.No\u200a=\u200a0; Yes\u200a=\u200a1There are several kinds of leaves, the ones bearing extant objects, the others carrying fossils. There are tips ending in present and tips ending in past times: either fossil or still-living species or groups can be assigned on leaves (0). This is the case with Pallas (0) but not with Darwin (1), for example. Alternatively, tips are restricted to objects of the present time (1). This character is coded \u201cnot applicable\u201d when the tree doesn't carry time.Yes\u200a=\u200a0; No\u200a=\u200a1Are the objects set on the leaves merely the product of fortuity (0) or has it been shepherded by any kind of destiny in evolution (1)? Chambers thinks so (1) whereas Darwin does not (0).No\u200a=\u200a0; Yes\u200a=\u200a1Some authors set concrete objects only at leaves. Then, there is no temporal distinction between leaves that can bear fossils and leaves that can bear extant entities. Some authors pretend to assign concrete objects somewhere else than leaves \u2013 at nodes \u2013 under the form of transitional forms, ancestors or missing links, seen as concrete objects. In such cases, leaves are not the only place for concrete objects. Mayr adheres to this last idea (1), whereas Hennig disagrees with it (0).Yes\u200a=\u200a0; No\u200a=\u200a1th century.A \u201ckingdom\u201d isn't seen as a mere group because it carries a cultural burden that dates back before elaboration of taxonomical rules. As a result, it has nothing to do with phylogeny and there are presumptions of polyphyly concerning kingdoms elaborated until the XIXAnthropogenie and between kingdoms for his Monophyletischer Stammbaum der Organismen.No vertical split: 0; Vertical splits between groups\u200a=\u200a1; between kingdoms\u200a=\u200a2. As an example, there is no vertical split for Darwin, splits between groups in Haeckel's The more there are entities into the group, the broader the \u201cblob\u201d is. This is the case with Agassiz, for example.Yes\u200a=\u200a0; No\u200a=\u200a1In addition to the mere numerical information, is there an idea of \u201csteps\u201d which overcome the sequence of blobs? Agassiz does so, whereas Hitchcock does not. This character is coded \u201cnot applicable\u201d when there is no blobs.Yes\u200a=\u200a0; No\u200a=\u200a1An \u201cancestral species\u201d carries a concept of mutation, of fundamental difference between a mother and a daughter species. A \u201cpast state\u201d insists on the continuity of a group or a family. Its name remains the same whereas the family's content has evolved. Buffon sees the ancestor as an ancestral species, whereas Lamarck sees it as the past state of the same group.Ancestral species\u200a=\u200a0; Past state of the group\u200a=\u200a1\u201cAncestors\u201d can bear several interpretations on the tree. They can be concrete individuals organized in a genealogical way that will set what are plesiomorphies (they express primitive steps or states). Alternatively, plesiomorphies refer to an hypothetical ancestor (which is expressed by them.) Mayr considers that ancestors are organized into successions of types in a genealogical way whereas Hennig considers ancestors as sets of plesiomorphies.Concrete ancestors express plesiomorphies\u200a=\u200a0; Plesiomorphies express virtual ancestors\u200a=\u200a1.Do primitiveness, ancestral states or plesiomorphies include an idea of lesser value and/or imperfect state of adaptation? As an example, Mayr thinks that primitiveness do so whereas Hennig does not think that plesiomorphies do so.Yes\u200a=\u200a0, No\u200a=\u200a1Is the ancestor the taxonomic group itself? For example, is the ancestor of the group \u201cMammalia\u201d the \u201cMammalia\u201d group itself? Haeckel thinks so whereas Mayr does not.No\u200a=\u200a0; Yes\u200a=\u200a1Diversification axis is vertical in Wallace's Attempts at a natural arrangement of birds, but is not vertical for Lamarck.No\u200a=\u200a0; Yes\u200a=\u200a1.Hierarchical axis is vertical from the bottom to the top in Darwin (1859)'s tree, but is not vertical for Buffon.No\u200a=\u200a0; Yes\u200a=\u200a1.Hierarchical axis is vertical from the top to the bottom for Duchesne, but is not such vertical for Buffon.No\u200a=\u200a0; Yes\u200a=\u200a1.Hierarchical axis is horizontal in Wallace's Attempts at a natural arrangement of birds, but is not horizontal for Buffon.No\u200a=\u200a0; Yes\u200a=\u200a1.As an example, the diversification axis is horizontal from the top to the bottom for Chambers, but is not such for Buffon.Yes\u200a=\u200a0; No\u200a=\u200a1.Properties are attributes given to the objects in the tree. Those properties form a succession in the axis where they take place. Their content may be unspecified, as well as a sum of mutations. Duchesne sets properties on the diversification axis of his tree, whereas Darwin does not.Yes\u200a=\u200a0; No\u200a=\u200a1Are there degrees of perfection or complexity associated to this axis? Augier thinks so whereas Darwin does not.No\u200a=\u200a0; Yes\u200a=\u200a1Is there a hierarchy of groups implied by this axis? Duchesne adheres to this idea, whereas Chambers disagrees with it.No\u200a=\u200a0; Yes\u200a=\u200a1Anthropogenie.Is time taken into consideration on this axis? Darwin does not do so, whereas Haeckel does in his No\u200a=\u200a0; Yes\u200a=\u200a1Augier does so, whereas Hennig does not.No\u200a=\u200a0; Yes\u200a=\u200a1Sokal & Sneath consider properties on this axis, whereas Darwin does not.Yes\u200a=\u200a0; No\u200a=\u200a1Sokal & Sneath do not consider time on this axis, while Darwin does.No\u200a=\u200a0; Yes\u200a=\u200a1Lamarck expresses such gradations, whereas Darwin does not.No\u200a=\u200a0; Yes\u200a=\u200a1If yes, generations must be explicitly specified on the tree or in its description. Darwin (1859) does so, whereas Sokal and Sneath do not.No\u200a=\u200a0; Yes\u200a=\u200a1Such horizontal discontinuities are present for Zaluziansky, but absent for Buffon.No\u200a=\u200a0; Yes\u200a=\u200a1Yes\u200a=\u200a0; No\u200a=\u200a1Origin of Species\u201d). On the opposite, Adam Zaluziansky draws trees with vertical discontinuities but no horizontal ones. The tree realized by Agassiz shown no continuity at all between groups , whereas Buffon's \u201cTable des chiens\u201d presents vertical and horizontal continuities  have a classificatory aim, whereas the ones made by Buffon (1766) in his chapter about degeneration do not have any classificatory aim.Yes\u200a=\u200a0; No\u200a=\u200a1Growth of biological thought\u201d. If no, classifying is made as the same time as the tree itself, such as what Hennig does.If yes, the tree merely illustrates a previously-made classification, what Mayr says, for example, in his \u201cNo\u200a=\u200a0; Yes\u200a=\u200a1Methods and Principles of Systematic Zoology\u201d, want to represent a pattern of life much more than to explain the process of its diversification. On the opposite, a \u201ctheoretical\u201d tree will not deal with concrete objects but with abstractions  and aim at illustrating or supporting a theory about processes of diversification. It represents a model or the theoretical background itself: it makes conjectures about how should patterns be organized according to the known processes. This is, in particular, what Hennig does.Our trees can be either epistemological or theoretical. \u201cEpistemological\u201d trees are classifying concrete things: they depicts a hierarchy in shared attributes among known concrete entities , interpreted through a given model. Those trees authors, such as Mayr in his \u201cEpistemological\u200a=\u200a0; Theoretical\u200a=\u200a1Finally, some authors aim to be simultaneously theoretical and epistemological. These authors will be coded 1. The most notable of the two components is coded in character 45. This is the case of Lamarck, who presents a theoretical and epistemological tree. Because his figure is more theoretical (the theory of increasing complexity) than epistemological (an idea of the sequence of concrete groups through generations), it is coded 1 for character 45 and 1 for character 46.No\u200a=\u200a0; Yes\u200a=\u200a1The tree illustrates a fundamentally ordered nature for Darwin, whereas it can't illustrate this order for Sokal & Sneath. For instance, for Darwin Nature is intrinsically ordered and we should have access to this order; for Sokal and Sneath Nature is intrinsically ordered however we do not have access to this order; and for Linn\u00e9 Nature is intrinsically ordered however this order has a supernatural origin and we have access to it.No\u200a=\u200a0; Yes, Nature is fundamentally ordered\u200a=\u200a1.Is the tree explicit, i.e. drew or described, or is it merely evoked through \u201creading between lines\u201d? The tree is implicit for Goethe, whereas it is explicit for others, for example, clearly described by Buffon or drew by Darwin.Yes, drew or written\u200a=\u200a0; No, implicit\u200a=\u200a1As an example, the tree is genealogical for Darwin, but it is not for Sokal & Sneath.No\u200a=\u200a0; Yes\u200a=\u200a1If the tree is \u201cnot only genealogical\u201d, external considerations are added to the mere genealogy . This is what Teilhard de Chardin and Mayr do.Strictly genealogical\u200a=\u200a0; Not only\u200a=\u200a1Beings are organized through a gradation in perfection. A gradation in terms of perfection is meant by Lamarck, for example.No\u200a=\u200a0; Yes\u200a=\u200a1The gradation in terms of perfection affects the interpretation of all characters for Lamarck, but only some of them for Gaudry.Affects interpretation of all characters\u200a=\u200a0; Affects only some of them\u200a=\u200a1. If there is no gradation of values at all, an \u201cirrelevant\u201d state will be coded.Teleology goes further than a mere trend towards an increasing complexity. It aims to converge in a given direction to a given end. For example, Teilhard de Chardin or Haeckel are teleologists.Yes\u200a=\u200a0; No\u200a=\u200a1Anthropogenie\u201d or Romer in his \u201cVertebrate Paleontology\u201d.Teleology is \u201cimplicitly mentioned\u201d if it is a logical conclusion of the author's classificatory theory. There is no supernatural mechanism that places mankind at the top of evolution. However, mankind is set at this location as a logical consequence of the description of evolution by the author. This is what does Haeckel in his \u201cExplicitly\u200a=\u200a0; Implicitly\u200a=\u200a1. If there is no teleology an \u201cirrelevant\u201d state will be coded.Fossilized individuals have been observed since centuries. But the interpretation about what they are has much changed. They can be interpreted as geological curiosities, never having been living forms. Some other authors, like Buffon, never include them in their classifications. Are fossilized living forms included in trees or not?No\u200a=\u200a0; Yes\u200a=\u200a1Fossils can be considered not as extinct species but as species still alive but undiscovered yet. This is especially what Lamarck thinks.No\u200a=\u200a0; Yes\u200a=\u200a1If yes, the tree must illustrate at least one extinction. An extinction is the complete disappearance of a bloodline, whatever its cause might be. Buffon considers such extinctions; whereas Lamarck does not do so in his tree.No\u200a=\u200a0; Yes\u200a=\u200a1An ancestor is said to be \u201cconcrete\u201d when an object such as a fossil, is considered as the ancestor of a group. This is especially what Gaudry and Romer do.Yes\u200a=\u200a0; No\u200a=\u200a1Vertebrate Paleontology\u201d.If, theoretically, a concrete ancestor is expected, the author can set conditions before attributing the status of \u201cancestor\u201d to a concrete being. Here, all nodes don't carry a named ancestor. As an example, this is what does Romer in his \u201cNo\u200a=\u200a0; Yes\u200a=\u200a1Natural arrangement of birds\u201d, whereas it is present in Darwin's trees.Time is absent from the tree of Pallas or from Wallace's one in his \u201cNo\u200a=\u200a0; Yes\u200a=\u200a1Is time explicitly set into the tree graph , as Agassiz does for example, or is it implicit \u2013 as, for example, Darwin's \u201cgenerations\u201d?Time is explicit\u200a=\u200a0; Implicit\u200a=\u200a1 (Coded as irrelevant if there is no time).Monophyletischer Stammbaum der Organismen\u201d, whereas Lamarck considers that there is no such kinship.Is there a link in terms of bloodlines between the two main kingdoms of life? This kinship is real according to Haeckel in his \u201cNo\u200a=\u200a0; Yes\u200a=\u200a1Some authors tolerate, although relationship between plants and animals is not stated, the fact that the same methods can be used to study plants and animals. Here, the comparison must be proven in the scheme or in its description, for example, as Augier does when he describes the elaboration of his tree.No\u200a=\u200a0; Yes\u200a=\u200a1Interbreeding between groups above the species level is generally impossible with few exceptions for Darwin or Lamarck. It is however regarded as generally possible by Buffon (1766) in the context of his theory of degeneration. Then, for some authors as Hitchcock, it is considered as an impossible phenomenon.Generally no\u200a=\u200a0; Generally yes\u200a=\u200a1; Never\u200a=\u200a2Some authors classify only a small part of life onto one tree. This is, for example, what Duchesne does with his tree of strawberry plants. But other authors, like Pallas, want to make a comprehensive tree of the links between all groups of living organisms.Only a part of beings\u200a=\u200a0; All beings\u200a=\u200a1If the tree is worth only for parts of the beings, a same method can nevertheless be used for different parts of life. Typically, Hitchcock uses the same methodology for his two separate trees, one for plants and the other one for animals. The two trees are besides facing on the same page. The character is coded irrelevant if the tree is used for all beings; and if there is only one tree for a single group of life in the work, then it will be coded 1.Yes\u200a=\u200a0; No\u200a=\u200a1Typically, Haeckel's tree (\u201cAnthropogenie\u201d) is the most common illustration of a tree placing mankind at its top. Conversely, it is absolutely not the case with that of Darwin.No\u200a=\u200a0; Yes\u200a=\u200a1However, mankind can be seen as too noble to be ranked alongside animals and even plants. Then, it will not be mentioned into the classification. However, there may be a special attribution given to a group to which mankind belongs , to emphasize on their sets of properties, as for example Barban\u00e7ois or Pallas do. Coded as irrelevant if Yes at character 67.No\u200a=\u200a0; Yes\u200a=\u200a1.If groups are not in Nature, they are openly considered as virtual. Note that considering groups as really in Nature or not is not necessarily linked to a position concerning the character 47, i.e. if there is a fundamental natural order or not. For instance, for Darwin groups are virtual but Nature is fundamentally ordered by genealogy, while for Buffon groups are virtual and Nature is disordered . In para\u201cNature refuses to be imposed of any arbitrary rule\u201dBut most groups are really in Nature: \u201cChaque classe, non comprise celle des reptiles qui est artificiellement form\u00e9e, voit pour elle revenir un nombre donn\u00e9 de mat\u00e9riaux, neuf, huit et sept: si cela n'est pas toujours \u00e0 l'\u00e9gard de quelques familles, l'exception vient confirmer la r\u00e8gle\u201d (p. 175)\u201cEach class, excluding that of the reptiles that is artificially formed, sees the presence of a given number of materials, nine, eight and seven, if this is not always towards some families, the exception confirms the rule\u201d.e le\u00e7onCours de l'histoire naturelle des mammif\u00e8res\u201d, 4, p. 11):Some species can exceptionally belong to several groups at the same time, such as Monotremes .Yes\u200a=\u200a0; No\u200a=\u200a1a-priori and imply some properties. The purpose is to assign specimens to some of them according to the properties found. Typically, this is what Lamarck does within the framework of his theory of evolution.Groups are given No\u200a=\u200a0; Yes\u200a=\u200a1\u201cAll true classification is genealogical\u201d.In an evolutionary consideration, there are genealogical links between entities. Do groups refer to this genealogy? It is the case for Darwin, for whom No\u200a=\u200a0; Yes\u200a=\u200a1.Ranking can be performed according to global similarity or to kinship links. This is for instance one of the oppositions between Linnaeus and Buffon: according to the first one, ranks are made according to global similarity; whereas, for Buffon, ranks should be made according to genealogical links.Ranking made according to global similarity\u200a=\u200a0; To hierarchy from kinship links\u200a=\u200a1.\u201cMajor steps in vertebrate evolution\u201d, then the content of the trunk becomes mono-dimensional, and the scheme becomes assimilated to a ladder  and used as such for classification.A branching graph must carry information on its terminal/lateral branches. If there is no such information, i.e. if there is no difference between leaves and the basement of branches, such as Romer's tree in his scala) of beings\u200a=\u200a0; Made from a tree\u200a=\u200a1.Classification under the form of a ladder (There are numerous authors creating groups according to shared properties (character 70), however these properties can be diverse. They can be shared characters or shared degree of perfection. For instance, if Hennig elaborates his groups only according to shared characters, Lamarck groups animals according to an idea of perfection degree.Yes\u200a=\u200a0; No, groups are made by perfection degree or adaptive level\u200a=\u200a1Agassiz, a catastrophist author, sees series of acts of supernatural creations and extinctions of species. Then, according to this idea, groups of species are independent the ones from the others; there in no natural link between them. On the opposite, for Darwin, species have to be grouped according to bloodlines and groups are nested within each other.Yes\u200a=\u200a0; No, groups are linked or nested within each-other\u200a=\u200a1Is there an emergence and an extinction of groups? This fact may be explained with evolutionism as well as with catastrophism. According to Linnaeus, groups have always existed whereas, for Agassiz, they are circumscribed in time.Yes\u200a=\u200a0; No, groups are circumscribed in time\u200a=\u200a1Is there a clear definition about what a group is or what it contains? As an example, for Hennig, groups are perfectly defined as they must be monophyletic ones, whereas Etienne Geoffroy Saint-Hilaire defines groups as vague sets of properties.Yes\u200a=\u200a0; No\u200a=\u200a1Do classificatory ranks insist on what is common or on what differs between what they contain? Ranks can be assigned to groups in an agglomerative procedure (0), according to shared characters. Ranks can also be assigned according to a divisive procedure (1). This is for instance what is done when classifiers confuse identification keys and phylogenies. They insist more heavily on what distinguishes groups, degrees of divergence between entities to classify (taxa). In the agglomerative approach there will be many nested ranks (like in cladistics), while in the divisive approach the trend will be to multiply groups of equal rank (like in phenetics). For instance, the divisive logic by which the class of birds is justified by Mayr explains why birds and reptiles have both the rank of a class.Ranks express a sharing of characters by taxa\u200a=\u200a0; A degree of divergence between taxa\u200a=\u200a1No\u200a=\u200a0; Yes\u200a=\u200aRanks mean only the sharing of a common ancestor\u200a=\u200a1Do categories, as species, genera, families, classes\u2026 etc. refer to objective, clearly definable, real entities in Nature?Yes\u200a=\u200a0; No\u200a=\u200a1For all categories\u200a=\u200a0; Only for some categories\u200a=\u200a1No\u200a=\u200a0; Yes\u200a=\u200a1.\u2026 or it also includes lack of properties , for instance what does Linnaeus with Cryptogames.No, It also includes lack of properties\u200a=\u200a0; yes\u200a=\u200a1\u2026 or they also include subjective judgments like degree of complexity, degree of perfection, explicit processes like \u201ccerebralization\u201d (as Teilhard de Chardin does).No, characters are not only made of observation of attributes\u200a=\u200a0; Yes\u200a=\u200a1Lamarck and Buffon classify life using global similarity among organisms, whereas Hennig considers each of their characters.Yes\u200a=\u200a0; No\u200a=\u200a1.There can be other considerations added to the one of classification by global similarity. For instance, Lamarck adds an idea of increasing complexity (1). If not, the classification will be said \u201cstrictly\u201d by global similarity (0). This is for instance what Buffon does.Yes\u200a=\u200a0; No\u200a=\u200a1.Monophyly is considered in its present meaning: all descendants from a common ancestor. So, Hennig uses monophyly whereas Romer does not.No\u200a=\u200a0; Yes\u200a=\u200a1Is monophyly used strictly and lonely or are there any other considerations added on? It is used strictly by Darwin or Hennig (0), but other considerations are added on by Haeckel. There is a specific case with Mayr, especially in his late writings: Mayr accepts in a first step of his studies the idea of cladograms, and even \u201cmonophylies\u201d. But, according to him, a phylogenetic study must not stop at this stage and must consider the idea of grades. So Haeckel and Mayr use monophyly not strictly (1).Strictly\u200a=\u200a0; Other considerations added\u200a=\u200a1Homoplasies are similar characters that have not been inherited from a exclusive common ancestor. Lamarck's methodology in unsuitable to detect homoplasies, whereas Hennig's one is.No\u200a=\u200a0; Yes\u200a=\u200a1.The presence of similar characters in individuals can be seen as similar adaptations acquired during a being's life. Then, adaptive convergences are much enhanced by living in a same place. This kind of inheritance of characters is fundamental in Lamarck's theory, whereas it is absent from Mayr's writings.Yes\u200a=\u200a0; No\u200a=\u200a1Standard parsimony approach was conducted using PAUP* 4.0b10 The matrix contains 41 taxa and 91 characters, all informative for parsimony .The parsimony analysis provides 279 trees of 378 steps, with a C.I. of 0.24 and a R.I. of 0.61  but to gradations in value (char.10). This gradation is also carried by the hierarchical axis of the tree (char.39).The tree graph is as theoretical as epistemological (char.46) and expresses a gradation in terms of values among beings (char.51).A special place is assigned to a group to which mankind belongs (char.68). This last character has a C.I. of 0.5.In terms of taxonomy, groups represent a non-arbitrary order (char.69) and are elaborated following a perfection degree or an increasing degree of complexity achieved through harmony between structures and their role in the environment (char.75). They are not perfectly circumscribed (char.78). Then, a reality is given not to all ranking categories, but at least for some of them (char.82). This character has a C.I. of 1 and strictly occurs in this group.Tree-makers are authors that use trees as tools for the classification of life.The hierarchical axis of their trees is oriented vertically from the bottom to the top (char.28) or horizontally from a side to the other (char.30). None of the axes carries properties. (char.37). There are no more well-marked discontinuities (char.42).To elaborate the tree, the authors consider common methods to study plants and animals (char.63). There is generally one tree in each work, and even if a kinship link between animals and plants is asserted, it is not translated into the use of similar methodologies for the study of the two (char.66).Groups are no more independent but embedded into each other (char.76). Then, reality is given to phylogenetic categories (char.81).Evolutionist authors consider not only a mere localized transformism, but a phenomenon of evolution in whole life, whatever its mechanisms are.On the root of their trees is set an extinct object (char.4). The hierarchical axis does no more bear an idea of diversification (char.36), but a notion of time appears on it (char.38). Horizontally, discontinuities are well-marked (char.41).With the idea of evolution comes new interpretations of fossils. Fossils are included into the tree graph (char.55). Trees take into consideration the extinctions of species (char.57). The notion of time is held into the graph (char.60). This character has a C.I. of 0.5.Classificatory ranks express a sharing of characters by taxa, and no more a degree of divergence between them (char.79).Finally, authors do not see an inheritance of acquired characters (char.91).Cladists define themselves through the use of formally coded characters and formalized procedures to find phylogenies and the rejection of grades. The main principles have been defined in Hennig's Phylogenetic Systematics (1966).For Cladists, the entity carried by the root is neither a concrete species nor ancestral group (char.1) but initial states of characters (char.2). The cladogram's lines do not express genealogical kinship links (char.8) but purely logical links (char.9).Classificatory ranks express a sharing of characters between taxa (char. 79).Finally, there is no inheritance of acquired characters (char. 91).Created in 1963 by Sokal and Sneath, the phenetic school is mainly characterized by a renunciation to find the phylogeny of life. A new, mathematically based methodology is elaborated to use trees to represent degrees in global similarity. If, in node 69 (see below), including pheneticists, the classification is elaborated by global similarity (char.86), there is no redundancy with this character because of the separation made by some authors of this last group between classification and elaboration of the tree. Pheneticists group those two actions in a single one, the computation of the tree. And it is the methodology of that computation that is based on global similarity.The entity carried on the root of the tree graph is a general states of characters (char.2) in the sense that the tree is rooted by an outgroup or on the most distant OTU to any other. The Phenogram's lines do not express genealogical kinship links (char.8) but purely logical links (char.9). The internal nodes express concepts (char.13) and no fossil is set on (char.14). Then, the hierarchical axis of the tree does not express time (char.38) .With the renunciation to discover the phylogeny, the tree does not intend to illustrate the order of nature (char.47) and is not genealogical (char.49).Phenetician authors use commons methods of study for separate trees (char.66). There is no special position assigned to mankind (char.67).The groups elaborated are openly made as virtual (char.69) and aim at assigning a specimen (char.71).Finally, there is a use of parsimony for phenetics (char.83). As an example, Sokal writes in his article: \u201cA computer program developed by Camin and the author constructs cladograms with the fewest number of evolutionary steps\u201d (p. 10).Along with previously recognized groups of tree-thinkers, it is possible to point out in th century. The first one has been written by Buffon and the other by his disciple, Duchesne. The \u201cbuffonians\u201d school is a novel one. It is epistemologically characterized by a theory of transformism by \u201cdegeneration\u201d.The two first identified \u201cevolutionist\u201d trees have been elaborated during the XVIIIThe root carries an indication of value (char.7). Moreover, the entity carried on the root has a higher value (char.5): this character has a C.I. of 1 and is exclusive to buffonians. Branches of the tree express genealogical links (char.8) instead of purely logical links (char.9). Time is not taken into consideration into the tree (char.16) and the hierarchical axis is not set from the bottom to the top (char.28).Finally, a strict monophyly  is used in buffonian trees (char.89).Buffon considers two kinds of change along bloodlines, both used to create \u201cmonophyletic\u201d groups. The first one is due to a reversible differentiation and the second one is the consequence of the phenomenon of degeneration. Reversible modifications are the consequence of changes in climate or in living conditions. They can be superimposed with one another, as for dogs, and they bring their current varieties. But when a dog returns to its \u201cnatural state\u201d, he returns then to his primary characteristics. This type of change is represented by linking the initial state of a dog with its different biogeographical modifications.\u201cThe Great Dane, the Mastiff and the Greyhound, although different at the first glance, are, however, the same dog: The Great Dane is no more than a Mastiff [with a hair] thicker, more enriched; the Mastiff a Greyhound slenderer, more tapering, and both neater; and there is no more difference between a Great Dane dog, a Mastiff and a a Greyhound, than between a Dutchman, a Frenchman and an Italian. Supposing therefore that the Mastiff is originated or rather natural to France, he will have produced the Great Dane in a colder climate, and the Greyhound in a warmer climate: and this is also verified by facts, as Great Danes comes us from the north, and Greyhounds come from Constantinople and the Levant\u201d The phenomenon of degeneration, mutationist and non-reversible, is itself associated with a high requirement of monophyly. The successive degenerations of a species will be represented on the same tree than the parent one. This is what is described in Buffon's famous tree of horses, donkeys and zebras:\u201cFrom this point of view, the horse, the zebra and the donkey belong all three to the same family, if the horse is the strain/root or the main trunk, the zebra and the donkey will be the collateral stems/branches: because the number of their similarities (/the similarities between them) is infinitely greater than their differences, we can consider them as making only one genera, from which the main characters are clearly defined and common to all three: they are the only ones really solipeds, that means, who have the horn of their feet in a single piece without any appearance of fingers or nails; and although three species are distinct, they are however not absolute nor clearly separated, since the donkey product with the mare, the horse with the jenny, and it is probable that if one overcomes to domesticate zebra, and ease its wild and recalcitrant nature, it would also occur with the horse and the donkey, as they produce together\u201d..This consideration of monophyly is not isolated: there are numerous other examples in this chapter:\u201cThose animals who have antlers, although they are ruminants and shaped inside such as those who bear horns, seem to make a genera, a separated family, in which the moose is the main stem and the reindeer, the deer, the cheetal, the fallow deer and the roe are the minor and collateral branches; because there are only those six species of animals that have the head armed with a branching antler which falls and is renewed every year; and independently of this generic and common character, they resemble each other a lot in the conformation and natural habits: so we would rather obtain hybrids of the deer or of the fallow deer mixed with the reindeer and the cheetal than hybrids of the deer and the cow\u201d (p. 349).The monophyly exhibited in Buffon's groups is more than a mere intuition. The author sees the ability of interbreeding as a proof of this monophyly. He develops a protocol of which he discusses the results.\u201cThe dog, the wolf, the fox, the jackal and the isatis form another genera, in which each is really so close to the others, and in which individuals are so much alike, especially in the internal conformation and in the parts of the generation, that is hard to understand why those animals do not produce together; it seemed to me by the experiences I made on the mix of the dog with the wolf and the fox, that the reluctance to coupling came from the wolf and the fox rather than from the dog, that is to say, from the wild animal rather than from the domestic animal; because the female dogs that I tested, would have willingly suffered the fox and the wolf\u201d (p. 449).This character has a C.I. of 0.5 and is shared with \u201cconnected graph users\u201d (see below).a priori the \u201cgreat tree of life\u201d concerning concrete organisms without the analytical step: there is a fusion of the first level  and the third level  in their use of the term \u201ctree\u201d. If the internal nodes of the trees do not refer to characters, races or species (char.11), the leaves express an evolutionary destiny (char.18). This character is exclusive to this group (C.I. 1).These authors directly draw The trees express a gradation in terms of perfection among beings (char.51). It is guided by theology, a direction given to evolution (char.53). This character has a C.I. of 0.5: they are not the only ones.There is no possibility of interbreeding between two groups with an upper rank than the one of species (char.64). Finally, a special position into the tree is given to a group to which mankind belongs (char.68). This character has a C.I. of 0.5.Connected graphs are mathematically based representations of trees. They are defined by the fact that it is possible, from any vertex, to join every other along the edges. \u201cConnected graphs users\u201d use highly topologically-based representations.Growth of biological thought, when he writes \u201cThe cladist ignores the existence of grades because this approach condones the recognition of \u201cparaphyletic\u201d taxa. A monophyletic group is \u201cparaphyletic,\u201d in the terminology of the cladists, if it is not \u201cholophyletic,\u201d that is, if it does not include all of the descendants of the common ancestor. The class Reptilia, for instance, as traditionally recognized, is a paraphyletic group, because it does not include the Aves and the Mammalia, two groups that were separated as having reached a grade level differing from that of the remaining Reptilia. The recognition of paraphyletic groups prevents the automatic translation of a classification into a branching pattern but it is able to express degrees of divergence, something the cladogram cannot do\u201d. This character has a C.I. of 0.5.Branches of the trees express genealogical links (char.8) instead of purely logical links (char.9).\u201cBlobs\u201d, when used, do not involve a concept of evolutionary gradation, but are merely used to draw a group (char.22). When \u201cblobs\u201d are used, they are superposed to a primarily elaborated connex graph. Two phases are given to elaborate such trees. The first one is a connex graph that expresses mere genealogical links. The second phase consists in elaborating groups based on overall similarity and ecological adaptation. That is what Mayr describes in his The numerous considerations about the elaboration of trees and their representation of what a \u201cphylogeny\u201d is, peculiarly in the texts, make trees to have a theoretical status (char.45).If the ancestor is seen as concrete, this is only under some conditions (char.59). There is a kinship between plants and animals (char.62). There is, generally, no ability to interbreed for different groups with an upper rank than the one of species (char.64). The tree worth for all beings (char.65).Groups are not considered as virtual, but as representative of a non-arbitrary order (char.69).Then, when monophyly is used, it is done strictly (char.89). This character has a C.I. of 0.5, shared with Buffonians (see above).This set is based on a common methodology.Groups are elaborated according to kinship links (char.73) in the sense that a grouping must contain an ancestor and all its descent. Using modern terminology, groups are monophyletic. Classificatory ranks express a degree of divergence among taxa (char.79) and the sharing of a common ancestor (char.80).th century. But, for monophyletists, the inheritance of acquired characters is an inheritance of accidents, ant not an effort of organisms to adapt themselves to their environment. The inheritance of acquired characters according to Buffon or Lamarck is narrowly linked to an answer of the organism to its environment: climate, food, and even bad treatments due to mankind and domestication. This last phenomenon is seen as reversible, especially for Buffon. On the opposite, the inheritance of acquired characters for monophyletists have the same randomness than the inheritance of innate ones. Darwin ties an explanation since the first edition of The Origin of Species (p. 131): \u201cBut the much greater variability, as well as the greater frequency of monstrosities, under domestication or cultivation, than under nature, leads me to believe that deviations of structure are in some way due to the nature of the conditions of life, to which the parents and their more remote ancestors have been exposed during several generations\u201d. Finally, the confusion between the two and the links between them is due to an ignorance of the mechanisms of variation, what Darwin confesses (p. 167 1st edition of the Origin of Species): \u201cOur ignorance of the laws of variation is profound. Not in one case out of a hundred can we pretend to assign any reason why this or that part differs, more or less, from the same part in the parents\u201d.Finally, homoplasies are detected (char.90) despite to an inheritance of acquired characters (char.91). The distinction between what is innate and what is acquired is late in the XIXOrigin of species (1859) where, as Nelson No surprise to find in that group of \u201cmonophyletists\u201d Charles Darwin in his first edition of the In tumbler pigeons, though some sub-varieties differ from the others in the important character of having a longer beak, yet all are kept together from having the common habit of tumbling; but the short-faced beak has nearly or quite lost this habit; nevertheless without any reasoning of thinking on the subject, these tumblers are kept in the same group, because allied in blood and alike in some other respects. If it could be proved that the Hottentots had descended from the Negro, I think he would be classed under the Negro group, however much he might differ in color and other important characters from Negroes\u201d.\u201cThis passage shows that Darwin recommended to classify organisms according to strict common ancestry whatever the divergence accumulated since common ancestors. Lecointre th page of his On the Law which has Regulated the Introduction of New Species, Wallace precises that: \u201cThere constantly occur two or more modifications of an organ or modifications of two distinct organs, leading us on to two distinct series of species, which at length differ so much from each other as to form distinct genera or families. These are the parallel series or representative groups of naturalists, and they often occur in different countries, or are found fossil in different formations. They are said to have an analogy to each other when they are so far removed from their common antitype as to differ in many important points of structure, while they still preserve a family resemblance. We thus see how difficult it is to determine in every case whether a given relation is an analogy or an affinity\u201d.Wallace centers the nodes of his trees on the concept of \u201cantitype\u201d, or ancestor. He links the formation of groups to the divergence of two lines from a node. In the 5Thus, the leaves are considered as the only detectable objects (char.19): this character is exclusive of the group (CI of 1).\u201cSimilarity classifiers\u201d are connected graph users, but use a methodology based on overall similarity.Tips of the tree's branches end in present as well as in past (char.17). The diversification axis explains properties (char.32).The classification of entities is made before the elaboration of the tree (char.44), and this one is not strictly genealogical (char.50).The classification is elaborated by global similarity (char.86) whatever the way the tree is made  and there is no use of monophyly (char.88).Gradists are diphyletic. If \u201cGradism\u201d appears as being fragmented, we can distinguish \u201cgrade users\u201d, that are a paraphyletic part of \u201cmetaphoricians\u201d, and \u201cgrade theoreticians\u201d at node 66. Those last are characterized by common thoughts on classifications and epistemological argumentation for the merits of the use of grades.In grade theoreticians, ancestors are organized into succession of types in a genealogical way into the tree (char.24). Moreover, the diversification axis of the tree implicitly expresses an idea of gradation of values (char.33).Then, there is a gradation in terms of perfection between beings into the tree graph (char.51).Anthropogenie (1877) has nothing to do with Darwin's tree though Haeckel claimed to be Darwinian The Consistency index is very low (0.24). Does it mean that the tree is meaningless? Note that the majority-rule consensus tree recovers a number of groups traditionally recognized like cladists, pheneticists, evolutionists, Buffon's recognized originality There are different meanings given to trees in the field of Biology the epistemological level,the theoretical level, andthe metaphorical/synthetic level.The epistemological level is exemplified by the tree we construct at the lab from a data matrix using, for instance, standard parsimony application of methodologies originally formulated for biological questions has earned general acceptance in historical linguistics ans stemmatics (\u2026), though the underlying theory had already been developed in these fields prior to the widespread implementation of cladistics in biology (\u2026)\u201d. Trees are also used by Moretti ad hoc hypotheses of character change required by the tree for the conflicting Such a distinction of three levels is of importance here to understand why some tools elaborated at the first level can be used in a foreign theoretical context (second level), i.e. that is not the one by which those tools originated. As T\u00ebmkin and Eldredge stated Why should we choose the tree that maximizes contiguity of identical character states (i.e. the most parsimonious tree) and not another one? Here we reformulate the second question set above: Why should we choose the tree maximizing consistency among characters? Two answers can be given.The first one refers to the theoretical (second) level: it is grounded by the theory of Biology. In comparative Biology, since Darwin  provides compelling evidence: he used such a \u201ctree\u201d that way \u2013obviously in a non-computerized manner- in a non-transformist theory of life. And outside science, trees had been used for long ago to organize the world in a hierarchical manner without any evolutionary connotations Character independence is often a desired property of the matrix prior to performing a phylogenetic analysis. However character independence is rarely neither controlled nor measured. In comparative anatomy, we often find in a matrix several characters from the skull without knowing anything about the degree of impact that would have the change on one of them on the others. This is the same here: does a given idea necessarily imply the presence of another? It is possible, however the high mosaicism of ideas and the rather low C.I. tend to show the contrary.What is the benefit of this approach for history of science? For systematics? The benefit is into formalization allowed a comparative approach to ideas, and character coding. Some historians wish to understand an author \u201cfrom within\u201d, practising what we call in literature the \u201cclose reading\u201d A posteriori, does it make sense? Some authors is not restricted to the biological world and in a broad sense applies to any historical process that rests upon transmission of information from one generation to the next\u201d. From a heuristic point of view, the assumption that at least some ideas must have been subject to \u201cdescent with modification\u201d makes sense in the realm of History of Science. Other ideas should have followed different paths, exhibiting patterns reflecting some departure from that basic assumption, just as in T\u00ebmkin and Eldredge critical analyzes of the diversity patterns of two musical instruments, the stringed psaltery and the brasswind cornet, reveal paths of information transfer and the origins of innovation unique to the cultural context that are unlike those in biological systems\u201d. In other words, let's use descent with modification as a kind of null hypothesis, which will provide the tools to measure vertical inheritance versus convergent occurrences or reversals, but also effect of \u201chorizontal diffusion\u201d of ideas. Let's focus on that point.At the (second) theoretical level, is there some interest to accept common ancestry of scientific ideas, at least provisionally? Indeed the flow of ideas through times doesn't behave like in biological entities. Ascending source of information pointing backwards to a single ancestor is not the sole possible process: an author is most of the time influenced not by a single precursor but by multiple sources. The flow of information is permanently multiple in its roots and in its outcomes. If there is a process of descent with modification, it does not have the form of Darwin's tree, rather a form closer to a network, e.g., what we find in bacteria due to horizontal gene transfer. The fact that epochs of those ideas about trees are rather grouped instead of completely shuffled suggest that authors first of all share ideas of their century. This brings into question the need of using networks If the transmission of ideas was really constrained through times, with a generation of authors linearly transmitting their ideas to their intellectual offspring, we would have obtained a comb with the earliest author as the most basal branch and the branches at the top being the most recent authors. It cannot be the reverse because an author can read his predecessors but cannot read future authors. The situation here is obviously more complicated: readings have been anachronistic in the sense that a given author could read any author of the past, whatever its ancientness."}
+{"text": "Honesty and integrity are key attributes of an ethically competent physician. However, academic misconduct, which includes but is not limited to plagiarism, cheating, and falsifying documentation, is common in medical colleges across the world. The purpose of this study is to describe differences in the self-reported attitudes and behaviours of medical students regarding academic misconduct depending on gender, year of study and type of medical institution in Pakistan.A cross sectional study was conducted with medical students from one private and one public sector medical college. A pre-coded questionnaire about attitudes and behaviours regarding plagiarism, lying, cheating and falsifying documentation was completed anonymously by the students.A total of 465 medical students filled the questionnaire. 53% of private medical college students reported that they recognize copying an assignment verbatim and listing sources as references as wrong compared to 35% of public medical college students. 26% of private medical college students self-report this behaviour as compared to 42% of public medical college students. 22% of private versus 15% of public medical college students and 21% of students in clinical years compared to 17% in basic science years admit to submitting a fake medical certificate to justify an absence. 87% of students at a private medical college believe that cheating in an examination is wrong as compared to 66% of public medical college students and 24% self-report this behaviour in the former group as compared to 41% in the latter. 63% of clinical year students identify cheating as wrong compared to 89% of their junior colleagues. 71% of male versus 84% of female respondents believe that cheating is wrong and 42% of males compared to 23% of females admit to cheating.There are significant differences in medical students\u2019 attitudes and behaviours towards plagiarism, lying, cheating and stealing by gender, seniority status and type of institution. The ability to identify acts of academic misconduct does not deter students from engaging in the behaviour themselves, as evidenced by self-reporting. Impeccable moral and ethical values are desired attributes of a medical practitioner. However, the medical profession today is facing a crisis of integrity as it moves from an ethics-based profession underpinned by core values of compassion and humanism to a more commercialized and business-like model driven by volumes and profits. This chThe desired competencies and moral practices of medical professionals are outcomes of academic training. Honesty and integrity are fundamental virtues expected from medical student. However academic misconduct, which includes but is not limited to cheating, plagiarism and falsifying documentation, is not uncommon in medical colleges across the world,7. A numPakistan, a developing country, is currently facing challenges such as extreme poverty, vast financial, social and educational divides. Despite the brain drain and lack of competent faculty, there is a mushrooming of medical colleges and universities, both in the public and private sector. With limited resources, the focus has inexplicably shifted to quantity instead of quality and the critical issue of academic misconduct and student integrity in medical colleges has not been addressed adequately. A study on occurrence of academic misconduct has been reported in the literature from Pakistan, related to students of business, commerce and engineering and anotA cross sectional study was conducted in medical students from one private and one public sector medical college of Pakistan in 2010\u20132011.The questionnaire used in this study was adapted from a previously reported study by Rennie and Crosby. Minor tAn internal ethical review board is only active at the private medical college included in this study. Accordingly, ethical approval  was received from the Ethical Review Committee of the former and formal permission taken from the Principal of the latter institution. Consent forms contained relevant details regarding the background and purpose of study, anonymity and confidentiality measures, possible benefits and risks, and right of refusal or withdrawal. All participants read and signed individual consent forms, which were returned with each completed questionnaire and filed by the study group. The study was administered through intermediary Year/rotation/department coordinators/faculty members who delivered the informed consent forms and questionnaires to the study participants in a regularly scheduled classes/curricular events and upon completion, collected the signed forms and anonymous questionnaires and delivered them to the study researchers. The target population of this study was students of one private and one public medical college. Students across all five years from the private institution were surveyed. Due to class and examination schedules, only students of Years 2 and 5 were available at the time of administration of this study in the public medical college. However, since these two years represent the two components of medical education i.e. basic science and clinical years, respectively, this sampling was deemed suitable.The percentage distribution of gender of students and mean with standard deviation of age of students by type of medical college was generated. The number and percentage of responses of students\u2019 self-reported attitudes (indicating that the student in the scenario was wrong) and behaviours (indicating that the respondent has done or would consider doing what is described in the scenario) regarding academic misconduct were generated with 95% confidence intervals for their differences by type of medical college, class and gender. Crude and adjusted prevalence ratios for each scenario with 95% confidence intervals were computed using the algorithm of Cox-proportional hazard regression. Statistical Package for Social Sciences  was used to analyze the data.The study sampling is presented in Table\u00a0In the first scenario related to plagiarism regarding a student who copies verbatim from the internet and other published sources and lists them as references, from the 452 students who stated their gender , 204 (45%) responded that the student in the scenario is wrong, 86 (43%) male and 118 (47%) female , 289 (64%) responded that the student in the scenario is wrong, 129 (64%) male and 160 (65%) female , 356 (78%) responded that the student in the scenario is wrong, 145 (71%) male and 211 (84%) female  , a large percentage believes it is wrong to plagiarize a friend\u2019s work without their knowledge .Students in Years 1 and 2 are more likely to identify acts of plagiarism and less likely to have committed or considered committing them. The reasons for this are probably multifactorial. Awareness of acts of academic misconduct, such as plagiarism, is raised in earlier years as part of a formal ethics curriculum, with a shift in curricular focus to clinical ethics issue and patient rights in later years. This may counter-act the fact that habits are likely inculcated in earlier schooling and through societal norms and thatBelieving that lying is acceptable and admitting to the same is an alarming trend exhibited in this study. Although a large majority of both private and public medical college students identified that a student is wrong to write \u201cExamination \u2013 normal\u201d in his patient presentation when he has not performed the procedure, almost a third of public medical college students admit to doing or considering doing this. Dishonesty in patient care activities, such as recording tasks not performed, reporting findings elicited by others, and lying about having ordered a test, are often motivated by fear and a desire to appear knowledgeable. This ma\u201cBecause the administration doesn\u2019t give leave except for illness, the students are forced to lie.\u201dThere are indeed strict attendance policies at the surveyed private institution predicated on the fact that attendance is essential for learning, particularly in a skills-based profession such as medicine, which explains why greater number of students at the private medical college and particularly in senior years admit to this behaviour. Although the students\u2019 justification does not absolve them of lying, it would be worthwhile for institutions to revisit medical leave policies for more innovative solutions to resolve this issue.\u201ceveryone does it\u201d indicates that cheating is widespread and as an act, has repeat-offenders. Indeed, it has been previously reported that cheating may be influenced by peer acceptance of this behavior[It has previously been reported that students who have cheated earlier during their primary or secondary schooling were more likely to carry on with similar behaviours than those who had never done so. In Pakibehavior and thatbehavior. Not sur\u201c[Cheating] not always wrong. Sometimes the exams are pointless and the system is flawed.\u201d\u201cDepends [on] if it was a fair paper in the first place.\u201d\u201cIf [the student] copies word [for] word, then he is wrong, and in major exams. But, in tests its ok.\u201d\u201cBy reporting the cheating, the student is actually helping the other student for his/her better[ment]\u201d), very few admit to having done the same due to demands on loyalty and fear of consequences:When it comes to reporting acts of cheating or stealing, it is apparent that the respondents grapple with a moral dilemma. Although the students in the study accept that reporting such acts is correct (\u201cI know it is the right thing to do, but social problems then arise.\u201d\u201cStudent unity [supersedes reporting]\u201d\u201c[Better to] mind your own business\u201dIndeed, previous studies have reported that students are not likely to report because of fear of repercussions by their peers, being outcast and believing that it is not a student\u2019s responsibility to report the misconduct of others,30. InteOn the other hand, our study found differences in other attitudes and behaviours between males and females, with the latter group better at identifying acts of plagiarism and less likely to lie or cheat. Previous studies have reported that females have a better understanding of academic integrity and are less likely to indulge in acts of academic misconduct as compared to males,16,32. GThe main limitation of the study is that it was conducted in just one private and one public sector medical college in Pakistan, which limited its scope as a representative sample. However, as such, it has served as a pilot study in this research area. Further representative studies will be conducted in the future with appropriate sample size and additional independent factors like the role of socio-economic status, religioIn our study significant differences were observed in the self-reported attitudes and behaviours towards academic misconduct between medical students of private and public sector institutions, between junior and senior students and in certain scenarios, between males and females. The students surveyed can identify what constitutes lying, cheating and stealing, but not all forms of plagiarism. However, ability to identify acts of academic misconduct does not deter students from engaging in the behaviour themselves. Academic integrity is essential in preparing medical students to be ethical and purposeful citizens of the profession and the world. It is therefore critical that institutions make concerted to generate a culture of integrity to correct student behaviours that may have previously been condoned in early educational environments and within the society at large. These eThe authors declare they have no competing interests.KG conceived of the study, facilitated data collection, participated in data analysis and interpretation, and preparation of the manuscript. GRL conceived of the study, facilitated data collection, participated in data analysis and interpretation, and preparation of the manuscript. HM collected data and was involved in preparation of the manuscript. IA performed the statistical analysis and contributed to preparation of the manuscript. SAS conceived of the study and participated in data interpretation and preparation of the manuscript. All authors read and approved the final manuscript.The pre-publication history for this paper can be accessed here:http://www.biomedcentral.com/1472-6939/15/43/prepub"}
+{"text": "Wistar rats were intravenously treated with buffer (negative control) or inhibitors and, subsequently, lipopolysaccharide was injected into their lungs. Blood, bronchoalveolar lavage fluid (BALF), and lung tissue were collected. In plasma, kinin release was higher in the LPS-treated animals in comparison to CeKI or rCeEI groups. rCeEI-treated animals presented less kinin than CeKI-treated group. Our data suggest that kinins play a pivotal role in lung inflammation and may be generated by different enzymes; however, neutrophil elastase seems to be the most important in the lung tissue context. These results open perspectives for a better understanding of biological process where neutrophil enzymes participate and indicate these plant inhibitors and their recombinant correlates for therapeutic trials involving pulmonary diseases.Inflammation is an essential process in many pulmonary diseases in which kinins are generated by protease action on kininogen, a phenomenon that is blocked by protease inhibitors. We evaluated kinin release in an In vivo, the activation of the plasma kallikrein-kinin system occurs when plasma prekallikrein and the HK (high-molecular-weight kininogen) assemble on endothelial cells [2 receptor. In the tissues, KLK1  hydrolyzes LK (low-molecular-weight kininogen) to release Lys-BK, which is converted into BK by aminopeptidase [2 receptor. Although this represents the major mechanism to BK release, bioactive kinins are also generated from kininogens by the action of other enzymes such as neutrophil proteases.Lung diseases are responsible for the death of millions of people every year. Inflammation is an essential component of many of these disorders, such as pneumonia, asthma, cancer, chronic obstructive diseases, acute lung injury, and granulomatous lung diseases. In this scenario, kinins are highly important in the physiopathology of lung inflammation. Once kinins are able to induce epithelial cells to release bronchodilators and mucus secretion, they participate in the airway smooth muscle contraction, leading to increased microvascular leakage . In vivoal cells . Plasma eptidase . Lys-BK During the inflammatory process, neutrophils migrate toward the site of inflammation and degranulate and release proteolytic enzymes, such as NE (neutrophil elastase), Cat G (cathepsin G), and PR3 (proteinase 3). These enzymes are involved in the degradation of extracellular matrix proteins and act on a variety of plasma proteins , 5. In a2-receptor after processing at the carboxyterminus [1 receptor and exert a hypotensive effect in vivo [Kininogen is also hydrolyzed by NE releasing E-kinin and by PR3 liberating PR3-kinin. E-kinin does not induce smooth muscle contraction but can bind to the Bterminus . PR3-kin in vivo . Despite in vivo \u201316, and  in vivo is using molecules that can bind to them, such as proteolytic enzyme inhibitors. These inhibitors are distributed among all living organisms, including animals, plants, and microorganisms.One way to evaluate the action of proteases in different physiopathological processesSeveral protease inhibitors extracted from plants have been studied for their pharmacological potential. Considering the involvement of proteases in lung inflammation and other lung pathologies, exogenous plant protease inhibitors have been tested , 18. C. echinata (Brazil-wood): (1) CeEI (C. echinata elastase inhibitor), a NE, Cat G, PR3, and plasma kallikrein inhibitor [C. echinata kallikrein inhibitor), a plasma kallikrein [In this context, we extracted and purified two different inhibitors from seeds ofnhibitor  and (2) llikrein , Cat G, llikrein . C. echinata seeds.In an edema model, using isolated perfused rabbit lungs, CeEI reduced pulmonary arterial pressure and lung weight, and CeKI was less effective . In the \u03b3-globulin was obtained from Intergen . EDTA (ethylenediaminetetraacetic acid) was purchased from Reagen  and PEG (polyethylene glycol 6000) from Quimesp . Rabbit anti-BK antibody was prepared according to the method described elsewhere [Human plasma kallikrein, neutrophil Cat G, NE and PR3, MeO-Suc-A-A-P-V-pNA, H-D-P-F-R-pNA, aprotinin, AEBSF (4-(2-aminoethyl)benzenesulfonyl fluoride hydrochloride), E-64 (trans-epoxysuccinyl-L-leucylamido-(4-guanidino)-butane), and SBTI (soybean trypsin inhibitor) were obtained from Merck KGaA . Suc-A-A-P-F-pNA, TPCK , o-phenanthroline, lisinopril, and LPS (lipopolysaccharide) were purchased from Sigma-Aldrich . BK and Tyr-BK were obtained from Peptide Institute Inc.  and lsewhere . ACE andlsewhere  were kinThis study was approved by the Ethics in Research Committee of the Universidade Federal de Sao Paulo and performed in accordance with the Guide for Care and Use of Laboratory Animals  and Lineas Directrices Relativas al Alojamento y a los Cuidados de los Animales .\u00b5M) in 50\u2009mM Tris buffer, containing 50\u2009mM NaCl pH 7.5, those of plasma kallikrein (4.0\u2009nM) in 20\u2009mM Tris buffer, containing 30\u2009mM NaCl pH 7.5, KLK1 (18\u2009nM), and those of ACE (20\u2009nM) in 20\u2009mM phosphate buffer pH 7.3. The enzymes were preincubated for 10\u2009min at 37\u00b0C with increasing amounts of rCeEI or CeKI. The residual activity of the enzymes was determined with the hydrolysis of appropriate substrates, namely, MeO-Suc-A-A-P-V-pNA (0.20\u2009mM), Suc-A-A-P-F-pNA (0.30\u2009mM), MeO-Suc-A-A-P-V-pNA (0.20\u2009mM), H-D-P-F-R-pNA (0.30\u2009mM), H-D-P-F-R-pNA (0.30\u2009mM), and Abz-F-R-K(Dnp)-P-OH (10\u2009\u03bcM), respectively. The ensuing p-nitroaniline (p-NA) release was followed at 405\u2009nm in a SpectraCount plate reader . The hydrolysis of the FRET (fluorescence resonance energy transfer) substrate was followed by measuring the fluorescence at \u03bbem = 420\u2009nm and \u03bbex = 320\u2009nm in the same plate reader.The inhibitory activities of rCeEI and CeKI were tested on NE (1.0\u2009nM) in 20\u2009mM Tris buffer pH 7.5, those of Cat G (17\u2009nM) in 50\u2009mM Tris buffer pH 8.0, those of PR3 (0.20\u2009Ki) was determined by measuring the residual enzyme activity on substrate hydrolysis. Ki value was calculated by adjusting the experimental points to the equation for a slow-tight binding mechanism [The equilibrium dissociation constant (echanism  using non = 8), positive control (n = 6), 2.6\u2009mg CeKI (n = 6), 7.8\u2009mg CeKI (n = 5), 0.78\u2009mg rCeEI (n = 5), and 2.6\u2009mg rCeEI (n = 5). The animals were pretreated by the intravenous injection (tail vein) of 50\u2009mM Tris buffer pH 8.0 (negative or positive controls), CeKI (2.6 or 7.8\u2009mg), or rCeEI (0.84 or 2.6\u2009mg) diluted in this same buffer. These concentrations were chosen based on previous results with CeKI and CeEI in an isolated lung edema rabbit model [\u03bcg LPS/animal diluted in the same buffer  was injected via trachea directly into their lungs. Six hours later, rats were once again anesthetized, a thoracotomy was performed, and blood was collected directly via the inferior cava vein by an incision in the presence of 34\u2009mM EDTA. To obtain plasma, blood was incubated on ice for 60\u2009min followed by centrifugation at 270\u2009\u00d7g for 15\u2009min at 4\u00b0C. Lungs were taken, cannulated, and washed with 10\u2009mM phosphate buffer pH 7.4 (10\u2009mL). The washing solution was collected and labeled BALF . Washed lungs were then homogenized in 10\u2009mM potassium phosphate buffer (pH 7.4) and centrifuged at 3,000\u2009\u00d7g for 30\u2009min at 4\u00b0C.For the lung inflammation model, we used the methodology described by Duong et al., 2001 , with soit model  and cons\u03bcg of protein mixture present in the BALF was applied in a sodium dodecyl sulfate polyacrylamide electrophoresis (SDS-PAGE) 12% slab gels according to the Laemmli method [Fifty i method ; the proTotal protein quantity was calculated according to Bradford  using thLeukocyte recruitment to alveoli was determined in the BALF in the presence of 0.40% Trypan Blue. Total and differential leukocyte cells were counted manually with a Neubauer chamber using an optical microscope.\u00b5M SBTI, 10\u2009\u03bcM lisinopril, 10\u2009mM EDTA, 100\u2009\u03bcM TPCK, 10\u2009\u03bcM E-64, 5.0\u2009mM o-phenanthroline, 1.0\u2009mM AEBSF, and 9.0\u2009\u03bcM aprotinin) was added to BALF, plasma, or lungs, and samples were centrifuged at 950\u2009\u00d7g for 15\u2009min at 4\u00b0C. Next, ethanol was added to the supernatant  and mixed for 30\u2009s. After centrifugation at 950\u2009\u00d7g for 15\u2009min at 4\u00b0C, the supernatant was transferred to another tube and vacuum-dried at 56\u00b0C. Water, acetone, and petroleum ether  were added to the pellet and mixed for 30\u2009s. The samples were centrifuged at 950\u2009\u00d7g for 15\u2009min at 4\u00b0C; the petroleum ether phase with the lipidic content was discarded and the acetone-aqueous phase was vacuum dried at 56\u00b0C.The kinin extraction from BALF, plasma, or lung was performed according to the method described by Shimamoto et al., 1988 , with soThe pellet obtained in The experiment was performed twice and radiation values were converted into kinin released (pg) using a standard curve.\u00b5L), collected in the absence of lisinopril, were maintained in 50\u2009mM Tris buffer pH 7.4 containing 50\u2009mM NaCl for 5\u2009min at 37\u00b0C before the addition of the substrate Abz-F-R-K(Dnp)-P-OH (10\u2009\u00b5M) in a final volume of 200\u2009\u00b5l. Fluorescence changes were monitored continuously for 30\u2009min at \u03bbex = 320\u2009nm and \u03bbem = 420\u2009nm in a SpectraCount plate reader . The slope of the generated fluorescence signal was converted into micromoles of substrate hydrolyzed per minute based on a calibration curve obtained from the complete hydrolysis of peptide and adjusted for total protein quantity. This reaction was performed in triplicate and lisinopril (10\u2009\u03bcM) was used to confirm ACE activity.Samples of lungs  with the commercial program GraphPad Prism Version 5 . Caesalpinia echinata seeds: CeEI and CeKI. Both inhibitors share similarities, according to Cruz-Silva et al. [In previous works, we purified and characterized two inhibitors froma et al. , 20. Coma et al. . TherefoLPS is an endotoxin found in the outer membrane of Gram-negative bacteria and it has a potent proinflammatory activity. In order to verify LPS-induced immune response, we evaluated PMN infiltration into the alveolar space, counting leukocyte cells in BALF. In BALF samples, we verified a 7.1-fold increase in PMNs in the positive control compared to the negative control, which was used as an indication of cell extravasation . All inhKinins were extracted by ethanol from BALF, plasma, or lung in the presence of a cocktail of protease inhibitors and submitted to kinin radioimmunoassay. In BALF, kinin release was observed in all groups. The LPS group (positive control) showed high kinin content , which corresponds to an augment of 13.5-fold in comparison to the negative control. The inhibitors reduced kinin release up to 9.0-fold, with no significant difference between experimental groups .In plasma, kinin release was also detected in all groups. Similarly, in the positive control, there was higher kinin generation  than in the negative control (7.5-fold). Accordingly, rCeEI reduced kinin release by 50-fold and CeKI up to 4-fold  in compaIn lungs, we observed smaller kinin release  compared to BALF and plasma. In addition, there was a significant reduction in kinin concentration only in rCeEI-treated group compared to the positive control (2.3-fold) , confirmIn order to understand the small presence of kinin in that tissue, we evaluated the kininase activity of ACE. As expected, a high ACE activity in the lung tissue, even in inhibitor-treated animals, was observed . NeverthThe underlying pathophysiological mechanisms in lung inflammation require a variety of disrupted homeostatic events involving pulmonary endothelial and epithelial barrier dysfunction, recruitment and neutrophil activation, and the release of potent antimicrobial substances including oxidants and proteases, such as NE, Cat G, and PR3. During inflammation, these enzymes are able to cleave several cellular substrates, and, under pathological conditions, they can damage host tissues.Here we analyzed the interplay between neutrophil recruitment and protease release, as well as the kallikrein-kinin system activation using LPS-induced lung inflammation model in rats and kinin detection method in BALF, plasma, and lungs.PMN participation, primarily neutrophils, has been described in many pulmonary diseases. In general, PMN infiltration can be observed from 4 to 8 hours after LPS or Gram-negative bacteria application or inhalation , 31. Our in vitro [ Bauhinia bauhinioides seeds, strongly inhibited leucocyte rolling, adhesion, and migration, in an inflammation model induced by carrageenan.The mechanism used by PMN to cross the endothelium and enter the alveolar space is not completely clear; however leukocyte chemotaxis has been associated with PMN migration . Among cin vitro , as wellin vitro . So, it in vitro  showed tRegarding kinin generation, it is well know that this peptide is involved in the major signs of inflammation, such as pain, heat, redness, and swelling .Using this LPS-induced lung inflammation model, we detected different kinin amount in the analyzed compartments , where they are believed to mediate these inflammatory events. Considering all potential sources of kinin and its high quantity in BALF , it can be suggested that this peptide could greatly be produced or be translocated into the alveolar space. In plasma, kinin content was smaller almost 150 times in comparison to BALF, while in lungs kinin was detected in a fg scale , which was slighter compared to BALF and plasma. Typically, kinin generation has been demonstrated in plasma and attributed to HK proteolysis by plasma kallikrein. However, this is not enough to explain the potential sources of kinin in the current model. In this context, Idell et al.  showed tIn this respect, it was demonstrated that kininogen can be also hydrolyzed by PR3  and addi C. echinata seeds, CeKI and rCeEI, which differently inhibit plasma kallikrein, PR3, Cat G, and NE. In BALF, both inhibitors reduced kinin release up to 9.0-fold, with no significant difference between experimental groups, indicating that a combination of kinin-generating pathways was activated in that compartment, and the inhibition of neutrophil enzymes  besides plasma kallikrein was responsible for this result. Although the presence of kallikrein is something unusual in BALF, our results regarding PMN extravasation into alveolar space, in addition to a number of evidences, support this suggestion, as neutrophils are able to bind kininogen [These evidences indicate that kinin could be generated by different enzymes and scenarios; thus, to better discriminate the action of these enzymes in this lung inflammation model, we used two protease inhibitors extracted fromininogen , 42 and ininogen .In the plasma, kinin release was mainly reduced by rCeEI up to 50-fold in comparison to LPS group, which may indicate that NE play a central role in kinin generation in that model. In the lungs, the smaller kinin release  compared to BALF and plasma was observed. It is absolutely reasonable that the slighter kinin content in lungs is a result of ACE activity, which is abundant on the surface of lung endothelial cells  and it wIn the lung tissue, similarly to other investigated compartments, since there was a significant reduction in kinin concentration in rCeEI-treated group compared to the positive control (2.3-fold), NE seems to be a central enzyme for kinin generation. In fact, although kallikrein is a classical enzyme for kinin release, it has been shown that kininogen can be hydrolyzed by NE and the released E-kinin is subsequently cleaved to produce BK , 45. TheSince protease inhibitors can access the alveolar microenvironment and bind to the major enzymes involved in the inflammation processes, they appear as tools to allow a better understanding of the lung inflammation process and its control. Also, they are good candidates for further investigation using DNA recombinant approaches in order to define the minimal dominium for inhibitory activity."}
+{"text": "Nptx2-/- results in reduced GluA4 expression, disrupted rhythmicity, and increased pyramidal neuron excitability. Postmortem human AD cortex shows profound reductions of NPTX2 and coordinate reductions of GluA4. NPTX2 in human CSF is reduced in subjects with AD and shows robust correlations with cognitive performance and hippocampal volume. These findings implicate failure of adaptive control of pyramidal neuron-PV circuits as a pathophysiological mechanism contributing to cognitive failure in AD.Memory loss in Alzheimer\u2019s disease (AD) is attributed to pervasive weakening and loss of synapses. Here, we present findings supporting a special role for excitatory synapses connecting pyramidal neurons of the hippocampus and cortex with fast-spiking parvalbumin (PV) interneurons that control network excitability and rhythmicity. Excitatory synapses on PV interneurons are dependent on the AMPA receptor subunit GluA4, which is regulated by presynaptic expression of the synaptogenic immediate early gene NPTX2 by pyramidal neurons. In a mouse model of AD amyloidosis, DOI:http://dx.doi.org/10.7554/eLife.23798.001 The cause of memory loss in Alzheimer\u2019s disease remains an important unknown that negatively impacts therapeutics development . AmyloidNptx2-/- results in a synergistic reduction of inhibitory circuit function in conjunction with a reduction of the AMPA type glutamate receptor GluA4. GluA4 is preferentially expressed in PV-interneurons at excitatory synapses where it co-localized with NPTX2 (presynaptic source)  where analysis suggested NTPX2 is required to bind and stabilize postsynaptic expression of GluA4 in PV-interneurons in conditions of altered activity   and conf source)  that is  source) . Nptx2-/activity , 2016. Iactivity . NPTX2 iNptx2 mRNA was also prominently reduced in assayed regions  subjects aged 19 y/o to 40 y/o compared to age matched controls  and mRNA were similarly reduced in older DS individuals with AD (NPTX2 protein was assayed by western blot (WB) in human brain from individuals with pathologically confirmed late onset Alzheimer\u2019s disease (AD) versus age-matched controls . NPTX2 w regions . Neurona regions . To furt regions . NPTX2 w regions   or mRNA stability. IEGs are targets of miRNA control ] were increased in AD frontal cortex where levels in individual samples correlated with Nptx2 mRNA  together with increases in miR-96 and miR-182   and Nptx2-/-. Amyloidosis in a similar mouse model increases hippocampal excitability by reducing excitability of PV-interneurons  were evident in all four groups    . To asserneurons . Accordir groups . SWR arer groups  and refl-/- mice . We next-/- mice . Gamma o-/- mice . In bothto 40 Hz . hAPP mirequency . hAPP/Npak power  to 3F. Aak power  indicatiNptx2-/- on pyramidal neuron-PV interneuron function in hAPP/Nptx2-/- mice. NPTX2 is required for homeostatic up regulation of GluA4 at excitatory synapses on PV interneurons in response to increased pyramidal neuron activity  analysis revealed the specificity, sensitivity and accuracy of NPTX2 was similar to A\u00df42 and superior to tau and p-tau for distinguishing controls from AD . A ratioDetailed cognitive data available for the second set of AD subjects revealed positive correlations (p\u00a0<\u00a00.05) of NPTX2 with the Dementia Rating Scale (DRS) , DigitalThe present study identifies NPTX2 down-regulation as an important mechanism in AD pathogenesis that is closely linked to cognitive deterioration. The observed reductions of NPTX2 protein in human brain and CSF, and the correlation of CSF NPTX2 with cognitive status and hippocampal volume provide support for the notion that NPTX2 could be an informative biomarker for AD. The potential value of NPTX2 as a biomarker is further advanced by the observation that NPTX2 appears \u2018orthogonal\u2019 to A\u00df and tau since NPTX2 is not reduced as a direct consequence of A\u00df amyloid in mouse models, appears independent of A\u00df in human asymptomatic AD (pre AD), and reductions of CSF NPTX2 do not correlate with reduction of CSF A\u00df42 or increases of tau/p-tau. Because of the synergistic effects of amyloidosis and NPTX2 down regulation, CSF levels of NPTX2 might distinguish subjects who will be most responsive to amyloid reducing therapy. A recent study reported that CSF NPTX2 may anticipate disease progression . But the2+ dependent lectin and appears to bind the glycoprotein network that prominently surrounds PV interneurons  acts in synergy with Nptx2-/- to down-regulate GluA4 expression and results in anticipated changes of excitability and rhythmicity. These observations validated GluA4 as a biomarker of NPTX2-dependent PV interneuron function in the context of amyloidosis. In human brain we found GluA4 expression was reduced and correlated with NPTX2 expression in the same samples supporting the notion that GluA4 expression is dependent on NPTX2 expression in AD brain. Unexpectedly, GluA4 and NPTX2 correlate within samples in both AD cases and in aged controls. This is notable since in young adults NPTX2 and GluA4 expression do not appear to correlate within samples, and NPTX2 appears higher in young brain than in aged controls. This age-dependence requires further analysis, but suggests that GluA4 expression in PV interneurons becomes dependent on pyramidal neuron expression of NPTX2 during normal aging, and GluA4 expression-PV interneuron function become critically reduced in AD as NPTX2 expression is reduced. Additional studies are also necessary to define the anatomic extent and possible progression of NPTX2 reduction beyond cortical regions.To assess the notion that NPTX2 down-regulation in human brain is indicative of a disruption of the pyramidal neuron-NPTX2-PV interneuron homeostatic mechanism we needed to identify a biomarker of PV-interneuron function that is dependent on NPTX2 expression and that could be quantitatively assayed in human tissue samples. We confirmed in a mouse model that amyloid expression  strain was obtained from Dr. Philip Wong. hAPP mice with single copy of transgene were crossed with Nptx2-/- to generate hAPP/+/-Nptx2, which were then crossed with Nptx2-/- to generate hAPP/Nptx2-/-. Similarly, WT (C57BL/6J) were crossed to hAPP mice to generate hAPP/WT, which were crossed to WT to generate cohort. For both WT and Nptx2 deletion mice cohorts, we confirmed that\u00a0~50% of progeny of the final cross carry the hAPP transgene, and this assured that mice carry a single copy of the transgene. All procedures involving animals were under the guidelines of JHMI Institutional Animal Care and Use Committee.nic mice  (here abHuman brain tissue of Alzheimer\u2019s disease (AD) and asymptomatic AD (ASYMAD) was obtained from the Johns Hopkins Brain Resource Center, which includes subjects from the Baltimore Longitudinal Study of Aging. Subjects were recruited by the Clinical Core at Johns Hopkins Alzheimer\u2019s Disease Research Center (ADRC) from the community or from the cohort already enrolled in the Baltimore Longitudinal Study on Aging. The assessment procedures have been coordinated by Joint Clinical Core meetings that assure standardization of diagnostic procedures for annual medical, neurologic, psychiatric and neuropsychological evaluations of all subjects. The Neuropathology Core arranges and performs autopsies on clinically well-characterized participants who agreed to autopsy. Results of neuropathological autopsies are then discussed on clinical-pathological conferences attended by members of the Clinical and Neuropathology Cores. Human Down syndrome (DS) brain tissue and control brains that went with those was obtained from two sources \u2013 one is University of Maryland brain and tissue bank, and another is Dr. Benjamin Tycko at Taub Institute for Research on Alzheimer\u2019s disease and the Aging Brain and Dr. Jerzy Wegiel at Institute for Basic Research in Staten Island. Brain samples were lysed in RIPA buffer plus protease inhibitor cocktail at a dilution factor 1:50 for Western blot analysis.Human cerebrospinal fluid (CSF) samples were obtained under IRB-approved protocols from participants in the UCSD Alzheimer's Disease Research Center. All participants were given informed consent before taking part in the study. Human CSF samples were dissolved with SDS loading buffer, and 12 \u00b5l of CSF were loaded to SDS-PAGE and subsequent Western blot. NPTX2 protein levels in CSF were further quantitated by ELISA assay developed in current study. All CSF samples were frozen at collection and assayed after first thaw. We noted that NPTX protein levels decreased with multiple freeze thaw cycles. To validate the value of NPTX2 as a potential CSF biomarker of AD, two independent cohorts of CSF samples were recruited and analyzed to confirm the finding. Clinic information was blinded during experiment.NPTX2-/- mice. Mouse anti-Arc monoclonal antibody was described previously ; mouse anti-APP N-terminus monoclonal antibody 22C11 is from Millipore ; rabbit ant-Egr1 (C-19) is from Santa Cruz ; mouse anti-PSD95 is from Thermo\u00a0Fisher Scientific ; mouse anti-gephyrin is from BD Transduction Laboratories ; mouse anti-Homer1 is from Santa Cruz Biotechnology ; rabbit anti-GluA4 is from Millipore (Cat. Number: MABN1109); mouse anti-parvalbumin is from Sigma ; mouse anti-actin antibody is from Sigma ; ECLTM anti-mouse IgG HRP is from GE Healthcare ; ECLTM anti-rabbit IgG HRP is from GE Healthcare (Cat. Number: NA934V); donkey anti-sheep IgG HRP is from Santa Cruz .Rabbit anti-NPTX1 and anti-NPTX2 were described previously . Mouse aeviously . All othWestern blot substrate SuperSignal West Pico Luminol Enhancer Solution (Cat. Number: 1859675) and SuperSignal West Pico Stable Peroxide Solution (Cat. Number: 1859674) are from Thermo\u00a0Fisher Scientific.4P2O7, 2 mM Na3VO4, and protease inhibitor cocktail in PBS, pH 7.4. Protein extracts were separated by 4\u201312% SDS-PAGE, transferred to PVDF membranes, blocked with 5% non-fat milk, and then probed with primary antibodies for overnight at 4\u00b0C. After washes with TBST (TBS with 0.1% Tween-20), membranes were incubated with HRP-conjugated secondary antibodies for 1 hr at room temperature (RT). Immunoreactive bands were visualized by the enhanced chemiluminescent substrate  on X-ray film and quantified using the image software TINA (www.tina-vision.net). Actin and PSD95 were used as loading controls. Proteins migrating similarly in SDS-PAGE gel were assayed on different blots without stripping.Cultured cells or brain tissue were lysed with a modified RIPA buffer containing 1% Triton, 0.5% Na-deoxycholate, 0.1% SDS, 50 mM NaF, 10 mM NaNptx2-myc in pRK5 vector was used as a template. The N terminal fragment encoding amino acid 1 to 201 was amplified with primers 5\u2019 GCAAGGATCCCAAGCCCAGGATAACCC 3\u2019 and 5\u2019 CATGTCGACTCATGCACTGTTGCCTCTCTC 3\u2019, and then cloned into pQE30 vector  at sites of BamH1 and SalI. The protein was expressed in XL1-blue host cells induced with 1 mM IPTG. The expressed NPTX2 fragment was purified with NI-NTA agarose column (Qiagen), and the protein concentration was quantified with BCA kit (Thermo Fisher\u00a0Scientific).Full length 2CO3 buffer (pH 9.5) was coated to the ELISA plate (Nunc) at 4\u00b0C for overnight. Next day, after treating with blocking solution (5% BSA in PBS) for 1 hr at RT, 100 ul of the series of diluted NPTX2 standard proteins or CSF samples were added into wells and incubated at RT for 1 hr with constant shaking. After washing with TBS, 100 ul of biotinylated mouse anti-NPTX2 antibody was added and incubated at RT for 1 hr. Then, 100 ul of HRP conjugated streptavidin  was added and incubated for 1 hr. After washing with TBS, 100 ul of DAB substrate (Biolegend) was applied and incubated for half hour at RT in dark. In the end, 100 ul of 4 M H2SO4 stopping solution was added and the absorbance was measured at 450 nm. The absolute levels of NPTX2 in CSF were determined by the calculation based on standard curve.Basically, the operation follows the regular process of ELISA. Briefly, 0.5 \u00b5g of rabbit anti-NPTX2 antibody in 50 mM Na2O for three times. Protein antigenicity was unmasked by the treatment with 88% formic acid for 5 min. Slides were washed with ddH2O 3 times for 5 min each. Then, sections were treated with blocking solution  for 1 hr at RT and incubated with mouse anti-PV antibody  and rabbit anti-GluA4 antibody  at 4\u00b0C for overnight. After three washes with TBS, tissue sections were incubated with Alexa Fluo-conjugated secondary antibody at RT for 1 hr. Coverslips were mounted on glass slides with ProLong Gold antifade reagent.Human neocortex was fixed by immersion in 10% formaldehyde in PBS (pH 7.4), and then embedded in paraffin and sectioned to 5 \u00b5m thickness on slides. Sections were deparaffinized and hydrated by incubating slides at 60\u00b0C for 30 min and then transferred into Xylene. The paraffin was removed after 3 changes of Xylene for 5 min. Then, slides were treated 3 min with sequential changes of 100%, 95%, and 70% ethanol and ddHTotal RNA and small RNA were extracted by mirVana miRNA isolation kit  according to the manufacturer\u2019s protocol. Isolated RNA was treated with DNase to remove DNA . One \u00b5g of isolated total RNA was then immediately reverse-transcribed into cDNA using the SuperScript First-Strand Synthesis System for RT-PCR . Quantitative PCR was performed with a StepOne Plus machine  using SYBR green ROX qPCR mastermix in a 96-well optical plate. PCR cycling consists of 95\u00b0C for 10 min, followed by 40 cycles of 95\u00b0C for 30 s, 64\u00b0C for 30 s and 72\u00b0C for 30 s. A melt curve was conducted to determine the specificity of PCR amplification. Gapdh was served as an internal control to nomalize data. To assay the direct transcripts pre-mRNA, primers were designed to bind with the intron of genes.For analysis of miRNA abundance, 30 ng of isolated samll RNA was reverse-transcribed using Taqman micoRNA reverse transcription kit (Applied Biosystems), and then subjected to Taqman microRNA assays according to manufacturer\u2019s protocol (Applied Biosystems) in StepOne Plus machine. PCR cycling consists of 95\u00b0C for 10 min, followed by 40 cycles of 95\u00b0C for 15 s, 60\u00b0C for 60 s. RNU48 served as an internal control to nomalize data.miR-96, miR-1271 and miR-182 were amplified by PCR from genomic DNA, and inserted into PacI and NheI sites of lentiviral vector pSME2. Constructs were verified by sequencing. The lentiviral production plasmids contain four constructs: the pSME2 lentiviral backbone plasmid and three packaging plasmids pCMV-VSVG, pLP1 and pLP2. All constructs were transformed into stbl3 competent cells (Life Technologies) and then prepared using a standard protocol of Qiagen Maxiprep columns.Precursors of CVCL_0063). No mycoplasma contamination was detected by MycoAlert Mycoplasma Detection Kit . HEK293T cells were grown in 175 cm2 flasks that were pre-coated with 0.01% poly L-lysine (PLL) solution and maintained with DMEM containing 10% FBS. To improve transfection efficiency, 25 \u03bcM chloroquine was added to the medium of cultured HEK293T cells when culture was 50% confluency, and transfection was performed one hour later. Cells were transfected using FuGene6  with the ratio of 1 \u03bcg plasmid DNA: 3 \u03bcl FuGene6. Eight hours after transfection, 10 \u03bcM sodium butyrate was added to the medium to improve transfection efficiency. Culture medium was changed at 24 hr after transfection and collected at 48 hr after medium change (the transfection efficiency was monitored by GFP fluorescence). Virus particles were pelleted by centrifugation at 25,000 rpm for 2 hr at 4\u00b0C (Beckman SW 28 rotor). Virus was aliquot and stored at \u221280\u00b0C for future use.Lentivirus was produced and packaged in HEK293T cells. HEK293T cell line was purchased from ATCC  mouse pups were prepared as described previously . Cells wDNA from postmortem brains of AD patients and healthy control was extracted using QIAamp DNA mini kit (Qiagen), then treated with bisulfite to convert cytosine residues to uracil, but leave methylated cytosine unaffected . Bisulfite-treated DNA was amplified by PCR using Qiagen DNA methylation assay PM00126406, then subjected to pyrosequencing to determine the DNA methylation at Johns Hopkins University Genetic Resources Core Facility.Nptx2 3\u2019UTR was amplified by PCR and inserted downstream of firefly luciferase in a reporter vector pmirGLO , which contains another luciferase, renilla luciferase, as an internal reference. Mutation of miR binding site on Nptx2 3\u2019UTR was generated by QuickChange site-directed mutagenesis kit using primers containing mutated nucleotids . Constructs were verified by sequencing.Nptx2 3\u2019UTR and miR mimics or negative control siRNA (Qiagen) by Lipofectamine 2000 (Life Technologies). One day later, cells were lysed and activities of firefly luciferase and renilla luciferase were assayed by Dual-luciferase reporter assay system (Promega). The ratio of firefly luciferase to renilla luciferase activity represented the effects of miR mimics on Nptx2 3\u2019UTR.HEK293 cells were co-transfected with pmirGLO/ WT or Mut NPTX2-/-, hAPP or hAPP/NPTX2-/- mice aged 3 to 4 months. Mice were anaesthetized using isoflurane, decapitated and the brain was immediately immersed in aCSF (at ambient temperature) aerated with 95% O2 and 5% CO2. The aCSF contained (in mM): NMDG (135), KCl (1), KH2PO4, (1.2), MgCl2 (1.5), CaCl2 (0.5), glucose (10) and choline bicarbonate (20). Horizontal slices (400 \u00b5m thick) containing the hippocampus were cut using a Leica VT1000S vibrating microtome  and were immediately placed into an interface-style chamber  containing humidified carbogen gas and perfused with aerated aCSF (1\u20131.5 ml min\u22121) containing (in mM): NaCl (126), KCl (3), MgCl2 (2), CaCl2 (2), NaH2PO4 (1.25), glucose (10) and NaHCO3 (26). Slices were incubated for at least one hour before initiating recording. Local field potentials were recorded from CA3 stratum pyramidale using glass pipettes pulled from standard borosilicate glass (3\u20135 M\u03a9) and filled with aCSF. Signals were low-pass filtered at 2 kHz and acquired at 10 kHz using an Axon Axopatch 1D amplifier , digitized using an Axon Digidata 1322A  and captured on a computer running pClamp 9 . All Data were imported into Igor Pro 6  using NeuroMatic  and analysed using custom-written procedures. Sharp wave ripple oscillation were recorded in drug-free conditions and then gamma oscillations were induced by applying 25 \u00b5M carbachol  as described , Initiation and Perseveration (37 points), Conceptualization (39 points), Construction (six points), and Memory (25 points). The DRS was administered according to the standardized instructions with the exception that every item was administered to every participant.In this task, subjects are presented with a key, which associates unfamiliar symbols with the numbers 1 through 9. They are then asked to use the key to draw the appropriate symbols below a series of their associated numbers as quickly as possible for 90 s.The subject is asked to generate orally as many different kinds of animals, fruits, and vegetables as possible within a given time limit. For each category, the subject is allowed one minute to generate items. The subject's score is the total number of items correctly named for the three categories. Perseverations and intrusion errors are also noted. Although fluency tests are sensitive to language dysfunctions and deterioration of semantic knowledge, they can also reflect an individual's capacity to retrieve information from semantic memory. If other language abilities, such as confrontation naming and comprehension are intact, impaired fluency may be due to an inability to initiate systematic retrieval of information in semantic storage .The Wisconsin Card Sorting Test is widely accepted as a measure of abstracting ability, which is sensitive to frontal lobe pathology. In For this constructional task, the subject is presented with four or nine red and white blocks and asked to construct replicas of 11 designs. The blocks are red on two sides, white on two sides, and half white, half red on two sides. The seven four block designs have either 60 or 75 s limits; the three nine block designs, two minute limits. The subject's score depends both upon accuracy and speed. For the first two block designs, the subject copies the examiner's block constructions; for the remaining nine designs, he copies two-dimensional pictures of the designs. The Block Design Test is sensitive to the early cognitive decline that occurs in either cortical or subcortical dementia.This test provides a measure of memory for geometric forms. On each of three trials, the subject must reproduce a complex geometric figure from memory immediately following a 10 s study period. Three increasingly complex stimuli containing from 4 to 10 components are presented on successive trials. As a measure of long-term retention, the subjects are asked after 30 min of unrelated testing to again reproduce the figures from memory. A delayed recognition test was also administered, which consists of 18 target items and 18 distractor items. Target items consist of the four complete original designs and 14 partial replications of the four original designs. Finally, the subject is asked to simply copy the stimulus figures in order to assess any visuoperceptual dysfunction that may be contaminating visual memory performance. The subject's reproductions are scored for the number of components present from the original stimulus drawings.The CVLT is a list-learning task that assesses multiple cognitive parameters associated with learning and memory, thereby providing an evaluation of the learning process as well as a measure of how much information is acquired and retained. On each of 5 trials, 16 words are presented orally at the rate of one word per second and immediate free recall of the words is elicited. The 16 words consist of four words from each of four semantic categories. Immediately following the fifth presentation/recall trial with the original list, a single presentation/recall trial is presented using a new list (list B) of 16 words. The subject is then asked to again recall the original 16 words, and then to recall the same words when provided with semantic cues. Following a 20 min delay that is filled with unrelated neuropsychological testing, free recall and cued recall of the original 16 word list is again elicited. Finally, a yes/no recognition test is administered consisting of the original 16 words and 28 randomly interspersed distractor words.Tests for which none of the CSF biomarkers reached p<0.05 included Mini Mental Status Exam (MMSE), Blessed Information-Memory-Concentration Test, Boston Naming Test, Clock Drawing Command, Clock Drawing copy. Tau shows correlation (p=0.012) for CERAD (Consortium to Establish a Registry for Alzheimer\u2019s Disease) trial three recall only.The MMSE is a structured scale that briefly assesses orientation to place, orientation to time, registration, attention and concentration, recall, language, and visual construction. It is scored in terms of the number of correctly completed items with lower scores indicative of poorer performance and greater cognitive impairment. The total score ranges from 0 to 30 (perfect performance).On the letter fluency test, the subject is asked to generate orally as many words as possible that begin with the letters \u2018F,' \u2018A,' and \u2018S,' excluding proper names and different forms of the same word. For each letter, the subject is allowed one minute to generate words. Performance is measured by the total number of correct words produced to the three letters. Perseverations  and intrusions  are noted.The test consists of 26 items that assess aspects of orientation , memory (remembering new and remote information), and concentration . The IMC test is scored in terms of errors (0 (perfect performance) to 33), with higher scores reflecting poorer performance and greater cognitive impairment.The UCSD abbreviated version of this test requires the subject to name 30 objects depicted in outlined drawings. The drawings are graded in difficulty, with the easiest drawings presented first. If a subject encounters difficulty in naming an object, a stimulus or phonemic cue is provided. The number of spontaneous and cued correct responses, perceptual errors, circumlocutions, paraphasias, and perseverations are used to evaluate the subjects' language performance. In addition to providing quantitative measures of naming ability with and without semantic cueing, the BNT also yields valuable information concerning the processes underlying a given patient's naming errors.In the first part of this visuoperceptual constructional task, the subject is required to draw a clock with numbers and to set the hands at ten past eleven. In the second part of the test, the subject attempts to copy a picture of a clock with the hands set at ten past eleven. Rouleau and colleagues  have devIf it is judged that an overwhelming majority of subjects are able to read, the CERAD Word-List Learning Test will be administered since this test has been widely and effectively used for the assessment of dementia. This task consists of immediate free recall of a 10-item word list assessed over three separate learning trials. The subject is asked to read aloud 10 printed words at a rate of one every two seconds. Immediately following the presentation of the list, the subject is asked to recall as many of the words as possible. Two additional learning trials are immediately administered following the same procedure. After a delay of five to eight minutes filled with unrelated testing, the subject is again asked to recall as many of the words from the 10-item list as he or she can . A savings score is calculated by dividing the number of words correctly recalled in the delay condition by the number of words recalled on the third learning trial. A delayed word-list recognition task is also administered. In this yes/no recognition task, the subject must identify the original 10 items on a list of these words intermixed with 10 distractor words. As with the Fuld Object Memory Test, the CERAD Word-List Learning Task provides a number of memory measures that are effective for detecting early dementia and for differentiating among different forms of dementia.TM a probabilistic-atlas based volumetric MRI software package , was used to derive regional volumes of the hippocampus and temporal horn using methods previously described (Imaging was performed using 3D T1-weighted MRI sequences based on the Alzheimer's Disease Neuroimaging Initiative (ADNI) . For segescribed . The hipescribed  is a meaTo evaluate the diagnostic value of CSF biomarkers, receiver operating characteristic (ROC) curve analysis  was perfSCR_002798) to perform statistical analyses. Two-tailed t test was employed to analyze difference between two groups. Correlation analysis were performed by Pearson correlation coefficient. Sample sizes of human specimens were estimated by power analysis using G*Power (RRID: SCR_013726).We used GraphPad PRISM version 5  and three reviewers, one of whom is a member of our Board of Reviewing Editors. The reviewers have opted to remain anonymous.Thank you for submitting your article \"NPTX2 and Cognitive Dysfunction in Alzheimer's Disease\" for consideration by The reviewers have discussed the reviews with one another and the Reviewing Editor has drafted this decision to help you prepare a revised submission.Summary:Your manuscript has been evaluated by three reviewers, who provided positive comments on the work. They found the results to be of interest, as the findings imply an influential role of the activity-dependent gene, NPTX2, in Alzheimer's disease. The authors demonstrate that GluA4, an AMPA receptor subunit selectively expressed at ES-PV and essential for inhibitory circuit function that underlies memory, is reduced in Alzheimer's disease cortex. Furthermore, NPTX2 CSF levels are correlated with cognitive performance and hippocampal volume in subjects with AD. Several mechanisms are proposed, including a specific microRNA that targets NPTX2 mRNA and lower GluR4 expression levels, which correlate with NPTX2. The reduction in NPTX2 in the CSF was regarded as a significant marker of the disease.However, all three reviewers raised a number of questions regarding the reduction and relationship of NPTX2 and GluR4. These issues will need more support and explanation. There were also several experimental issues that should be considered, such as additional EEG measurements. If this is feasible within the two month time frame, it would enhance the analysis. In any case, we believe you will be able to address the majority of the major issues listed below in a revised manuscript.Essential revisions:1) NPTX2 CSF levels are correlated with cognitive performance and hippocampal volume in subjects with AD. Thus, NPTX2 might be used a biomarker in the disease. This is potentially important. This reviewer has some reservations regarding the animal studies. In an attempt to provide mechanistic insights on the role of GluA4 and NPTX2 in AD, the authors have investigated a mechanism that might justify the detrimental action of GluA4 and NPTX2 reduction in the disease using animal models. This section of the manuscript is underdeveloped. Specifically, it is not clear to the present reviewer how the reduction in GluA4 and NPTX2 starts and ends up involving the whole brain in addition to PV interneurons. Finally, it is not even clear if pathology involves other parts of the brain.2) Previous data implied the NPTX2 binds specifically to GluA4 and may lead to clustering and recruitment to excitatory synapses. How does NPTX2 result in a reduction of GluA4? Do these events occur inside neurons? What is the consequence of lower GluR4 levels upon AMPA receptor function? Essential revisions:1) NPTX2 CSF levels are correlated with cognitive performance and hippocampal volume in subjects with AD. Thus, NPTX2 might be used a biomarker in the disease. This is potentially important. This reviewer has some reservations regarding the animal studies. In an attempt to provide mechanistic insights on the role of GluA4 and NPTX2 in AD, the authors have investigated a mechanism that might justify the detrimental action of GluA4 and NPTX2 reduction in the disease using animal models. This section of the manuscript is underdeveloped. Specifically, it is not clear to the present reviewer how the reduction in GluA4 and NPTX2 starts and ends up involving the whole brain in addition to PV interneurons. Finally, it is not even clear if pathology involves other parts of the brain.We appreciate these comments and agree that the relationship between NPTX2 and GluA4 was underdeveloped in the original manuscript. Because this is an important issue we have revised the manuscript to better explain the rationale and relevance of GluA4 as a biomarker of NPTX2 function in AD brain. The Discussion was rewritten in entirety primarily to address this issue.In response to the question whether NPTX2 down-regulation involves other parts of the brain and how it may progress, we note this issue in the Discussion as a future direction.2) Previous data implied the NPTX2 binds specifically to GluA4 and may lead to clustering and recruitment to excitatory synapses. How does NPTX2 result in a reduction of GluA4? Do these events occur inside neurons? What is the consequence of lower GluR4 levels upon AMPA receptor function?We now know that neuronal pentraxins  similarly bind to all AMPA receptors. Early work demonstrated that NPTX2 clusters and co-IPs GluA1 and GluA2 subunits  . In studies examining its direct interaction with AMPA receptors we focused on GluA4 for technical reasons . NPTX binding to AMPA receptors has been recently reported independently by Dr. Sudhof\u2019s group .How does the down-regulation of NPTX2 result in down-regulation of GluA4? As summarized in the revised Discussion, NPTX2 is secreted from pyramidal neurons and acts as a presynaptic factor that clusters postsynaptic GluA4 at the excitatory synapse on PV-interneurons . The essential contribution of GluA4 to AMPA receptor function in PV-interneurons is rapid channel inactivation   . GluA4 is required for effective pyramidal neuron drive of PV interneurons, generation of \u03b3 frequency oscillations, and multiple forms of memory including episodic memory ."}
+{"text": "This is made up of a positive scaling below the summer mean temperature and a negative scaling above. Using seasonal means instead of daily means, we find a consistent scaling rate for the region of 6.7\u20137%/K for both daily and hourly precipitation extremes, about 10% higher than the regional Clausius-Clapeyron scaling of 6.1%/K based on a mean temperature of 24.6\u2009\u00b0C. With up to 18% further increase in extreme precipitation under continuing global warming towards the IPCC\u2019s 1.5\u2009\u00b0C target, risks of flash floods will exacerbate on top of the current incapability of urban drainage systems in a rapidly urbanizing China.Global warming increases the moisture holding capacity of the atmosphere and consequently the potential risks of extreme rainfall. Here we show that maximum hourly summer rainfall intensity has increased by about 11.2% on average, using continuous hourly gauge records for 1971\u20132013 from 721 weather stations in China. The corresponding event accumulated precipitation has on average increased by more than 10% aided by a small positive trend in events duration. Linear regression of the 95 Global warming is expected to strengthen the hydrological cycle with increased mean precipitation and precipitation extremes1234689115131415The increase in moisture supply at a given time in the atmospheric column and surrounding area increases the potential amount of precipitation in a short period of time without reinforcement from lateral transport, leading to amplified precipitation intensity and possibly frequency of occurrence for extreme eventsLimited by available observational measurement, most studies of precipitation extremes are based on daily accumulated total amount13141516171819Existing studies use either small number of observational sites or short period of time. Here we analyse, for the first time, hourly precipitation records from 721 observational sites in China over the period 1971\u20132013 for the summer months June-August. These sites are chosen from over 2400 stations to ensure they have continuous measurements for 43 years with missing data less than 5%.th percentile of hourly precipitation for wet hours (>0.1\u2009mm/hr) in the summer of 1971\u20132013  hourly and b) daily precipitation intensity with daily mean surface air temperature. Here the percentiles are defined in the same way as in ref. th percentile of daily precipitation extremes are mostly above 10\u2009hours. Actually, less than 50% of extreme hourly precipitation overlaps with daily extremes (i.e. on the same day), particularly over South China (south of 30\u00b0N) where less than 40% overlaps. Less than 20% of the daily precipitation extremes reach the threshold of the 95th percentile hourly precipitation extremes. This highlights the difference between daily and hourly precipitation extremes.The increase in precipitation extremes is largely attributed to rising temperatures resulting from global warming , which corresponds to a C-C scaling of 6.1%/K shown by the dashed lines. Unlike some previous studies, we deliberately avoid the 99.9th percentile because the sample size becomes too small for statistical significance. Agreeing with earlier reports17181920293031th percentile for example, for temperatures below the mean, both panels show super-C-C scaling of 9.8%/K for hourly and 9.0%/K for daily precipitation. For temperature above the mean, the scaling for hourly precipitation levels off becoming sub-C-C relationship, while for daily extremes, it immediately turns negative with a rate about \u221218.9%/K. th daily precipitation from the 95th hourly extremes (green). The seasonal mean temperature gives a clear separation between the two different measures of precipitation extremes. Below the mean temperature, the two measures represent the same events: presumably large scale precipitation with duration above six hours. The accumulating process, hence moisture convergence, plays a more important role. For temperature above the mean, the two measures are less likely representing the same process, which are mostly intense convective rainfall with short durations around two hours. If they happen to fall into the same category, those hourly heavy downpours dominate the daily measurement. Using the same estimate of 10\u2009m\u2009s\u22121 for typical low-level winds, those events are raining out moisture content from an atmospheric column with a radius less than 100\u2009km, which are more likely to be accounted for by the C-C argument. Within As shown by refs As can be seen from th percentile daily (R95d) and hourly (R95h) precipitation extremes relationships with seasonal mean surface air temperature for all the 721 stations. With obvious spread due to regionalities, the coherent relationship is clear and robust. Moreover, we now see a good agreement between the scaling rates of daily precipitation extremes with that of hourly.The inconsistency between the scaling rates of precipitation extremes measured by daily and hourly observations with daily mean temperature raises questions about the prevailing popular approaches, in particular the attribution of increasing precipitation to rising temperature under global warming. It also brings in significant uncertainties in future projections of extreme precipitation that have vital implications for climate change impact assessment and adaptation. The physical basis for attributing extreme precipitation to rising temperature is through the indirect C-C argument with moisture holding capacity of the atmosphere. As shown by ref. This study has analysed a large dataset of continuous precipitation records with high spatial (721 weather stations) and temporal resolution (hourly) covering a period of 43 years from 1971 to 2013. This is probably so far the most comprehensive study on summer precipitation extremes employing over 68 million observations. A robust conclusion is that the regionally averaged maximum summer hourly rainfall rate across a large part of China has increased by 11.2%. Hourly and daily precipitation records can lead to very different conclusions, particularly for their temperature dependencies. A neutral point which is the local seasonal mean temperature provides the best environmental climate background linked to moisture supply, for which both daily and hourly extreme precipitation intensities scale with around the C-C rate. Beyond the summer seasonal mean (until 30\u2009\u00b0C), hourly precipitation extremes continue to intensify at a sub-C-C rate while daily precipitation extremes decrease rapidly with rising temperatures. We have inferred that it is probably the extreme convective summer rainfall continues to intensify, but further investigation such as refs An intriguing phenomenon is that the positive correlation between precipitation extremes and surface air temperature is only found within certain intermediate temperature range, beyond which the relationship reverses. This is particularly true with daily extremes and has also been reported in previous studies such as refs http://news.ifeng.com/shendu/nfzm/detail_2013_07/18/27643337_0.shtml). During the period 1971\u20132013, the regional average summer mean temperature across a large part of China has increased by ~0.95\u2009\u00b0C, smaller than the annual mean rise of 1.44\u2009\u00b0C345Urban flooding has seen acceleration over China in recent decades due to rapid urbanization and incapability of outdated drainage systemsData used in this study was provided by National Meteorological Information Center, China Meteorological Administration, including quality controlled daily mean surface air temperature and precipitation38A wet event is defined as such that the precipitation rate is larger than 0.1\u2009mm for both daily and hourly observations. Detailed methods are provided in figure captions for each individual plot. Standard percentile technique is applied for precipitation intensity categories. When calculating precipitation temperature dependencies, a 1\u00b0 bin size is used for temperature. How to cite this article: Xiao, C. et al. Robust increase in extreme summer rainfall intensity during the past four decades observed in China. Sci. Rep.6, 38506; doi: 10.1038/srep38506 (2016).Publisher's note: Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations."}
+{"text": "Theoretically, precipitation extremes will increase at a rate of 6\u20137% with temperature increasing, namely the Clausius-Clapeyron relationship. However, many gauge observations suggest a peak structure of the relationship between precipitation extremes and atmospheric temperature, deviating from the Clausius-Clapeyron relationship. In this study, a comprehensive investigation about the temperature dependence of precipitation extremes  across China is implemented. The results confirm the widespread existence of the peak structure for daily and hourly precipitation extremes and show that (1) there is a generally positive spatial correlation between the precipitation extremes at the peak and temperature at the peak, and this scaling rate is close to the C-C rate; (2) the scaling of event-based extremes for precipitation amount with temperature follows a similar pattern to the daily precipitation extremes while the event-based precipitation intensity does not show a peak structure; (3) the decrease of rain duration is the main cause for the peak structure of the rain amount scaling. Hence, prediction of precipitation, especially for precipitation extremes, is of significant importance to enhance the adaptivity of human beings to climate change. Among all the climate factors, temperature is the one better predicted than the others because of its physical characteristics and more accurate historical records9. Considering the predictability of temperature, predicting precipitation extremes based on the relationship between precipitation extremes and temperature is a feasible way under climate change. Therefore, detecting the fundamental processes of precipitation extremes with temperature is studied all over the world12.Precipitation becomes more unevenly distributed in the warming climate forced by nature and anthropogenic activities. Historical observations and future predictions from global and regional climate models indicate that both the magnitude and the frequency of extreme precipitation increase obviously13. The explanation is that, theoretically, the distribution of relative humidity would remain roughly constant under climate change because of the control on the moisture in the troposphere: moisture condenses out of supersaturated air. In this case, the Clausius-Clapeyron (C-C) relationship implies that specific humidity would increase roughly exponentially with temperature at an approximate rate of 6\u20137% per degree Celsius. Therefore, under the assumption that the precipitation extremes tend to precipitate out all moisture in the rising air13, the relationship between precipitation extremes and atmospheric temperature (Ta) should follow the C-C relationship. However, many studies show that the relationship between precipitation extremes and Ta may not be always consistent with the C-C relationship. Lenderink and Meijaard14 find that the scaling rate is related to temperature in the Netherlands. The scaling rate of the temperature dependence of daily precipitation extremes is similar to the C-C rate at Ta below 8\u201310\u2009\u00b0C and smaller than the C-C rate at higher temperatures, while that of hourly precipitation extremes is larger than the C-C rate (super-CC rate) at high temperatures. In Europe, a seasonality is detected in the temperature dependence of precipitation intensity with a general increase with temperature in winter and a decrease in summer15. Besides, peak structures, resulting from negative proportion in the relationship between precipitation extremes and Ta at higher temperatures, have been detected in many studies all over the world, especially for those areas located in mid-latitudes16. Utsumi et al.16 illustrate that the temperature dependence of daily precipitation extremes exhibited a peak-like structure at mid-latitudes (20\u00b0\u201355\u00b0N and S), and they point out that the decrease in the daily extreme precipitation intensity resulted from the decrease in the duration of the precipitation events. In Australia, Hardwick and Jones17 find that there would be an inflection in the relationship between precipitation extremes and surface temperature when the temperature is between 20\u2009\u00b0C and 26\u2009\u00b0C. They attribute the decrease in precipitation intensity at high temperatures (larger than 20\u201326\u2009\u00b0C) to the decrease in relative humidity. In Canada, based on different duration observations and event-based analysis, Panthou et al.18 find that the duration and the climatic region are important factors that determine the relationship between precipitation extremes and temperature. They find a supper-CC scaling with an upper limit for those short duration observations in inland regions and illustrate that the relative humidity is a limitation for the relationship in inland regions but not for that in coastal regions. In China, the peak-like structures and supper-CC scaling are also found by Miao et al.19. In their work, peak structures of the relationship between hourly precipitation extremes and daily Ta are universal for all the first-class basins in China. The fact that the peak structures exist robustly all over the world probably indicate that there would be an upper limit for future precipitation extremes with the warming climate. However, Wang. et al.13. find that, compared with the historical temperature dependence of daily precipitation extremes, both the peak of extreme precipitation and the peak-point temperature will increase with warming climate, which means that this peak structure does not imply a potential upper limit for future precipitation extremes. As stated above, the relationship between precipitation extremes and Ta have been studied thoroughly, however, the relationship between peak-point extreme precipitation and peak-point temperature, the relationship between event-based precipitation extremes and temperature, and the relationship between precipitation durations and temperature are rarely investigated. The objectives of this paper were to (1) identify the relationship between peak-point precipitation extremes and peak-point temperature; (2) identify the relationship between event-based precipitation extremes and temperature; and (3) identify the relationship between precipitation durations of event-based precipitation extremes and temperature.Some studies point out that the temperature dependence of precipitation extremes is controlled by the Clausius-Clapeyron (C-C) relationship19. There is an abnormal phenomenon that more supper C-C relationship is found in daily precipitation extremes than hourly precipitation extremes, while, in many other studies, the supper C-C relationship is usually found in hourly precipitation extremes more than daily precipitation extremes. This phenomenon may be caused by the different regional climate characteristic (Europe or Asia), the different meteorological data sets (station-based or grid-based) and/or the different spatial scale (a point or a region).The daily and hourly precipitation extremes-Ta relationship are analysed over China. The results show that the temperature dependence of daily and hourly precipitation extremes for most stations  have peak structures. We select 5 stations randomly, one for each climatic zone  over China, to illustrate the relationship curve patterns and the peak structures. Figure\u00a0To detect the relationship between different peak points of different stations, the peak-point precipitation and the corresponding peak-point temperature of all the stations are extracted. It should be noted that those temperature bins having less than 3 extreme precipitation points are ignored to eliminate the effect of anomalous values on the accuracy of the statistic results. The relationship between peak points is illustrated at different spatial scales: climatic zones and China. Figure\u00a020. The \u201cHu line\u201d, starting from Aihui County in the northeast of China to Tengchong City in the southwest of China, divides China into densely-populated rich southeast region and underpopulated poor northwest region. The line is highly consistent with the 400\u2009mm precipitation isoline of China. The spatial distribution of the peak-point precipitation extremes is similar to the distribution of the peak-point temperatures, increasing from northwest to southeast along the normal direction of the \u201cHu line\u201d. The spatial distribution patterns of the peak points verifies the trend shown in Fig.\u00a0The spatial distributions of peak-point temperatures and the peak-point precipitation extremes of daily temporal scale and hourly temporal scale are shown in Fig.\u00a0To explore the generation mechanism of the peak structure of temperature dependence of precipitation extremes, event-based analysis is performed from two perspectives: the relationship between precipitation event amount extremes (PAE) and Ta, and the relationship between precipitation event mean intensity extremes (PIE) and Ta. The temperature dependence of PAE and PIE takes on different trends. The relationship between PAE and Ta have peak structures in almost all the stations, while the relationship between PIE and Ta shows a monotonous increase trend in the overwhelming majority of the stations 88.2%). The spatial distribution of stations that have no peak structures and have peak structures is illustrated in Fig.\u00a0%. The sp21. To figure out the mechanism of the peak structures, the temperature dependence of the duration of PAE and PIE is investigated. As Fig.\u00a0Rainfall duration is a critical factor in distinguishing rainfall types. Generally, large-scale rainfall caused by the slow ascent of air in the synoptic system has long precipitation duration while convective rainfall falls over a certain area for a relatively short timeTo illustrate the difference between PAE and PIE more obviously, The durations of those randomly selected 5 stations above are compared. Figure\u00a022 find that the relative humidity decrease at high temperatures in many regions all over the world and argue that the available moisture is the control factor for the decrease of daily precipitation extremes at high temperatures. However, the mechanism of the interaction with the atmospheric saturation level is not clear - the atmospheric saturation level can be both a cause and a consequence of the extreme precipitation16.Noted that the magnitude of daily precipitation extremes and PAE are almost the same Fig.\u00a0 and the 19 and we take the mid-time temperature as the lateral axis for PIE, the temperature axis of hourly observation extremes and PIE may be different considering the cooling effect of the heaviest precipitation. Taking a 5-hour rainfall as an example, if 2-hour rainfall with much bigger intensity occurs before 24 o\u2019 clock and 3-hour rainfall that has slight intensity occurs in the next day, the temperature of the next day will be used as the lateral axis of PIE and the temperature of the previous day will be used as the lateral axis of hourly precipitation extremes. In this case, the temperature axis of PIE may be not reasonable for the cooling effect of the heaviest precipitation is ignored. In other words, the temperature of PIE used in the statistic method may be higher than the actual one. Some recent studies23 indicate that, to some extent, high-temperature weathers are accompanied by various types of circulation anomaly such as anomalous anticyclone in China. Anticyclonic conditions bring dry weather, reduce relative humidity, and inhibit deep convection24, leading to the decrease of hourly precipitation extremes with warming at very high temperatures. According to the analysis above, the downturn in the scaling of hourly precipitation extremes in China may be caused by following reasons: (1) the cooling effect of the heaviest rainfall, (2) the much more anticyclone bringing hotter and drier weathers.The temperature dependence of PIE shows different trend compared with that of hourly precipitation extremes Fig.\u00a0. PIE shohttp://cdc.nmic.cn/home.do). 20 National stations are used for providing these precipitation and temperature datasets, which is selected from more than 2400 stations in the dataset considering the length of the sequences (longer than 30 years).Hourly precipitation dataset is used in this study, which is provided by the National Meteorological Information Centre of the China Meteorological Administration. Daily mean temperature data is obtained from the SURF_CLI_CHN_MUL_DAY_V3.0 dataset, downloaded from the China Meteorological Data Sharing Service System Pa and Pb are precipitation of time a and time b while Ta and Tb are atmospheric temperature of time a and time b, respectively. r is the scaling rate, of which theory value is 6\u20137% per Celsius degree25.In which, 26. The peak-point temperature and the corresponding precipitation extreme are extracted using the locally weighted regression smoothing (LOWESS) method27. To explore the temperature dependence of precipitation extremes in details, the event-based analysis is performed from two perspectives: one is the relationship between precipitation event amount extremes (PAE) and Ta, and the other is the relationship between precipitation event mean intensity extremes (PIE) and Ta. Precipitation events are usually derived from precipitation observations by specifying a minimum precipitation event amount and a minimum inter event time28. However, Panthou et al.18 indicate that the definition of these two parameters has no significant impacts on the results through a sensitivity analysis of the two parameters. Hence, in this study, we define the precipitation event as the continuous hours when precipitation depth is larger than 0.3\u2009mm simply.The temperature dependence of daily and hourly precipitation extremes is analysed to identify the peak structure in the relationship between precipitation extremes and Ta suggested by many studies13. Then, the resulting statistics are used to explore the relationship between precipitation extremes and Ta.The temperature is first divided into bins with the size of 0.5\u2009\u00b0C. Then precipitation is allocated to bins according to the temperature when it occurs. Within each Ta bin containing more than 50 data points, the 99th percentile of precipitation is estimated. For each temperature bin, the precipitation exceeding the 99th percentile is averaged and paired with the temperature of the middle of the bin. Those bins with data point less than 50 are discarded. The resulting extremes corresponding to different bins are then smoothed with 3-bin moving window averaging"}
+{"text": "The cognitive changes in PD are characterized by a frontal-subcortical impairment with decreased attention and executive function leading to progressive impairment in prefrontal tasks, visuospatial skills, and memory. Still, 20 to 25% of PD-ND patients may exhibit a pattern of cortical impairment with memory tasks and confrontation naming defects, and cognitive findings associated with cortical pathology, such as language errors, develop in many patients with PD with dementia (PDD) .This impairment is common to some degree even in nondemented Parkinson's disease patients (PD-ND) and eventually progresses to dementia in 24 to 31% of patients  .The identification of the biomarkers for cognitive impairment in patients with PD will allow better assessment of the patients' prognosis. Some genes, such as apolipoprotein E (ApoE) and microtubule-associated protein tau (MAPT), are of particular interest because of their known association with dementia in other neurodegenerative diseases, such as Alzheimer's disease (AD) and atypical parkinsonian syndromes, including progressive supranuclear palsy and corticobasal degenerationThe aim of this study is to determine the role of genetic factors associated with cognitive decline in Parkinson's disease (PD). We examined whether variations in apolipoprotein E (ApoE) and microtubule-associated protein tau (MAPT) genotypes are associated with cognitive decline in PD.The current study is a pilot study. In this pilot study, we applied a prospective design, to evaluate cognitive changes between groups defined by genotype differences. .This study included 50 patients recruited from neurology outpatient clinic and Neurology Department in Kasr AL-Ainy Hospital, Cairo, Egypt, who fulfilled the criteria for diagnosis of idiopathic Parkinson's disease based on British Brain Bank criteria ; patients with Geriatric Depression Scale (GDS) \u2265 10; patients with evidence from the history, physical examination, or investigations for any concomitant medical or metabolic illness known to affect cognition, e.g., thyroid, parathyroid, hepatic, and renal disease; patients with marked tremor, which interferes with the imaging session and produces movement artifacts, were excluded.Exclusion criteria: patients with secondary parkinsonism  or atypical parkinsonism; patients with severe dementia MMSE <11 or with major language disturbance and severe physical, auditory, or visual impairment affecting their ability to complete testingAfter assessment of cognitive functions by Mini-Mental State Examination and Parkinson's Disease-Cognitive Rating Scale (PD-CRS), the patients were divided into 2 groups; Group I included 14 patients with IPD and no cognitive impairment; Group II included 36 patients with IPD and cognitive impairment. Cognitive impairment was considered if there was an abnormality in more than one cognitive domain, representing a decline from premorbid level.The study was approved by Neurology Department Board in Cairo University and follows the principles outlined in the Declaration of Helsinki. Verbal informed consent was obtained from all patients prior to the commencement of the study after a structured interview clarifying the aim and steps of the study.All patients in this study were submitted to the following: thorough history taking and neurological examination according to the standardized sheet of Neurology Department, Kasr Al-Ainy Hospital. Unified Parkinson's Disease Rating Scale (UPDRS) in which there are decreased attention and executive function together with the impairment in visuospatial skills and memory.The MMSE score in our study patients ranged from 12 to 30. In group I, the mean MMSE decreased by 0.93 points in 3 months, while in Group II the mean MMSE decreased by 0.73 points in 3 months (a nonsignificant difference). Cognitive impairment in PD has been clearly reported in the medical literature. The exact pattern of this impairment and its frequency are still a subject of considerable controversy. In our study, the mean PDCRS frontosubcortical change was 2.12 points compared to the mean PDCRS posterior-cortical change which was 0.96 points in all patients after 3 months of follow-up. The frontosucortical patterns of cognitive impairment in PD patients were also recognized by Dubois et al. (1991) did not find significant association between increasing age and cognitive impairment in patients with PD. They attributed this to the effect of the degenerative process in PD which may be more prominent than the effect of aging on cognitive functions. Caviness et al. (2007)  and Verb a trend for a significant role of disease duration in developing cognitive impairment in patients with PD.In the current study, a negative correlation is observed between the age of onset of PD symptoms and PDCRS in group I  and Group II . .UPDRS has been the most widely used scale to measure impairment and disability in PDThe UPDRS  score in patients of this study ranged from 10 to 72. In Group I, the mean UPDRS increased by 5.14 points after 3 months of follow-up. In Group II, the mean UPDRS increased by 3.98 points after 3 months of follow-up. A statistically significant difference was observed between Groups I and II as regards the UPDRS at baseline assessment and after 3 months of follow-up . Campos et al., 2015 for factors predicting dementia, they found that motor performance as assessed by the (UPDRS-Part III) was a strong predictor, whereas, neither age nor Hoehn and Yahr scale (H&Y) scoring was predictors . On the contrary, Stavitsky et al. (2011) found that UPDRS  and sleep did not predict a future memory decline [In a study performed by decline . Muslimovic et al., 2005 , Verbaanand Aarsland et al., 2010 [ Cooper et al. 1991 and Abo-El-Naga 2006  failed to establish a relationship between motor function and cognitive impairment in patients with PD. The investigators defended their findings by concluding that cognitive dysfunction in early PD patients reflected neuropathological changes that are distinct from those responsible for the motor disorder.In this study, the decline in cognition after 3 months in Group I patients was 4.14 points (in PDCRS) in relation to worsening of motor symptoms by 1.85 points (in UPDRS III) and in Group II patients where decline in cognition was 2.67 points (in PDCRS) in relation to worsening of motor symptoms by 0.75 points (in UPDRS III); an inverse relationship is observed between UPDRS III (motor) and PDCRS , as the UPDRS III score increases (motor symptoms worsen) the PDCRS score decreases (cognitive symptoms worsen). A statistical significant correlation between UPDRS III and PDCRS   in all PD patients was in agreement with studies byl., 2010  who repol., 2010 . On the  .There is a continuous search for biological markers of cognitive dysfunction in Parkinson's disease, which encouraged the investigation of the genetic effect; some of the studied genes were previously reported to be associated with cognitive impairment in PD, through affecting the dopaminergic systems. Other genes, ApoE and MAPT, are of particular interest because of their known association with dementia in other neurodegenerative diseases, such as Alzheimer's disease (AD) and atypical parkinsonian syndromes, including progressive supranuclear palsy and corticobasal degeneration MAPT H1 haplotype as a risk factor for cognitive impairment in PD. All PD patients in our study were genotyped for MAPT polymorphism. In Group I, the H1/H1 haplotype (n=7) represents 50%, while in Group II the H1/H1 haplotype (n=5) represents a much smaller proportion 13.9% to other haplotypes (n=31) which represent 86.1%. A statistical significance was found between different haplotypes  among Groups I and II patients. Contrary to our findings, Ezquerra et al.  found no difference in H1 frequency between PD patients with and without dementia. The results of the current study showed a faster rate of decline in MMSE scores in individuals with the MAPT H1 variant. Although no statistical significance was found between change in MMSE and MAPT haplotypes, yet, the mean MMSE change was higher in patients with MAPT H1/H1 haplotype compared to those with other haplotypes, being 1.14 (group I) and 1.40 (Group II) points in the former and 0.75 (group I) and 0.61 (Group II) points in the later. A longer follow-up with such decline rates might show a significant decline in MMSE score in MAPT H1/H1.Relatively few studies examined the Williams-Gray et al., 2009 , which included a cohort of 122 PD patients who were followed up for 5 years; they found that MAPT-H1 haplotype was associated with a more rapid decline in Mini-Mental State Examination score and was a significant risk factor for conversion to dementia. On the contrary, Morley et al. (2012)  did not find a significant association between MAPT haplotype and rates of cognitive decline.We also concluded that the changes in PDCRS frontosubcortical, PDCRS posterior-cortical, PDCRS total were worse in the MAPT H1/H1 haplotype compared to other haplotypes as measured by PDCRS without statistical significance. These results are similar to some extent to a study conducted by\u03b54 carrier (n=7) represents 50% which is equal to \u03b54 noncarrier (n=7) which represent 50% in PD patients without cognitive impairment, while, in Group II, the \u03b54 carrier (n=15) represents smaller proportion, 41.7%, to \u03b54 noncarrier (n=21) which represents 58.3%.In this study, the \u03b54 carrier than with \u03b54 noncarrier where a statistical significance was found between change in PDCRS and ApoE \u03b54 carrier/noncarrier as the mean PDCRS total change by 7.43 (in Group I) and 6 (in Group II) points in \u03b54 carrier and by 0.86 (in Group I) and 0.29 (in Group II) points in \u03b54 noncarrier. Harhangi et al., 2000 ; Parsiancame with similar results. In contrast, other studies as Williams-Gray et al., 2009 ; Ezquerrand Ryu and kwon, 2010  failed to find a correlation.We found that worsening of cognition was more with ApoE  Morley et al., 2012 [The observed association between ApoE and cognitive decline may not be specific to PD and it could be observed in otherwise healthy older individuals. This was previously discussed byl., 2012  who coul\u03b54 carrier and/or MAPT H1/H1. PD patients with ApoE \u03b54 carrier or MAPT H1/H1 represent larger proportion (75%) compared to PD patients with both ApoE \u03b54 carrier and MAPT H1/H1 (n=7) represents 25%. A statistical significance was found between change in MMSE  and ApoE \u03b54 carrier and MAPT H1/H1. A statistical significance was found between change in PDCRS frontosubcortical , PDCRS total , and carriers of both ApoE \u03b54 and MAPT H1/H1 with scores of cognitive functions being worse with carriers of both ApoE \u03b54 and MAPT H1/H1 more than carriers of either ApoE \u03b54 or MAPT H1/H1.In conclusion, patients in Group I with no cognitive dysfunction showed statistically significant worsening in PDCRS frontosubcortical but not in PDCRS posterior-cortical, while patients in Group II with cognitive dysfunction showed significant worsening in PDCRS frontosubcortical and PDCRS posterior-cortical, and this result of early involvement of the frontosubcortical tests rather than posterior-cortical which is affected later in the disease with development of dementia. In this study, 27 PD patients have ApoE"}
+{"text": "Salmonella (NTS), Vibrio spp. and their associated antimicrobial resistance (AMR), in shrimps locally purchased in Ho Chi Minh City (Vietnam). In addition, we investigated the relationship between AMR in NTS, Vibrio spp. and antimicrobial residue in the same sample. A total of 40 samples of shrimp heads/shells from different retail sources was cultured using ISO 6579\u20131:2017 (NTS) and ISO/TS 21872\u20131:2007 (Vibrio spp.). Phenotypic antimicrobial susceptibility was investigated using Vitek  and disk diffusion . A total of 9 (22.5%) samples contained antimicrobial residue, including tetracyclines, fluoroquinolones, sulfonamides and macrolides . Shrimp samples from supermarkets had a higher prevalence of antimicrobial residue than those purchased in street markets (50% vs. 13.3%) (p\u202f=\u202f0.049). A total of 30 (75%) samples were contaminated with NTS. All samples contained Vibrio spp., with V. parahaemolyticus being most common (87.5% samples). A total of 58.9% NTS isolates were multidrug resistant. With regards to the highest priority, critically important antimicrobials, the highest resistance corresponded to quinolones (14.4\u201347.8%), followed by 3rd and 4th generation cephalosporins (3.3\u20137.8%). Vibrio spp. isolates were characterised by their high resistance against ampicillin (82.7%) and 3rd generation cephalosporins (8.3\u201316.5%). Extended Spectrum Beta-Lactamase (ESBL) activity was detected in 28.1% V. parahaemolyticus isolates. Half of ESBL-positive V. parahaemolyticus strains harboured blaCTX-M1. We found an association between the presence of residues and the number of resistances for NTS (p\u202f=\u202f0.075) and Vibrio spp. isolates (p\u202f=\u202f0.093) from the same sample. These findings suggest that the presence of residues may contribute to the selection of AMR in foodborne pathogens in shrimps. Authorities should strengthen policies aiming at restricting inappropriate antimicrobial usage in shrimp farming, and step up monitoring of antimicrobial residues and food-borne pathogens at retail in Vietnam.We investigated antimicrobial residues, non-typhoidal  \u2022Highest prevalence of antimicrobial residues found in shrimps from supermarkets.\u2022Salmonella (NTS).75% samples were contaminated with non-typhoidal \u2022Isolates from samples with antimicrobial residues had highest prevalence of phenotypic resistance.\u2022V. parahaemolyticus isolates.Extended Spectrum Beta-Lactamase activity detected in 28.1%  Among oSalmonella (NTS) and certain Vibrio spp. are major microbiological hazards associated with shrimp and seafood consumption  and tdh-related hemolysin (trh) are considered major virulence factors of this micro-organism . In 2017, shrimp exports made up about half of the total Vietnam seafood exports, with sales worth 3.8 billion US$ .Vibrio spp.; and (2) to characterise the AMR profile of these organisms, including the presence of Extended Spectrum Beta-Lactamases (ESBL) and colistin resistance. In addition we investigated the relationship between the presence of AMR in the two bacterial species and antimicrobial residues in the same batches, which to our knowledge has not been previously investigated.Shrimp exports are regularly screened for their microbiological safety by the companies themselves. However, little is known about the microbiological safety of shrimps available for domestic consumption. Therefore, the aims of this study were: (1) to investigate major foodborne hazards associated with shrimps from local retail sites in Ho Chi Minh City (HCMC), Vietnam, such as antimicrobial residues, NTS and 22.1per batch were weighted using precision scales. Shrimp species were identified based on their morphological features. Using a pair of sterile scissors, the heads, legs and exoskeleton were separated from the muscle tissue, and were subsequently pooled (shell mix). Muscle tissue samples were investigated for the presence of antimicrobial residues, and the shell mixes were investigated for NTS and Vibrio spp.Batches of shrimps (250\u2013300\u202fg each) were purchased from 40 different retail sites located in 10 districts of HCMC (Vietnam) from March to June 2018. In order to maximize the diversity of sources, from each district three street markets and one supermarket were selected. From each retail site, one batch of live or dead shrimps  was purchased. Shrimps were collected into a clean plastic bag, and were transported to the laboratory within 2\u202fh in an ice-containing box. Five representative specimens 2.2Bacillus stearothermophilus spores. Positive or inconclusive result samples were then examined for the presence of macrolides, amphenicols, tetracyclines, \u03b2-lactams and sulfonamides antimicrobial classes, as well as for the presence of chloramphenicol, streptomycin and gentamicin/neomycin using a Charm II analyzer 7600  , an assay based on the inhibition growth of es, USA) . Samples2.3Vibrio spp. using a modification of the ISO/TS 21872\u20131:2007 method. Briefly, the steps were: (1) 25\u202fg of the shell mix was suspended in 225\u202fmL of alkaline saline peptone water (ASPW) at 41.5\u202f\u00b0C for 24\u202fh; (2) a loop of enrichment was cultured on thiosulfate citrate bile and sucrose agar  at 37\u202f\u00b0C for 24\u202fh. Four suspected Vibrio spp. isolates from each sample were confirmed by MALDI-TOF.The shrimp shell mixes were investigated for NTS using a modified ISO 6579\u20131:2017 method. Briefly, from each sample 25\u202fg of homogenized shell mix was pre-enriched in 225\u202fmL buffered peptone water  at 37\u202f\u00b0C for 18\u202fh. A loop of pre-enrichment media was then inoculated on Modified Semi-solid Rappaport-Vassiliadis , and incubated at 41.5\u202f\u00b0C for 24\u202fh. and positive growth was further inoculated on chromogenic Rambach agar  and incubated at 37\u202f\u00b0C for 24\u202fh . Matrix-2.4Vibrio spp. isolates were tested using the disk diffusion method for 12 antimicrobials representative of eight classes . The full list of antimicrobials investigated is displayed in Vibrio spp. isolates were classified as susceptible, intermediate or resistant according to CLSI guidelines    (33 antiio spp.) . A straiio spp.) . Antimicio spp.) .2.5aroC, dnaN, hemD, hisD, purE, sucA and thrA  and a tdh-related hemolysin gene (trh) was investigated by PCR in all Vibrio spp. isolates , blaTEM, blaSHV, and blaOXA genes  was investigated by multiplex PCR  among phenotypic colistin-resistant isolates was investigated by multiplex PCR  allowed determining a prevalence of MDR of \u223c27% (based on published data) with a 95% level of confidence and a 9% relative precision. The prevalence of contamination and resistance across variables was compared using chi-square tests. The level of agreement between presence of residues and presence of intermediate (or resistant) isolates in each shrimp batch sample was investigated using the kappa statistic.33.1Litopenaeus vannamei) (30)  1.2\u202fcm length), giant tiger shrimp (Penaeus monodon) (5) , banana shrimp (Penaeus merguiensis) (3) , greasy-back shrimp (Metapenaeus ensis) (1) , and giant prawn (Macrobrachium rosenbergii) . The descriptive data for the samples investigated, and the prevalence of PremiTest, NTS and Vibrio spp. sample positivity results are shown in The 40 batches investigated included specimens of five shrimp species: white leg shrimp . Four of the nine PremiTest-positive samples were positive by Charm II, whereas the remaining five tested negative .Antimicrobial residues were detected in 9/40 (22.5%) samples by PremiTest. Shrimp samples from supermarkets had a higher prevalence of antimicrobial residues than those purchased in street markets (50% vs. 13.3%) . There was lower probability of recovering NTS from PremiTest-positive samples than from PremiTest-negative samples (5/9 vs. 25/31), although this difference was not significant . MLST was performed on 62 isolates with a unique serogroup-antimicrobial susceptibility pattern. The remaining 28 isolates were assigned to serovar based on MLST results of isolates recovered from the same sample and with the same serogroup-AST pattern. A total of 28 MLST sequence types (ST) corresponding to 25 NTS serovars were identified. One NTS strain (Group B) could not be assigned to ST, and therefore its serovar identity was not determined , followed by V. navarrensis (60%), V. alginolyticus (52.5%), V. cholerae non-O1 (37.5%), V. vulnificus (22.5%) and V. fluvialis (10%)  shrimp batches . The pretermined . The mosis (10%) .3.4Among highest priority-critically important antimicrobial classes, the highest prevalence of resistance corresponded to quinolones  (range 14.4\u201347.8%), followed by 3rd and 4th generation cephalosporins  (3.3\u20137.8%). Among high priority-critically important antimicrobials, resistance was highest against aminoglycosides (16.7% gentamicin and 7.8% tobramycin), monobactams (7.8% aztreonam), and glycylcyclines (3.3% tigecycline) , Table C3.5Vibrio spp. against 12 antimicrobial drugs are shown in V. parahemolyticus and V. alginolyticus isolates were fully resistant to ampicillin. The prevalence of resistance against amoxicillin-clavulanic, penems, aminoglycosides, tetracyclines, quinolones and phenicols was <11.3% in all cases. A total of 18/64 (28.1%) V. parahaemolyticus were ESBL producers; however none (0%) of the 69 non-V. parahaemolyticus strains were ESBL producers. Overall, 18 of 133 (13.5%) Vibrio spp. isolates were MDR, but this percent was 28.1% among V. parahemolyticus, and 0% among other Vibrio species.Results of antimicrobial susceptibility testing of 133 of 3.6Vibro spp. isolates tested positive for either the tdh or trh genes.None of the 133 3.7blaCTX-M9. The three serovar Give isolates tested positive for both blaCTX-M1 and blaTEM. Interestingly, all isolates were fully susceptible to cefepime and cefoxitin. A total of 9/18 (50%) ESBL-positive V. parahaemolyticus strains were positive for blaCTX-M1. In addition, one of these isolates tested positive to the blaTEM gene.The phenotypically ESBL-positive serovar Branderup isolate tested negative for all ESBL genes investigated. All three serovar Infantis isolates (from the same sample) were positive for 3.8Vibrio spp. isolates from PremiTest-positive samples (n\u202f=\u202f29) were resistant to a median of 1 [IQR 1\u20134] antimicrobial, compared with 1 [IQR 1\u20132] among Vibrio spp. from PremiTest-negative samples (n\u202f=\u202f104)  . In addition, there was a moderate agreement between samples that contained ESBL-positive Vibrio spp. and ESBL-positive NTS isolates   were resistant to a median of 10 antimicrobials [IQR 3\u201313], whereas NTS isolates from samples testing negative (n\u202f=\u202f75) were resistant to 5 antimicrobials [IQR 0\u20139] . =\u202f0.093) . We foun<\u202f0.001) . However4Vibrio spp. (100%). This result is in line with a previous survey of shrimps from local markets in the Red River and Mekong Delta regions of Vietnam  , NTS (75%), and ctively) , but higctively) . Howeverctively) , althougctively)  that wasctively) . A surprctively) . The obsctively) . A recenctively) . In contctively) .We found a considerable serovar diversity (25) of NTS in our samples, with serovars Braenderup, Anatum, Saintpaul and Rissen accounting for 46.7% of all NTS isolates. Most serovars detected in shrimps have been isolated in outbreaks of human disease in different countries. A study from 2004 on 56 human clinical  in Vietnam identified 12 different serovars , of whicVibrio spp., being V. parahaemolyticus the most prevalent species (87.5% samples). Other Vibrio species were isolated in 10.0\u201360.0% samples. These levels of contamination are comparable with studies in northern Vietnam   in any of the 133 Vibrio spp. isolates. Previous research in Malaysia has shown a low prevalence of tdh (4%) and trh (12%) genes in non-clinical V. parahaemolyticus isolates  retail shrimp samples were contaminated with valence)  and Malavalence) , althougvalence) , confirmironment . In addi disease . We did isolates . In a stectively . Howeverectively , Hong Koectively , or Sri ectively . In the reported . It was rh genes .Vibrio spp. isolates were resistant to ampicillin . This prevalence was comparable to published resistance levels among V. parahaemolyticus isolates from shrimps in northern Vietnam (87%) and Malaysia (82%)  . A totalBL genes . InteresVibrio spp. in the same samples. This may be a reflection of AMR selection during the farming process, or may alternatively reflect post-harvesting contamination. The latter would be likely if the antimicrobial residue in the sample contributed to preferentially select for contamination with more resistant strains.The study confirmed the association between presence of antimicrobial residues and phenotypic resistance in NTS and Vibrio spp. among shrimps purchased in retail sites in HCMC. We found a high prevalence of MDR among NTS, with worryingly high levels of quinolone resistance. Although most Vibrio spp. isolates are unlikely to be pathogenic, the high carriage levels of ESBL in V. parahaemolyticus is of concern. We recommend authorities to enforce existing policies aiming at restricting inappropriate antimicrobial usage on shrimp farms, stepping up hygiene conditions during harvesting, transporting and retailing of shrimps, and to establish monitoring of antimicrobial residues, NTS and Vibrio spp. (focused on ESBL and virulence factors) in Vietnam. These findings should encourage the establishment of microbiological surveillance systems focused on health hazards in aquaculture food products, as well as strengthening laboratory capacity to enable comparisons between NTS and Vibrio spp. isolates from shrimps and human cases of disease.This study provides evidence of high levels of contamination with antimicrobial residues, NTS and The authors declare no conflict of interest."}
+{"text": "In vitro synergy between the CDK9 inhibitor and radiation was evaluated by clonogenic assay. In vivo synergy between the CDK9 inhibitor and radiation was assessed in multiple xenograft models including a patient\u2019s tumor derived xenograft (PDX). Reverse phase protein array (RPPA), western blotting, immunohistochemistry, and qPCR were utilized to identify and validate targets of the CDK9 inhibitor. The CDK9 inhibitor plus radiation significantly reduced growth of FLO-1, SKGT4, OE33, and radiation resistant OE33R xenografts and PDXs as compared to the cohorts treated with either single agent CDK9 inhibitor or radiation alone. RPPA identified Axl as a candidate target of CDK9 inhibition. Western blot and qPCR demonstrated reduced Axl mRNA (p = 0.02) and protein levels after treatment with CDK9 inhibitor with or without radiation in FLO-1 and SKGT4 cells. Axl protein expression in FLO-1 xenografts treated with combination of CDK9 inhibitor and radiation was significantly lower than the xenografts treated with radiation alone (p = 0.003). Clonogenic assay performed after overexpression of Axl in FLO-1 and SKGT4 cells enhanced radiosensitization by the CDK9 inhibitor, suggesting dependency of radiosensitization effects of the CDK9 inhibitor on Axl. In conclusion, these findings indicate that targeting CDK9 by BAY1143572 significantly enhances the effects of radiation and Axl is a novel downstream target of CDK9 in esophageal adenocarcinoma.Cyclin-dependent kinase 9 (CDK9) transcriptionally regulates several proteins and cellular pathways central to radiation induced tissue injury. We investigated a role of BAY1143572, a new highly specific CDK9 inhibitor, as a sensitizer to radiation in esophageal adenocarcinoma.  The incidence of adenocarcinoma of the esophagus and gastro esophageal junction has rapidly increased in the USA and other western countries over past 30 years , 2. MajoCyclin dependent kinase (CDK) 9 is a promising target to enhance radiosensitization \u201316. PrevPreviously, we showed that CDK9 inhibitors exert dose-dependent anti-proliferative effects against 6 esophageal adenocarcinoma cell lines . RadioreSF0.1) in FLO-1 cells , followed by radioresistant OE33R cells , SKGT4 cells  and radiosensitive OE33 cells   .p = 0.01) and 42% smaller than that of xenografts treated with the CDK9 inhibitor only (p = 0.05).The treatment cohorts and dosing regimen are shown in p = 0.03) and 98% (p = 0.02) smaller than that of the control arm (p = 0.005) and 85% smaller than that of xenografts treated with the CDK9 inhibitor only (p = 0.06). The mice showed no significant signs of toxicity throughout the treatment period .Slow growing SKGT4 xenografts  respondetrol arm . The meap = 0.005) and 100% (p = 0.005) smaller, respectively, than that of control xenografts (p< 0.001) smaller, respectively, that that of control xenografts (p = 0.01) in OE33R xenografts. The mean volume of the CDK9 inhibitor-plus-radiation\u2013treated xenografts was 100% smaller than that of xenografts treated with radiation only or CDK9 inhibitor only in OE33 cells.Growth inhibition of radiation-na\u00efve OE33 xenografts was evident from the onset of treatment with CDK9 inhibitor or radiation. At day 21, the mean volumes of OE33 xenografts treated with 12.5 mg/kg CDK9 inhibitor or 12.5 mg/kg CDK9 inhibitor plus a total of 8 Gy of radiation were 94% (nografts . At day nografts . The meaThe mice showed no significant signs of toxicity throughout the treatment period .p = 0.037 compared to radiation alone).Tumor cell necrosis in xenografts can be due to cytotoxic effects of the treating agents or due to tumor cells outgrowing the vascular supply. It is not possible to differentiate ischemic necrosis or drug induced cytotoxicity in cell line derived xenografts due to lack of stromal elements. To normalize the tumor cell necrosis to the rate of tumor growth, we assessed percentage of tumor necrosis divided by the tumor growth rate (mm/day) to deduce necrosis induced by the treatment. As shown in p = 0.016) and by 48% compared with the CDK9 inhibitor alone (p = 0.062)   and 4C. = 0.062) , 5 of 8 p = 0.002), radiation (p = 0.002), and CDK9 inhibitor (p = 0.009) groups.PDXs have patient tumor stroma in contrast to cell line\u2013derived xenografts; therefore, it was possible to assess treatment-induced stromal fibrosis in PDXs. The median percent tumor fibrosis for control, CDK9 inhibitor-, radiation-, and combination-treated cells were 15, 10, 20, and 30, respectively . Tumor gin vitro and in xenograft samples. Owing to technical challenges in obtaining reasonable downregulation of CDK9 by shCDK9 in FLO-1 and OE33 cells, we generated shCDK9-mediated genetic downregulation in SKGT4 and ESO26 cells. Genetic downregulation of CDK9 in both SKGT4 and ESO26 cells significantly lowered Axl protein expression compared to their control counterparts , 8 hours after treatment with BAY1143572 (0.5 and 1\u03bcM), as compared to control in FLO-1 and SKGT4 cells. However, at 24 hours, 1\u03bcM BAY1143572 treated FLO-1 and SKGT4 showed slight downregulation of Axl protein as compared to the control. BAY1143572 (0.5 and 1\u03bcM) decreased Axl RNA in FLO-1 and SKGT4 cells compared to control cells (p< 0.05) at 24 hours after treatment. Axl was further downregulated 48 hours after treatment with CDK9 inhibitor  at the protein and mRNA level  and 4B. nhibitor , confirmnhibitor .Radiation alone reduced Axl protein expression at 48 hours. CDK9 inhibitor in combination with radiation further downregulated Axl and MCL-1 in FLO-1, and SKGT4 cells.p< 0.05, and CDK9 inhibitor plus radiation modestly decreased Axl RNA more than either treatment alone did  H-scores of Axl staining on xenografts treated with radiation or the CDK9 inhibitor alone were significantly lower than that of the control xenografts (SF0.1) and 50% (DERSF0.5) in FLO-1 Axl cells  compared to its control FLO-1 RFP cells . Similarly, BAY1143572 exhibited higher degree of sensitization in SKGT4 Axl cells  compared to its control SKGT4 RFP   .This study provides strong evidence of efficacy of a novel CDK9 inhibitor in preclinical models of esophageal adenocarcinoma, supporting a role of targeted inhibition of CDK9 as sensitizer to the radiation in a clinical trial of esophageal adenocarcinoma.in vivo compared to other CDK9 inhibitors. These pharmacologic properties distinguish BAY1143572 from other CDK9 inhibitors in terms of potency, drug safety, and tolerability and enabled BAY1143572 to be the first highly selective PTEFb/CDK9 inhibitor to enter phase 1 clinical trials (NCT01938638 and NCT02345382) ) or CDK9 inhibitor. Five hours after treatment, the cells were irradiated with 0, 2, 4, 6, or 8 Gy. Twenty-four hours after radiation treatment, the medium was changed, and the cells were maintained in the normal culture conditions. Between days 12 and 20, the medium was removed, and cell colonies were stained with crystal violet (0.1% in 20% methanol) (Sigma-Aldrich) . Colonieeviously .http://bonsai.hgc.jp/~mdehoon/software/cluster/software.htm) with Pearson correlation and a center metric was used to hierarchically cluster data. The resulting heatmap was visualized with Treeview (http://www.eisenlab.org/eisen/) and presented in a high-resolution bmp format.Cells were treated with 1 \u03bcM CDK9 inhibitor for 30 hours. Cell lysates were analyzed for protein expression by RPPA at our institutional Functional Proteomics Core Facility , 42. Clu6 cells into the mice\u2019s contralateral hind legs (FLO-1 in right hind leg and SKGT4 in left hind leg or OE33 in right hind leg and OE33R in left hind leg). 21 days after treatment initiation mice were euthanized and tumor tissues were harvested. Tumor volume was calculated as (W2 \u00d7 L)/2, where W is the smallest diameter of tumor and L is the largest diameter of tumor. Ratio of tumor volume to baseline was calculated for further analysis. The patient derived xenografts (PDXs) were established from a 3-cm subcutaneous metastatic mass from a 45-year-old patient with stage IV esophageal adenocarcinoma [Four-week-old female athymic nude mice were used for xenograft studies. All experiments involving mice were conducted according to an animal experimental protocol approved by Institutional Animal Care and Use Committee. To assess the radiosensitizing effects of CDK9 inhibitor, we subcutaneously injected 5 \u00d7 10arcinoma . Signs oPercentage of tumor cell necrosis and/or stromal fibrosis was assessed in formalin-fixed, paraffin-embedded tumor section stained with H&E. Axl immunohistochemistry was performed on formalin fixed paraffin embedded tissue samples by Axl rabbit monoclonal antibody  with 15 minutes incubation at room temperature. Endogenous peroxidase activity was blocked by 3% hydrogen peroxidase. The immunoreactive protein was visualized with the Ventana DAB detection system . The tumor cells with Axl membranous staining intensity scores of 0, 1, 2, or 3 in 10 fields were counted at 200x magnification. H-score was calculated as sum of the percentage of tumor cells with 0 intensity \u00d7 0 + the percentage of tumor cells with staining intensity 1 \u00d7 1 + the percentage of tumor cells with staining intensity 2 \u00d7 2 + the percentage of staining intensity 3 \u00d7 3.Negative control lentivirus (# LVP-Null-RP) and lentiviral particles with a blasticidin-RFP marker expressing the human gene Axl (# LVP124) were purchased from Amsbio. For transduction with lentivirus, cells were infected with 2\u00d7 diluted virus media containing 6 \u03bcg/ml polybrene for 16 hours. RFP positive cells stably overexpressing Axl were selected by flow cytometry twice. The expression of Axl was confirmed by Western blotting. Cells with negative control were named as FLO-1 RFP and SKGT4 RFP cells while cells stably overexpressing Axl were called FLO-1 Axl and SKGT4 Axl cells.in vitro experiment was repeated at least 3 times. For each assay, the one-sided Student t-test is used to assess differences between groups. Data is presented as mean \u00b1 standard error, and p value < 0.05 is considered significant.Each"}
+{"text": "The adenoviral E1A protein induces cell proliferation, transformation, andtumor formation in rodents, on the one hand. On the other hand, E1A expressionincreases cell sensitivity to a number of cytotoxic agents. Therefore, E1A is acandidate for use as a component of combination therapy for malignant tumors.The highest augmentation in the cytotoxic effect was achieved by a combined useof E1A expression and histone deacetylases (HDAC) inhibitors. However, HDACinhibitors do not induce apoptosis in cells transformed with E1A and cHa-rasoncogenes. In this study, it was shown that HDAC inhibitors reduce theexpression of adenoviral E1A. However, under unregulated E1A overexpression,these cells undergo apoptosis in the presence of HDAC inhibitors. Treatmentwith a HDAC inhibitor, sodium butyrate (NaBut), was shown to activate theanti-apoptotic factor NF-kB in control cells. However, NaBut was unable tomodulate the NF-kB activity in E1A overexpressed cells. Therefore, it is fairto postulate that cells transformed with E1A and cHa-ras oncogenes avoid theapoptosis induced by HDAC inhibitors thanks to a NaBut-dependent decrease inE1A expression. The E1A gene of human adenovirus type 5 is an early response gene that isexpressed in infected cells and provides the necessary conditions for virusreplication , 3. It wThe transforming activity of E1A is determined by its ability to deregulate thecell cycle by binding to and altering the activity of such cellular factors aspRb family proteins -7 and thAdenoviral E1A promotes apoptotic cell death by modulating the expression ofthe genes regulating apoptosis -19, the ras oncogene, which activates theanti-apoptotic PI3K/Akt cascade and NF-\u03baB via the stimulation of theRas/Raf/MEK/ERK kinase cascade [The level of apoptosis in cells expressing E1A can be reduced by thecomplementary transforming  cascade . Theant cascade . Thus, t cascade .Histone deacetylase inhibitors (HDIs) inhibit tumor cell growth, thus causingcell cycle arrest, senescence, or apoptosis, without having a toxic effect onnormal cells , 26. ThecHa-Ras and E1A oncogenes [cHa-ras to avoid death underthe action of HDIs is due to the HDI-dependent decrease in E1A expression andactivation of the NF-\u03baB anti-apoptotic factor. Therefore, induction ofapoptosis in E1A+Ras-transformed cells by HDIs is possible only underunregulated E1A expression.We have previously shown that HDIs cause cell cycle arrest and senescence ofcells transformed by ncogenes -29but dncogenes , 26. TheCell linescHa-ras and with p1Aplasmid that contained nucleotides 1\u20131634 of the genome of humanadenovirus type 5 encoding the E1A protein [Our studies were performed using mouse embryonic fibroblasts that had beenstably transformed with a vector encoding  protein . Cells wCell distribution according to DNA content2 HPO4 , 1.5 mM KH2 PO4 , pH7.2), permeabilized with saponin at a final concentration of 0.01% for 20 min,and repeatedly washed with the PBS solution to remove saponin. The cells werethen incubated with RNase A (100 \u00b5g/mL) and propidium iodide  and analyzed on a Coulter Epicks XL flowcytometer .The distribution of cells by DNA content was studied by flow cytometry. Thecells were washed with a PBS solution -2,5-diphenyltetrazolium bromide (MTT) (Sigma) toinsoluble purple formazan. The cells were incubated in a MTT solution in PBS ata final concentration of 0.5 mg/mL (1.5 h at 37\u00b0C in a CO2incubator). The culture medium was then removed, and the cells were suspendedin dimethyl sulfoxide (DMSO). The optical density in each well was determinedat a wavelength of 570 nm using a Multiscan-EX plate reader (Labsystems). DMSOwas used as a blank control.Cell viability was measured by MTT assay. The cells were plated in 96-wellplates at a density of 2 \u00d7 10Protein immunoblottingThe cells were lysed in a buffer containing 1% NP40, 0.5% sodium deoxycholate,0.1% sodium dodecyl sulfate (SDS), protease, and phosphatase inhibitors.Proteins were separated by electrophoresis, transferred to a PVDF membrane(Millipore), and analyzed using the appropriate specific antibodies. Proteinson the membranes were detected using the enhanced chemiluminescence method. Antibodies raised against E1A (M73) proteins , Gapdh (14C10)  and pan-Rasproteins  were used.Gene transcription analysisCellular RNA was isolated using a Trizol reagent . The reversetranscription reaction was performed using 2 \u00b5g of RNA. The amplificationreaction (PCR) was performed in the presence of 100 ng of the correspondingprimers to cDNA of the mouse e1a and gapdh genes:5\u2019-TGTGATGGGTGTGAACCACG-3\u2019/5\u2019-CCAGTGAGCTTCCCGTTCAG-3\u2019.Linear PCR amplification of DNA fragments was performed during 25\u201335cycles. The specific reaction product was analyzed by electrophoresis in 2%agarose gel.Caspase-3 activityn-nitroanilide at a wavelength of 405 nm using a Multiscan-EXspectrophotometer (Labsystems).Caspase-3 activity was assayed in vitro based on the cleavage of the specificcolorimetric substrate Ac-DEVD-pNA . Cells were lysed for 20 min at+4\u00b0C in a buffer containing 50 mM Tris-HCl, pH 7.5; 120 mM NaCl; 1 mMEDTA; 1% NP-40, and protease inhibitors. Caspase activity was determined in96-well plates in 40 \u00b5L of lysates mixed with 160 \u00b5L of a reactionbuffer  containingAc-DEVDpNA substrate. The efficiency of Ac-DEVD-pNA cleavage was determinedspectrophotometrically based on the accumulation ofTemporary transfection and analysis of luciferase activityCells were transfected using the Lipofectamine-2000 reagent (Invitrogen),according to the manufacturer\u2019s protocol. A luciferase reporter vectorcarrying three copies of NF-\u03baB-binding sequences (3 \u00d7 \u03baB-luc)was used for transfection. Renilla luciferase expression was used as aninternal control. Cells were treated with 4 mM NaBut 24 h post-transfection andthen processed according to the manufacturer\u2019s instructions for measuringluciferase activity after 48 h. Luciferase activity was determined using aTD-20/20 luminometer (Turner Designs). Each experiment was repeated at least 3times.Histone deacetylase inhibitor sodium butyrate inhibits the expression ofadenoviral E1AFig. 1 showthat E1A expression is reduced in the presence of NaBut. In mouse embryo fibroblaststransformed with the E1A and cHa-Ras oncogenes (mERas line),transcription of the e1a gene and the levelof E1A protein decreased as soon as during the first hoursof exposure to NaBut. Is this effect specific to the particular cell line andHDIs employed? In order to answer this question, we analyzed the E1A expressionin the transformed human cell lines and used alternative HDIs. We found thatvalproic acid (VA), trichostatin A (TSA) (data not shown), and vorinostat alsoreduced the amount of E1A in mERas transformants.The results shownin Fig. 1C demonstratethat the decrease in E1A expression under the action of HDIs is not specific onlyto the mERas line. Immunoblotting demonstrated that the amount of E1A protein inthe transformed human renal epithelial HEK-293 cells decreased in the presenceof NaBut. The results of immunoblotting showed that the expression of the Rasprotein did not change in the presence of NaBut.Thus, HDIs were found to suppress the expression of adenoviral E1A,whereas Ras expression was not modulated by HDIs.In order to clarify the reasons for the absence of the expected cytotoxiceffect of HDIs in E1A-expressing cells, we analyzed the effect of a HDI, sodiumbutyrate (NaBut), on the expression of transforming oncogenes. The data presentedin The detected decrease in the E1A protein level in the presence of HDIs canshift the equilibrium between the activities of transforming proteins in mERascells. Meanwhile, the action of oncogenic Ras becomes dominant. We consideredthat the low level of apoptosis in the E1A+Ras transformed cells treated withHDIs was associated with the HDIs-mediated decrease in pro-apoptotic E1Aprotein expression and activation of the anti-apoptotic Ras/Akt/NF-\u03baBcascade.Production of a E1A+Ras-transformed cell line with E1A expressionunregulated by HDIs e1a gene. In order to test the hypothesisthat reduction in E1A expression is required to reduce the HDIs-inducedapoptosis, we produced a MER-E1A cell line based on mERas cells. The MER-E1Acell line additionally expressed the E1A 12S protein under the control of anunregulated cytomegalovirus (CMV) promoter. Regulation and activity of CMV andAd5 viral promoters differ significantly: so, they can be used in target cellsfor different purposes. The high-activity CMV promoter is convenient forefficient transgene expression.The mERas cell line was obtained using a p1A plasmid carrying the nucleotides1\u20131634 of human adenovirus type 5 encoding the E1A protein . In thesFigure 2 showsthe immunoblotting results that demonstrate howNaBut affects the expression of the E1A protein in the original mERas cell line(upper panel) and in the new MER-E1A cell line with constitutive E1A expressionunder the control of the CMV promoter (lower panel). In the control mERascells, E1A expression decreased to almost zero already during the first hoursof exposure to NaBut and remained at a low level throughout the entire study(up to 72 h). However, in MER-E1A cells, the E1A 12S protein was expressed at ahigh level independently of NaBut.Thus, we obtained a line of transformed rodent cells expressing the adenoviralE1A gene under the control of the CMV promoter in which E1A expression did notdecrease in the presence of HDIs.Sodium butyrate induces apoptosis only in E1A+Ras-transformed cells wherethe amount of E1A does not decrease in the presence of HDIsFigure 3A demonstratesthat the viability of control mERas cells treated with NaBut decreased more thanthat of the untreated ones. However, the amount of formazan, whichcharacterizes cell viability, rose with an increase in the duration of exposureof mERas cells to NaBut. The increased amount of formazan attests to the factthat the cells did not divide but remained alive. Meanwhile, the number ofviable MER-E1A cells decreased below the baseline, indicating cell death.Next, we compared the effect of HDIs on the proliferation ofE1A+Ras-transformed cells where E1A is expressed under the control of anintrinsic promoter, and in cells where the CMV promoter regulates E1Aexpression. We evaluated the effect of NaBut on cell viability depending on E1Aexpression. The control mERas cells and MER-E1A cells with unregulated E1Aexpression were treated with NaBut for 24\u201372 h; their viability wasdetermined using the MTTassay. Fig. 4A.One can see that NaBut did not increase the sub-diploid peakin cells transfected with the control empty pcDNA3 vector. At the same time, the percentage of cells with a sub-diploid DNAcontent in cells transfected with CMV-E1A increased twofold already 48 h afterthe exposure to NaBut. The findings demonstrate that there is a significant differencein cell response to HDIs depending on how HDIs modulate E1A expression.In order to test the hypothesis about the induction of death of cells with E1Aexpression not regulated by NaBut, we analyzed the distribution of cells by DNAcontent using a flow cytometer. Cell distribution after transient transfection is shownin Fig. 4B).Meanwhile, 35% of MER-E1A cells contained fragmented DNA 72 h after the exposure to NaBut.The corresponding results were obtained in stable clones with E1Aoverexpression under the control of the CMV promoter (MER-E1A). In the controlmERas cells, NaBut did not increase the sub-diploid peak in the distributionhistogram of DNA content, which is characteristic of dying cells, even after 72 h.The differences in the regulation of caspase-3 activity by HDI depending onmodulation of the E1A expression are consistent with our data demonstratingdifferences in the proliferative response of these cells to HDI.We analyzed the activity of the caspase-3 mediating the transduction of theapoptotic signal. For this purpose, cells transfected with pcDNA3 or CMV-E1Awere either left untreated or treated with NaBut for 24 h; the as cells.MeanwhiNaBut does not increase NF-\u03baB activity in cells with unregulated E1AexpressioncHa-ras [Fig. 4D).We found that unregulated high expression of adenoviral E1A from the CMV promoterprevented HDI-dependent activation of the anti-apoptotic factor NF-\u03baB.Therefore, inhibition of NF-\u03baB activity by adenoviral E1A is one ofthe reasons for the induction of apoptosis by HDIs in these cells.It was shown earlier that HDIs activate the anti-apoptotic factor NF-\u03baB incells transformed with E1A and cHa-ras . This acCells with unregulated E1A expression do not accumulate senescence markerSA-\u03b2-Gal in the presence of NaButcHa-Ras andE1A oncogenes [Fig. 5)show that there is SA-\u03b2-Gal in almost allcontrol mERas transformants after treatment with NaBut for 72 h, thusindicating that cellular senescence was induced. In MER-E1A cells, theSA-\u03b2-Gal marker had not accumulated. After exposure to NaBut for 72 h,very few MER-E1A cells remained attached to the slides for furtherSA-\u03b2-Gal staining; most cells died and were floating. Hence, it is fair toconclude that NaBut induces cellular senescence in cells transformed withE1A and Ras if E1A expression decreases inthe presence of NaBut. Meanwhile, the transformants with constitutive E1Aexpression die rather than senesce.Cellular senescence and apoptosis are the alternative anti-proliferativeprograms induced by cytotoxic and stress factors. It was previously shown thatHDIs induce senescence of cells transformed with ncogenes -29. The ncogenes . In ordeRas or other oncogenes,adenoviral E1A immortalizes and transforms primary rodent cells [in vitro [In cooperation with activated nt cells , 3. Intnt cells , 17-19.in vitro ,16. Morin vitro . Clinicain vitro , 33,34.in vitro . AccordicHa-ras and E1Aoncogenes used in this study. However, sodium butyrate inducedapoptosis in these cells when adenoviral E1A was expressedunder the control of a HDI-unregulated promoter. In studies reporting thatcombined use of HDIs and E1A enhanced the cytotoxic effect, E1Aexpression was controlled not by a native promoter, but by thecytomegalovirus (CMV) promoter or by the catalytic subunit of telomerase (TERT)[Fig. 1A).The regulation of E1A expression is currently understudied. No data on the roleof acetyltransferases or deacetylases in the regulation of E1A transcription areavailable. Inhibition of histone deacetylases activates gene transcription via arelaxation of the chromatin structure. On the other hand, HDIs can inhibit oractivate transcription by changing the acetylation level of transcriptionfactors [E1Atranscription. Earlier, we showed that NaBut suppresses thetrans-activating ability of the E2F factor [Many studies have demonstrated that combined use of HDIs and adenoviral E1A intumor cells increases the cytotoxic effect , 36, 37.e (TERT), 39-40.e (TERT), 38.Confactors . Hence, factors . The absF factor , 43. TheF factor , whereasF factor ,46. TheFig. 1B).Moreover, the content of the E1A protein decreasesmore intensively than E1A transcription does. This findingindicates that deacetylase inhibitors modulate the stability of the E1Aprotein. Like many cellular proteins, virus-encoded proteins also act assubstrates for acetyltransferases and deacetylases. The E1A protein is able tobind to p300/ CBP and can be acetylated by p300 and PCAF[Second, our data suggest that HDIs reduce the content of the E1A protein bothin mERas cells and in a transformed human embryonic kidney (HEK) 293 cell line.We have shown that avoidance of apoptotic death by control mERascells is associated with the downregulated expression of the pro-apoptotic E1Aprotein and activation of the anti-apoptotic NF-\u03baB cascade. Meanwhile, theoncogenic Ras inducing senescence starts to play a predominant role. In turn,induction of apoptotic death in the presence of NaBut in cells with E1Aoverexpression is associated with a suppressed and unregulated activity of theanti-apoptotic NF-\u03baB complex. Data on the repression of NF-\u03baBactivity by E1A oncoprotein have been reported[Comparison of the responses of transformed cells with regulated and unregulatedE1A expression to HDIs showed that apoptosis was induced only in cells with anincreased unregulated E1A expression. In the control mERas cells with a reducedcontent of E1A, the cell senescence program was initiated(reported, 20, 21.reported, it is fcHa-Ras and E1Aoncogenes in which E1A is expressed under the control of a native viralpromoter. In the present study, we have shown that HDIs suppress the expressionof adenoviral E1A. Apoptotic death of E1A/Ras-transformed cells can be inducedby HDIs if E1A is expressed at a high unregulated level. In other words, theavoidance of apoptotic death by Ras-transformed cellsexpressing E1A is associated with downregulation of E1A expression in thepresence of HDIs. In turn, the forced HDI-independent expression of E1A pavesthe way for apoptosis induction.Expression of adenoviral E1A increases the sensitivity of tumor cells toapoptosis-inducing agents .Therefo"}
+{"text": "Consistent with gender stereotypes, female surgeons received higher warmth ratings (p < .001) and lower competence ratings (p = .001) than male surgeons. The stereotype of surgeons held by the general public is that they are high in warmth and competence relative to other occupational groups. Surgeon gender appears to influence general beliefs about the warmth and competence of female and male surgeons.Past research indicates that patient perceptions of surgeon warmth and competence influence treatment expectancies and satisfaction with treatment outcomes. Stereotypes have a powerful impact on impression formation. The present research explores stereotypes about surgeon warmth and competence and investigates the extent to which surgeon gender influences perceptions of female and male surgeons. A between-subjects experiment was conducted online using crowdsourcing technology to derive a representative sample from the general population. Four hundred and fifteen participants were randomly assigned to evaluate the warmth and competence of males, females, surgeons, male surgeons, or female surgeons, using validated measures. Planned contrasts revealed that as a group, surgeons received higher warmth and competence ratings than non-surgeons ( In particular, patients\u2019 impressions of surgeon competence  and warmth  are associated with greater trust in surgeons,, 2 satisPatients\u2019 impressions of their surgeon\u2019s warmth and competence may be informed by a surgeon\u2019s behavior,, 7\u201310 orPrevious research into stereotypes about surgeons has almost exclusively represented the views of medical students and nursing staff, who perceive surgeons to be egoistic, stubborn, aggressive, competitive, and domineering, but also technically masterful, astute, energetic, and precise.\u201328 In otboth warmth and competence, reflecting perceivers discomfort with females occupying traditionally \u201cmasculine\u201d professional roles.[Based on previous research, we expect surgeons, as a professional group, to be perceived as lower in warmth than competence. As members of the healthcare profession, however, we expect surgeons to be higher in both competence and warmth relative to members of non-medical professions . At the same time, we expect that stereotypes of surgeons may vary by surgeon gender in one of two ways. On the one hand, gender stereotypes , 30 may al roles.\u201335www.nethics.nl). As such, the institutional review committee adheres to national and international codes of ethics, including the Declaration of Helsinki (2008).Ethical approval was obtained by the Free University Amsterdam Human Ethics Review Board (VCWE) of the Faculty of Behavioral and Movement Sciences, Department of Experimental and Applied Psychology, 2013), a member of the National Ethics Council for Social and Behavioural Sciences  had not previously participated in the study (as indicated by their recorded IP address).Respondents were paid $1.00(USD) to participate in a 3\u20135 minute anonymous online survey and were included in analyses if they (a) completed at least 90% of the survey items, (b) recorded a survey completion time of The current study uses a within- and between-subjects experimental design to examine stereotypes of surgeons in general , and to explore stereotypes of female and male surgeons, specifically.Participants in the study completed a \u2018Social Perception Task\u2019, in which they indicated their perceptions of the one of the following target evaluation groups to which they were randomly assigned: \u2018Females\u2019, \u2018Males\u2019, \u2018Surgeons\u2019, \u2018Female Surgeons\u2019, or \u2018Male Surgeons\u2019. In addition, participants indicated their impressions of four non-medical professional groups: TV Celebrities, Politicians, Elite Athletes, and Inner City Police Offers . These additional evaluations served to mask the target evaluation groups and to provide a benchmark against which to interpret participants\u2019 ratings of the target evaluation groups. Participants reported whether or not they had previously experienced surgery, as well as their age, gender, and ethnicity.1 = not at all, 2 = slightly, 3 = moderately, 4 = very, 5 = extremely) to indicate their general perceptions of \u201cthe attributes associated with different social groups\u201d. Based on previous research,[Participants used a 5-point scale  using separate one-way repeated measures ANOVAs for warmth and competence. To examine sex effects, a 5  \u00d7 2  ANOVA with planned contrasts was conducted separately for warmth and competence ratings. We included previous surgery (dummy-coded) as a covariate. We planned the following between-groups contrasts: (1) Female Non-Surgeons vs. Male Non-Surgeons; (2) Female Surgeons vs. Male Surgeons; (3) Female Surgeons vs. Surgeons (unspecified sex); (4) Male Surgeons vs. Surgeons (unspecified sex); (5) Female Non-Surgeons vs. Female Surgeons; and (6) Male Non-Surgeons vs. Male Surgeons. We examined all interactions and controlled Type I error rate using the Hochberg method, to give \u03b1 = .01.Mean warmth and competence scores were compared using a paired-samples There were 328 participants included in the analysis after applying the exclusion criteria . Participants identified themselves as Caucasian American (34.6%), Asian or Asian American (34.8%), African American (4.3%), Hispanic or Hispanic American (5.8%), Native American (1.5%), or \u201cOther\u201d (19.0%). Approximately half of the participants (47.6%) had previously had surgery: 35.1% with a male surgeon, 7.9% with a female surgeon, 6.1% with both a male and a female surgeon, and 3.4% did not remember the gender of their surgeon.M = 4.13, SD = 0.62) than warmth , t(62) = 7.18, p < .001.Overall, surgeons (unspecified sex) were rated as higher in competence  = 121.32, p < .001, \u03b7p2 = .38, Inner City Police Officers, F = 125.05, p < .001, \u03b7p2 = .39, Politicians, F = 199.48, p < .001, \u03b7p2 = .51, and Elite Athletes, F = 27.31, p < .001, \u03b7p2 = .12. Surgeons (unspecified sex) also received significantly higher competence ratings than TV Celebrities, F = 118.31, p < .001, \u03b7p2 = .38, Inner City Police Officers, F = 147.28, p < .001, \u03b7p2 = .43, Politicians, F = 211.16, p < .001, \u03b7p2 = .52, and Elite Athletes, F = 23.09, p < .001, \u03b7p2 = .11.As shown in F = 22.77, p < .001, \u03b7p2 = .07. Female Surgeons were also rated as higher in warmth than Female Non-Surgeons, F = 12.59, p < .001, \u03b7p2 = .04, and Surgeons (unspecified sex), F = 15.88, p < .001, \u03b7p2 = .05.Female Surgeons were rated as higher in warmth than Male Surgeons F = 0.38, p = .539 \u03b7p2 = .001. Further, there was no difference between the perceived warmth of Male Non-Surgeons and Male Surgeons, F = 1.45, p = .229, \u03b7p2 = .01. Replicating previous research, Female Non-Surgeons were perceived as significantly warmer than Male Non-Surgeons, F = 7.00, p = .009, \u03b7p2 = .02  = 0.50, p = .482, \u03b7p2 = .002.There was no difference between the warmth ratings given to Surgeons (unspecified sex) and Male Surgeons,  .02 see . None ofF = 10.58, p = .001, \u03b7p2 = .03  = 30.35, p < .001, \u03b7p2 = .09, and there was no difference in evaluations of the competence of Female Surgeons and Female Non-Surgeons, F = 0.66, p = .416.When applying the Bonferroni correction, ratings of Surgeons (unspecified sex) were not significantly different from ratings of Male Surgeons, F = 5.59, p = .019, \u03b7p2 = .02. However, Male Surgeons were rated as significantly more competent than Male Non-Surgeons, F = 6.90, p = .009, \u03b7p2 = .02. In contrast to previous research, there was no difference between the rated competence of Female and Male Non-Surgeons, F = 0.02, p = .895, \u03b7p2 < .001. None of these effects interacted with participant sex. Further, the competence ratings reported by Female and Male participants were not statistically different, F = 3.57, p = .060, \u03b7p2 = .01.Male Surgeons were perceived as significantly more competent than Female Surgeons,  .03 see . SurgeonIn contrast to the view that surgeons are low in social skills but high in technical skills, participants from the general population  rated surgeons, as a group, as high in warmth as well as competence, relative to other non-medical occupational groups. In addition, the extent to which surgeons were rated as high in warmth and competence depended on their gender: As a group, female surgeons received higher warmth ratings than male surgeons, while male surgeons received higher competence ratings than female surgeons. Our findings did not reveal evidence for \u201cbacklash effects\u201d, whereby females who occupy traditionally male-dominated professions (i.e. surgery) are perceived as less warm than females in general. Instead,surgeons has not been investigated, however in light of our finding that people expect female surgeons to be higher in warmth than male surgeons, we would expect patients to show more partnership building, question asking, social conversation, and emotional disclosure with female surgeons compared to male surgeons. I may be because of patients\u2019 greater willingness to communicate more demonstratively with female surgeons that female surgeons then display greater warmth than male surgeons.It is important to emphasize that the stereotypes reflect perceptions, not reality: Female sIt important to acknowledge that there will be conditions under which stereotypes are not used to form judgments of surgeons in a clinical context. Stereotypes are generally not used to form impressions of others when their attributes are unambiguous or if their attributes have been explicitly described by a reliable source. For examNevertheless, the finding that people hold positive stereotypes of surgeons  bodes well for perceptions of surgeon warmth and competence in interactions with patients. Stereotypes have been shown to shape judgments of behavior in two ways, both by increasing peoples\u2019 attention to and memory for stereotype consistent behavior, and by influencing the interpretation of ambiguous behavior., 41 TheoParticipants in the current study reported their perceptions of surgeons (unspecified sex), male surgeons, or female surgeons, in response to an online survey. There are two main strengths to this research design and procedure. Online surveys enable researchers to recruit a participant sample that is heterogeneous in terms of age, ethnicity and education. Consequently the social attitudes that are reported by participant samples recruited online tend to be more reliable  than reports provided by selective samples of medical or psychology students. An additSeveral researchers have independently validated the use of online participant recruitment for the collection of reliable  data on publicly held opinions.\u201344 Howevchoosing a surgeon), they tend to use individuating information to form impressions rather than stereotypes.[Nevertheless, given the experimental nature of the present research we would caution against making inferences about how patients perceive and respond to female and male surgeons based on the current data alone. Follow-up research studies are required to observe how these stereotypes influence patients\u2019 impressions of surgeons in a clinical context. On the one hand, interactions between patients and surgeons are relatively limited, especially in comparison to primary care specialists. Hence, it is plausible that stereotypes of surgeons  predict patients\u2019 impressions of surgeons in practice. On the other hand, research suggests that when people are motivated to form accurate impressions of others  measures of patient preferences, such as waitlist demands on male versus female surgeons for elective surgeries, rather than patient self-reported preferences or behavioral intentions. In many countries, such as the United States, patients provide satisfaction ratings (Press Ganey Scores) which may provide insight into whether patients\u2019 expectations of differences in male and female surgeon warmth and competence have any consequences for their experience of female and male surgeon warmth and competence. It will be interesting to note whether there are differences between patients\u2019 explicitly reported satisfaction ratings of male and female surgeons following non-elective (emergent) surgeries. Finally, it will be important to consider factors that moderate patients\u2019 expectations of and preferences for surgeon attributes. For example, the degree to which patients expect and value surgeon warmth may depend on the type of surgery being performed (e.g. mastectomy vs. lung transplant)[The current research suggests that there is a general held perception that surgeons, as a group, are higher in warmth and competence than other professional groups and that female surgeons, specifically, are perceived to be higher in warmth and lower competence than male surgeons. In consideration of the limitations of the current research, described above, the implications of the current results are unclear. In particular, it will be important for future research to investigate whether social stereotypes of male and female surgeon attributes bias ansplant), or whetThe current study contributes to our understanding of patient expectations and impressions of surgeons by examining generally held beliefs or stereotypes about surgeons, as a professional group. The results of this study suggest that surgeons are, as a group, expected to be high in both warmth and competence relative to other professional groups and that gender stereotypes may \u201cspillover\u201d to further nuance beliefs and expectations of female and male surgeons. In consideration of the experimental methodology used in the current research, additional studies are recommended to validate the generalizability of the current findings with a patient population.S1 File(XLSX)Click here for additional data file."}
+{"text": "AMER1, or whole gene deletions have been reported to cause OSCS. In this study, we describe two families with phenotypic features typical of OSCS. Exome sequencing and multiplex ligation-dependent probe amplification (MLPA) did not identify pathogenic variants in AMER1. Therefore, genome sequencing was employed which identified two deletions containing the non-coding exon 1 of AMER1 in the families. These families highlight the importance of considering variants or deletions of upstream non-coding exons in conditions such as OSCS, noting that often such exons are not captured on probe or enrichment-based platforms because of their high G/C content.Osteopathia striata with cranial sclerosis (OSCS) is an X-linked dominant condition characterised by metaphyseal striations, macrocephaly, cleft palate, and developmental delay in affected females. Males have a more severe phenotype with multi-organ malformations, and rarely survive. To date, only frameshift and nonsense variants in exon 2, the single coding exon of  AMER1  [AMER1 variants, or those with Klinefelter syndrome (XXY), manifest a phenotype similar to female heterozygotes [Osteopathia striata with cranial sclerosis (OSCS: MIM# 300373) is a rare skeletal dysplasia caused by loss-of-function or truncating variants in, or deletion of, AMER1 encodes adenomatous polyposis coli (APC) membrane recruitment protein 1, which regulates the WNT1 signalling pathway by stimulating \u03b2-catenin degradation. Loss-of-function variants resulting in reduced expression of AMER1 cause enhanced WNT signalling through increased nuclear accumulation of \u03b2-catenin [-catenin . WNT sig-catenin ,7, leadi-catenin .AMER1, (NM_152424.4:c.-417_-99+1606del) and (NM_152424.4:c.-1290_-99+380del), resulting in isolated deletion of the 5\u2019 non-coding exon 1. Previous attempts at a diagnosis using exome sequencing and multiplex ligation-dependent probe amplification (MLPA) did not detect the deletions because these platforms did not target this non-coding exon for sequencing and dosage analysis respectively. The deletions were subsequently discovered using genome sequencing (GS). These cases highlight the importance of screening 5\u2032 untranslated exons in genes that produce phenotypes due to a loss-of-function mechanism.In this report, we describe two families with OSCS phenotypes who were found to have novel pathogenic variants in Two unrelated individuals with OSCS were ascertained by physician-initiated referral. The study was conducted in accordance with the Declaration of Helsinki and families were consented to participate in a research study under approved protocols MEC/08/08/094 and 13/STH/56 . Clinical images are reproduced with consent from the families.AMER1 coding exon were performed as described previously [Genomic DNA was extracted from blood from the affected individuals and their family members. X-inactivation analysis, and multiplex ligation-dependent probe (MLPA) analysis and targeted Sanger sequencing of the eviously .Exome sequencing was performed by Otogenetics , and genome sequencing was performed by the Kinghorn Centre for Clinical Genomics  using a HiSeq2500 . Exome enrichment was performed with the Agilent SureSelect Human All Exon V4+UTRs (untranslated regions) or V5+UTRs capture kits . Preparation for genome sequencing was performed with the Illumina 30x GS (TruSeq Nano (Illumina)) v2.5 kit. Reads were paired, with a read length of 150 base pairs. Alignment of reads and variant calling was done according to the Genome Analysis Tool Kit (GATK) best practice guidelines ,11. AligManta (v1.6.0)  was usedAllele specific PCR using genomic DNA extracted from dermal fibroblasts confirmed segregation of the variant within the families. PCR was performed with Q5 HotStart High Fidelity DNA polymerase . Individual PCR primers were designed for the two families, but the experimental design was the same. Primer set 1 was designed to flank the deletions, producing products too large for amplification under the chosen conditions from the WT allele, therefore amplifying only the deletion-containing allele, producing products of 1221 bp (Family A) or 546 bp (Family B). Primer set 2 consists of one primer embedded within the deletion, amplifying only the wild-type allele, producing products of 662 bp (Family A) or 669 bp (Family B). PCR conditions were appropriate for amplification of 100\u20131200 bp products. Primer sequences are available upon request.Proband A was diagnosed with bilateral cleft lip and palate, and bilateral absence of fibulae on prenatal ultrasound at 26th week gestation. She was born at 30 weeks and 4 days. She had an abnormal head shape, hypertelorism, bilateral cleft lip and palate, and bilateral choanal atresia. She also manifested severe features more commonly seen in the male OCSC phenotype including ventricular septal defect, a secundum atrial septal defect, patent ductus arteriosus, hydronephrosis, intestinal malrotation, and anal stenosis. She required a tracheostomy for laryngotracheomalacia. Magnetic Resonance Imaging (MRI) of the head showed hypoplasia of the splenium of the corpus callosum. Radiographs showed generalized increased bone density, absent fibulae bilaterally, and shortening and undermodelling of the proximal phalanges A\u2013C. ChroProband B was born at 35 weeks gestation by caesarean section because of polyhydramnios. Bilateral cleft lip and palate, macrocephaly, hypertelorism, and lymphoedema were noted at birth. She had a nasopharyngeal airway inserted because of upper airway obstruction. She had a bilateral cleft lip repair at 1 year 11 months, and cleft palate repair at 2 years 6 months. A skeletal survey demonstrated metaphyseal striations D with caAMER1 (Xq11.2) contains 2 exons. Exon 1 is non-coding and exon 2 contains the translation initiation site for the coding region. In proband A, Sanger sequencing and MLPA analysis of the single coding exon of AMER1 was performed, and no pathogenic variants were found. There was no skewing of the ratio of X-chromosome inactivation (54:46). The same sequence and MLPA analysis of AMER1 was performed in her father and demonstrated no anomalies. Similarly, in proband B, no pathogenic variants were found by Sanger sequencing or MLPA analysis. The absence of discoverable variants in AMER1 led us to seek pathogenic variants at another locus and whole exome sequencing was carried out. This approach failed to identify plausible candidate variants. Since the exon capture platforms used here did not include the first non-coding exon in AMER1, and due to the potential for locus heterogeneity underlying OSCS, whole genome sequencing was utilised. In both probands, a deletion of the 5\u2019 non-coding exon which encodes most of the 5\u2032 untranslated region of AMER1 was identified. Proband A was heterozygous for a 1924 bp deletion, , encompassing the entirety of exon 1 , encompassing the entirety of exon 1 that encodes most of the 5\u2032 untranslated region of AMER1 , delete the sole transcription start site for the gene, and predict a loss of transcript produced from this allele. Both have been assigned \u2018Pathogenic\u2019 as per American College of Medical Genetics guidelines   and haveAMER1, as well as whole gene deletions, cause OSCS [Germline truncating variants in use OSCS ,9. In thAMER1 exon 1 results in the same phenotype as loss-of-function variants in the coding region of AMER1, or whole-gene deletions of the locus [AMER1 did not target exon 1 as variants in this region had not been previously implicated in OSCS. MLPA did not detect the deletions, because of an inability to locate a probe pair in such as small sized exon due to its sequence composition. In whole exome sequencing, the 5\u2032 AMER1 non-coding exon was not represented on the capture platforms used in this study and therefore not sequenced. However, it should be noted that more recent capture kits that capture UTRs do target AMER1 exon 1, for example Agilent SureSelect Human All Exon V6/V7+UTRs, however the high G/C content may still prevent satisfactory sequencing of the region.Despite being non-coding, loss of he locus . The patThese two cases demonstrate the need to conduct similar, focused searches in other genes associated with loss-of-function phenotypes that contain upstream non-coding exons. Deletions that encompass 5\u2032 non-coding exons may be frequently overlooked in conventional diagnostic methods for a number of reasons. Upstream, non-coding exons are often small, therefore deletions that remove them can also be small and likely to be missed by large-scale genomic methods to detect copy number variants. They are also commonly separated from the first coding exon by large introns, therefore targeted sequencing of the whole gene may not extend to these regions, or they will not be captured in some exome sequencing protocols. Furthermore, the frequently high G/C content of these regions complicates the design of efficient capture probes for exome or MLPA type-analyses. Consequently, although focused sequencing may detect single nucleotide variants in 5\u2032 UTRs, a targeted approach to identify pathogenic deletions outside of the coding region should also be considered.AMER1, leading to deletion of the 5\u2032 non-coding exon, in two families with OSCS. This demonstrates that the whole gene should be considered when screening for OSCS, not merely the coding region of exon 2. Inclusion of methodologies such as whole genome sequencing and PCR can increase diagnostic sensitivity in conditions with similar circumstances to what we describe here for OSCS.In conclusion, we identified two novel variants in"}
+{"text": "Mountains are plant biodiversity hotspots considered particularly vulnerable to multiple environmental changes. Here, we quantify population changes and range-shift dynamics along elevational gradients over the last three decades for c. two-thirds of the orchid species of the European Alps. Local extinctions were more likely for small populations, after habitat alteration, and predominated at the rear edge of species\u2019 ranges. Except for the most thermophilic species and wetland specialists, population density decreased over time. Declines were more pronounced for rear-edge populations, possibly due to multiple pressures such as climate warming, habitat alteration, and mismatched ecological interactions. Besides these demographic trends, different species exhibited idiosyncratic range shifts with more than 50% of the species lagging behind climate warming. Our study highlights the importance of long-term monitoring of populations and range distributions at fine spatial resolution to be able to fully understand the consequences of global change for orchids. Many mountain species are threatened by climate change and habitat loss. Here, the authors investigate population declines and range shifts of orchids in an alpine region in NE Italy over 28 years. For most species, population size decreased, while range shifts were idiosyncratic with over half of the species lagging behind climate change. While a large body of research has elucidated how plants respond to temperature warming by shifting their range4, significant knowledge gaps still remain. First, there is growing evidence that range shifts can lag behind climate change for several decades due to the ability of plants to persist under unfavourable conditions, dispersal limitation or lack of suitable habitats7. Declines in population density stemming from changes in mortality and fecundity rates are expected to precede range shifts9, and even when demographic changes are dramatic, they may often go undetected due to the lack of long-term monitoring data11. Second, current methodological approaches such as resurveys of permanent sites or species distribution modelling are often limited to common and abundant taxa, overlooking the response of rare species7. Third, previous research has mostly focussed on population dynamics at mountain tops, where warm-adapted species are expanding their distributions but cold-adapted species tend to decline in abundance or to go extinct due to climate warming12. There is also an urgent need to consider the dynamics of species at the rear, low-elevation edge of their distributions14, where the pressures of global change are likely to be stronger and the effects of climate warming are less predictable due to the co-occurrence of multiple drivers of plant distribution15.Mountain ecosystems harbour a high rate of endemic and rare plant species that are considered particularly vulnerable to climate change16, with potentially negative consequences for resident plant communities. In the European Alps, a major trend is the abandonment of remote and less productive areas at mid-elevations and above17. Human activities directly shape the elevational distribution of habitats, often irrespective of the direction and speed of climate change18. As a result, climate warming may cause a spatial mismatch between suitable climatic conditions and habitat availability21. Under these circumstances, habitat distribution and quality are expected to play a central role in explaining local population dynamics and climate-induced range shifts26, in particular for specialist, rare and threatened species whose range shift dynamics are likely to be most sensitive to the elevational distribution of suitable habitats.Besides climate warming, mountain ecosystems have experienced rapid habitat transformations such as forest expansion, increased urbanization and invasion of exotic species30 (but see ref. 31 for a positive effect of warming on orchid populations). These declines are usually associated with land-use intensification or habitat loss33, coupled with the loss of mutualistic interactions with mycorrhizal fungi and pollinators28. Moreover, plant species in the southern European Alps are expected to shift upwards with a rate of 3.8\u20135.5\u2009m\u2009year\u22121 to keep track of recent rates of warming2. We used multiple data sets containing a very large number of both occurrence records and population data for taxa that are normally disregarded due to their rarity and scattered geographical distribution. First, we combined historical data with a field resurvey campaign to elucidate the mechanisms underpinning orchid population persistence under global change. Second, we quantified both orchid demographic trends and shifts in the optimum, rear and leading edge of species\u2019 elevational ranges. Here we show that orchid populations at the rear edge and in sites undergoing habitat alteration were more likely to suffer local extinctions. Similarly, population size declined at the rear edge of the elevation range in most habitat types, contributing to increased local extinction risk. Besides these consistent population declines, different species exhibited idiosyncratic range shifts with upward, downward and no movement, suggesting that temperature was not the sole factor driving range dynamics. Despite some upward shifts, the interspecific variability in range dynamics meant that most species did not shift their range uphill as fast as rates of warming.Here we analysed population survival, trends in population size, and range-shift dynamics of Alpine orchids over 28 years across the whole elevational range (66\u20132970\u2009m) in one of the plant diversity hot-spots of Europe  Fig.\u00a0. Orchids28, we first attributed each species to one of the six non-overlapping categories using a published description of habitat preferences34 (see \u2018Methods\u2019 for details): (1) specialists of forest (forest), (2) generalists, (3) specialists of grassland habitats with wide thermal niche (grassland), (4) warm-adapted specialists of semi-natural grassland , (5) cold-adapted specialists of subalpine habitats , and (6) specialists of wetlands (wetland) :  specialip\u2009=\u20090.063). Orchid survival was explained by habitat alteration, elevation and historical population size, irrespective of habitat preference and time elapsed between the two surveys  could also contribute to the observed patterns. Third, we found a positive effect of historical population size . In 2018 and 2019, we revisited 463 sites to test for local habitat alteration and population survival since initial surveys . Habitat alteration was observed in 37% of the resurveyed sites and included land-use changes  or local disturbances related to building infrastructure. Habitat alteration tended to be more likely at lower elevations  binomial, ys Table\u00a0, supportnge Fig.\u00a0. Biogeogize Fig.\u00a0, consist37, population size at the lower elevational limits of forest (Time\u2009\u00d7\u2009Elevation p\u2009=\u20090.002), grassland (Time\u2009\u00d7\u2009Elevation p\u2009=\u20090.011) and subalpine species (Time\u2009\u00d7\u2009Elevation p\u2009=\u20090.043) declined more strongly than at the upper limits, where population size showed a less pronounced decrease . This effect on population size is consistent with the higher probability of extinction at the rear edge observed in the resurveys , elevation and their interaction, we quantified how local population size of orchids with different habitat preferences has changed over the past 28 years across the whole elevational range. To do so, we used information from 21,601 orchid sites visited one time between 1990 and 2017. Consistent with the existence of a thermal optimum at mid-elevations, all species exhibited a hump-shaped relationship between elevation and local population size, except for wetland orchids that showed a weaker response Table\u00a0. Populatase Fig.\u00a0. Populatase Fig.\u00a0, and eveeys Fig.\u00a0. Populateys Fig.\u00a0 and speceys Fig.\u00a0. The for14. To understand how orchid distributions changed in the past three decades, we estimated range dynamics of each species at the regional scale (see \u2018Methods\u2019). To estimate range shift, we split the historical data set into two periods (1990\u20132003 and 2004\u20132017) and evaluated species with at least 30 distribution records in each period. This approach reduced the risks that sampling biases could affect range shift estimation (see \u2018Methods\u2019). Despite some degree of inter-specific variability within habitat category, we found that orchids shifted their rear edges, optima and leading edges differently according to their habitat preference 2, rear and leading edges of forest species, optimum and leading edge of semi-natural species and optimum of generalist lagged significantly behind climate warming, while only grassland species shifted upwards faster than warming. However, only rear edges and optima of grassland orchids shifted faster than expected probably because of higher local extinctions than expected from climate warming alone.Both local extinction and demographic changes are expected to result in species range shifts40. We generally observed asymmetric and idiosyncratic range shifts across species, with only a few species showing a symmetric march upwards of both rear and leading edge . More than 50% of the species were not able to fully track climate change  showed a downward shift at the leading margin resulting in a range contraction. Only two forest species moved upwards  but with a slower shift at the leading edge. By contrast, generalists were the only group of orchids that often expanded their range to higher elevations by moving the leading edge faster than the rear edge . All grassland orchids moved significantly upwards; however, three moved quicker at the rear than at the leading edge, therefore contracting their range . Semi-natural orchids showed either a stable range (e.g. Himantoglossum adriaticum) or a downward shift of the leading edge (e.g. Orchis morio and Orchis tridentata), contracting their range. Except for Nigritella miniata, subalpine orchids moved upwards with a trend for a slower leading edge shift . Finally, two of the four species of wetland orchids shifted significantly upwards. It is important to stress that rare species with low numbers of records were overrepresented in the wetland and semi-natural group affecting the power of the decile comparison described above40 . A previous study in the region indicated that a vertical spread rate from 3.8 to 5.5\u2009m\u2009year\u22121 is necessary for species to be able to fully track climate warming2. Precipitation is abundant throughout the year, and mean annual precipitation over the past 40 years was 1050\u2009mm. Annual rainfall slightly increased between 1981 and 2010 (+2%), but decreased in winter (\u22126%)55.Climate in the region depends primarily on elevation: it is alpine at high elevations and continental in the lowlands. Maximum annual temperature between 1980 and 2010 was 17.5\u2009\u00b0C and minimum 7.8\u2009\u00b0C (at 200\u2009m a.s.l.)56. For the extent of semi-natural grasslands in 2009, we used a detailed map provided by the Rovereto Museum (provided by F.P. and A.B.). We converted vectorial layers of each habitat into a raster layer with a grain of 50\u2009\u00d7\u200950\u2009m. Then, for each habitat layer we extracted the elevation of each pixel (50\u2009\u00d7\u200950\u2009m) and created a density plot in order to evaluate the regional availability of each habitat type over the elevational gradient : the leading edge of grape (c. 750\u2013850\u2009m) and apple cultivation (c. 1000\u20131100\u2009m) moved upwards in the past two decades58. These two ongoing changes, of increased direct anthropogenic pressure at low elevations and reduced pressure (abandonment) at mid-elevations, each imposed direct increasing constraints on habitat availability for orchids associated with open areas.The availability of the major habitat types for orchids is influenced by land-use at different elevations. To describe the current elevational distribution of these major habitat types, we used the most accurate land-use maps available. We used data from the 2009 regional land-use map for alpine habitats, forests and wetlands2, including in the count areas where no orchids are usually found , and slope. Nomenclature follows Perazza and Lorenz34. All the data were stored in the private database of G.P. and in the GIS-inventory database of the Museo Civico di Rovereto .In total, the historical database included 50,074 records belonging to 60 orchid species spanning an elevational gradient from 66 to 2970\u2009m over 28 years 1990\u20132017) , who constantly helped verifying baseline data, confirming species identification, relocating the sites and assessing habitat alterations. The sites were only visited once either in 2018 or in 2019. The resurvey was performed by actively searching the whole area around the sites surveyed in the historical survey . Orchid species and the number of individuals were recorded. Along with the orchid data, the following parameters were recorded: date, elevation, habitat type, and description of any local alteration occurred between the two periods. For the latter, we reported if a local disturbance  or a habitat type change occurred in the second survey by comparing the description of the sites in the initial survey with the current conditions.To detect local extinction of historically recorded populations, we selected a subset of sites to resurvey orchid populations starting from the database described above. The selection of the sites was performed using a stratified random sampling in a GIS environment . The strata were the four major habitat types occurring across the elevational gradient: forests, subalpine areas, semi-natural grasslands, and wetlands. Further criteria of site selection were: (1) to include the whole elevational distribution of each resurveyed species, (2) to exclude sites with the occurrence of a single individual, and (3) to cover most of the geographical area of the historical survey. We revisited 463 sites in all major habitat types, covering the whole elevational range of orchid distributions from the lowlands to high elevation natural areas. Of the final 463 sites, 167 were classified as forests, 53 as subalpine/alpine natural habitats, 198 as semi-natural grasslands and 45 as wetlands. Usually, resurvey studies are constrained by the quality of the baseline data (e.g. relocating the sites), the need to maintain consistent taxonomy and observer effects (e.g. detecting rare species)34 , (2) generalist species able to colonize both forests and grasslands , (3) species able to colonize grasslands from low elevations to alpine habitats , (4) specialists of grasslands below the tree-line including mown meadows, abandoned grasslands, grass margin and extensive perennial crop areas such as vineyards and olive groves , (5) specialists of subalpine open habitats, i.e. rocky habitats, alpine and subalpine grasslands , and (6) specialists of wetlands, e.g. fens, mires and ponds (wetland). Due to the well-known habitat specialization of Alpine orchids, there was little uncertainty in the category attribution. To provide an ecological characterization of the habitat categories, we derived for each species Landolt\u2019s indicator values60 . Second, we computed the coldest and hottest MAT experienced in the study area as 5 and 95% quantiles of the temperature density distribution. Finally, we calculated thermal niche breadth as the difference between these values. The thermal niche breadths characterize the realized thermal niches for orchid populations in the study area while they are not descriptive of the whole range of temperatures enabling their survival and reproduction.We attributed each orchid species to one of the six non-overlapping categories using the description of habitat preferences according to Perazza and Lorenz61. To match species phenology between the initial and the second survey, we excluded observations with >30-day differences between survey dates. The use of smaller or larger thresholds did not qualitatively change the results. Moreover, we excluded species recorded <5 times in the initial survey (n\u2009=\u200943 species) and sites revisited after <5 years. We present results from the full models. We also performed model simplification by removing with a backward deletion procedure non-significant variables (p\u2009>\u20090.10). Model estimates between full and reduced models were stable. Recent advances in Bayesian statistics provide efficient methods to model extinction\u2013colonization dynamics62. However, these methods rely on the availability of repeated samplings in the same survey period to estimate detectability probabilities. It is important to stress that we had only one visit per period and that our analysis did not focus on estimating real extinction\u2013colonization rates but rather on testing the relative role of different environmental drivers or species traits in explaining population dynamics. Any potential bias in the detectability of the species in the two periods  is not expected to be related to any of the tested variables and therefore should not influence the conclusions of our analyses.We analysed orchid probability of survival across 463 sites, where species were observed in the initial surveys. The response variable was binary assuming the value 1 when the second resurvey reconfirmed the occurrence and 0 when the species was absent. We fitted a generalized linear mixed model (GLMM) with a binomial distribution with species as random factor. We tested as fixed effects time , historical population size , habitat alteration (yes or no), the categorical variable of species habitat preference and elevation. Within each species, elevation was standardized to mean 0 and SD\u2009=\u20091 to make the elevational distribution comparable among species and to test whether populations tended to disappear more often at the rear edge than towards the core or upper part of the elevational distribution. This test was valid as the site selection in the resurvey was done to cover the whole elevational distribution of the species included in the analyses. To assess possible collinearity issues between fixed effects, we estimated variance inflation factors (VIFs). VIFs were close to c. 1, indicating very little collinearity among predictorsn\u2009=\u200944 species). We fitted as fixed effects time (continuous), elevation and their interaction using population size as the response variable. Since population size was a count, we used a Poisson distribution. As we expected that population size should be maximum at a thermal or habitat optimum for each species and then decline towards higher and lower elevations, we included the quadratic term of elevation. In all models, we added species as a random intercept, and to correct for overdispersion, we used an observation-level random effect (OLRE) crossed with species63. OLRE models the extra Poisson variation in the response variable by using a random intercept with a single level for each data point.To test the effect of time and elevation on orchid population size, we used GLMMs. Within each species, we standardized elevation to mean 0 and SD\u2009=\u20091 to make the elevational distribution comparable among species. We ran separate models for each habitat preference category and considered only species with at least 30 records in the first 14 years (1990\u20132003) and last 14 years (2004\u20132017) of the historical data set  and current range, we split the data set into two periods of 14 years (1990\u20132003 and 2004\u20132017). We used time as categorical for two reasons: (1) to minimize the potential bias of botanist sampling effort along the elevation gradient and (2) to obtain solid density distributions to estimate shift of leading and rear edge. Estimating shift at the edge is particularly challenging and therefore pooling 14 years of data allowed to reduce the uncertainty. For each species with >30 records per period, we estimated a density distribution of the elevation of occurrence for the first and second period separately (n\u2009=\u200944 species). The rear and leading edge were calculated as the 5 and 95% quantiles of the density distribution and the optimum as the highest peak of the density distribution. The shift was measured by subtracting historical (1990\u20132003) from current (2004\u20132017) measures of elevational range. We divided the total shift by 14 years to obtain an annual rate.Rates of shift in the elevational distribution of species, i.e. changes in optimum, rear (low-elevation) and leading (high-elevation) edge, were computed similarly to Rumpf et al.64 to show the differences at rear edge, optimum and leading edge between habitat preference categories. For each species, to further understand where and how the elevational distribution changed in the two periods, we compared the distribution in the historical period with that in the current using the function \u2018qcomhd\u2019 of the R package WRS266. This function compares deciles estimated from two independent density distributions using a percentile bootstrap to calculate confidence intervals, and therefore, it enables a detailed comparison of shifts along the elevational range. For each species, the analysis can quantify the shifts of the single deciles and if these shifts are different from 0 using bootstrapped intervals of confidence. Low, medium and high deciles approximated rear, optimum and leading edge, respectively. In addition, we tested whether the distribution changed between the historical and the current period using the non-parametric Kolmogorov\u2013Smirnov (K\u2013S) test and adjusting the p values with the Benjamini\u2013Hochberg correction. Species showing a significant or marginally significant shift according to K-S test were the same that showed a significant difference between deciles.To test the effect of habitat preference on the observed shift rates, we fitted three general linear models assuming a Gaussian distribution, testing whether species with different habitat preferences exhibited different mean range shift rates at the rear edge, optimum and leading edge separately. In addition, we carried out post hoc pairwise comparisons using Tukey honestly significant difference with the R package multcomp67. To account for these potential problems, we first described the spatio-temporal patterns of sampling effort. There were roughly the same number of sites sampled in the two periods . We also checked the elevational distribution in each period for all sites and separately for the major habitat types. These analyses did not reveal any strong bias in sampling effort  for which we had at least 10 records in the first and 10 records in the second survey. This approach estimated the rear and leading edge and the optimum using the density distribution based on a spatially fixed network of sites. We calculated shift rates as the difference between current and historical rear edge/optimum/leading edge divided by the average time elapsed between the two surveys within each species . For shifts at the leading and optimum, the correlation was still positive but weaker . Based on the analyses of sampling effort and on the comparison between observed shift rates on the whole data set and shift rates on resurveys, we decided to present the range shifts at rear, leading and optimum positions obtained on the whole data set.Since we did not have a fixed network of sites in the two periods, non-random sampling effort across the study region could have biased the estimates of range shift rates68 and \u2018lme4\u201969, while model assumptions were visually evaluated using quantile\u2013quantile plots of the residuals and plots depicting residuals vs. predicted values in the packages \u2018DHARMa\u2019 and \u2018car\u2019 for R 3.5.170.All models were run using GLMMs or GLMs implemented in the package \u2018MASS\u2019Further information on research design is available in the\u00a0Supplementary InformationReporting Summary"}
+{"text": "Fecal contamination by human and animal pathogens, including viruses, bacteria, and protozoa, is a potential human health hazard, especially with regards to drinking water. Pathogen occurrence in groundwater varies considerably in space and time, which can be difficult to characterize as sampling typically requires hundreds of liters of water to be passed through a filter. Here we describe the design and deployment of an automated sampler suited for hydrogeologically and chemically dynamic groundwater systems. Our design focused on a compact form to facilitate transport and quick deployment to municipal and domestic water supplies. We deployed a sampler to characterize water quality from a household well tapping a shallow fractured dolomite aquifer in northeast Wisconsin. The sampler was deployed from January to April 2017, and monitored temperature, nitrate, chloride, specific conductance, and fluorescent dissolved organic matter on a minute time step; water was directed to sequential microbial filters during three recharge periods that ranged from 5 to 20\u2009days. Results from the automated sampler demonstrate the dynamic nature of the household water quality, especially with regard to microbial targets, which were shown to vary 1 to 2 orders of magnitude during a single sampling event. We believe assessments of pathogen occurrence and concentration, and related assessments of drinking well vulnerability, would be improved by the time\u2010integrated characterization provided by this sampler. Article impact statement: Using the automated sampler described here, microbial concentrations in groundwater are shown to vary significantly over short time periods. Human and animal pathogens are disease\u2010causing microorganisms that can affect suitability of the water for certain use, and thus deteriorate groundwater resources and related water availability. Fecal contamination by human and animal pathogens, including viruses, bacteria, and protozoa, is a potential human health hazard, especially with regards to drinking water sources  deep and the casing extended to 8.8\u00a0m (29\u2009feet) as determined by geophysical and borehole video logs . The well construction report for a replacement well  indicates that 6.7\u00a0m (22\u2009feet) of surficial sediment overlie the dolomite at this site. The sampler was deployed January 18 through April 9, 2017.Bacteroides, ruminant Bacteroides, pepper mild mottle virus, and rotavirus group A. In the auto\u2010sampler work, we chose to target these frequently detected microbial markers as well as commonly reported total coliform concentrations.Concurrent with auto\u2010sampler deployment, a companion study was being conducted in the same region on the sources of fecal contamination in private wells. Four microbial targets were frequently being detected in the companion study: HF183 To provide context for automated sampler design decisions, a short description of a commonly employed manual sampling method for pathogens and indicators is provided, followed by a detailed description of the automated sampler workflow. See Appendix Microbial samples from groundwater are typically collected in two ways. Pumping wells are sampled by connecting a filter to a wellhead tap while the pump was running or piezometers are sampled by peristaltic or other pump with the tubing sterilized between samples. Viruses are concentrated in the field by dead\u2010end ultrafiltration, which has a pore size of approximately 30\u2010kDa  was met the system would be shut down by closing the main valve into the sampler. If glass\u2010wool filters were used, the automated sampler design described here could be modified to accommodate pH conditioning , and turbidity using a multi\u2010probe water\u2010quality sonde and a flow\u2010through chamber. Measurements were made every minute and stored on the sampler's datalogger. Water\u2010quality data collected were available real\u2010time using the two\u2010way telemetry of the sampler. The purpose of this monitoring was to characterize the dynamics and conditions of the household system during time periods when pathogen samples were taken. Because only periodic calibration was performed during the study, reported values are considered to approximate actual analyte concentrations. During initial testing, degassing of the water in the flow\u2010through chamber caused bubble artifacts in results from the water\u2010quality sensors (discussed below); orientating the sonde more vertically reduced, but did not eliminate, bubble formation. Water was continually flushed through the flow\u2010through chamber at a rate of approximately 0.6\u00a0L/min. This resulted in a constant relatively low\u2010flow rate discharge that required constant disposal using gravity drainage into a floor drain. Because the sampler is designed for installation in domestic households it included an emergency shutdown capability triggered by the occurrence of water in the bottom of the sampler. The sampler was constructed using a small refrigerator; therefore, filters could be refrigerated until they were removed to increase holding times.Hydrologic conditions used to determine when to activate microbial samplers were tracked using online resources. The regional groundwater system was monitored using real\u2010time data available from a USGS monitoring well .The local conditions in the household water supply were monitored on a minute time step using low\u2010flow rates routed through the water\u2010quality sonde flow\u2010through chamber. When a target recharge event was identified in the monitoring well hydrograph, the smartphone was used to open the valve to the first filter. The sampler program then monitored the flow rate until the user\u2010specified volume passed through the filter, at which point the valve to the first filter was shut and the valve to the second filter was opened. This continued until all filters were used or the user canceled the sampling event. Filters were collected every 1 to 3\u00a0days during the testing to minimize holding times and maintain continual coverage over the sampling period. During collection, the sampler was paused, filters with quick disconnect couplers were replaced, used filters placed in a plastic bag, sealed, and shipped to the analytical laboratory. Protective latex gloves were worn throughout filter collection to prevent contamination.Our initial discussion focuses on insights gained from the entire January to April 2017 sampling period; a March to April 2017 snowmelt event within this period is examined in more detail. All water quality data shown here are provided by Owens et al. .Data from the USGS monitoring well shows the period had multiple recharge events Figure\u00a0. The samAlthough the water quality sonde data were only used to provide background characterization and identify potentially anomalous conditions in the household water system, results are included here for illustrative purposes. Water quality measured by the sampler's sonde show fluctuation operating on the order of days and weeks Figure\u00a0. This isBacteroides was not found in any sample during the period. Total coliform, found in water from the well in all but one filter, can vary 1 to 2 orders of magnitude during sampling events . However, inclusion of a water quality sonde in the sampler provides a cost\u2010effective geochemical context for the water supply over time. Such insight is important for choosing microbial sampling periods, which helps ensure representative results while lowering the cost of microbial sampling.Most household water systems are under pressure, therefore artifacts of bubble formation during depressurization/degassing are expected to occur unless steps are taken to keep the flow\u2010through chamber pressurized.Inadvertent failure to restart the flow to the flow\u2010through chamber after sonde calibration is not flagged by the datalogger so gaps in the sonde time series can occur  to ensure a target system is adequately characterized.The results presented here demonstrate that microbe occurrence and concentration time series can be efficiently characterized in the field. These results represent those of shallow fractured aquifers with rapid travel times. In this setting, the sampler documents highly variable domestic household water quality over time. Characterization of groundwater quality using single snapshot sampling can be expected to leave longer\u2010term characterization of pathogen occurrence and magnitude highly uncertain. Therefore, deploying samplers as described here can be critical for understanding pathogen source and transport, as well as microbial dynamics, in aquifer settings.The authors do not have any conflicts of interest or financial disclosures to report.Appendix S1. Methods used for microbial sample processing and analysis.Click here for additional data file."}
+{"text": "Osteosarcoma (OS) is the most common primary bone malignancy and responsible for considerable morbidity and mortality due to its high rates of pulmonary metastasis. Although neoadjuvant chemotherapy has improved 5-year survival rates for patients with localized OS from 20% to over 65%, outcomes for those with metastasis remain dismal. In addition, therapeutic regimens have not significantly improved patient outcomes over the past four decades, and metastases remains a primary cause of death and obstacle in curative therapy. These limitations in care have given rise to numerous works focused on mechanisms and novel targets of OS pathogenesis, including tumor niche factors. OS is notable for its hallmark production of rich extracellular matrix (ECM) of osteoid that goes beyond simple physiological growth support. The aberrant signaling and structural components of the ECM are rich promoters of OS development, and very recent works have shown the specific pathogenic phenotypes induced by these macromolecules. Here we summarize the current developments outlining how the ECM contributes to OS progression and metastasis with supporting mechanisms. We also illustrate the potential of tumorigenic ECM elements as prognostic biomarkers and therapeutic targets in the evolving clinical management of OS. Osteosarcoma (OS) is the most common primary bone malignancy and disproportionately affects those in childhood and adolescence . Before Very recently, the tumor microenvironment (TME) has gained prominence outside of its traditional role of cellular support as a veritable contributor to cancer progression and metastasis . The TMEIn this review, we summarize the most recent discoveries of ECM contribution to OS progression and metastasis. We also detail the various ECM components that have shown preclinical and clinical promise as prognostic predictors and therapeutic targets in OS.The ECM is primarily composed of collagen, fibronectin, laminin, and proteo- glycan which shape and maintain tissue vitality , 19, 20.Collagens are the main organic components of the ECM and represents approximately 30% of the total protein mass of the human body . The colCollagen I is composed of two alpha 1 chains and one alpha 2 chain, which are encoded by the COL1A1 and COL1A2 genes, respectively . CollageCollagen III is composed of three identical peptide chains encoded by the COL3A1 gene and is found throughout cortical bone , 65. A sCollagen IV is a heterotrimer composed of three different \u03b1 chains from alpha 1 to alpha 6 . These cCollagen V exists as an alpha1, alpha2, and alpha3 heterotrimer which are encoded by COL5A1, COL5A2, and COL5A3 genes, respectively . While cCollagen XVIII contains 10 collagenous domains encoded by the COL18A1 gene . This coFibronectin is an adhesive glycoprotein of the ECM composed of two polypeptides which bind integrins, collagen, fibrin, heparin, and proteoglycans , 77. It Fibronectin displays various functional motifs that interact with integrins, which are the most common transmembrane receptors and regulate its function \u201384. The Laminins are components of the basement membrane in ECM and are constructed of heterotrimeric glycoproteins with alpha, beta, and gamma chain subunits , 87. TheProteoglycans are heavily dispersed throughout the ECM and are composed of glycosylated proteins with a protein core and covalently attached glycosaminoglycan (GAG) chains , 90. TheSLRPs have relatively short protein cores with a central domain of leucine-rich repeats . The SLRBiglycan is a class I SLRP encoded by the BGN gene which promotes proliferation and differentiation in OS cells , 102. A Decorin is another class I SLRP and a small pericellular matrix proteoglycan with a structure closely related to biglycan. That is where their similarities end, however, as its presence negatively correlates with oncogenesis. Decorin inhibits OS cell migration through its glycosaminoglycan side chains , 103. EcLumican is a class II SLRPs and encoded by the LUM gene . It posiModular proteoglycans are multidomain motif proteins with a highly glycosylated structure . They arAs previously stated, HAs have similar functions to proteoglycans . They exThe function of ECM is derived from its diverse composition of macromolecules, proteases, inhibitors, and their respective downstream signaling pathways . Within MMPs are proteolytic enzymes that degrade surrounding ECM components, release active growth factors, and promote tumor angiogenesis . ElevateHeparanase is an endo-\u03b2-D-glucuronidase that cleaves heparan sulfate chains in the ECM, thus releasing heparan sulfate-binding angiogenic factors and allowing for tumor cell migration, invasion, and metastasis , 120 (FiAlthough the adoption of neoadjuvant chemotherapy in OS has significantly improved patient survival since its implementation several decades ago, outcomes have since plateaued. The personalized and immunotherapies that have shown great promise in several cancers have had less favorable results for OS, likely due in part to its heterogeneity between patients. There is, therefore, an urgent need for prognostic biomarkers which allow for the delineation of patients according to their unique tumor microenvironments and response patterns, so that their therapeutic regimens can be tailored accordingly. In response, there has been an expansion of works investigating the components of the ECM, some of which have been found to play vital roles in cancer progression, metastasis, and clinical outcomes \u2013125. An The ECM is pivotal in OS pathogenesis, especially in tumor cell migration and invasion. Targeting the regulatory and responsible molecules within the ECM has thus been explored as a novel strategy for OS treatment Table\u00a0.Table 3Overexpression of COL3A1 can decrease apoptosis and promote methotrexate resistance in OS cell lines. The precise targeting of COL3A1 is therefore a promising and personalized strategy for overcoming methotrexate resistance in candidate OS tumors . The antThe fibronectin and integrin families within the ECM regulate a diverse array of cellular functions crucial for proliferation, progression, and metastasis . TherapeIn a murine OS model, significantly fewer pulmonary metastases and longer survival times were observed in mice treated with decorin, a matrix proteoglycan. The works of these investigations support decorin as a potential therapeutic target in the prevention of lung metastasis in OS . As prevIn addition to is physiologic importance in structural and biochemical support, the ECM has gained increased recognition for its carcinogenic roles, including in the progression and metastasis of OS. The various components of the ECM including collagens, fibronectin, laminins, and proteoglycans may contribute to OS progression and metastasis through distinct and intertwining mechanisms. It is therefore important to further study and validate the ECM components, cellular receptors, and associated signaling pathways in OS synergistically and as components of the primary tumor tissue. Novel culture systems will be especially important in this endeavor, as resembling the in vivo tumor microenvironment with in vitro customizability, such as with 3D cell culture, will be necessary to accurately model extracellular matrix and growth. Overall, the ECM components have shown promise as clinical biomarkers and therapeutic targets in OS, and warrant a continued evaluation in preclinical models as well as future clinical trials."}
+{"text": "We characterize degeneracy conceptually in terms of a manifold representing the geometric locus of the dynamics in the high dimensional state-space of neurobehavioral signals. The geometry and dimensionality of the manifold are determined by task constraints and team coordination requirements which restrict the manifold to trajectories that are conducive to successful task performance. Our results indicate that team coordination is associated with dimensionality reduction of the manifold as evident in increased inter-brain phase coherence of beta and gamma rhythms during critical phases of task performance where subjects exchange information. Team coordination was also found to affect the shape of the manifold manifested as a symmetry breaking of centro-parietal wavelet power patterns across subjects in trials with high team coordination. These results open a conceptual and empirical path to identifying the mechanisms underlying team performance in complex tasks.Team coordination\u2014members of a group acting together rather than performing specific actions individually\u2014is essential for success in many real-world tasks such as military missions, sports, workplace, or school interactions. However, team coordination is highly variable, which is one reason why its underlying neural processes are largely unknown. Here we used dual electroencephalography (EEG) in dyads to study the neurobehavioral dynamics of team coordination in an ecologically valid task that places intensive demands on joint performance. We present a novel conceptual framework to interpret neurobehavioral variability in terms of  Success in real-world tasks is crucially dependent on the quality of team efforts. Performing a task as a team requires that team members mutually coordinate their actions. Irrespective of the skills that team members have for performing certain actions, it is their coordination that distinguishes high team performance from the less desirable outcome achieved when the very same actions are performed incoherently by its members. Such is the notorious problem of people-matching that pervades many human activities. Although multiple behavioral studies of team coordination have been conducted . In the following we describe the conceptual framework that we developed to interpret behavioral and brain dynamics in the presence of degeneracy. We first focus on the behavioral level, then on the neural level and then show how the two are linked conceptually. Our aim is to show how degeneracy of brain dynamics can be harnessed to reveal neural correlates of inter-personal coordination.Performing a task implies that the subjects restrict their behavioral dynamics to meet the requirements of successful task execution. However, the restrictions imposed by the task are in most, if not all cases, insufficient to single out a uniquely optimal behavioral trajectory  typically involves a large number of measurement sites. Here we used a 60 electrode cap for each subject and perform a wavelet analysis of the EEG data using a complex Morlet wavelet Bruns, . Complexk = 60 be the number of electrodes of one subject and f the number of frequencies taken into account. Using wavelet powers as descriptive variables, the dimensionality of the wavelet power state space is d = 2kf and using phase coherence as descriptive variable the wavelet phase coherence state space dimensionality is d = k(2k \u2212 1)f. Here we restricted our analysis to the frequency band of 15 \u2212 40Hz (low and high \u03b2 and low and medium \u03b3 band), because the behaviors of interest such as signaling readiness by the follower, movement initiation by the leader, and entry coordination between the two subjects occur at time scales of 200ms or less, corresponding to 3 \u2212 25 cycles in the chosen frequency band. Further we used a frequency resolution of 0.5Hz and hence f = 51. The state space for wavelet power had hence d = 6, 120 dimensions, and the state space for phase coherence had d = 364, 140 dimensions. Note that by using proper scaling, the two state spaces could also be combined, but we chose to keep the two descriptions separate.Let We measured the dynamics of phase coherence using a sliding window of 80 ms  from Equation (1). The data we have about the brain dynamics manifolds consist of the trajectories that could be constructed from the EEG data. Because of the prohibitively high dimensionality of the phase coherence state space we chose to not explicitly reconstruct the manifold, and instead analyzed the properties of the manifold indirectly via the analysis of its mapping to a lower dimensional space.For phase coherence the brain dynamics manifold consists of all possible phase coherence trajectories over the time windows in the context of the virtual room clearing task at a given team coordination level. Each point on the trajectory is represented by the coordinates To this end we restricted our analysis to intra- and inter-brain phase coherence, respectively. A subject's intra-brain phase coherence in a frequency band for a given trial segment was computed as the average over all phase coherences among all electrode pairs of the subject and averaged over the time windows in the trial segment. Inter-brain phase coherence was assessed in the same way, but instead of averaging over all electrode pairs of one subject, the average was taken over all electrode pairs in which each electrode belonged to a different subject of the dyad. Note that to determine inter-brain phase coherence, all inter-subject electrode pairs were taken into account, not only anatomically corresponding pairs. To determine how intra- and inter-brain phase coherence were related to team coordination we computed the correlations between the team coordination measure of leader readiness  and the intra- and inter-brain phase coherences in seven crucial segments of the trials, namely the preparatory segments s9, s0, and s1, and the entry segments s2\u2013s5. To avoid spurious correlations due to outliers, we excluded the 5% lowest and 5% highest values for phase coherence and the 5% lowest and 5% highest values for team coordination.As a complementary measure to inter- and intra-brain phase coherence we also analyzed joint wavelet power patterns across the dyad that are specific to high and low team coordination, respectively. Due to the degeneracy of brain dynamics, multiple different dyadic wavelet power patterns could fulfill the specificity requirement. These correspond to the data we have about the manifolds in the wavelet power state space. As with phase coherence we chose an indirect approach to analyzing the properties of the manifold.x and y was thereby defined asTo identify joint wavelet power patterns of the dyad that are specific to high and low team coordination, respectively, we divided the data into two classes. The class of high leader readiness included all trials with segment s1 duration < 338 ms and the class of low leader readiness included all trials with segment s1 duration > 523 ms. The cutoff values represent the 35% lowest and highest percentiles taken over all trials and teams and were chosen as a compromise between maximizing the number of trials included in the analysis while simultaneously maximizing the contrast between the two classes. Each dyadic wavelet power pattern can be considered as a vector in a 2 \u00d7 60 \u00d7 51 = 6, 120 dimensional state space, and our goal is to identify those vectors which are specific for their respective class. As mentioned above, due to the degeneracy of brain processes various distinct vectors could fall into the same class. To determine class specific dyadic wavelet power patterns, we computed the distance matrix between all dyadic wavelet power patterns  in the high and low team coordination class. The distance between two dyadic wavelet power patterns N and n be the numbers of dyadic wavelet power patterns of high and low team coordination, respectively. Then the distance matrix is an (N + n) \u00d7 (N + n) matrix with the square N \u00d7 N and n \u00d7 n blocks on the diagonal containing the respective intra-class distances (high and low team coordination respectively) and the N \u00d7 n and n \u00d7 N rectangular off-diagonal blocks containing the respective inter-class distances. Due to the symmetry of the distance matrix, the two off-diagonal blocks are the transpose of each other. To define intra- and inter-class distances we performed an ordering of the values in each column of the square and rectangular blocks by increasing distance, respectively. After such a reordering each column of a block represents the distance between the dyadic wavelet power pattern indexed in this column and all other dyadic wavelet power patterns in increasing order, separately for intra- and inter-class distances. We defined as intra-class distance the 10-th percentile row of the ordered square blocks, and as inter-class distance the 10-th percentile row of the ordered rectangular blocks. The 10-th percentile was chosen to keep the intra-class distances small while avoiding outliers affecting the distance measure. A dyadic wavelet power pattern was deemed specific to high or low team coordination, respectively, if its inter-class distance was greater than the intra-class distance. Note that this method can be used to identify specific patterns for any two classes and definitions of pattern vectors. For instance, it could be used to determine phase coherence patterns in high and low performance trials. The advantage of this method is that it can yield specific patterns even for highly overlapping classes. Furthermore, using a percentile as the distance measure rather than the maximum distance prevents the results from being dominated by outliers.Class specific dyadic wavelet power patterns were then computed as follows: Let k \u00d7 k correlation matrix for the k = 60 electrodes of each team member role . Correlation was assessed across frequencies and the dyadic wavelet power patterns over all subjects in the respective role. We then applied a spectral clustering method to reorder the two resulting correlation matrices in such a way that highly correlated clusters appear as square blocks along the diagonal. This allows to identify electrodes with similar wavelet power patterns within each team role .Because of neural degeneracy the specific dyadic wavelet power patterns are expected to be diverse. To assess the similarities of dyadic wavelet power patterns between different electrodes we calculated the f = 51 frequencies in the specific wavelet patterns in leader and follower were related to each other, we averaged the specific dyadic wavelet power patterns of the medial centro-parietal electrodes and computed their inter-subject correlation matrix across the various specific wavelet power patterns. This yielded two f \u00d7 f correlation matrices, one for the high and one for the low team coordination condition. We then defined a coefficient of asymmetry for each matrix element and performed a Wilcoxon signed rank test on the asymmetry coefficients of both matrices.To determine how the Consistent with the conceptual framework of degeneracy we identified multiple signatures of team coordination in the brain dynamics of the dyads, measured by EEG and analyzed by wavelet phase coherence and wavelet power patterns, respectively.In our data inter-brain phase coherence in the \u03b2 (20\u201329 Hz) and \u03b3 band (30\u201339 Hz) showed a significant positive correlation with leader readiness, the measure we used for team coordination, in the segments that involved information exchange between the subjects cf. , but notTeam coordination does not necessarily involve similar processes in the two brains of the dyad. Particularly in trial segments with unidirectional information flow such as when the follower has to coordinate his or her avatar's behavior to the leader's, but not vice versa, e.g., in the entry segment (s4), or in segment s1 where the follower signals the leader to initiate movement, we expect different brain activity patterns in the two subjects (s0\u2013s4), depending on their respective role as leader or follower. We hence asked the question whether there were specific dyadic wavelet power patterns that were associated with high or low team coordination, respectively. Here we concentrated on segment s1 where team coordination occurs in terms of leader readiness. As expected from our discussion about behavioral variability and degeneracy of brain processes, we found multiple dyadic wavelet power patterns that were associated with high and low leader readiness, respectively, in 14 out of 16 dyads. Spectral clustering revealed a set of medial centro-parietal electrodes that showed very similar wavelet power patterns within each team role . This set was essentially the same in the leader and the follower and in the low and high leader readiness conditions, and included a wide territory over the medial aspect of posterior cortex . This means that while the dyadic wavelet power patterns that were specific to high and low team coordination did exhibit degeneracy, the individual wavelet power patterns were highly similar across a set of 11 centro-parietal electrodes, hence indicating that both brain dynamics manifolds, corresponding to high and low team coordination, on which the specific dyadic wavelet power patterns \u201clive,\u201d have reduced dimensionality.Furthermore the specific wavelet power patterns in these medial centro-parietal electrodes exhibited an asymmetry in the high team coordination correlation matrix for different frequencies cf. . The corIn our quest for neural signatures of team coordination we proposed a general geometric framework that addresses degeneracy in behavioral and brain dynamics. Degeneracy is an inevitable attribute of team coordination in realistic settings and an important property of biological systems (Whitacre and Bender, Our findings support the increasing evidence that inter-brain phase coherence plays a role in social interaction (Dumas et al., Team coordination involves different behaviors of the two subjects throughout the trial as summarized in Behavioral studies in movement sciences have a history of dealing with degeneracy (Kelso et al., a priori one, guided by the research question and the data at hand. Here we have used wavelet power and phase coherence owing to the oscillatory nature of brain activity and its reflection in the EEG. Other brain imaging methods may require other choices of variables of interest. The experimental data represent a sample of the underlying manifold and hence inference of the geometry of the manifolds from the data may require a low-dimensional state space or the mapping of the manifold onto a low-dimensional one. Interestingly, this is not such a strong restriction as it might seem, since due to synergies, coordination is often associated with low dimensional dynamics (Kelso, Using the present framework, we have identified neural signatures of inter-subject coordination in an ecologically valid task using two sets of variables of interest. The choice of variables, and hence the choice of the state space in which the respective behavioral and brain dynamics are described, is an s Kelso, . Our finTo summarize, the present conceptual framework provides a unifying account for tasks with multiple degrees of freedom and hence is particularly suited to guide the analysis of team tasks in the presence of degeneracy. Degeneracy is a way for biological systems to cope with the ancient doctrine of Heraclitus that no one can step into the same river twice. In accounting for degeneracy our framework represents a departure from the quest for single neural mechanisms underlying given behaviors and explicitly acknowledges the highly synergistic nature of brain processes.https://gitlab.com/BrainyDays/Degeneracy.The datasets generated for this study are available on request to the corresponding author. Wavelets and software related to this study can be found at The studies involving human participants were reviewed and approved by IRB at Florida Atlantic University. The patients/participants provided their written informed consent to participate in this study. Written informed consent was obtained from the individuals for the publication of any potentially identifiable images or data included in this article.ET and JK designed the study. SD analyzed the data. All authors prepared the manuscript.The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest."}
+{"text": "Piper sylvaticum Roxb. is traditionally used by the indigenous people of tropical and subtropical countries like Bangladesh, India, and China for relieving the common cold or a variety of chronic diseases, such as asthma, chronic coughing, piles, rheumatic pain, headaches, wounds, tuberculosis, indigestion, and dyspepsia. This study tested anxiolytic and antioxidant activities by in vivo, in vitro, and in silico experiments for the metabolites extracted (methanol) from the leaves and stems of P. sylvaticum (MEPSL and MEPSS). During the anxiolytic evaluation analyzed by elevated plus maze and hole board tests, MEPSL and MEPSS  exhibited a significant and dose-dependent reduction of anxiety-like behavior in mice. Similarly, mice treated with MEPSL and MEPSS demonstrated dose-dependent increases in locomotion and CNS simulative effects in open field test. In addition, both extracts (MEPSL and MEPSS) also showed moderate antioxidant activities in DPPH scavenging and ferric reducing power assays compared to the standard, ascorbic acid. In parallel, previously isolated bioactive compounds from this plant were documented and subjected to a molecular docking study to correlate them with the pharmacological outcomes. The selected four major phytocompounds displayed favorable binding affinities to potassium channel and xanthine oxidoreductase enzyme targets in molecular docking experiments. Overall, P. sylvaticum is bioactive, as is evident through experimental and computational analysis. Further experiments are necessary to evaluate purified novel compounds for the clinical evaluation. Human neurological disarrays have instigated as ever-growing intimidation in the public health sector and significantly affected the function and quality of life . AnxietyPiper sylvaticum (Roxb.) belongs to the Piperaceae family; is a climbing herb, commonly known as pahari pipul (Hindi), pahaari peepal (Folk medicine), vana-pippali (Ayurveda), chang bing hu jiao (China), or the mountain long pepper (English). It is widely distributed in the tropical and subtropical countries such as India, Bangladesh, China, and Myanmar. The plant has several parts, such as leaves, the stem, roots, fruits, and seeds, and most of them have wide traditional uses for the treatment of various diseases such as rheumatic pain, headaches, chronic cough, cold, asthma, piles, diarrhea, wounds in lungs, tuberculosis, indigestion, dyspepsia, hepatomegaly, and pleenomegaly [nomegaly ,8,9. Besnomegaly . The prenomegaly . Besidesnomegaly . In addinomegaly . Paul etnomegaly  and Haqunomegaly . Chy et nomegaly . Chy et P. sylvaticum) has numerous significant medicinal properties, hitherto, no studies have been performed to determine the anxiolytic and antioxidant activities of the leaf and stem parts. Therefore, this study aimed to investigate the anxiolytic and antioxidant activities of the methanol extracts of P. sylvaticum leaves and stems (MEPSL and MEPSS) in several experimental models, and an in silico molecular docking study was performed to identify the potential lead compounds of this plant for the aforementioned activity.Even though the plant (3), were obtained from Merck . 1,1-diphenyl-2-picrylhydrazyl radical (DPPH) and trichloroacetic acid (TCA) were obtained from Sigma Chemicals Co. , and ascorbic acid from BDH Chemicals Ltd. . Diazepam was obtained from Square Pharmaceuticals Ltd . All other chemicals used in this study were of analytical reagent grade unless unless specified with an additional reference.Methanol, potassium ferricyanide, phosphate buffer, and ferric chloride (FeClPiper sylvaticum (Roxb.) were collected from Sita Pahar area of Kaptai, Rangamati district, Chittagong division , Bangladesh in October 2014, and the plant was identified by Dr. Shaikh Bokhtear Uddin, Taxonomist and Professor, Department of Botany, University of Chittagong. A voucher specimen number (SUB 3217) has been deposited at the Department of Pharmacy, International Islamic University, Chittagong, Bangladesh, and also in the Herbarium of the University of Chittagong for future reference.The leaves and stems of P. sylvaticum leaves and stems (MEPSL and MEPSS). The detailed procedure was described in our previous articles\u2014see materials and methods sections [Approximately 400 g (leaves) and 220 g (stem) of the powdered materials were soaked in 700 and 900 mL of methanol, respectively at room temperature for 14 days with occasional stirring and shaking. Finally, the resultant mixture was filtered through a cotton plug, followed by Whatman No.1 filter paper , and the filtrate solution evaporated to yield the methanol extract of sections .Swiss albino mice of both sexes  were collected from Jahangir Nagar University, Savar, Dhaka, Bangladesh. The animals were sheltered in polypropylene cages by maintaining suitable laboratory conditions  along with standard laboratory food and distilled water ad libitum. All the experimental works were conducted in noiseless conditions and the animals were acclimatized to laboratory conditions for 10 days before experimentation. This study was carried out in accordance with the internationally accepted principles for proper use of laboratory animal\u2019s; namely, those of the National Institutes of Health (NIH) and the International Council for Laboratory Animal Science (ICLAS). The present study protocol was reviewed and approved by the \u201cP&D committee\u201d of the Department of Pharmacy, International Islamic University Chittagong, Bangladesh with a reference number: Pharm-P&D-61/08\u203216-125 (25/08/2016).n = 6). Here, the control group received 1% Tween-80 in distilled water ; the positive control group received reference drug diazepam , whereas the remaining groups were given 200 and 400 mg/kg body weight of the MEPSL and MEPSS, individually.In the present study, mice were randomly divided into six groups, and each group consisted of six mice , a rodent/experimental animal model which is used for the test . With a The hole board test is the widely used valid pharmacological method for assessing anxiolytic and/or anxiogenic activity . The holThe spontaneous locomotor activities were assessed using the open field test . Test anThe DPPH  free radical scavenging activities of the MEPSL and MEPSS were determined as described previously , and res17H19NO3), piperlonguminine (C16H19NO3), sylvamide (C14H27NO3), sylvatine (C24H33NO3), sylvatesmin (C21H24O6), and sylvone (C23H28O8) were selected through literature study, and the chemical structures of the compounds were downloaded from the PubChem compound repository: piperine (PubChem CID: 638024); piperlonguminine (PubChem CID: 5320621); sylvamide (PubChem CID: 21580215); sylvatine (PubChem CID: 90472536); sylvatesmin (PubChem CID: 3083590); and sylvone (PubChem CID: 15043005).Piperine (CP. sylvaticum were obtained from PubChem database (https://pubchem.ncbi.nlm.nih.gov/); then to prepare the ligand it was neutralized at pH 7.0 \u00b1 2.0 and minimized by LigPrep tool (force field OPLS_2005) embedded in Schr\u00f6dinger suite-Maestro version 10.1. Alternatively, three-dimensional crystallographic structures were retrieved from the Protein Data Bank RCSB PDB [The chemical structures of six major compounds of RCSB PDB : potassiRCSB PDB  and xantRCSB PDB . These pMolecular docking studies were performed to elucidate the possible mechanisms of the selected compounds against potassium channel and xanthine oxidoreductase receptors for anxiolytic and antioxidant activities. In this study, molecular docking experiments were carried out using Glide embedded in Maestro by standard precision scoring function, as in the previously described method .P-values less than 0.05, 0.01, and 0.001 were considered statistically significant.SPSS version 20  software  was used for data analysis and all comparisons were made by using one-way ANOVA followed by Dunnett\u2019s test. Values were expressed as means \u00b1 SEM (standard errors of means) and standard deviations (SD), for which the P. sylvaticum leaves and stem (MEPSL and MEPSS) through in vivo, in vitro, and in silico approaches. An earlier preliminary qualitative phytochemical study of this plant (both leaves and stem) reported that the plant contains numerous phytochemicals, such as alkaloids, flavonoids, carbohydrates, tannins, and saponins. Additionally, a quantitative phytochemical analysis of MEPSL also reported that it contains substantial amounts of phenol , flavonoids , and condensed tannins . Furthermore, MEPSS contains significant amounts of phenol (93.39 mg), flavonoids (53.74 mg), and condensed tannins (55.82 mg) [The present study was carried out to investigate the anxiolytic and antioxidant activities of the methanol extract of 5.82 mg) ,14. On t5.82 mg) .Piper sylvaticum, to find whether leaves and stems of P. sylvaticum (MEPSL and MEPSS) have manifold pharmacological effects toward mitigating the anxiety disorder\u2014the ultimate aim of our research. Then, we also explored the potentials of MEPSL and MEPSS for antioxidant activity, and finally a molecular docking study was performed to identify the possible lead compounds for the anxiolytic and antioxidant activity.Medicinal plants are the innumerable resources of pharmacologically active components. Plant-derived drugs have been demanding a very potential position due to their role as safer, cheaper, and effective drugs in the present world . HoweverP. sylvaticum were evaluated for anxiolytic activity by employing the elevated plus maze (EPM) animal model, which is very popular due to the rapid assessment of the anxiety modifying reactions in mice [P < 0.01) elevated the amount of time spent in the open arms. Among both extracts, MEPSL was very effective, and 400 mg/kg remarkably enhanced spending time (109.65 \u00b1 4.88) (P < 0.01) and the number of entries (11.33 \u00b1 1.33) (P < 0.001) in the open arms. Similarly, 200 mg/kg showed a moderate (82.73 \u00b1 3.03) but significant (P < 0.01) anxiolytic effect compared to the control group (78.50 \u00b1 4.75). In addition, reference drug  treated mice exposed an obvious provocation in the time spent and number of entries in the open arms.Both extracts of  in mice . The typ in mice . Table 1In the same way, with the hole board test (HBT) we intended to determine the exploratory responses as well as numerous extents of the undefined behavior of a mouse to an unacquainted atmosphere . The demP. sylvaticum may exert anxiolytic actions by modifying neurotransmitter synthesis and functions. It is supposed that active components of P. sylvaticum interact with the neurotransmitter or neuromodulator receptors, which regulate the neuronal communication, stimulate the CNS activity, and improve the function of endocrine systems [Further we confirmed the possibility of locomotor and exploratory activity of MEPSL and MEPSS through open field assay. The conditions of this test were highly anxiogenic, for which most standard anxiolytic agents are identified from this assessment . In our  systems . Additio systems , and our systems ,11. ThusRammal H et al. 2008 revealed a clear interlink between anxiety and OS wherein such an imbalance of the redox system in mice led to the development of neuro-degeneration and chronic inflammation [50) values were found 288.39 \u03bcg/mL for MEPSL and 476.97 \u03bcg/mL for MEPSS, respectively, while ascorbic acid showed 6.87 \u03bcg/mL.Stressful conditions, such as EPM, HC, and OP tests, can boost up the production of reactive oxygen species (ROS) in mice and prevails over their brain defenses. However, the interplay relationship between oxidative stress (OS) and neurological disorders is not surprising . Rammal ammation . In this3+ to Fe2+ ions, we conducted ferric reducing antioxidant power assay (FRAP). Both extracts were found as strong antioxidant, confirmed by color change from yellow (test solution) to green and prussian blue, indicating reduction of Fe3+ to Fe2+ ions. The reduction was also monitored by UV-vis analysis at 700 nm, as increased absorbance is proportional to higher reduction of Fe3+ ions [To reassess the antioxidant ability of MEPSL and MEPSS in reducing Fee3+ ions . Data foe3+ ions ,40,41. Ae3+ ions ,11. Thusin silico molecular docking study was performed. Molecular docking is a key tool which has been widely used for the drug development process. It is a form of structure-based process that measures the binding affinities between small molecules and macromolecular targets like proteins. Moreover, it is also used to understand the possible molecular mechanism of action of various pharmacological responses [P. sylvaticum were docked against two target enzyme or receptor, viz. the potassium channel receptor (PDB: 4UUJ), and xanthine oxidoreductase (PDB ID: 1R4U) enzyme, and the docking scores obtained for all compounds have been reported in The previous phytochemical study revealed the presence of various phytochemicals in the MEPSL and MEPSS like alkaloids, flavonoids, carbohydrates, tannins, and saponins. In addition, an earlier quantitative phytochemical analysis of this plant indicated the highest amount of polyphenols contents in the both plant extract ,11. Furtesponses ,42. FromP. sylvaticum were docked against xanthine oxidoreductase (PDB ID: 1R4U) and showed docking scores ranging from +1.33 to \u22123.43 kcal/mol. The result of the docking study is shown in In the case of antioxidant docking study, the six selected phytocompounds of In the case of anxiolytic docking study, results are shown in The molecular docking study of each compound displayed several binding interactions between the ligands and the target receptor. Here, piperine interacts with the potassium channel (PDB: 4UUJ) receptor through five hydrogen bonds to Asp165 (two interactions), Asn145 (two interactions), Asp143, and one pi-alkyl interaction with Lys142. Piperlonguminine interacted with the same receptor by forming five hydrogen bonds to Ile144 (two interactions), Asp143, Asp165, and Asn145; two pi-pi stacked interactions with Trp163; and one alkyl interaction with Pro172, whereas sylvatine showed only one hydrogen bond interaction with Lys199. Besides, sylvamide interacted with the same receptor by forming four hydrogen bonds to Lys142, Glu105, and Asp165 (two interactions); three alkyl interactions with Pro172 (two interactions) and Lys142; and one pi-alkyl interaction with Trp163. The standard drug , diazepaFrom these results, we can conclude that the studied phytocompounds, particularly piperine, piperlonguminine, sylvamide, and sylvatine, may in part be responsible for the anxiolytic and antioxidant activities of the plant extract through interactions with these target enzyme or receptor. It has been previously reported that piperine has anxiolytic  and antiIn summary, results of the present study revealed that both extracts (MEPSL and MEPSS) possesses significant anxiolytic and antioxidant activities. These activities might be due to the presence of high polyphenol content in both extracts and could be due to the individual or synergistic effects of different phytochemicals, such as alkaloids, flavonoids, saponins, tannins, and phenols. Additionally, our molecular docking study unveiled that piperine, piperlonguminine, sylvamide, and sylvatine have higher binding affinities towards the target receptor/enzymes for anxiolytic and antioxidant activity, respectively. It might be possible that, for these four phytocompounds responsible for the observed pharmacological responses, further study is still necessary to elucidate their in-depth molecular mechanisms of action in animal models."}
+{"text": "ACTA2 R179 carriers present with early-onset stroke; occlusive lesions of the distal internal carotid artery and branches are filled with cells staining positive for smooth muscle cell (SMC) markers. We will identify pathways leading to increased SMC proliferation and migration and thus occlusion. METHODS/STUDY POPULATION: We generated an Acta2SMC-R179C/+ mouse model, which expresses the Acta2 R179C mutation in SMCs via the SM22a-Cre-Lox system. rt-PCR performed in aortic tissue confirms the presence of the mutation in the mutant mice and absence in mice with only the floxed allele (WT). We will determine phenotypic differences between mutant and WT brains using micro CT, vascular casting, histology, and immunostaining. We will characterize mutant SMC phenotype in culture by assessing expression of contractile genes and stem cell markers, proliferation, and migration. Single cell RNA (scRNA) sequencing of the brain will assess differential gene expression and cell populations between mutant and WT mice. RESULTS/ANTICIPATED RESULTS: Mutant mice have decreased blood pressure compared to WT mice from 8-24 weeks old, consistent with the phenotype seen in ACTA2 R179 patients. We expect to see occluded and straighter cerebrovascular arteries and white matter changes in the Acta2SMC-R179C/+ mice. iPSC-derived SMCs from patients show de-differentiation, continued expression of stem cell markers, and increased proliferation and migration. We expect to see a similar phenotype in Acta2SMC-R179C/+ mouse SMCs in culture. Via scRNA sequencing, we expect to see altered transcriptional profiles in mutant mice brains including upregulated proliferative pathways in SMCs, glial cell activation, and gene expression changes in neurons. DISCUSSION/SIGNIFICANCE OF IMPACT: These studies will contribute important information on the pathogenesis of the cerebrovascular disease in ACTA2 R179 patients. These results may aid in identifying treatments to prevent or decrease risk of developing strokes in those with known predisposition to cerebrovascular occlusive disease.OBJECTIVES/GOALS:"}
+{"text": "Provision of up-to-date cost information is crucial for not only addressing knowledge gap on the cost of essential health services (EHS) but also budgeting, allocating adequate resources and improving institutional efficiency at public health centers where basic health services are delivered the most.To analyze the costs of essential health services at public health centers in Jimma Zone.A facility based cross-sectional study was conducted in public health centers of Jimma zone from April 10, 2018 to May 9, 2018. The study was conducted from a provider perspective using retrospective standard costing approach of one fiscal year time horizon. Step-down allocation was used to allocate costs to final services. All costs for provision EHS were taken into account and expressed in United States dollar (USD). Sixteen public health centers located in eight districts were randomly selected for the study.The Average annual cost of providing essential health services at health centers in Jimma zone was USD 109,806.03\u2009\u00b1\u200950,564.9. Most (83.7%) of the total Annual cost was spent on recurrent items. Nearly half (45%) of total annual cost was incurred by personnel followed by drugs and consumables that accounted around one third (29%) of the total Annual cost. Around two third (65.9%) of the total annual cost was incurred for provision of EHS at the final cost center. The average overall unit cost was USD 7.4 per EHS per year.Cost providing an EHS at public health centers was low and so, necessitating funding of significant resources to provide standard health care. The variability in unit costs and cost components for EHS also suggest that the potential exists to be more efficient via better use of both human and material resources.The online version contains supplementary material available at 10.1186/s13561-021-00334-y. The aim of Universal Health Coverage (UHC) as per the World Health Organization (WHO) is to ensure that all individuals receive the quality health services they require without facing financial difficulties. However, delivering essential health services at a reasonable cost that realizes the ultimate goal of Universal Health Coverage (UHC) is a worldwide challenge . EHS is \u2018Envisioning Ethiopia\u2019s Path to Universal Health Care through strengthening of Primary HealthCare\u2019 highlights the Ethiopian governments\u2019 commitment to universal health coverage . The analysis also included all recurrent costs  and all relevant capital costs related to provision each essential health services at each health center .All the selected health centers\u2019 have similar structure having about 19\u2009\u00b1\u20092.75 rooms. The average number of staff per HCs was 21\u2009\u00b1\u20095.94. The average actual population covered by a Public Health Centre (PHCs) was 14,579\u2009\u00b1\u20097992.79. The number of ANC visits, deliveries and PNC visits, immunization service, chronic, curative child health varied among the health centers. [Table\u00a02]. Two third (65.9%) of the total cost incurred for provision of essential health services at HC was on accounted for various essential health services at the final cost center. Curative health services accounts the highest with 15.2%, followed by chronic care service with 12.5% while EPI consumed the least, with 5.8% of total annual cost per health center [Figure 1].The total cost of running the health centers in providing essential health services in the sixteen public health centers in 2009 Ethiopian financial year was USD 1,754,150.18 while the mean annual costs those services at HCs were USD 109,806.03\u2009\u00b1\u200950,564.9. The largest part of total annual cost USD1,227,872.7 (65.9%)] were absorbed by the final cost centers (the service departments) followed by overhead cost center which absorbed 21.9% of the total annual cost while the intermediate cost center were absorbed only 12.2% percent of total annual expenditure The total annual recurrent cost was USD 1,468,174.55 while the mean annual recurrent cost per health center was USD 91,760\u2009\u00b1\u200942,344.22. It also contributed to 83.7% of total annual cost. Among the recurrent cost component, the highest proportion was incurred by Personnel which accounted for USD 790,508.49\u2009\u00b1\u200916,831.01. It comprised for 53.8% of the total annual recurrent cost. The lowest proportion of recurrent cost, USD 26,562.78 was incurred by medical supplies & consumables with that also comprised for (1.9%) of the total annual recurrent cost with standard deviation of USD 794.47.The average cost for personnel was USD 49,406.78 per health center where the greater parts (53%) were absorbed by the final cost centers followed by overhead cost center which absorbed 28% of the total personnel costs while only 19% of the total personnel cost were absorbed by intermediate cost center.The average cost for medical supplies & consumables USD 1660.17 per health center. The total medicine, Laboratory supplies & reagents and medical supplies & consumables cost was USD 584,595.49 (28%) of total annual cost from which medicine shared USD 472,553.58 (21.9%), Laboratory supplies & reagents consumed USD 85,479.13 (4.8%) and USD 26,562.79 (1.5%) spent on medical supplies &consumables while average cost of medicine USD 29,534.61 per health center, that of Laboratory supplies & reagents was USD 5342.45 and medical supplies &consumables consumed USD 1660.17.The average cost for medical supplies & consumables USD 1660.17 per health center. The total medicine, Laboratory supplies & reagents and medical supplies & consumables cost was USD 584,595.49 (28%) of total annual cost from which medicine shared USD 472,553.58 (21.9%), Laboratory supplies & reagents consumed USD 85,479.13 (4.8%) and USD 26,562.79 (1.5%) spent on medical supplies &consumables while average cost of medicine USD 29,534.61 per health center, that of Laboratory supplies & reagents was USD 5342.45 and medical supplies &consumables consumed USD 1660.17.Over two third (70%) of medicines, laboratory supplies and medical consumables cost were from revolving fund where it was 74% for medicine and 52% for laboratory & medical consumables. About 100% of the total medicine, laboratory cost and 95.8% of medical consumables were allocated to the final cost centers respectively. Curative consuming the highest percentage with 25.4% of medicine, 40.5% of laboratory supplies and 30.3% medical supplies &consumables cost while emergency consume the lowest medicine cost (5.6%) and medical consumables cost (3.5%) while EPI consume the lowest laboratory supply cost (2.4%).The Average annual cost administration and utility were USD 12,355.88 per health center with the highest cost was spent on stationary and others\u2019 office consumables &supplies with USD 4242.67 per health center which is about 34% of the total cost of administration and utility.[Figure ].It can be evidently said that the cost center which incurred the highest cost was final cost center which consumes USD 109,542.817 for all health centers which is about 58% of the total cost of administration and utilities, followed by overhead cost center which absorbed 28% of the total administration and utility costs while only 14% of the total administration and utility cost were absorbed by intermediate cost center administration Figure .Fig. 2aThe total annual capital cost was USD 285,975.6 and the mean of USD 17873.4 with standard deviation of USD. It also contributed to 16.7% of total annual cost. Among the total annual capital cost the highest proportion was incurred by Health centers\u2019 building cost with USD 75,047.28 (26.2%) & the mean annual equivalent cost of USD 4690.45 per health center followed by building with total annualized cost of USD 62958.41 & mean annual equivalent cost of USD 3934.91 per health center.The depreciation costs of buildings accounted for USD 110,958.4 (3.6%) of the total annual costs and about 22% total annual capital cost. It can also be evidently said that the Final cost center  have the highest annualized cost of building at USD 2745.29, as they occupied more number of rooms which consumed about 71% of the total annual buildings cost.The depreciation of equipment also accounted for about was USD 121,104.91 (4.2%) of the total annual cost and 26.2% total annual capital cost. Half (51%) of the costs calculated under the heading \u201cequipment\u201d were attributable to the final cost centers while 42% to intermediate cost centers.The total cost of furniture was USD 1679.06 per health center and accounted for 1.6% of the total health centers\u2019 costs. Over three fourth (79%) of the costs calculated under the heading \u201cfurniture\u201d were attributable to the final cost centers while 14% to intermediate cost centers.[Table\u00a04].The total annualized cost of the vehicles was USD 75,047.28 which represented about 6.9% of the total annual cost and about 42% of the total of the annualized capital costs. About 100% of the total vehicle cost was allocated to the overhead cost center [Fig.\u00a0].The final cost center namely maternal and family health services consume more building costs compare to others that might be attributed to the number of rooms required to provide full scope of essential maternal and family health service while maternal and family health services and emergency service consume large part of furniture\u2019s cost. Similarly, laboratory services consumed largest part of capital equipment costs that might be due number and sophistication of durable medical equipment used at the department Fig.\u00a0.Fig. 3a[Table ]. The variations in the unit cost were attributable to recurrent expenditure like personnel cost drivers as capital costs  contribute relatively small percentage (less than one fifth) to total annual cost. Hence, the resultant unit cost of services based on recurrent cost did not show much difference to that of unit cost analysis based on total cost where child health service had relatively high unit cost (USD 8.75) while pharmacy service visit (USD 0.62) had relatively low unit cost per output [Table ].Overall the average unit cost for all essential health services provided by the financial year was USD 7.34. The most expensive unit of output is child health service with USD 9.72 while the least expensive unit of output was being the pharmacy services USD 0.62. All health centers spent on average USD 9.72 per child health service visit, USD 9.12 per family health service visit, USD 3.84 per delivery and USD 2.79 per ANC visit. Variations in the unit cost within individual health center and between services at health centers were discovered with personnel having higher costs than other cost drivers Table . The vart USD 8.7 while phThe total annual costs were affected by discount rate variation and useful life of capital items at health centers to some extent but not to level of significance set prior to the study. The average annual cost of providing range of essential health services at health center varies from USD 109634.39 to USD 111682.63 on varying discount rate from 5 to 7% for the capital costs that only resulted 1.3% of change in total cost and 1.8% of change in overall all unit cost on average. Useful life of capital items affected both total capital and annual costs to some extent. For building alone using useful life 20\u2009years instead of 30\u2009years resulted in fluctuation of total capital cost by 22.1% (from USD 17873.47 to USD 105699.48) and affected total annual cost by 3.6% (by changing from USD7.34 to USD 7.08) on average. On the other hand, increasing the average number of the attendants at health center by 10% has lower impact on the unit costs. For instance, increasing the number of EPI beneficiaries by 10% (from 1518 to 1669) resulted in a 9.3% reduction in cost per EPI attendant (from USD 4.4 to USD 3.9) and similar reduction will happen for the child health services by increasing child health services attendants by 10%.Effect of increasing personnel cost on total annual cost was also explored. For instance, having an expectation that the number of staff will increase in future due to government policies or health care reforms like HSTP to provide an improved health care for its\u2019 citizen, 10% increase in personnel cost at health centers, resulted in increment of annual recurrent cost by 5.4%. Similarly, the average annual cost of providing care will increase by 4.5%  while overall unit cost will increase by 4.3% (from USD 7.34 to USD 7.67).Though all the study health centers had basic infrastructure listed in Ethiopian health care standards, there were variations in some of the background characteristics like the number of rooms, number and pattern of staff, the catchment areas, and the number of EHS visit during a fiscal year. Most (93.8%) of health centers had an adequate number of rooms as stated and listed in Ethiopian health center standards . The aveThe average annualized cost for providing essential health services through a health center was USD 109,683 (USD7.4 per capita). This finding is close to finding from Syria, where average costs per EHS were USD 6.01., USD 2 per capita in Vietnam, USD 1.4 per capita in Uganda, and USD 1.3 per capita in Nepal . But, itThe recurrent cost accounted for more than three fourth (83.7%) of total annual costs. In this regard, these findings close to the study done in Burkina Faso , ThailanThe main cost drivers for health centers were personnel, drugs & consumables. Personnel cost accounted for the highest proportion, nearly half (45%) of total annual cost and 53.8% of the recurrent costs. It is close to the finding from another study done on primary health care in Ethiopia through the federal ministry of health that explained 46%of total annual costs went to human resources at health centers , 25, 30.Drugs & consumables were the second key cost drivers that consumed nearly one-third (29%) of the total annual cost. This finding is close to the studies done in Indonesia, Pakistan, and New Guinea. The Indonesia primary care providers spent only 27% of the total facility\u2019s expenditure each on drugs and supplies , while dTwo third (65.9%) of the total annual cost was accounted in the final cost center. Curative health services accounted for the highest with 15.2%, followed by chronic care service with 12.5%, while EPI consumed the least, with 5.8% of the total annual cost per health center. The finding is contrary to the study done in 11 districts of health facilities of Ghana, where the higher percentage (66%) spent on the preventative and promotive component of essential health services .Child health service had the highest unit cost (USD 9.7), which is higher than findings from Burkina Faso that indicated an average Cost per Child health as USD 27.6. Child health service followed by family health service with unit cost per output of USD 9.1, which is higher than findings from Burkina Faso that indicated an average cost per FP as USD 0.51 . In contA study done in Ethiopia on immunization of children during the Child Health Days indicated that an average cost per child per one round was USD 0.56  and costReaders should be cautious of the limitations of the study while interpreting the results. Total and unit cost estimates are affected by the quality of the available data. Record keeping at the health centers was poor and could affect the study results. Some donated items and technical assistance that provides the exempted essential health services have no cost records on them at the health centers, cost of such services were not included in the cost analysis.Building costs was calculated indirectly based on the number of room shared among essential health services and total health center construction cost as it was difficult to obtain reliable cost of building of the health centers. Similarly, personnel cost across cost center were allocated indirectly based on the number and type of profession working at cost center rather than staff time allocation pattern that bases on time-motion to assess time contribution of staff performing multiple tasks. In spite of these stated limitations, the methodology used in this study is applicable across various settings & the estimates from this study are reflective of the current level of health centers and services delivered at them.Cost of providing essential health care service through health center is low. Recurrent cost categories and final cost centers are the major area of resource consumption at health centers. The variability in unit costs and cost components of all essential health services, suggest that potential exists to reduce costs through efficient use of both human and material resources like personnel, drugs and medical supplies. The unit costs of essential health services provided at health centers mainly depends on the intensity of use of the resources and utilization pattern for essential health services. Further work is required to explore the key drivers of efficiency and interventions that may facilitate efficiency improvements at health centers.The personnel cost was the Prime cost variable in this study. It is better if Oromiya regional health bureau and District health service managers carefully consider how much would it cost from the providers\u2019 perspective; and whether that cost allocation affects the provision of essential health services during human resource recruitment planning on the expansion of primary health care.The regional, and district health service managers ought to fund the health centers through proper health sector budgetary allocation, community mobilization, and seeking donor assistance for exempted services delivery since health spending is far below what is nationally recommended for public health centers to provide adequate essential health service at service delivery point.The Oromiya regional health bureau, as the main provider, financing agency, and regulator for the district health system should intensify its efforts to control healthcare costs increment by introducing cost-control measures.Medicines, laboratory reagents, medical supplies, and consumables were revealed in the study as one of the important cost drivers. Hence, the health center management team should manage the proper allocation to this cost category.Antenatal care, vaccination, family planning and postnatal Care (PNC) are the main lists of the essential health service package. Health centers managing directors\u2019 needs allocate proper amount of health centers\u2019 resources to these final cost centers (case team) to improve provision of essential health services to population in their catchment area. Since this study was conducted from the health care provider perspective to estimate resources incurred when providing essential health services, Costs from clients\u2019 angles and the opportunity cost of alternatives were not included in the analysis. Hence, basing this study as the starting point, future health policy and system management researchers need to explore this area using large numbers of primary health facilities in different parts to generate more generalizable results.Additional file 1."}
+{"text": "Safrole is a natural compound extracted from various plants, and has shown various biological activities. The current study aimed to investigate the antioxidant, antidiabetic, antimicrobial, and anticancer activity of safrole oil and to study the influence of safrole nanoemulgel on these activities.The antioxidant and antidiabetic in-vitro assays were conducted using standard biomedical methods. The safrole oil nanoemulgel was developed using a self-emulsifying technique. Then the antimicrobial activity of the safrole oil and safrole nanoemulgel were performed on different microbial species, and cytotoxicity was determined against Hep3B cancer cell lines using the MTS assay.50 value 50.28\u2009\u00b1\u20090.44 and 1.55\u2009\u00b1\u20090.32\u2009\u03bcg/ml, respectively. Moreover, it had potent \u03b1-amylase inhibitory activity (IC50 11.36\u2009\u00b1\u20090.67\u2009\u03bcg/ml) compared with Acarbose . The safrole nanoemulgel had pseudo-plastic behaviour, droplet sizes below 200\u2009nm, a polydispersity index (PDI) below 0.3, and a zeta potential of less than \u2212\u200930\u2009mV. Safrole oil has potential antimicrobial and anticancer activities, and these activities were improved with safrole nanoemulgel.Safrole oil showed moderate antioxidant activity compared with standard Trolox, with ICThe safrole oil may be applied for the prevention and treatment of oxidative stress, diabetes, different microbial species and cancer, and these activities could be improved by nano-carriers. Nanotechnology has influence many areas of science in recent years . The worA nanoemulsion is a drug delivery system consisting of emulsified oil and water, with an average droplet size of 5\u2013200\u2009nm . It is cMoreover, within the main collection of semi-solid preparations, gel is a clear, semi-solid dosage medium of good stability and application compared to cream and ointment. Nevertheless, it is inefficient for the supply of poorly soluble medicines . To overIn the last few years, pharmaceutical research has focused more on natural bioactive compounds. Plant extracts or raw plants have a range of phytochemicals and bioactive components that provide synergistic therapeutic effects, which have multi-target effects in the curing of diseases . HoweverSeveral studies have been carried out on safrole derivatives and their pharmacological effects, particularly their cytotoxicity \u201336, Twenn-hexane were obtained from Loba Chemie (India). N-Succ (Ala) 3-o-nitroanilide (SANA) and porcine pancreatic elastase (PPE) were obtained from Sigma Aldrich, USA. The \u03b1-amylase enzyme from Sigma Aldrich , and acarbose was obtained from Sigma-Aldrich .Safrole oil was purchased from . The carboxyvinyl polymer (Carbopol 940) was obtained from the CBC Co., Ltd., Japan. Dimethyl Sulfoxide (DMSO) was obtained from Riedel-de-haen, . Trolox  and 2,2-Diphenyl-1-picrylhydrazyl (DPPH) were purchased from Sigma Aldrich (Denmark). Both surfactants Span and Tween were bought from Al-Shamas company . DNSA 3,5-Dinitrosalicylic acid (DNSA) reagent was purchased from Sigma-Aldrich  Methanol and The antioxidant activity of the safrole oil was evaluated using the free radical-scavenging assay. DPPH was used to measure the scavenging activity of the oil. Stock solutions of the safrole oil and trolox (as a standard reference compound) were prepared at a concentration of 1\u2009mg/mL, from which serial dilutions were carried out . One millilitre of the stock solution and 1\u2009ml of methanol were mixed with 1\u2009ml of DPPH solution. The solution was then incubated in the dark for 30\u2009min at room temperature, and the blank solution was prepared by replacing the stock solution with methanol. Trolox was used as a control, and the absorbance was measured by a UV\u2013Visible (UV\u2013Vis) spectrophotometer at 517\u2009nm, which was compared with the control. The following equation was used to calculate the percentage of DPPH inhibition by the trolox standard and the safrole oil:Where B is the absorbance of the blank and T is the absorbance of the tested samples. The IC50 of the antioxidant (50% Inhibition concentration) was calculated for both Trolox and the safrole oil using BioDataFit edition 1.02 .2HPO4/NaH2PO4; 0.02\u2009M), NaCl (0.006\u2009M) at pH\u20096.9 to yield 1000\u2009\u03bcg/ml concentrations, from which the following dilution was prepared: 10, 50, 70, 100, 500\u2009\u03bcg/ml. A 200\u2009\u03bcl volume of the porcine pancreatic \u03b1-amylase enzyme solution (2\u2009units / ml) was combined with 200\u2009\u03bcl of safrole oil, and incubated at 30\u2009\u00b0C for 10\u2009min. Two hundred microlitres of the freshly prepared starch solution (1% in water [w/v]) was then added to each tube, and the solution was incubated for 3\u2009min. Termination of the reaction was carried by adding 200\u2009\u03bcl of DNSA reagent  and then diluted with 5\u2009ml of distilled water and boiled in a water bath at 85\u201390\u2009\u00b0C for 10\u2009min. The mixture was cooled to ambient temperature. Then using a UV-Visible spectrophotometer, the absorbance was taken at 540\u2009nm. The blank with 100% enzyme activity was primed with 200\u2009\u03bcl of the buffer to replace the safrole oil. A blank reaction in the absence of the enzyme solution was similarly prepared using safrole oil at each concentration [The assay for \u03b1-amylase inhibition was conducted using the process of 3,5-dinitrosalicylic acid (DNSA). Safrole oil was dissolved in a minimum of 10% DMSO and subsequently dissolved in the buffer  for 2\u2009min. The oil was then emulsified with water under gentle agitation. Finally, the physical properties have been calculated and based on these characteristics the ideal formulation has been chosen.A NanoBrook Omni 280,173  was used to determine the polydispersity index (PDI) and droplet size of the nanoemulsion. The mean and standard deviation were measured in triplicate. The formulation that provided the smallest droplet size with the lowest PDI and the highest amount of oil was selected.The hydrogel was created by the addition of Carbopol\u00ae 940 to water and continuous mixing using a homogeniser to prepare a uniform dispersion. Subsequently, under constant mixing, 2\u2009M NaOH was added to the hydrogel to adjust the pH to 6. The mixture underwent continuous mixing and was left for 24\u2009h to completely gel.The nanoemulgel formulation was prepared by the addition of different concentrations  of the hydrogel matrix to the optimum nanoemulsion at 100\u2009rpm for 10\u2009min. The PDI, droplet size, and zeta potential were subsequently measured.The droplet size, PDI, and spreadability, in addition to the visual appearance of the nanoemulgel formulation were inspected.The zeta potential is defined as the potential that forms between the oil droplet and the liquid phase. Stable formulations have a positive or negative potential that is greater than 30\u2009mV. A NanoBrook Omni 280,173  was used to measure the zeta potential of the nanoemulgel formulation.The rheological performance of the nanoemulgel formulations obtained at different Carbopol\u00ae 940 concentrations  as a gelling agent was assessed at ambient temperature using a rotational viscometer . All measurements were performed in triplicate. In the shear rate range (0\u2013100\u2009rpm), the viscosity was calculated.Escherichia coli, Staphylococcus aurous, MRSA, Pseudomonas aeruginosa, Klebsiella, Proteus vulgaris and Enterococcus faecium, and Candida was used for the fungal test.The organisms used for the bacterial test were Muller Hinton agar is a bacterial crop medium containing 2\u2009g of beef extract, 1.5\u2009g of starch, 17.5\u2009g of casein hydrolysate, and 17\u2009g of agar per liter of filtered water. The media were created by combining the components and heating them with restlessness until they boiled. The media was then autoclaved at 121\u2009\u00b0C for 20\u2009min. Following cooling, the agar was poured onto a flat surface in sterile plates of petri, which were held in a depth of 4\u2009\u00b0C. Sabouraud dextrose agar containing 40\u2009g dextrose, 10\u2009g of peptone and 20\u2009g of agar per liter of distilled water was the medium used for fungal production. As mentioned above, the media was prepared.8\u2009CFU/mL.McFarland turbidity standards were used to standardise the inoculums. McFarland 0.5 standard was used for turbidity comparison, which offers a turbidity similar to that of a bacterial suspension containing 1.5\u2009\u00d7\u200910For inoculation of normal bacterial cultures, a plate containing Muller Hinton agar was inserted with 6-mm opening. A was negative control, B was loaded with safrole oil natural, C was filled with the safrole oil nanoemulgel and D was eventually packed with 500\u2009mg of amoxicillin dissolved with 10\u2009mL of water in the bacterial test. The plate was incubated at 35\u2009\u00b0C for 24\u2009h. The fungal assay consisted of 100,000\u2009IU nystatin and was incubated for 48\u2009h at 37\u2009\u00b0C. Antimicrobial activity was measured using the diameter of the inhibition zone.2 at 37\u2009\u00b0C in a moist environment. Cells were plated on a 96-well substrate at 2.6\u2009\u00d7\u2009104 cells/well. Various concentrations of the safrole oil and safrole oil nanoemulgel were incubated for 24\u2009h, and after 48\u2009h cell viability was measured in compliance with the guidance of the supplier  by a CellTilter96\u00ae Aqueous One Solution Cell Proliferation (MTS) Assay. In brief, 20\u2009\u03bcL of MTS solution was applied at the end of treatment per 100\u2009\u03bcL of medium and incubated at 3 wells [The RPMI-1640 media was used to culture hepatocellular carcinoma cells (Hep3B cells) and combined with 10% fetal bovine serum, 1% Penicillin/Streptomycin antibiotics and 1% l-glutamine. Cells were cultivated with 5% CO 3 wells .p-value was <\u20090.05, the statistical meaning was taken into consideration.The findings from safrole oil and safrole nanoemulgel were expressed as the mean\u2009\u00b1\u2009standard deviation (SD). The T-test was used to compare pooled results. When the 50 of 50.28\u2009\u00b1\u20090.44\u2009\u03bcg/mL for safrole oil and an IC50 of 1.55\u2009\u00b1\u20090.32\u2009\u03bcg/mL for Trolox.The antioxidant activity of safrole oil is related to the scavenging activity of free radicals, it was comparatively lower than the Trolox reference standard, which is known to have high antioxidant activity. However, the results shown in Fig.\u00a050 values of 11.36\u2009\u00b1\u20090.67\u2009\u03bcg/ml, in comparison with acarbose, which is the reference compound that had an IC50 value of 5.88\u2009\u00b1\u20090.63\u2009\u03bcg/mL.The \u03b1-amylase inhibitory activity of safrole oil was determined and compared with the positive control (acarbose). Figure\u00a0To choice an appropriate formulation for a nanoemulsion with droplet size below 200\u2009nm and a PDI of less than 0.3, two separate compilations of surfactant/co-surfactant with safrole oil were utilized to create the ternary phase diagrams (Tween 80/Span 80 and Tween 20/Span 80). Figure\u00a0Both surfactants have shown a different behaviour during the emulsion preparation. Tween 80 was capable of producing a nanoemulsion with droplet sizes of less than 200\u2009nm, while Tween 20 produced a nanoemulsion with a droplet size greater than 200\u2009nm. However, the ideal nanoemulsion composition was chosen not only based on its scale but also the oil concentration and the PDI in the selected formulations, as can be seen in Table\u00a0a shows a comparison of the average droplet size with nanoemulsion  and nanoemulgel formulations with varying concentrations of Carbopol 940. Figure 4b displays the size distribution of nanoemulgel formulations containing safrole oil.The findings regarding the average droplet size that the developed drugs are on the sub-micron scale with a low PDI, indicating a narrow distribution of droplet size. The findings regarding the optimum formulation for the nanoemulsion were compared with the results of nanoemulgel formulations obtained with a mean droplet size and PDI. Figure\u00a04Depending on the zeta potential test, it became apparent that all nanoemulgel formulations with safrole had a zeta potential below 30. The results are reported in Fig.\u00a0Typically, the flow properties of semisolid pharmaceutical products are normally regulated and measured by the rheological characteristics, which are critical to ensure the consistency and effectiveness of the formulation. The rheological analysis of the safrole nanoemulgel formulations is shown in Fig.\u00a0Antimicrobial results obtained from this work show that safrole oil has various bioactivity against the growth of microbes  and as shown by the positive control (amoxicillin). The safrole oil showed no activity against E. coli and Klebsiella and partial resistance against S. aureus and MRSA. However, it showed good bacterial inhibition against Enterococcus faecium, Pseudomonas aeruginosa and Proteus vulgaris. However, it showed no activity against E. coli and only partial activity against Klebsiella. The results of the in vitro antibacterial activities were calculated in terms of the zone of inhibition diameter (mm), and they are recorded in Table\u00a0The The MTS assay was used to determine the cytotoxicity effect of pure safrole oil and the safrole nanoemulgel dosage form on Hep3B hepatocellular carcinoma cells. As shown in Fig.\u00a0From ancient time until now, many of the important and common pharmaceuticals have been used for a wide range of medicinal purposes. In the last two decades, the use of herbal products, known as medicinal agents, in mainstream health systems, has increased. Popular herbal remedies known as \u201cold wives\u201d have been clinically accepted and provide possible bioactive compounds for even the deadliest illnesses, such as cancer, atherosclerosis, diabetes, and Alzheimer\u2019s diseases. Clearly, the medicinal herbal discovery and isolation of their active molecules actually entails large scientific research centers and also multinational pharmaceutical companies.Medicinal plants are known to be important sources of natural antioxidants in traditional medicine . AntioxiPiper auritum, which showed antioxidant activity [C. macrocarpum essential oil found out the safrole was the major component of this oil (54.5\u201359.5%) and demonstrated significant activity on DPPH [In a study conducted by Salleh and Ahmed, the authors reported safrole to be the precursor of many products, such as activity . Another on DPPH . Studies on DPPH . These i50 of safrole oil proves that safrole oil has potent \u03b1-amylase inhibitory activity and that it could be an excellent candidate for manufacturing potential antidiabetic herbal supplements.Amylase is a carbohydrate digestion enzyme with several forms, one of which is alpha-amylase, which is produced by the salivary and pancreas gland. Diabetes mellitus (DM) is a chronic condition that has become a large burden on the health system, and its prevalence has increased dramatically because of the population\u2019s sedentary lifestyle and obesity. One approach proposed in the treatment of type II DM is to limit the ingestion of glucose into the intestine, and this is accomplished through medications that act by inhibiting the metabolic enzymes involved in the mechanism of digestion of specific glucose sugars, namely \u03b1-amylase. This results in successful outcomes in term of a reduction in the glucose levels in blood and in the treatment of the disease. Several plants demonstrate the distinct inhibitory action of this enzyme, which may be a healthy substitute and a potential source of new medicines . The comA ternary phase diagram was established for identifying the self-nanoemulsion regions and for choosing the suitable surfactant, and co-surfactant concentrations used in the formulation of an optimum safrole nanoemulsion. The diagram was drawn to demonstrate the best formulation for achieving droplet sizes of less than 200\u2009nm. Due to the perfect combination of solubility, The hydrophile-lipophile balance (HLB) values, and molecular geometry, a high nanoemulsion region of safrole oil was probable, as verified by Mayer and his team .Droplet size was a key factor in the success of the nanoemulsion since the rate of release and absorption could be influenced. Furthermore, because of the smaller particle size and the large interfacial region, the bioavailability improved rapidly if the droplet was less than 200\u2009nm. The right mixture of surfactant and co-surfactant resulted in a smaller globule size, leading to a higher mechanical barrier that explained the prevention of globule aggregation .The PDI is another parameter with a value that is similar to the droplet size in the nanoemulsion formula. The distribution of the droplet size is often called the homogeneity measurement distribution. As the PDI value small values, it displays homogeneity (narrow distribution of the particles size) and better emulsion with greater physical stability.Nanoemulgels with safrole oil were made with a variety of Carbopol 940 concentrations . Carbopol is a gelling agent ingredient that gives the formulation swelling properties . The tecThere was no substantial variation between the size of the droplets and the PDI of the safrole oil in the form of a nanoemulsion or when it was converted to a nanoemulgel. The measured stability is defined as the magnitude of the zeta potential in the submicron preparation. When the droplets have high negative and positive zeta potential, the droplets will repel each other, and if the values are low, there is dispersal instability since they are not stopped by force.There is a boundary line between unstable and stable dispersions, which is usually +\u200930 or\u2009\u2212\u200930\u2009mV . The zetIn semisolid preparations, rheological measurements are important for mechanically describing the system (flow properties) and for controlling the consistency, which is necessary to guarantee the performance and durability of the formulation. A higher viscosity can affect the release of drugs and their bioavailability due to the decreased drug delivery from the vehicle . The finWithania somnifera cream on microbial growth. He found an increase in Withania somnifera cream silver nanoparticle penetration, which led to growth inhibition. Furthermore, the packaging of nanoparticles in bacteria increases the concentration of medicines that enter bacteria by increasing the contact between medicines and bacteria [The safrole nanoemulgel displayed a higher and enhanced zone of inhibition compared to the pure oil antibacterial action. There are many reasons behind these findings. First, since the nano-droplets are small in size and have a huge surface, they result in greater penetration and action . Marslinbacteria . In 2019bacteria .The cytotoxicity test is the way certain medications and chemicals can be used to evaluate their impacts on cancer cells in different action mechanisms and on which cell lines can act as a future treatment for cancer. The cytotoxic activity of safrole oil and the safrole nanoemulgel was tested against Hep3B cancer cells (Hep3B cells are derived from liver cancer). It is known to be the most common type of primary liver cancer, and it is the leading cause of cancer-related mortality worldwide , 61.A study conducted by Catalan and his team on nine derivatives from safrole assessed the antiproliferative effect using different human cell lines. Some safrole derivatives demonstrated better antiproliferative effects than the parent compound on breast cancer cell lines (MCF-7) and a colorectal cancer cell line (DLD-1). These findings support the findings of the current study since safrole showed anticancer activity on different cancer cell lines . In anotThe techniques of nano-formulation in relation to conventional drug delivery systems are proposed for promising alternatives since these include exclusive drug supplies. These findings were proved by several studies, Taghipour et al., conducted a study on the anticancer activity of polyphenol nanoformulations as bioactive agents and concluded that the advantages of natural polyphenol against cancer can be potentiated through nanonisation through multiple pathways. The nanoformulations led to increased antineoplasty, higher intracellular polyphenol concentration, slow and long-term drug release, and improved proapoptotic activity against tumour cells .The present study demonstrated the potential antidiabetic, antioxidant, antimicrobial, and anticancer activities of safrole oil. It can be concluded that safrole oil has potent \u03b1-amylase and oxidant inhibitory activity compared to acarbose and Trolox. In addition, the safrole oil nanoemulgel was prepared using the self-emulsifying technique with droplet sizes below 200\u2009nm and showed high stability, as indicated by its low zeta potential and narrow size distribution. The safrole nanoemulgel improved the activity against different microbial species when compared with pure safrole oil. Moreover, regarding the cytotoxicity assay, safrole oil was tested against a human cancer cell line (Hep3B) and showed significant cytotoxic activity against hepatocellular carcinoma cells, and this activity improved significantly when safrole oil was used in the form of a nanoemulgel. This study suggests that herbal nano-formulations containing safrole have the potential to treat oxidative stress and diabetes and can be used for cancer treatments. They can also be utilised for the development of herbal medicines or food supplements for commercial pharmaceutical use."}
+{"text": "Commercial, recreational, and indigenous fisheries are critical to coastal economies and communities in the United States. For over three decades, the federal government has formally recognized the impact of fishery disasters via federal declarations. Despite these impacts, national syntheses of the dynamics, impacts, and causes of fishery disasters are lacking. We developed a nationwide Federal Fishery Disaster database using National Oceanic and Atmospheric Administration (NOAA) fishery disaster declarations and fishery revenue data. From 1989-2020, there were 71 federally approved fishery disasters (eleven are pending), which spanned every federal fisheries management region and coastal state in the country. To date, we estimate fishery disasters resulted in $2B (2019 USD) in Congressional allocations, and an additional, conservative estimate of $3.2B (2019 USD) in direct revenue loss. Despite this scale of impact, the disaster assistance process is largely ad hoc and lacks sufficient detail to properly assess allocation fairness and benefit. Nonetheless, fishery disasters increased in frequency over time, and the causes of disasters included a broad range of anthropogenic and environmental factors, with a recent shift to disasters now almost exclusively caused by extreme environmental events . Nationwide, 84.5% of fishery disasters were either partially or entirely attributed to extreme environmental events. As climate change drives higher rates of such extreme events, and as natural disaster assistance requests reach an all-time high, the federal system for fisheries disaster declaration and mitigation must evolve in order to effectively protect both fisheries sustainability and societal benefit. Marine fisheries represent an important part of the United States (US) economy, employment, and food security, generating $244B in annual revenue, providing 1.7M part- and full-time jobs , and supRecent improvements in our understanding of linkages between fisheries, ecosystems, climate, communities, and economies indicate that disaster impacts can have rapid and lasting effects . When USFishery disasters are approved on a case-by-case basis by the US Secretary of Commerce under the jurisdiction of sec312(a) and 315 of the Magnuson-Stevens Fishery Conservation and Management Act  and \u00a71864,), as well as sec308(b and d) of the Interjurisdictional Fisheries Act . Fishery disaster requests are typically filed by either state governor(s) or elected or duly appointed representative(s) of affected indigenous fishing communities. For a disaster request to be approved, three fundamental criteria must be met: (1) there must be an identified state, federal, or Native American fishery resource disaster associated with either species population decline or loss of fishing infrastructure, (2) it must have an \u201callowable cause\u201d , and (3)Federal Fishery Disaster review and assistance implementation timelines follow a six-step process: (1) disaster event, (2) request for assistance, (3) analysis and determination, (4) appropriation, (5) allocation, and (6) a grant out for assistance . DisasteThe thirty-year history and national scale of fishery disasters in the US indicate a clear need for a nationwide synthesis that can allow fisheries scientists, managers, and policymakers to advance a more adaptive fisheries management approach in a new disaster-specific context. To date, federal fisheries science and management have focused largely on reducing the number of stocks that are overfished or experiencing overfishing. Meanwhile, US Federal Fishery Disasters have been processed on a case-by-case basis with a lack of peer-reviewed science dedicated to comprehensive learning across all disasters. Our aim was to produce a national synthesis that answers how the frequency and causes of disasters have changed since the inception of the assistance program, and to estimate the economic impacts of disasters at both national and regional scales. This will not only inform disaster-related fishery management and policy decisions, but it will expand on our understanding that overfished/overfishing stock metrics, such as the NOAA Fish Stock Sustainability Index (FSSI), should be the primary metric with which we evaluate national fishery management success. To illustrate the scale and trends of disasters and their associated economic impacts, we developed a national and regional database of all Federal Fishery Disasters in the US and synthesized the associated spatial and temporal data reported in US federal disaster records. We used the frequency of disasters and common details across federal disaster requests and approvals to analyze temporal trends and to create a standardized metric for annual and region-specific disaster impacts. We estimated economic impacts based on Congressional allocations for disaster assistance as well as direct fishing revenue loss using NOAA and state-level landings and revenue data. In so doing, we highlight a recent shift in disaster frequency and causes; we discuss inefficiencies in the request, determination, and implementation processes; and we open a discussion for more proactive solutions to managing fishery disasters. This is especially critical when federal disaster assistance requests reached an all-time high , and whehttps://www.fisheries.noaa.gov/national/funding-and-financial-services/fishery-disaster-determinations, and all fishery landings and revenue data are available via the NOAA Fisheries One Stop Shop (FOSS) website  we assessed trends in the frequency of disaster determinations per year , and (2) we assessed trends in the number of disasters per year. In both cases, we fit the following Poisson regression generalized linear model (GLM) with a log link, and scaled (Z-scored) year as a fixed continuous effect to model the count of disaster determinations or ongoing disasters per year. Given that the mean and variance for both response variables are approximately equivalent, we feel the assumption of Poisson distributed data is appropriate . The frequency of disasters will likely vary by management zone  in part because different regions are more likely to experience different types of disasters . To address the potential for non-independence between zones, we also fit the following Poisson generalized linear mixed models (GLMM) with a fixed continuous effect of year  and random categorical effects of management zones, using the ary lme4 . Model fpolr function in the R library MASS , hurricanes, warming events, or oil spills, were then condensed into three ordered categories: environmental, combination of environmental and anthropogenic, and anthropogenic. Disasters resulting from hurricanes or HABs were labeled as environmental, but disasters resulting from overfishing or oil spills were labeled as anthropogenic. Because the publicly reported federal disaster declarations did not often include a cited rationale for cause determinations, with many causes labeled arbitrarily as \u2018natural disaster of unknown causes,\u2019 we used peer-reviewed fisheries literature and federal fisheries reports as additional sources for cause classifications. This allowed a more detailed understanding and documentation of the causes of each disaster. For example, causes of West Coast salmon fishery disasters were typically classified as a combination of both environmental  and anthropogenic  factors due to the wide variety of well documented impacts on salmon stocks in each case. Once causes were assigned, disaster records were then separated by cause, year, and management region to highlight not only reasons why disasters are occurring, but also whether the reasons behind them are changing over time. To assess trends in the frequency of these categorical assignment through time, we performed an ordinal logistic regression with the category of each disaster as the response, and year as a fixed continuous effect. As above, we also fit a mixed effects ordinal logistic regression with fixed effect of year and random effects of management zone. We fit the fixed effects model using the ary MASS , and the ordinal .Economic impact associated with each fishery disaster was measured using the federal assistance dollar amount allocated by Congress, as well as estimates of the direct fishing revenue impact. All dollar amounts were converted from nominal to real dollars (2019 USD) using an inflation multiplier from the US Bureau of Labor Statistics CPI inflation Calculator for the year in which the disaster occurred . The fedTo estimate the direct revenue impact associated with each fishery disaster\u2014defined as revenue loss associated only with changes in landings and not throughout the supply chain\u2014we evaluated each determination in accordance with NOAA Fisheries policy guidance on economic thresholds required for a successful determination ; the difn\u00a0=\u00a079). Non-parametric bootstrapping techniques were used to estimate the sampling distribution of the median direct revenue impact and associated measures of uncertainty because the obtained revenue impact estimates were non-normally distributed  . For each sample statistic, 100,000 replications were performed using the \u201cBoot\u201d package in R programming language , spanning the impact period from 1989\u20132019, during which time 71 disasters were federally approved . Congreshttps://www.fisheries.noaa.gov/national/noaa-fisheries-coronavirus-covid-19-update) to approve the allocation of an additional $300M for fisheries as a result of the ongoing COVID-19 pandemic.For the purposes of this study, all economic estimates are reflected in 2019 USD, with eleven 2020 assistance requests still pending. The total amount allocated by Congress throughout the entire federal disaster assistance program from 1994\u20132020 was over $1.99B . This dohttp://www.fisheries.noaa.gov/regions) obtained the most assistance since the inception of the program , followed by the West Coast , Alaska , Greater Atlantic , and Pacific Islands . Overall, the entire western US  accounted for 50.3% of all approved US disaster allocations (excluding pending disasters), while the Southeast and Greater Atlantic Regions accounted for 49.7% of allocations , and ranged from $0\u2013$300M annually (mean of $73.8M\u00a0\u00b1\u00a0$96.1M SD). The Southeast Region (ocations .increase in revenue in the year(s) of the disaster reported on the online portal. Omitting these 12 cases  results in a median percent change in revenue of \u221260.6 (IQR range = \u221274.1 \u2013\u221224.8). The median revenue loss in a disaster year was \u2212$3.5M (n\u00a0=\u00a079), with a bootstrapped 95% confidence interval of [\u2212$5.6 M \u2013$4.8 M]  across the 63 disasters for which data were attainable. Omitting the 12 cases where revenue increased results in a median revenue loss in a disaster year of \u2212$11.6M (n\u00a0=\u00a062), with a bootstrapped 95% confidence interval of [\u2212$18.7 M \u2013\u2212$7.6 M] . The Alaska Region accounted for 66.2% of the revenue impact overall, followed by the West Coast Region (18.1%), Southeast Region (10.7%), Greater Atlantic (5.1%), and Pacific Islands (<0.01%) .We generated direct revenue loss estimates\u2014defined as revenue loss associated only with changes in landings\u2014for 63 of the 71 approved fishery disasters, which amounted to over $3.2B in revenue loss from 1994\u20132019, with additional significant revenue losses anticipated in 2020 due to the ongoing COVID-19 pandemic. These estimates were non-normally distributed, motivating the use of non-parametric statistical techniques. The median percent change in revenue during a disaster relative to the mean annual revenue over the preceding five-year period was \u221238.3 (IQR range = \u221270.4 \u2013\u22121.3) across the 63 disasters for which data were attainable . We alsohttps://github.com/vrsaccomanno/federal-fish-disasters.git) strongly indicate that disasters are increasing over time . We are therefore confident that the statistical findings from our GLM models are robust.It is possible that auto-correlation could manifest in the generative processes underlying our time-ordered data. That is, the underlying causes of disasters such as climate driven storm events or mis-management may carry momentum through time. Such a lack of independence between data points would violate the assumptions of the statistical methods we applied. However, we found no evidence of this based on an analysis of autocovariance in the residuals of the linear model regressing the number of disasters across years. In fact, the correlation at lag 1  was \u223c0, and no lag regardless of size had a correlation of >\u20140.-2\u2014 , followed by the Southeast (18/71), Alaska (14/71), Greater Atlantic (10/41), and Pacific Islands (1/71) regions. Overall, the entire western US (including one approved disaster in the Pacific Islands) accounted for 60.6% of all approved US disasters, while the Gulf Coast and east coast accounted for 39.4% of approved disasters.Since the 1990s, the predominant cause of fisheries disasters has shifted from anthropogenic to environmental in nature, with extreme environmental events reflecting 95.3% of the revenue loss during the most recent years (2014\u20132019), increasing from 38.5% during the first five years (1994\u20131998). Disaster causes were aggregated into three condensed categories: anthropogenic, environmental, or a combination of both. Marine heatwaves accounted for the most disasters overall, followed by hurricanes, overfishing, low returns , and HABs. Disasters caused by \u201clow returns\u201d in salmon fisheries were typically due to a combination of anthropogenic and environmental factors. Both the fixed and random effects logistic regression models performed similarly in terms of AIC scores , with boThe average time to fully process a disaster declaration was approximately 2.1 years (\u00b1 1.4 years SD), with a maximum total process time of six years, and one disaster request from 2005 that remains undetermined. The time period from the disaster occurrence to the formal assistance request filing averaged 6.4 months (\u00b1 12.0 months SD), with 66.2% of requests being filed within 1 year after the disaster, and 87.7% filed within 2 years after the disaster. Once the request was filed, determination time (time between steps 2 and 3 of the 6-step process) lasted as long as 4.0 years (mean of 8.3\u00a0\u00b1\u00a08.7 months SD). One disaster approval occurred 92 days before the request was formally filed (disaster number 29: Hurricane Katrina).Federal Fisheries Disasters have generated large, yet remarkably variable revenue impacts throughout the US during the last three decades, and the frequency of disasters is increasing over time. In turn, the US government has spent billions of dollars to mitigate these impacts. In the early days of fishery disaster determinations, these impacts were largely due to mixed factors and relatively poor fisheries management. Fortunately, such direct anthropogenic causes of disasters appear to be on the wane as fisheries management improves e.g., . HoweverDespite the multi-billion dollar economic impacts, we are likely underestimating the true magnitude of the economic effects of Federal Fishery Disasters. First, our economic analyses only include estimates for 63 of the 71 approved fishery disasters due to data limitations, and there are still eleven pending disaster requests that were also not included in the analysis. Second, our analyses represent fisheries that were formally included in federal assistance requests, but there may be impacted fisheries/communities that never applied for assistance. Third, our revenue impact estimates only included losses during the disaster year(s) as reported on the online portal, not potential losses in subsequent years due to delayed impacts. Fourth, our impact analyses were based on the NOAA disaster determination model that uses direct commercial fishing revenue as the primary impact metric, but indirect economic losses across supply chains are undoubtedly larger . In addiThe magnitude of economic impacts of fishery disasters is clearly a problem, but the lack of standardized reporting with sufficient detail in disaster requests and determinations creates significant challenges for implementing solutions. For example, the median revenue loss across all approved disasters (38.3% loss) was notably less than the 80% threshold that triggers federal determination of a commercial fishery failure, and is just above the 35% threshold that allows further review according to federal guidelines. We also identified 12 cases of federally approved disasters in which fishery-specific direct revenue actually increased during the disaster year relative to the previous 5-year average, a surprising finding given that an increase in revenue in a disaster year does not meet NOAA Fisheries policy guidance on economic thresholds required for a successful determination . Our conservative estimates of economic impacts may not be capturing the full scale of impact, but the consistency in the economic metric used between our study and the federal determination process suggests a need for improved economic data collection and federal reporting. Improved reporting would also provide critically needed clarification about specifically which fisheries are impacted. For example, fishery disasters ranged in spatial scale from individual rivers to multiple states; they might impact only one Native American community or several; and they might affect only one fishery or virtually every fishery in a state or region. Enumerating disaster impact by specific fisheries is thus problematic because information about which species, fisheries, and communities were affected was not always provided in federal disaster assistance requests and determinations. These details could facilitate improved estimations of impact, more transparency when and where the Secretary of Commerce determines there are special circumstances that may justify using a lower threshold of percent revenue loss in disaster determinations, and a more streamlined and transparent process for estimating and allocating assistance to the most heavily impacted fisheries and fishing communities.Problems also exist with assistance processing lags and opaque determination process. Across all Federal Fishery Disaster declarations, total federal process duration . A more The federal response to the growing impacts of fishery disasters clearly needs reform, but the lack of standardized reporting in Federal Fishery Disaster requests and determinations makes identifying solutions difficult. Our finding that many of the published determinations failed to list the specific commercial fishery(ies) used to make the determination is problematic. While disasters ranged in scale from individual fish stocks and fisheries to multiple states and fishing communities, the details provided in determination documents do not reflect the complexity of disaster impacts. Transparent, detailed, and mechanistic descriptions of economic impact determinations are necessary for the Secretary of Commerce to determine if there are special circumstances that may justify using a lower threshold of percent revenue loss in Federal Fishery Disaster determinations. To achieve this, public reporting of a full economic impact assessment in each fishery would undoubtedly cause prohibitive slowing of the disaster assistance process, but publicly reporting the data that are already behind each disaster determination would achieve a greater level of transparency and impact detail while adding little to the process and timeline. In addition, there is need for a more streamlined, fair, and transparent process for allocating assistance . While cThis study represents a national-scale view of fishery disasters, a problem that has worsened over time, and has cascading socioeconomic impacts to society. This study also highlights a clear need for consideration of ecosystem and cultural impacts of fishery disasters that were not the focus of this study. For example, Native American fisheries represent a far more extensive history of coastal harvest and culture than commercial or recreational fisheries, illustrating the intimate connection possible between nature and people that span millennia. However, in three decades, 29 federally approved (and four pending) disasters have impacted salmon fisheries in the Pacific northwest . Over haAs currently structured, the legal framework for declaring Federal Fishery Disasters can depend on a range of economic impact metrics that typically go unreported in disaster determinations, but Congressional appropriations depend on demonstrating a direct loss of revenue to commercial fisheries. However, there is no question that the broader market and non-market value of fisheries losses grossly outweigh the direct revenue loss . These aAs disaster impacts to fishing communities worsen via increased disaster frequencies, federal response times to mitigate these impacts continue to lag by years in most cases . DevelopThere has never been a better time to identify and implement more effective government response to disasters. The COVID-19 pandemic has added a new layer of impacts across virtually every sector of the global economy, including fisheries . By Sept10.7717/peerj.11186/supp-1Supplemental Information 1Click here for additional data file."}
+{"text": "Premature ovarian insufficiency (POI), a condition affecting up to 1% of women by the age of 40 years, is characterized by an extremely low chance of spontaneous pregnancy. Currently, fertility restoration options are virtually nonexistent for this population. To become pregnant, the only solution is egg donation. Interestingly, animal studies have provided encouraging results in terms of fertility restoration, and consequently, research has begun into the most promising approaches for women suffering from POI. The PubMed database was searched for studies in which techniques aiming at restoring fertility in women with spontaneous POI were tested. Although robust studies are lacking, the literature suggests a positive effect of certain techniques on fertility restoration in women with POI. The most promising approaches seem to be intraovarian injection of autologous platelet-rich plasma or of mesenchymal stem cells. In addition to these, in vitro and mechanical activation of dormant follicles and etiology-driven therapies have also been studied with mixed results. No safety concerns were raised in these studies. The absence of robust studies does not allow us to draw meaningful conclusions on the efficacy or superiority of any single technique at this stage, and so research in this area should continue using robust study designs, i.e., multicenter randomized controlled trials including sufficient subjects to achieve statistical power.  Premature ovarian insufficiency (POI) was defined in 2016 by the European Society of Human Reproduction and Embryology (ESHRE) as the onset of menstrual disturbance (oligomenorrhea or amenorrhea) for at least 4 months, associated with serum follicle stimulating hormone (FSH) levels \u2265 25 IU/mL measured at least twice with a 4-week interval, before the age of 40 years [Clinicians distinguish iatrogenic POI, which is the consequence of oncological treatments (chemo- and/or radiotherapy) or ovarian surgery performed during premenopausal stages, from spontaneous POI, whose etiology is often complex. It may be the consequence of different genetic mutations or of autoimmunity . However, in 90% of the cases, no etiology is found, a condition referred to as idiopathic POI . SpontanApproaches to preserve fertility in cases of iatrogenic POI have been developed and have already shown efficacy . HoweverSome research groups are experimenting with new strategies in the hope of re-activating the small pool of quiescent follicles that is still present in the ovaries of women with spontaneous POI ,5. The aWe performed a PubMed search with the terms \u201cpremature ovarian insufficiency\u201d or \u201cpremature ovarian failure\u201d and \u201cfertility treatment\u201d, \u201cfertility restoration\u201d, or \u201cfertility rejuvenation\u201d with the \u201chuman\u201d limit. The main criteria for the study selection were: interventional studies specifically evaluating strategy(ies) to restore fertility in a population of women suffering from spontaneous POI, and reports published in English from 1 January 2011 to 6 August 2021, with the exclusion of reviews and meta-analyses. Out of the 437 articles retrieved, 392 were excluded based on their title and/or abstract . After rAfter centrifugation of a subject\u2019s whole blood, it is possible to collect plasma that has high concentrations of platelets, called platelet-rich plasma (PRP), which may subsequently be reinjected into the subject at specific injured sites, a process referred to as autologous PRP injection. This process has been known for more than 50 years, and has previously demonstrated a certain degree of efficacy in some health conditions requiring tissue healing and regeneration, notably in orthopedics, cardiothoracic surgery, plastic surgery, dermatology, dentistry, and diabetic wound healing . The mecSfakianoudis et al. were pioneers in studying the effects of PRP in women with POI. They initially reported, in two publications, the cases of four women presenting with POI who had rejected the option of oocyte donation ,9. The sFollowing these encouraging results, the same research group conducted a pilot uncontrolled study in which 30 women diagnosed with POI underwent transvaginal intraovarian autologous PRP injection . RecentlInterestingly, in both studies, a lower FSH level and a higher AMH level prior to treatment were positively correlated with a better outcome of the technique. Therefore, the authors suggested that intraovarian PRP injection helps by stimulating existing pre-antral/early antral follicles. The presence of these follicles could thus be a prerequisite for conditioning the magnitude of the response. No safety concerns were reported in these studies by the authors.Over the last 10 years, numerous preclinical studies conducted in animal models of POI have suggested the benefit of stem-cell-based therapy in restoring ovarian function. Most of these studies were conducted in rodents with chemotherapy-induced POI. Stem cells from different sources have been tested, but the most promising results were seemingly obtained with stem cells of mesenchymal origin (MSCs), which can notably be found in amniotic fluid, menstrual blood, the umbilical cord, bone marrow, and adipose tissue . In almoThe mechanism of action of MSCs in restoring damaged tissues is extremely complex and still under active investigation. Although beyond the scope of this article, based on current knowledge, we may summarize that MSCs\u2019 repair potential relies on two properties: first, the differentiation potential, and second, the secretome ,14. The In addition to the large number of preclinical studies, only five clinical studies have been published to date on women with POI: three single-arm studies and two controlled studies (one of them randomized). These studies are summarized in The basic principle behind this method relies on in vitro activation of the dormant primordial follicles that persist in a certain percentage of women with spontaneous POI, followed by regrafting the activated ovarian tissue back into the subject. Before initiating a study in humans, Kawamura et al. demonstrated, using murine and human ovarian tissue, the possibility of activating primordial follicle growth in vitro by two different approaches. First, by fragmentating the ovarian cortex tissue, the Hippo signaling pathway (a cascade resulting in negative growth stimulation of the ovaries) is disrupted. Consequently, growth factors increase in the fragmented ovarian tissue, which promotes follicle development. The second approach consisted of incubating the ovarian tissue with two follicle-activating drugs, namely, an inhibitor of phosphatase with TENsin homology deleted in chromosome 10 (PTEN) and an activator of phosphatidynositol-3-kinase (PI3 kinase) ,23. The The single-arm clinical study included 37 participants with POI who agreed to undergo laparoscopic removal of one (or both) ovary(ies) and subsequent re-implantation of fragmented ovarian tissues previously incubated with PI3 kinase and PTEN ,24. FollBefore performing the in vitro activation, a small part of the ovarian cortex of all the participants was histologically analyzed to detect the presence of residual follicles. No follicles could be seen in 17 women, generally in those who had developed POI more than 5 years before the ovariectomy. In these women, after transplantation of the in vitro activated ovarian tissue, no antral follicle was detected (failure of the technique). This provides interesting information: the number of residual activatable follicles decreases over time after the cessation of menses; therefore, fertility restoration attempts should be started as soon as the diagnosis of POI is established in order to increase the success rate.As described in the previous section, ovarian cortical fragmentation seems to stimulate follicle growth by disrupting the Hippo signaling pathway. It was hypothesized by Zhang et al. that performing local injury to the ovarian cortex could be sufficient to disrupt the Hippo signaling pathway . They enAlthough somewhat disappointing, the results of this experimental study confirm the important information already suggested in other studies: the success of the techniques largely depends on the presence of existing follicles in the ovaries.As mentioned above, in most cases, no underlying cause was found to explain POI. However, a certain percentage of women present autoimmunity directed against the ovarian tissue. One might therefore hypothesize that treating the underlying condition could improve ovarian activity. A few reports have suggested that treatment with corticosteroids may improve fertility in women with autoimmune POI. However, corticotherapy is not devoid of unwanted and potentially serious side effects . Safer iThe goal of this work was to describe some innovative approaches in the last decade to restoring fertility in women presenting with spontaneous POI. It is important to recognize the interest in research in this field, where, currently, the only hope for the patients to become pregnant remains egg donation, a solution that is not always accepted by the woman or her partner. In addition, egg donation is not legal in some countries. In that case, adoption becomes the single solution that can be offered to these patients .The ground for research aimed at restoring fertility in women with POI has been laid by studies conducted on animal models, which delivered promising results, opening the door to some hope for human medicine. In this last decade, a series of clinical studies have therefore been conducted in women presenting with POI. For the moment, the most studied techniques are intraovarian injection of PRP and use of MSCs. Some interest was also paid to mechanical techniques aimed at stimulating dormant follicles in the ovaries (in situ and/or in vitro).Although these trials seem to deliver promising results, at this stage, the lack of robust studies prevents us from drawing meaningful conclusions on the relative efficacy or superiority of the various techniques. As shown in this article, the currently available clinical data were generally obtained through case reports or single-arm studies. Only two controlled studies were found, in which no sample size seems to have been calculated, which precludes them from delivering statistically significant data. However, it is known that ovulation has an approximately four percent chance per month to spontaneously occur in women with POI, as a consequence of which spontaneous pregnancies have been reported in these patients . The phePerforming well-conducted randomized controlled studies appears to be crucial, and probably necessitates a large population of patients only achievable in multicentric studies. Large-scale international collaboration could be a good way to facilitate recruitment and to achieve, in a timely fashion, the required number of participants. We could also consider building an international database that would include all the POI patients of the participating centers, as has been performed to improve research on other rare diseases. The frequent lack of knowledge regarding the underlying causes of the disease is another difficulty encountered in this field. One might suspect that defining specific pathologic groups could help to identify the best approach depending on the POI cause. This is notably illustrated by the anecdotal case report showing fertility improvement in a woman with autoimmune POI treated with immunosuppressive agents. Here also, an international database could facilitate the recruitment of patients depending on their underlying pathology when the latter is known.As shown in a couple of articles described above, one of the most important parameters that seems to condition response to treatment could be the presence of remaining follicles in the ovaries at the time of study. Histological analysis of the ovarian cortex seems therefore a good approach to selecting patients. Less-invasive approaches such as dosage of AMH could also be helpful, even though it seems to be of less importance . CrucialNo adverse events were reported in any of the studies reviewed in this article. It should however be noted that these techniques use transvaginal or laparoscopic ovarian manipulations, which are not devoid of undesirable side effects. In addition, some specific concerns linked to the clinical use of stem cells must be considered . Among tFinally, in this very early phase of clinical research, it is particularly important for researchers to report the results of their studies, including the less- or unsuccessful ones. Indeed, this represents an important way to advance research progress by avoiding the repetition of failed approaches. Therefore, unsuccessful studies are just as instructive as successful ones, and their publication should be encouraged by the scientific community.Research in the field of ovarian function restoration in women with spontaneous POI is of high interest, but requires well-conducted, randomized controlled studies with sufficient statistical power, probably using multicentric international designs."}
+{"text": "The authors investigate the association of breakfast skipping and its interaction with a dietary inflammatory index (DII) with the severity of psychological disorders. A total of 2876 Iranian general adults were enrolled in this cross-sectional study. Psychological problems profile score was calculated using the regression method in the framework of factor analysis based on depression, anxiety and psychological distress. The higher scores indicate more severity of mental problem. The frequency of breakfast eating in a week was assessed. Dietary intakes were assessed using a food-frequency questionnaire and twenty-seven items were included in the calculation of DII. In the crude model, individuals who ate breakfast seldom had the highest odds for having worse psychological problems profile . Adjustment for various confounders did not change the associations . In the adjusted multinomial logistic regression model, participants with high DII (>median) who skipped breakfast had highest risk of being in the higher tertiles of psychological problems profile compared with those who had low DII (<median) and ate breakfast . Similar results were observed in women and men regarding the impact of breakfast skipping alone and interaction with DII on scores of psychological problems profile. Breakfast skipping is associated with higher risk of psychological problems. Similar findings were obtained in the stratified analysis by sex. Our findings confirmed that the DII and breakfast skipping are associated with mental health, interactionally. Further longitudinal studies are needed to confirm the true link between breakfast skipping and psychological problems. Although there are many possible efficient ways to treat mental disorders, half of all Americans who suffer from a severe mental disorder do not receive treatment. In addition, due to the direct link between mental illness and metabolic disorders, taking some actions to prevent is more helpful rather than treating. Accordingly, the identification of some relevant lifestyle-related factors may be necessary in this context.Based on the World Health Organization reports, the burden of mental disorders will increase to 15\u00a0% 2020\u20137, brain activity\u201310 and mental health status\u201316. However, the association between breakfast skipping and mental health has been rarely investigated and yielded conflicting evidence. While some investigations have found a direct link between breakfast skipping and the risk of psychological problems,13,16\u201319, some others failed to find any link. For example, an investigation among adolescents indicated that only a high-quality breakfast, containing at least three food groups, was associated with better mental health. A 2-year prospective cohort study among Japanese adults and a cross-sectional study in haemodialysis patients found no relationship between breakfast skipping and depressive symptoms. Differences in study populations  may explain the conflicting findings.There is evidence that unhealthy eating habits, such as breakfast or dinner skipping and irregular meal patterns may affect metabolic profile. Although breakfast consumption is known as a health-promotion dietary behaviour, skipping breakfast is a common dietary habit in both adults and adolescents, and it is more frequent in socioeconomically disadvantaged groups. Breakfast consumption may promote mental health by lowering insulin resistance and cortisol production which affect moods. In addition, it is possible that higher diet quality and nutrient intakes, particularly those involved in neurons function (e.g. pyridoxine and omega-3 fatty acids) besides other healthy lifestyle behaviours such as not smoking, less drinking alcohol and higher physical activity levels,27,28 in breakfast consumers favourably affect psychological well-being. In this regard, various bioactive components in the diet may exert pro- or anti-inflammatory effects. Therefore, pro-inflammatory features of an unhealthy diet may underpin chronic inflammation and psychological disorders. Several investigations have evaluated the relationship between the dietary inflammatory index (DII), reflective of the potential pro-inflammatory properties of a diet, with psychological disorders and mostly indicated a direct link between DII and the risk of psychological disorders\u201337.Breakfast is specifically defined as \u2018the first meal of the day that breaks the fast after the longest period of sleep and is consumed within 2 to 3\u00a0h of waking; it is comprised of food or beverage from at least one food group and may be consumed at any location\u2019Given that lifestyle differs by sociocultural factors, epidemiological studies in different populations can provide new insight into the relationship between dietary behaviours (i.e. breakfast eating) and different health outcomes such as mental health. Although earlier studies have controlled their results for various lifestyle-related confounders, they have mainly conducted in high-income countries and most of them have not assessed the quality of diet between breakfast eaters and skippers as well as their interaction. Therefore, we conducted a cross-sectional study to examine the association between breakfast skipping and the risk of higher scores of psychological problems profile  in nonacademic staff of Isfahan University of Medical Sciences (IUMS) with different socioeconomic levels like a general population of Iranian adults, where due to being a low-income country, breakfast might be skipped more frequently. Moreover, we evaluate the role of diet quality, determined by the inflammatory potential of diet, in interaction with breakfast skipping on severity of psychological disorders.. Data collection was carried out in two separate consecutive phases to enhance the accuracy and response rate. In the first phase, performed in April 2010, 10\u00a0087 self-administered questionnaires regarding demographic information, anthropometric measurements and dietary intakes were distributed. The response rate in this phase was 86\u22c516\u00a0% and 8691 completed questionnaires were returned. Information regarding gastrointestinal symptoms and psychological disorders were collected in the second phase (in mid-May 2010) using self-administered valid questionnaires. In the second phase, 5614 completed questionnaires out of 8691 distributed questionnaires were returned (response rate: 64\u22c56\u00a0%). Finally, 4763 completed questionnaires gathered in the two phases could be matched. In the present study, 2876 persons who had complete information regarding both the frequency of breakfast consumption and psychological problems, i.e. depression, anxiety and distress, were included in the statistical analysis.The Epidemiology of Psychological, Alimentary Health and Nutrition (SEPAHAN) project is a cross-sectional study which conducted in 2010 among nonacademic staff of Isfahan University of Medical Sciences (IUMS) with different socioeconomic status who were working in fifty different centres across Isfahan province. The majority of participants were involved in administrative tasks in IUMS, rather than health provider systems, and some university hospitals and research centres were excluded because the heavy workload might decrease their collaborative rate. The participants were selected using a multistage cluster and convenience sampling method. The main aim of SEPAHAN project was to evaluate the relation of common gastrointestinal disorders with lifestyle factors and psychological disorders. More details regarding SEPAHAN project have been provided elsewhereThe frequency of breakfast eating was assessed by asking \u2018On how many days in a week do you usually eat breakfast?\u2019. Possible answers were classified into four categories: (1) never or 1\u00a0d/week, (2) 2\u20134\u00a0d/week, (3) 5\u20136\u00a0d/week and (4) every day. In the present study, using the aforementioned responses, we categorised participants into three groups for the frequency of breakfast consumption: (1) seldom (who ate breakfast never or 1\u00a0d/week), (2) sometimes (who ate breakfast 2\u20134\u00a0d/week) and (3) always (who ate breakfast 5 or more d/week). and General Health Questionnaire (GHQ-12), respectively. HADS includes two separate sections which measure the severity of anxiety and depression. There are 7 items with a four-point rating scale in each section. Higher scores indicate a greater degree of anxiety or depression. The possible score ranged from 0 to 21 for both disorders. Scores of 8 or higher on either section were considered to indicate the presence of anxiety or depression, and scores of 7 or less were considered normal. Cronbach's alpha coefficient (to test reliability) has been found to be 0\u22c578 for the HADS anxiety sub-scale and 0\u22c586 for the HADS depression sub-scale. Known groups validity of HADS showed satisfactory results; in which both anxiety and depression sub-scales showed good discrimination between different subgroups of patients in clinical settings as defined by their disease stage.In SEPAHAN, information about psychological problems, including depression, anxiety and psychological distress, was obtained from validated Iranian version of Hospital Anxiety and Depression Scale (HADS)r \u22120\u22c556; P\u00a0<\u00a00\u22c50001). Also, the two-factor structure has been extracted by factor analysis that jointly accounted for 51\u00a0% of the variance of 12-main questions. In the GHQ, there are 12 questions regarding psychological distress. A four-point rating scale has been provided for each question as follows: less than usual, no more than usual, rather more than usual or much more than usual. In accordance with the original Persian version of GHQ that revealed the bimodal scoring method (0-0-1-1) was useful in the Iranian population, the scores of distress were calculated by bimodal scoring fashion. Accordingly, the first two answers  were scored \u20180\u2019, and the second two answers  were scored \u20181\u2019. The maximum score could be 12 and higher scores demonstrate an elevated level of distress. In the present study, participants were considered to have psychological distress if they scored \u22654.Reliability analysis of GHQ-12 in the Iranian general population showed satisfactory internal consistency . Convergent validity indicated a significant negative correlation between the GHQ-12 and global quality of life scores  was obtained. The scores of identified factors were calculated using the regression method in the framework of factor analysis. In our proposed model, \u2018psychological problems profile\u2019 as a latent response was regressed on breakfast consumption as a predictor that provides a comprehensive and integrative examination of the relation between two variables. The higher scores of psychological problems profile present more severity of psychological problems. The tertiles of factor scores were used in the association analyses.. Briefly, food items were categorised into five main groups: mixed dishes ; grain-based foods and potatoes (n 10); dairy products ; fruit and vegetables (n 22) and miscellaneous food items and beverages . For each item, the most common portion sizes familiar to all people were asked to determine the amount of food consumed. Nine different levels, from \u2018never or less than once a month\u2019 to \u201812 or more times per day\u2019 based on the popularity of food items, were considered to indicate the frequency of consumption. For example, for foods that are consumed less frequently, high-frequency items were omitted but kept for foods that are consumed regularly. Household measures were used to convert food items to g/d. Daily energy and nutrient intakes of each participant were estimated based on the USDA food composition database.Dietary intake was assessed by using a validated, self-administered 106-item dish-based food-frequency questionnaire (DFQ). The DFQ was designed according to the Willet-format food-frequency questionnaire to assess dietary intakes over the preceding year. More information about the design, validity and reliability of DFQ has been described elsewhereet al.. Accordingly, first, the energy-adjusted dietary components through the residual method were computed. Then, each dietary component was linked to its regionally representative database that indicates an estimate of global mean intake for each item, along with its standard deviation provided in the DII definition. Next, given that standard means were subtracted from these values and divide by the corresponding standard deviation. The z scores derived in this way were converted to percentile and then doubled and \u20181\u2019 was subtracted. Finally, the centred percentiles for each parameter as multiplied by its corresponding overall inflammatory effect score, and all derived values were summed to create the overall DII. In the present study, since some components of DII had not been assessed in the DFQ or not usually consumed in Iranians\u2019 diet as a Muslim population (like ethanol), we did not include them in the DII calculation. Therefore, the DII was calculated based on 27 nutrients, onions, tea and caffeine, which derived from the DFQ in the present study.DII, as a measure of diet quality, was calculated according to the method suggested by Shivappa  and participants were categorised as moderately active (1\u20133\u00a0h/week), active (>3\u00a0h/week), moderately inactive (<1\u00a0h/week) and inactive . The consumption of psychotropic medicines including nortriptyline, amitriptyline, imipramine, fluoxetine, citalopram and fluvoxamine during the last 6 months was assessed. The consumption of at least one of these medicines was taken into account as a psychotropic consumer. Because of the close relation between gastrointestinal disorders and psychological health, we considered functional gastrointestinal disorders (FGIDs) as an important covariate in our analysis. Suffering from gastrointestinal disorders was assessed using a valid and modified Iranian version of ROME III questionnaire. FGID was defined as suffering from at least one of the following main gastrointestinal disorders: gastroesophageal reflux, dyspepsia, irritable bowel syndrome, bloating and constipation. Body mass index (BMI) was calculated as weight (kg) divided by height squared (m2).The general characteristics of participants including sex, age, marital status , educational level [duration of education (years)] and smoking habit  were assessed using a pre-tested self-administered questionnaire. The current level of participants\u2019 physical activity was assessed using General Practice Physical Activity Questionnaire\u03c72 test for continuous and categorical variables, respectively. Pairwise comparisons between groups were conducted both in ANOVA and \u03c72 tests, and Bonferroni adjustment was adopted. Age- and sex-adjusted means for energy intake, and age-, sex- and energy-adjusted means for other dietary variables were compared across the categories of breakfast consuming frequency by analysis of covariance (ANCOVA). We used multinomial logistic regression to estimate odds ratios (ORs)  for having higher scores of psychological problems profile by decreasing the frequency of breakfast eating in crude and multivariable-adjusted models. In model 1, adjustment was made for demographic variables including age, sex, marital status and educational level. Model 2 was additionally adjusted for lifestyle factors which may be related to mental disorders including BMI, smoking and physical activity,52. Additional adjustment in model 3 was conducted for FGIDs and psychotropic medicines. Due to the potential effect of breakfast consumption on diet quality as well as the close relation between some nutrients and mental health status, adjustment for dietary intakes of magnesium, riboflavin, pyridoxine, folate, cobalamin, Docosahexaenoic acid and Eicosapentaenoic acid, energy, fibre and caffeine was made in model 4. Stratified analyses by sex, applying the above-mentioned models, were run to examine the association of breakfast skipping and breakfast skipping/DII interaction with psychological problems profile scores separately in men and women. P for linear trends was determined by linear by linear \u03c72 test. Statistical significance (two-sided) was accepted at P\u00a0<\u00a00\u22c505.Participants were categorised into three groups based on the frequency of breakfast consumption  as well as the tertiles of psychological problems profile's scores. To determine significant differences in demographic characteristics across the categories of frequency consumption and tertiles of psychological problems profile, we used analysis of variance (ANOVA) and n 2247) always consumed breakfast, 14\u22c57\u00a0% (n 424) sometimes ate breakfast and 7\u22c513\u00a0% (n 205) seldom consumed breakfast. Compared with individuals who seldom or sometimes consumed breakfast, individuals in the always category had higher mean age (P\u00a0<\u00a00\u22c50001) and were more likely to be male (P\u00a0=\u00a00\u22c5001). However, the prevalence of depression or anxiety or psychological distress (P\u00a0<\u00a00\u22c50001), psychotropic medicine use (P\u00a0<\u00a00\u22c50001), FGIDs totally (P\u00a0<\u00a00\u22c50001) and most of evaluated gastrointestinal disorders were lower in those who always consumed breakfast compared with those in the seldom and sometimes categories. Also, the prevalence of consuming higher pro-inflammatory diet was significantly higher among people who did not consume breakfast (P\u00a0=\u00a00\u22c5002). The general characteristics across the categories of breakfast consumption frequency by sex are also shown in Supplementary Table S1 of Supplementary material. Such as total population, the distribution of the majority of confounders was significantly different between the categories of breakfast consumption both in men and women and the distribution of these confounders was not similar in men and women; accordingly, we conducted a stratified analysis by gender for follow up the present study main objectives.The mean age of study participants was 36\u22c53 years (ranged from 19 to 70 years) and 1960 were females. The participants\u2019 characteristics across the frequency of breakfast consumption are shown in v. T1 51\u22c59\u00a0%; P\u00a0<\u00a00\u22c50001). The proportion of married subjects was slightly different across the tertiles of psychological problems profile scores . Individuals who were in the highest tertile of psychological problems profile scores were less educated (P\u00a0<\u00a00\u22c50001) and less physically active , but more probable to be smoker  or have FGID  or consume psychotropic medicines . The proportion of overweight or obese participants was not statistically different . We also evaluated the distribution of confounders across the categories of psychological problems profile scores separately in women and men and similar results with total population were obtained, although the distribution of these confounders was not the same in women and men; suggesting stratified analyses by gender for follow up the present study main objectives .The general characteristics of participants across the tertiles of psychological problems profile scores are presented in P\u00a0=\u00a00\u22c5006), thiamin (P\u00a0=\u00a00\u22c5038), riboflavin and long-chain omega-3 fatty acids (P\u00a0<\u00a00\u22c50001), fruit (P\u00a0=\u00a00\u22c5005) and red meats (P\u00a0=\u00a00\u22c5007), but lower intake of fat and caffeine (P\u00a0=\u00a00\u22c5002). Dietary intakes of protein, magnesium, pyridoxine, folate and cobalamin were not different across the categories of breakfast consuming frequency.The age-, sex- and energy-adjusted dietary intakes of participants across the categories of breakfast consuming frequency are presented in P\u00a0<\u00a00\u22c50001). Adjustment for various confounders changed the odds very slightly, while in the final adjusted model, the OR and its corresponding 95\u00a0% for being in the highest tertile of psychological problems profile was 3\u22c535  in the seldom category of breakfast eating.P\u00a0=\u00a00\u22c5004) and women  in the crude model. These associations were not considerably influenced by adjusting the impacts of various covariates. In the final adjusted model, the odds for being in the highest tertile of psychological problems profile scores was 5\u22c500  in men and 2\u22c575  in women who ate breakfast seldom. We also observed an inverse significant correlation between frequency breakfast consumption per week and psychological problems profile scores either in men or in women . In the whole population, the corresponding value was \u22120\u22c5176 (P\u00a0<\u00a00\u22c50001).In stratified analyses by sex , skippinThe results of the association between DII/breakfast habit (interaction of breakfast skipping and DII levels) and psychological problems profile scores in the whole population and separately in men and women are presented in The present study found that breakfast skipping is associated with increased risk of higher scores of psychological problems profile in a general population of Iranian adults. Also, our analyses showed that the breakfast skipping in combination with low diet quality, determined by DII, more adversely affect the psychological health; in which we observed that those participants who skipped breakfast and ate diet with higher pro-inflammatory content had highest risk of larger psychological problems profile scores. In the stratified analysis by sex, this direct link was observed among both men and women, but much stronger among men than women.; and therefore, identifying the risk factors contributing in the high prevalence of mental disorders among Iranians is relevant.Due to differences in socioeconomic status, lifestyle and dietary habits among countries, it is conceivable that findings derived from observational studies may vary between countries. In Iran, a relatively large fraction of total years of life lived with disability (YLD) is caused by mental disorders,56. However, the largest proportion of YLDs from mental disorders in Iranians occurs in young adults (19\u201339 years); and therefore, taking into account the differences in lifestyle between adults and children/adolescents, it would be worthwhile to evaluate such association among young adults. To our knowledge, there is only one study in Iranian adults which assessed the breakfast-mental disorders association. In the present study, because of high incidence of comorbid or co-occurring of psychological problems, we constructed a score providing a comprehensive overview for the mental health status of participants based on applying sophisticated statistical method, i.e. factor analysis through combining the scores of three common mental health disorders . In line with our previous analysis, which indicated an indirect link between breakfast consumption and depression, anxiety, and psychological distress risk, the newly constructed model also confirmed the beneficial association between breakfast consumption and mental health status. Moreover, in the present study, we evaluated the role of diet quality, determined by the inflammatory potential of diet, intricately with breakfast skipping on psychological health. Taken together, a number of dietary components have been related to pro- or anti-inflammatory pathways and the circulating concentrations of pro- or anti-inflammatory mediators. Despite this, it has been suggested that taking into account diet as a whole, in combination with dietary habits, may be important, because of the role of potential interactions between, and/or synergistic effects of, food and habits components.To date, the association between breakfast eating and psychological health, violent behaviours and happiness has been evaluated among Iranian children, adolescents and college students. In contrast, Korean Community Health Survey provided evidence that individuals who had breakfast seldom or sometimes had higher risk for depression compared with individuals who had breakfast always. Consistently, another cross-sectional field study suggested that older adults who received home-delivered breakfast for 5\u00a0d in a week had fewer depressive symptoms. In the secondary school children, breakfast skipping was associated with greater risk of distress, anxiety and depression in a cross-sectional design, while following children for 6 months revealed no significant link. A direct link between breakfast skipping and psychological distress has been also suggested in two other cross-sectional studies,19. Differences in study design, study population and methods of depression assessment may contribute to the discrepancies in the results of studies. Although based on available evidence and our results, breakfast skipping is cross-sectionally related to the risk of higher scores of psychological problems, it is impossible to determine whether breakfast skipping is a cause or a result of affecting by psychological disorders using cross-sectional analysis. For example, taking psychotropic medicines may disrupt sleep cycles and consequently influence eating behaviours, and interests in daily activities such as eating. In addition, the poverty of participants may lead to skipping meals or the feeling of being cared for/not isolated in elderlies who received home-delivered breakfast may be the reason for fewer depressive symptoms. Therefore, drawing a conclusion in this regard should be done cautiously.The findings from previous studies regarding the association of breakfast skipping with mental disorders are inconsistent. A longitudinal study among Japanese workers, who were high risk for depressive symptoms, has indicated no beneficial effect of breakfast eating on depression incidence after a 2-year follow-up, while the baseline results of this study confirmed the direct link between breakfast skipping and depressive symptoms and sex differences in the use of coping strategies which seems to be involved in the pathogenesis of anxiety and depression. It has been shown that in women, using more positive reframing was associated with lower depressive symptoms, while in men, depressive symptoms were independent from positive reframing.We observed a stronger association between breakfast skipping and breakfast skipping/DII interaction with higher scores of psychological problems profile in men than women in stratified analyses. The reasons for this discrepancy are not clear and require further investigations. However, it is possible that the stronger association among men may be due to different personality traits. Over-activity of the HPA axis has been suggested as a plausible mechanism in all depressive disorders. Furthermore, elevated levels of cortisol are associated with greater inflammation which contributes to mental disorders particularly depression by affecting neurotransmitters synthesis. Consistently, our analysis supports the interrelationship of DII and breakfast eating habit with psychological problems profile which is in line with other investigations indicating a positive association between DII and mental disorders. Although it is not clear which inflammatory mediators, and to which extent, contribute to developing mental disorders, however, previous studies suggest that diet-related inflammatory effects may be mediated via mediators other than serum inflammatory biomarkers such as IL-6 and C-Reactive Protein (CRP),65. Moreover, since CRP and IL-6 levels are affected by many modifying factors, such as age, adiposity, physical fitness, activity and dietary habits, they are unlikely specific indicators for systematic inflammation per se. Thus, further research investigating the link between DII and inflammatory mediators such as dietary habits including meals consumption is required.The exact mechanisms underlying the favourable effect of breakfast eating on moods have not been elucidated. It is probable that breakfast eaters have better mental health status because of having a healthier lifestyle. Nevertheless, we observed that even after controlling for lifestyle factors, including physical activity, dietary intakes and smoking, breakfast skippers had higher risk of higher scores of psychological problems. Another possible explanation might be higher levels of cortisol in breakfast skippers which stimulates hypothalamic\u2013pituitary\u2013adrenal (HPA) axis independent of stress. Substantially large sample size and considering the confounding effects of various variables are the strengths of the present study.The present study has several limitations which should be taken into account when interpreting the results. First, the study population was not truly a representative sample of the whole Iranian population. Nevertheless, this would be more important in a descriptive report than in an analytical study like this. Moreover, because of the large sample size and good distribution of potential confounders, it is unlikely that our findings are affected by the lack of representativeness. Second, since this study was a cross-sectional, we could not draw any causal inferences. For example, psychological problems may reduce appetite and lead to breakfast skipping, an association that cannot be evaluated using the present data. Third, both exposure and outcome were collected using self-administered questionnaires in this study. Applying more sophisticated tools to assess psychological problems may lead to stronger associations. Fourth, despite controlling for various confounders, there may be some unknown or unmeasured confounders which cannot be excluded. For instance, sleep quality and duration, wake up time, and bedtime may affect both breakfast skipping and mental health as well as nutrients intake. Finally, although turning continuous variables into categorical variables is not a statistically preferred approach, we used the tertiles of psychological problems profile to simplify the clinical interpretations of mental disorders as well as the presentation of results which are the common method in epidemiological studiesIn conclusion, our findings confirm the previous evidence, suggesting that breakfast skipping is associated with higher risk of psychological problems in a general population of Iranian adults. Moreover, our further analysis confirmed that the DII and breakfast skipping are associated with mental health, interactionally. This association was not explained by some measures like socioeconomic status, physical activity, smoking and dietary intakes. Therefore, eating breakfast could be a simple approach to promote mental health among Iranians, especially men. Further longitudinal studies are needed to confirm the true link between breakfast skipping and psychological problems and to investigate possible mechanisms."}
+{"text": "States compatible with \u201cDelusional disorder\u201d have been described since the XIX century. Esquirol mentioned \u201cirrational ideas and actions that would develop via logical and plausible arguments\u201d; Kraepelin referred to the condition as \u201cparanoia\u201d and considered that hallucinations could not be present\u2013 unlike Bleuler, who considered them to be a possible feature. The criteria for delusional disorder have suffered several changes in the last centuries.We aim to review the evolution of the criteria for delusional disorder across the editions of the Diagnostic and Statistical Manual of Mental Disorders (DSM).Review of DSM editions.Criteria for the diagnosis of \u201cparanoia\u201d (DSM III) or \u201cdelusional disorder\u201d (DSM III-IV.V) underwent several changes. In the first editions hallucinations could not be prominent (DSM-III-IIIR) and in the DSM IV, only tactile or olfactory hallucinations related to delusions could be present. In DSM-V hallucinations of other modalities related to the delusional theme can be present. Regarding delusional themes, the first edition of the DSM III regarded persecutory delusions only \u2013 which was changed in the DSM-III-R, with the inclusion of grandiose, jealous, erotomaniac, and somatic. Only in the DSM-V did the occurrence of bizarre delusions become possible in delusional disorder. Across the editions, there is a consensus about the absence of negative symptoms, absence of disorganized speech, and that the behavior is not odd aside from delusional content.The most debatable symptoms across centuries in the classification of delusional disorders were: presence of hallucinations, the nature of the delusional content, and inclusion of bizarre delusions.No significant relationships."}
+{"text": "This study is the third in a series of investigations conducted by the authors, and certainly the most comprehensive research regarding the former uranium, copper, and charcoal mines from a particular geographical area of Romania. In this respect, the present scientific incursion focused on two areas containing former extraction uranium ore sites, Ciudanovita and Lisava, as well as copper ore from Moldova Noua and charcoal mines from Anina, Banat Region, Romania. It highlighted that, for the first time, the heavy metal concentration was correlated with the values of physicochemical indicators of water , by using multivariate analysis, to shape a regional based model on spatial distributions and the variability of toxic contaminants from the hydrographic basin of Banat, Romania, as a consequence of former uranium, copper, and charcoal mines. In this regard, 11 metals including Al, Cr, Mn, Fe, Ni, Co, Cu, Zn, Sr, Cd, and Pb from different water samples , collected from three mining areas  were investigated. Non-carcinogenic and carcinogenic health risks of seven heavy metals were assessed using the EDI, DIM, and THQ. The obtained THQ values were within the acceptable limits for cancer risks for adults, but as regards children, eight samples out of 18 proved toxic. However, the HRI and THQ average values for Cd (0.265 adults/0.996 children) and Pb (0.025 adults/0.095 children) for children were 3\u20134 times higher than those for adults. This is a source of concern as their prevalence in well water exposes children and residents in the Banat Region to the risk of various types of cancers.  In the last century, anthropogenic activities and major climate changes have led to the irreversible deterioration of surface water, on one hand, and of groundwater, on the other hand. Assuring good water quality is considered to be determinant for biodiversity. Particular attention should be given to freshwater resources, which usually satisfy the worldwide demand of people for drinking water. Waterborne diseases have frequently decimated the population of many cities due to chemical pollution ,2,3. ThrThe monitoring process of chemical contaminants continues to concern the scientific world as this activity helps comprehend and predict the long-term health effects of chronic exposure to low concentrations of various pollutants, including heavy metals ,13,14,15Bell and Donnelly  revealedMajor environmental problems are found in one of the most beautiful regions of Romania, namely Banat ,12,46 F, where uThe purpose of this study is the assessment of the quality of surface water and groundwater affected by mining activities, especially tailing dumps/mining landfills in the areas of closed uranium mines from Ciudanovita and Lisava, as well as of copper ore mining from Moldova Noua, and charcoal mines from Anina, Banat Region, Romania . So far,Field surveys and water sampling were carried out in Romania, in the southern area of the Banat Mountains, within the perimeter of former mining exploitation. From a geological point of view, the mountainous area  stands out through the existence of sedimentary deposits specific to the Getic Canvas, as well as through the Resita-Moldova Noua syncline, and in the hilly and depression areas, through suites of alluvial deposits\u2014Mio-Pliocene\u2014Quaternary Age . As a result of the differential erosion influenced by the presence of rocks with different hardness and also of the tectonics, a series of local depression areas were formed, such as Anina, Ciudanovita, and Lisava  47,48,4,448,49.The submountain depression of Oravita is situated in the south-western part of the low mountains of Banat. The depression is crossed from east to west by the Oravita brook, the Caras and Nera Rivers. Contact with the neighboring mountainous regions is well cut and often in steps, which explains the tectonic origin of this depression. It may be described as a more fragmented region to the east and south, where it is in direct contact with the mountain; furthermore, it may be stated that the degree of fragmentation decreases proportionally to the west. The average altitude is about 150\u2013200 m, but on the east side it exceeds 300 m. The Caras River flows from north-east to south-west along the entire depression, determining its inclination line. It has a well-defined valley, due to the limestone relief, with a series of tributaries, more numerous on the left side. The Moldova Noua depression develops at the south-eastern foot of the Locva Mountains, on the left bank of the Danube, at an average altitude of 250\u2013300 m. The hydrographic network that drains the area belongs to hydrographic basins from the southwestern part of the country: Caras, Nera, but also direct tributaries of the Danube on the southern slopes of the Locva Mountains\u2014Almaj [The Caras springs from the western slope of the Semenic Mountains from an altitude of 680 m, having a length of 79 km in the Romanian territory; it flows directly into the Danube in the territory of Serbia. The Caras River collects 31 tributaries. The Nera springs from the Semenic Mountains and flows into the Danube forming a 15 km state border with Serbia. The hydrostructures in the mountain area are concentrated in the upper precambrian crystalline schists, lower carboniferous crystalline limestones and dolomites, Jurassic age detrital and carbonate deposits, Jurassic-Cretaceous carbonate, and detrital deposits and in conglomerates, sandstones, limestones, and upper Cretaceous marl limestone. In the areas of the intramountain depressions they are in predominantly detrital and subordinate carbonate deposits, of Badenian age, but also in alluvial deposits  of Quaternary age .They may be cross-border in nature. Groundwater dynamics are much slower than surface water dynamics and the impact on the quantitative and qualitative status of groundwater bodies may exceed the natural recharge rate of the aquifer ,52,53. TThe geographical locations of the sampling points were taken using a Global Positioning System (GPS) and the ArcGIS Pro mapping software, which provided real data for selected sites.In this study, a total of 408 water samples, divided as 34 water samples/day/week of each month of autumn of the year 2019  were randomly collected, thus covering the entire area of the former mining area in the Banat Region, Romania . SamplesThe sampling focused primarily on the underground aquifer structures . In this respect, it can be mentioned that the water wells samples, noted as P1\u2013P18, were collected at different depths as follows: P1 at 8 m, P2 at 4.5 m, P3, P11 and P13 at 4 m, P4 and P10 at 7 m, P5 and P14 at 8 m, P6 at 4.2 m, P7 and P8 at 5.5 m, P9 at 6 m, P12 at 3.5 m, P15 and P18 at 3.0 m, P16 and P17 at 0.5 m. Approximately 90% of the old wells contain non-potable water . These wells are in an advanced state of clogging. In this situation, the water supply is made by capturing through the hydrophore, from depths of about 7\u20138 m , with the mention that laboratory tests were not performed by the authorities and there was limitation/prohibition of water consumption by students in the Ciudanovita area, P14, In addition, for a clear view image, samples from three spring sources  were collected, usually used as drinking water by children, mainly I1 near school and I2 representing a slope spring at 500 m by the entrance to Ciudanovita settlement, as well as I3, located 10 km from Oravita City on the interfluve between the cities of Oravita and Anina, used by tourists as well as by habitants. Therefore, it was revealed that there are no wells between the above-mentioned localities to be used for farming activities.Regarding surface water, the samples were collected downstream of the former mining operations, from 11 hydrographic points  of the rAfter sampling, everything was stored in sterile high-density polyethylene (HDPE) bottles of 1 L capacity, rinsed 2\u20133 times with water sample. Sampling and handling procedures were carried out following the Surface Water Sampling-Operation Procedure . All samThe values of physicochemical indicators  of water samples were obtained immediately after sampling , using electroanalytical methods, as a subsequent determination would provide erroneous information, according to EN and ISO standard methods . In ordeMicrowave-assisted pressure digestion was used for samples preparation. In this regard, the samples were mineralized in aqua regia  using a TOPwave microwave-assisted pressure digester , with contactless real-time temperature and pressure monitoring for all TFM-PTFE vessels with samples, which can be removed individually after digestion. The water samples were acidified at pH < 2 before inductively coupled plasma mass spectrometry (ICP-MS) analysis. After digestion, the clear solutions were transferred with distilled water to 25 mL volumetric flasks. The concentration of metals, including Al, Cr, Mn, Fe, Ni, Co, Cu, Zn, Sr, Cd, and Pb, were determined using an iCAP\u2122Q ICP-MS spectrometer  in accordance with SR EN ISO 17294-2:2017 standard method . The hig2 correlation coefficients in the range of 0.990 to 0.999. The analytical curves for each analyzed elements were prepared using standard stock solutions . The limits of detection (LODs) and limits of quantitation (LOQs) of the analyzed element were established using the calibration data and are presented in Metals calibration curves showed good linearity over the concentration range (0.1 to 10.0 mg/L), with REstimated Daily Intake (EDI)water = metal content in water, I = average intake rate: 2 L for adults and 1.5 L for children under the age of 12;Considering the equations presented and described in previous research , the folCarcinogenic Risk (CR) associated to Pb exposure:Pb = 0.0085 mg\u22121 kg day; acceptable risk levels for carcinogens range from 10\u22124  to 10\u22126 ;Daily Intake MetalsHealth Risk Index (HRI),\u22121 day\u22121 for Cr(VI), 1 mg L\u22121 day\u22121 for Cr(III), 140 \u03bcg L\u22121 day\u22121 for Mn, 20 \u03bcg L\u22121 day\u22121 for Ni, 40 \u03bcg L\u22121 day\u22121 for Cu, 300 \u03bcg L\u22121 day\u22121 for Zn, 1 \u03bcg L\u22121 day\u22121 for Cd, 35 \u03bcg L\u22121 day\u22121 for Pb,THQ)Cumulative Health Risk  helped develop the studied area maps and spatial interpolation of analyzed data. For the spatial interpolation, all data were integrated into GIS based on the inverse distance weighted (IDW) algorithm interpolation method  to visualize the quality indicators of drinking and surface waters, and their potential risk-prone areas. Statistical analysis was used to investigate the relationship between toxic metals between drinking water (wells and springs) and surface water (rivers and lakes), such as the main component analysis method (PCA) and Pearson correlation coefficient (PCC) using the IBM SPSS Statistics (v.21) software.It is well known that surface water as well as groundwater frequently contains numerous chemical compounds provided by anthropogenic sources and various geochemical processes. In this respect, the assessment of physicochemical indicators regarding the quality of water is important for understanding the behavior of the toxic elements and their interrelationship in the chemical equilibrium of a particular geographical area. In spite of that, the threat to human health, in terms of water quality, are associated with: (1) pollution sources; (2) water treatability (the forming of disinfection by-products); and (3) direct health risks  . As aforThe pH value is considered a neutral indicator and also an important indicator when water hardness  is considered. According to the obtained data a, the pHIn addition, the pH average value of surface water samples collected from 11 hydrographic points a in RomaIt is well known that the major cation and anion levels determine the electrical conductivity (EC) of water and determine the overall salinity . CertainOxidation-reduction potential (ORP) is one of the important indicators of redox-sensitive processes in water as well as in sediments. The negative values of ORP indicate an abundance of available electrons , therefoWater resources in mining areas from Romania, the Banat Region, are exposed to serious pollution. The contamination of surface and underground waters due to mining operations  is strongly linked to the release of heavy metals. Some of these metals are considered naturally ubiquitous in surface waters and groundwater (sources for drinking water) and the impact on human health due to exposure to them is significant. In addition, the mobility of these elements increases in the case of mining activities due to the fact that contaminated water also passes through the cracks of rocks and mine drainage networks. On the other hand, the mining operations  generate huge quantities of poisonous solid residues . The former copper and uranium mines, from Moldova Noua and Ciudanovita-Lisava, respectively, due to the drainage process, highly affect the groundwater and surface waters and further increase the levels of heavy metals ,12. In tConcentrations of Pb, Cu, Cd, Cr, and Ni were higher than national accepted values and the World Health Organization specifications  for watechromium: P2 and P10 for all categories ; P3, P13, and P14 for female; P3 and P13 for girls 9\u201312 years;cadmium: P1, P2, and P10 for male and female; all samples except I1 and I2 for boys and girls 9\u201312 years;lead: P9 for male and female; P6\u2013P9 for boys and girls 9\u201312 years;The lifetime risk of developing cancer due to lead exposure was beyond the imposed limits in the samples P8 and P9 .According to the Institute of Medicine  and the Considering the obtained results for estimated daily intake and the body mass for adults (~70 kg) and children (~14 kg) the values for daily intake metals from drinking waters are presented in The health risk index (HRI), also known as the target hazard quotient (THQ), represents the evaluation of health risks induced by the consumption of contaminated food and/or drinking water. It is used to estimate the potential health effects expected as a consequence of ingestion and to evaluate the adverse effects. If the HRI value is less than 1, then no adverse health effects are expected. However, this study takes into account only the metals from drinking water, not the entire content ingested daily. Data shown in Pearson correlation coefficient (PCC) and principal component analysis (PCA) are commonly used methodologies for the selection of linear variables . The anaAs already mentioned in previous studies by Pehoiu et al. ,12, the The Principal Component Analysis (PCA), a data reduction technique that summarizes several variables to the essential components, was applied to determine the likely sources of heavy metals and their associations in drinking water .The principal component analysis was applied to 21 variables, representing the entire set of drinking water quality data from the analyzed sites. The PCA generated many principal components (PCs), but only those components with an eigenvalue > 1 were taken into account. The results of the analysis regarding the main components showed that the contribution of four components is responsible for 82.782% of the total variation of the data . The firIn the case of surface water , three mKnowing the distribution of toxic metals both in surface and underground waters is an essential factor for the protection of the environment and human life. Water represents one of the primary sources of life and its importance must prevail over any argument against it when it comes to preserving it qualitatively as well as quantitatively; therefore, it is paramount for present and future generations to try to reach this desideratum. Identifying the toxic metal sources of pollution is important for strategy development and for further actions in order to prevent and fight pollution. This study reveals significant concentrations of toxic metals in water, which entails the need to find administrative solutions in environmental protection and alerting the population regarding the risks generated by daily intake. In addition, the statistical correlations were important in establishing the metal sources and relations between them.This study is the third in a series of investigations conducted by the authors, and it is certainly the most comprehensive research regarding former uranium, copper, and charcoal mines from a particular geographical area of Romania. In this respect, the present scientific endeavor focused on two areas, which include former extraction uranium ore sites, Ciudanovita and Lisava, as well as copper ore from Moldova Noua and charcoal mines from Anina, Banat Region, Romania. It highlighted that, for the first time, the heavy metal concentration was correlated with the values of physicochemical indicators of water  by using a multivariate analysis. The purpose was to shape a regional based model on spatial distributions and the variability of toxic contaminants from the hydrographic basin of Banat, Romania, as a consequence of former uranium, copper, and charcoal mines. Although the actions were less visible on a high scale and the studies barely existed, awareness regarding the risk should be present among the population. Therefore, it was mandatory for a complex study to be undertaken in order to assess the state of those areas and how much it will impact them from an anthropogenic point of view. In this regard, 11 metals including Al, Cr, Mn, Fe, Ni, Co, Cu, Zn, Sr, Cd, and Pb from different water samples , were collected from three particular geographical mining areas, and investigated. Non-carcinogenic and carcinogenic health risks of seven heavy metals were assessed using the estimated daily intake (EDI), daily intake metals (DIM) and target hazard quotient (THQ). The obtained THQ values were within the acceptable limits for cancer risks for adults, but (as was highlighted) are toxic for children in the case of eight samples from 18. The HRI and THQ values for Cd and Pb for children were three times higher than those for adults. This is a source of concern as their prevalence in well water exposes children and residents in the Banat Region to the risk of various types of cancers. The data obtained were subjected to a multivariate analysis in order to investigate the correlation and emphasize the significant differences between metal concentrations and potential risks to human health (both adults and children). Therefore, for toxic metals in well water samples, strong correlations (>0.50) are observed between Al and Cr, Al and Mn, Al and Fe, Al and Ni, Al and Cu, Cr and Mn, Cr and Fe, Cr and Ni, Mn and Fe, Mn and Ni, Mn and Cu, Fe and Ni, Fe and Cu, Ni and Cu.Pb was found to have a significant correlation with Cd, indicating that both metals originated from the same source. Concentrations of Pb, Cu, Cd, Cr, and Ni were higher than national allowed values and the World Health Organization specifications for water intended for human consumption for all water samples, except I3, R6, and R9. Chromium concentrations were the lowest in surface water samples (rivers and lakes). The level of toxic/carcinogenic metals including Pb, Cd, and Ni in water samples was higher than the WHO recommendations and represents a real risk for human health, especially for children.The data provided by this research can be used to develop a framework for quantifying some of the physicochemical indicators that stakeholders and authorities use when preparing guidelines for water quality (GWQ), taking into consideration these mining areas, which cause strong pollution of the environment and pose a risk to human health."}
+{"text": "Micronutrient imbalances pose a severe threat to the health and productivity of livestock and poultry. In this regard, a further stage in feeding science development will control and optimize the intake of mineral substances, including determining the elemental composition in some biosubstrates. One of these biosubstrates can be a feather. However, the amount of available information on the content of trace elements in laying hens is limited, complicating the laboratory data interpretation. Therefore, this study established reference intervals for the concentrations of the main essential and toxic elements in laying hens in different periods of ontogenesis.The study was conducted on clinically healthy Hisex Brown laying hens at the age of 10 (n=150), 30 (n=150), 120 (n=150), 150 (n=150), and 210 (n=150) days. All examined birds were born and raised on the territory of the South Ural biogeochemical province of Russia. The sampling of feathers was carried out by plucking the flight feathers of the wing. Inductively coupled plasma dynamic reaction cell mass spectrometry determined the elemental composition of the feather according to 25 parameters.th to the 120th day, there was a significant decrease in these indicators. Later, from the 120th to the 150th day, a statistically significant increase in concentrations was replaced. Little growth and relative concentration stability were observed in the last part of the experiment (150-210 days). Chemical element concentrations in feathers were computed in reference ranges for each age group.The results showed that at the minimum age (10 days), the highest concentrations of chemical elements were observed in laying hens. Subsequently, as they grew older, in the period from the 30The calculated ranges of chemical element concentrations in laying hens can be used to compile norms for their content in the body; however, it is worth noting that these ranges can vary depending on the biogeochemical province of breeding and the bird\u2019s age. One of the main prerequisites for normal body functioning is the stability of its mineral composition. Mineral substances  are necessary for the normal functioning of almost all biochemical processes in the body. They are part of numerous enzymes, coordinate many biological processes and affect the health and productivity of farm animals. Optimal nutrition with a sufficient level of trace elements assures adequate functioning of the body. Structural, physiological, catalytic, and mechanisms are the most critical -5. ImbalThe study aimed to assess age characteristics and establish reference intervals for the concentrations of the main essential and toxic elements of laying hens bred in a separate biogeochemical province using inductively coupled plasma dynamic reaction cell mass spectrometry (ICP-DRC-MS) methods. The intervals specified in this study will allow timely detection of elementosis in laying hens at different stages of ontogenesis and prescribing the appropriate mineral complexes for the metabolic correction of the elemental status.The Local Ethics Committee of the Orenburg State University, Orenburg, Russia, approved the protocol of the present investigation . All animal studies were performed following the ethical standards laid down in the 1964 Declaration of Helsinki and its later amendments.The study was conducted in March and April 2021 in the conditions of three poultry farms  located on the territory of Orenburg Region, Russia. The territory of the Southern Urals is located in the depths of the Eurasian continent, far from the oceans. This continentality significantly affects the climate, soils, and vegetation. The climate is sharply continental; hot summers are accompanied by dry winds and winters are cold with stable snow cover. There is a large absolute amplitude of air temperature fluctuations, reaching 85\u00b0C. In summer, heated air enters the region from Central Asia and Kazakhstan, so the air temperature reaches 40-43\u00b0C. In the cold season, frosts intensify due to the cold air from Siberia, and the temperature drops to \u221240\u00b0C. Precipitation averages 374 mm/year.3/h, in the warm period-5 m3/h. Incandescent lamps with a power of 40-75 W are used to illuminate poultry houses. The illumination in the area of the feeders was 10-15 lux. The length of daylight hours in the poultry house for the adult population of laying hens was 14 h, in the rooms for young animals 7.5 h. Laying hens were vaccinated against Newcastle, Marek, Gumboro disease, infectious bronchitis chickens, egg drop syndrome, pneumovirus, reovirus tenosynovitis, salmonellosis, and coccidiosis.The territory of the Orenburg region belongs to the regions with favorable ecological conditions. The studies were conducted on clinically healthy Hisex Brown laying hens at the age of ten (n=150), 30 (n=150), 120 (n=150), 150 (n=150), and 210 (n=150) days. The keeping conditions for all examined chickens were identical. Birds were kept in metal cages of 145 cm (width)\u00d770 cm (depth)\u00d7250 cm (height) with mesh floors. The cells were arranged in five tiers on either side of the feeding passage. The air temperature in the workshop for rearing laying hens was 15-18\u00b0C, humidity-60-70%. Air exchange per 1 kg of live weight of adult laying hens in the cold period of the year was 0.7 mIn general, the nutrient content in the diet of the experimental birds met the needs of laying hens during the periods of starter, growth, and laying . The comFeathers were sampled by taking the flight feathers of the wing. In addition, the proximal part of the feather, weighing at least 0.4 g, was collected for research. Feather samples were taken from three heads from 50 randomly selected cages located in different workshop sections on the territory of each poultry farm under study.The obtained feather samples were washed in acetone  to remove external contamination and then rinsed thrice in deionized water (18 MW cm). After washing, the samples were dried at 60\u00b0C to a stable weight. Fifty milligrams of feather samples were placed into Teflon tubes containing 5 mL of concentrated nitric acid (Sigma-Aldrich Co.) and subsequently digested in the microwave system . Bergh of SW-4 DAP-40 microwave system. The obtained solutions were poured into 15-mL polypropylene test tubes, adjusted to the final volume of 15 mL with deionized water, and thoroughly mixed by shaking in the closed test tubes. Essential, conditionally essential , toxic, and potentially toxic  trace elements in the samples were assessed using a NexION 300D spectrometer  equipped with an ESI SC-2 DX4 autosampler . Standard solutions with various concentrations of trace elements prepared from Universal Data Acquisition Standards Kits (PerkinElmer Inc.) are used to calibrate the system. The 10 g/L Yttrium and Rhodium Pure Single-Element Standard (PerkinElmer Inc.) used for internal online standardization. Permanent analysis of the certified reference material of hair GBW09101  was employed for laboratory quality control. A study was conducted before and after every round of examination. The recovery rate for all trace elements analyzed was between 88 and 107%. The Center for Biotic Medicine laboratory  is an IUPAC company associate and participates in the Occupational and Environmental Medicine External Quality Assessment Schemes system.The significance of differences was tested using the Mann\u2013Whitney U test. The significance level (p) was considered at \u22640.05. The data were processed using the Statistica 10.0 software package . The reference intervals were estimated using the American Society for Veterinary Clinical Pathology Quality Assurance and Laboratory Standard Guidelines . BrieflyA comparative analysis of the data obtained revealed a significant difference in the main essential and toxic elements in different periods of ontogenesis .As a result, the overwhelming list of chemical elements was discovered to have the highest concentrations in 10-day laying hens. The highest concentrations of the overwhelming list of chemical elements were found in laying hens at 10 days of age. Furthermore, compared to the 30 days of age, there was a considerable drop in Ca (p\u22640.01), Mg (p\u22640.01), P (p\u22640.001), I (p\u22640.001); Mn (p\u22640.01), Se (p\u22640.01), As (p\u22640.05), Al (p\u22640.01), Sr (p\u22640.01), and Hg (p\u22640.01) as they grew older.At the age of 120 days, this difference increased and was, respectively, for Ca \u2013 66.6% (p\u22640.001); K \u2013 75.6% (p\u22640.001); Mg \u2013 51.8% (p\u22640.001); Na \u2013 56.7% (p\u22640.001); P \u2013 79.7% (p\u22640.001); Co \u2013 74.7% (p\u22640.001); I \u2013 95.9% (p\u22640.001); Mn \u2013 73.1% (p\u22640.001); Se \u2013 53.5% (p\u22640.001); B \u2013 65.7% (p\u22640.001); Li \u2013 75.0% (p\u22640.001); V \u2013 53.5% (p\u22640.001); As \u2013 55.3% (p\u22640.001); Al \u2013 79.8% (p\u22640.001); and Sr \u2013 73.4% (p\u22640.001). Si concentration in feathers of birds of 30 and 120 days of age was higher - by 76.5 (p\u22640.01) and 68.9% (p\u22640.01); Cr \u2013 by 82.4% (p\u22640.01) and 9.8%.th to 210th day, the fact of a gradual increase was observed in the concentrations of Ca (p\u22640.01), Mg (p\u22640.001), Na (p\u22640.01), Co (p\u22640.001), Cu (p\u22640.001), Fe (p\u22640.001); I (p\u22640.05), Mn (p\u22640.05), Se (p\u22640.001), B (p\u22640.01), Li (p\u22640.001), V (p\u22640.05), As (p\u22640.001), Al (p\u22640.05), Sr (p\u22640.01), and Hg (p\u22640.05). Simultaneously, the concentration levels of Co (p\u22640.001), Cr (p\u22640.001), Cu (p\u22640.001), Fe (p\u22640.001), Ni (p\u22640.001), Si (p\u22640.05), V (p\u22640.05), Sr (p\u22640.01), Sn (p\u22640.001), and Cd (p\u22640.001) increased in laying hens in the period from 120th to 150th day, after which they statistically insignificantly decreased to 210-day age.We recorded the minimum concentrations of Ca, K, Mg, Na, P, Co, Cr, Cu, Fe, I, Mn, Se, B, Li, Ni, V, As, Al, Sr, Cd, and Hg for the entire study period of egg production at the age of 120 days. The exception was Si, the concentration of which did not confirm the general pattern and was higher relative to the same indicator calculated for the age of 150 days by 25.8% (p\u22640.001). In general, for the period from 120Because the average values of the concentrations of chemical elements in laying hens in different periods of ontogenesis  had significantly significant differences, the reference intervals were calculated separately for each listed period Tables-. ConsequSignificant differences in the magnitude of the percentile intervals were discovered when the borders of the generated intervals were compared in the analyzed age periods. For example, at the age of 30 days, the most outstanding 97.5 percentile value was found for Ca, Mg, Na, Co, Cr, Cu, Fe, Mn, Se, Zn, B, Li, NI, Si, As, Al, Sr, Pb, Sn, and Cd, and the lowest values for K, P, I was observed at the age of 10 days. However, lying hens had minimum values of 2.5 percentile for all examined elements at 120 days of age, except for Si, which had minimum values at 10 days.th to the 120th day, there was a significant decrease in these elements, which was later replaced by a statistically significant increase in concentrations in the period from the 120th to the 150th day. Minimal growth and relative stability of concentrations characterize the experiment\u2019s final period (150-210 days).It can be stated that the highest concentrations of chemical elements were observed in laying hens at the age (of 10 days). Subsequently, as they grew older, in the period from the 30It was assumed that changes in the concentrations of chemical elements in the bird\u2019s feathers would depend on the level of the latter\u2019s intake of feed, as we previously showed for horses . HoweverHowever, this hypothesis was not confirmed in a comparative analysis of the results for the concentrations of As, Al, Sr, and Pb, the content of which at an early age (10 and 30 days) was significantly higher than in later periods. These differences may be associated with the metabolism of metallothionein, a protein synthesized in the body of animals in response to the intake of heavy metals from the external environment . Sex horThe significant fact is that the minimum concentrations of almost all the evaluated chemical elements were observed at the end of molting at 120 days. Accompanying a natural decrease in feed intake and inhibition of the metabolism of trace elements in the body of laying hens . ElementThe data obtained in our experiment compared with the data on the content of trace elements in birds raised in different regions were to understand the influence of the breeding biogeochemical province on the elemental status of laying hens. Comparative analysis showed that the data on the Zn content obtained in our experiment were higher than the results obtained for chickens raised in Malaysia  and KoreThe observed difference in the content of toxic metals in feathers may be related to background pollution with toxic metals in the surveyed areas ,58,59. SThus, the concentrations of most chemical elements in feather-laying hens varied significantly depending on age. In this regard, the age factor must be considered when developing reference intervals for specific regions. In this study, reference concentration intervals were determined for 25 chemical elements  in the feathers of physiologically healthy laying hens of the Hisex Brown cross at different periods of ontogenesis . The established reference intervals are proposed to be used to detect elementosis in laying hens bred in the South Ural biogeochemical province.SL: Carried out general management and developed experimental methods. OZ: Did statistical analysis and drafted the manuscript. AF conducted experiments, analyzed, and interpreted data. All authors read and approved the final manuscript."}
+{"text": "Here, we propose a two-step approach, an initial unsupervised inspection of the structure of the high dimensional data followed by supervised analysis of gene expression levels, to reconstruct the surface patterns on different subtypes of acute myeloid leukemia (AML). First, Bayesian methodology was used, focusing on surface molecules encoded by cluster of differentiation (CD) genes to assess whether AML is a homogeneous group or segregates into clusters. Gene expressions of 390 patient samples measured using microarray technology and 150 samples measured via RNA-Seq were compared. Beyond acute promyelocytic leukemia (APL), a well-known AML subentity, the remaining AML samples were separated into two distinct subgroups. Next, we investigated which CD molecules would best distinguish each AML subgroup against APL, and validated discriminative molecules of both datasets by searching the scientific literature. Surprisingly, a comparison of both omics analyses revealed that CD339 was the only overlapping gene differentially regulated in APL and other AML subtypes. In summary, our two-step approach for gene expression analysis revealed two previously unknown subgroup distinctions in AML based on surface molecule expression, which may guide the differentiation of subentities in a given clinical\u2013diagnostic context. High-throughput molecular analyses are becoming increasingly affordable in clinical medicine, and have significantly improved our understanding of diseases such as cancer ,2. HowevDiagnosis of acute myeloid leukemia (AML) is of great medical importance in the field of hematology, as one of its subtypes, specifically, acute promyelocytic leukemia (APL), is associated with a substantial risk of early death from bleeding complications . AlthougIn this work, we applied an unbiased mathematical approach that combines Bayesian and computed ABC analysis  on gene http://firebrowse.org/?cohort=LAML&download_dialog=true, accessed on 3 April 2017). It can also be downloaded from the GDC Data Portal for each case separately . Clinical annotations for the LAML dataset included FAB subgroups as the most diverse established classification system for AML, while more recent classifications such as WHO 2016 )In summary, we conclude that our unbiased mathematical approach was highly successful in deducing knowledge from complex biological datasets. \u201cThe important few\u201d AML-specific CD genes identified by combined Bayesian and calculated ABC analysis are widely congruent with actual knowledge in the field, independent from the particular method of gene expression analysis. Thus, the work described here may serve as a blueprint for translating relevant information from high-dimensional biological data into clinical applications."}
+{"text": "Airway mucus obstruction is a major challenge in children admitted to the paediatric intensive care unit (PICU). We aimed to evaluate the evidence and contemporary use of the mucolytic medication dornase alfa for non-cystic fibrosis conditions in the PICU.Study selection: for quality assessment and data synthesis, we included only randomised controlled trials (RCTs) that compared dornase alfa to standard care or placebo in critically-ill paediatric patients (<18 years of age) in the PICU. However, non-randomised controlled studies and case series are also discussed. Data extraction: data were extracted independently by multiple reviewers using data extraction forms. The primary outcome was duration of mechanical ventilation. Data synthesis: The GRADE approach was used for quality assessment. No meta-analysis could be performed. (2) A national cross-sectional survey among all seven PICUs in the Netherlands was also performed.(1) We performed a systematic review with searches in PubMed, EMBASE, and the Cochrane Library. The systematic review yielded only one RCT, comparing dornase alfa with normal saline in children after cardiac surgery. In this study, dornase alfa led to a reduction in duration of mechanical ventilation by approximately 1 day (36% reduction). In addition, we found nine retrospective observational and case studies. The survey revealed high current use of dornase alfa in Dutch PICUs: 42% of the respondents reported prescribing dornase alfa at least once every week. Only 4% of the respondents reported having access to a local PICU dornase alfa protocol.The off-label use of dornase alfa in the PICU is frequent without strong evidence or local protocols, highlighting the need for further research on the effectiveness of this mucolytic agent. Airway obstruction resulting from a combination of mucus hypersecretion, increased mucus viscosity and decreased mucociliary clearance poses a major challenge in the care for critically-ill children with respiratory disease in the paediatric intensive care unit (PICU).Mucus viscosity is substantially increased by the presence of extracellular DNA,The extent of off-label use of dornase alfa in non-CF patients in the PICU is largely unknown. To provide further insight, we performed a systematic review of the literature to establish the current evidence and carried out a national survey to determine the contemporary use of dornase alfa in PICUs in the Netherlands.We first performed a systematic review of the literature following the Cochrane collaboration principles and quality assessment, in accordance with the Preferred Reporting Items for Systematic Reviews and Meta\u2010Analyses (PRISMA) statement , atelectasis resolution or improvement on chest X-ray, re-intubation rate, mortality, respiratory system mechanics measurements , oxygenation/ventilation indices, and adverse events.For data synthesis and quality assessment, we only included randomised controlled trials (RCTs) that compared dornase alfa to standard care or placebo in critically-ill paediatric patients (<18 years of age) admitted to the PICU. However, observational studies and case studies are also reported unless only available in abstract form. Studies with CF patients, laboratory or animal studies, studies that were not available in English and studies that were not carried out in a PICU were excluded from this review.We performed a final search on 21 July 2020 for relevant studies in the electronic databases Pubmed, EMBASE, and Cochrane Library. Databases were searched from inception to the dates as stated using search terms as provided in the Two review authors (BH and RL) removed duplicate reports and screened titles and abstracts identified by the search for eligibility and coded them as \u201cretrieve\u201d  or \u201cdo not retrieve\u201d. Review authors BH and RL independently checked those marked as eligible, potentially eligible or ineligible against the inclusion criteria. We retrieved the full-text of eligible trial reports or publications and four review authors  independently screened the full-text articles and identified studies for inclusion, recording reasons for exclusion of ineligible studies. The references of relevant articles were checked for potentially eligible studies.Data were captured using a standardised data extraction form. Study information was extracted on the design and setting of the study, inclusion and exclusion criteria, participant characteristics , nature of the intervention(s) in each group , time-points of measurements, and outcomes as described above. Any disagreements were resolved through discussion or, if required, with consultation of the other review authors.For eligible RCTs, four review authors  independently used the Cochrane risk of bias tool for randomised trials.Data are presented in a summary of findings table. We determined an overall grading of the evidence for the outcomes using the principles of the GRADE system to determine the strength of the evidence. The GRADE approach assesses the quality of evidence into one of four grades: high, moderate, low or very low.For binary variables, data were calculated as relative risk (RR) with 95% confidence intervals (95% CI). Data for continuous variables were calculated as mean differences (MD with 95% CI) when applicable. Medians of continuous variable were presented for each group, as no median difference could be calculated.In July 2019 an online, anonymous survey containing questions pertaining to the current use  of dornase alfa was distributed via Limesurvey to the full medical staff and fellows (n=99) of all seven PICUs in the Netherlands (~4000 admissions per year). Email addresses were retrieved via the Dutch Paediatrics Association (NVK), section Paediatric Critical Care. The survey was created and distributed following current available recommendations where possible and appropriate.10.1136/ejhpharm-2020-002507.supp2Supplementary dataThe search on 21 July 2020 yielded a total of 2398 results of which only one study was an RCT fulfilling inclusion criteria, while 11 were observational or case studies .19\u201330 Fo10.1136/ejhpharm-2020-002507.supp3Supplementary data10.1136/ejhpharm-2020-002507.supp4Supplementary dataThe use of dornase alfa in the PICU was studied for the treatment of atelectasis in critically-ill children receiving invasive mechanical ventilation,In addition, four retrospective studies with small sample sizes (n<50) in mechanically ventilated patients described improvement of atelectasis, chest X-ray scores, respiratory and heart rate, and gas exchange/ventilator parameters, but all with different end points between studies.The survey response rate was 46% . This included responses from all seven PICUs, with a mean\u00b1SD of 14.3\u00b15.5% of the respondents per centre. Respondents from all but one PICU reported prescribing dornase alfa for non-CF conditions, and 42% reported frequent use (\u22651 times per week) . This waThe main finding from our systematic review of the literature is that the evidence for effectiveness of dornase alfa treatment for airway mucus obstruction in critically-ill children with non-CF diseases in the PICU is scarce, comprising only one RCT in addition to several observational/case studies. This importantly contrasts with the main finding of our national, multicentre survey reporting a remarkable frequent off-label use of dornase alfa in non-CF conditions in the PICU in the Netherlands, despite a lack of local protocols.To our knowledge, this systematic review is the first to study the current evidence for dornase alfa specifically in the PICU. While several retrospective and case studies suggest beneficial effects of dornase alfa on resolution of atelectasis and/or clinical indices were identified, there is only one RCT of good quality which showed shortening of duration of mechanical ventilation (primary outcome in this systematic review), but only in a specific age and disease population. This paucity of data in critically-ill children, who are in general highly prone to develop respiratory failure following airway mucus obstruction related to their small airway diameter,Despite the limited evidence for effectiveness as well as reported lack of local protocols for dornase alfa, current reported use of this mucolytic agent in PICUs in the Netherlands was high. These findings are in line with a recent single centre PICU study from the US reporting major usage of dornase alfa, which was associated with high costs of up to US$150 000 per year.Following the frequent use of dornase alfa despite limited scientific evidence, potential safety issues, in addition to the associated costs as discussed above, should also be addressed. Luckily, dornase alfa is in general well tolerated, with mild adverse effects such as voice alteration or rash reported in large meta-analyses in patients with CF.Based on our combined systematic review and survey results, we have identified the need for future randomised controlled testing of (cost-)effectiveness of dornase alfa in the PICU. Given the notorious heterogeneous patient population coupled with a challenge to obtain large sample sizes in PICU research, RCTs may be focused on largely homogenous diseases such as severe viral bronchiolitis, as was also identified as a priority in our survey. Furthermore, based on our survey, we propose the duration of invasive mechanical ventilation as the primary clinical outcome in future RCTs , instead of focusing on (chest X-ray confirmed) atelectasis or oxygenation/ventilation indices. Duration of mechanical ventilation needs standardising of weaning/extubation protocols, but given the general low PICU mortality which is often unrelated to severity of respiratory disease,A limitation of our systematic review was that only one (industry sponsored) RCT was found, focusing on one specific patient PICU population, which hampered our conclusions. In addition, a limitation of our survey study was the moderate response rate, although this was certainly reasonable when considering nationwide surveys in general. This may have caused bias by reporting higher use of dornase alfa. However, responses from all PICUs were documented, which strengthens our findings.In conclusion, based on a systematic review of the literature, there is insufficient evidence to recommend dornase alfa as a routine treatment for airway mucus obstruction or atelectasis in critically-ill children with non-CF diseases in the PICU. Despite this paucity of data and lack of local protocols, the current use of dornase alfa in PICUs in the Netherlands is high. Given the clinically relevant and challenging treatment of airway mucus obstruction in critically-ill children, but also the potentially high costs associated with dornase alfa use, further research on the effectiveness of dornase alfa in the PICU is needed."}
+{"text": "In recent years, there has been a positive attitude toward gut microbiota and its effect on cardiovascular diseases, including heart failure.The purpose of this study was to evaluate the effect of synbiotics on left ventricular hypertrophy by measuring NT-proBNP, and their effect on blood pressure and hsCRP as an inflammatory biomarker in patients with chronic heart failure.p < 0.05 as statistically significant.In this triple-blind randomized clinical trial, 90 eligible patients were included in the study. They were randomly assigned to receive one capsule (500 mg) of synbiotics or placebo per day for 10 weeks. NTproBNP, hsCRP and blood pressure were measured at the beginning and end of the study. Statistical analysis was performed on 80 patients by using SPSS 24, and P = 0.04). However, hsCRP increased in both groups as compared to the beginning of the study, but only in the placebo group the increase in hsCRP was significant (P = 0.01). The results showed that the changes in hs-CRP was not significant between the two groups. No statistically significant differences were observed in systolic and diastolic blood pressure between the two groups at the end of the intervention.At the end of the study, the level of NT-proBNP decreased significantly in the synbiotic group compared to the placebo group . Although the inflammatory factor increased in both groups, the significant increase in hsCRP in the placebo group could indicate the beneficial effects of synbiotics on the inflammatory status of these patients.https://en.irct.ir/user/trial/42905/view, identifier: IRCT20091114002709N52. Chronic heart failure (CHF) is a complex clinical syndrome which is characterized by a structural or functional disorder in the heart leading to the failure to pump blood within physiological pressure levels . The preIn recent years, there has been a positive attitude toward gut microbiota and its effect on cardiovascular diseases, including heart failure. Several small cohort studies have shown changes in the intestinal microbial population in patients with HF . ChangesParticipants were selected from patients with heart failure who were referred to Shahid Rajaie hospital, Tehran, Iran between October 2019 and August 2020. All items included in the checklist of Extending the CONSORT Statement to Randomized Trials of Non-pharmacologic Treatment were fulfilled. Patients with heart failure, aged between 30 and 70 years with LVEF <40 (left ventricular ejection fraction), who had been approved by a cardiologist and had received standard treatments for heart failure for at least 3 months and the medications had reached the maximum tolerable and constant dose, and those who were in one of I\u2013III stages of the NYHA , diabetes, thyroid disorders, severe renal impairment (creatinine \u2265300 mmol/L), lung diseases, inflammatory and autoimmune diseases, cancer, and acute infections. We also excluded those patients taking any nutritional supplements within the past 2 months, corticosteroids within the past 4 weeks, antibiotics within the past 3 months, as well as taking anti-inflammatory drugs except for low-dose aspirin (80 mg daily). Meanwhile, patients with a history of gastrointestinal surgery, rheumatic heart disease, and prosthetic heart valve were excluded from this study. Further exclusion criteria included smoking, pregnancy and lactation, insulin injection, BMI>30 kg/mThis study was approved by the ethics committee of Iran University of Medical Sciences  and was registered in the Iranian Clinical Trials Register (registration no. IRCT20091114002709N52). Informed consent forms and signatures were received from all the participants before any intervention. Participants were told that they could withdraw from the study at any stage of the project if they did not wish to continue cooperating with the project, and were assured that their information would remain confidential.n = 45) received one synbiotic capsule (each capsule = 0.5g) and control group (n = 45) received one placebo capsule (each capsule = 0.5 g) per day for 10 weeks. They were/told to keep the supplements in the refrigerator. Patient compliance s was checked by telephone calls and they were requested to bring their capsule box in the last visit.This study was performed as a randomized, triple-blind, placebo-controlled, parallel- group clinical trial in patients with heart failure. Participants entered the run-in period and did not consume any probiotic products and yogurt, for 2 weeks prior to the beginning of the study. Patients were asked not to consume yogurt, any probiotic products and any nutritional supplement during the study. They were also asked to maintain their regular life including physical activity and diet. Participants were randomized into two groups. experimental group  was determined as the sample size , 17. A sAll patients were distributed between the two groups by quadratic-blocks randomization and a random list was prepared by statistical software. Randomization and blinding were performed to maintain concealment in the study.n = 45) received one synbiotic capsule (0.5 g) which contained Lactobacillus casei (109 cfu), Lactobacillus acidophilus (1.5 \u00d7 1010 cfu), Lactobacillus rhamnosus (3.5 \u00d7 109 cfu), Lactobacillus bulgaricus (2.5 \u00d7 108 cfu), Bifidobacterium breve (1010 cfu), Bifidobacterium longum (5 \u00d7 108 cfu), Streptotus thermophilus (1.5 \u00d7 108 cfu), and excipients included fructooligosaccharide (38.5 mg), lactose, magnesium stearate, talc, and silicon dioxide. The other group (n = 45) received one placebo capsule (0.5 g) containing lactose, magnesium stearate, talc and silicon dioxide per day for 10 weeks. In a study that examined the effect of the probiotic Saccharomyces bulardii on patients with heart failure, it was found that the proposed treatment with probiotic is safe and well-tolerated and there are no reports of side effects in patients (Participants were randomized into two groups. One group (patients . The syn2). For most adults, an ideal BMI is in the 18.5\u201324.9 (kg/m2) range. BMI scores of 25\u201329.9 (kg/m2) are considered overweight. Normal and overweight BMI were included in the present study.Participants' weight with minimum coverage and without shoes was measured by using Seca scales with an accuracy of 100 grams and the standing height was measured without shoes by a gauge with an accuracy of 0.5 cm at the beginning and end of the study. BMI was calculated by using the formula , and the usual intake of energy, macronutrient and micronutrient was calculated by Nutritionist IV software. The amount of physical activity was assessed by using the short form of the International Physical Activity Questionnaire (IPAQ) (Dietary information was collected at the beginning of the study and at the end of the 10e (IPAQ)  at the bth week after 10\u201312 h of fasting by a laboratory expert. Blood samples were stored at \u221280\u00b0C during the study. The concentration of NTproBNP was measured by using ELISA method , and hsCRP by immunoturbidometery method .To measure blood factors, venous blood samples were taken from patients at the beginning of the study and at the end of the 10Systolic and diastolic blood pressure was measured via the right arm in a sitting position after 10 min of rest in the morning by a digital sphygmomanometer at the beginning and end of the study. People who entered the study had controlled blood pressure and were under the supervision of a doctor, and we did not include people who had uncontrolled high blood pressure (>14/8 mmHg).T test and intragroup comparison was performed using paired-samples T test. ANCOVA method was used to evaluate the effect of the intervention performed after adjusting based on the baseline values of the outcomes and BMI as covariates.In this study after collecting data, demographic and descriptive information as well as the relationship between variables were examined using statistical methods, all analyzes were performed with SPSS-24 software. Quantitative data were described as mean \u00b1 SD and median. qualitative variables were also reported as frequency in percentage. Kolmogorov-Smirnov test and other indicators of normality were used to check the normality of the data. Value for between-group comparison of qualitative data was performed by using Chi square or Fisher's exact test. Intergroup comparison of quantitative data was performed by using independent-samples p = 0.04) (p = 0.01)  . There w = 0.01) , Table 3 = 0.01) .The findings of the present study show that synbiotics have some effects on the serum levels of NTproBNP in patients with CHF, while they have no significant effects on hsCRP and blood pressure. To our knowledge, this is the first clinical trial which has been performed on the effect of synbiotics on NT-proBNP factor in patients with heart failure. Several clinical trial studies have been performed on the NT-proBNP factor which have shown consistent results with the current study \u201321. Pei-The results of some studies on serum NT-proBNP levels are inconsistent with the findings of the current study. Wujec-Makarewicz et al. reported that there were no changes on NT-proBNP levels, after 30 weeks of omega-3 fatty acid intake in a dose of 1 g per day in heart failure patients. They reported a limited sample size study and suggested that further research with higher sample sizes was needed to better understand the relationship between patient diet and the effectiveness of omega-3 supplements . AnotherDysbiosis and alteration of intestinal microbes can impair endothelial function by increasing reactive oxygen species (ROS), increasing lipopolysaccharides, decreasing SCFAs in the intestine, and reducing Nitric Oxide (NO) release in the endothelium, leading to chronic hypertension, which increases the severity of cardiac overload. As a result, we would observe an increase in NT-proBNP levels, which is one of the most important indicators of increased cardiac overload . Probiotp = 0/01). To the best of our knowledge, no study has examined the effect of synbiotics on hs-CRP levels in patients with heart failure. Ghanei et al. reported that the daily consumption of two probiotic supplements  for 12 weeks in 60 patients with polycystic ovary syndrome showed a significant decrease in serum hs-CRP levels within both groups at the end of the study, but in line with our study, no difference was observed between the two groups  for 6 weeks were investigated. At the end of that study, consistent with the results of current study, serum hs-CRP levels increased in both groups, although it was not statistically significant  for 6 months led to a significant decrease in CRP levels in the intervention group compared to baseline values but no significant difference was observed between the groups. It seems that the lack of effect between the groups was due to the high level of endotoxin and basal adipokine in the probiotic group compared to the placebo group (In the present study, there was no statistically significant difference in serum hs-CRP levels between the two groups at the end of the study. In fact, hs-CRP levels increased in both synbiotic and placebo groups; however, it should be noted that this increase was significant in the placebo group (o groups . Similarnificant . In anotbo group . Studiesbo group . In the bo group . The resbo group , 36. Morlactobacillus helveticus, a significant difference in systolic and diastolic blood pressure was observed between the groups. In this study, the species Lactobacillus helveticus was used and the reason for this choice was the production of biological peptides by the species of Lactobacillus, which have a similar activity to the angiotensin converting enzyme inhibitor and are even more effective than these kind of medications. Another mechanism mentioned for the antihypertensive effect of fermented milk is the calcium content of milk (Although we observed a decrease in blood pressure after the intervention in the synbiotic group and an increase in blood pressure in the control group, these numbers were not statistically significant and there was no significant difference between the two groups at the end of the intervention. Similar studies have reported the same finding indicating no significant difference in systolic and diastolic blood pressure after synbiotic supplementation. In a study evaluating the blood pressure lowering effects of fermented milk by  of milk . In a re of milk .The key strength of the present is that this is the first study evaluating the effect of synbiotics in patients with heart failure. Moreover, the patients were selected in such a way that there was no significant difference between the characteristics of the two groups before the intervention, indicating that very accurate and principled randomization was performed.However, there are some limitations to the present study. We did not examine the intestinal microbiome at the beginning, during and after taking synbiotics due to financial limitations.Overall, in this study, synbiotic consumption in patients with chronic heart failure for 10 weeks resulted in a significant decrease in NT-proBNP levels compared to the control group but it had no effect on the inflammatory factor hs-CRP, and systolic and diastolic blood pressure. Further studies are suggested to determine the mechanisms of action of probiotics by measuring the levels of SCFAs and TMAOs.The raw data supporting the conclusions of this article will be made available by the authors, without undue reservation.https://www.irct.ir/ Iran University of Medical Sciences, Tehran, Iran. The patients/participants provided their written informed consent to participate in this study.The studies involving human participants were reviewed and approved by FS, SS, and NN designed the research. SS conducted the research and wrote the paper. NN and AA heart failure specialists who made final approval of patients to enter the study. FH-B analyzed the data. FS had primary responsibility for final content. AD English specialist who has translated the language of the article into Native English. All authors reviewed the manuscript and approved it prior to submission.This RCT was funded by Iran University of Medical Sciences, Tehran, Iran.The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest.All claims expressed in this article are solely those of the authors and do not necessarily represent those of their affiliated organizations, or those of the publisher, the editors and the reviewers. Any product that may be evaluated in this article, or claim that may be made by its manufacturer, is not guaranteed or endorsed by the publisher."}
+{"text": "Ascaris lumbricoides and Ascaris suum. While preventive chemotherapy continues to be the most common control method, recent reports of anthelminthic resistance highlight the need for development of a vaccine against ascariasis. The aim of this study was to use a reverse vaccinology approach to identify potential vaccine candidates for Ascaris. Three Ascaris proteomes predicted from whole-genome sequences were analyzed. Candidate proteins were identified using open-access bioinformatic tools  which test for different characteristics such as sub-cellular location, T-cell and B-cell molecular binding, antigenicity, allergenicity and phylogenetic relationship with other nematode proteins. From over 100,000 protein sequences analyzed, four transmembrane proteins were predicted to be non-allergen antigens and potential vaccine candidates. The four proteins are a Piezo protein, two voltage-dependent calcium channels and a protocadherin-like protein, are all expressed in either the muscle or ovaries of both Ascaris species, and all contained high affinity epitopes for T-cells and B-cells. The use of a reverse vaccinology approach allowed the prediction of four new potential vaccination targets against ascariasis in humans and pigs. These targets can now be further tested in in vitro and in vivo assays to prove efficacy in both pigs and humans.Ascariasis is the most prevalent helminthic disease affecting both humans and pigs and is caused by the roundworms  Ascaris is the most prevalent soil-transmitted helminth (STH) infection in humans, being responsible for 0.861 million disability-adjusted life years (DALYs) worldwide  protocols, continues to be the mainstay of ascariasis control in humans, as advocated in the World Health Organization (WHO) roadmap for the control of Neglected Tropical Diseases (NTDs) . Reducedfections , 7, and ials yet . The proile eggs \u201312. ThesAscaris lumbricoides and Ascaris suum, which enable the search for putative vaccine candidates using a reverse vaccinology analysis. A reverse vaccinology approach combines genome information and bioinformatic tools for identification of vaccine candidates, and has been successfully applied to other nematodes before, such as Toxocara canis and Trichuris muris  . The procorrplot ] and IBMhttp://tools.iedb.org/mhcii/). This tool employs neural networks trained on IEDB experimentally validated epitopes to predict and quantify the binding affinity between a given peptide/antigen epitope and a selected MHC-II molecule recognized by CD4+ Th cells. The IEDB-recommended 2.22 prediction method was used, comprising the Consensus approach, NN-align, SMM-align, CombLib and Sturniolo methods, or NetMHCIIpan, if any of the previous methods was not available for the selected MHC-II allele  Major Histocompatibility Complex class II (MHC-II) binding predictor v2.22.3  to check for identity in humans and pigs. Epitopes with 100% identity to human or pig epitopes were discarded. The BLASTp analysis was conducted with a threshold of e-value=0.05. Each epitope was also submitted to Allertop 2.0  predicted to bind to the largest combined number of unique alleles in MHCII-IEDB tool analysis were retrieved. These epitopes were submitted to a BLASTp  search  (The presence of B-cell linear epitopes was assessed using Bepipred 2.0 webserver (available at: piPred/) . Using tCaenorhabditis elegans available in WormBase ParaSite database (http://www.ebi.ac.uk/Tools/muscle/index.html), the phylogenetic analysis was performed with Maximum-likelihood method using the JTT + G substitution model in MEGA-X .The correlation assessment of the Vacceed framework demonstrated a high correlation between the results of the different Vacceed runs . The remA. suum PRJNA62057 dataset. A total of 25,179 protein sequences were then analyzed for epitope binding to MHC-II alleles. When analyzing the final output, 32 protein sequences had epitopes predicted to bind to all the 27 MHC-II alleles in the reference set with a rank between 0.01 and 1. From this set of 32 protein sequences, 9 proteins belonged to the A. lumbricoides proteome, while the other 23 proteins were from the two A. suum proteomes, 3 from BioProject PRJNA80881 and 20 BioProject PRJNA62057. Only three of these protein sequences were predicted to be secreted proteins. A table detailing the WormBase protein identifiers and protein aa length for these 32 candidate proteins is provided in Before the CD4+ Th cell binding prediction was carried out, a further 2,906 duplicate sequences were identified and removed from the A. lumbricoides and A. suum were grouped into five clusters, represented by distinct genes in all three Ascaris genomes. The five genes and their respective transcripts are predicted to be responsible for the transcription of four membrane transporters and one cell adhesion protein.The analysis with AllerTop 2.0 and AllergenFP did not predict any allergens in the 32 protein sequences. However, antigen prediction tools classified four proteins sequences as non-antigenic, and these proteins were disregarded. The remaining protein sequences that had similar results between their respective orthologs in GS_24322, ALUE_0000418301 and AgB13X_g094)], \u201cPiezo-type mechanosensitive ion channel component\u201d [APiezo ], \u201cVoltage-dependent L-type calcium channel subunit alpha\u201d [ALtype ], and \u201cProtocadherin-like\u201d [AProto ]. According to the most recent transcriptomic data, both ATtype and AProto are highly expressed in the ovaries while APiezo and ALtype are highly expressed in the muscle of adults  being more closely related to the nematodes in Clade IV and the Spiruromorpha nematodes  being closer to the Clade V nematodes. These relationships can be seen in To analyse the potential relationship between the predicted vaccine targets and proteins in other nematodes, orthologs of the selected vaccine targets were retrieved from other nematode proteomes present in WormBase Parasite (Supplementary Table 5), aligned and used for the generation of a phylogenetic tree. There is a general clustering of the proteins within each nematode clade. The exception occurred in the APiezo orthologs where clade III nematodes were separated in two different groups, with the Ascaridomorpha nematodes (e.g., Ascaris proteins that could be included in multi-epitope vaccines against human and pig Ascaris infections. These genes are highly expressed in two distinct regions of the parasite: the ovaries and early egg stages, in the case of ATtype and Aproto, and in the muscle, the case for APiezo and ALtype (C. elegans was shown to affect reproductive tissue development and malfunction (Necator americanus and filarial parasites such as Loa loa, suggesting a role in adaptation to contact with blood. The AProto protein is the most unique as to our knowledge, as protocadherins have not been reported before in nematodes. The structural domains appear to be more closely related to that of Flamingo/Stan cadherins due to the presence of both laminin-G and EGF-like receptors with seven transmembrane domains (with these last highlighted in Ascaris (In this study we have used bioinformatic approaches to identify four different d ALtype , 19. Whifunction . One int Ascaris . It is aAscaris proteins (Trichuris is based on recombinant proteins and showed efficacies vastly superior to similar vaccines against ascariasis. With vaccine development against ascariasis lagging behind other parasitic diseases, there is a need to discover other antigens to be tested as vaccine candidates. The reverse vaccinology approach used in our study is based on genomic and proteomic data to predict which proteins may be usable as vaccine candidates prior to new in vivo studies. This methodology allows researchers to focus down vaccination assays to a smaller set of proteins, effectively reducing costs and time. This reverse vaccinology approach has been successfully applied to identify vaccination targets for other helminths, for example T. canis (, T. muris (Echinococcus granulosus (Schistosoma mansoni (Previous attempts to generate a vaccine against ascariasis used crude extracts, recombinant proteins and, more recently, chimeric proteins \u201312. The proteins . The vacT. canis , T. muriT. muris , Echinocanulosus , and Sch mansoni , 49.Ascaris proteomes. Previous in silico studies on vaccine candidate prediction in Ascaris focused exclusively on secreted proteins (A. lumbricoides multi-epitope vaccine candidate was developed using in silico methodology and proteins were selected based on their binding to the HLA-DRB1*07:01 and HLA-DRB1*15:01 MHC-II alleles (Ascaris antigens in humans, they only cover up to 15% of the human population in areas where human ascariasis is endemic (in vivo studies that cover population that do not have these MHC-II alleles, limiting its usefulness.Our reverse vaccinology analysis used all the proteins predicted in the three proteins . The wor alleles . Althoug endemic . This miAscaris is predicted to be 254 proteins (Ascaris. Recent work in Toxocara canis, a parasite of the same family as Ascaris, showed that membrane proteins are capable to induce protection in a mouse model, reinforcing the idea that it is an error to disregard these proteins when looking for vaccination targets in nematodes (Each of the three genomes included in the analysis were predicted to have over 5,000 proteins that could be further investigated as good vaccine targets according to Vacceed, which corresponds to 25\u201329% of all the proteins present. As the number of secreted proteins in proteins , this suproteins . As37 waematodes .Ascaris are still only partially understood (A. lumbricoides infections in humans (Haemonchus contortus vaccination assays, glycosylation was fundamental for the recognition and protection induced by some antigens (Ascaris proteins and how it affects the host is still not entirely understood and requires more work, but it is known to be a strategy that the parasite has developed to modulate the host immune response and make it less responsive (Escherichia coli (The underlying host's immune responses against derstood . This isn humans , 54. Thin humans , 50. A rn humans , 56. Selantigens . Glycosysponsive , 59. Anohia coli . To replhia coli .in vitro and in vivo. The next step should be to confirm in vitro that both humans and pigs are able to recognize these proteins targets and their respective epitopes. Should these proteins prove useful in stimulating an immune reaction in the host, we propose that the proteins and respective epitopes identified in this work should be incorporated into a multi-epitope vaccine which, ideally, would include CD4+ Th cell and B-cell binding epitopes from other proteins, such as As14, As16 and As37. Ideally, such a vaccine should be tested using a pig model to assess its potential effect on both larvae and adult Ascaris, impossible to assess using a mouse model. This is more relevant when testing for the utility of incorporating ATtype and AProto epitopes due to protein higher expression in the ovaries of adult female Ascaris and the released eggs (Whilst the proteins we selected have been predicted to be useful and have similarities to other proteins tested in vaccination assays against other nematodes, there is still the need to test them sed eggs . Should in silico methodology can play in identification of vaccine candidates for parasitic diseases. The genome-wide approach, without bias toward secreted proteins, led to the prediction of four novel candidates that were not identified in previous studies but show the promise of promoting a useful immune response in vaccination assays against A. lumbricoides and A. suum. These proteins should now be tested in vitro and in combination with already known vaccine targets. Ultimately, the findings of this study will support the future development of a vaccine against both ascariasis in humans and pigs, thus promoting the health of both populations by reducing the need to use mass-drug administration and decreasing the risk of anthelmintic resistance appearing.In conclusion, this study highlights the role that reverse vaccinology and The original contributions presented in the study are included in the article/Concept and design, data interpretation, and critical review and editing of the manuscript: FE, AV, SL, and MB. Data acquisition and analysis and manuscript draft: FE. All authors contributed to the article and approved the submitted version.This study was funded by a Doctoral College Studentship Award from the University of Surrey awarded to FE.The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest.All claims expressed in this article are solely those of the authors and do not necessarily represent those of their affiliated organizations, or those of the publisher, the editors and the reviewers. Any product that may be evaluated in this article, or claim that may be made by its manufacturer, is not guaranteed or endorsed by the publisher."}
+{"text": "Haloarcula. The Haloarcula sp. OS acetone extract (HAE) obtained from the biomass contained bacterioruberin and mainly C18 fatty acids, and showed potent antioxidant capacity using ABTS assay. This study further demonstrates, for the first time, that pretreatment with HAE of lipopolysaccharide (LPS)-stimulated macrophages results in a reduction in ROS production, a decrease in the pro-inflammatory cytokines TNF-\u03b1 and IL-6 levels, and up-regulation of the factor Nrf2 and its target gene heme oxygenase-1 (HO-1), supporting the potential of the HAE as a therapeutic agent in the treatment of oxidative stress-related inflammatory diseases.The production of reactive oxygen species (ROS) plays an important role in the progression of many inflammatory diseases. The search for antioxidants with the ability for scavenging free radicals from the body cells that reduce oxidative damage is essential to prevent and treat these pathologies. Haloarchaea are extremely halophilic microorganisms that inhabit hypersaline environments, such as saltworks or salt lakes, where they have to tolerate high salinity, and elevated ultraviolet (UV) and infrared radiations. To cope with these extreme conditions, haloarchaea have developed singular mechanisms to maintain an osmotic balance with the medium, and are endowed with unique compounds, not found in other species, with bioactive properties that have not been fully explored. This study aims to assess the potential of haloarchaea as a new source of natural antioxidant and anti-inflammatory agents. A carotenoid-producing haloarchaea was isolated from Odiel Saltworks (OS) and identified on the basis of its 16S rRNA coding gene sequence as a new strain belonging to the genus  This lipid structure is totally different from that found in the membrane of bacteria or eukaryotes and is one of the structural characteristics that supported the definition of Archaea as an independent domain of life [Many pathologies such as inflammatory bowel disease, psoriasis, and rheumatoid arthritis have an inflammatory base, triggered in part by a deficient antioxidant system that leads to ROS overproduction and chronic inflammation. Impairment of the antioxidant defense systems causes the overaccumulation of these oxidative species, which produces oxidative damage in lipids, proteins, and DNA, inducing cell death . For thi of life . Previou of life ,9,10,11;Most members of the class Halobacteria are pink or red pigmented due to the presence of carotenoids and retinal proteins in their membranes . CarotenHaloarcula was isolated from Odiel Saltworks, and the antioxidant and anti-inflammatory properties of an acetone extract from this microorganism, containing carotenoids and FA, were evaluated by both in vitro and cellular assays, to explore the molecular mechanisms underlying these activities. In the present study, a new strain of haloarchaea belonging to the genus 2\u22196H2O, 20 g MgSO4\u22197H2O, 1 g CaCl2\u22196H2O, 4 g KCl, 0.2 g NaHCO3, and 5 g yeast extract. The colony with the most intense red color was purified by five streaking rounds on fresh agar plates and preserved in 20% glycerol (w/v) at \u221280 \u00b0C for further use.Haloarchaeal strains were isolated from water samples from a crystallizer pond in Odiel Saltworks , located in the Odiel River Marshlands in Huelva . Water samples (20 \u00b5L) were plated in agar plates and incubated at 37 \u00b0C for 30 days. The culture medium used for the isolation contained per liter: 10 g glucose, 156 g NaCl, 13 g MgCl\u00ae DNA polymerase , and 2.5 \u00b5L of its specific 10\u00d7 buffer that contained 10 pM of each primer, 0.2 mM dNTPs, and 2.5 mM MgCl2. The thermal profile was set to 0.5 min at 96 \u00b0C, 0.5 min at 56 \u00b0C, and 1 min at 72 \u00b0C for 30 cycles, followed by 10 min of final extension. The PCR products were checked by electrophoresis, on a 1% agarose gel, and sent to Stabvida  for Sanger sequencing. The 1.4 kb 16S rRNA gene sequences obtained were compared to those available at the GenBank and the European Molecular Biology Laboratory (EMBL) databases, using the Basic Local Alignment Search Tool (BLASTn) at the National Center for Biotechnology Information (NCBI) [The selected microorganism was identified by 16S ribosomal RNA gene sequencing. Genome DNA was extracted by using the Gene JET Genomic Purification kit , following the manufacturer\u2019s instructions. The full length of the 16S rRNA coding gene was amplified with specific primers for archaea 21F (5\u2032-TTCCGGTTGATCCTGCCGGA-3\u2032) and 1492R (5\u2032-GGTTACCTTGTTACGACTT-3\u2032). Polymerase chain reaction (PCR) was carried out in a total volume of 25 \u00b5L, using an Eppendorf thermo-cycler. The reaction mixture contained 1 \u00b5L of genomic DNA, 0.2 U RED Taqn (NCBI) . g for 15 min at 4 \u00b0C. The cellular pellet was treated overnight with 10 mL of cold acetone (\u221220 \u00b0C) per gram of fresh biomass in the dark, and vortex several times until a colorless pellet was obtained. Then, the sample was centrifuged at 4 \u00b0C and 19,800\u00d7 g for 30 min, and the supernatant, which contains carotenoids and other lipophilic compounds, was dried in a rotary vacuum evaporator and freeze dried. The selected microorganism was grown in the liquid medium previously detailed for the strain isolation at 37 \u00b0C and 150 rpm for 10 days, and the growth was monitored according to the optical density at 580 nm. When the culture reached the stationary phase of growth, 1 L was collected by centrifugation at 19,800\u00d7 TM kit from MIDI, Inc. , after acetone removal at 40 \u00b0C and 100 mBar on a vacuum evaporation system . At least two samples of extract were used per lipid extraction. For lipid quantification, the FA C19:0 , was added as an internal standard prior to transesterification. The base-catalyzed kit allows the methylation of FA to FAMEs and their extraction to an organic solvent for analysis. The FAs were extracted and simultaneously methylated to fatty acid methyl esters (FAMEs) using the Instant FAMEThe FAMEs were analyzed by gas chromatography on a 6890N gas chromatograph, equipped with a flame ionization detector (FID) and a 7683B series injector, all from Agilent Technologies . The gas chromatograph was equipped with a 25 m long Agilent J&W Ultra 2 capillary column and was programmed and controlled by the Sherlock software package, version 6.2 . Peak identification was carried out by Sherlock Software by comparison with standards. Their identification was confirmed by injection of the same samples on an Agilent 7820A gas chromatograph equipped with a 7693A autoinjector and a 5977E quadrupole mass spectrometer . A 25 m long Agilent J&W Ultra 2 capillary column was used, and the carrier gas was helium at 1.5 mL/min.1% = 2540 (100 mL g\u22121 cm\u22121) [\u22121. Solvents were (A) a mixture of acetonitrile/water (9:1 v/v) and (B) pure ethyl acetate. The gradient elution program was as follows: 0\u201316 min 0\u201360% A; 16\u201330 min 60% A; 30\u201335 min 100% A. The column temperature was kept at 25 \u00b0C, and the injection volume was 100 \u00b5L. Chromatograms were recorded in the range of 450 nm and the EZ ChromeElite program was used for data processing. The compounds were identified on the basis of their retention time and UV\u2013Vis spectra. The content of total carotenoids in the acetone extract was calculated by the absorbance of the sample at 496 nm in a cuvette with a 1 cm path length and using the specific absorption coefficient A\u22121 cm\u22121) . The chr50) was calculated, and results were expressed as Trolox Equivalent Antioxidant Capacity, TEAC (EC50 sample/EC50 Trolox).The antioxidant activity of the compounds as a scavenger was performed by the ABTS colorimetric method . The ABT\u00ae, Life Technologies, New York, NY, USA) containing 10% heat-inactivated fetal bovine serum, 100 U/mL penicillin, and 100 mg/mL streptomycin , in a humidified atmosphere containing 5% CO2 at 37 \u00b0C. Human acute monocytic leukemia cell line, THP-1, was purchased from the American Type Culture Collection  and cultured in RPMI 1640 media  and, incubated in a humidified atmosphere of 5% CO2 at 37 \u00b0C for 72 h. Afterward, the medium was removed, and cells were washed twice with ice-cold phosphate saline buffer . Then, the macrophages were treated with different concentrations of the acetone extract  for 24 h prepared in DMSO stock solutions at a concentration of 50 mg/mL and diluted to desired concentration directly in the culture medium. Controls were incubated in a fresh medium containing DMSO (0.2% v/v), which did not affect cell viability. Then, the cells were washed  prior to the addition of 100 \u03bcL of 0.25 mg/mL MTT solution into each well and were incubated for 4 h. The formazan crystals were dissolved with DMSO (200 \u03bcL) and 0.1 M glycine buffer pH 10.5 (25 \u03bcL). Finally, the absorbance was measured at 550 nm by using a Multiskan EX microplate reader  and the 50% inhibitory concentration (IC50) was calculated.The in vitro cytotoxicity assessment of HAE was determined by the 3--2,5 diphenyltetrazolium bromide  method  by using5 cells/mL with 8 nM PMA as described above. Then, the medium was removed, and cells were washed . Subsequently, a pretreatment with the HAE , and dexamethasone (Dex) as control (1 \u00b5M) was carried out for 1 h. Then, the intracellular ROS production was induced by the addition of lipopolysaccharide from E. coli  for 24 h. Control groups, unstimulated (Control) and stimulated (LPS) were incubated with a medium containing DMSO (0.2% v/v). Then, the supernatants were removed, and cells were washed  supplemented with 20 \u00b5M DCF-DA (100 \u00b5L/well) and incubated for 45 min, according to the manufacturer\u2019s instructions. Fluorescence was measured by using a fluorescence plate reader  at 485 nm for excitation and 535 nm for emission.The production of intracellular ROS was determined by using DCF-DA dye assay  in THP-1 macrophages. Briefly, THP-1 cells were seeded into a 96-well black plate (100 \u03bcL/well) at a density of 105 cells/mL in the presence of 8 nM PMA as described previously. After differentiation, the medium was removed, and cells were washed twice . Subsequently, a pretreatment with the HAE at different concentrations  and Dex (1 \u00b5M) as positive reference compound was performed for 1 h. Then, the inflammatory response was induced by the addition of LPS (1 \u03bcg/mL) for 24 h. Control groups were incubated with a growth medium containing DMSO (0.2% v/v). Afterward, the supernatants were collected and stored at \u221280 \u00b0C until cytokines determination by ELISA , according to the manufacturer\u2019s protocol. The absorbance was measured with a microplate reader  at 450 nm.The production of pro-inflammatory cytokines was studied in human THP-1 macrophages. Briefly, THP-1 were seeded into a 96-well plate (100 \u03bcL/well) at a density of 105 cells/mL in the presence of 8 nM PMA as previously described. After the incubation period, the medium was removed, the cells were washed twice , and incubated with different concentrations of the HAE  for 1 h. The inflammatory response was induced by the addition of LPS (1 \u03bcg/mL) for 24 h. The Control group was incubated with a growth medium containing DMSO (0.2% v/v). Subsequently, cell pellets were mixed with cold lysis buffer containing a cocktail of protease inhibitors -N,N,N\u2019N\u2019-tetraacetic acid, 0.5 mM EDTA, 1 mM phenylmethylsulfonyl fluoride, 0.01 mg/mL leupeptin, 0.01 mg/mL pepstatin, 0.01 mg/mL aprotinin, and 250 mM NaCl (40 \u00b5L per sample) and incubated on ice for 30 min. After that, cell homogenates were centrifugated  to discard cell debris and DNA. The protein cytoplasmic content in the supernatants was determined using the Bradford method. Aliquots of supernatants containing equal protein (50 \u00b5g) were separated on 10% acrylamide gel by SDS-polyacrylamide-gel electrophoresis. Then, the proteins were electrophoretically transferred onto a nitrocellulose membrane and incubated with specific primary antibodies as follows: rabbit anti-Nrf2 (1:1000) and rabbit anti-HO-1 (1:1000) . Each membrane was washed three times for 10 min and incubated with the secondary horseradish peroxidase-linked anti-rabbit . To prove equal loading, the blots were analyzed for \u03b2-actin expression by using an anti-\u03b2-actin antibody . Immunodetection was performed by using a chemiluminescence light-detecting kit . Densitometric data were analyzed following normalization to the housekeeping gene (\u03b2-actin), and the signals were quantified with Scientific Imaging Systems .The expression of the antioxidant proteins Nrf2 and HO-1 was determined by Western blotting in THP-1 macrophages. Briefly, THP-1 were seeded into 6-well plates (2000 \u03bcL/well) at a density of 4 \u00d7 10p values < 0.05 were considered statistically significant. The statistical test used for individual analyses is provided in the figure legends.All values in the figures, tables, and text are expressed as arithmetic means \u00b1 standard error of the mean (S.E.M.). Data were evaluated by using the GraphPad Prism Version 6.00 software . The Kolmogorov\u2013Smirnov test was used to verify the normality of the data. \u22121), as shown in Haloarcula species, such as H. hispanica, H. japonica, or H. marismortui. In this regard, multiple alignments were generated by Multiple Sequence Comparison by Log-Expectation (MUSCLE). Thus, it was designated as Haloarcula sp. OS. A new strain of haloarchaea was isolated from a crystallizer pond in Odiel Saltworks with 32% salinity at the moment of sampling. This microorganism was selected for its fast growth  , includiloarcula .Haloarcula sp. OS (HAE) with the aim of testing its potential as an antioxidant and anti-inflammatory agent. The carotenoid and FA content of this extract was analyzed by RP-HPLC-DAD and GC-MS, respectively. The elution profile of the carotenoids revealed three main peaks with identical absorption spectra with absorption maxima at 468, 496, and 532 nm and two cis absorption maxima at lower wavelengths (1% = 2540 (100 mL g\u22121 cm\u22121).An acetone extract was obtained from elengths , which cIn addition to carotenoids, other lipid compounds, such as unsaturated FAs, have been shown to play an important role as antioxidants against ROS species. When the HAE was analyzed by gas chromatography-mass spectrometry, significant amounts of 16:0, 18:0, and 18:0 10-methyl FA were identified. This led to the characterization of the extract in terms of FAs. The analysis of the FAs content of the total lipids in the HAE showed that the most abundant FA was 18:0 , while the others accounted for ca. 0.4\u201314% . The amoThe antioxidant capacity of the HAE was tested using the 2,2\u2032-azino-bis (3-ethylbenzothiazoline-6-sulfonic acid) (ABTS) method. Several dilutions of the HAE were assayed A to obtaThe levels of intracellular ROS produced in LPS-stimulated THP-1 macrophages were measured by using 2\u2032,7\u2032-dichlorodihydrofluorescein diacetate (DCF-DA) . First, p < 0.001), which showed 57.3% of ROS basal levels. The glucocorticoid dexamethasone  reduced ROS production to similar levels to those of the Control group (p < 0.001). The treatment with the HAE caused a significant decrease in ROS production at all tested concentrations (p < 0.05), which achieved a reduction close to 40% in ROS levels.ROS production was significantly increased in the LPS group in comparison with the Control group . The anti-inflammatory reference drug dexamethasone significantly reduced the levels of both cytokines (p < 0.001). As shown in p < 0.01 and p < 0.001, respectively). Furthermore, the HAE substantially reduced IL-6 levels at all tested concentrations (p < 0.001) (The in vitro anti-inflammatory activity of the HAE obtained from < 0.001) B.p < 0.05) in LPS-stimulated macrophages   for 1 h and then stimulated with LPS (1 \u03bcg/mL). As presented in rophages B. This rctively) C.The bioactive properties of haloarchaea extracts are usually linked to the antioxidant capacity of bacterioruberin. The potential of this carotenoid as a radical scavenger has been demonstrated in vitro by several chemical assays  in different genera of halophilic archaea ,25,26. HM. fervidus [Halobacteriaceae, the core lipid that is the basis for the most polar lipid structures is 2,3-di-O-phytanyl-sn-glycerol, with monomethylated phosphatidylglycerophosphate (PGP-Me) being the main phospholipid [Haloarcula sp. OS, H. japonica, H. marismortui, and H. hispanica, also contain sn-2,3-di-O-phytanylglycerol exclusively as a core lipid [Halobacterium halobium, Methanobacterium thermoautotrophicum, Methanococcus jannaschii, and Methanopyrus kandleri [Although bacterioruberin is the main carotenoid found in haloarchaea, ,28,29, tfervidus ,31. Dietfervidus . In the pholipid . The clore lipid ,34. Signkandleri . Archaeakandleri . Howeverkandleri .Haloarcula sp. OS strain by using ABTS assays. Therefore, the antioxidant activity of the HAE in LPS-stimulated THP-1 macrophages was further evaluated as an in vitro model of oxidative stress. HAE significantly reduced intracellular ROS production induced by LPS, thus protecting cells from oxidative stress. These results are consistent with a variety of studies reporting the antioxidant activity of carotenoids [Accumulating evidence has revealed that oxidative stress and inflammation play a key role in the development and progression of many pathologies, including atopic dermatitis, psoriasis, inflammatory bowel disease, cardiovascular disease, and cancer, among others. It has been shown that in an inflammatory process, immune cells release large amounts of ROS, which induce damage to macromolecules such as DNA, lipids, and proteins, as well as lead to the production of pro-inflammatory mediators . For thiotenoids ,40, and otenoids ,42,43,44Overproduction of ROS results in the release of high levels of pro-inflammatory cytokines such as TNF-\u03b1 and IL-6. These cytokines can activate immune cells to generate more inflammatory mediators and amplify the immune inflammatory response, leading to tissue damage . In the Nrf2 is a redox-sensitive transcription factor that under oxidative stress translocates to the nucleus and activates the expression of antioxidant genes such as HO-1. Previous studies have shown that the increase in Nrf2-mediated HO-1 has anti-inflammatory effects through the inhibition of many pro-inflammatory mediators, including TNF-\u03b1 and IL-6 . It is wAdditionally, it is well known that the bioaccessibility and bioavailability of carotenoids depend on the proportion of these molecules solubilized in micelles that are formed with other lipophilic compounds, such as FAs, cholesterol and phospholipids . In factiso and anteiso FAs, have been found to have a beneficial anti-inflammatory role by increasing the expression of IL-10 [It is well established that diets rich in polyunsaturated FAs and pigments, as well as the use of these compounds in supplements, have significant health benefits . The HAEof IL-10 , as wellof IL-10  and antiof IL-10 ,53.per se, since this promising carotenoid is poorly investigated. On the other hand, the potential of HAE as an antioxidant/anti-inflammatory agent has been evidenced in the present work, but additional in vivo bioaccessibility and bioavailability studies are necessary to demonstrate its therapeutic potential and explore further mechanistic studies. Numerous studies on the lipid composition, including FAs and carotenoids, of, e.g., microalgae have been published but studies on the composition of Archaea are still scarce [Based on the results of the present paper, the authors are aware of the limitations of this study but also its potential. In this regard, we have only performed in vitro experimental work with an acetone extract enriched in the carotenoid bacterioruberin and FAs. Therefore, further studies focused on optimizing culture conditions would be of interest to obtain extracts or batches with a similar composition in FAs and bacterioruberin, as well as higher amounts of bacterioruberin l scarce ,55. Our Haloarcula sp. OS isolated from Odiel Salworks produces the carotenoid bacterioruberin and significant amounts of FAs. The findings show that the HAE exhibits high antioxidant capacity by the ABTS method. In addition, this study demonstrates, for the first time, that the HAE reduces LPS-induced oxidative stress and acute inflammation in THP-1 macrophages by attenuating both ROS levels and the production of the pro-inflammatory cytokines TNF-\u03b1 and IL-6. The mechanisms underlying these protective effects are related, at least in part, to the activation of the Nrf-2/HO-1 signaling pathway. Furthermore, the HAE involves an alternative mechanism of action to classical glucocorticoids as dexamethasone. These contributions support the potential use of HAE as a therapeutic agent in the treatment of oxidative stress-related inflammatory diseases.In summary, the results show that the new strain"}
+{"text": "Objective: Previous studies have shown that gabapentin or pregabalin use is associated with cognitive decline. Herein, we aimed to evaluate the association between gabapentin or pregabalin use and the risk of dementia.Methods: In this retrospective, population-based matched cohort study, all research data were collected from the 2005 Longitudinal Health Insurance Database, which contains data of 2\u00a0million people randomly selected from the National Health Insurance Research Database of Taiwan in 2005. The study extracted data from 1 January 2000, to 31 December 2017. Adult patients taking gabapentin or pregabalin were included in the exposure group, and patients not using gabapentin or pregabalin matched to exposure subjects in a 1:5 ratio by propensity scores composed of age, sex and index date were included in the non-exposure group.Results: A total of 206,802 patients were enrolled in the study. Of them, 34,467 gabapentin- or pregabalin-exposure and 172,335 non-exposure patients were used for analysis. The mean follow-up day (\u00b1standard deviation) after the index date was 1724.76 (\u00b11282.32) and 1881.45 (\u00b11303.69) in the exposure and non-exposure groups, respectively; the incidence rates of dementia were 980.60 and 605.48 per 100,000 person-years, respectively. The multivariate-adjusted hazard ratio of risk of dementia for gabapentin or pregabalin exposure versus the matched non-exposed group was 1.45 . The risk of dementia increased with higher cumulative defined daily doses during the follow-up period. Moreover, the stratification analysis revealed that the risk of dementia associated with gabapentin or pregabalin exposure was significant in all age subgroups; however, it was higher in younger patients (age <50) than in the older patients .Conclusion: Patients treated with gabapentin or pregabalin had an increased risk of dementia. Therefore, these drugs should be used with caution, particularly in susceptible individuals. Dementia is one of the most prevalent neurodegenerative disorders worldwide. It causes progressive impairments in memory, executive function, learning, and ability to perform daily activities . MultiplAn estimated 50 million people live with dementia globally, with over 10 million new cases diagnosed each year . Due to As the prevalence of dementia rises, there are increasing concerns regarding gabapentin and pregabalin use owing to their potential contribution to neurocognitive changes. Several publications have reported that these drugs may be associated with cognitive adverse effects . Glutama-2/delta-1 subunit of voltage-gated calcium channels on neurons to modulate calcium fluxes, GABAergic neurotransmission and reduce glutamate release  and The European Medicines Agency (EMA) had approved gabapentin and pregabalin for neuropathic pain  and epilepsy adjuvant therapy, especially partial seizures. They are used for similar indications in Taiwan as well. However, the growing trend of gabapentinoid off-label use for various other pain syndromes, alcohol addiction, anxiety, bipolar disorder, and migraines has been noted . GabapenOther relevant research and systemic reviews have investigated the effects of gabapentinoid drugs on cognitive abilities . However. The Research Ethics Committee of Academia Sinica approved this study (AS-IRB-BM-18059).This study was based on the data from the National Health Insurance Research Database (NHIRD) in Taiwan. The single-payer National Health Insurance program was initiated in 1995, and 99.9% of the Taiwan\u2019s 23\u00a0million population were enrolled. We used the 2005 Longitudinal Health Insurance Database (LHID), which contains data on 2\u00a0million people randomly selected from the NHIRD in 2005. Overall, 18\u00a0years of data were included, from 1 January 2000, to 31 December 2017. There was no significant difference in the gender, age and average insured payroll-related premiums between the patients in the LHID 2005 and the original NHIRD data . All patWe used the NHIRD registration, identification, and medical claims files  for analysis.Adult patients taking gabapentin or pregabalin were included in the exposure group, and patients not using the drugs were matched to exposure subjects in a 1:5 ratio by propensity scores composed of age, sex and index date were included in the non-exposure group. The index date was defined as the first time pregabalin, or gabapentin treatment was initiated. We extracted data from 1 January 2000, to 31 December 2017, and the index date period was from 1 January 2001, to 31 December 2016. The pre-index period, from 1 January 2000, to 31 December 2000, was used to identify comorbidities and ensure that all study participants had been in the database for at least 1\u00a0year. The post-index period, from 1 January 2017, to 31 December 2017, was also included to confirm that all study participants had been followed-up for at least 1\u00a0year. The exposure time was defined as 90\u00a0days of using gabapentin or pregabalin  recommended the defined daily doses (DDDs) for Drug Statistic analysis. First, we used the formula to quantify the use of gabapentin and pregabalin, as follows: /(amount of drug in DDD) = number of DDDs. We also used cumulative defined daily doses (cDDDs) to measure and standardize exposure to gabapentin and pregabalin for investigating the dose-response relationship between drug exposure and dementia. The hazard ratio (HR) was calculated according to the cDDDs quartile in the subgroup analysis.In the NHIRD, the international classification of diseases, ninth revision, clinical modification (ICD-9-CM) was used for recording diagnoses before 2015, and the 10th revision (ICD-10-CM) was used for patient diagnoses after 2016. After the literature review, a crosswalk between ICD-9-CM and ICD-10-CM codes were used to identify the comorbidities in our analysis .First, we excluded patients who  were ageWe further excluded patients who  were losAs a result, 206,802 patients were enrolled in the analysis, including 34,467 cases and 172,335 controls, respectively. The participants were subsequently divided into two cohorts: pregabalin- and gabapentin-exposed and non-exposed groups  and ICD-10-CM codes  for dementia. The endpoint of the study was achieved when the patient was diagnosed with dementia or the patient died.Age was categorized into four groups: <50, 50\u201359, 60\u201369 and \u2267 70\u00a0years for subgroup analysis.In addition, diabetes mellitus, hypertension, hyperlipidemia, cerebrovascular disease, head injury, and depression have been identified as major risk factors for dementia . TherefoAll statistical analyses were performed using SAS version 9.4 .t-test for the continuous variables, and Pearson\u2019s chi-squared test for the categorical variables. The Kaplan-Meier method was used to estimate the cumulative event rate of dementia, and the log-rank test was used to compare between groups. Cox proportional hazards regression models were used to investigate the associations between exposure to gabapentin or pregabalin and the quartiles of cDDDs of gabapentin or pregabalin exposure and the risk of dementia, adjusting other potential confounders and estimating the hazard ratios (HR) and 95% confidence intervals (CIs). The association between gabapentin or pregabalin exposure and dementia risk was further examined with stratification according to sex, age, and comorbidities such as diabetes, hypertension, stroke, dyslipidemia, depression, and head injury. Statistical significance was set at p < 0.05, and all tests were two-tailed.The distributions of patient demographics and comorbidities between the two groups were examined using two-sample This retrospective, population-based cohort study used data from the Longitudinal Health Insurance Database (LHID). The baseline characteristics of the study groups are presented in A total of 1,596 and 5,375 dementia cases newly developed during 162,757.8 and 887,719.9 years of follow-up in the exposure and non-exposure groups, respectively, accounting for the incidence rate of dementia of 980.60 and 605.48 per 100,000 person-years, respectively. The HR (95% CI) of dementia for gabapentin or pregabalin exposure was 1.45 (1.36\u20131.55) compared to non-exposure group, after adjustment for diabetes mellitus, hypertension, stroke, hyperlipidemia, depression, and head injury.p < .001).The cumulative incidence curve revealed that the gabapentin- or pregabalin-exposed group had a significantly higher cumulative incidence of dementia than the non-exposed group during the entire follow-up period (p = 0.001), 1.69  and 2.44  for cDDDs 0.50\u20131.95, 1.96\u20139.66 and >9.66, respectively, compared to cDDDs <0.5 as the referent  cDDDs per year during follow-up was 28.12 (\u00b1139.54); median (Q1-Q3) was 1.95 (0.50\u20139.66). We further investigated the association between the quartiles of cDDDs of gabapentin or pregabalin exposure and the risk of dementia and discovered that HRs increased with increasing cDDDs per year during follow-up. The comorbidities-adjusted HR was 1.24   . In this < .001) . In a re < .001) . However-dependent, and transient in nature after dose reduction . A systematic review analyzing 24 relevant articles found that the use of gabapentinoid agents significantly decreased BPSD in patients with Alzheimer\u2019s disease, suggesting a possible benefit. However, 15 papers were original case series/case reports, and the remaining 9 papers were solely reviews. There were no randomized trials.In our analysis, the possibility of dementia development associated with gabapentin or pregabalin exposure appeared to be higher in the younger group compared with the older group. This finding is a true novelty of this article. Gabapentinoid agents are absorbed gastrointestinally via the l-amino acid transport system in the proximal small bowel . GabapenOur study has several strengths. First, our cohort studies had a large sample size, with 34,467 and 172,335 patients in the exposure and non-exposure group, respectively. Second, the follow-up time after the index date was long, at nearly 5\u00a0years (1724.76 \u00b1 1282.32 in the exposure group and 1881.45 \u00b1 1303.69 in the non-exposure groups).The study also has some limitations. First, as in many previous NHIRD-based studies, it was retrospective in nature and relied on the ICD-9-CM and ICD-10-CM codes instead of direct medical records or interview data. Therefore, errors related to lack of detailed documentation and misdiagnosis may have occurred. Second, neuropsychological tests, including the mini-mental state examination, clinical dementia rating scale, and cognitive abilities screening instrument, were not provided in the NHIRD. Therefore, detailed information on the severity of dementia and its clinical staging was unavailable. Third, we used cDDDs of gabapentinoids in this study, which only assumed the average maintenance dose per day. Fourth, the NHIRD lacked patients\u2019 lifestyle information , which may have affected the incidence of dementia. Fifth, we had limitations in eliminating the impacts of different dementia types. Sixth, we only examined the adverse effects of gabapentinoids. We did not estimate the effect of the concomitant medications; confounders such as benzodiazepines, antihistamines, anticholinergics/antimuscarinics, tricyclic antidepressants (TCAs), muscle relaxants, opioids, proton pump inhibitors, antiepileptic drugs, antiparkinson drugs, and antipsychotics. Finally, it was likely that residual confounding effects could still exist due to those unmeasured variables, including chronic pain conditions, mood and anxiety disorders (other than depression) and psychotic disorders. In a longitudinal, population-based cohort study, chronic pain was associated with accelerated memory decline . In 2016Dementia is a slow and progressive neurodegenerative disorder. Although in our cohort, a study period of 18\u00a0years was sufficient to observe the association between gabapentinoid use and dementia. This finding deserves further validation in cohort studies with longer follow-up periods.In conclusion, in this analysis of the NHIRD in Taiwan, we observed an association between gabapentin and pregabalin use and dementia risk. Apart from the well-described neuropsychiatric effects associated with gabapentinoids, cognitive impairment and dementia should be considered, especially in long-term treatment, patients with higher cDDDs, and younger patients. However, our study was a retrospective NHIRD cohort study. Therefore, further prospective investigations are required to understand the mechanism of dementia development with these two widely used drugs in the future."}
+{"text": "Coronavirus disease COVID-19, which is caused by severe acute respiratory syndrome coronavirus SARS-CoV-2, has become a worldwide pandemic in recent years. In addition to being a respiratory disease, COVID-19 is a \u2018vascular disease\u2019 since it causes a leaky vascular barrier and increases blood clotting by elevating von Willebrand factor (vWF) levels in the blood. In this study, we analyzed in vitro how the SARS-CoV-2 spike protein S1 induces endothelial cell (EC) permeability and its vWF secretion, and the underlying molecular mechanism for it. We showed that the SARS-CoV-2 spike protein S1 receptor-binding domain (RBD) is sufficient to induce endothelial permeability and vWF-secretion through the angiotensin-converting enzyme (ACE)2 in an ADP-ribosylation factor (ARF)6 activation-dependent manner. However, the mutants, including those in South African and South Californian variants of SARS-CoV-2, in the spike protein did not affect its induced EC permeability and vWF secretion. In addition, we have identified a signaling cascade downstream of ACE2 for the SARS-CoV-2 spike protein-induced EC permeability and its vWF secretion by using pharmacological inhibitors. The knowledge gained from this study could be useful in developing novel drugs or repurposing existing drugs for treating infections of SARS-CoV-2, particularly those strains that respond poorly to the existing vaccines. Coronavirus disease COVID-19) is an infectious disease that has recently become a threat to human health and life globally. The World Health Organization officially declared the outbreak as a public health emergency of international concern on 30 January 2020 9 is an i. It has The severity of COVID-19 is closely related to the presence of the so-called \u201ccytokine storm\u201d (the increased cytokine levels), which is an exaggerated immune response by the patients to SARS-CoV-2 infection. The patients show the elevation of proinflammatory cytokines such as IL-1\u03b2, IL-6, and TNF-\u03b1 levels in the blood . HoweverIt is currently believed that, in addition to being a respiratory disease, COVID-19 might also be a \u2018vascular disease\u2019 ,14,15, aThrombin cleavage of PAR1 results in phosphorylation of myosin light chain (MLC), leading to the reorganization of the actin cytoskeleton into contractile stress fibers and opening of intercellular gaps, causing the increase of EC permeability ,33,34. ITo study how SARS-CoV-2 infection impacts leaky endothelial vascular permeability, we assessed in vitro the dose- and time-dependent effect of the SARS-CoV-2 spike protein S1 RBD on the permeability of EA.hy 296 cells, which are widely used for endothelial cell (EC) permeability assays ,38,39. FSince vWF levels also increase in COVID-19 patient blood and endothelial cells are known to secrete vWF ,41, we aSince we have seen a time-dependent increase of EC permeability by the SARS-CoV-2 spike S1 RBD, we also assessed the dose-dependent effect of the SARS-CoV-2 spike protein S1 RBD on the permeability of EA.hy 296 cells. For this purpose, cells were treated with 0\u201310 \u00b5g/mL of the SARS-CoV-2 spike protein S1 RBD for 72 h. The EC permeability was increased in a dose-dependent manner from 0.01\u201310 \u00b5g/mL and reached ~50% in the 10 \u00b5g/mL RBD-treated cells a. We didIt is well known that the SARS-CoV-2 virus spike protein S1 mutates over time, which leads to genetic variation in the circulating viral strains that seriously impact human health . So, we Since SARS-CoV-2 requires ACE2 and ARF6 to enter human cells ,44, we aThe ARF family of small GTPases cycles between GDP-bound inactive and GTP-bound active conformations. Guanine nucleotide exchange factors (GEFs) activate ARFs whereas GTPase activating proteins (GAPs) inactive them b 45]. S. S45]. SAs we showed that the SARS-CoV-2 Spike protein S1 RBD upregulates ACE2 expression and ARF6 activation, we next determined the effect of the activation of ACE2 and ARF6 on the RBD-induced EC permeability and vWF secretion. Several studies reported a promising anti-COVID-19 drug candidate, the lipoglycopeptide antibiotic dalbavancin, which directly binds to ACE2 with high affinity and thereby blocks its interaction with the SARS-CoV-2 spike protein in vitro ,48. The We next used the pharmacological inhibitors of ARF6 activation (chlortetracycline) and inactivation (QS11), NF-kB SC-514), reactive oxygen species (ROS) (N-Acetylcysteine [NAC]), and ROCK1/2 (Y27632) to define the signaling cascade downstream of ACE2 in the EC permeability and vWF secretion in the SARS-CoV-2 spike S1 RBD-stimulated EA.hy 296 cells a. In thi4, reactiWe hypothesized that these inhibitors may affect the RBD-induced EC permeability and vWF secretion by inhibiting the signaling pathway downstream of ACE2. To test this hypothesis, we analyzed the effect of chlortetracycline, QS11, SC-514, NAC, and Y27632 pretreatment on the EC permeability and vWF secretion in RBD-treated EA.hy 296 cells. We found that Chlortetracycline, SC-514, NAC, and Y27632 significantly inhibited the RBD-induced EC permeability b as wellSince the mammalian target of rapamycin (mTOR) is modulated in SARS-CoV-2 infected cells , rapamycIt has been suggested that the SARS-CoV-2 spike protein causes not only a leaky vascular barrier but also increases the expression of vWF . Thus, sSince ACE2 mediates SARS-CoV-2 infection , we thenThe excess vascular leak seen in bacterial LPS-triggered sepsis is caused by the activation of ARF6 . COVID-1Since NF-\u03baB, Mtor, and dynamin play a role in SARS-CoV-2 infection and ROCK1/2 activation is important for thrombin-induced EC permeability, we also analyzed the effect of the inhibitors of these signaling molecules in the RBD-induced EC permeability and vWF-secretion. SC514 (NF-\u03baB) and Y27632 (ROCK1/2 inhibitor) significantly inhibited the RBD-induced EC permeability and vWF secretion. However, rapamycin and dynasore failed to reduce EC permeability and vWF secretion in the RBD-treated cells and even induced high EC permeability in the RBD-untreated cells, suggesting they may be toxic to the cells. Based on the findings of our study and that of others, we proposed a signaling cascade downstream of ACE2 for SARS-CoV-2 spike protein-induced EC permeability and its vWF secretion . The SAR\u00ae half-area black plates with flat bottoms were obtained from Greiner Bio-one. Enhanced chemiluminescence (ECL) Select immunoblotting Detection Reagent was from Cytiva. Restore plus stripping buffer and ultra TMB substrate were obtained from Thermo Fisher Scientific. ChemiDoc XRS imaging system was from Bio-Rad.All chemicals used in this study were obtained from Sigma-Aldrich unless otherwise specified. SC514 was purchased from Tocris. Rapamycin was obtained from LC Laboratories. Y27632 dihydrochloride was purchased from Hello Bio. Dynasore was obtained from Ascent Scientific. SARS-CoV-2 (2019-nCoV) spike protein S1 RBD  and vWF ELISA Kit were purchased from Sino Biological. SARS-CoV-2 spike protein S1 mutant sampler set containing wild-type (WT), D614G mutant, N439K mutant, SA variant (K417N/E484 K/N501Y), and SC variant (S13I/W152C/L452R) was obtained from Abenomics. Cy3-conjugated anti-mouse immunoglobulin (Ig)G was purchased from Jackson ImmunoResearch. The anti-ARF1 antibody, rabbit polyclonal, was described previously ) in a humidified incubator at 37 \u00b0C and 5% CO\u00ae half-area black plate with flat bottom were coated with biotin-gelatin by adding 25 \u03bcL of 0.25 mg/mL biotin-gelatin made in phosphate-buffered saline (PBS) in each well and incubating the plate for 60 min at room temperature. Thereafter, 80,000 EA.hy 296 cells were seeded into each of the biotin-gelatin coated wells and grew at 5% CO2/37 \u00b0C for 4 days to reach 100% confluency (and thereby became a monolayer). The cells were pre-incubated for 30\u201360 min without or with specific inhibitors and then stimulated without or with the SARS-CoV-2 spike protein S1 or S1 RBD in phenol red-free DMEM with 0.2% fat-free BSA (PRF medium) for the indicated time. After the treatment, the medium was removed from each well and stored at 20 \u00b0C for analysis of the secreted vWF, and the cytokines  by ELISA. Then, the cells were incubated with FITC-streptavidin (25 \u03bcg/mL) in PRF medium for 10 min and fixed with 4% paraformaldehyde (PFA) for 20 min. The cells were then washed with PBS and left in Prolong Live antifade reagent (diluted 1 in 100 FluoroBrite DMEM) at 4 \u00b0C or used immediately to visualize by fluorescence microscopy at 10\u00d7 magnification and assessed the percentage permeability by quantifying the fluorescence intensity by ImageJ.This was carried out as described previously with some modifications . Briefly2, 1% NP40, 5% glycerol) containing 1% mammalian protease inhibitor mix, 10 mM sodium fluoride, and 1 mM sodium orthovanadate. Thereafter, 350 \u03bcL of the lysate incubated with 20 \u03bcL glutathione s-transferase-Golgi-associated, adaptin ear-containing, ARF-binding protein (GGA)3 protein-binding domain beads (25% resin containing 5 mg protein/mL of resin) at 4 \u00b0C with continual mixing. After 2 h incubation, the beads were washed three times with pulldown lysis buffer, resuspended in 1\u00d7 sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) sample buffer, boiled at 100 \u00b0C for 5 min, and stored at \u221220 \u00b0C. For the input controls, 100 \u03bcL of the lysate was mixed with 25 \u03bcL 5\u00d7 SDS-PAGE sample buffer  and boiled at 100 \u00b0C for 5 min. This assay was carried out as described previously with some modifications . BrieflyEA.hy 296 cells were lysed by using TRI Reagent and carried out immunoblotting as described previously ,67. The 2SO4, its optical density at 450 nm (OD450) was measured using a 96-well plate reader.By using ELISA Kits, vWF and three important proinflammatory cytokines  secreted from EA.hy 296 cells were measured. The ELISA assays were carried out at room temperature, unless otherwise specified, by following the manufacturers\u2019 instructions. Briefly, a 96-well microplate was coated with capture antibody by incubating the plate overnight at 4 \u00b0C. After washing with wash buffer , the wells were blocked for 1 h using blocking buffer (2% BSA made in wash buffer). The wells were then incubated with samples or standards diluted in sample dilution buffer (0.1% BSA in wash buffer) for 2 h. After washing with wash buffer, the wells were incubated with the biotin-conjugated detection antibody diluted in sample dilution buffer for 2 h. Again, the wells were washed with wash buffer and incubated with HRP-conjugated Streptavidin for 20 min. The wells were then washed with wash buffer and incubated with Ultra TMB substrate for 20 min in dark. After stopping the reaction by adding 2 M Hp < 0.05 considered statistically significant.Image J software was used for densitometric analysis. Data were analyzed using GraphPad Prism 6 software. For all data, comparisons were made using Ordinary one/two-way analysis of variance (ANOVA). Results are shown as the mean \u00b1 SEM with We have shown in this study that the SARS-CoV-2 spike protein S1 RBD significantly induces leaky endothelial vascular permeability and vWF secretion, which are unaffected by the mutations in the spike protein including those found in SA and SC variants. We showed alteration in ACE2 expression and ARF6 activation in the RBD-treated cells. The inhibitors of ACE2, ARF6 activation, NF-\u03baB activation, and ROS and ROCK significantly inhibited SARS-CoV-2 spike protein S1 RBD-induced EC permeability and vWF secretion. We proposed a signal cascade for RBD-induced EC permeability and vWF secretion. Further investigation is needed to find missing steps in the signaling pathway for RBD-induced permeability and vWF secretion. This will yield potential targets for developing novel drugs or repurposing existing drugs to treat SARS-CoV-2 strains that evade immunity by COVID-19 vaccines."}
+{"text": "Ethics-based nursing practice can transform health care practices. As the biggest human capital in the health care system, nurses are obliged to follow ethical principles in this field. One of these ethical principles; is beneficence, which is considered the core of nursing care. This study aimed to investigate clarification of the principle of beneficence in nursing care and its related challenges.This integrative review was conducted using the Whittemore & Knafl method in 5 stages, including problem identification, searching the literature, evaluating primary sources, analyzing data, and presenting the results. Databases like SID, Irandoc, Magiran, Google Scholar, Web of Science, PubMed, and Scopus were searched using the keywords; \u201cbeneficence\u201d, \u201cethic\u201d, \u201cnursing\u201d and \u201ccare\u201d in English and Persian in the time range of 2010 to 10 February, 2023. After applying inclusion criteria and assessing the articles using Bowling\u2019s Quality Assessment Tool, finally, 16 papers were included from 984.After reviewing and evaluating the qualified articles, the findings were classified into four main categories: (1) nature, (2) applicability, (3) Relevant and influential factors, and (4) challenges related to the ethical principle of beneficence in nursing care.Based on the results of this review it seems that paying attention to clarification the principle of beneficence in nursing care can provide positive outcomes for patients to benefit from this principle and finally, it leads to increasing the well-being and health of patients, reducing their mortality rate, increasing satisfaction and maintaining the respect and human dignity of patients. Today, nurses are considered the biggest human capital in the health care system ; so the The history of nursing shows that professional ethics, as a familiar concept in nursing, has been an inherent part of this profession since the early days, and it is internationally recognized as an essential part of nurses\u2019 practice . Four baOn the other hand; studies show that beneficence as an integral part of bioethics has always been beside other ethical principles, including autonomy, justice, and confidentiality, and therefore, there is a major challenge to balance the patient\u2019s right to choose and the benevolent intention of the caregiver , and as What is obvious is that the basic issue in the principle of beneficence is the commitment to the benefit of patients in nursing care . AlthougThis study is an integrated review based on articles related to the ethical principle of beneficence, which was conducted to collect data from various studies on this concept. This integrative review was conducted using the Whittemore & Knafl method in 5 stages of review, including (a) problem identification, (b) searching the literature, (c) evaluating data from primary sources, (d) analyzing data, and (e) presenting the results, using of this method also increases the rigor of this study \u201331.According to the Whittemore & Knafl method, a) in the first stage, the following question was set to answer the study\u2019s aim: What is the ethical principle of beneficence in nursing care and its related challenges?b) In the second stage, searching for articles was done by two researchers in the time range of 2010 to February 10, 2023. Databases like SID, Irandoc, Magiran, Google Scholar, Web of Science, PubMed, and Scopus were searched using the keywords; \u201cbeneficence,\u201c \u201cethic,\u201c \u201cnursing,\u201c and \u201ccare\u201d in English and Persian separately or combined using Boolean operators: AND and OR for papers that were published. The result of the initial and comprehensive search included 984 articles. After applying the inclusion criteria, including access to the full text of the article, writing in Persian and English, and the presence of keywords in the title and abstract of the article, finally, 968 were removed.c) In the third stage, to evaluate the data, two researchers reviewed the content of the studies to evaluate their quality using Bowling\u2019s Quality Assessment Tool , so 4 arThe key data extracted from the articles included: the authors\u2019 profile, the publication\u2019s year, the country of the study, the title and the methodology of the study, and also the main results that were extracted by the two researchers.Data charts were designed independently by two researchers and they were evaluated. The data chart was updated in a continuous process. Then, the extracted data were analyzed and interpreted. The data analysis process was initiated when the final 16 papers for inclusion were determined and had been verified by all three authors. First, a data extraction sheet were created to document the required information for each review, including the five methodological stages. So, each review was analyzed individually by two researchers separately. All of the data gathered in the data extraction sheets was read by the same two researchers, who reached a consensus on selecting pertinent and significant items for each stage. Then, the similarities and differences among the reviews with regard to each methodological stage were examined throughout the data analysis process. Finally, conclusion drawing and verification were performed by all three authors to ensure that all 16 reviews were thoroughly assessed in terms of methodological stages and that the results described matched the research questions of this present study.Whittemore and Knafl (2005) state that assessing the quality of the included evidence is not essential in a supplementary review . All stuAccording to the framework of review and selection of articles, 16 articles were selected from 984 articles. All articles included in this study were in English, including quantitative (n\u2009=\u20092) and qualitative (n\u2009=\u200914) studies.After reviewing and evaluating the qualified articles, the findings were classified into four main categories as follows: 1) nature, (2) applicability, (3) Relevant and influential factors, and (4) challenges related to the ethical principle of beneficence in nursing care  and twenty-six sub-categories. It is obvious that the ethical principle of beneficence is an integral part of the nursing code, also called the \u201cmoral heart of the nursing profession,\u201c so a nurse should provide nursing care only with the goal to provide benefit to the client . It is oThe patient\u2019s best interest must be the center of ethical decision-making at all times , so healA beneficent act promotes the betterment and welfare of patients, and nurses should deliver professional care to enhance the recovery of patients. As Beauchamp and Childress 2013) mentioned this principle is positive beneficence and break it down into three components: to prevent evil or harm; to remove evil or harm; and to do or promote good , 49, 50.13 mentioRecent research shows that healthcare institutions and organizations that have a benevolent ethical atmosphere may achieve better clinical results, improve patient and family satisfaction, and reduce patient mortality . The impSince the professional duty to respect the rights of patients and their autonomy in decision-making is considered a universally accepted norm , it may The principle of beneficence makes it necessary to provide equitable care based on need and equally without discrimination for all patients , so whenA concern to promote beneficence may be expressed in traditional medical ethics by paternalism, where the health professional makes a decision based upon a perspective of acting in the patient\u2019s best interests. However, some believed that this approach acts against person-centered values found in nursing ethics . By the The attention and focus of the principle of beneficence in nursing management are also on providing safe, effective, timely, efficient, fair, and patient-centered care combined with accuracy, kindness, and staff collaboration . In suchAll patients should be treated with dignity and protected from any possible harm, it is the professional\u2019s moral obligation, to not cause harm , 70. ThuTruth-telling to the patient as an issue of communication and trust is considered as the applicability of beneficence, which nurses should combine with the patient\u2019s autonomy and balance in their care. As a result, the goal of Truth-telling in health care will be achieving treatment that is effective and based on the patient\u2019s interest , 44, 46,In general, it should be noted that the main guideline in ethical judgment about different choices, especially in cases of conflict and dilemmas, is to refer to beneficence, which includes a kind of rational profit in terms of cost-effectiveness regarding the results of the intervention and outcomes for the patient .Studies show that although nurses have good knowledge about nursing ethics, most are not familiar with the principle of beneficence in nursing care and what is good for the patient and for her/his benefit , 42. HowThe ethical principle of beneficence is considered an important issue and one of the primary values in nursing care, and this is while the results of the present study clarify different aspects of this principle. Lack of acquainted with the definition of the beneficence concept in nursing care is an important challenge that makes it necessary to conduct more studies focusing on the analysis of the concept of the beneficence and developing appropriate instruments in different nursing wards and fields for its measure and application. It seems that conducting clarification of the approach of the principle of beneficence in nursing care can provide positive outcomes for patients to benefit from this principle.On the other hand, paying attention to the applicability obtained from studies that focus on reducing and predicting pain, fair distribution of resources and care, performing evidence-based care, not harming the patient, telling the truth in the correct situation, performing palliative and ending life care and finally the patient\u2019s safety in nursing care leads to increasing the well-being and health of patients, reducing their mortality and preserving human respect and dignity. Promoting a dignified life by observing the principle of beneficence for patients in nursing care, and paying attention to the principles of autonomy and justice, will ultimately increase patients\u2019 satisfaction. Therefore, it is suggested that more studies should be done focusing on identifying the exact dimensions of the concept of beneficence, developing an appropriate instrument to measure this concept in nursing care, and providing adequate training in this direction.The limitations of this study include: not searching for articles in languages other than English and Persian, so our search strategies may have under-represented studies in other languages, such as Spanish and Portuguese."
\ No newline at end of file