diff --git "a/cluster/564.jsonl" "b/cluster/564.jsonl"
new file mode 100644--- /dev/null
+++ "b/cluster/564.jsonl"
@@ -0,0 +1,44 @@
+{"text": "From a biochemical perspective, a living cell is a collection of molecules jampacked into a confined space by a flexible barrier, called the plasma membrane. A diverse array of proteins embedded in the plasma membrane act as conduits between the cell interior and its external environment, conveying nutrients, metabolites, and information. The life of a cell\u2014as well as that of any multicellular organism\u2014depends on a cell's ability to communicate with its neighbors, both near and far. One way cells do this is with transmembrane receptors outfitted with both extracellular and intracellular domains that mediate information flow between the cell's external and internal environment. One class of transmembrane receptors, called integrin receptors, specializes in interacting with and binding to other cells and the extracellular matrix, a complex of molecules surrounding cells that provides structural support. By integrating various components of the extracellular matrix, integrins , play an important role in such diverse processes as cell differentiation, programmed cell death, wound healing, and metastasis.Integrins can be regulated by signals within the cell to bind to their ligands with either low or high affinity. While a multitude of integrin ligands have been identified and the general mechanics of both the extracellular and intracellular domains of these receptors are known, exactly how a signal crosses the receptor's transmembrane segment to regulate affinity has remained obscure. Now, Bing-Hao Luo, Timothy Springer, and Junichi Takagi have taken a mutational approach to shed light on the inner workings of the transmembrane segment and to explain how it transmits information.Much of what we know about the function of integrins has come from studying the crystal structures and models obtained from structural analysis. These analyses have generated information not only about the structure and composition of the extracellular and intracellular domains of integrins, but also about the conformational changes that accompany signaling events. Integrins contain a large extracellular domain, a transmembrane segment, and a relatively short intracellular \u201ctail.\u201d Integrins are heterodimers\u2014molecules that contain two subunits composed of different amino acids\u2014made up of an \u03b1 chain and a \u03b2 chain. Tight association of the two subunits is associated with an inactive, or low-affinity, state of the extracellular ligand-binding domain. Separation of the intracellular subunits is associated with a dramatic conformational change and activation of the extracellular domain, changing a bent structure with a downward-pointing ligand-binding site into an extended one with an outwardly stretched ligand-binding site. This mechanism differs from most transmembrane signaling molecules, which usually achieve activation through association with their target molecules.To investigate how the transmembrane segment mediates these changes, Luo, Springer, and Takagi systematically replaced amino acids in both the \u03b1 and \u03b2 transmembrane domains of the heterodimer with cysteines, creating the potential for binding interactions through a chemical reaction, disulfide bond formation, between the two subunits. By analyzing 120 possible cysteine pairs, the researchers not only confirmed the structure of the transmembrane region as helical but also mapped the proximal amino acid residues between the helices. To understand how the helical transmembrane domains transmit signals, the team introduced activating mutations in the amino acids of the \u03b1 subunit cytoplasmic tail. Using this approach, they observed the loss of the contact between the subunits, indicating a separation of the transmembrane helices. Furthermore, when disulfide bond formation occurred, linking the transmembrane segments together, activation was suppressed. While previous models had proposed various modes of subunit movements, including hinge- and piston-like models, these results strongly support the notion that lateral separation of the subunits is the driving force behind the signal. As many diseases arise from defects in integrin adhesion, understanding the conformation and mechanism of integrin activation could suggest promising avenues for drug development aimed at correcting such defects."}
+{"text": "Cells receive and send signals across the plasma membrane using the integrin family of receptors. What is it about their structure that can mediate their function? It goes without saying that the cellular plasma membrane effectively creates a barrier between the inside (intracellular area) and outside (extracellular area) of the cell it defines. In order for the cell to sense and respond to its environment (including other cells and the supporting structures that comprise the extracellular matrix [ECM]) and for the environment to influence cell function (including cell growth and movement), bidirectional signaling across the plasma membrane has to be mediated by receptors and other structures. About two decades ago, it became widely appreciated that many of the cell surface receptors that mediate cell\u2013cell and cell\u2013ECM interactions were structurally and functionally related, and the term \u201cintegrins\u201d was coined to reflect the capacity of members of this family to integrate the extracellular and intracellular environment . IntegriThe integrin family comprises 20 or more members that are found in many animal species, ranging from sponges to mammals . They coMutational studies provided the initial hints that disruption of the non-covalent clasp between \u03b1 and \u03b2 cytoplasmic tails is clearly the event within the structure of the integrin that initiates inside-out signaling. Point mutations in the \u03b1 and \u03b2 cytoplasmic tails that are near the membrane or deletion of either region result in constitutive activation of the receptor . Mutatinv\u03b23 (the nomenclature identifies the particular \u03b1 and \u03b2 subunits) was determined  interacts with itself\u2014called homotypic oligomerization of the transmembrane domains  Li et a. Ligand Despite the molecular level of our understanding of integrin activation, a number of key questions remain unresolved. Although we know that the membrane-proximal clasp on the integrin cytoplasmic face controls the integrin activation, the distal side of either the \u03b1 or \u03b2 cytoplasmic tails may also play a role in integrin activation, since other mutations indicate that the C-terminal membrane distal region is important in regulating integrin activation via a mechanism that is yet unknown. Thus, the picture for the cytoplasmic face-controlled inside-out activation may be substantially more complicated than specified in Upon the inside-out activation, integrins bind to specific extracellular matrix proteins. However, for the integrins to grip tightly to the extracellular matrix to mediate cell adhesion and migration, the integrin cytoplasmic domains must be anchored to the cytoskeleton . This is"}
+{"text": "Chelonia mydas) over 28 years to understand fibropapillomatosis, a tumor-forming disease linked to a herpesvirus. Turtle size is a consistent risk factor and size-standardized models revealed considerable spatial and temporal variability. The disease peaked in some areas in the 1990s, in some regions rates remained constant, and elsewhere rates increased. Land use, onshore of where the turtles feed, may play a role. Elevated disease rates were clustered in watersheds with high nitrogen-footprints; an index of natural and anthropogenic factors that affect coastal eutrophication. Further analysis shows strong epidemiological links between disease rates, nitrogen-footprints, and invasive macroalgae and points to foraging ecology. These turtles now forage on invasive macroalgae, which can dominate nutrient rich waters and sequester environmental N in the amino acid arginine. Arginine is known to regulate immune activity, promote herpesviruses, and contribute to tumor formation. Our results have implications for understanding diseases in aquatic organisms, eutrophication, herpesviruses, and tumor formation.Wildlife diseases are an increasing concern for endangered species conservation, but their occurrence, causes, and human influences are often unknown. We analyzed 3,939 records of stranded Hawaiian green sea turtles ( Chelonia mydas) afflicted by fibropapillomatosis (FP) a debilitating tumor-forming disease Combined with overexploitation, habitat loss, and climate change, emerging diseases pose major impacts to biodiversity worldwide \u03b1-herpesviruses as the leading candidate after their DNA fragments were discovered in turtle tumors, but were absent in tumor-free turtles Early hypotheses of causal factors of the disease examined vascular trematodes and toxins but results were inconclusive Further advances to understanding this disease have been limited by the inherent complexities of epidemics and their ecosystems Green turtles develop FP  only aftWe examine FP records of green turtles stranded on Hawaiian beaches from 1982\u20132009 considering the uniqueness of the archipelago. Unlike stranding investigations in the southeastern USA where turtles drift considerable distances after offshore mortality SCL\u200a=\u200a0.93*CCL, r2\u200a=\u200a0.99), when only the latter was available. This yielded 3,939 records spanning 28 years containing location, disease, and turtle size data.We compiled strandings data from dead or moribund turtles reported to the National Marine Fisheries Service, Pacific Islands Fisheries Science Center As size is a known risk factor for FP jy and jn are the FP positive and the total individuals, respectively, in each size bin  in the locally-observed population; and jns)( and n+s) so we combined adjacent years with <5 records and plotted the resulting rates as the mean time. We distinguished island regions by terrestrial hydrology, identifying seven regions on Oahu , three on Maui , and two on Hawaii (Kona and Hilo). We then compared the statistical variability of the time series between spatial scales (see c) Having a comparable measure of local FP rates, ales see  ranking To understand the influence of spatial scale more acutely, we calculated disease rates in individual watersheds and examined the influence of land use. We obtained GIS coverages of land features and land use from the State of Hawaii Office of Planning As individual green turtles in Hawaii are repeatedly captured in the same nearshore sites For urbanization, sugar/pineapple, cattle grazing, and poultry/hog production, the Nitrogen-footprint score is the average of the % area coverage and the % drainage coverage. We preferred this to area coverage alone as human activity tends to be clustered along coastal waters and may this may skew its impact. Perennial streams, rivers, and canals accumulate within each watershed, receiving a value of 0.5 for each contribution. We scored aquaculture/fishponds and estuaries/wetlands as the % coastline coverage of their maximum width. We scored sewage injection wells by their permitted flow rates: \u201cmajor\u201d wells are municipal facilities or wells pumping 50,000\u20133,000,000 gallons per day (gpd), \u201csignificant\u201d wells pump 10,000\u201349,999 gpd, and \u201cminor\u201d wells pump 1,000\u20139,999 gpd. We only used wells located in \u201cUnderground Injection Control Areas,\u201d or immediately proximate to coastal waters c.We calculated standardized disease rates for watersheds with (1) and tested for spatial autocorrelation with Moran's Index. We built geographically weighted regression (GWR) models to compare the variable relationships within watersheds, considering that parameters themselves are influenced by surrounding areas Hypnea musciformis, Gracilaria salicornia, and Acanthophora spicifera. We documented occurrence using the definitive authority on Hawaiian rhodophytes Es) and as a result, all further comparisons of disease rates are standardized according to turtle size Simple incidence proportions of FP show disease increases with turtle size, peaks, and then declines . Fitted \u03b4AICc values). This indicates that FP varies locally, which when considered in conjunction with spatiotemporal fidelity, encourages investigation into local causes.Es)(\u200a=\u200a0.91); Kualoa, Kaneohe (Es)(\u200a=\u200a0.90); Kamiloiki, Maunalua (Es)(\u200a=\u200a0.89); and Waikele, South Shore (Es)(\u200a=\u200a0.88) \u2013 with the highest disease rate found on Maui - Hapapa, South Maui (Es)(\u200a=\u200a0.93). By comparison, Hawaii has relatively low disease rates - with the exception of Wailuku, Es); Waikele, South Shore (iN\u200a=\u200a0.97); and Halawa, South Shore (iN\u200a=\u200a0.93). The right series in I\u200a=\u200a0.14, z\u200a=\u200a3.4, p<0.01) indicating spatial statistics are required. The GWR examines how Nitrogen-footprint influences disease rates within watersheds; comparing the two map series in r2\u200a=\u200a0.72) in observed disease rates. Importantly, the model produces randomly arrayed residuals  indicating no systemic model deficiencies.Watershed disease rates are spatially clustered  turtle size is a consistent disease risk factor, (ii) disease variability is at the local scale, (iii) disease rates and land use are correlated, and (iv) the disease is linked to macroalgae. We discuss these results and potential mechanisms below.The observed demographic patterns of stranded turtles are likely influenced by factors besides disease. As a result, it is uncertain how these patterns relate to the population's actual population demographics. For example, the first size class never outnumbers the second  which isDespite any demographic changes through the study, however, the relationship between turtle size and disease rate is consistent. The highest-ranked models show subadults are always the most affected group, but through time the size at peak disease rate decreases. This could reveal a variety of dynamics. Adults, for example, may have developed greater immunity or the disease may have become increasingly virulent, killing off younger turtles. In essence, opposite factors could produce similar patterns. The result could have little to do with epidemiology, on the other hand, and simply reflect density-dependent factors slowing somatic growth rates Size-standardized disease rates reveal considerable spatiotemporal variation \u20134 and for2\u200a=\u200a0.72) and as its residuals have no spatial structure, the model does not appear to have systemic deficiencies.The disease and Nitrogen-footprint maps have compelling similarities  which thThe high ranking of the local time series model  encouragHypnea musciformis and Ulva fasciata, as having elevated Arg. Later isotope analysis revealed up to 43% of stored N in these species originated from discharged sewage One explanation for our results is the dietary promotion of FP in eutrophic habitats. After 1950, native Hawaiian algae and sea grasses were displaced by nonnative species, especially in locations with elevated nutrient loads Immunology and virology studies are particularly revealing. In many chronic diseases, Arg is involved in cell inflammation and immune dysfunction Table S1Model results comparing temporal demographics of stranded Hawaiian green turtles, 1982\u20132009. Times are divided into five equal 55-month periods. N represents the strandings sample size during the period. The log-normal model is always the highest-ranked model evidence by the \u03b4AICc value is always zero. We provide log-normal parameters as a result. All models have two parameters.(0.07 MB PDF)Click here for additional data file.Table S2Model structure and correlates used to examine disease rate time series . D is th(0.08 MB PDF)Click here for additional data file.Table S3Complete data table for watersheds used in the geographically weighted regression and seen in (0.01 MB TXT)Click here for additional data file.Table S4Full model results from the geographically weighted regression that allows model coefficients to vary in space. The null model is the \u201cglobal\u201d or traditional linear regression, using ordinary least squares methods. But even though this model has the lowest AICc value, it is inappropriate because the variables are spatially autocorrelated see . The hig(0.08 MB PDF)Click here for additional data file."}
+{"text": "Cytoplasmic dynein is the predominant minus-end-directed microtubule (MT) motor in most eukaryotic cells. In addition to transporting vesicular cargos, dynein helps to organize MTs within MT networks such as mitotic spindles. How dynein performs such non-canonical functions is unknown. Here we demonstrate that dynein crosslinks and slides anti-parallel MTs in vitro. Surprisingly, a minimal dimeric motor lacking a tail domain and associated subunits can cause MT sliding. Single molecule imaging reveals that motors pause and frequently reverse direction when encountering an anti-parallel MT overlap, suggesting that the two motor domains can bind both MTs simultaneously. In the mitotic spindle, inward microtubule sliding by dynein counteracts outward sliding generated by kinesin-5, and we show that a tailless, dimeric motor is sufficient to drive this activity in mammalian cells. Our results identify an unexpected mechanism for dynein-driven microtubule sliding, which differs from filament sliding mechanisms described for other motor proteins.DOI:http://dx.doi.org/10.7554/eLife.00943.001 When cells divide, they must also divide their contents. In particular, both \u2018mother\u2019 and \u2018daughter\u2019 cells require full sets of chromosomes, which must first be duplicated, and then evenly distributed between the cells. Protein filaments called microtubules form a network that helps to accurately segregate the chromosomes. Microtubules emanate from structures at each end of the dividing cell known as spindle poles; after the chromosomes have duplicated, the microtubules latch onto them and align the pairs in the middle of the cell. As the two cells separate, microtubules at opposite spindle poles reel in one chromosome from each pair.Microtubules are composed of alternating copies of two different types of a protein called tubulin, and have ends with distinct properties. The \u2018minus\u2019 ends are directed outwards, away from the chromosomes; the \u2018plus\u2019 ends\u2014which can actively add tubulin\u2014grow toward the middle of the cell, and can also bind to chromosomes. Microtubules can be manipulated by motor proteins that \u2018walk\u2019 along them carrying cargoes, which can include other microtubules. The combined actions of many motor proteins rearrange the microtubule network into a configuration that enables the chromosomes, and other cellular structures, to partition equally between the mother and daughter cells.Motor proteins such as dynein and kinesin transport cargoes along microtubules; each motor is composed of two identical copies of the protein bound to each other. Kinesin walks toward the plus end of a microtubule, propelling itself using \u2018feet\u2019 that are called motor domains; it binds cargoes (including other microtubules) through additional regions located at the opposite end of the protein. In contrast, dynein walks toward the minus end of a microtubule. Although dynein is known to carry certain cargoes through regions outside its motor domain, how it transports other microtubules is not well understood.Tanenbaum et al. now show that regions outside the motor domain of dynein are unnecessary to transport microtubule cargoes. When two dynein motor domains are isolated and linked to each other in vitro, each can bind to a separate microtubule. By walking toward the minus ends of their respective microtubules, the motor domains drive the microtubules in opposite directions, sliding them apart. These studies thus provide insight into the mechanism through which dynein works with additional motor proteins (such as kinesin) to rearrange microtubules during cell division\u2014and also to ensure that chromosomes segregate evenly between mother and daughter cells.DOI:http://dx.doi.org/10.7554/eLife.00943.002 Cytoplasmic dynein is a 1.2 MDa, multisubunit microtubule motor complex that belongs to the AAA family of molecular machines . The dynIn addition to its well-studied role in cargo transport, cytoplasmic dynein has been implicated in the organization of the MT cytoskeleton itself, particularly during cell division. When mammalian cells enter mitosis, dynein is needed to remodel the prophase MT network , and at In contrast to cargo transport, which involves a well-studied walking mechanism of the two dynein motor domains along a MT , the mecAlternatively, dynein could physically crosslink two MTs and slide them relative to each other. To generate sliding between two MTs, an individual dynein motor, a dimer of two heavy chains, could use its two motor domains to walk along one MT and employ a second MT binding domain to transport a \u2018cargo MT\u2019. Axonemal dyneins function in this manner to produce MT sliding in cilia and flagella. Several classes of kinesin utilize a similar mechanism for crosslinking and sliding MTs . HoweverHere using an in vitro assay, we demonstrate that both native rat, and recombinant yeast cytoplasmic dynein can drive sliding of anti-parallel MTs in the absence of additional proteins. Single molecule data of dynein in a MT overlap zone is most consistent with a model in which the two dynein motor domains walk along different MTs to generate sliding. We also show in vivo that a minimal dynein dimer, lacking expected cargo binding interactions, can substitute for native dynein in generating an inward force within the spindle that antagonizes outward MT sliding forces generated by kinesin-5 and kinesin-12. Together, these results show that dynein can slide and organize MTs, using a sliding mechanism that differs from that described for other motor proteins.Previous work has reported that purified brain cytoplasmic dynein crosslinks and bundles MTs , but the331kDa, which contains the motor domain but lacks the non-motor tail domain and other dynein subunits   . Analysipulation , indicatyn1331kD . The rea387kD bundled MTs in the absence of ATP  in its motor domain (387kD \u0394MTBD). Dyn1387kD \u0394MTBD showed no specific association with MTs in a cosedimentation assay , similar to yeast GST-Dyn1subunits , which wsubunits . When exsubunits , indicatTo test whether GST-hDyn is able to generate an inward force within the spindle, we designed two types of assays. In the first assay, we evaluated dynein\u2019s ability to drive monopolar spindle formation when kinesin-5 is inhibited before the onset of mitosis. Kinesin-5 inhibition results in the formation of monopolar spindles , but thiIn a second assay, we tested dynein-driven MT sliding forces in metaphase-arrested spindle (cells treated with the proteosome inhibitor MG132). During metaphase, two kinesins (kinesin-5 and kinesin-12) provide an outward force on the spindle, which is counterbalanced by an inward force produced by dynein . Thus, uOur two assays together suggest that GST-hDyn is sufficient to generate an inward force, which is most likely the product of anti-parallel MT sliding. To determine if dimerization of the motor domains is required for the inward force generation by dynein in vivo, we fused dynein to FKBP (FKBP-hDyn), which homodimerizes upon addition of the small molecule dimerizer AP20187 (inducing processivity of yeast dynein ), and thIn addition to its role in generating an inward force in the spindle, dynein also is important for focusing MT minus ends at the spindle pole . To testIn this study, we show that cytoplasmic dynein can slide anti-parallel MTs in vitro and provide evidence that this mechanism can occur in vivo. Several kinesin motors have the ability to crosslink and slide MTs in vitro. However, these motors either form a tetrameric complex , or cont387kD), indicating that it was not an effect of artificial dimerization. These results suggest that the two motor domains have considerable flexibility, allowing them to explore space on a rapid time scale, making frequent transitions between one and two MT bound states.Our single molecule results also reveal that the two dynein motor domains can switch abruptly from walking along the same MT to walking on separate MTs when the motor encounters a MT-MT overlap. Inside the overlap, dynein often pauses and switches directions, suggesting the motor spends a fraction of time stepping with both motor domains on a single MT in the overlap, and some fraction with each motor domain bound simultaneously to opposite MTs. This behavior was observed for both GST-dimerized dynein, as well as two natively dimerized dyneins , except for the full-length dynein which was too low of a concentration and was thus used directly after TEV release.Rat brain cytoplasmic dynein was purified as described . The peacassette  into thehttp://labs.bio.unc.edu/Salmon/protocolscoverslippreps.html). A \u223c10 \u00b5l flow chamber was assembled using double-sided sticky tape and a glass slide. The chamber was coated sequentially with the following solutions: 5 mg/ml BSA-biotin , 60 \u00b5l BC buffer , 20 \u00b5l 0.5 mg/ml streptavidin , and 60 \u00b5l BC buffer to remove excess streptavidin. The chamber was finally washed into assay buffer  containing an oxygen scavenging system , 0.2 mg/ml \u03ba-casein, and 0.1% Pluronic F-168.Glass coverslips were acid washed as described .To track single molecules of dynein with high resolution, the Localization Microscopy plugin of \u00b5Manager (developed by Nico Stuurman) was used  in a TLS-55 tube. A 250 \u03bcl solution of either TEV released GFP-Dyn1387kD, or gradient standards, was layered on top. The gradients were centrifuged in a TLS-55 rotor at 55K rpm  for 3 hr at 4\u00b0C. Standards used were thyroglobulin  or BSA . Gradients were fractionated by carefully pipetting 100 \u03bcl from the top.Step gradients were made by carefully layering 250 \u03bcl each of 8, 16, 24, or 32% sucrose in Pipes-Hepes buffer  according to manufacturer\u2019s guidelines. DNA was transfected using polyethyleneimine (PEI). MG132 (Sigma) was dissolved in DMSO and was used at 5 \u00b5M final concentration. STLC (Sigma) was dissolved in DMSO and was used at indicated concentrations. AP20187  was dissolved in ethanol and used at a final concentration of 200 nM.Cells were grown in glass bottom 96-well plates. At the time of fixation, culture medium was removed and cells were fixed in PBS with 3.7% formaldehyde and 1% Triton X-100 for 5 min. Cells were then washed with PBS and post-fixed with cold methanol for 5 min. Fixed cells were incubated with anti-\u03b1-tubulin antibody  overnight. Secondary antibody was goat-anti-mouse-AlexaFluor555 , which was incubated for 1 hr. Cells were imaged on a Zeiss spinning disc confocal with a 100 \u00d7 1.45 NA objective and a Hamamatsu EM-CCD camera. The microscope was controlled by \u00b5Manager software . review process). Similarly, the author response typically shows only responses to the major concerns raised by the reviewers.eLife posts the editorial decision letter and author response on a selection of the published articles . An edited version of the letter sent to the authors after peer review is shown, indicating the substantive concerns or comments; minor concerns are not usually shown. Reviewers have the opportunity to discuss the decision before the letter is sent , while the native motor could slide the MTs by a different mechanism, for example using a second MT binding site. To show that native dynein slides MTs using the proposed mechanism, the authors could use 'minimal-dimeric-motor' recombinant yeast heavy chains dimerized natively.eLife. However, if you feel that you can perform the experiment with the minimal dimeric motor, then we would encourage you to submit your interesting paper again to eLife.We are rejecting the paper because experiments that would be a substantial amount of work should result in a rejection at A second problem identified by the reviewers concerned whether GST-dynein rescues spindle assembly upon DHC knock-down. This is never shown; rather you show the sensitivity to kinesin-5 inhibition. No data are shown in the absence of the drug, and it is not discussed whether the rescued spindles are positioned correctly and functional to segregate chromosomes, with poles focused, chromosomes aligned, etc. While we would not insist that these data are included, you should more fully discuss the other major functions of dynein in the spindle, and whether they might be accomplished by an anti-parallel sliding mechanism. For example, can this mechanism generate a spindle pole. Again a schematic would help, and ideally some data showing whether or not GST-dynein can generate asters or mediate pole focusing.Minor comments:- Binding of dynein to MTs without ATP in solution might impair further functionality of the motors. The authors could address this by performing a single molecule no-ATP to ATP switching experiment on single MTs and quantify the percentage of processively moving dynein molecules.- The native dynein slides MTs very slowly and with pauses. Are the pauses accounted for in the average velocity in the histogram in - The fact that the GST-hDyn slides MTs in vivo doesn't clarify the mechanism of the native dynein sliding.- Using polarity-marked MTs an anti-parallel MT orientation was inferred for 18 out of 21 events. Were the other 3 events parallel sliding? How good was the polarity marking? Please quantify.- What influence did the ionic strength of the assay buffer have on the results?- The role of kinesin-14 as minus-end directed, MT-MT sliding motor in spindle assembly and integrity should be discussed.Xenopus egg extracts, and spindle pole focusing, have been shown to require dynein. Similarly, \u201cThese results provide the first direct demonstration that cytoplasmic dynein can slide MTs within bundles\u201d seems to be a bit of an overstatement.- In the Introduction, it is stated that there is no evidence that dynein could directly cross link and slide MTs relative to one another. This may be true for pure motor domains in vitro, but movements of MT seeds on the spindle in - One issue that speaks to whether dynein could carry microtubules as cargo is the presence of non-motor microtubule binding domains. While perhaps not present on the dynein motor itself, doesn't the fact that rat dynein possesses a much slower velocity on bundled MTs compared to single microtubules indicate there is another MT binding domain on the heavy chain? Furthermore, spindle dynein is known to function together with dynactin, which does have a MT binding domain. The authors show convincingly that just a motor dimer can mediate one aspect of spindle morphogenesis, the inward sliding, but without examining the other functions they should soften their statements about the sufficiency of this mechanism.[Editors\u2019 note: what now follows is the decision letter after additional work had been performed.]eLife. Your article has been favorably evaluated by a Senior editor, a Reviewing editor, and 2 reviewers, one of whom, Stefan Diez, wants to reveal his identity.Thank you for giving us another opportunity to evaluate your work entitled \u201cCytoplasmic dynein crosslinks and slides anti-parallel microtubules using its two motor domains\u201d for consideration at The Reviewing editor and the two reviewers discussed their comments before we reached this decision, and the Reviewing editor has assembled the following comments to help you prepare a revised submission.Although the results are much stronger [than those in the previous submission], we still have some concerns about the experiments that we would like you to address before publication. These address both the in vitro and the in vivo experiments.On the side of the cell work:1) The authors switch to using GST-GFP-hDyn for the cell experiments but do not describe this construct very well beyond which nucleotides were sub cloned in the Materials and methods section. How similar/identical is it to the yeast protein? Why can it be assumed to behave the same? Does it associate with any other proteins within cells? How does it run on a sucrose gradient/gel filtration? Does the yeast protein behave similarly when introduced? Does the dimerized yeast construct rescue a yeast dynein mutant?2) To what degree is endogenous dynein depleted? Blots should be shown also to show how much overexpression there is of the introduced proteins.3) The two assays in 4) In 5) In On the in vitro work:1) In order to exclude dynein aggregation as a potential cause for MT bundling and sliding, the authors should still investigate and show the dynein-GFP signal during the MT\u2013MT sliding experiments . Does thTo exclude the protein aggregation, the authors now did look already at single GFP labelled dynein molecules new . However [Editors\u2019 note: the author responses to the first round of peer review follow.]The paper has been seen by three referees. Over all they find the idea that a minimal, GST-dimerized human dynein motor lacking the tail domain and the ability to bind to its adaptor proteins is capable of producing an inward force in the spindle that can substitute for endogenous dynein. These findings are novel. They indeed raise the possibility that dynein-driven MT-MT sliding may be propelled by the two dynein motor domains binding to and walking along two individual MTs.However, the referees agree that there is one major potential problem in interpreting your data, which comes from artificial dimerization by GST or native rat brain dynein including the three accessory chains and potentially other accessory proteins. The sliding mechanism that the authors present might be an artifact of the artificial dimerization , while the native motor could slide the MTs by a different mechanism, for example using a second MT binding site. To show that native dynein slides MTs using the proposed mechanism, the authors could use 'minimal-dimeric-motor' recombinant yeast heavy chains dimerized natively.We are rejecting the paper because experiments that would be a substantial amount of work should result in a rejection at eLife. However, if you feel that you can perform the experiment with the minimal dimeric motor, then we would encourage you to submit your interesting paper again to eLife.387kD). We show that Dyn387kD sediments at \u223c19S on a sucrose gradient, similar to other dimeric dyneins, and does not contain additional subunits. By deleting its canonical MT binding domain, we also find no evidence for a second \u201ccryptic\u201d MT binding site that might crosslink microtubules. Functionally, single Dyn387kD molecules move processively along MTs. Next, we show that Dyn387kD can bundle MTs, slide MTs within the bundles, and slide MTs within single MT-MT overlaps, very similar to GST-Dyn331kD. While Dyn387kD walks processively and unidirectionally on single MTs, it frequent pauses and reverses direction in anti-parallel MT overlaps. Taken together, these results show that a minimal, natively dimerized motor can slide MTs using only its two motor domains. We should also note that transition from unidirectional motion along a single microtubule, to pauses and bidirectional runs within an overlap is most likely a single molecule signature of the two motors domains binding to two different microtubules in an overlap region. This behavior is noted for native yeast dynein, again underscoring that this behavior is not an artifact of truncating the heavy chain.We have now addressed this critical point in full in two new figures . As suggA second problem identified by the reviewers concerned whether GST-dynein rescues spindle assembly upon DHC knock-down. This is never shown; rather you show the sensitivity to kinesin-5 inhibition. No data are shown in the absence of the drug, and it is not discussed whether the rescued spindles are positioned correctly and functional to segregate chromosomes, with poles focused, chromosomes aligned, etc. While we would not insist that these data are included, you should more fully discuss the other major functions of dynein in the spindle, and whether they might be accomplished by an anti-parallel sliding mechanism. For example, can this mechanism generate a spindle pole. Again a schematic would help, and ideally some data showing whether or not GST-dynein can generate asters or mediate pole focusing.We thank the referees for this clarification, as we did not describe our results and views adequately. We never meant to imply that a minimal dynein dimer can fully compensate for all dynein functions in spindle assembly. Our results show that GST-dynein  can counteract the outward microtubule sliding forces generated by kinesin-5 and kinesin-12, which strongly suggests that this construct produces anti-parallel microtubule sliding in vivo. However, we agree that other dynein functions in mitosis are unlikely to be replicated by this minimal dynein dimer, including pole focusing which occurs mainly between parallel microtubules. We have now tested this directly and show that GST-dynein does not rescue spindle pole focusing after dynein heavy chain RNAi. The spindle pole focusing mechanism likely involves the dynein tail domain, as well as associated molecules such as NuMa. We have clarified these points in the Discussion. We also have expanded the Discussion with recent data showing that the inward sliding forces produced by native dynein in the spindle require associated chains. While we feel that native dynein and the minimal GST-dynein slide anti-parallel MTs by the same mechanism, these results illustrate that native dynein has additional requirements for in vivo function, which may include stability of the entire heavy chain by associated proteins, as well as regulation of its force-generating activities. Thus, between our new in vivo data and new Discussion section, we feel that we have better represented the broader activities of dynein in the spindle. We experimented with a schematic but felt that it did not enhance the paper. We have added a schematic of our model for dynein-driven sliding and how it differs from mechanisms proposed for other motor proteins.Minor comments:- Binding of dynein to MTs without ATP in solution might impair further functionality of the motors. The authors could address this by performing a single molecule no-ATP to ATP switching experiment on single MTs and quantify the percentage of processively moving dynein molecules.While this is an interesting suggestion, we are unfortunately unable to do such experiments because we do not have a setup to add ATP to our flow chamber while performing simultaneous imaging. We note that the majority of dynein molecules appear to be motile in our assays.- The native dynein slides MTs very slowly and with pauses. Are the pauses accounted for in the average velocity in the histogram in? What is the explanation of the slow sliding speed compared to the fast speed of the surface gliding?MTs that were stationary for prolonged periods of time were not included in the average speed. However, since our time between images in these experiments was 3-5 sec, pauses of less than 3 sec are likely included in the average speed. Nonetheless, these pauses cannot explain the slow speed of MT-MT sliding. We currently do not fully understand why rat brain dynein slides MTs faster in surface gliding experiments than in MT-MT sliding. One possible explanation is that mammalian dyneins have a low MT affinity, much lower processivity, and show birectional movements in vitro , while yeast dynein is more processive and unidirectional. This point is now discussed in the manuscript.- The fact that the GST-hDyn slides MTs in vivo doesn't clarify the mechanism of the native dynein sliding.Our findings that native rat bovine brain dynein and four different recombinant dimerized dyneins (two yeast and two human) all can slide MTs make it reasonable to propose a model in which native dynein slides MTs by a similar mechanism. However, we cannot exclude the possibility that native dynein uses a sliding mechanism that differs from what we have observed in our in vitro assay. We have noted this possibility in the Discussion.- Using polarity-marked MTs an anti-parallel MT orientation was inferred for 18 out of 21 events. Were the other 3 events parallel sliding? How good was the polarity marking? Please quantify.Polarity marked MT can be problematic, since occasionally they fragment or anneal to yield a spurious result. In this revision, we have included an additional method of assessing polarity- direct single molecule observation of the direction of movement of individual GFP-dynein molecules on the track and transport MTs. Using this approach we found 21/22 sliding events to be anti-parallel. The one parallel event showed very slow sliding. This analysis is now included in the manuscript. Collectively, these two methods reveal predominant anti-parallel MT sliding with an occasional MT sliding event.- What influence did the ionic strength of the assay buffer have on the results?We tested MT-MT sliding at a higher ionic strength (100 mM KAc) and observed very similar sliding activity. At 200mM KAc, we observed no crosslinking or sliding of MTs. We included this information in the Materials and methods section.- The role of kinesin-14 as minus-end directed, MT-MT sliding motor in spindle assembly and integrity should be discussed.We added a sentence indicating kinesin-14\u2019s important role in pole focusing to the Discussion.- In the Introduction, it is stated that there is no evidence that dynein could directly cross link and slide MTs relative to one another. This may be true for pure motor domains in vitro, but movements of MT seeds on the spindle in Xenopus egg extracts, and spindle pole focusing, have been shown to require dynein. Similarly, \u201cThese results provide the first direct demonstration that cytoplasmic dynein can slide MTs within bundles\u201d seems to be a bit of an overstatement.It is true that previous studies found that dynein is required for MT movement and organization in the spindle . However, it has never been shown that dynein alone is sufficient for sliding of MTs in the spindle, as it could be indirect and require additional factors. Nonetheless, we have changed the text to specify that our results are the first fully reconstituted in vitro demonstration of dynein-dependent sliding and have added a reference to the study that shows transport of stabilized seeds to the spindle pole by dynein .- One issue that speaks to whether dynein could carry microtubules as cargo is the presence of non-motor microtubule binding domains. While perhaps not present on the dynein motor itself, doesn't the fact that rat dynein possesses a much slower velocity on bundled MTs compared to single microtubules indicate there is another MT binding domain on the heavy chain?We have now included new data, as described above, showing that a minimal, natively dimerized yeast dynein molecule can drive MT-MT sliding in the absence of associating factors and without an additional MT binding site. We do not fully understand why rat dynein possesses a slower MT-MT sliding speed. It is possible that this is due to an additional MT-binding site somewhere in the complex (which may be regulated in vivo), but it is also possible that this is due to the short dwell time and low processivity of mammalian dynein in vitro  and we have added these possible reasons to the Results section.- Furthermore, spindle dynein is known to function together with dynactin, which does have a MT binding domain.As noted above, we cannot completely exclude that the native dynein complex has an extra MT binding site, but MT-MT sliding in the spindle appears to be independent of dynactin .- The authors show convincingly that just a motor dimer can mediate one aspect of spindle morphogenesis, the inward sliding, but without examining the other functions they should soften their statements about the sufficiency of this mechanism.As discussed above, we have now included additional data examining the ability of the minimal dimer to rescue spindle pole focusing. We have adjusted our statements in the abstract and main text regarding the role of dynein-dependent MT sliding in spindle morphogenesis accordingly.[Editors\u2019 note: the author responses to the re-review follow.]On the side of the cell work:1) The authors switch to using GST-GFP-hDyn for the cell experiments but do not describe this construct very well beyond which nucleotides were sub cloned in the Methods section. How similar/identical is it to the yeast protein? Why can it be assumed to behave the same? Does it associate with any other proteins within cells? How does it run on a sucrose gradient/gel filtration? Does the yeast protein behave similarly when introduced? Does the dimerized yeast construct rescue a yeast dynein mutant?Dictyostelium, and rat  To what degree is endogenous dynein depleted? Blots should be shown also to show how much overexpression there is of the introduced proteins.We have now included a western blot showing that dynein is strongly down regulated by \u223c87% upon RNAi . This re3) The two assays inare basically showing the same thing twice. The authors should note that MG132 treatment does more than just arrest at metaphase as it influences turnover of MAPs .We have now included the reference to the turnover of MAPs in response to MG132 treatment. We included two different assays, exactly for this reason. As each assays has its specific pitfalls, we performed two assays to be sure that the ability of dynein to collapse the spindle was not due to a specific type of assay.4) In, the fraction of monopolar spindles in response to STLC in an RNAi control should be shown.This information is presented in 5) In, the spindles appear more multipolar than with \u201csplit poles\u201d and the chromosomes are misaligned. How is it determined whether the cells are in metaphase or prometaphase and does dynein RNAi cause chromosome misalignment?The multipolar spindles are due to centrosomes that detach from the spindle, which is a well-known phenotype of dynein depletion. Similarly, dynein depletion is known to cause chromosome alignment defects  In order to exclude dynein aggregation as a potential cause for MT bundling and siding, the authors should still investigate and show the dynein-GFP signal during the MT-MT sliding experiments (and). Does the signal look homogeneous ruling out the possibility of clustering? The authors probably already have the data to answer this question.To exclude the protein aggregation, the authors now did look already at single GFP labeled dynein molecules (new). However, the dynein concentration in single molecule experiments is most likely much lower than in sliding experiments, so the lack of aggregates in single molecule experiments still doesn't rule out that there are clusters in the sliding assay.We have included a representative"}
+{"text": "AbstractGastrocopta have been identified from the Pilbara region, Western Australia, by means of comparative analyses of shell and mtDNA variation. Three of these species, Gastrocopta hedleyi, Gastrocopta larapinta and Gastrocopta servilis, have been recorded in the Pilbara for the first time. Gastrocopta sp. CW1 is probably new to science and might be endemic to the region. By contrast, Gastrocopta hedleyi, Gastrocopta larapinta and Gastrocopta mussoni are shown to be widespread.Six species of  Gastrocopta Wollaston, 1878 is the most speciose pupillid genus in Australia with twelve recorded species  and Hedley . Pupillidae from the south and mid-west coasts of Western Australia and later (Pupillidae) from the Kimberley, Northern Territory and Red Centre regions. A second major revision by nd later  the non-Gastrocopta in the Pilbara region has greatly expanded. Most of this collecting has been associated with expanding mineral operations in the region and improved vehicle access to remote areas. A Western Australian Museum fieldtrip during August 2009 visited the eastern Pilbara area, collected macro- and micro- non-marine molluscs and significantly increased the pupillid collection in that region.Since Pokryszko\u2019s  revisionGastrocopta in the Pilbara, establishing new records and range extensions; (2) tests the taxonomic significance of morphological characters commonly used for the identification and delimitation of species by using a mitochondrial phylogeny; (3) provides comparative remarks on shell morphology of Gastrocopta species; (4) indicates systematic issues that require clarification by further studies. For detailed comparative analyses of shell characters we refer to This paper (1) presents new data on Gastrocopta material from the Pilbara in the malacological collections of the Western Australian Museum was examined. Additional specimens from the private collection of Mr Vince Kessner and from the collection of the Field Museum of Natural History, Chicago were also included. In total 545 Gastrocopta lots were studied with distributional maps being plotted by use of the online vector map software available at www.planiglobe.com.All PageBreakand measured using a Leica MZ16A microscope with Leica DFC500 camera. DNA was extracted from entire specimens taken from their shell by use of a QIAGEN DNA extraction kit for animal tissue following the standard procedure of the manual. Fragments of the mitochondrial 16S rRNA (16S) and of the COI genes were amplified by PCR using the primer pairs: 16Sar and 16Sbr . Another species, Gastrocopta bannertonensis was only collected from the inner mid-west region of Western Australia and was not discussed in this paper.Six species of a region . Four sp1.Pilsbry, 1917http://species-id.net/wiki/Gastrocopta_hedleyiGastrocopta hedleyiAustralbinula hedleyiNarrabri, New South Wales.21.1343\u00b0S, 119.1259\u00b0E (WAM S64439). Burrup Peninsula: 20.6080\u00b0S, 116.7670\u00b0E (WAM S60089); 20.6141\u00b0S, 116.7548\u00b0E (WAM S60226); 20.6066\u00b0S, 116.7681\u00b0E (WAM S60227); 20.5833\u00b0S, 116.8000\u00b0E ; 20.6102\u00b0S, 116.7607\u00b0E (WAM S60353); 20.6232\u00b0S, 116.7784\u00b0E (WAM S60402); 20.6166\u00b0S, 116.7833\u00b0E (WAM S60475); 20.6119\u00b0S, 116.7587\u00b0E (WAM S60477); 20.6238\u00b0S, 116.7777\u00b0E (WAM S60480); 20.6300\u00b0S, 116.7800\u00b0E (WAM S65167); 20.5858\u00b0S, 116.8044\u00b0E (WAM S65168). Cloud Break area: 22.2997\u00b0S, 119.3737\u00b0E (WAM S60416). Hope Downs: 23.0865\u00b0S, 119.3184\u00b0E (WAM S42661); 23.0379\u00b0S, 119.2124\u00b0E (WAM S42663); 23.0952\u00b0S, 119.2022\u00b0E (WAM S59553); 23.1030\u00b0S, 119.2917\u00b0E (WAM S59555). Kalgan PageBreakPool area: 23.1872\u00b0S, 119.6958\u00b0E (WAM S58079); 23.1877\u00b0S, 119.6965\u00b0E (WAM S58091). Kangeenarina Gorge: 22.0588\u00b0S, 117.8549\u00b0E (WAM S60085). Karajini National Park: 22.4782\u00b0S, 118.5598\u00b0E (WAM S65307); 22.9797\u00b0S, 118.5891\u00b0E (WAM S65310); 22.8446\u00b0S, 118.5403\u00b0E (WAM S65314); 22.3714\u00b0S, 118.2989\u00b0E (WAM S65336). Marillana Station: 22.4285\u00b0S, 119.2043\u00b0E (WAM S81440). Mount Brockman area: 22.4815\u00b0S, 117.2384\u00b0E (WAM S83560). Mt Farquhar area: 22.4815\u00b0S, 116.8108\u00b0E (WAM S83564); 22.4932\u00b0S, 116.8679\u00b0E (WAM S83586). Nullagine area: 22.3848\u00b0S, 119.9696\u00b0E (WAM S58093); 22.3210\u00b0S, 119.4442\u00b0E (WAM S80958). Orebody 35\u00b0E(ca. 8km W of Newman): 23.4047\u00b0S, 119.6052\u00b0E (WAM S64713); 23.3943\u00b0S, 119.6316\u00b0E ; 23.4108\u00b0S, 119.5715\u00b0E (WAM S64720); 23.3994\u00b0S, 119.5843\u00b0E (WAM S64722); 23.4045\u00b0S, 119.6211\u00b0E (WAM S64726); 23.4182\u00b0S, 119.5847\u00b0E ; 23.4049\u00b0S, 119.6052\u00b0E (WAM S64732); 23.4045\u00b0S, 119.6247\u00b0E (WAM S64735); 23.4049\u00b0S, 119.6053\u00b0E ; 23.4003\u00b0S, 119.6524\u00b0E (WAM S64740); 23.4137\u00b0S, 119.5826\u00b0EPageBreak(WAM S64741); 23.4029\u00b0S, 119.6021\u00b0E (WAM S64742); 23.4003\u00b0S, 119.5721\u00b0E (WAM S64745); 23.3947\u00b0S, 119.5913\u00b0E (WAM S64750). ca. 35km E of Paraburdoo: 23.1300\u00b0S, 117.8984\u00b0E (WAM S41446); 23.1663\u00b0S, 117.9484\u00b0E (WAM S41447); 23.1670\u00b0S, 117.9597\u00b0E (WAM S41448). ca. 7.07.5km NW of Tom Price: 22.6500\u00b0S, 117.7185\u00b0E (WAM S42668); 22.6423\u00b0S, 117.7451\u00b0E (WAM S42672). Phil\u2019s Creek: 22.7319\u00b0S, 119.1940\u00b0E (WAM S59376). Sulphur Springs: 21.1475\u00b0S, 119.2269\u00b0E (WAM S60229). Wonmunna: 23.1216\u00b0S, 119.0498\u00b0E (WAM S65971); 23.1428\u00b0S, 119.0099\u00b0E (WAM S65976); 23.1266\u00b0S, 119.0470\u00b0E ; 23.1255\u00b0S, 119.0797\u00b0E (WAM S80937); 23.1287\u00b0S, 119.0904\u00b0E (WAM S80938); 23.1393\u00b0S, 119.0182\u00b0E (WAM S80939); 23.1220\u00b0S, 119.0611\u00b0E (WAM S80941); 23.1436\u00b0S, 119.0064\u00b0E ; 23.1185\u00b0S, 119.0649\u00b0E (WAM S81004); 23.1592\u00b0S, 118.9928\u00b0E ; 23.1632\u00b0S, 118.9770\u00b0E ; 23.1615\u00b0S, 119.0020\u00b0E ; 23.1185\u00b0S, 119.0649\u00b0E (WAM S81091); 23.1596\u00b0S, 118.9703\u00b0E (WAM S81052); 23.1283\u00b0S, 119.0736\u00b0E (WAM S81059); 23.1331\u00b0S, 119.0154\u00b0E (WAM S81103); 23.1356\u00b0S, 119.0463\u00b0E (WAM S81120); 23.1546\u00b0S, 118.9932\u00b0E (WAM S81122); 23.1314\u00b0S, 119.0774\u00b0E (WAM S81174). ca. 6km W of Wodgina Mine: 21.2383\u00b0S, 118.6519\u00b0E (WAM S65895); 23.1348\u00b0S, 119.0338\u00b0E (WAM S81074).Western Australia: Abydos (64km W of Marblebar): This species has previously been recorded fromnorthern New South Wales and from scattered localities in northern Queensland (Cape York Peninsula), central Australia (Glen Helen area) and northern Western Australia (King Leopold Ranges) . In addiGastrocopta hedleyi shellsare slightly smaller (shorter) than those of other Gastrocopta species (excluding Gastrocopta sp. CW1) recorded from the Pilbara. They typically have (1) a large, usually rounded (sometimes acute) columellar tooth that is drooping at the anterior end (2) a high, strongly convergent upper palatal tooth (3) a long, high, strongly twisted parietoangular tooth that usually comes in close proximity to the upper palatal tooth (4) a prominent infraparietal tooth that is sometimes prolonged as thin ridge on parietal wall (5) often a strong basal tooth (6) very occasionally with a weak interpalatal tooth.Gastrocopta hedleyi shells (particularly more elongate specimens) can be difficult to separate from the ovate form of Gastrocopta mussoni but (1) are smaller (slender) when sympatric (2) have a less rounded body whorl (3) have a more strongly sigmoid lower palatal tooth (4) have a larger upper palatal tooth that is usually strongly convergent with the lower palatal (5) have a longer, more strongly twisted parietoangular tooth (6) have a larger, more rounded columellar tooth that is usually drooping at the anterior end .Some Gastrocopta mussoni is also very similar to Gastrocopta hedleyi but (1) has a lower, shorter and less twisted parietoangular tooth  (2) has a shorter and less sigmoid  lower palatal tooth (3) generally lacks an infraparietal tooth (4) has a smaller upper palatal tooth  (5) has a more acutely angled, slanted columellar tooth, rarely drooping at the anterior end.The cylindrical form of Gastrocopta hedleyi during this study. Many specimens grouped as Gastrocopta hedleyi from the eastern Hamersley Range  have reduced barriers and often a lower parietoangular tooth  but a large series shows a progression to shells that typically possess a large, strongly convergent upper palatal tooth and a strongly twisted parietoangular tooth.There is considerable variation in the shell size and barrier length of specimens identified as Gastrocopta hedleyi was somewhat similar to Gastrocopta pilbarana, although in that case he was actually referring to the ovate form of Gastrocopta mussoni (see section on Gastrocopta mussoni).Gastrocopta hedleyi on the Burrup Peninsula is intriguing. The large numbers are presumably related to its\u2019 habitat requirement of either Fig tree, Cypress or Brigalow Stands among rocky substrates, and its\u2019 preference for high calcium soils http://species-id.net/wiki/Gastrocopta_larapintaPupa larapintaGastrocopta larapintaAustralbinula larapintaCentral Australia.22.0298\u00b0S, 115.4296\u00b0E (WAM S42993). Central Pilbara: 22.3855\u00b0S, 117.4667\u00b0E ; 22.3200\u00b0S, 117.6194\u00b0E (WAM S65778); 22.2675\u00b0S, 117.7197\u00b0E (WAM S65780); 22.1350\u00b0S, 117.4728\u00b0E (WAM S58493); 21.0216\u00b0S, 117.0560\u00b0E (WAM S65817); 20.7506\u00b0S, 117.0096\u00b0E (WAM S65797). Christmas Creek: 22.4061\u00b0S, 119.7376\u00b0E (WAM S65612); 22.3985\u00b0S, 119.7930\u00b0E (WAM S65604). Cloud Break area: 22.3210\u00b0S, 119.4442\u00b0E ; 22.2688\u00b0S, 119.3147\u00b0E (WAM S61128); 22.3652\u00b0S, 119.3409\u00b0E (WAM S65150); 22.3985\u00b0S, 119.4748\u00b0E (WAM S65156); 22.3949\u00b0S, 119.5019\u00b0E (WAM 65161); 22.3527\u00b0S, 119.4189\u00b0E (WAM S65135). Collier Rocks: 20.4071\u00b0S, 116.8514\u00b0E (VK 30297). Cy Creek: 22.8183\u00b0S, 114.0609\u00b0E (WAM S34381). Du Boulay Creek: 21.1833\u00b0S, 116.1833\u00b0E (WAM S34569). Fortescue Marsh area: 22.2930\u00b0S, 119.0606\u00b0E (WAM S61996-7); 22.4646\u00b0S, 119.7726\u00b0E ; 22.4430\u00b0S, 119.7785\u00b0E (WAM S64649); 22.4252\u00b0S, 119.7235\u00b0E (WAM S64635); 22.3125\u00b0S, 119.2348\u00b0E ; 22.2875\u00b0S, 119.1701\u00b0E (WAM S64650); 22.2822\u00b0S, 119.1276\u00b0E . Hope Downs: 23.1030\u00b0S, 119.5821\u00b0E (WAM S59298); 23.0919\u00b0S, 119.1875\u00b0E (WAM S59550). Jimblebar: 23.3693\u00b0S, 120.1958\u00b0E (WAM S41346). Kalgan Pool area: 23.1877\u00b0S, 119.6965\u00b0E (WAM S58005); 23.1874\u00b0S, 119.6957\u00b0E (WAM S80939). Koodaideri Corridor West (90.4km NW of Tom Price): 21.8833\u00b0S, 117.7000\u00b0E (WAM S83434). Marillana Station: 22.6260\u00b0S, 119.2834\u00b0E (WAM S34638); 22.5840\u00b0S, 119.3114\u00b0E ; 22.5739\u00b0S, 119.2562\u00b0E (WAM S34474); 22.5666\u00b0S, 119.2327\u00b0E (WAM S34637); 22.5663\u00b0S, 119.2308\u00b0E (WAM S34633); 22.6013\u00b0S, 119.2913\u00b0E (WAM S80924); 22.5625\u00b0S, 119.2311\u00b0E (WAM S80908); 22.1269\u00b0S, 119.2123\u00b0E (WAM S80911); 22.4080\u00b0S, 119.0067\u00b0E (WAM S80914); 22.4285\u00b0S, 119.2043\u00b0E (WAM S8143940); 22.3476\u00b0S, 119.1518\u00b0E (WAM S81433); 22.4295\u00b0S, 119.1923\u00b0E (WAM S81446). Millstream National Park: 21.2000\u00b0S, 117.2667\u00b0E (WAM S60343); 21.6000\u00b0S, 117.1000\u00b0E (WAM S 61044); 21.5833\u00b0S, 117.1000\u00b0E (WAM S 61048); 21.5833\u00b0S, 117.0833\u00b0E (WAM S60944-5); 21.5833\u00b0S, 117.0667\u00b0E (WAM S 60947); 21.4255\u00b0S, 117.0535\u00b0E (WAM S81213); 21.2039\u00b0S, 117.0440\u00b0E (WAM S81267). ca. 30km NNE of Newman: 23.1164\u00b0S, 119.8865\u00b0E (WAM S64469). ca. 65km NW of Newman: 22.9169\u00b0S, 119.2128\u00b0E (WAM S80937). ca. 108118km N of Newman: 22.3132\u00b0S, 119.8599\u00b0E ; 22.3134\u00b0S, 119.7886\u00b0E (WAM S65646); 22.2972\u00b0S, 119.8633\u00b0E ; 22.2954\u00b0S, 119.8109\u00b0E (WAM S65652). North Star Mine: 21.2284\u00b0S, 119.0386\u00b0E (WAM S65720); 21.2104\u00b0S, 118.8769\u00b0E (WAM S65723). Phil\u2019s Creek: 22.7412\u00b0S, 119.1959\u00b0E ; 22.7320\u00b0S, 119.1836\u00b0E (WAM S59374). ca. 100km S of Port Hedland: 20.6066\u00b0S, 119.5016\u00b0E (WAM S80942). ca. 200km SSE of Port Hedland: 22.1554\u00b0S, 119.0216\u00b0E (WAM S83486). Robe River area: 21.8063\u00b0S, 116.0774\u00b0E (WAM S42832). 6km SW of Redmont Airport: 22.0195\u00b0S, 118.9816\u00b0E (WAM S83423). NNE of Rocklea Homestead: 22.7882\u00b0S, 117.4974\u00b0E (WAM S80977). Roy Hill Station: 22.4898\u00b0S, 119.8951\u00b0E (WAM S34703); 22.4547\u00b0S, 119.8709\u00b0E ; 22.4943\u00b0S, 119.9217\u00b0E ; 22.5383\u00b0S, 119.9424\u00b0E ; 22.4793\u00b0S, 119.9420\u00b0E ; 22.6394\u00b0S, 119.9642\u00b0E (WAM S60398); 22.5769\u00b0S, 119.9952\u00b0E ; 22.5771\u00b0S, 120.0247\u00b0E (WAM S60422); 22.7058\u00b0S, 119.7082\u00b0E (WAM S60392); 22.6430\u00b0S, 119.9599\u00b0E (WAM S60396); 22.6076\u00b0S, 119.9826\u00b0E (WAM S60388); 22.6593\u00b0S, 119.9198\u00b0E (WAM S60397); 22.6642\u00b0S, 119.9458\u00b0E ; 22.6431\u00b0S, 119.9642\u00b0E ; 22.6225\u00b0S, 119.9634\u00b0E (WAM S610723); 22.5050\u00b0S, 119.9143\u00b0E (WAM S64455). Running Waters (east of Nullagine): 21.6819\u00b0S, 121.1254\u00b0E ; 21.6806\u00b0S, 121.1261\u00b0E (WAM S58032). 15km W of Shaw River Airport: 21.6123\u00b0S, 119.2642\u00b0E (WAM S83412). Wonmunna: 23.1220\u00b0S, 119.0611\u00b0E ; 23.1356\u00b0S, 119.0463\u00b0E ; 23.1216\u00b0S, 119.0498\u00b0E (WAM S81096); 23.1201\u00b0S, 119.0484\u00b0E . ca. 18-23km SE of Wodgina Mine: 21.2273\u00b0S, 118.8336\u00b0E (WAM S646089); 21.2871\u00b0S, 118.8671\u00b0E . ca. 20km NNE of Wodgina Mine: 21.0260\u00b0S, 118.7024\u00b0E (WAM S64610). Yule River area: 21.6961\u00b0S, 118.8604\u00b0E (WAM S83372).Western Australia: Cane River: This species has previously been recorded fromcentral Australia (southern part of Northern Territory) with fewer records in north-western Queensland (Gregory River Basin); eastern coast of Queensland and a single record from the Oscar Ranges, in the southern Kimberley region of Western Australia . In addiGastrocopta larapinta specimens are distinguished from most other Gastrocopta species in the Pilbara by (1) their large size (2) usually the presence of three solid palatal teeth  (3) a short, solid parietoangular tooth that is usually deflected or curved moderately toward the columellar wall so that its anterior end is somewhat vertical in the apertural view (4) a long angular tooth that is generally fused  to the parietoangular tooth, occasionally separate  (5) smaller, more rounded PageBreakcolumellar tooth that curves or angles abruptly toward the columellar wall (6) usually the presence of an infraparietal tooth or basal tooth (or both).The shells of typical Gastrocopta larapinta shells with a small interpalatal tooth  appear considerably more variable in apertural barrier structure , making their separation from the cylindrical and elongate-ovate forms of Gastrocopta mussoni difficult. As such the following separation is tentative. Gastrocopta larapinta shells are typically (1) slightly to moderately larger (obese) (2) have a slightly smaller, more rounded columellar tooth (3) usually a much shorter parietoangular tooth that is positioned lower in apertural view (4) generally possesses an infraparietal tooth (5) often a slightly lower, less convergent upper palatal tooth (6) usually a less sigmoid lower palatal tooth.Typical Gastrocopta larapinta  with the cylindrical and elongate-ovate forms of Gastrocopta mussoni has proved extremely difficult and a more detailed molecular study is required to resolve this issue. Gastrocopta larapinta specimens from cylindrical Gastrocopta mussoni based on shell size  and columellar tooth angle (less acute). However, from the small genetic data available and from examination of many shells, Gastrocopta larapinta shells were slightly, to moderately more obese.The separation of Gastrocopta mussoni contained mixed lots of Gastrocopta larapinta and Gastrocopta mussoni. Interestingly, Poykryszko had identified a few of these larger Cy Creek specimens as Gastrocopta larapinta, but included those records as Gastrocopta mussoni in her publication. Gastrocopta mussoni from central Australia (FMNH 201570) that some of the ovate Gastrocopta mussoniPageBreak were quite large  but we consider most of those to be Gastrocopta larapinta with a small or no interpalatal tooth (see Gastrocopta mussoni section).Some of those near west coast specimens (Cy Creek) included as cylindrical Gastrocopta larapinta when separating cylindrical Gastrocopta mussoni and Gastrocopta larapinta  but this does not reflect accurately in her identifications. During this study specimens from Kalgan Pool (WAM S58005) were unexpectedly grouped within the Gastrocopta larapinta clade. These specimens, although slightly more slender, have proven difficult to separate from cylindrical Gastrocopta mussoni specimens identified by Gastrocopta larapinta and in this sense, Pokryszkos\u2019  was correct.It is possible ryszkos\u2019  separatiGastrocopta mussoni and Gastrocopta larapinta shells with a small or no interpalatal tooth, the above separation is tentative and a more detailed genetic investigation is required.As there is doubt surrounding the distinguishing morphological characters of cylindrical 3.http://species-id.net/wiki/Gastrocopta_margaretaePupa margaretaePupa wallabyensisGastrocopta margaretaeGastrocopta tateiGastrocopta wallabyensisAustralbinula margaretaeAustralbinula wallabyensisAustralbinula tateiGastrocopta pilbaranaWallaroo, South Australia.23.0552\u00b0S, 113.8234\u00b0E (WAM S42834). ~18km N of Boolathana Homestead: 24.4133\u00b0S, 113.7445\u00b0E (WAM S64708). Boolathana Station: 24.4127\u00b0S, 113.7631\u00b0E (WAM S64709). Bush Bay: 25.1175\u00b0S, 113.8063\u00b0E (WAM S42806); 25.1316\u00b0S, 113.7681\u00b0E (WAM S60355); 25.1136\u00b0S, 113.7311\u00b0E (WAM S64575); 25.1175\u00b0S, 113.8063\u00b0E (WAM S64577). Carrarang Station: 26.1666\u00b0S, 113.3500\u00b0E (WAM S34378). Cy Creek: 23.1000\u00b0S, 113.8000\u00b0E (WAM S34380). Dirk Hartog Island: 25.7166\u00b0S, 113.0667\u00b0E (WAM PageBreakS14439); 25.8333\u00b0S, 113.0500\u00b0E (WAM S34398). Francois Peron National Park: 25.9760\u00b0S, 113.5707\u00b0E (WAM S60269); 25.9758\u00b0S, 113.5706\u00b0E (WAM S64706); 25.8752\u00b0S, 113.5497\u00b0E (WAM S61127). Lake Macleod area: 24.3449\u00b0S, 113.5194\u00b0E (WAM S65084); 24.3668\u00b0S, 113.5145\u00b0E (WAM S65093); 24.3544\u00b0S, 113.5098\u00b0E (WAM S65102); 24.4760\u00b0S, 113.5257\u00b0E (WAM S65108); 24.4598\u00b0S, 113.5013\u00b0E (WAM S65110); 24.3544\u00b0S, 113.5098\u00b0E (WAM S65121). 0.25 miles W of Nichol Springs: 24.1333\u00b0S, 118.4167\u00b0E (WAM S60270). ~25 miles N of turn off to Shark Bay on NW Coastal Highway: 26.0647\u00b0S, 114.3353\u00b0E . 0.5 miles W of 512 mile peg on NW Coastal Highway: 26.1966\u00b0S, 114.3758\u00b0E (WAM S34379). Quobba Station: 24.4758\u00b0S, 113.4166\u00b0E (WAM S42829); 24.2448\u00b0S, 113.5353\u00b0E (WAM S61125); 24.1927\u00b0S, 113.4548\u00b0E (WAM S64576); 24.2233\u00b0S, 113.5036\u00b0E (WAM S64707). Salutation Island: 26.5333\u00b0S, 113.7667\u00b0E (WAM S34377). Winderabandi Point: 22.4929\u00b0S, 113.7258\u00b0E (WAM S60474). Zuytdorp: 27.2636\u00b0S, 114.0703\u00b0E (WAM S64710).Western Australia: Bateman Sanctuary: This species has previously been recorded fromthe western and southern coastal areas of Western Australia, the southern regions of South Australia and the area near Alice Springs in the Northern Territory. There is also an isolated record from the King Leopold Range in the north of Western Australia . In the Gastrocopta margaretae are easily distinguished from other Gastrocopta species in the Pilbara by the presence of (1) a moderately to strongly folded columellar tooth (2) a generally large and transverse basal tooth (3) a high and long lower palatal tooth (4) an upper palatal tooth that is moderately to strongly convergent with the lower palatal (5) a weak to strong infraparietal tooth present.Shells of Gastrocopta wallabyensis from the south coast Gastrocopta margaretae based on size  and length of apertural barriers (longer). He also described a new species, Gastrocopta pilbarana, from the west coast but his separation of it from Gastrocopta wallabyensis was vague. Solem later . It is not known whether there is a continuous distribution between the two areas. Until more detailed molecular work is undertaken we have maintained Pokryszko\u2019s  could represent genetic isolation by distance or perhaps a different species from those on the west coast (WAM S42834) but more molecular data are required. The southern specimens are (1) much larger with reduced apertural barriers (2) more strongly rounded whorls  and (3) consistently lack an infraparietal tooth. Specimens resembling the smaller west coast form  have also been recorded from the south west area of Western Australia  where it is often sympatric with ryszko\u2019s  systematPageBreak4.Pilsbry, 1917http://species-id.net/wiki/Gastrocopta_mussoniGastrocopta larapinta desertiGastrocopta mussoniAustralbinula helmsianaAustralbinula mussoniGastrocopta desertiCalliungal (=Mt Morgan), Queensland.23.4331\u00b0S, 118.7329\u00b0E (WAM S65935). Anketell Point area: 20.6356\u00b0S, 117.0398\u00b0E (WAM S59990); 20.6719\u00b0S, 117.0965\u00b0E (WAM S599912); 20.7025\u00b0S, 117.0473\u00b0E (WAM S80936). Area C: 22.9104\u00b0S, 118.9664\u00b0E (WAM S60417). Barrow Island: 20.7833\u00b0S, 115.4000\u00b0E\u00b0E (WAM S34384); 20.8649\u00b0S, 115.4069\u00b0E\u00b0E (WAM S34455); 20.6666\u00b0S, 115.4667\u00b0E ; 20.7921\u00b0S, 115.4573\u00b0E (WAM S59636); 20.7858\u00b0S, 115.4573\u00b0E (WAM S59637); 20.7997\u00b0S, 115.4403\u00b0E (WAM S59640); 20.7069\u00b0S, 115.4194\u00b0E (WAM S59642); 20.7866\u00b0S, 115.4547\u00b0E ; 20.7938\u00b0S, 115.4575\u00b0E (WAM S59651); 20.8644\u00b0S, 115.3428\u00b0E (WAM S59652); 20.8101\u00b0S, 115.4270\u00b0E (WAM S60410); 20.6666\u00b0S, 115.4667\u00b0E ; 20.7977\u00b0S, 115.4064\u00b0E ; 20.7684\u00b0S, 115.4673\u00b0E (WAM S65174). Cane River Conservation Park: 22.1694\u00b0S, 115.5606\u00b0E (WAM S42961); 22.4321\u00b0S, 115.2895\u00b0E (WAM S42967); 22.2685\u00b0S, 115.6470\u00b0E (WAM S42974); 22.0975\u00b0S, 115.4942\u00b0E (WAM S42976); 22.2075\u00b0S, 115.5260\u00b0E (WAM S42981); 22.1451\u00b0S, 115.7249\u00b0E (WAM S42987); 22.0298\u00b0S, 115.4296\u00b0E (WAM S42992); 22.0131\u00b0S, 115.6325\u00b0E (WAM S42998). Cape Preston area: 20.8435\u00b0S, 116.2016\u00b0E (WAM S59141). Chichester Ranges: 22.0525\u00b0S, 118.9883\u00b0E (WAM S60407); 22.0516\u00b0S, 118.9884\u00b0E ; 22.1508\u00b0S, 119.0179\u00b0E (WAM S42709); 22.0503\u00b0S, 118.9934\u00b0E (WAM S42717); 23.1164\u00b0S, 119.8865\u00b0E (WAM S64460). Christmas Creek area: 22.4170\u00b0S, 119.8941\u00b0E (WAM S65603); 22.4078\u00b0S, 119.8767\u00b0E (WAM S65605); 22.4061\u00b0S, 119.7376\u00b0E (WAM S65611). Cloud Break area: 20.3216\u00b0S, 119.4418\u00b0E (WAM S34460); 22.3210\u00b0S, 119.4442\u00b0E ; 22.3181\u00b0S, 119.3788\u00b0E (WAM S60267); 22.2935\u00b0S, 119.3872\u00b0E (WAM S61122); 22.2997\u00b0S, 119.3737\u00b0E (WAM S61123); 22.2881\u00b0S, 119.2360\u00b0E ; 22.3251\u00b0S, 119.4458\u00b0E (WAM S65139); 22.3527\u00b0S, 119.4189\u00b0E (WAM S65144); 22.3652\u00b0S, 119.3409\u00b0E (WAM S65148); 22.3894\u00b0S, 119.4380\u00b0E (WAM S65155); 22.3985\u00b0S, 119.4748\u00b0E (WAM S65157); PageBreak22.3949\u00b0S, 119.5019\u00b0E (WAM S65213). Cy Creek: 22.8183\u00b0S, 114.0609\u00b0E (WAM S34382). Dolphin Island: 20.4833\u00b0S, 116.8500\u00b0E (WAM S34385). Du Boulay Creek: 21.1833\u00b0S, 116.1833\u00b0E (WAM S34568). Finucane Island: 20.2982\u00b0S, 118.5572\u00b0E (WAM S16108). Fortescue Marsh area: 22.2822\u00b0S, 119.1276\u00b0E ; 22.2938\u00b0S, 119.0732\u00b0E (WAM S61991); 22.5098\u00b0S, 119.1274\u00b0E ; 22.2872\u00b0S, 119.0301\u00b0E ; 22.1322\u00b0S, 119.1983\u00b0E (WAM S64684); 22.2924\u00b0S, 119.0279\u00b0E (WAM S64687). East Hamersley Range: 22.8586\u00b0S, 119.6728\u00b0E (WAM S42921); 22.6335\u00b0S, 119.3289\u00b0E (WAM S64470). Hope Downs: 23.1474\u00b0S, 119.5191\u00b0E (WAM S42662); 23.1030\u00b0S, 119.2917\u00b0E ; 23.0925\u00b0S, 119.2058\u00b0E (WAM S59551); 23.0878\u00b0S, 119.1609\u00b0E (WAM S59552). Jinayri area: 22.9219\u00b0S, 119.2036\u00b0E (WAM S42929); 23.0530\u00b0S, 119.2701\u00b0E ; 23.0129\u00b0S, 119.2371\u00b0E ; 22.9058\u00b0S, 119.2000\u00b0E ; 22.9275\u00b0S, 119.1275\u00b0E (WAM S59585); 22.9169\u00b0S, 119.2128\u00b0E (WAM S59587); 22.9219\u00b0S, 119.2036\u00b0E (WAM S59591); 23.0504\u00b0S, 119.2731\u00b0E (WAM S60406). Kalgan Pool area: 23.1877\u00b0S, 119.6965\u00b0E (WAM S439823). Kangeenarina Gorge area: 22.1186\u00b0S, 117.9427\u00b0E (WAM S61763); 21.8489\u00b0S, 117.3837\u00b0E (WAM S81210). Karratha area: 20.7166\u00b0S, 116.8500\u00b0E (WAM S60412); 21.4036\u00b0S, 116.9392\u00b0E (WAM S81217). SE of Karratha: 21.0698\u00b0S, 116.9702\u00b0E ; 21.0300\u00b0S, 116.9997\u00b0E ; 20.9853\u00b0S, 116.8811\u00b0E (WAM S81268). Lake Macleod: 24.3544\u00b0S, 113.5098\u00b0E (WAM S65120). Marillana Station: 22.5840\u00b0S, 119.3114\u00b0E (WAM S84075); 22.5663\u00b0S, 119.2308\u00b0E (WAM S34473); 22.5497\u00b0S, 119.2147\u00b0E (WAM S34476); 22.5851\u00b0S, 119.3142\u00b0E (WAM S34478). 22.5739\u00b0S, 119.2562\u00b0E ; 22.5538\u00b0S, 119.2283\u00b0E (WAM S34635); 22.6260\u00b0S, 119.2834\u00b0E (WAM S34639); 22.5625\u00b0S, 119.2311\u00b0E (WAM S80907); 22.1269\u00b0S, 119.2123\u00b0E (WAM S80910); 22.5625\u00b0S, 119.2311\u00b0E (WAM S80913); 22.4080\u00b0S, 119.0067\u00b0E (WAM S80916); 22.6376\u00b0S, 119.3744\u00b0E (WAM S80917); 22.4285\u00b0S, 119.2043\u00b0E (WAM S81437); 22.3182\u00b0S, 119.1175\u00b0E (WAM S81442); 22.4295\u00b0S, 119.1923\u00b0E (WAM S81444). Meentheena Outcamp: 21.2671\u00b0S, 120.4570\u00b0E (WAM S58055); 21.2815\u00b0S, 120.4511\u00b0E (WAM S58099); 21.2816\u00b0S, 120.4508\u00b0E (WAM S58098). Millstream National Park: 21.6000\u00b0S, 117.1000\u00b0E ; 21.5833\u00b0S, 117.0833\u00b0E ; 21.5833\u00b0S, 117.0667\u00b0E (WAM S60946); 21.4255\u00b0S, 117.0535\u00b0E (WAM S81212); 21.1781\u00b0S, 117.0461\u00b0E (WAM S81250); 21.2039\u00b0S, 117.0440\u00b0E . Mount Brockman area: 22.4815\u00b0S, 117.2384\u00b0E (WAM S83561). Mt Farquhar area: 22.4815\u00b0S, 116.8108\u00b0E (WAM S83563). Muiron Island: 21.6666\u00b0S, 114.3333\u00b0E (WAM S34383). Murray Hills: 22.1147\u00b0S, 118.5221\u00b0E (WAM S59996). ~60km NW of Newman: 23.0530\u00b0S, 119.2701\u00b0E ; 23.0878\u00b0S, 119.1609\u00b0E (WAM S59549); 23.0504\u00b0S, 119.2731\u00b0E ; 22.9632\u00b0S, 119.2276\u00b0E . ~112km PageBreakNNE of Newman: 22.3621\u00b0S, 119.9691\u00b0E (WAM S65650); 22.3132\u00b0S, 119.8599\u00b0E (WAM S 65672); 22.3871\u00b0S, 119.9664\u00b0E (WAM S 65694). ~110km N of Newman: 22.2954\u00b0S, 119.8109\u00b0E (WAM S65638); 22.3132\u00b0S, 119.8599\u00b0E (WAM S65672); 22.2972\u00b0S, 119.8633\u00b0E (WAM S65683). ~70km S of Newman: 23.7270\u00b0S, 119.7242\u00b0E (WAM S58073). North Star: 21.2523\u00b0S, 118.8334\u00b0E (WAM S65699); 21.1971\u00b0S, 118.8286\u00b0E ; 21.2681\u00b0S, 118.9682\u00b0E (WAM S65713); 21.2104\u00b0S, 118.8769\u00b0E (WAM S65718); 21.2104\u00b0S, 118.8769\u00b0E (WAM S65719); 21.2319\u00b0S, 118.8263\u00b0E (WAM S65728). Nullagine area: 21.8221\u00b0S, 120.3409\u00b0E (WAM S61802). Orebody 35\u00b0E (ca. 8km W of Newman): 23.4108\u00b0S, 119.5715\u00b0E (WAM S64733); 23.3837\u00b0S, 119.6478\u00b0E (WAM S64748); 23.3712\u00b0S, 119.6127\u00b0E (WAM S64749); 23.3819\u00b0S, 119.6133\u00b0E (WAM S64751); 23.3970\u00b0S, 119.6138\u00b0E (WAM S64752). West of Pannawonica: 21.7000\u00b0S, 116.1667\u00b0E (WAM S42805); 21.8063\u00b0S, 116.0774\u00b0E (WAM S60268); 21.7202\u00b0S, 116.0705\u00b0E ; 21.6298\u00b0S, 116.0206\u00b0E (WAM S60415). Point Quobba, near lighthouse: 24.4797\u00b0S, 113.4178\u00b0E (FMNH 201611); Phils` Creek area: 22.7320\u00b0S, 119.1836\u00b0E ; 22.7316\u00b0S, 119.1931\u00b0E ; 22.7351\u00b0S, 119.1856\u00b0E (WAM S59373); 22.7384\u00b0S, 119.1916\u00b0E (WAM S59377); 22.7412\u00b0S, 119.1959\u00b0E (WAM S59378); 22.7448\u00b0S, 119.1927\u00b0E (WAM S59379); 22.7412\u00b0S, 119.1959\u00b0E (WAM S59380); 22.7366\u00b0S, 119.1811\u00b0E (WAM S59381); 22.7316\u00b0S, 119.1798\u00b0E (WAM S59382). ~40km S of Port Hedland: 20.6095\u00b0S, 118.6661\u00b0E (WAM S81404). NNE of Rocklea Homestead: 22.8101\u00b0S, 117.4734\u00b0E (WAM S80990). Roy Hill Station: 22.6642\u00b0S, 119.9458\u00b0E (WAM S34588); 22.4943\u00b0S, 119.9217\u00b0E ; 22.4396\u00b0S, 119.9453\u00b0E (WAM S42837); 22.4898\u00b0S, 119.8951\u00b0E ; 22.5383\u00b0S, 119.9424\u00b0E (WAM S42927); 22.7058\u00b0S, 119.7082\u00b0E (WAM S60393); 22.6347\u00b0S, 119.9698\u00b0E (WAM S60394); 22.8174\u00b0S, 119.9473\u00b0E ; 22.5771\u00b0S, 120.0247\u00b0E ; 22.4793\u00b0S, 119.9421\u00b0E (WAM S60427); 22.5039\u00b0S, 120.0210\u00b0E (WAM S60864); 22.5566\u00b0S, 119.9700\u00b0E (WAM S60865); 22.7489\u00b0S, 119.9221\u00b0E (WAM S61067); 22.7195\u00b0S, 119.9395\u00b0E ; 22.6365\u00b0S, 119.9639\u00b0E (WAM S61070); 22.6431\u00b0S, 119.9642\u00b0E ; 22.5050\u00b0S, 119.9042\u00b0E (WAM S64448); 22.5843\u00b0S, 120.0172\u00b0E (WAM S64453).Running Waters (east of Nullagine): 21.6819\u00b0S, 121.1254\u00b0E (WAM S58050); 21.6815\u00b0S, 121.1270\u00b0E (WAM S58059). W end of Telfer Road: 21.3290\u00b0S, 121.1390\u00b0E (WAM S58044). NW of Tom Price: 22.3734\u00b0S, 117.4631\u00b0E (WAM S34566); 22.1350\u00b0S, 117.4728\u00b0E (WAM S65775); 22.1519\u00b0S, 117.5428\u00b0E (WAM S65781); 22.2997\u00b0S, 117.6378\u00b0E (WAM S65787); 22.3855\u00b0S, 117.4667\u00b0E (WAM S65788). Weeli Wolli Creek: 22.6166\u00b0S, 119.4000\u00b0E (WAM S60231). Near Wodgina Mine: 21.1831\u00b0S, 118.6569\u00b0E ; 21.2871\u00b0S, 118.8671\u00b0E (WAM S64618); 21.1789\u00b0S, 118.6463\u00b0E ; 21.1737\u00b0S, 118.6503\u00b0E (WAM S65844); 21.2383\u00b0S, 118.6519\u00b0E (WAM S65903). Wonmunna: 23.1436\u00b0S, 119.0064\u00b0E ; 23.1355\u00b0S, 119.0384\u00b0EPageBreak(WAM S65983); 23.1596\u00b0S, 118.9703\u00b0E (WAM S65979); 23.1632\u00b0S, 118.9770\u00b0E (WAM S65985); 23.1615\u00b0S, 119.0020\u00b0E (WAM S 65990); 23.1201\u00b0S, 119.0484\u00b0E (WAM S65993); 23.1287\u00b0S, 119.0904\u00b0E (WAM S 65996); 23.1283\u00b0S, 119.0736\u00b0E (WAM S65998); 23.1268\u00b0S, 119.0673\u00b0E (WAM S81032); 23.1309\u00b0S, 119.0689\u00b0E ; 23.1428\u00b0S, 119.0099\u00b0E (WAM S81053); 23.1355\u00b0S, 119.0384\u00b0E (WAM S81081); 23.1169\u00b0S, 119.0396\u00b0E (WAM S81099); 23.1255\u00b0S, 119.0797\u00b0E (WAM S81094); 23.1216\u00b0S, 119.0498\u00b0E ; 23.1393\u00b0S, 119.0182\u00b0E (WAM S81104); 23.1210\u00b0S, 119.0632\u00b0E (WAM S81109); 23.1356\u00b0S, 119.0463\u00b0E ; 23.1185\u00b0S, 119.0649\u00b0E (WAM S81114); 23.1255\u00b0S, 119.0797\u00b0E (WAM S81116); 23.1201\u00b0S, 119.0484\u00b0E (WAM S81119); 23.1331\u00b0S, 119.0154\u00b0E (WAM S81170); 23.1216\u00b0S, 119.0498\u00b0E (WAM S81178); 23.1220\u00b0S, 119.0611\u00b0E (WAM S81180). Yandi Mine: 22.8200\u00b0S, 119.2500\u00b0E (WAM S61774).Western Australia: Angelo River: This species has previously been recorded from central Australia (the southern part of Northern Territory), with a few records from the mid-west coast and northern Western Australia; northern Northern Territory; northern and north-eastern parts of Queensland and South Australia . In addiGastrocopta mussoni can be mistaken for Gastrocopta larapinta specimens  but (1) are slightly to moderately slender (2) have a higher, usually longer parietoangular tooth (3) have a larger, more strongly slanted and acutely angled columellar tooth, with its posterior edge often forming a prominent wide ridge along the columellar wall (4) quite frequently have an upper palatal tooth that is slightly  convergent with the lower palatal  . Gastrocopta mussoni very occasionally possesses a small interpalatal tooth, usually located close to the upper palatal.Cylindrical and elongate-ovate forms of Gastrocopta mussoni can be confused with Gastrocopta hedleyi  but (1) are larger (obese) when sympatric (2) have a less sigmoid lower palatal tooth and (3) have a smaller, less convergent upper palatal tooth .The typical ovate form of Gastrocopta mussoni, the larger ovate form and smaller, slender cylindrical form, and in agreement with There appears to be two size forms in Gastrocopta mussoni appears to be most common in the Pilbara. Prior to Pokryszko\u2019s Gastrocopta pilbarana Solem, 1986 was described from the Shark Bay area with an isolated record from the Chichester Range (north of Roy Hill). This species was synonymised with Gastrocopta margaretae  by Gastrocopta mussoni.The ovate form of PageBreakSome of those specimens tentatively identified as the elongate-ovate form of Gastrocoptamussoni during this study  are (1) much larger (obese) than the usual elongate-ovate form (2) have the parietoanangular tooth lower (45o) (3) usually have a supraparietal tooth and (4) quite frequently possess a small interpalatal tooth. These specimens may prove to be the somewhat variable Gastrocoptalarapinta with a small or no interpalatal tooth, but in the absence of a larger series of specimens and more detailed molecular data, we have left them as Gastrocopta mussoni.Gastrocopta mussoni identified by Poykrosko (1996) and during this study requires more work. It is probable we have lumped the slender form of Gastrocopta larapinta from Kalgan Pool  withcylindrical Gastrocopta mussoni.The nature of many cylindrical 5.Gastrocopta pilbarana20.7069\u00b0S, 115.4194\u00b0E (WAM S59641). Cape Range No. 2 Deep Well: 21.9500\u00b0S, 114.0333\u00b0E (WAM S14132). Cape Range (cave): 22.1166\u00b0S, 113.9833\u00b0E (WAM S34394); 22.1500\u00b0S, 114.0000\u00b0E ; 22.0833\u00b0S, 113.9833\u00b0E (WAM PageBreakS34396); 22.1833\u00b0S, 113.9833\u00b0E (WAM S80955). Exmouth rubbish tip: 21.9166\u00b0S, 114.1167\u00b0E (WAM S60408)Western Australia: Barrow Island: This species is recorded from the Cape Range and from an isolated site on Barrow Island .Gastrocopta sp. CW1 are easily recognized by their (1) small size (2) very solid, non-lamellate columellar tooth that projects horizontally from the columellar wall (shelf-like), slightly drooping at anterior end (3) long sigmoid lower palatal tooth (4) large, transverse upper palatal tooth (5) presence of a suprapalatal tooth.Shells of Gastrocopta recondita  but in a later review, Gastrocopta stupefasciens.Gastrocopta sp. CW1. is very similar to Gastrocopta stupefaciens and Gastrocopta recondita but (1) is smaller (2) has longer apertural barriers and (3) has a thick, solid, non-lamellate columellar tooth and is here within regarded as a new species. Some of Solems` Gastrocopta recondita specimens from limestone outcrops near Katherine (station WA-685) and Lake Argyle (station WA-248) have a similar columellar tooth structure and their relationship to Gastrocopta sp. CW1 needs further work.Gastrocopta pilbarana (which was later synonymised with Gastrocopta margaretae) but those specimens were in fact Gastrocopta sp. CW1. She suggested that although this population of snails was ameliorated with the limestone caves of the Cape Range, although it was not generally cavernicolus. The accumulation and breakdown of leaf litter within caves combined with calcareous rocks was deemed advantageous for snails. Gastrocopta recondita. The few records of Gastrocopta sp. CW1 from the limestone dominated Barrow Island and Cape Range show similar requirements.6.http://species-id.net/wiki/Gastrocopta_servilisPupa servilisPupa microsomaPupa lyonsianaFr. 5,713.Gastrocopta lyonsianaGastrocopta microsoma (Tapparone-Canefri), Gastrocopta servilisnear Matanzas, Cuba.PageBreak20.7385\u00b0S, 116.8357\u00b0E .Karratha area: This species has previously been recorded from just north of Broome (Quondong Point) across northern Australia to mid-eastern Queensland and offshore islands . In addiGastrocopta servilis are easily distinguished from other Pilbara Gastrocopta by their (1) strongly rounded whorls (2) short, straight columellar tooth which is perpendicular to the mid-columellar wall (3) very long angular tooth which is fused with the parietoangular tooth (4) weak to absent basal tooth and (5) weak to absent upper palatal tooth.The shells of Gastrocopta servilis has been a recent introduction to the residential gardens of Karratha.Gastrocopta  as well as 16 Genbank sequences of several American Gastrocopta species that stem from the study of Vertigo spp. and Pupilla spp. were used as out-group to root the trees. Maximum Likelihood analyses of the COI and 16S fragments resulted in identical tree topologies  in COI as well as on average 1% (max. 2%) in 16S in all Australian species but Gastrocopta margaretae (Tables 2\u20133). In Gastrocopta margaretae intraspecific genetic distances were found to be significantly higher than in any other Australian species (16% in COI and 5.3% in 16S). Apart from Gastrocopta margaretae, the intraspecific divergence was about an order of magnitude smaller than the observed interspecific distances of 5\u201326% (on average 18%) in COI and 2\u201314% (on average 9%) in 16S. Only in Gastrocopta margaretae did the amount of intraspecific genetic differentiation overlap with the range of interspecific genetic distances.Two mitochondrial gene fragments, COI and 16S, have been analysed. The data sets contained 27 sequences of Western Australian pologies \u20137. All sGastrocopta species recorded here (except Gastrocopta sp. CW1) have relatively large distributional ranges. Although limited, the molecular data supports PageBreakPageBreakPageBreakthe shell-based delineation of the six species recognized herein. The molecular data also confirms the large distributional ranges of Gastrocopta larapinta and Gastrocopta mussoni by including samples from areas that are about 100 and 550 kilometres apart, respectively. The apparently widespread distribution of Gastrocopta species is probably due to the common ability in which a single Gastrocopta adult can self-fertilize their eggs and establish a new population  might represent relictual populations from the Miocene. Both Cape Range and Barrow Island contain moist, well sheltered limestone gorges and caves.Some of the species PageBreakOther recorded species represent a range extension from the red centre. These include Gastrocopta mussoni and Gastrocopta larapinta which are common in the Pilbara. This is not suprising given their affinity to arid or semi-arid environments, which persist throughout much of the Pilbara. Future collecting will no doubt show a mostly continuous distribution for these species between the Pilbara and the red centre.Gastrocopta margaretae (2) the relationship of Gastrocopta sp. CW1 to similar specimens in the Kimberley region (3) the morphological separation of Gastrocopta larapinta and Gastrocopta mussoni.The present CO1 and 16S molecular data set, although small  mostly supports the taxonomic revision of Gastrocopta species, which are separated from each other by interspecific pair-wise Gastrocopta species are also lower than the genetic distances found in other Western Australian land snails, such as the Camaenidae. In this group interspecific sequences in COI were usually larger than 6% (e.g., The Australian species are less well differentiated by means of evolutionary divergence than the American 6% e.g.,  (16S disGastrocopta species, and often this is associated with variation in apertural barrier structure. This can make separation of species difficult, particularly Gastrocopta larapinta, Gastrocopta hedleyi and Gastrocopta mussoni which share similar apertural barrier structures. It is advisable to collect a large series of individuals so the wide variation in apertural barrier structures can be seen.There appears to be tremendous variation in shell shape and size between and within populations of some Gastrocopta hedleyi, Gastrocopta larapinta, Gastrocopta. sp. CW1 and Gastrocopta servilis are recorded from the Pilbara region for the first time. Gastrocopta servilis has been a recent introduction to the residential gardens of Karratha. Gastrocopta hedleyi, Gastrocopta larapinta and Gastrocopta mussoni were shown to be common across the Pilbara. Gastrocopta sp. CW1may represent an undescribed species.In summary,"}
+{"text": "Crocus sativus L.) is one of the most important and expensive medicinal spice products in the world. Because of its high market value and premium price, saffron is often adulterated through the incorporation of other materials, such as Carthamus tinctorius L. and Calendula officinalis L. flowers, Hemerocallis L. petals, Daucus carota L. fleshy root, Curcuma longa L. rhizomes, Zea may L., and Nelumbo nucifera Gaertn. stigmas. To develop a straightforward, nonsequencing method for rapid, sensitive, and discriminating detection of these adulterants in traded saffron, we report here the application of a barcoding melting curve analysis method (Bar-MCA) that uses the universal chloroplast plant DNA barcoding region trnH-psbA to identify adulterants. When amplified at DNA concentrations and annealing temperatures optimized for the curve analysis, peaks were formed at specific locations for saffron (81.92\u00b0C) and the adulterants: D. carota (81.60\u00b0C), C. tinctorius (80.10\u00b0C), C. officinalis (79.92\u00b0C), Dendranthema morifolium (Ramat.) Tzvel. (79.62\u00b0C), N. nucifera (80.58\u00b0C), Hemerocallis fulva (L.) L. (84.78\u00b0C), and Z. mays (84.33\u00b0C). The constructed melting curves for saffron and its adulterants have significantly different peak locations or shapes. In conclusion, Bar-MCA could be a faster and more cost-effective method to authenticate saffron and detect its adulterants.Saffron ( Crocus sativus L. is a perennial triploid sterile herb of the family Iridaceae that has purple flowers and 3-branched style [ed style . Red-dried style \u20136. Saffred style . In 2009ed style . The wor Carthamus tinctorius L. and Calendula officinalis L. flowers, Hemerocallis L. petals, Daucus carota L. fleshy root, Curcuma longa rhizomes, Zea may L., and Nelumbo nucifera Gaertn. stigmas [ Calendula, Carthamus flowers, or ground turmeric rhizome. The addition of calibrated amounts of other plant materials rich in carotenoids may easily go undetected [Due to its high market value, perceived value, demanding production, and premium price, attempts have been made to adulterate saffron with various substances with similar color and morphology to increase the volume and weight of commercial lots. The most frequently incorporated materials are stigmas \u201312. The  stigmas . Chemica stigmas , 15, hig stigmas , 17, nea stigmas , 19, and stigmas . These m stigmas , 21\u201323.  stigmas , 25. Fordetected , 26. TheMolecular markers can detect differences at the DNA level and offer numerous advantages over conventional phenotype-based alternatives because they are stable and detectable in all tissue types, regardless of the growth environment, development state, or differentiation status . The adv rbcL, matK, rpoB, and rpoC1 genes, the noncoding atpF-atpH, psbK-psbI, trnH-psbA, and trnL-F spacers, and the nuclear internal transcribed spacer (ITS2), have been proposed to serve as DNA barcodes for identifying flowering plants [ rbcL, matK, and trnH-psbA and ITS2 fragments have been recommended by CBOL (Consortium for the Barcode of Life) for the barcoding of seed plants and were successful at discriminating more than 79 percent of plant groups [DNA barcodes are short orthologous DNA sequences that are used to identify species. By using a standardized DNA region as a tag, DNA barcodes provide a rapid, accurate, and automatable identification method. It has been widely used in plant identification, biodiversity assessment and conservation, adulteration detection, and traditional medicine authentication \u201337. Diffg plants , 39. TheMelting curve analysis is a fast and sensitive method for differentiating PCR production by fluorescence monitoring of the melting curve of the double-stranded DNA that is intercalated by the dye SYBR Green I in a real-time PCR system . MeltingHerein, we describe a new application of SYBR Green melting curve analysis that is coupled with DNA barcoding and uses universal regions for the rapid detection and adulteration measurement of saffron and their commercial food products. Bar-MCA distinguished saffron and its different adulterants species and detected trace adulterants in commercial products. C. sativus samples were purchased from herb markets in China, including two samples from the Anguo herb market, one sample from the Bozhou herb market, and five batches from the TongRenTang pharmacy. Three C. sativus samples marketed as whole stigmas were purchased from Iran. Another six unidentified commercial samples were collected from the Shanghai Traditional Chinese Medicine Co. Ltd.  and the Anguo herb market . Twenty-two adulteration samples, such as D. morifolium, C. officinalis, C. tinctorius, N. nucifera, H. fulva, and Z. mays, were purchased from herb markets, as described in  D. carota and Z. may were obtained from a supermarket and frozen at \u221280\u00b0C for DNA extraction. All of the collected samples were identified by a taxonomist, except for 6 unidentified C. sativus commercial samples . The total genomic DNA was isolated from fresh and dried material as previously described using the modified CTAB method . The ext\u03bcL on an ABI 7500 real-time PCR system . The reaction mixture contained 10\u2009ng of genomic DNA, 10\u2009\u03bcL of 2x SYBR Green Premix Ex Taq , 0.2\u2009\u03bcL of 10\u2009mM forward and reverse primers , and 0.4\u2009\u03bcL of 50x ROX reference Dye II . The five pairs of candidate barcoding primers and their real-time PCR reaction conditions are shown in PCR amplification, DNA melting, and fluorescence signal collection were performed in a total volume of 20\u2009trnH-psbA, rbcL, matK, and ITS2) and a trnL-F spacer fragment were selected to authenticate saffron and its adulterants by analysis of the melting curve shapes and the melting temperature (Tm) of the amplicons. The barcoding fragments were amplified with the primer pairs psbAF/trnHR, 1F/724R, 3F/1R, ITS2/ITS3, and trnL/trnF, respectively. The fragments that could discriminate between saffron and all of its adulterants were selected for further analysis. The primer sequences and PCR conditions are shown in Four CBOL-recommend DNA barcoding fragments , 0.2\u2009\u03bcL of 10\u2009\u03bcM forward and reverse primers, 1\u2009\u03bcL of 10\u2009mM dNTP stock, and 1 unit of Ex Taq polymerase . PCR amplification was performed in a GeneAmp PCR 9700 system  programmed for 5\u2009min at 95\u00b0C, 35 cycles of 30\u2009s at 95\u00b0C, 30\u2009s at 58\u00b0C, and 40\u2009s at 72\u00b0C and a final extension for 5\u2009min at 72\u00b0C. The PCR products were confirmed by electrophoresis in a 1.5% agarose gel and directly visualized with ethidium bromide under UV light. The PCR products were directly sequenced in an automated ABI 3730 sequencer  by Beijing Genomics Institute. The sequences were aligned with the ClustalW program. The GC content and predicted melting temperatures were calculated by OligoCalc, an online program [The botanical origins of all authentication samples were confirmed by amplification and sequencing of the program . trnH-psbA fragments of the unidentified sample CsA1 were subcloned into the pMD19-T vector  for sequencing, and 3 positive clones were screened and sequencing using an ABI 3730 sequencer. Sequences were identified by the web-based MegaBLAST algorithm in the NCBI nucleotide nr/nt database by the default settings.Amplified rbcL, matK genes, the noncoding trnH-psbA, the trnL-F spacer, and the nuclear internal transcribed spacer (ITS2) were used for the amplification of saffron and its adulterants by a rapid real-time PCR procedure. The melting curves were analyzed by the ABI 7500 version 1.4 software. The results show that the melting curves of saffron and its adulterants generated by psbAF/trnHR, 1F/724R, ITS2/ITS3, 3F/1R, and trnL/trnF were all single peaks. The difference between the Tm value of saffron and that of its adulterants ranged from 0.6 for the primer pair ITS2/ITS3 to 1.2 for psbAF/trnHR. When amplified by the primer pair psbAF/trnHR, distinct melting curves and Tm values were found for D. morifolium, C. officinalis, C. tinctorius, N. nucifera, H. fulva, Z. mays, D. carota, and saffron  were found for the saffron melting curve when the DNA concentration ranged from 2.5 to 20\u2009ng/\u03bcL. The melting curve was not different when the DNA concentration was 5\u201310\u2009ng/\u03bcL. This concentration was selected as the optimal DNA concentration.The effect of DNA concentration on the melting curve was also considered. Saffron DNA was randomly selected. The concentration was adjusted to 100\u2009ng/increase . No sign trnH-psbA PCR products had the same sharp melting curve, and the average Tm of the saffron trnH-psbA fragment was 81.92\u00b0C, with a standard deviation of 0.20 and relative standard deviation (RSD) of 0.24%  and N. nucifera (80.58\u00b0C) melting curves fulfilled this characteristic. From this result, we can infer that CsA1 may be adulterated with D. carota or N. nucifera. However, because the melting curve depends on the GC content and length and sequence of the PCR product [Tm will shift in a mixture sample  or C. officinalis (79.62\u00b0C) is probable. Under these circumstances, the sharpness of the melting curve can be used as supplementary means to authenticate saffron. The melting curve of the N. nucifera trnH-psbA fragment had a secondary peak at approximately 75\u00b0C. The unidentified sample CsA1 had the same secondary peak. The results imply that CsA1 may be adulterated with N. nucifera. To further confirm the results, trnH-psbA sequences retrieved from the unknown sample CsA1 were cloned into a PMD19-T vector for sequencing. Three positive clones were randomly selected and sequenced. MegaBLAST results indicate that the 2 clones were 100% identical with C. sativus psbA gene (GenBank: EU110147.1) and the 1 clone was similar to the N. nucifera complete chloroplast genome (GenBank: FJ754270.1) at 99% nucleotide similarity level. The agreement between the sequencing results and melting curve analysis confirms that the sample CsA1 was adulterated with N. nucifera.To test the efficiency of the method for authenticating unknown commercial samples of saffron, 6 commercial saffron samples were tested using barcoding melting analysis with the psbAF/trnHR primers. The results show that 5 saffron samples from Beijing, Shanghai, and Anguo were authentic saffron and that 1 sample from the Anguo herb market (CsA1) was fraudulent . To conf product , the melTm values for 5 barcode fragments of saffron and its adulterants. A primer that can discriminate between saffron and adulterants based on Tm was selected and evaluated using authentic saffron material at an optimized concentration and annealing temperature to determine the precision and reproducibility of the method.The precise identification of plant species is crucial for agriculture, industry, and consumers. Saffron is an important commercial medicinal plant that must be authenticated. However, the detection of fraudulent saffron is a challenging task because the physical, chemical, and classical morphological properties are not always easily identifiable, particularly when the sample is finely ground or when the spice is added to a seasoning mixture . The preTm of the product [Tm of specific PCR products [Compared with current sequence-based species discrimination methods, melting curve analysis is a very promising technique, particularly in terms of costs and time. DNA melting was observed as a sudden decrease in the fluorescence of the dsDNA dye SYBR Green I as a sample was heated through the  product . When th product . Meltingproducts . One minproducts . However trnH-psbA was selected to authenticate the saffron and detect its adulterants by barcoding melting curve analysis. The plastid trnH-psbA intergenic spacer, which was proposed by Kress et al. [Tm. Therefore, the Tm could be predicted by the analysis sequence from public databases, such as NCBI , BOLD (Barcode of Life Data System) [ trnL-F, trnH-psbA, rbcL, matK, and ITS2 barcode sequences for saffron and its adulterants from public databases. We then aligned and unified the sequences with the clustalW program using the BioEdit software to unify the sequences from different labs that used different primers. When the Tm was calculated by OligoCalc, the Tm values for all 5 barcodes were different for saffron and its adulterants. matK presented the largest temperature difference between H. fulva and D. morifolium. trnL-F had the maximum temperature difference between N. nucifera and Z. mays  , or MMDB System) . We obta Z. mays . HoweverL-F>rbcL , 49. Altriations  and affeTm predictions for saffron and its adulterant are similar to the experimental Tm results. There is an approximately 2\u00b0C maximum deviation between the theoretical values and the experiment result for the adulterant D. carota, indicating that the Tm calculated from the sequence can serve as a preliminary reference in determining which primers for screening. Barcodes with large Tm differences could be used to prioritize confirmation experiments to reduce the experimental work.The  C. tinctorius and C. officinalis flowers, Hemerocallis L. petals, D. carota fleshy root, C. longa rhizomes, Z. may, or N. nucifera stigmas. The real-time PCR-based method described in the present study is a powerful rapid and sensitive nonsequencing authentication technology that can detect adulterants in traded saffron. By amplification with the barcoding primer pair psbAF/trnHR and performing melting curve analysis, saffron was distinguished from the adulterants or detected in mixtures based on its Tm. This technique could detect the presence of an expected plant material and adulterant materials in close-tube reactions. The method could be applied to other medicinal plants contaminated with adulterants.Saffron is a very expensive medicinal spice product and is often adulterated by incorporation of materials such as"}
+{"text": "DNM1 mutation and rupture of the cranial cruciate ligament are both common syndromes in the Labrador retriever breed. A cohort of 313 Labradors was recruited based on their CCLR status and were subsequently genetically tested for EIC. Epidemiological aspects of the cohort were also described, including sex, sterilization status, and age at sterilization.Exercise-induced collapse (EIC) due to p =0.357), although the sample cohort was not of sufficient size to entirely rule out an association. A significant difference (p\u2009=\u20090.031) was observed in the sex distribution of dogs affected with CCLR compared to those without CCLR. An increased number of female CCLR cases were observed compared to the number of female controls; male CCLR cases and controls were approximately the same number. When CCLR status was examined in each sex, no significant differences were observed between those that were sterilized and those that weren\u2019t. However, for female dogs that were sterilized, CCLR cases were significantly higher in dogs sterilized at one year of age or younger compared to those sterilized when over the age of one year ; for males, this finding was suggestive, but not statistically significant .No sex difference was observed in dogs susceptible to EIC (homozygous for the mutant genotype) compared to dogs not susceptible to EIC . No evidence for association was detected between CCLR status and EIC status  may increase the risk of Labradors developing CCLR later in life . These results should be considered preliminary and require confirmation in larger populations of Labrador retrievers. Tear or rupture of the cranial cruciate ligament (CCL) in dogs is equivalent to humans tearing their anterior cruciate ligament (ACL), a knee ligament. CCL rupture (CCLR) in dogs can occur from trauma, but may also have genetic risk factors, because some breeds seem to be predisposed, including the Labrador Retriever. The definitive cause of CCLR has not been determined, but probably has many factors.DNM1 gene. A genetic test can determine if a collapse episode is due to the DNM1 mutation and predicts which dogs are susceptible to this form of collapse. During an EIC episode, a dog will usually first lose control of its hindlimbs, and may stumble while trying to continue running, all of which could stress the knee joint. Further, the DNM1 mutation interferes with nerve signal transmission, which might impact the body\u2019s ability to protect the integrity of joints, such as the knee. We wondered if EIC and CCLR, which are both common in the Labrador retriever breed, might be related. Therefore, we assembled a group of Labradors that were carefully screened to either be cases (have torn their CCL) or controls  and subsequently genetically tested them for EIC. In addition, this was a good opportunity to describe the sex, sterilization status, and age-at-sterilization for this group of dogs.Labrador retrievers affected with exercise-induced collapse (EIC) have two defective copies of the Our results show that dogs with CCLR do not have EIC in a markedly higher frequency compared to dogs without CCLR. Therefore, if both syndromes are observed in the same dog, it\u2019s probably just a coincidence due to how common both conditions are in the breed. From the epidemiological data, we observed a higher proportion of females in the CCLR cases compared to males. When we looked only at sterilized dogs, and divided them by what age they were sterilized, we saw a significantly higher proportion of CCLR cases in those dogs that were spayed or neutered early in life (before 1 year of age) in females. Ideally, these epidemiological findings should be confirmed in a larger population of dogs.DNM1) [Exercise-induced collapse (EIC) and cranial cruciate ligament rupture (CCLR) are often observed in active Labrador retrievers. Dogs with EIC are normal when resting, but can manifest a \u2018wobbly\u2019 gait, which typically progresses to loss of control (flaccid paraparesis) of the hindlimbs, after a short duration of strenuous exercise . The colDNM1) . DependiDNM1) , indicatCranial cruciate ligament rupture (CCLR) is a significant cause of pelvic limb lameness , with afDogs experiencing EIC-specific collapse lose coordination, often use a crouched posture (knee flexion) with their pelvic limbs , and mayNorth American dogs were recruited for this study as either CCLR cases or controls, with no consideration to sex or sterilization status, and were subsequently tested to determine their EIC genetic status. Therefore, no phenotype information was obtained regarding any dogs\u2019 collapse status. After informed client consent was obtained, and each dog\u2019s purebred Labrador retriever status was established (either by registration in or eligibility for registration in the American Kennel Club or the Canadian Kennel Club), case or control status was determined by stifle joint palpation by a board certified veterinary surgeon. The vast majority of CCLR cases (>90%) were defined by surgical confirmation of CCL tear, either unilateral or bilateral, with the remaining cases defined via physical exam, stifle palpation, and radiographs. Controls were defined as greater than 7 years of age  with no DNM1 exon 6, which contains the EIC mutant allele. PCR products were digested with restriction enzyme SmlI and visualized on 2% agarose gels as previously described [DNA was obtained either from whole blood or cheek swabs using standard extraction methods. Each DNA sample was calibrated to a standardized concentration and subjected to PCR amplification of p-value less than or equal to 0.05 was considered significant.The prevalence of EIC susceptibility in the entire cohort was calculated. Prevalence of CCLR in the Labrador breed could not be accurately calculated with this study due to ascertainment bias in recruiting for affected dogs. Descriptive statistics were performed for the distributions of sex for CCLR cases versus controls and for EIC genetic susceptibility; descriptive statistics were also performed for sterilization status and age at sterilization for CCLR cases versus controls. A Fisher\u2019s exact test was used to test for association between sex and CCLR, sex and EIC, EIC and CCLR, sterilization status and CCLR for both sexes, and age at sterilization and CCLR for both sexes; odds ratios (OR) with a 95% confidence interval (CI) were calculated for each test. In addition, the test for the differences in proportions was used to compute the 95% confidence intervals on the EIC distribution in CCLR cases versus controls, and the Agresti-Coull method  was usedp\u2009=\u20090.031, OR 1.65, 95% CI 1.02\u20132.66) from the sex distribution of dogs without CCLR.There were 313 Labrador retrievers recruited to the study; 174 were CCLR cases and 139 were CCLR controls  from the sex distribution of dogs without EIC . This is consistent with an autosomal mutation; DNM1 is located on canine chromosome 9 [Based on their genotyping data, 11 dogs (3.5%) were susceptible to EIC (EE), 91 dogs 29.0%) were EIC carriers (EN), and 211 dogs (67.5%) were homozygous normal (NN). The sex distribution of dogs susceptible to EIC  (Table\u00a09.0% werep\u2009=\u20090.357) association was found between a diagnosis of CCLR and an EIC-susceptible genotype. However, the odds ratio was 2.18, with a 95% confidence interval of 0.51 to 13.0, indicating that the dataset does not allow definitive exclusion of association between these two conditions. Another way of looking at the data is to test for difference in the proportions: 4.6% of all CCLR cases had EIC-susceptible genotypes, while 2.2% of all CCLR controls had EIC-susceptible genotypes, a difference of 2.4%. The test for differences in proportions here gives a p-value of 0.3922 (95% CI -0.021\u20130.070).2.5% of the dogs in the study had both CCLR and EIC. Possible association between CCLR and EIC was assessed using the Fisher\u2019s exact test . Among males, 116 (80.6%) were neutered (61 CCLR cases and 55 controls) and 28 (19.4%) were intact (10 CCLR cases and 18 controls). The CCLR case distribution among males (neutered versus intact) was also not statistically different .Sterilization status was available for 311 of the 313 dogs , with almost 87% of spayed female CCLR cases having been sterilized at or before one year of age. Among neutered male CCLR cases, 31 were neutered at or before one year, while only 4 were neutered when older than one year. Among neutered male controls, 30 were neutered at\u2009\u2264\u20091 year of age, while 12 were neutered at\u2009>\u20091 year of age. This was not statistically different .When accounting for a dog\u2019s age at sterilization, differences between CCLR cases and controls in the female cohort became more apparent. Information regarding the dog\u2019s age at sterilization was available for 185 dogs Table\u00a0. Among sp\u2009=\u20090.357, Fisher\u2019s exact test), and, if they are associated, that CCLR is not associated with large increases in EIC occurrence. The test for differences in the proportion of EIC-susceptibility in CCLR cases versus CCLR controls (a 2.4% difference was observed) tells us that this difference could go as much as 2% in one direction and 7% in the other direction, and this is not likely to be a clinically significant difference.Dogs homozygous for the EIC mutation were identified in 8 of 174 CCLR-affected Labradors  and 3 of 139 CCLR-normal Labradors , which is not a significant difference. Because the number of dogs affected with EIC in the overall pet population of Labradors is low, it is not surprising that we only detected a small number of dogs concomitantly affected with EIC susceptibility and CCLR. It was entirely unknown prior to this study how frequently dogs would be concomitantly affected with EIC and CCLR, therefore several hundred were recruited. Ultimately, though, this study was under-powered to draw strong conclusions about association of EIC and CCLR, due to the relative rarity of dogs with both conditions. This sample cohort demonstrates that CCLR and EIC-susceptibility might be unrelated . Because our entire cohort was recruited based on CCLR status, it is inappropriate to use this group to calculate prevalence of CCLR in the Labrador breed. However, since these dogs were only subsequently tested for EIC, and they were not recruited based on collapse phenotype, this represents an opportunity to examine EIC frequency in the breed. Our finding that 3.5% of 313 dogs were EE is consistent with the overall-breed frequency of 3% as previously reported [Actual collapse status of the 11 EIC-susceptible dogs is unknown due to the lack of follow-up investigation, which was not undertaken due to the post hoc nature of the EIC testing and the fact that penetrance of EIC-susceptible dogs actually experiencing collapse has been examined in other work. The EIC-associated mutation is not fully penetrant; previous work has shown that dogs homozygous for the EE allele and therefore collapse-susceptible can be phenotypically normal and not experience collapse. One study reported 9% of EE dogs had no history of collapse , while ap\u2009=\u20090.031, OR 1.65, 95% CI 1.03\u20132.66), it may not be clinically significant. With hundreds of dogs in the study, a more precise calculation of statistical significance is possible; this can allow detection of smaller  differences. The group of CCLR cases was 59% female while only 47% of the CCLR control dogs were female; given the confidence interval for these proportions , there could be almost twice as many female CCLR cases as female CCLR controls in the global population of Labradors retrievers. This difference, if observed, likely would have clinical significance. However, one could argue that the confidence interval also includes the possibility of 50% case:50% control for both sexes. In effect, these findings can only suggest that female dogs may be predisposed to CCLR.In our cohort, which was recruited without respect to sex or sterilization status, a sex distribution difference was observed between dogs with CCLR versus dogs without CCLR. However, while this was statistically different  rupture in humans is three times higher in females compared to males . There ap\u2009=\u20090.485, OR 2.25, 95% CI 0.41\u201422.89; Males: p\u2009=\u20090.141, OR 0.503, 95% CI 0.19\u20141.27). A more balanced population of intact dogs to sterilized dogs would allow drawing of stronger conclusions; as it stands, the confidence intervals, particularly with the females, are wide.Human orthopedic disease studies typically do not need to consider the effects of lost gonadal hormones , whereas the majority of US dogs are sterilized, often at a young age, and there has been concern that the early loss of gonadal hormones may influence orthopedic disease development later in life. The removal of gonadal hormones can delay long-bone growth plate closure , 19, whiSince there were so few intact dogs in the present study, the subset of all sterilized dogs were examined for the age at which they sterilized, and whether this was associated with CCLR status. Differences were observed between those sterilized at a young age (\u2264 1 year) versus an older age (>1 year). For both sexes, more CCLR cases were observed in dogs sterilized at a young age compared to those sterilized at an older age, and these differences were statistically significant for the females, though they were not quite statistically significant in the males.Other studies have also examined the age at sterilization of CCLR cases. In one study, which looked exclusively at Golden Retrievers, a significantly higher percentage of both male and female early-neutered (sterilized at\u2009<\u200912 months) dogs had CCLR compared to intact dogs and to late-neutered (\u2265 12 months) dogs . AnotherWhile it is tempting to simply conclude that sterilization at a younger age predisposes a dog to CCLR, and the present cohort supports such a conclusion, it should not be ignored that there were many CCLR controls, both male and female, that were similarly neutered at a young age. Also, it is important to note that in this study typically the owner, and not a medical record, provided the age at the time of their pet\u2019s sterilization, introducing a potential inaccuracy. In addition, if there is a relationship between age of sterilization and CCLR occurrence, there is no current biologic explanation for a dichotomous  relationship. It is difficult to draw firm conclusions regarding what impact sterilization, at any age, has on development of CCLR with only this cohort, but, taken together with results from previous studies, these data suggest that early sterilization might be a risk factor for eventual development of CCLR. Prospective evaluation of this association would address potential errors or bias in data collection and allow for a more precise evaluation of the relationship.The lack of follow-up information on these dogs is a limitation of this study. Without lifetime follow-up, it is possible that a subset of any of the controls (sterilized or intact) may have developed CCLR at a time after their enrollment in the study. Additionally, a subjective body condition score (BCS) was not consistently or uniformly assessed in this cohort of dogs. Excess weight has been suggested to contribute to CCLR , 14, butFinally, given the size of the present cohort , these results should be considered preliminary, and in need of further confirmation in larger populations. Such limitations deserve to be addressed in future work attempting to better understand the risks and causes of CCLR in Labrador retrievers, which hopefully will shed further light on what risk, if any, is truly contributed by EIC status, sex, sterilization status, and age at sterilization.DNM1 mutation homozygosity which might cause a dog to collapse during exercise [per se is not a risk factor for development of CCLR, while early age at sterilization may increase a dog\u2019s risk of developing CCLR, particularly for females. The finer points of these epidemiological aspects are beyond the scope of this study and deserve further investigation, with the addition of BCS data and even genetic data, in light of the multifactorial nature of CCLR.We did not identify a significant association between a diagnosis of CCLR and having the EIC-susceptible genotype. There are reasons other than exercise  any of w"}
+{"text": "Penile injuries are relatively uncommon[1]. The crush injury mediated by entrapment of the skin between the teeth and fastener of a zipper mechanism has been described. It is seen more commonly in uncircumcised children than adults[4]. A number of treatment methods have been mentioned in the literature. An adult case presentation and novel method of management using two small needle holders is illustrated."}
+{"text": "A major challenge facing the visual system is how to map such a large dynamic input range into its limited output range, so that a signal is neither buried in noise in darkness nor saturated in brightness. A fly photoreceptor has achieved such a large dynamic range; it can encode intensity changes from single to billions of photons, outperforming man\u2010made light sensors. This performance requires powerful light adaptation, the neural implementation of which has only become clear recently. A computational fly photoreceptor model, which mimics the real phototransduction processes, has elucidated how light adaptation happens dynamically through stochastic adaptive quantal information sampling. A Drosophila R1\u2013R6 photoreceptor's light sensor, the rhabdomere, has 30,000\u00a0microvilli, each of which stochastically samples incoming photons. Each microvillus employs a full G\u2010protein\u2010coupled receptor signalling pathway to adaptively transduce photons into quantum bumps . QBs then sum the macroscopic photoreceptor responses, governed by four quantal sampling factors (limitations): (i) the number of photon sampling units in the cell structure (microvilli), (ii) sample size (QB waveform), (iii) latency distribution , and (iv) refractory period distribution (time for a microvillus to recover after a QB). Here, we review how these factors jointly orchestrate light adaptation over a large dynamic range.Light intensities (photons\u00a0s GPCRG\u2010protein\u2010coupled receptorLIClight\u2010induced currentQBquantum bumpR1\u2013R6six outer photoreceptorsRandPamrandom photon absorption modelTRPtransient receptor potentialTRPLtransient receptor potential likePLCphospholipase\u00a0C\u20131\u00a0\u03bcm\u20132) in a natural scene can span several orders of magnitude from shaded foliage to direct sunlight, in contrast to a photoreceptor's 30\u201360\u00a0mV electrical output range  from the environment and transduces them into its electrical signals (output). For diurnal animals, a critical challenge facing phototransduction is the huge difference between the input and output ranges. Light intensities , and we exclude any subsequent longer term adaptations.A), including landscapes against bright skies, window\u2010lit interiors with daylight outside and backlit objects .The dynamic range of a natural scene covers light intensities from the darkest shadows to the brightest reflections. Light intensity can vary many thousandfold in typical sun\u2010and\u2010shade scenes Fig.\u00a0A, incluComposite imaging techniques can be used to enlarge the dynamic range of cameras. For example, multiple exposures can be combined into a single picture, or, similarly, many graduated filters can be used for the picture integration  , with parameters fitted to reproduce neural responses only for explicit stimulus conditions. The predictive power of such models is very limited, beyond the conditions in which the models were tested. To study the emergent properties of complex adaptive systems, such as living cells, it seems better to use bottom\u2010up biomimetic approaches, whereupon a computational virtual cell model is constructed to replicate its real counterpart's ultrastructure and signalling.Drosophila R1\u2013R6 photoreceptor cell. Akin to a real R1\u2013R6, this model integrates the parallel outputs of 30,000\u00a0G\u2010protein\u2010coupled receptor (GPCR) signalling pathways inside 30,000\u00a0microvilli  A). Its output is the absorbed photon sequences of each microvillus  distributes the incoming photons to the 30,000\u00a0microvilli following Poisson statistics Fig.\u00a0A. Its o(ii)B): stochastic biochemical reactions inside a microvillus transduce the absorbed photon sequences to QB sequences Summation Model: QBs from 30,000\u00a0microvilli integrate to the macroscopic light\u2010induced current (LIC) response.(iv)C). This module transduces LIC into voltage response by reproducing the voltage\u2010gated K+ conductance dynamics on the photon\u2010insensitive membrane . Parameters were not automatically fitted, but were fixed to their physiologically measured or pre\u2010estimated values. Remarkably, by comparing the response waveforms, signal\u2010to\u2010noise ratios and information transfer rates of the model simulations to the corresponding intracellular recordings, it has become clear that the model generates realistic voltage output to all tested light intensity time series  without parameter refitting, even when the statistical structure of the stimulus changes : (i) the number of sampling units (microvilli); (ii) sample size ; (iii) latency distribution  and (iv) refractory period distribution .The model has helped us to elucidate how quantal information sampling underlies light adaptation in a fly photoreceptor (Song A and B). A QB is considered a sample of light, and its size and likelihood reflect the stimulus intensity.A QB is the product of a successful photon transduction by a microvillus Fig.\u00a0A and B.B)  , sample incoming photons. QBs from all microvilli integrate the macroscopic response.2+ influx feeds back to multiple molecular targets in the microvillus, governing the QB termination and regulating the QB sizes /transient receptor potential like (TRPL) channels in all microvilli. Brightening increases Ca2+ influx and photoreceptor depolarization, which strengthen the global feedbacks, shrinking QBs and compressing the macroscopic response more  with brightening by both local and global feedback mechanisms. Light\u2010induced CaThe basic rules about how these quantal factors curb light information sampling are as follows:We now assess how these rules jointly modulate a fly photoreceptor's output dynamics to light intensity time series.et\u00a0al. et\u00a0al. et\u00a0al. et\u00a0al. The light signal is quantal, with information carried by discrete photon arrivals. What is the quantal limit of vision? Or, how many photons must an eye capture for its beholder to see light? This question was raised already at the beginning of the 20th century Bialek, . Early pA)  activates the G protein, catalysing the exchange of GDP for GTP. This in turn produces the active G\u03b1*\u2010GTP. G\u03b1*\u2010GTP binds to PLC to form a G\u2010protein\u2010PLC complex, which hydrolyses phosphatidylinositol 4,5\u2010bisphosphate (PIP2) into diacylglycerol and inositol 1,4,5,\u2010trisphosphate  light\u2010sensitive channels   can be used to simulate these molecular dynamics Fig.\u00a0B (Song B), with the resultant QB being smaller than the sum of those produced independently  . Multiple rhodopsins can be activated, but only one QB is produced  , since a typical fly photoreceptor has tens of thousands of microvilli  , together with the photon arrival rate , jointly determines the microvillar QB production rate. In dim conditions , photon arrivals are sparse. Therefore, photon hits to an individual microvillus are very rare  , photon arrivals are so frequent that the refractory period effectively sets the maximum QB rate (sample rate) .Furthermore, model simulations have elucidated how refractoriness contributes to light adaptation . The response first rapidly decays and then plateaus , even when the stimulus stays the same (light step). The fast adaptation reflects refractory QB production by the limited microvillus pool . At a bright stimulus onset, most microvilli of a dark\u2010adapted photoreceptor are available, producing their first QBs with high quantum efficiency. But this makes them also refractory, leaving a smaller pool of microvilli available for responding to the next photons. Thus, the QB count (samples) from the activated microvilli first peaks, then rapidly falls, before settling to a steady\u2010state as photon arrivals and refractory periods balance . However, the early transient response cannot be evoked by dim continuous stimulation as most microvilli are available (few are refractory) to respond to fewer photon arrivals . These dynamics are further shaped by the concurrent QB size adaptation; the brighter the stimulation the smaller the QBs (see below).Importantly, refractoriness also dynamically attenuates photoreceptor output to salient light inputs  is a key parameter that limits a photoreceptor's encoding capacity  is not critical for good vision. For example, as long as a Drosophila R1\u2013R6 photoreceptor \u2018counts\u2019 5\u00a0\u00d7\u00a0104\u20135\u00a0\u00d7\u00a0105\u00a0quantum bumps\u00a0s\u22121, its macroscopic response would have a very high signal\u2010to\u2010noise ratio  the stochastic photon arrivals to the microvillus population   . Sampling with equal probabilities utilizes microvilli and photoreceptor output range more evenly  , reducing up to 50\u00a0times from dim to very bright illumination  . Both the local Ca2+ influx inside a microvillus and the global somatic Ca2+ spread from many microvilli can increase inhibition  . This memory effect induces a temporal adaptation that improves the signal\u2010to\u2010noise ratio of macroscopic responses, in comparison to the estimates that were sampled randomly  . The brighter the light input, the higher the membrane voltage, the lower the electromotive force and the smaller the generated QBs. Third, it contributes to the relative contrast normalization of the responses to naturalistic light contrast time series stimuli at different illumination conditions . The voltage feedback compresses signals less in dim conditions, but far more in bright stimulation, comparable to divisive nonlinearity . Refractory sampling automatically tunes quantum efficiency (photon to QB conversion probability) at different light levels. In dim conditions, quantum efficiency is near 100%, providing highly sensitive vision. Yet, quantum efficiency drops gradually with brightening, reaching \u2264\u00a01% in bright daylight. Conversely, QB size reduction, through Ca2+ and voltage feedbacks, improves temporal resolution and increases contrast gain in photoreceptor output. Stochastic QB integration (from the entire microvillus population) makes the resulting voltage responses to the same naturalistic contrast stimulus look similar in different light conditions.In summary, we have explained how light adaptation in fly photoreceptors emerges through a stochastic adaptive sampling framework. In this framework, light adaptation is largely accountable by two quantal sampling mechanisms: (i) reduction in sample numbers (QBs from activated microvilli) and (ii) sample sizes (QB waveforms), each contributing about 50% at normal daylight levels  for funding. M.J. thanks these funding sources for supporting this work: the State Key Laboratory of Cognitive Neuroscience and Learning open research grant, Natural Science Foundation of China Project 30810103906, Jane and Aatos Erkko Foundation Fellowship, Leverhulme Trust Grant RPG\u20102012\u2010567, and Biotechnology and Biological Sciences Research Council Grants BB/F012071/1, BB/D001900/1, BB/H013849/1 and BB/M009564/1."}
+{"text": "The introduction of the new generation of particle-filled and high strength ceramics, hybrid composites and technopolymers in the last decade has offered an extensive palette of dental materials broadening the clinical indications in fixed prosthodontics, in the light of minimally invasive dentistry dictates. Moreover, last years have seen a dramatic increase in the patients\u2019 demand for non-metallic materials, sometimes induced by metal-phobia or alleged allergies. Therefore, the attention of scientific research has been progressively focusing on such materials, particularly on lithium disilicate and zirconia, in order to shed light on properties, indications and limitations of the new protagonists of the prosthetic scene.This article is aimed at providing a narrative review regarding the state-of-the-art in the field of these popular ceramic materials, as to their physical-chemical, mechanical and optical properties, as well as to the proper dental applications, by means of scientific literature analysis and with reference to the authors\u2019 clinical experience.A huge amount of data, sometimes conflicting, is available today. Both in vitro and in vivo studies pointed out the outstanding peculiarities of lithium disilicate and zirconia: unparalleled optical and esthetic properties, together with high biocompatibility, high mechanical resistance, reduced thickness and favorable wear behavior have been increasingly orientating the clinicians\u2019 choice toward such ceramics.The noticeable properties and versatility make lithium disilicate and zirconia materials of choice for modern prosthetic dentistry, requiring high esthetic and mechanical performances combined with a minimal invasive approach, so that the utilization of such metal-free ceramics has become more and more widespread over time. At \u201cThe Digital Dentistry Society II Consensus Conference on Digital Technologies \u2013 Marrakech 2018\u201d the main topics of digital interest were thoroughly discussed, in order to draw clinical recommendations based on scientific evidence and, when missing, on the clinical experience shared by the scientific community. The present narrative review is focused on the technical and clinical profile of the two most popular metal-free materials, lithium disilicate and zirconia, in order to briefly shed light on their different indications, advantages and shortcomings.An extensive research has been carried out in the literature available on the subject, worldwide, limiting itself exclusively to articles in english, available on the main search engines  and published in the most important indexed journals of the Materials and Dental sector, with and without impact factor. The results highlighted in this narrative review were extrapolated from this literature search, with reference to the authors\u2019 clinical experience.2) is classified as a glass-ceramic, in the class of particle-filled glass materials. Introduced on the market in the 90s with the commercial formulation named \u201cIPS Empress 2\u201d , it was composed of 65\u2009vol% lithium disilicate, small needle-shaped crystals (3\u20136\u2009\u03bcm\u2009\u00d7\u20090.8\u2009\u03bcm) embedded in a glass matrix, with a 1\u2009vol% porosity [5(PO4)3F) embedded in a glassy matrix [Lithium disilicate (LSsity [5PO3F) embed2 was marketed as \u201cIPS e.max Press\u201d (Ivoclar Vivadent), exhibiting improved mechanical properties and optical features : 2.8\u20133.5\u2009MPa\u221am), much higher than the older glass-ceramics. The high mechanical performance of this material is due, on one side, to a layered, tightly interlocked distribution of the elongated disilicate crystals, hindering crack propagation across the planes and, on the other side, to a mismatch between the thermal expansion coefficients of LS2 crystals and the glassy matrix, so that the latter induces a tangential, compressive stress around the crystals [Thanks to an optimization of the processing parameters, allowing the formation of smaller and more uniformly distributed crystals, in 2005 a new formulation of LS2SiO3) in addition to lithium disilicate crystal nuclei (Li2Si2O5). Such blocks are characterized by moderate flexural strength of ~\u2009130\u2009MPa, resulting in higher cutting efficiency, easier and faster workability and lower wear of the milling tools [1/2. The blocks are available in different colors, obtained by dispersing staining ions in the glassy matrix [Besides the heat-pressed technique, the widespread, increasing implementation of computer-aided design/computer-aided manufacturing (CAD-CAM) technologies has led to the introduction of ceramic blocks aimed at the production of restorations by milling devices (IPS e.max CAD), also suitable for chairside production of restorations. Partially, pre-crystallized blocks are manufactured in a \u201cblue state\u201d, containing 40% of metasilicates LiSiO3 in ai Li2Si2O. Such bly matrix  and in dy matrix , 8. Party matrix .In vitro fully anatomical e.max CAD crowns have been shown to exhibit fracture resistance that is suitable for posterior, monolithic restorations  and to b2 crowns exhibit significantly lower fracture load values (1431.1\u2009\u00b1\u2009404.3\u2009N) compared to monolithic ones (2665.4\u2009\u00b1\u2009759.2\u2009N), the main failure mechanism being bulk fracture initiating from the occlusal surface [As regards mechanical resistance, it has been clearly demonstrated that, in vitro, veneered LS surface \u201322.2, as well as Zirconia reinforced-Lithium Silicate ceramics (ZLS), offers higher fracture resistance than bilayered, hand-veneered zirconia [2; the latter, in turn, are higher than those of ZLS [Monolithic LSzirconia , while ae of ZLS .2, fatigue resistance is strongly influenced by many experimental variables, like amount of cyclic loading, abutment and antagonist design and material, thermocycling parameters and test environment; for this reason, the heterogeneity and lack of standardization in research designs, tested materials and experimental conditions make a comparison of data not easily feasible [It has to be pointed out, however, that, particularly as regards LSfeasible .2 shows quite favourable properties, that are highly depending on the surface characteristics of the restoration. When accurately polished at its surface, the material exhibits convenient tribological behaviour in vitro, in terms of friction and wear of restorations, being its abrasiveness quite close to enamel, although more aggressive when compared to type III gold [As to wear and abrasiveness, LSIII gold  or to poIII gold \u201328. SuchIII gold .2 is one of the most critical materials to adjust intraorally, due to significant chip accumulation in the diamond burs, requiring higher machining forces and energy, with likely onset of intergranular and transgranular fractures, besides risks of thermal damage to tissues and restorations [On the other hand, it has been reported that grinding, glaze coating and fluorapatite ceramic veneering can increase wear, both of the antagonist teeth and of the restoration itself; at the same time, surface roughness can also be increased, besides a reduction of gloss, in the presence of basic pH environment and after toothbrushing with abrasive toothpaste \u201333. For orations .2 is the excellent quality of soft tissue response. In vitro, this material exhibits high levels of biocompatibility, not only due to low plaque retention, but also to adhesion and proliferation of human epithelial cells [2 restorations no inflammatory reactions were detected, analyzing the concentration of inflammation indicators in the gingival crevicular fluid; the same results were found with zirconia restorations [2 restorations are likely to yield very natural and sound aspect of soft tissues when in contact with marginal gingiva or peri-implant mucosa, in the presence of subgingival margins.One of the strongest points of LSal cells  and humaal cells , particuorations . Such faorations . In clin2 exhibits very good esthetic features, especially as regards translucency, that is about 30% higher than conventional zirconia [2 is an acid-sensitive ceramics, so that high strength of adhesion to the substrate is expected, due to both micromechanical and chemical bonding mechanisms. Micromechanical interlocking between ceramics and resin cement at the intaglio surface is based on the creation of surface microirregularities, pits and roughness by means of acid etching and/or physical treatments like alumina particles sandblasting or diamond bur grinding. For the glass-ceramic class, to date hydrofluoric acid (HF) etching is the best-established procedure, to be performed according to validated protocols taking into account both acid concentration and etching time. For LS2, 20\u2009s HF etching (at 5% concentration) is suggested, that is a shorter time than requested for feldspathic and leucite-based ceramics . Higher HF concentrations (9\u201310%) and longer etching times have been shown to be too aggressive and can introduce relevant damages, not only to the surface but also to the internal microstructure of the material, negatively influencing mechanical performance (reduction of flexure strength), adhesion potential and long-term success of ceramic restorations, particularly when thickness is low [2 with aluminum oxide particles. Nevertheless, it has been shown that this procedure, as well as laser etching, can determine excessive loss of material, with surface modifications that are less uniformly distributed than after HF etching and that can significantly reduce flexural strength [2 is efficiently increased by silane, ensuring a chemical interaction between the resin-based agent and the ceramics, obtained forming strong siloxane linkages [In addition to excellent biocompatibility and high mechanical properties, LSzirconia . Moreoves is low \u201341. Anotstrength , 43. In linkages \u201350.Recently, it has been shown that the use of silane combined to a phosphate functional monomer, the 10-Methacryloyloxydecyl-Dihydrogen-Phosphate (10-MDP), creating an acidic environment further improves the bond strength of resin-based luting cement to lithium disilicate ceramics .2, it has to be pointed out that this is one of the most versatile metal-free materials for its high esthetic potential, good mechanical properties and favourable bonding strength to dental tissues, thanks to its silica content. Lithium disilicate ceramics can be utilized both for tooth- and implant-supported restorations, ranging from SCs to FDPs, from anterior veneers to posterior inlays, onlays and overlays [As regards clinical indications of LSoverlays , 7.2 restorations, particularly as regards CAD-CAM production. Prospective, medium-term studies reported good cumulative survival rates, both for tooth-supported crowns  and imp 8\u2009years ). A rece service . Similarchipping , 55\u201358.2 crowns revealed a survival rate of 83.5% after 10\u2009years of follow-up; the main complications were loss of retention, secondary caries and hypersensitivity [As regards chairside procedures, monolithic LSsitivity .2 has been proposed for producing full-contoured, monolithic SCs to be bonded to CAD-CAM zirconia full-arch frameworks supported by implants. In a mid-term study, such a restorative solution exhibited 100% survival rate, after 5\u2009years of follow-up [2 crowns supported by ceramic-reinforced polyether ether ketone (PEEK) implant abutments may be an alternative to zirconia abutments with a titanium base for single-implant restorations in the anterior region [In the last decade, LSollow-up . Recentlr region .2 clinical indications also include adhesively retained, tooth-supported restorations. In the anterior sites, in the authors\u2019 and in other clinicians\u2019 clinical experience, laminate veneers made of bilayered, hand-veneered LS2 are a likely choice, particularly when clinical performance and high esthetic results are expected [Thanks to the high reliability of resin bond to glass-ceramics, LSexpected . Clinicaexpected , 64. Dueexpected .2 has also been proposed as an alternative material for such cantilevered restorations, showing comparably promising clinical results [Since their introduction in 1991, all-ceramic, resin-bonded fixed dental prostheses (RBFDPs) have been increasingly utilized as minimally invasive restorations aimed at replacing one missing tooth in the anterior arch . Althoug results \u201378. In a results . In anot results , even th2 can be successfully employed for resin-bonded single restorations, like inlays, onlays, non-retentive partial crowns and full coverage table-tops, in the monolithic form. The material offers undisputable advantages, like high fracture resistance, showed by high load-at-fracture values in table-tops/occlusal veneers, allowing reduced thickness of the restorations (1\u20131.5\u2009mm), low wear and abrasive potential, adhesive bonding strength and high biocompatibility, properties that are very favourable when teeth are severely abraded or a heavy occlusal correction is needed  [2 partial crowns can be used as successful restorative solutions for endodontically treated posterior teeth, with no significant differences between premolar or molars and with or without the use of fiber posts [In the posterior sites, LSen bite) , 81\u201385. en bite) , 87. A rer posts .2 for FDPs is a controversial topic: literature data is quite scant and not homogeneous, with a high variability of reported survival and success rates, ranging from rather poor clinical results [The utilization of LS results \u201392 to ac results . In the 2 crowns made from conventional impressions with polyvinylsiloxanes exhibit better fit than CAD-CAM digitally produced ones [Several studies evaluated the adaptation of lithium disilicate restorations, fabricated in both conventional and digital workflow. According to the most recent literature, there is no significant difference in terms of marginal accuracy between conventional and full-digital procedures for the fabrication of monolithic lithium disilicate crowns \u201396. Moreced ones .2 crowns were more accurate when using digital impression technique; in any case, whatever the workflow used, the adaptation was shown to be within clinical acceptability range [Furthermore, centralized milling production has been reported to result in better fit compared to chairside system; in the same study, occlusal internal adaptation was better in the conventionally manufactured crowns than in the digitally fabricated ones . Conversty range \u2013101.To date, drawing univocal conclusions about adaptation accuracy of lithium disilicate restorations is not easy, due to the high number of variables involved in the final prosthetic fit, like digital impression system and technique, used material and fabrication procedure, so there is still a noticeable amount of controversial debate , 102. As2 [In the last years, the continuous research and progress in prosthetic material field for dental CAD-CAM applications has led to the introduction on the market of promising materials, the ZLS, thanks to an alternative strategy to enhance translucency: a glassy matrix, containing a homogeneous crystalline structure made of lithium silicate crystals, is reinforced with tetragonal zirconia fillers (about 10% by weight) allowing higher strength values than LS2 . The hig2 , 110, al2 . The res2 . In case2 .To date, as regards mechanical properties and clinical performances of ZLS, data are still limited, often controversial and short-term; these highly promising ceramics need further studies, both in vitro and in vivo, in order to precisely define physical-mechanical properties, clinical indications, limits and long-term performance of such restorations \u2013117.2) is a heterogenous, highly-resistant, polycrystalline ceramic, characterized by favourable mechanical properties  and good optical characteristics [In the ceramic classification, zirconia , tetragonal (from 2370\u2009\u00b0C to 1170\u2009\u00b0C) and monoclinic (from 1170\u2009\u00b0C to room temperature). These different allotropic states present with distinct mechanical and optical properties that can be exploited differently in Prosthodontics \u2013121, 124Conventionally, zirconia is mainly used in its partially yttria-stabilized tetragonal phase (Y-TZP) as a prosthetic material for indirect restorations. Under the effect of mechanical, thermal and/or combined stresses, the adsorbed energy can break part of the atomic bonds of its polycrystalline structure turning such tetragonal crystals to a stabler monoclinic shape. This spontaneous and irreversible transformation is known as Phase Transformation Toughening (PTT) and shows a contemporary 4\u20135% increase in crystals volume, creating significant compressive stresses within the material \u2013121, 124From the technological and prosthetic sides, the PTT has been advertised as a paramount advantage, since it allows a kind of self-repairability of zirconia; indeed, it permits to block or at least to hinder the propagation of micro-cracks and fractures within the material. In fact, the subsequent volumetric increment of the crystals generates comses within the material at the fracture tip, limiting crack propagation , 124\u2013126In order to profit from the positive features of the PTT intraorally, during industrial manufacturing cubic and tetragonal zirconia are stabilized with metal oxides, just like yttrium, magnesium, cerium and lanthanum; the percentage of such dopants can vary according to manufacturing techniques and clinical use. These stabilizing oxides contribute to keep zirconia in its crystalline tetragonal phase also at room temperature in a thermodynamically metastable state, preventing the spontaneous transformation in the more stable monoclinic crystals. However, such dopant oxides can get lost after traumatic events, surface modifications  and material aging , 124\u2013127In turn, the PTT is closely related to a negative phenomenon, the so-called \u201cLow Temperature Degradation (LTD)\u201d, responsible for zirconia aging. At room temperature, the material can undergo a spontaneous and irreversible transformation to the monoclinic phase, even in the absence of any mechanical stress. This phenomenon causes a worsening of mechanical properties, till the possible occurrence of spontaneous fractures , 130. ThAs reported in a recent in vitro study, monolithic tetragonal zirconia restorations can undergo hydrothermal degradation (i.e. aging) also after short observation times; however, such phenomenon does not reduce significantly the mechanical properties of tetragonal zirconia even in the presence of wide monoclinic transformed areas . In the 2, which, from their part, are higher than those of ZLS; the number of fatigue loading cycles does not seem to affect the load-to-fracture of zirconia restorations [In vitro studies have clearly demonstrated that mechanical properties of zirconia, expressed by parameters like load-to-fracture values, are higher than those of LSorations .Laboratory investigations reported that monolithic zirconia restorations showed higher resistance to fracture than bilayered ones, even after mechanical cycling and aging \u2013136. SurZirconia is usually considered as an opaque restorative material with optical and esthetic properties less attractive than glassy ceramics, particularly in terms of translucency. By means of transillumination, it has been shown that tetragonal zirconia allows only about 25% of incident light to pass through; this characteristic can be advantageously used to mask dark substrates  , 142\u2013144Recently, in order to enhance the esthetic properties of the material, translucent zirconia has been introduced in the market, characterized by the presence of 30\u201335% of cubic crystals. Besides the improved optical characteristics, in the presence of such cubic phase no hydrothermal degradation (i.e. aging) of this allotropic component is evidenced. However, apart from the better optical properties, the toughness of translucent zirconia is reduced, compared to tetragonal one, with values of flexural strength ranging between 500 and 900\u2009MPa; as a consequence, translucent zirconia represents a suitable esthetic and mechanical compromise to be preferred in anterior areas up to the first premolars in its monolithic configuration , 143. AsAlthough new additive technologies are emerging from the research on dental materials, to date, zirconia is still fabricated by CAD-CAM milling, according to two different production techniques: either soft machining of pre-sintered zirconia or hard machining of fully-sintered zirconia. Both procedures can be accomplished in industrial milling centers, in dental laboratories or by chairside devices , 127.Soft machining represents the most popular manufacturing technique and is based on milling of pre-sintered zirconia blanks fabricated by cold-isostatic pressing a mixture of zirconia powder, stabilizing oxides and binding agents (the latter removed during the pre-sintering process). With this technique, zirconia is highly homogenous and easier to mill, reducing production times, machinery wear and surface flaws; furthermore, soft machining generates negligible internal porosities (about 20\u201330\u2009nm). The downside is that this process requires a 25% oversizing of the framework to be milled, since following sintering a linear shrinkage of the final volume occurs; as a consequence, although milling procedures are easier, soft machining requires a precise matching of CAD oversizing and material shrinking in order to avoid dimensional inaccuracies, particularly in the presence of complex framework geometry , 127.Viceversa, hard machining requires milling of fully-sintered zirconia blanks generally produced with hot isostatic pressing (HIP) at 1400\u00b0-1500\u2009\u00b0C. This approach eliminates the problem of post-milling shrinkage, since neither oversizing nor sintering are necessary; however, hard machining needs longer milling times and more complex manufacturing, involving higher costs due to accelerated wear of production machinery and increased risks of attrition flaws. In addition, right after hard machining, zirconia frameworks can undergo a certain amount of monoclinic transformation phase due to mechanical stress, working burs friction and overheating subsequent to machining of the hard material , 127.Literature data are still controversial about which technique is the best, being the choice mainly guided by the operator preference, according to considerations related to shape, volume and complexity of the prosthetic geometry as well as time and cost of the milling procedures \u2013121, 127High temperature and prolonged sintering time generate bigger zirconia crystals and the dimension of such grains significantly influences the mechanical properties of the material. In fact, the critical crystal dimension is about 1\u2009mm: above this diameter, zirconia becomes spontaneously more susceptible to PTT, while under 0.2\u2009mm such phenomenon does not occur and the toughness of the material decreases. Consequently, fabrication procedures (particularly sintering) significantly affect mechanical properties and stability of zirconia and have to be carefully checked during the whole manufacturing process , 142.In order to get a proper color of the restorations, specific metal oxides can be used as stains within the pre-sintering zirconia powder mixture or metallic salts can be infiltrated after milling; moreover, zirconia blanks are also available in multilayered color configurations. It has been clearly demonstrated that the coloring process does not influence mechanical properties of tetragonal zirconia, whilst uncertainty still remains regarding translucent cubic crystals , 130.Zirconia can be fabricated in monolithic or layered configurations. The monolithic material, not veneered with any ceramic layer, shows a less attractive esthetic appearance, but is not affected by the frequent cohesive fractures of the layering ceramics, known as \u201cchipping\u201d , 145.To date, scientific evidences support the use of monolithic zirconia in posterior regions and in not esthetically relevant areas of the anterior arch , while the use of layered restorations should be mainly addressed in highly esthetic zones , 145\u2013149The accuracy of zirconia prostheses can be influenced by several factors, such as manufacturing, complexity of framework geometry  and aging. The comparison of data regarding internal precision and marginal fit of zirconia is quite difficult, as literature data are heterogeneous and study designs are different for both laboratory and clinical investigations , 127. ToAs regards preparation geometry, the high stability and structural resistance of zirconia are compatible with both vertical and horizontal finish lines , 153.Due to the absence of any glassy matrix, zirconia is free from silica and, consequently, cannot be conditioned with conventional acid etching techniques, differently from glass-ceramics , 122. SeThe use of coupling agents like silane can be adopted only after a tribochemical conditioning with silica-coated alumina particles or after infiltrating the zirconia surface with a thin layer of glassy ceramics , 161; hoThe combination of mechanical and chemical treatments of zirconia surface was proved to offer the best results; particularly, the use of primers and adhesion promoting agents containing acidic monomers (10-MDP) can have a synergic effect with silane, improving the effectiveness of simplified adhesive techniques , 160\u2013163On the basis of the physical-chemical properties of zirconia, in the presence of retentive preparation geometries and full coverage prostheses, conventional water-based luting agents (i.e. glass-ionomer and zinc phosphate cements) and hybrid cements (i.e. resin-modified glass-ionomer cements) can be considered a good choice for cementation. Otherwise, in the presence of partial coverage restorations, scarcely retentive preparation geometries  and/or high masticatory loads, besides the above mentioned conditioning treatments of zirconia surface, it is possible to use conventional resin cement or simplified self-adhesive luting agents, so as to allow resin better adsorb, distribute occlusal forces and withstand possible micro-cracks on the inner surface of the restorations , 162.2 for 3-, 4- and 5-unit FDPs respectively) and with rounded interdental embrasures, in order to avoid sharp angles that can contribute to generate risky stress concentration [From a clinical point of view, in the last decades zirconia has more and more gained ground in the realm of metal-free, mainly utilized to restore both natural teeth and osseointegrated implants with SCs and short- and medium-span FDPs up to 5 elements , 165. Asntration . The prentration ; consequntration .Recently, clinical investigations regarding tooth- and implant-supported full-arch restorations have been published . AlthougAs regards zirconia implants, the literature reports controversial, short-term and mainly anecdotal data , 170\u2013174At the moment, it can be stated that silicate- and zirconia-based ceramics are amongst the most versatile metal-free materials available for the \u201cdigital prosthodontic environment\u201d. In the last years, an increasing amount of available in vitro and in vivo data is shedding precious light on the outline of guidelines for a restorative rational use, focused on specific materials advantages and limitations, taking into account mechanical, optical and biological properties in the light of a widespread clinical experience Table\u00a0. In the"}
+{"text": "Limited information exist on tobacco and e-cigarette use patterns in cancer survivors. The purpose of this study is to report on use patterns in cancer survivors compared with non-cancer participants from the Population Assessment of Tobacco and Health (PATH) Study.Sociodemographic data and tobacco product use were analyzed for 32,244 adult participants from the PATH Study in 2013\u20132014 by cancer status and age. Logistic regression examined the patterns of and factors associated with tobacco use by cancer status.Overall, cancer survivors represented 7.1%  of participants, were older, and had a higher proportion of females and non-Hispanic whites than non-cancer participants. In cancer survivors, current and former cigarette smoking was reported in 12.7% and 32.9% respectively, compared with 18.5% and 19.0% in non-cancer adults. Current e-cigarette use was reported by 3.8% of survivors compared with 5.7% of non-cancer participants. Dual tobacco use was reported by 25.0% and poly use by 6.9% of cancer survivors who currently smoked. All other forms of current tobacco use were individually reported by <5% of survivors. Young adult cancer survivors (aged 18\u201344) reported the highest rates of current cigarette smoking (27.9%) and current e-cigarette use (11.8%). The effects of age, sex, race/ethnicity, education, and income on tobacco use status were comparable for cancer survivors and non-cancer participants. Cancer survivors who were younger, male, of lower educational attainment, and those diagnosed with a tobacco-related cancer were more likely to report current tobacco use.Among cancer survivors, cigarette smoking remains the predominant form of tobacco use, although other tobacco/nicotine use and dual/poly use are common. The PATH Study provides detailed tobacco product use patterns in survivors, including their adoption of emerging alternative tobacco products. Many cancer survivors continue to use tobacco products after their cancer diagnosis despite the mounting evidence showing reduced effectiveness of cancer treatments, increased overall and cancer-specific mortality and increased risk for a second primary cancer. Tobacco The use of e-cigarettes and other tobacco products have increased considerably in recent years,,6 and a The Population Assessment of Tobacco and Health (PATH) Study was established in 2011 following the Family and Smoking Prevention and Tobacco Control Act of 2009. The purpA recent analysis of data from the PATH Study examined dual use of cigarettes and e-cigarettes in cancer survivors and found that among smokers, cancer survivors were using e-cigarettes at similar rates as non-cancer participants and both groups were motivated to use e-cigarettes largely for perceived health-related reasons. Given itData were obtained from the PATH Study, a household-based, longitudinal, nationally representative cohort study of 45,971 adults and youth in the U.S. that is designed to measure prevalence and correlates of tobacco use. The current study was limited to adults who participated in Wave 1 of the PATH Study between September 2013 and December 2014. PATH recruitment was completed using a four-stage, stratified probability sample design in which a predetermined number of participants  was randomly recruited by home address. The sample included current, former, and never tobacco users who completed computer- and audio-assisted structured interviews and received $35 compensation. The time required to complete the survey was approximately 45 minutes. The PATH Study was weighted to reflect the U.S. population including adjustments for oversampling and nonresponse. AlthoughThe PATH Study uses pictures to assist respondents in answering questions about their awareness and use of noncigarette tobacco and nicotine products. Prevalence of current, former, or never use was assessed for the following tobacco and nicotine products: cigarettes, e-cigarettes (electronic cigarettes), traditional cigars, cigarillos, filtered cigars, smokeless tobacco, snus, pipe tobacco, and hookah. For cigarettes, current smoking status was assigned to participants who had smoked more than 100 cigarettes in their lifetime and currently smoke cigarettes every day or some days, and former smoking was assigned to those who had smoked at least 100 cigarettes in their lifetime but now do not smoke at all. Never smoking was assigned to those who had never smoked a cigarette, even one or two puffs. Current cigarette smokers were further classified into daily and less than daily smokers. Pack-year history was also calculated for current and former cigarette smokers. For all other tobacco and nicotine-delivery products, current use was assigned to those who have ever used the product and now use it every day or some days, whereas former use was assigned to those who had ever used the product fairly regularly but now do not use it at all. Never use was assigned to those who had never used the product even once or twice. Among current users of any tobacco/nicotine products, we further classified product use into mono use (1 product only), dual use (any 2 products), or poly use (>2 products).Participants who reported current use of any noncigarette product or who had quit such products in the past 12 months were asked a series of yes or no questions about 13 reasons for using these products. There were 3 health-related reasons\u2014\u201cthey might be less harmful to me than cigarettes,\u201d \u201cthey might be less harmful to people around me than cigarettes,\u201d and \u201cusing them helps people to quit smoking cigarettes.\u201d The remaining reasons were not health-related, including, \u201cI can use them at times when or in places where smoking cigarettes isn\u2019t allowed,\u201d \u201cthey don\u2019t smell,\u201d \u201cthey are more acceptable to non-tobacco users,\u201d \u201cthey come in flavors I like.\u201d Each reason was analyzed separately.Participants were defined as cancer survivors if they responded affirmatively to the following question, \u2018Have you ever been told by a doctor or other health professional that you had cancer?\u2019 Cancer survivors were further classified as having a tobacco-related cancer if the cancer site reported was one of the following: bladder, cervix, colon, esophagus, kidney, larynx, liver, lung, mouth, pancreas, rectum, stomach, and throat.The following demographic characteristics of participants were included: gender , age (in years) aggregated into groups , race/ethnicity , educational attainment , annual household income , and U.S. Census region .Frequencies and percentages weighted to the U.S. population were calculated by cancer status  and age group across all adults who completed the survey for current/former/never use of the following nicotine and tobacco product categories: cigarettes, e-cigarettes, any cigars , smokeless tobacco and snus, pipe tobacco, and hookah. We also classified participants who had used any tobacco/nicotine products as mono (one product), dual (two products), and poly (more than two) tobacco/nicotine product users among those who reported current use of any types of tobacco or nicotine products. Weighted percentages were calculated for use of the aforementioned categories by cigarette smoking status and stratified by cancer status (cancer survivor vs. no history of cancer). Among cancer survivors, weighted percentages and 95% confidence intervals (CIs) were calculated using the logit transformation method with FayCharacteristics of adult respondents in Wave 1 of the PATH Study, stratified by cancer status, are presented in Weighted prevalence of current, former, and never use of tobacco and nicotine products stratified by cancer status is reported in Former use of any tobacco or nicotine product was higher in cancer survivors as compared with non-cancer participants (33.1% vs. 18.2%) as was former use of conventional cigarettes (32.9% vs. 19.0%), pipe tobacco (6.6% vs. 2.3%), and any cigars (4.2% vs. 3.3%). In contrast, lower prevalence of former tobacco use was reported among cancer survivors vs. non-cancer respondents for e-cigarettes (0.7% vs. 1.0%), smokeless tobacco and snus (2.5% vs. 3.3%) and hookah (0.2% vs. 0.8%). Among cancer survivors on average, former smokers had a 29.0 pack-year history compared to 21.2 pack-year history among non-cancer respondents.Among cancer survivors who were current tobacco or nicotine product users and reported complete information on product use (n = 636), 68.1% used only one product (mono users), 25.0% were dual users, and 6.9% used more than two products . Among nAmong non-cancer respondents who were current cigarette smokers , 54.2% were exclusive cigarette smokers, whereas 21.2% were also current users of e-cigarettes, 20.6% were also current smokers of any cigars, 10.0% were also current hookah smokers, 7.0% were also current users of smokeless tobacco or snus, and 3.1% were also current smokers of pipe tobacco. On average, non-cancer respondents who were exclusive cigarette smokers reported smoking 15.7 cigarettes per day, compared with 16.8 cigarettes per day among current e-cigarette users, 16.7 cigarettes per day among former e-cigarette users and 17.2 cigarettes per day among never e-cigarette users.The reasons for non-cigarette product use among cancer survivors are described in Results from the multivariable logistic regression modeling of current tobacco/nicotine product use stratified by cancer status are reported in Adults with higher than a high school education were less likely than those without a high school degree to be current tobacco/nicotine users regardless of cancer history. For example, adults with a bachelor\u2019s degree or higher were less likely than the referent education level to be current tobacco/nicotine users in both cancer survivors  and in non-cancer respondents . Additionally, adults with higher income were less likely to be current tobacco/nicotine users compared to adults with a lower annual household income. Among cancer survivors, those with a tobacco-related cancer diagnosis were more likely to be current tobacco/nicotine users  than those diagnosed with a non-tobacco-related cancer.In general, among those who reported current use of any tobacco or nicotine products, the correlates of dual and poly tobacco/nicotine use (vs. mono use) were similar to those variables associated with any tobacco or nicotine product use, with some exceptions . First, This cross-sectional analysis of tobacco-use behaviors among adult cancer survivors compared with non-cancer respondents provides an update on the prevalence of cigarette smoking and e-cigarette use, in addition to benchmark estimates of current and former use of other tobacco products in this population. Among adult cancer survivors participating in the PATH Study, approximately 17% are current tobacco users, including 13% who are current cigarette smokers, 5% who are current e-cigarette users, and 2% who are current cigar smokers. Many correlates of tobacco use in cancer survivors are consistent with those in the general population of U.S. adults: younger age, male gender, and lower household income. In additThe estimated prevalence of current cigarette smoking among adult cancer survivors is consistent with estimates published by the National Cancer Institute\u201412.8% inAlthough many correlates of tobacco use were consistent across cancer survivors and non-cancer participants, there were notable differences. Racial/ethnic and geographical associations of tobacco product use appeared to be more pronounced for non-cancer participants compared with cancer survivors, suggesting that cancer survivors nationwide exhibited less disparate tobacco use patterns than adults who did have a history of cancer. However, more research is needed to examine the racial/ethnic and geographic patterns in tobacco use among cancer survivors.A previous analysis of the PATH Study data had focused on investigating e-cigarette use in cancer survivors who were cigarette smokers. Similar Our study took a broader approach than Symes et al. by charaAs described in the Symes et al. study, a majoriAlthough we found the prevalence of cigarette smoking and any product use to be lower among cancer survivors compared with non-cancer participants in the PATH Study, almost one in five cancer survivors reported current use of a tobacco or nicotine product. Continued tobacco use by cancer patients not only increases the risk for adverse cancer treatment outcomes, but alsoThere are several limitations to this study. First, the PATH Study relies on self-reported cancer diagnosis, which typically underestimates cancer prevalence. Tobacco Findings from the current study demonstrate dynamic use patterns for cigarettes, e-cigarettes, and other tobacco products among cancer survivors compared with the general population. As data from the PATH Study mature, future analyses can evaluate changes in patterns of use and begin to better define opportunities for assessment of health risk and intervention."}
+{"text": "Host-microbiome interactions (HMIs) are critical for the modulation of biological processes and are associated with several diseases.\u00a0Extensive HMI studies have generated large amounts of data. We propose that the logical representation of the knowledge derived from these data and the standardized representation of experimental variables and processes can foster integration of data and reproducibility of experiments and thereby further HMI knowledge discovery.Through a multi-institutional collaboration, a community-based Ontology of Host-Microbiome Interactions (OHMI) was developed following the Open Biological/Biomedical Ontologies (OBO) Foundry principles. As an OBO library ontology, OHMI leverages established ontologies to create logically structured representations of (1) microbiomes, microbial taxonomy, host species, host anatomical entities, and HMIs under different conditions and (2) associated study protocols and types of data analysis and experimental results.Aligned with the Basic Formal Ontology, OHMI comprises over 1000 terms, including terms imported from more than 10 existing ontologies together with some 500 OHMI-specific terms. A specific OHMI design pattern was generated to represent typical host-microbiome interaction studies. As one major OHMI use case, drawing on data from over 50 peer-reviewed publications, we identified over 100 bacteria and fungi from the gut, oral cavity, skin, and airway that are associated with six rheumatic diseases including rheumatoid arthritis. Our ontological study identified new high-level microbiota taxonomical structures. Two microbiome-related competency questions were also designed and addressed. We were also able to use OHMI to represent statistically significant results identified from a large existing microbiome database data analysis.OHMI represents entities and relations in the domain of HMIs. It supports shared knowledge representation, data and metadata standardization and integration, and can be used in formulation of advanced queries for purposes of data analysis. A microbiome is defined as a community of microbes  found in a particular habitat  \u20133. MicroAn ontology is a human- and computer-interpretable representation of the types, properties, and interrelationships that exist in a particular domain . OntologThe above-mentioned ontologies provide components for the systematic representation of certain aspects of HMIs, but they do not cover, for example, HMIs \u2013 the interactions between hosts and microbiomes \u2013 themselves. They also do not cover the associations between HMIs and specific diseases (such as rheumatoid arthritis), or HMI investigation metadata. We have created the Ontology of Host-Microbiome Interactions (OHMI), therefore, not merely in order to incorporate terms in these specific areas, which are important foci of current microbiome research, but also to provide a single framework for systematic representation of all entities relevant to HMI.http://www.obofoundry.org/) principles. For example, OHMI satisfies the openness and collaboration principles [https://github.com/OHMI-ontology/OHMI) documents the successive versions of the ontology presented at the 23rd International Scientific Symposium on Biometrics (BioStat 2017), the Sixth Annual Workshop of the Clinical and Translational Science Ontology Group, and the Microbe 2018 meeting of the American Society of Microbiology (ASM).OHMI follows the Open Biological/Biomedical Ontologies (OBO) Foundry  tool was employed to detect inconsistencies or conflicts arising during development.OHMI uses the eXtensible Ontology development (XOD) methods , meaningAll HMI-related data elements were first compiled in a spreadsheet\u00a0from the literature, public resources, and use cases, then discussed by the community, and transformed into terms and relational expressions for inclusion in the ontology. Following the OBO Foundry principle of reuse, wherever a term was already defined in one or more existing ontologies (identified using Ontobee ) we impoOur major use case was the study of the association between microbiome profiles and rheumatic diseases. Rheumatic diseases include conditions causing chronic, often intermittent pain affecting the joints and/or connective tissues such as rheumatoid arthritis (RA), ankylosing spondylitis (AS), and systemic lupus erythematosus (SLE). In this study, we manually curated published rheumatic disease-related HMI data from peer-reviewed publications.http://www.ontobee.org/sparql) [https://raw.githubusercontent.com/OHMI-ontology/OHMI/master/docs/SPARQL%20scripts.txt). DL queries were performed using the Prot\u00e9g\u00e9 5.0 (beta 15) DL Query plugin as described in the Results section.We have also defined and used two competency questions derived from the rheumatic disease use case to evaluate the OHMI ontology. For this purpose, we used the Simple Protocol And Resource Description Framework (RDF) Query Language (SPARQL) and Description Logic (DL) languages. SPARQL is a query language that retrieves data stored in the RDF format . SPARQL /sparql) . The SPAhttps://github.com/ohmi-ontology. The source code, including development and release versions, is available at https://github.com/ohmi-ontology/OHMI. OHMI is released under a Creative Commons 4.0 License. It has been accepted as an OBO library ontology (http://obofoundry.org/ontology/ohmi.html) and deposited in the Ontobee ontology server [http://www.ontobee.org/ontology/OHMI, and in BioPortal [https://bioportal.bioontology.org/ontologies/OHMI. Ontobee is the default server for dereferencing OHMI terms.OHMI is an open source project maintained through y server  at http:ioPortal  at httpsFigure The class OHMI: microbiome is defined as a subclass of ENVO:biome. The latter is defined as follows:biome\u2009=\u2009def. an ecosystem to which resident ecological communities have evolved adaptations.OHMI then defines microbiome as follows:microbiome\u2009=\u2009def. a biome that consists of a collection of microorganisms  and the surrounding environment where the microorganisms reside and have evolved adaptations.OHMI further defines the term \u2018microbiota\u2019 as a subclass of the term \u2018collection of organisms\u2019 in the Population and Community Ontology (PCO):microbiota\u2009=\u2009def. a collection of microbial organisms that reside in a particular environment.To define the \u2018host\u2019 class in OHMI, we first of all define the host role, which is a BFO:role borne by an entity when one or more further entities are spatially located in its interior. An OHMI:host is then an organism that bears a host role in relation to some microbiome.The basic design pattern of OHMI is illustrated in Fig. host-microbiome interaction\u2009=\u2009def. an interaction that occurs between a microbiome and its host.with a logically equivalent class definition as follows:host-microbiome interaction: interaction and (\u2018has participant\u2019 some host) and (\u2018has participant\u2019 some microbiome).Porphyromonas macacae in AS human gut\u2019 is an \u2018AS human-gut microbiota interaction\u2019 in which the size of the population of Porphyromonas macacae is increased  located in the host organism. This host organism may in addition have a disease \u2013 a phenomenon that is illustrated by the representation of a general HMI pattern in patients with ankylosing spondylitis (AS) Fig. . In thissed Fig. .http://www.ontobee.org/ontostat/OHMI.As of September 9, 2019, OHMI contains 1238 terms, including 1020 classes, and 128 object properties. OHMI includes 481 OHMI-specific classes and properties with the \u201cOHMI_\u201d prefix, which are new ontology terms not covered in any other OBO Foundry ontologies. More detailed and updated OHMI statistics can be found at the Ontobee statistics page at: As a major use case, we systematically collected and annotated the peer-reviewed results of studies of\u00a0HMI related to rheumatic diseases. Rheumatic diseases are characterized by inflammation of connective tissues, most commonly the joints, but also the tendons, ligaments, bones, muscles, and even solid organs. Our use case study focused on the most common rheumatic diseases, including AS, enthesitis-related arthritis (ERA), gout, psoriatic arthritis (PsA), RA, and systemic lupus erythematosus (SLE), which affect approximately 1% of the global human population. RA is a common rheumatic disease characterized by persistent synovitis, systemic inflammation, and autoantibodies . Many stPrevotella copri, Porphyromonas gingivalis, and Collinsella are expanded or depleted in anatomical locations such as the gut, mouth, lung, and skin in the patients of rheumatic diseases, and the possible underlying mechanisms. These microbe-rheumatic disease associations were represented in the OHMI using the design pattern described above  types. To standardize these, we reference different resources, starting with the Minimum Information about a Genome Sequence (MIGS)  and abouTable Competency question 1: What are the human diseases for which a bacterium or bacterial group  is expanded in population size in the microbiome?A commonly asked competency question relates to the identification of the microbiome components that are increased in humans with a specific disease as compared with healthy control subjects. For example, Porphyromonas macacae is expanded in the gut of AS patients, which we represent by means of the term \u2018expansion of Porphyromonas macacae in AS human gut\u2019  and a microbe, where the population of the microbe is expanded in a diseased host as compared to a healthy host control. As illustrated in the above example, the domain of the relation is a HMI process, and the range is a microbe such as a bacterium. This specific relation is formulated in natural language by means of several different expressions. The inclusion of such a specific relation in OHMI provides a single target for the corresponding annotations which represents a direct logical linkage between a disease-specific HMI and a microbe. OHMI thereby supports efficient knowledge querying and analysis also where we take natural-language inputs as our starting point.E. coli-associated human diseases investigated in [E. coli and four specific E. coli strains were found in rheumatic arthritis, gout, and colorectal cancer.Competency question 2: What microorganisms are expanded or depleted in subjects with a specific disease (for example RA) relative to health controls?OHMI records manually mined knowledge relating to many types of microorganisms that are increased or decreased in population size in patients with a specific disease relative to healthy controls. This knowledge is often obtained by text-mining all the papers referenced in the literature reports of well-controlled epidemiological studies. OHMI represents this knowledge in two ways. First, it creates a logically well-defined representation of a specific HMI in association with specific disease and microbiome information, as exemplified in Fig. We can use the relationship \u2018has microbe expanded in diseased host\u2019 to represent the disease-associated HMIs related to each specific bacterium or bacterium group. For example, such a representation method can be used to identify all the gated in \u201351 on thPorphyromonas macacae in AS human gut\u2019: \u2018has microbe expanded in diseased host\u2019 some (\u2018Porphyromonas macacae\u2019 and (\u2018located in\u2019 some (\u2018lower digestive tract\u2019 and (\u2018part of\u2019 some (\u2018Homo sapiens\u2019 and (\u2018has disease\u2019 some \u2018ankylosing spondylitis\u2019)))))).\u2018expansion of P. macacae and the disease ankylosing spondylitis (AS). This style of logical definition can serve as a basis for both DL and SPARQL queries. However, since the logical definition includes four relations and is quite complex, it is difficult to write efficient query scripts for queries of this sort.The above is a class definition formulated using logical equivalence. It thus provides necessary and sufficient conditions for the specific HMI class to be exemplified. Using this type of definition, we can specify the link between the microbe To solve this problem, OHMI provides shortcut relations to link an organism directly to a disease, for example, \u2018has microbe depleted in gut of human with disease\u2019, which is used as follows:Prevotella:\u2018microbe susceptibly depleted in gut of human with disease\u2019 some \u2018rheumatoid arthritis\u2019.Lactobacillus sp. and Lactobacillus salivariusc are increased in RA patients, the former in the gut, the latter in the oral cavity. On the other hand, five bacteria under Betaproteobacteria were all depleted in RA patients. Among them, three Neisseriaceae bacterial groups  are all decreased in the oral cavity in the RA patients, two Burkholderiales groups (Burkholderia and Sutterella wadsorthensis) are depleted in the gut or respiratory airway of the RA patients. Interestingly, Bifidobacterium bifidum is decreased in the gut of RA patients; however, Bifidobacterium dentium is increased  is a web-based database and systems biology platform for integrating, mining and analyzing data from microbiome experiments [Prevotella is significantly lower in diarrheal patients compared to controls; however, for unclassified Proteobacteria and Natronobacillus bacteria the converse was true  to leverage OHMI to ask whether the identified list of differentially abundant taxa is enriched for any disease processes or interactions. Such an approach is similar to how the Gene Ontology (GO) has been used to support data analysis, by providing prior knowledge relating to the roles of given genes in realizing given functions, knowledge which can then be used to support gene enrichment and other data analysis . Such a Helicobacter pylori infection. People with an H. pylori infection have a roughly six-fold greater risk of developing gastric cancer than uninfected people. However, not all people infected with H. pylori have gastric cancer, suggesting that there are more factors and mechanisms involved in gastric carcinogenesis which are not yet understood. Comparative bacterial genomic analysis in patients with or without gastric cancer allows gene-level study of host-microbiome interactions as it relates to gastric carcinogenesis in humans. Clinical trials together with multi-omics studies are being performed to further explore the mechanisms of host-microbiome interactions leading to gastric cancer.A newly funded project is to apply OHMI to study the host-microbe interactions related to gastric cancer. Gastric cancer (GC) is the fifth most prevalent malignancy and the third leading cause of cancer death worldwide. Almost half of new cases occur in China, and it is the second leading cause of cancer death in China. The strongest risk factor for gastric cancer is chronic OHMI is an ongoing project. Future work includes expansion of OHMI to cover more diseases such as obesity and inflammatory bowel disease. More molecular and cellular entities and processes will be included to better understand HMI mechanisms. Such host-specific microbiome profiles may serve as a biological marker for specific host types or specific health conditions. Various types of biological conditions  may affect the outcomes of HMIs and will be systematically studied. Thus, one important outcome of OHMI is to identify opportunities to collect microbiome data related to pervasive exposures that cut across multiple disease states  and which were not captured by the Human Microbiome project. OHMI is expected to become an ontology-based interoperable knowledge base of host-microbiome interactions, which can be used to address many technical challenges in constructing microbiome-disease association knowledge bases  and therOHMI ontologically represents entities of various types associated with HMIs and the relations among such entities. Our use cases demonstrate how OHMI could be used as a canonical platform for HMI knowledge representation, metadata standardization, semantic querying and data analysis.Additional file 1: Figure S1. SPARQL query for all microbes associated with RA and their relations. The query was conducted using the Ontobee SPARQL endpointAdditional file 2: Manually annotated rheumatic disease HMI data from the literature. The annotated information is represented in OHMI"}
+{"text": "The thickness and ratio of noncompacted and compacted layers of the left ventricular (LV) myocardium in the normal fetus were investigated by fetal echocardiography. We aimed to investigate the compaction process of the LV myocardium during the normal gestation period and provide reference for echocardiographic diagnosis of a fetus with ventricular myocardium noncompaction. A total of 56 pregnant women in the gestational period of 23\u201330 weeks were included. Complete fetal echocardiography was performed with system ultrasonographic examination to exclude congenital heart malformation or extracardiac malformation. All 56 fetuses showed normal development. In the short-axis view of the fetal heart, the LV wall was divided into an upper and lower section at the level of the papillary muscle. Each section was then further divided into four segments, namely, anterior, posterior, lateral, and inferior wall. Thus, the LV wall was divided into eight segments. The thickness of the ventricular noncompacted and compacted layers and the ratio of the ventricular noncompacted to compacted layers of these segments at end-systole were measured and calculated. In echocardiography, the fetal LV myocardium is a two-layered structure: the endocardial noncompact myocardium (NC) with higher echo and the epicardium compact myocardium (C) with lower echo. The noncompacted layer is thinner than the compacted layer in the anterior wall, but thicker than the compacted layers in the posterior, lateral, and inferior wall. With respect to the upper and lower sections of the LV myocardium, the noncompacted layer in each segment of the upper section is thinner than that in each segment of the lower section, whereas the compacted layer of the upper section is thicker than that of the lower section. This study suggests that the densification of the fetal LV myocardium occurs gradually from base to apex and from the anterior to lateral, posterior, and inferior walls. This finding aids in further understanding the process of myocardial densification and provides a diagnostic reference for noncompaction of noncompaction cardiomyopathy (NCCM). Noncompaction cardiomyopathy (NCCM) is a rare cardiomyopathy that is characterized by excessively prominent trabeculae in the biventricular and deep intertrabecular recesses . TrabecuWe prospectively enrolled 56 pregnant women  who were referred to the echocardiography department of our hospital for prenatal examination between February 2016 and April 2016. Routine and prenatal system examinations were performed to exclude potential cardiac abnormalities. All fetuses showed normal development. All patients had previously provided written informed consent. The study protocol was approved by the ethics committee of the Second Affiliated Hospital of Xi'an Jiaotong University.Fetal echocardiography was performed with Voluson E8 ultrasound scanner  using a RAB6-D transducer with 2\u20138\u2009MHz (BT12). The examination was performed under the written consent of each patient, and pregnant women were kept in the supine or left lateral position, if needed. In the short-axis view of the heart, the LV wall was divided into an upper and lower section at the level of the papillary muscle Figures . Then, tStatistical analyses were performed using SPSS version 23.0 . All measurement data were expressed as mean \u00b1 standard deviation (x\u00b1s). One-way ANOVA was performed to compare the NC/C ratio in the four divisions of the LV wall. The NC/C ratios in the upper and lower sections were compared using paired-sample t-test. A two-tailed P-value of < 0.05 was used as a cutoff for statistical significance.The muscular layer of the LV wall of the fetal heart can be divided into two layers according to the ultrasound image, that is, the compaction layer and noncompaction layer. The compaction layer is located in the epicardial myocardium, which is surrounded by a hypoechoic circular layer with a uniform internal structure. The noncompaction layer is located in the endocardial myocardium, which is hyperechoic and surrounds the inner side of the myocardium of the heart. Its internal structure is less compact, and the side near the endocardium is uneven with some small trabecular protuberances. This structure is more prominent from the bottom to the apex, and the most apparent two-layered structure boundary was present at the level of the papillary muscle .The specific thickness of all 8 segments of the compacted and noncompacted layers was measured, and the NC/C ratios of the LV myocardium were calculated. All parameters mentioned above were measured in triplicate to obtain the mean value, and the NC/C ratios were determined . The NC/The NC/C ratios in the four segments were further compared. The NC/C ratios of the LV myocardium was 0.807 in the anterior wall , 1.460 in the posterior wall , 1.674 in the lateral wall , and 1.593 in the inferior wall  . One-way MYH7, MYBPC3, and TTN genes were the most prevalent [NCCM is an increasingly recognized type of cardiomyopathy with the presence of an extensive trabeculated myocardium separated into two distinct layers: NC and C , 13. In revalent , 18. PreOur study revealed that the myocardium layer of the LV of the fetal heart can be divided into two layers according to the ultrasound image, that is, the C myocardium and N myocardium. The two-layered structure of the myocardium shown on the ultrasound closely corresponds with the embryonic development of the heart . At the However, our study also has limitations. This study is only a preliminary study of the NC and C layers of the fetal heart, and the study is limited to fetuses with a gestational age of 23\u201331 weeks. We could systematically study the fetal cardiac compaction and noncompaction layer and their ratios at different time points during early, middle, and late pregnancy in a future study. If such observations can be made in the future, it will aid in the elucidation of the complete process of human heart compaction during embryonic development. Furthermore, because the ratio of the NC/C layer depends on the location where it is measured, the results strongly depend on the observer. The reproducibility of the results and interobserver variability should not be ignored. Thus, a future study is needed to confirm this conclusion."}
+{"text": "Targeting mPGES-1 is envisioned as a safer alternative to traditional non-steroidal anti-inflammatory drugs (NSAIDs). Herein, we compared the effects of mPGES-1 inhibitor Compound III (CIII) with the cyclooxygenase (COX)-2 inhibitor NS-398 on protein and lipid profiles in interleukin (IL)-1\u03b2-induced A549 lung cancer cells using mass spectrometry. Inhibition of mPGES-1 decreased PGE2 production and increased PGF2\u03b1 and thromboxane B2 (TXB2) formation, while inhibition of COX-2 decreased the production of all three prostanoids. Our proteomics results revealed that CIII downregulated multiple canonical pathways including eIF2, eIF4/P70S6K, and mTOR signaling, compared to NS-398 that activated these pathways. Moreover, pathway analysis predicted that CIII increased cell death of cancer cells  while NS-398 decreased the same function . In our lipidomics analyses, we found alterations in nine phospholipids between the two inhibitors, with a stronger alteration in the lysophospholipid (LPC) profile with NS-398 compared to CIII. Inhibition of mPGES-1 increased the concentration of sphinganine and dihydroceramide (C16:0DhCer), while inhibition of COX-2 caused a general decrease in most ceramides, again suggesting different effects on cell death between the two inhibitors. We showed that CIII decreased proliferation and potentiated the cytotoxic effect of the cytostatic drugs cisplatin, etoposide, and vincristine when investigated in a live cell imaging system. Our results demonstrate differences in protein and lipid profiles after inhibition of mPGES-1 or COX-2 with important implications on the therapeutic potential of mPGES-1 inhibitors as adjuvant treatment in cancer. We encourage further investigations to illuminate the clinical benefit of mPGES-1 inhibitors in cancer.Pharmacological inhibition of microsomal prostaglandin E synthase (mPGES)-1 for selective reduction in prostaglandin E One third of NSCLC tumors have a mutation in the 2. In this study, we aimed to examine the effects on proteins and lipids in IL-1\u03b2-induced A549 cells after pharmacological inhibition of mPGES-1 or COX-2.While many of the studies conducted in the field of COX-1/2 and mPGES-1 inhibitors are specifically focusing on the eicosanoid profile, there is a lack of knowledge regarding the effects on the proteome and lipidome when targeting key enzymes in the biosynthesis of PGE2. Cells were seeded in 175-cm2 flasks with ventilated cap at a density of 2 million cells/flask and grown to 85% cell confluency. At confluency, the cells were induced with 5 ng/ml of IL-1\u03b2 (R&D Systems) in fresh medium and treated with either 10 \u03bcM mPGES-1 inhibitor Compound III (CIII)  or 0.1 \u03bcM COX-2 inhibitor NS-398 (Sigma-Aldrich), previously tested to yield reduction in PGE2 biosynthesis to the same degree during these settings , IL-1\u03b2 (IL-1\u03b2 + DMSO), CIII (IL-1\u03b2 + CIII), and NS-398 (IL-1\u03b2 + NS-398). After 24-h treatment, cell supernatants were collected and immediately stored at \u221280\u00b0C for prostanoid profiling. The cells were washed once with PBS (Sigma-Aldrich) and detached using trypsin\u2013EDTA (Sigma-Aldrich). Viable cells were counted by staining with trypan blue (Sigma-Aldrich). The cells were pelleted at 300 \u00d7 g for 5 min and then stored at \u221280\u00b0C until further processed. All experimental conditions were performed in technical triplicates. The cell culture experiments were performed in separate batches for proteomics and lipidomics analyses. Each batch of experiments, i.e., four conditions in triplicates, were quality controlled by staining of mPGES-1 and COX-2 using Western blot and by measuring extracellular PGE2 using prostanoid profiling as described below. Cell cultures were routinely checked for mycoplasma contamination using MycoAlert\u2122 PLUS kit  according to the manufacturer\u2019s instructions.A549 cells  were cultured in Dulbecco\u2019s modified eagle medium (DMEM), supplemented with 10% fetal bovine serum (FBS), 100 U/ml penicillin, 100\u00a0\u03bcg/ml streptomycin, 1 mM sodium pyruvate, and 6 mM glutamine  at 37\u00b0C in a humidified atmosphere containing 5% CO\u00ae Novex\u00ae Bis\u2013Tris gel system . Proteins were transferred to a polyvinylidene difluoride (PVDF) membrane by using a Trans-Blot SD semi-dry transfer cell , and the membrane was blocked with 5% milk  in PBS containing 0.1% Tween 20 (Sigma-Aldrich) for 30 min on a shaker at RT. Subsequently, the membrane was incubated with polyclonal antibody against either mPGES-1 [Dimethyl4]; charge: 2:5, rt_typical: 12 s; rt_min: 3\u00a0s; mz_tolerance: 10 ppm; missed_cleavages: 2; intensity_cutoff: 10; peptide_similarity: 0.6; averagine_similarity: 0.5. The identification result was mapped to the quantification result using \u201cIDMapper\u201d allowing 5-s retention time and 5-ppm mass deviation. Finally, the peptides across the samples were linked using \u201cFeatureLinkerUnlabeledQT\u201d allowing 60-s retention time and 10-ppm mass error deviation. Ingenuity Pathway Analysis  was applied to identified and quantified protein datasets in order to find altered pathways. The mass spectrometry proteomics data have been deposited to the ProteomeXchange Consortium via PRIDE  by \u201cmsconvert\u201d from ProteoWizard , sonicated in a water bath, and then split in two fractions: 150 \u00b5l for fatty acid profiling of total lipids using gas chromatography with flame ionization detector (GC-FID) and 350 \u00b5l for phospholipid analysis with LC-MS/MS. The fraction for CG-FID analysis was processed directly according to below. Butylated hydroxytoluene (BHT) was added to a final concentration of 0.1 mg/ml in the phospholipids fraction to prevent oxidation of lipids, and the samples were stored at \u221220\u00b0C until analyzed.Lipids were extracted from cell pellets according to a previously described method  and analyzed with GC-FID according to a previously described method . For the analysis of sphingolipids, cell pellets containing around 15 million cells were lysed with 1 ml of MeOH and sonicated in an ultrasound bath for 15 min. Samples were then centrifuged at 10,000 \u00d7 g for 15 min. Two separate methods were used for quantification of sphingolipids.Sphingolipids are named based on head group  with acyl chain length and degree of unsaturation in the amide-linked fatty acid , ceramides , hexosylceramides , lactosylceramides , and dihydroceramides , an aliquot of 100 \u00b5l of the extract was used. First, 10 \u00b5l of a mixture containing odd chain sphingolipids (one for each class) was added to the extract. After a vortexing step, 280 \u00b5l of MeOH and 190 \u00b5l of CHCl3 was added to the samples. Extraction was performed by sequential additions of H2O, CHCl3, and H2O , with a vortexing step after every addition. Samples were then centrifuged at 5,000 \u00d7 g for 10 min and the organic lower layer was transferred to another Eppendorf tube. The organic extract was then evaporated to dryness under vacuum and stored at \u221280\u00b0C until analysis. On the day of analysis, extracts were reconstituted in 200 \u00b5l of MeOH, sonicated for 2 min, vortexed, and filtered by centrifugation for 3.5 min at 3,500 \u00d7 g using 0.1-mm membrane spin filters . Extracts were then transferred into autosampler vials and 7.5 \u00b5l was injected for LC-MS/MS analysis.Extraction method 1: For the analysis of sphingomyelins  coupled to a Xevo TQ mass spectrometer . Two independent chromatographic separations were used on an Acquity UPLC BEH C8 column  equipped with an Acquity UPLC BEH C8 VanGuard precolumn. The chromatographic method and MS/MS selected reaction monitoring transitions are detailed elsewhere , IL-1\u03b2 (IL-1\u03b2 + DMSO), CIII (IL-1\u03b2 + CIII), and NS-398 (IL-1\u03b2 + NS-398). SYTOX Green Nucleic Acid Stain  was added to one set of triplicate wells and Annexin V Red Reagent  and Caspase-3/7 Green Reagent  were added to another set of triplicate wells. Staurosporine  at 1 \u00b5M was used as positive control. The cells were monitored using IncuCyte S3 (Essen BioScience) for 48 h. Four images per well at 10\u00d7 magnification were collected every third hour. The data were analyzed using IncuCyte S3 version 2018A (Essen BioScience) with individual mask settings for SYTOX Green, Annexin V Red Reagent, and Caspase-3/7 Green Reagent based on green or red fluorescence intensity. Results are presented as green object count per mm2 for SYTOX Green and active caspase-3/7 and as red object area (% confluence) for annexin V.Apoptosis assay: A549 cells were seeded at 20,000 cells per well in a 96-well tissue culture plate. The cells were let to attach overnight and treated the next day as specified in the section Cell Culture: Ctrl (DMSO), IL-1\u03b2 (IL-1\u03b2 + DMSO), CIII (IL-1\u03b2 + CIII), and NS-398 (IL-1\u03b2 + NS-398). SYTOX Green Nucleic Acid Stain (1:50.000) was used as marker for cell death. The cells were monitored using IncuCyte S3 for 70 h. Four images per well at 10\u00d7 magnification were collected every third or fourth hour. The data were analyzed using IncuCyte S3 version 2018A with individual mask settings for SYTOX Green (based on green fluorescence intensity) and confluency (phase object). Results are presented as percentage of total well area for confluency and green object count per mm2 for SYTOX Green.Proliferation assay: A549 cells were seeded at 5,000 cells per well in 96-well tissue culture plates. The cells were let to attach overnight and treated the next day as specified in the section Cell Culture. In addition, cells were treated with cytostatic drugs cisplatin (0.01\u2013100 \u00b5M), etoposide (0.01\u2013100 \u00b5M), or vincristine (0.001\u201310 \u00b5M) in combination with the treatment stated earlier: t test followed by the Benjamini\u2013Hochberg procedure (\u03b1 = 0.05) to account for false-positive discoveries. One-way ANOVA followed by pairwise independent t test with Bonferroni correction were used for testing statistical significance in prostanoid concentration, fatty acid composition of total lipids, phospholipid profile, and sphingolipid concentration. The level of significance was set to p < 0.05. Principal component analysis (PCA) was performed on the lipidomics data (excluding the prostanoid data) using SIMCA P+ version 12 .Statistical analyses were performed using GraphPad Prism 6.0 . Statistical significance of individual proteins was tested with independent 2 production and increased PGF2\u03b1 and TXB2 formation while NS-398 blocked the production of all prostanoids (The protein expressions of mPGES-1 and COX-2 were induced with IL-1\u03b2 in the presence or absence of CIII or NS-398 during 24 h of incubation (p < 0.01) across the dataset in the cytosolic and microsomal fractions was 860 and 882, respectively. The shared protein identities between the different treatment groups are shown in p = 0.00014) and Myosin light polypeptide 6 (p = 0.00014) with decreased Autism susceptibility gene 2 protein (p = 1.6E\u221211), Heterogenous nuclear ribonucleoprotein C-like 2 (p = 6.2E\u221205), L-aminoadipate-semialdehyde\u2005\u2005dehydrogenase-phospho-pantetheinyl transferase (p = 0.00013), ATP-dependent DNA helicase Q1 (p = 0.00016), 4F2 cell-surface antigen heavy chain (p = 0.00021), Nucleolar protein 56 (p = 0.00024), and Pescadillo homolog (p = 0.00024). These proteins were not altered by IL-1\u03b2 alone (p = 2.5E\u221209) and TGF-beta receptor type-2 (p = 5.1E\u221206). However, only the effect in 60S ribosomal protein L21 was unique for NS-398 as the change in TGF-beta receptor type-2 was also observed with IL-1\u03b2 alone , cell death of tumor cells , necrosis , and cell death . NS-398 treatment was predicted to increase synthesis of proteins  and metabolism of proteins  and decrease cell death of cancer , cell death , necrosis , and cell death of tumor cells .Quantitative LC-MS/MS-based proteomics was performed to analyze differences in protein levels in an untargeted manner. Subcellular fractionation and HPLC-based reversed-phase separation at peptide level were employed to achieve deep proteome coverage and stable isotope labeling of peptides was utilized for relative protein quantification. The total number of quantified proteins at the significant level (2X(1) = 0.51, R2X(2) = 0.18] showed separate clustering of the two inhibitors in a scores plot  and active caspase-3/7 for measuring apoptosis. We did not observe any significant changes in cell death between the two inhibitors or compared to IL-1\u03b2 alone  antagonist   of the possible increase in other prostanoids needs to be evaluated in vivo.It is difficult to extrapolate our prostanoid results via actin. Autism susceptibility gene 2 protein is implicated in neurodevelopment, and deletion of this gene has been associated with lung adenocarcinoma . Pescadillo homolog is an estrogen-induced protein implicated in breast cancer development and progression  and the role of each protein to be tested in functional assays. It should be pointed out that the inhibitors may influence enzyme activity 2  with decrease in Cers (C24:1 and C24:0) . This effect was unrelated to COX-2 inhibition since other tested COX-2 inhibitors did not alter sphingolipid levels. In line with this, several studies have shown that accumulation of DhCers precedes apoptosis in cancer cell lines. Jiang et al. have demonstrated this effect for vitamin E forms of \u03b3-tocopherol in A549 cells  in an ovarian cancer cell line  or inhibition of anti-apoptotic mediators Bcl-2 and Bcl-XL, and activate JNK signaling and suppress Akt signaling that ultimately decreases cell survival. The reduction in ceramides together with activation of mTOR suggest increased cell survival or less apoptosis with NS-398 treatment. However, the molecular effect of Cers is dependent on acyl chain length and saturation degree  previously described in cancer cell death. The change in cell death was demonstrated in live cell imaging experiments, where CIII decreased proliferation and potentiated the cytotoxic effect of cisplatin, etoposide, and vincristine. Hence, inhibition of mPGES-1 can sensitize cancer cells to treatment with cytotoxic drugs, and this could be a valid therapeutic strategy to improve efficacy of existing chemotherapy. Results from our study motivate the development of selective mPGES-1 inhibitors as therapeutic adjuvants to treat cancer.In conclusion, we report that selective inhibition of mPGES-1 or COX-2 affects protein and lipid profiles differently in A549 cells. Our proteomics and lipidomics data suggested a pro-cell death state with inhibition of mPGES-1 compared to inhibition of COX-2 based on 1) changes in molecular pathways based on alterations in protein profiles and 2) accumulation in two sphingolipid species , Innovative Medicines Initiative , Stockholm County Council , the Swedish Rheumatism Association (grant no: R-755861), King Gustaf V\u2019s 80 Years Foundation (grant no: n/a), the Swedish Cancer Society (grant no: CAN2016/739), the Cancer Society in Stockholm (grant no: 171073), and funds from Karolinska Institutet (grant no: n/a).P-JJ is member of the board of directors at Gesynta Pharma, a company that develops anti-inflammatory drugs. The remaining authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest."}
+{"text": "In this work, a deep walk embedding method is developed for predicting DTIs from a multi-molecular network. More specifically, a multi-molecular network, also called molecular associations network, is constructed by integrating the associations among drug, protein, disease, lncRNA, and miRNA. Then, each node can be represented as a behavior feature vector by using a deep walk embedding method. Finally, we compared behavior features with traditional attribute features on an integrated dataset by using various classifiers. The experimental results revealed that the behavior feature could be performed better on different classifiers, especially on the random forest classifier. It is also demonstrated that the use of behavior information is very helpful for addressing the problem of sequences containing both self-interacting and non-interacting pairs of proteins. This work is not only extremely suitable for predicting DTIs, but also provides a new perspective for the prediction of other biomolecules\u2019 associations.Predicting drug\u2013target interactions (DTIs) is crucial in innovative drug discovery, drug repositioning and other fields. However, there are many shortcomings for predicting DTIs using traditional biological experimental methods, such as the high-cost, time-consumption, low efficiency, and so on, which make these methods difficult to widely apply. As a supplement, the  Prediction of drug\u2013target interactions (DTIs) is one of the most important steps in the genomic drug discovery pipeline and drug repurposing , the purRecently, several computational methods were developed and considered to discover the DTIs . Many reIn the MAN, we not only used DTI data, but also added other biomolecules\u2019 interactions information in the network. The main idea of this work comes from computational systems biology , networkTo summarize, In order to illustrate that the behavior features of nodes contain more useful information than the traditional attribute features of biomolecules, we compared the performances of various well-known classifiers based on these two different types of features under five-fold cross-validation in various evaluation criteria. Cross-validation is mainly used to prevent over-fitting caused by over-complicated models. It is a statistical method used to evaluate the generalization ability of training data. For the five-fold cross-validation, the original data is randomly divided into five parts, and four parts are selected as the training set each time, and the remaining one part is used as the test set. The cross-validation was repeated five times, and the average value for the accuracy of the five runs was taken as the evaluation index of the final model. In this work, the number of the five training sets is 17,770, 17,770, 17,770, 17,770, 17,776, respectively; the number of five test sets is 4444, 4444, 4444, 4444, 4448, respectively.In the experiment, we employed the state-of-the-art method Support Vector Machine (SVM) to assess the performance between the two different features on the integrated dataset. The two features include attribute features and behavior features. The attribute features are obtained from the molecular sequence information. The behavior features are derived from the MAN. We hypothesized that the MAN may assist in improving prediction performance. In order to ensure reasonable fairness, we set the same parameters to compare the performances of the two different features on the model. The results are shown in Meanwhile, receiver operating characteristic (ROC) curves are widely applied in many fields, such as machine learning, data mining, and so on. We also used ROC curves to measure the comprehensive index between the False Positive Rate and the True Positive Rate continuous variable. The area under curves (AUC) could be shown as the prediction accuracy of the classifier. The larger the AUC, the higher the accuracy.The ROC curve of the SVM classifier based on attribute feature and behavior feature with 5-fold cross-validation is shown in In order to illustrate that the behavior features are indeed better than the attribute features, either on a single liner classifier or on an ensemble classifier, we also implemented the RF model on our experiment. In this experiment, we set the same parameters to compare the performances of the two different features on the model, the results are shown in The ROC curves of the RF classifier based on attribute feature and behavior feature with five-fold cross-validation are shown in As mentioned above, it is apparent that the constructed MAN network can receive accurate DTI detection because more behavior information can be obtained from the complex biomolecular associations network. The presented complex network has made an indelible contribution to the prediction of DTIs. The main innovations can be summed up in the following two aspects: (1) Construction of the MAN network, which integrates five types of biomolecules and nine known relationships between them. It can provide a novel potential helpful tool for predicting new DTIs across the whole field of bioinformatics; (2) Behavior features were obtained by deep walk network embedding method, which can further optimize the performance of classifiers. This method can achieve more helpful information in the data than traditional attribute features. In a few words, experimental results revealed that our presented network is not only extremely suitable for DTI prediction, but also fit for other biomolecule associations prediction.In this article, the heterogeneous data input to the MAN is collected from nine known relationships: DTIs, drug\u2013disease associations (DDAs), protein\u2013protein interactions (PPIs), protein\u2013disease associations (PDAs), lncRNA\u2013target interactions, protein\u2013miRNA interactions, lncRNA\u2013disease interactions, lncRNA\u2013miRNA association, miRNA\u2013disease association; which were shown in From the collection of nine known relationships between five types of biomolecules annotated in many well-known databases which are mentioned above, we constructed a multi-molecular network, also called MAN by linking two arbitrary association nodes. The complex MAN is shown in The drug molecular data was extracted from DrugBank database. To further process these data better, we calculated the Morgan fingerprints of drug molecules with the RDKit  tool in The total protein sequence information was collected from the STRING database. For protein sequences, 20 types of amino acids were classified into four categories by the polarity of the side chain information, which contained , , , and . Similarly, each protein sequence was transformed into a 64-dimensional (4 \u00d7 4 \u00d7 4) feature vector by counting the frequency of every subsequence appearing in the whole protein sequence, and each dimension of the vector is the normalized frequency of the corresponding 3-mer in the sequence .In 2014, G a random vertex vi is uniformly sampled as the root of the random walk. Then, a walk samples uniformly from each vertex to the adjacent nodes until it reaches the maximum length. In this way, the process of text generation is simulated to find sequence information for each node in the network, e.g., 14->V11->V12->V13, V27->V23->V24->V21->V22, V34->V32->V36->V31->V37V, and so on. Random walks on MAN is shown in In the MAN, a homogeneous network was constructed by five research objects  at the cellular level. On the assumption that there is a network graph Skip-Gram is one type of the word2vec model, which was proposed by vi\u2013c and vi+c are the left and right context of the word vi, c is the size of the window. In addition, we map each vertex vk to its current representation vector \u03a6(vk)d\u2208 R.where, log value of the probability of other nodes in the sequence when the node appears, and the vector representation of the node is updated with the help of the stochastic gradient descent algorithm.The conditional probability of each vertex in the sequence is calculated, that is, the Classification is one of the important tasks in data mining. The so-called classification is to classify the unknown data into existing categories according to its characteristics or attributes. That is to say, using given categories and known training data to learn classification rules and classifiers, and then predicting the unknown data.n-dimensional space (n is the number of features), and each eigenvalue is a value of a specific coordinate. Then, classification is carried out by finding the hyper-planes that distinguish the two classes. In the sample space, the partition of hyper-planes can be described by the following linear equations:Support Vector Machine (SVM) is a supervised machine learning algorithm, which is mainly used for binary classification problems . In this+1, \u22121}, for a classifier, f(x) > 0 represents the class that label is +1, otherwise, it is \u22121. In order to maximize the distance between the nearest two classes of samples on both sides of the plane, we need to find two hyper-planes parallel to and equal to the hyper-plane.Assuming that it has completed the separation of samples and the labels of the two samples are {max(1/||w||). Thus, SVM can provide a good generalization ability for classification problems.Then, to maximize the interval between these two hyper-planes Random forest is a relatively novel machine learning model. In the 1980s, n features 1, f2, f3, \u2026, fnf, the Gini variable importance measures (VIM) of each feature fi can be described as follows:In the process of feature importance assessment using RF, it depends on the contribution of each feature to each tree in the RF. The contribution is usually measured by Gini index or error rate of out-of-bag (OOB) data. Assuming that there is m represents m classes. pnm is the proportion of class k in node n.Where, In our study, in order to size up the effectiveness and steadiness of our constructed model, we counted the results of five parameters: Accuracy (Acc), recall , specificity , precision  and Matthews\u2019s Correlation Coefficient (MCC), respectively. These parameters can be represented as follows:TP is the count of true interacting pairs correctly predicted, i.e., the number of true positives. FP refers to the quantity of false positives, which is described as the number of true non-interacting pairs falsely predicted. TN means the quantity of true negatives, in other words, it represents the number of true non-interacting pairs predicted correctly. FN represents the quantity of false negatives, i.e., the true interacting pairs falsely predicted to be non-interacting pairs. According to these parameters, a Receiver Operating Characteristic (ROC) was plotted to evaluate the performance of the random projection method. Then we can calculate the AUC to assess the performance of the model.where In this study, we investigated the relationship among drug, protein, miRNA, lncRNA and disease. Then, we developed a novel method to discover the potential interaction between drug and target on a large scale. We constructed a novel scheme based on the above five molecules and nine relationships arbitrarily between two molecules, which is called the MAN network. By focusing on this network, each node can obtain a feature vector by using node behavior information . To our knowledge, this is the first report to predict DTIs from a complex heterogeneous network in an overall view at the cellular level. Experimental results demonstrated that our model has achieved good prediction results, which is a new attempt to predict DTIs. This work would have potential applications for drug discovery and repositioning.The raw data required to reproduce these findings cannot be shared at this time as the data also forms part of an ongoing study. Requests to access the datasets should be directed to the corresponding author.Z-HC and Z-HY conceived the algorithm, carried out analyses, prepared the data sets, carried out experiments, and wrote the manuscript. Z-HG and H-CY designed and performed the experiments. G-XL and Y-BW analyzed the experiments and checked the manuscript. All authors read and approved the final manuscript.The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest."}
+{"text": "P\u2009>\u00a00.05); however, the milk total Se levels and milk glutathione peroxidase (GSH-Px) activities were higher with Nano-Se supplementation than sodium selenite (P\u2009<\u20090.05). At the end of the experiment, Nano-Se supplementation significantly increased plasma Se levels and GSH-Px activity, compared with the sodium selenite supplement. The mRNA expression levels of glutathione peroxidase 1, 2 and 4; thioredoxin reductase 2 and 3; and selenoproteins W, T, K and F were markedly upregulated (P\u2009<\u20090.05) in the mammary gland of the Nano-Se group. Thus, the source of selenium plays an important role in the antioxidant status and in particular the Sel gene expression in the mammary glands of dairy cows, both being stimulated by nano sources.Supplementation with selenium is common for dairy cows, but the importance of selenium source is not clear. This study aimed to compare nano-selenium (Nano-Se) and sodium selenite supplements for dairy cows on lactation performance, milk Se levels and selenoprotein (Sel) gene expression. Twelve multiparous Holstein cows were randomly divided into two groups: a control group fed a basal diet plus 0.30\u00a0mg Se/kg of DM as sodium selenite or Nano-Se for 30\u00a0days. Dry matter intake, milk yield and composition were not affected by dietary Se source ( Selenium (Se) is a trace element nutrient that acts as a cofactor of antioxidant enzymes (such as glutathione peroxidases) and affects the antioxidant activities and immune functions of animals . Se defiMilk potentially makes an important contribution to a person\u2019s daily intake of Se, as consumption of 100\u00a0g milk/day will provide at least 10% of the daily Se requirement for adults . TherefoNano-selenium (Nano-Se) is a new method of supplementing with Se that uses a protein as a dispersant and the red element Se as a membrane. Nano-Se contains more active centres than conventional Se products, with higher biological activity and lower toxicity, and is more effective at increasing selenoprotein (Sel) expression \u201316. ElemAll experimental procedures were approved by the Animal Care and Use Committee of Henan Agricultural University, which was performed according to the Guidelines for Experimental Animal of the Ministry of Science and Technology .Twelve multiparous Holstein cows  were randomly divided into two groups with six cows in each group. Treatment diets consisted of a basal diet plus 0.30\u00a0mg Se/kg DM from sodium selenite  for the control group and a basal diet plus 0.30\u00a0mg Se/kg DM from Nano-Se  for the Nano-Se group. The experimental cows were fed a total mixed ration (TMR). The experimental period was 35\u00a0days, with 5\u00a0days of adaptation and 30\u00a0days of sampling. Cows were housed in a naturally ventilated barn, fed individually in their own troughs. They were milked three times daily at 6:00, 14:00 and 20:00\u00a0h and were fed ad libitum a total mixed ration (TMR) after each milking. The ingredients and chemical composition of the diets are reported in Table Feed offered and refused were measured daily for each cow and recorded throughout the experimental period to calculate DM intake. Milk production was recorded daily, and consecutive morning, midday and evening samples were collected every 7\u00a0days . Milk samples were divided into two, one stored with preservative at 4\u00a0\u00b0C for the analysis of fat, protein and lactose by infrared spectrophotometry , and the second stored at \u2212\u200980\u00a0\u00b0C for later chemical analysis. Samples of TMR were collected once per week and stored at \u2212\u200920\u00a0\u00b0C for later chemical analysis.g for 30\u00a0min at 4\u00a0\u00b0C. Aliquots of plasma were frozen (\u2212\u200980\u00a0\u00b0C) until further analysis.Blood samples were collected from the coccygeal vein before feeding using evacuated tubes containing heparin on the 30th day of the experiment. After blood collection, plasma was obtained by centrifugation at 2000\u00d7The concentrations of Se in feed sample, milk and plasma samples were analysed by the fluorometric method . Brieflyg for 30\u00a0min at 4\u00a0\u00b0C, after which the upper layer of milk fat was removed and the resultant milk whey was diluted 1:10 with PBS to detect the GSH-Px enzyme activity. The GSH-Px activity of both the milk whey and plasma was measured using a glutathione peroxidase (GSH-Px) assay kit  according to the manufacturer\u2019s instructions.Milk samples were centrifuged at 10,000\u00d7n\u2009=\u20095) was obtained percutaneously on day 30, as described previously [Bos taurus sequence (https://www.ncbi.nlm.nih.gov/) to produce PCR products. Gene symbols and primer sequences are presented in Table A biopsy sample of mammary gland tissue , time (T) and their interactions (D\u2009\u00d7\u2009T). Differences between means were tested using the LSD test. GPX-PX activity, blood parameters and gene expression were analysed using Student\u2019s t tests. A P value <\u20090.05 was considered statistically significant.Data statistics and differences among groups were analysed by SPSS 25.0 . The data describing DM intake, milk yield, milk composition and milk Se were analysed for significant differences using a repeated measures general linear model. The model included the factors of diet (P\u2009>\u20090.05) for cow DMI, milk yield, milk protein, fat or lactose concentration .The milk GSH-Px activity is presented in Fig.\u00a0P\u2009<\u20090.01, Table Compared with controls, cows in the Nano-Se treatment had increased plasma Se and plasma activity of GSH-Px  was not affected by the Nano-Se treatment P\u2009>\u20090.0, Table 5In the present research, the Se concentration in the basal diet was measured as 0.05\u00a0mg/kg DM, which is the critical level for Se deficiency in cattle. A meta-analysis has indicated that cows supplemented with Se yeast (6\u00a0mg/head) each day had increased milk Se levels . As an iThe scientific literature on the effects of Se on lactation performance is inconclusive. Several studies found that dietary Se has no significant effect on milk yields and components , 26. On Increased serum GSH-Px activity with Nano-Se supplementation has been reported in laying hens . SimilarOur results showed that Nano-Se was more effective than inorganic Se at increasing the milk Se concentration. A research with broiler chickens has also demonstrated that nanoparticles are more effectively absorbed in comparison with the usual dietary additive, sodium selenite . The difSe exists in the form of selenoproteins (Sels) that play important biological function in dairy cows . The uprNano-Se was more effective than sodium selenite at improving antioxidant status and increasing milk Se levels of dairy cows. The Sel expression was increased in the mammary gland tissue of dairy cows with Nano-Se supplement when compared with sodium selenite supplementation. The present findings provide initial evidence of benefits of Nano-Se supplementation in dairy cows."}
+{"text": "Milk and dairy products, such as cheese and yogurt, can be useful sources of selenium-enriched products to increase human Se intake. We studied the effect of dairy cow feed supplementation with inorganic plus organic Se on milk yield, and on the Se enrichment of milk and dairy products to obtain naturally enriched products. Two groups of lactating cows were assigned to two feeding treatments, both with 0.240 mg Se/kg of ration dry matter: One was supplemented with inorganic Se, the other with a 60/40 ratio of inorganic Se/organic Se. The results showed that the inclusion of inorganic plus organic Se did not affect the yield or basic chemical composition of milk; however, the Se content of milk was higher with inorganic plus organic Se supplementation. Cheese from cows fed inorganic plus organic Se had a higher Se content, although this effect was not observed for yogurt. At a moderate level in the diet, sodium selenite plus Se yeast may be more effective than only inorganic Se, increasing the Se concentration in milk and cheese.\u00ae), at 0.144 and 0.096 mg Se/kg of ration DM, respectively. The results indicated that, in general, the IOSe treatment did not modify the metabolic profile, and even decreased the total oxidant status (p < 0.05) and did not lead to a deterioration of quality and yield of milk. However, milk and cheese from IOSe had higher Se content  than CON (p < 0.01), but this effect was not observed in yogurt. In general, physical or sensorial parameters of cheeses did not show differences between treatments. Moderate inorganic plus organic Se supplementation may be more effective than inorganic Se, increasing the Se content in milk and cheese, without causing a deterioration in quality or productive parameters.This work studied the effect of dairy cow ration supplementation with inorganic plus organic Se on metabolic status, milk yield, and the quality of milk and dairy products, especially its Se content. Twenty multiparous Holstein Friesian lactating cows were assigned to two feeding treatments. The cows were fed with 22.5 kg dry matter (DM) of total mixed ration (11.75 kg DM of forage plus 10.75 kg DM of concentrate) by head. There were two different concentrates with the same Se content (0.240 mg/kg of ration DM) but with different Se sources: The control (CON) was supplemented with inorganic Se (sodium selenite); and the other (IOSe) was supplemented with sodium selenite plus organic Se (Sel-Plex Selenium is an essential micronutrient required in trace quantities for normal growth and development of animals, which plays an important role in many metabolic functions related to antioxidant activity and the prevention of degenerative processes . This elIn situations of Se deficiency, one option would be to improve the selenium content of foods. Particularly, an opportunity in the livestock sector may be to increase Se levels in animal origin foods, without resorting to extra manipulations after its production. It is known that Se is one of the minerals with the best responsiveness of milk of dairy cows to dietary supplementation . MoreoveThe bioavailability of Se strongly depends on the chemical form found in the diet . SeleniuAccordingly, there is considerable interest in supplementing the diets of lactating animals with organic Se, and there are many studies that show positive results with increased levels of Se in milk ,19,20,21Recent studies indicate that the supplementation of the diets of dairy cattle with organic Se could affect the aromatic profile of milk and derived dairy products such as cheese ,27. In aAs a consequence, the hypothesis of this work was that the supplementation of lactating cow feed with inorganic plus organic Se at moderate levels would improve the Se status of the animal\u2014the concentration of Se in milk and dairy products\u2014without negatively affecting their nutritional or organoleptic properties. The aim of this work was to study the effect of sodium selenite plus Se yeast supplementation on feeding dairy cows\u2019 (within the levels of European Union legislation and with a wide safety margin) health status, yield, milk composition, and the chemical and technological quality of dairy products, in order to obtain enriched products for the market.The experimental procedure was performed according to the protocol approved (A13170805) by the Ethics Committee of the University of Murcia and the Authorities of the Region , according to the European Union regulation (2010/63/EU Directive) related to the protection of animals used for scientific purposes .The trial was conducted over 2 months at the Dairy Cattle Unit of Veterinary Teaching Farm (University of Murcia). Twenty multiparous Holstein Friesian lactating cows were used in the experiment. Animals had an average weight of 649.7 \u00b1 48.55 kg LW, 170.2 \u00b1 33.15 days in milk, and a 30.0 \u00b1 4.85 kg/day of milk yield. They were randomly distributed into two groups of 10 cows in each. Thus, the cows were housed in two pens separated by an electric fence, with a straw-covered floor, provided with feeders for total mixed rations (TMR), and with free access to water.\u00ae . This additive is rich in organic Se derived from a specific strain of Saccharomyces cerevisiae, containing >63% selenomethionine (SeMet) (CNCM I-3060).For the experiment, each group of cows was assigned to a feeding treatment: One was a control, supplemented with inorganic Se (CON); the other was supplemented with inorganic and organic Se (IOSe). Both TMR diets had the same base diet , with a The estimated Se levels were similar in both diets, and <55% of the maximum level of Se in the ration according to the legislation of the European Union. Regulation 2019/804 for CNCM I-3060  admits a0, T21 and T49, respectively), and individual milk samples (representatives of the morning and afternoon milking) were also taken. Samples were divided into two subsamples: One (approximately 150 mL) for pH determination, and fat, protein, and lactose analysis; the other (approximately 100 mL), which was stored at \u221220 \u00b0C, was analyzed for mineral content  of the milk.Cows were milked twice a day at 7:00 h and 19:00 h; and on days 0, 21, and 49, the individual milk yield was recorded : One sample was used to analyze the mineral content  and the GSH-Px activity of the whole blood; and the other sample was centrifuged (3000\u00d7 g for 15 min) to obtain plasma and stored at \u221280 \u00b0C until metabolic profile determination was carried out. A sample of whole blood per animal was sampled with K3EDTA tubes  to analyze hemoglobin (Hb).Blood samples of all cows were collected via coccygeal venipuncture before morning feeding on days 0, 21, and 49 of the experiment. Two samples per animal of whole blood were taken using Lithium-heparin tubes  in a proportion of 1 g/100 L. Finally, yogurts were packaged and incubated at 45 \u00b0C during 4 h and kept at 4 \u00b0C after incubation process.Yogurts were prepared on three different days, after 49 day of the experiment,  at the Food Technology Pilot Plant of the University of Murcia. Each day, six yogurts were prepared per treatment, 3 were used for physicochemical analysis, and 3 for sensorial study. One liter of pasteurized milk (95 \u00b0C during 240 s) was allocated in a stainless-steel vat with 100 g of milk powder and 20 g of sugar, mixing and heating until 95 \u00b0C. Then, it was left to temper at 45 \u00b0C, and 2  and 0.3 mL/kg of calf rennet  supplied by Caglio Star Espa\u00f1a, S.A.  were added. It was left to rest for 40 min. After that time, it was cut for 3 min with a speed of 25%, leaving to stand for 5 min. Then, 80 g of salt was added and stirred again for 1 min. Following stirring, it was left to rest for a further 10 min and stirred again for 1 min. Finally, the whey was drained, and the curd was filled into molds without pressing. The cheese was left draining in refrigeration at 4 \u00b0C during 24 h. Each cheese was split into two halves, one for physicochemical analysis and the other for sensorial study.Also, cheeses were prepared on three different days, after 49 d of the experiment,  at the Food Technology Pilot Plant of the University of Murcia. Each day three cheeses were prepared per treatment. Ten liters of pasteurized milk (75 \u00b0C during 20 s) were allocated in a 12 L double 0 stainless-steel vat , and tempered for 10 min until a constant temperature of 33\u201334 \u00b0C. In stirring, 0.3 mL/kg of anhydrous CaClForages , concentrates, and TMR (CON and IOSe) were weekly sampled. TMR samples were pre-dried in a convection oven at 60 \u00b0C for 48 h. All samples were ground to pass a 1 mm screen . Feed samples were analyzed by the Association of Official Analytical Chemists (AOAC) procedures : dry mat3, and Se and other minerals  were determined by inductively coupled plasma-mass spectrometry  using the method of standard addition.Samples of feeds, whole blood, milk, and dairy products were digested in a microwave digestion system  in the presence of HNO+, in occurrence with glutathione reductase and NADPH. The rate of reduced GSH formation is monitored by the decreasing of absorbance produced by the consumption of NADPH. Hb was analyzed by an automated hematological analyzer .GSH-Px activity and Hb were analyzed in whole blood samples. GSH-Px activity was determined with a commercial kit  adapted from the method of Paglia and Valentine . This teThe general metabolic profile evaluation in plasma samples  and urea) was analyzed. These assays were carried out on an automated chemistry analyzer . For these assays commercial Beckman kits  were used. Thus, glucose was measured by the hexokinase G-6-PDH method; total cholesterol was determined by the cholesterol dehydrogenase method; total proteins were measured by the adapted Weichselbaum method ; total t+ is reduced to NADH, of which absorbance changes are directly related with the \u03b2-BHB concentration Plasma non-esterified fatty acids (NEFAS) was quantified by commercial Randox kit . This NEFAS assay protocol is based on a colorimetric method associated to enzymatic incubation with acyl-CoA-synthetase, acyl-CoA-oxidase, and peroxidase.The \u03b2-hydroxybutyrate (\u03b2-BHA) was determined by commercial Randox kit . This method is based on the oxidation of \u03b2-BHA to acetoacetate by the enzyme \u03b2-BHA dehydrogenase, where concomitantly the NAD\u2022+) performed by antioxidants present in the sample. TOS procedure is based on the oxidation of ferrous ion to ferric ion in the presence of oxidant species of samples, thus ferric ion making a colored complex with xylenol orange in acidic medium, that can be measured spectrophotometrically.In addition, TAC (antioxidant capacity) and TOS (oxidative status) were analyzed in plasma by the methods described by Erel ,39. TAC The proximate composition of milk  and yogurt (fat and protein) were analyzed by infrared spectroscopy  according to IDF standard 141B:1996 . In chee\u00ae pH meter  connected to a Crison\u00ae glass combined electrode (1952\u20132002) previously calibrated at room temperature.pH was directly determined in milk and yogurt. On cheese samples, pH measurements were made in grated cheese (5 g \u00b1 0.1 mg) suspended in 30 mL of distilled water and stirred for 10 min. The measurements were carried out using a CrisonYogurt syneresis (released whey) was measured after weighing 50 g of yogurt sample and centrifuging it at 3000 rpm for 20 min in order to subsequently measure the amount of whey drained, used as an index of syneresis. Cheese yield was calculated as the amount of cheese expressed in kilograms obtained from 100 kg milk. The color/lightness attributes were determined in dairy products with a CR-400 MINOLTA colorimeter . An average of three L* (lightness), a* (redness), and b* (yellowness) readings was taken per replication.3) rindless, and at room temperature (20 \u00b0C). For TPA tests, each sample was compressed twice to a distance of 15 mm using a P/100 probe (compression platen of 100 mm of diameter) moving at a speed of 1 mm/s. The software Exponent Lite  was used and the texture parameters determined were hardness (expressed as N), cohesiveness (dimensionless), gumminess , elasticity (expressed as mm), chewiness , and adhesiveness (expressed as N s), calculated as described by Bourne [Texture profile analysis (TPA) was performed on cheeses using a texture analyzer  equipped with a load cell of 500 N. The analyses were conducted in triplicate on cheese cube shaped samples  was considered as an intra-subject factor. For cheese and yogurt, physicochemical data were analyzed using the mixed procedure of the same statistics software, considering the type of treatment as a fixed effect, and the elaboration batch as a random effect. Student\u2019s T tests were used for sensorial analysis using the same software. Results were considered statistically significant at at p < 0.05.Data of whole blood, plasma, and milk were analyzed using a general linear model with repeated measures in IBM SPSS Statistics software , where the type of treatment (CON or IOSe) was considered as an inter-subject factor and the time of measure at different days of trial (Tp > 0.05) by the treatment, except for zinc levels, which were lower in the blood of CON cows. In addition, hemoglobin and GSH-Px activity were unaffected by treatment (p > 0.05). However, GSH-Px activity was increased (p < 0.001) throughout the trial . No interactions between treatment and time were found (p > 0.05) on these parameters.The effect of feeding inorganic plus organic selenium supplement on the mineral  content of the whole blood of dairy cows at 0, 21, and 49 days of experiment are presented in p < 0.001) of the cholesterol concentration  and significant decrease (p < 0.01) of the \u03b2-hydroxybutyrate  were observed throughout the experiment. An effect of the type of ration (p < 0.05) and an interaction between the time and ration (p < 0.01) were found for \u03b2-hydroxybutyrate, with lower values in the CON group. In addition, the TAC was not modified by the treatment, while TOS was lower (p < 0.05) with IOSe diet. Other effects were not found for the parameters analyzed in the plasma.p > 0.05) in milk yield between treatments. In addition, the fat, protein, and lactose content, and pH of milk were unaffected (p > 0.05) by inorganic plus organic selenium supplementation. Regarding the composition of the mineral fraction of milk, no treatment effects were found (p > 0.05), except for the concentration of selenium in milk, which was higher (p < 0.01) in the IOSe group compared to the CON group . However, a day effect (p < 0.05) was observed for fat, protein, lactose, Zn, and Cu content, showing fluctuations throughout the trial in both treatments. In addition, no interactions between treatment and time were found (p > 0.05) on the yield, composition, or pH of milk.The effect of feeding with an inorganic plus organic selenium supplement on milk yield, composition, and pH of milk of dairy cows at 0, 21, and 49 days of experiment are presented in p > 0.05) between treatments on proximate composition, pH, mineral content (including selenium), syneresis, or colorimetric parameters of the yogurt. Only the Ca content was slightly higher (p < 0.05) in the CON treatment.p < 0.05) were found in the odor of cow\u2019s milk, which was slightly lower in IOSe yogurt. In addition, the overall acceptability showed differences (p < 0.05) between treatments. Thus, the CON group yogurt obtained higher evaluation results than the IOSe group yogurt. The other parameters evaluated were not affected (p > 0.05) by inorganic plus organic selenium supplementation.The results of the panelists\u2019 evaluation of yogurt are shown in p > 0.05) on proximate composition, except for the dry extract (p < 0.05) that was higher in the CON group. In terms of mineral composition of cheese, Ca, P, and Zn content was not modified by treatments (p > 0.05); but level of Cu showed greater level (p < 0.001) in CON cheese, and Se content was greater (p < 0.01) in IOSe than CON cheese . In addition, no effects of Se source were observed in cheese yield, colorimetric parameters, and texture profile (p > 0.05), except for elasticity (p < 0.01), which was slightly lower in CON cheese.p < 0.05) in the salty taste of cheese, it being greater in CON cheese; the other sensory parameters of cheese were unaffected by treatments (p > 0.05). In addition, there were no differences (p > 0.05) in the overall acceptability of CON and IOSe cheese.The results of the sensory profile of cheeses are shown in The Se composition of the rations, both in the CON and IOSe groups, were close to estimated values (0.240 mg Se/kg DM), with deviations of \u226415%.Except for the level of Zn, the mineral content of whole blood was not affected by dietary treatments, and the Zn levels were within the physiological range for cattle . All aniSimilar to our study, Juniper et al.  observedIn addition, Se can only be incorporated into red blood cells during erythropoiesis , and becIn general, the biochemical plasma profile did not change throughout lactation, with the exception of cholesterol and \u03b2-hydroxybutyrate. These metabolic indicators are related to lipid metabolism, and it has been shown that they can vary according to the physiological state of the cow . As lact0, 228.7 T21, and 256 U/g Hb at T49). A similar effect was reported by Gunter et al. [The indicators of the blood oxidative status studied showed that the whole blood GSH-Px activity, despite not being affected by treatments, increased throughout the experiment in both treatments  of the IOSe treatment group. Therefore, this milk could not be labeled as a source of Se, despite the fact that supplementation with inorganic plus organic selenium increased its content by 29.7%.According to Regulation 1169/2011  of the European Union, beverages that provide 7.5% of the daily reference intake of selenium (55 \u00b5g) can be labeled as a \u201csource of selenium\u201d (4.13 \u00b5g/100 mL) . In our A day effect was observed for fat, protein, and some microelements (Zn and Cu) content in both treatment groups, with a slight decrease, although milk production was not affected. In addition, the fat/protein ratio of milk in all cases was very close to or within the ranges indicated by \u010cejna and Chl\u00e1dek  for statIn general, the physicochemical composition of the yogurt was not affected by treatment; only Ca content was slightly lower in the IOSe group yogurt. On the other hand, pH values in yogurt were lower than in milk. This was an expected result, considering the lactic fermentations that occur in the preparation of yogurt. In contrast, the average selenium content of yogurt was quantitatively higher than in milk for both treatments. Csap\u00f3  found a The study of the feeding treatment effect on the sensory parameters of yogurt showed that the smell of cow milk was altered, being less strong in IOSe yogurt; this could be linked with the lower overall acceptability of IOSe enriched yogurt. Alzate et al.  reportedFor yogurt, according to the regulation of the European Union, solid food that provide 15% of the daily reference intake of selenium (8.25 \u00b5g/100 g), could be labeled as a source of selenium. Thus, the yogurt obtained by both dietary treatments could not be labeled specifying this property.In cheese, the general proximate composition was not affected by dietary treatments, except for the dry extract, but this did not affect the cheese yield. However, the highest levels of Se found in experimental cheese were due to the fact that Se is largely associated with the different whey and casein protein fractions of milk. Yoshida et al.  indicateIn general, the texture profile of cheese did not show differences between treatments, except in terms of elasticity, which was slightly lower in the CON group. This could be due to the numerically greater amount of calcium found in this cheese, as Outinen and Rantamaki  found leWe found that the effect of inorganic plus organic Se (as sodium selenite plus Se yeast) supplementation of feeding dairy cows at a moderate level (within the range of European Union legislation and with a wide safety margin) was more effective than sodium selenite, increasing milk Se concentration of dairy cows by 29.7% without altering its general metabolic status, and even decreasing the total oxidant status, and showing no deterioration in terms of overall milk quality and yield. However, this increase of Se was not observed in yogurt with inorganic plus organic Se supplementation. In fresh cheese obtained from sodium selenite plus Se yeast supplementation, there was 38.2% more Se compared to cows fed with an inorganic Se supplementation, achieving Se levels that are labelable as a \u201csource of selenium\u201d, without harming the quality of the product."}
+{"text": "Unusually for aliphatic \u03b1-amino acid peroxosolvates, the H2O2 mol\u00adecules are linked, forming infinite hydrogen-bonded hydro\u00adperoxo chains running along the c-axis direction.The title compound, C 6H11NO2\u00b72H2O2, is the richest (by molar ratio) in hydrogen peroxide among the peroxosolvates of aliphatic \u03b1-amino acids. The asymmetric unit contains a zwitterionic pipecolinic acid mol\u00adecule and two hydrogen peroxide mol\u00adecules. The two crystallographically independent hydrogen peroxide mol\u00adecules form a different number of hydrogen bonds: one forms two as donor and two as acceptor  and the other forms two as donor and one as acceptor . The latter hydrogen peroxide mol\u00adecule forms infinite hydrogen-bonded hydro\u00adperoxo chains running along the c-axis direction, which is unusual for aliphatic \u03b1-amino acid peroxosolvates.The title compound, C The O\u2014Oon Fig.\u00a05. It is sN,N-di\u00admethyl\u00adglycine  , dl-2-amino\u00adbutyric acid (C4H9NO2) and l-phenyl\u00adalanine anti-orbitals to form hydrogen bonds is strongly affected by steric hindrance caused by \u03b2-substituents in the side chains of carb\u00adoxy\u00adlic acids  I. DOI: 10.1107/S205698902000972X/fy2147Isup2.hklStructure factors: contains datablock(s) I. DOI: 2016846CCDC reference:  crystallographic information; 3D view; checkCIF reportAdditional supporting information:"}
+{"text": "Secondary hyperparathyroidism (SHP) is a common complication of chronic kidney disease (CKD) that correlates with morbidity and mortality in uremic patients. It is characterized by high serum parathyroid hormone (PTH) levels and impaired bone and mineral metabolism. The main mechanisms underlying SHP are increased PTH biosynthesis and secretion as well as increased glandular mass. The mechanisms leading to parathyroid cell proliferation in SHP are not fully understood. Reduced expressions of the receptors for calcium and vitamin D contribute to the disinhibition of parathyroid cell proliferation. Activation of transforming growth factor-\u03b1-epidermal growth factor receptor (TGF-\u03b1-EGFR), nuclear factor kappa B (NF-kB), and cyclooxygenase 2- prostaglandin E2 (Cox2-PGE2) signaling all correlate with parathyroid cell proliferation, underlining their roles in the development of SHP. In addition, the mammalian target of rapamycin (mTOR) pathway is activated in parathyroid glands of experimental SHP rats. Inhibition of mTOR by rapamycin prevents and corrects the increased parathyroid cell proliferation of SHP. Mice with parathyroid-specific deletion of all miRNAs have a muted increase in serum PTH and fail to increase parathyroid cell proliferation when challenged by CKD, suggesting that miRNA is also necessary for the development of SHP. This review summarizes the current knowledge on the mechanisms of parathyroid cell proliferation in SHP. Pa. Pa32]. ase Pin1 ,34. micrase Pin1 . The incThe parathyroid cells are generally quiescent under physiological conditions, with low turnover and mitoses rates . HoweverExperimental SHP of CKD is induced in animal models by several methods: 5/6 nephrectomy is performed by removing one kidney and 2/3 of the contralateral kidney. SHP of 5/6 nephrectomized rats is characterized by an increase in serum and PTH mRNA levels and parathyroid cell proliferation that are further increased when the nephrectomized rats are fed a high-phosphorus diet. A low-phosphorus diet decreases both PTH expression and parathyroid cell proliferation, emphasizing the role of a normal phosphate in the prevention of parathyroid cell proliferation ,14,41. RAnother useful experimental model for SHP of CKD is obtained by feeding rats or mice an adenine high-phosphorus diet ,43. The Hypophosphatemia, hypercalcemia, as well as high serum levels of 1,25D and FGF23 suppress parathyroid activity. Therefore, the parathyroid CaSR, VDR, and the FGF23 receptor complex FGFR1-klotho have a central role in the regulation of PTH expression in physiological and disease states. Parathyroid gland hyperplasia of CKD-induced SHP is associated with downregulation of the parathyroid CaSR, VDR, FGFR1, and klotho expressions  47,48,4,448,49.The tight control of calcium homeostasis is interrupted in patients with either primary or secondary hyperparathyroidism caused by end-stage renal disease. This abnormal control of PTH secretion is attributed, at least in part, to the downregulation of the CaSR in hyperplastic parathyroid tissue. A substantial reduction in the expression of the CaSR mRNA and protein levels was demonstrated in hyperplastic parathyroid glands of uremic patients ,50,51. IA reduction of VDR mRNA and protein levels was shown in glands from uremic patients with severe SHP ,55. Low The classical treatment for SHP includes active vitamin D compounds and phosphate binders to limit gastrointestinal phosphate absorption ,58. Vita42\u2212) [Recent studies have identified the CaSR as a phosphate sensor in the parathyroid gland. The crystallized extracellular domain of the CaSR revealed four putative multivalent anion-binding sites occupied by phosphate (Pi) and sulfate (SO42\u2212) . Anion b42\u2212) .FGF23 decreases PTH levels both in vitro in bovine parathyroid cells and in vivo in rats with normal renal function ,19. On tcyclin D1/PRAD1 (parathyroid adenomatosis 1) oncogene and the MEN1 (multiple endocrine neoplasia type 1) tumor-suppressor gene [MEN1 gene, is a tumor suppressor protein in a variety of cancer types. Inactivating MEN1 mutations lead to the development of parathyroid neoplasia in almost all patients with MEN1. 10\u201325% of cases of MEN type 2A with the RET (rearranged during transfection) oncogene mutation have parathyroid neoplasia [PTH gene locus in 20\u201340% parathyroid adenoma patients identified cyclin D1 overexpression, suggesting that overexpression of PRAD1/cyclin D1 is one of the genetic abnormalities responsible for tumorigenesis in sporadic primary parathyroid adenomas contributing to parathyroid hyperplasia in humans [Specific genetic abnormalities were proposed as the mechanisms regulating parathyroid proliferation in primary hyperparathyroidism. Two particular genes have been implicated in the pathogenesis of parathyroid tumorigenesis: the sor gene ,69. Menieoplasia . PRAD1, n humans ,72. Trann humans ,74,75. Tcyclin D1 and MEN1 in SHP is not entirely understood. Expression analysis of human hyperplastic parathyroid glands from patients with advanced SHP showed only a minor role of PRAD1/cyclin D1 induced by PTH gene rearrangement. The levels of cyclin D1 and retinoblastoma gene products increase in CKD-induced hyperplastic parathyroids [Parathyroid carcinoma in CKD-induced SHP patients is a rare event. It is not clear if benign parathyroid tumors may develop towards malignant forms in SHP ,76. Furtthyroids . The incthyroids . The decthyroids ; 1,25D, thyroids ,80. A hithyroids .The increased expression of TGF-\u03b1 and its receptor EGFR in uremic rat and human hyperplastic and adenomatous parathyroid glands correlates with parathyroid cell proliferation ,82. EGFR\u2212/\u2212 mice had impaired PTH secretion in experimental CKD and no increase in parathyroid cell proliferation compared with the expected increase in uremic wild-type mice [mTOR is part of the mammalian target of rapamycin complex 1 (mTORC1) that affects cell proliferation and metabolism by sensing the availability of growth factors and nutrients in the cell environment. AKT phosphorylation mediates signaling, which activates mTORC1 . Rapamycype mice . These rReduced circulating 1,25D and parathyroid VDR density play key roles in the progression of parathyroid cell proliferation. 1,25D partially restores parathyroid VDR expression and suppresses parathyroid cell proliferation by binding to its receptor . In renaProduction of prostaglandins is catalyzed by the constitutive cyclooxygenase (COX) 1 and the tissue-specific COX2 enzyme, which is expressed mainly in inflammatory and proliferative cells . EnhanceMicroRNAs (miRNAs) are small noncoding RNAs which reduce the expression of various genes by binding to untranslated regions of mRNAs and enhancing their degradation and/or inhibiting their translation . miRNAs \u2212/\u2212Dice mice) develop normally and have normal serum PTH, calcium, and phosphate levels. However, when stressed by an adenine high-phosphorus diet to induce CKD, these mice had a muted increase in serum PTH and failed to increase PTH mRNA levels and parathyroid cell proliferation, suggesting that miRNA are essential for the development of SHP.Cytoplasmic cleavage of the pre-miRNA precursor by the RNase III ribonuclease dicer is the final step of miRNA maturation. Mice with specific deletion of dicer and miRNAs in the parathyroid (PT-SHP is a common complication in CKD patients that correlates with morbidity and mortality. Increased PTH production and secretion per cell as well as a larger mass of the parathyroid gland, mainly secondary to increased parathyroid cell proliferation, lead to SHP in CKD. The physiologic regulation of parathyroid cell proliferation by calcium, phosphate, 1,25D and FGF23 is interrupted in advanced CKD due to receptor downregulation. Activation of proproliferative signaling pathways of mTOR, TGF-\u03b1-EGFR, NF-\u03baB and Cox-PGE, together with interruption of cell division gatekeepers such as p21, lead to parathyroid cell proliferation in CKD. A better understanding of the mechanisms of CKD-induced SHP may identify new intervention opportunities for the control of the high serum PTH in SHP ."}
+{"text": "Environmental, social and governance pressures should feature in future scenario planning about the transition to a low carbon future. As low-carbon energy technologies advance, markets are driving demand for energy transition metals. Increased extraction rates will augment the stress placed on people and the environment in extractive locations. To quantify this stress, we develop a set of global composite environmental, social and governance indicators, and examine mining projects across 20 metal commodities to identify the co-occurrence of environmental, social and governance risk factors. Our findings show that 84% of platinum resources and 70% of cobalt resources are located in high-risk contexts. Reflecting heightened demand, major metals like iron and copper are set to disturb more land. Jurisdictions extracting energy transition metals in low-risk contexts are positioned to develop and maintain safeguards against mining-related social and environmental risk factors. As low-carbon energy technologies advance, markets are driving demand for energy transition metals, increasing the stress placed on people and the environment in extractive locations. Here, the authors quantify this stress by developing a set of global composite environmental, social and governance risk indicators, and find that 84% of platinum resources and 70% of cobalt resources are located in high-risk contexts. Major finance institutions are divesting from thermal coal and investing in the energy transition economy2. Combined investments in low-carbon energy technologies have reached ~30% of global energy investments3. The world\u2019s electric car fleet, for instance, has been growing by over 50% every year for a decade, reaching 5.1 million in 2018, a rate that would reach an international target of 100 million by 20305. For this growth to be sustained, the worldwide production of Lithium may need to double in the next decade6. In addition to rapid growth, low-carbon energy technologies generally require more metal to produce the same power output as their fossil fuel counterparts. Photovoltaic power requires up to 40 times more copper than fossil fuel combustion, and wind power up to 14 times more iron7. More than 20 energy transition metals (ETMs), including iron, copper, aluminium, nickel, lithium, cobalt, platinum, silver and rare earth metals, are predicted to face market pressure as the production of low-carbon energy technologies intensifies8.Climate change is reshaping the mineral resource investment landscape9. Demand would have to be met through significant growth in resource extraction. The social and environmental implications of the anticipated rise in ETM extraction are rarely acknowledged in energy transition scenarios. Trade-off projections typically do not differentiate between the point of extraction and the remaining supply chain . Research that expresses concern about the implications of increased ETM extraction does so without the support of global quantitative data . Discussions about risk at the source of extraction instead focus on emblematic cases of metals mined in conflict or post-conflict zones. Conflict is but one factor to consider as the world transitions to a low-carbon future and demand for ETMs increase.Improvements in material efficiency and recycling are not sufficient to meet the increasing demand for ETMs12, especially in jurisdictions where governments are unable, or unwilling, to safeguard against severe social and environmental externalities. Mineral extraction has contributed to environmental degradation, population displacement, violent conflicts, human rights violations and other adverse impacts13. Managing the downside risks that accompany ETM extraction sits at the core of a just transition\u00a0- a transition designed to address climate change while respecting the rights of workers and communities and protecting the environment15.Mining activities alter the host environment, and tend to exacerbate pre-existing vulnerabilities16. A global data set of 6888 mining projects covering 20 ETMs was analysed against seven ESG risk dimensions. Each dimension is a composite indicator built from aggregate measures available in the public domain. The geographic distribution of risk factors and their co-occurrence indicates varying levels of complexity within the contexts that host extractive activities. High-risk scores across multiple dimensions translate into a high degree of difficulty in mitigating future impact scenarios17. Depending on the spatial distribution of extractive projects, ETMs exhibit different global risk profiles.This paper presents a global assessment of environmental, social and governance (ESG) complexities associated with the extraction of ETMs. It uses a methodology developed to categorise and quantify source risks, i.e., risks surrounding the point of extraction18  both directly and indirectly impacted by mining operations.Social vulnerability reflects national and regional socio-economic factors of vulnerability such as poverty, inequalities and demographic imbalance.Governance characterises the adequacy of national political and regulatory institutions.The ESG risk context is modelled using seven dimensions. These include three environmental dimensions ; three social dimensions ; and an overarching governance dimension. ESG dimensions are a reflection of ESG risk contexts, which are localised in space and time. For a given location, at the time of analysis (2019):\u2018Methods\u2019 and Supplementary information describe the design and analysis of the sample using these risk dimensions.20. Exponential growth in the exploration and extraction of lithium and cobalt21 brings new risks to new locations. These two ETMs exhibit contrasting ESG risk profiles. Seventy per cent of cobalt resources by tonnage are located in contexts with high to very high ESG scores, while 65% of lithium resources are located in the very low to medium range. The two metals also differ on which risks contribute the most to the total score. Environmental risks, and particularly water, are higher for lithium, with 65% of lithium resources located in areas of medium to very high water risk, whereas social risks are higher for cobalt. The degree to which ESG risks co-occur in mining contexts is significantly higher for cobalt than it is for lithium. Ninety-eight per cent of cobalt resources with high social risks also have a high governance risk. In contrast, 53% of lithium resources located in high environmental risk contexts are also located in countries with high governance risks.Cobalt, rare earths, lithium, platinum and nickel are predicted to experience very high relative increase in annual demand see Fig.\u00a0. Such hi23. The Clarion-Clipperton seabed mining zone alone contains more cobalt than the entire global terrestrial reserve base24. The search for alternative sources or substitute metals will need to be supported by quantitative assessments of source risks.Because lithium and cobalt are almost solely used in low-carbon energy technologies, mines extracting these two metals will be of strategic importance in the energy transition. Company or government decisions to prioritise mining developments in low-risk contexts could contribute to temporarily lowering their overall commodity risk profile. However, with anticipated market pressure, this may only delay project development in high-risk contexts. For cobalt, a delay strategy is limited given the small number of projects in low-risk contexts. Strategies to avoid high-risk contexts may push cobalt extraction into areas where ESG risks and implications are disputed, e.g., seabed miningOther ETMs are not expected to experience such dramatic sector growth. For these ETMs, however, absolute demand is significant. For metals like iron and copper, the relative increase in transition-related demand is small because it adds to strong demand in other sectors. Their absolute demand is high because low-carbon energy technologies require significantly more iron and copper than lithium or cobalt. Production volumes are therefore much larger for these two metals Fig.\u00a0. Figure\u00a025. A higher ore tonnage means more and/or larger mines, and an overall higher land disturbance, which, in turn, increases the likelihood of land use competition, which can generate or exacerbate pressures within the surrounding social and environmental context.Figure\u00a0Current projections, consolidated in Fig.\u00a0The potential increase in land disturbance for the extraction of copper, iron and nickel is markedly higher than for lithium and cobalt. For these metals, which have a long history of use, a global energy transition will add to an already high demand for other applications. While the growth in mining activity associated with low-carbon energy technologies may be marginal compared to other uses, it will reinforce existing ESG risk conditions for these commodities, and at a much larger scale than lithium mining. For copper, iron and nickel, which have an even spread of projects in low-risk and high-risk contexts, innovation in the management and mitigation of ESG risks is critical. These findings suggest that a global extraction strategy across these sectors is needed. Sites in low complexity contexts  where one or two high risks are present can help identify solutions to individual risks that are implementable across the sector.The world overview of aggregated social and environmental risk conditions shows that mining development affects regions unevenly Fig.\u00a0. Hot spoThe countries that yield the top 15 ESG scores Fig.\u00a0 are charCold spot countries like Canada still yield a total ESG score in the top 15 due to their large number of mining projects. Canada\u2019s mining projects are located in contexts with, on average, a very low ESG risk score, i.e., fewer concurrent risk conditions. Canada, however, has the second highest number of projects in the world (1068 mining properties) after Australia (1070 mining properties). Australia and the United States, by comparison, combine a large number of mines with, on average, medium scores against the risk dimensions. Because Canada, Australia and the United States are countries with good governance scores, they may have capacity to develop and maintain safeguards against mining-related social and environmental impacts, and are well positioned to identify solutions for existing ESG risks in contexts of relative complexity. National-level assessments of source risks can help governments build capacity in the management and mitigation of these risks.Countries with the greatest number of hot spots are China, Mexico, Peru and South Africa, totalling 575, 270, 211 and 191 mining properties, respectively, in, on average, high complexity settings. These are countries with weak or below average governance scores. Future ETM demand is likely to drive mining developments in these resource-rich countries, placing pressure on existing social and environmental contexts. They host important proportions of key ETMs like platinum (84%), manganese (45%) and rare earths (32%). Countries with very high complexity host few mining properties and exploit few resources, exhibiting that extreme levels of ESG risks can constrain mining development. This is the case for Afghanistan, Eritrea, Ethiopia, Haiti, Uganda and Yemen.26. International non-governmental organisations objected to the World Bank\u2019s facility, arguing that using clean energy sources does not prevent miners from perpetuating environmental and social harm27. This debate highlights the dual role of the mining industry as both a negative impactor and a supplier of ETMs that are crucial for climate change mitigation. The mining industry is an intensive energy user and greenhouse gas emitter24 and is perceived as a dirty activity that has caused adverse social and environmental impacts. The synergies and trade-offs at the source of ETM supply chains should be interrogated with greater focus and depth than has occurred to date.The World Bank\u2019s Climate Smart Mining Facility promotes the use of low-carbon energy technologies in miningThe large-scale deployment of low-carbon energy technologies will continue to drive social and environmental risk. These risks can be identified by location or commodity. A global assessment of the ESG risks associated with the extraction of ETMs reveals the location of risk conditions and their combination. Identifying hot spots and locations with particular combinations of ESG risks may prompt governments, investors and other institutional actors to address acute forms of risk. Likewise, identifying ESG risks by commodity highlights the complexities and potential constraints attached to the global supply of particular metals. Access to fresh water, for instance, is a key constraint for lithium extraction. Developing water-efficient methods in the extraction and processing of lithium could offset water scarcity issues. A high ESG score across an entire commodity, like cobalt, raises concerns about the risks of increasing its supply to meet demand.28. This has arguably led to increased opposition to mining and resource extraction. Future ETM production faces a dual pressure: increased demand to support the transition and increased scrutiny due to adverse impacts in locations with pre-existing ESG complexity. New projects in sound governance jurisdictions will have to confirm their ability to assess, manage and minimise ESG risks, or face opposition, which may, in turn, constrain the supply of ETMs and inhibit the transition to a low-carbon future.The anticipated increase in future extractive activity comes atop a century of exponential growth in metal production. Previous mismanagement of ESG risks has created social and environmental pressures within mineral resource-rich regions31, models the interface between a mining project and the geographic context in which it is located. It focuses on building an understanding of inherent or latent complexities present in the external context. The industry\u2019s engagement and management of risks in different contexts determine whether these risks are static, exacerbated or reduced. We assume that a high score in any ESG dimension drives up both the likelihood and the severity of the consequences of a detrimental event  occurring at the interface between the mine and its context and potentially having consequences to the developer, local people and the environment.The methodological framework consists of a spatial overlay between mining data from the S&P Global Market Intelligence database\u2014a commercial database that gathers public disclosures from mining companies\u2014and publicly available data sets assembled into seven ESG dimensions. This approach, used in previous workThe S&P database includes records of operating mines, as well as mining projects in pre-production stages including the target outline stage: advanced exploration, prefeasibility and scoping, feasibility, construction and commissioning stages. Records of early stages grassroots and exploration projects were excluded on the basis that their future development is too preliminary, meaning any estimation of contained resources would be unreliable. For each mining project included in the analysis, we extracted the spatial coordinates and the most up to date resources estimates. Resources estimates represent current known metal content and discount material already extracted. Due to reporting norms, these estimates are likely to be understated. Data are current as of May 2019.Conducting a global review at resource-scale inevitably involves some constraints on data. The S&P database relies on public disclosure, and the level of disclosure varies according to commodities and countries. For the nine ETMs presented in this paper, the S&P database covers between 72% for aluminium and 100% for platinum of current global production . The 6888 mining projects were overlain with each variable and attributed location-specific values. Overall, 24 global variables from 14 different sources were applied. Of those 24 variables, 8 are national-level indexes and 16 are rasters and polygons data sets that were overlayed to the 6888 point data set on ArcGIS. The theoretical framework and data selection are summarised below, and visualised in Supplementary Fig.\u00a0The seven ESG dimensions were constructed using the methodology on composite indicators from the Organisation for Economic Co-operation and Development33. Waste rock dumps and voids, including open pits and underground workings, cover most of the remaining land. Mine owners are responsible for minimising the impacts of their activities on the host environment by rehabilitating disturbed areas and ensuring the effective containment or neutralisation of polluting substances.Mining projects are characterised by large material movements that occur throughout the mine\u2019s life cycle. These movements result in waste stocks and mining voids, which are the main cause of direct land disturbance. In terms of land use, tailings storage facilities can cover half of the area of disturbance34. The waste dimension takes into account both the risk of catastrophic failures and of chronic seepage and airborne pollution. The risk indicators that were selected to build this ESG dimension included seismic risk, cyclones risk, average wind speed and maximum annual precipitation. A fifth indicator represents terrain ruggedness, which is a topographic factor that expresses the variability of elevation in an area, and adds complexity to the construction of large and stable structures. Further explanation on the waste dimension is provided in Supplementary Note\u00a0Natural conditions in and around mine sites pose challenges to the design, construction and maintenance of waste facilities and mining voids. Reactive substances within the unearthed material and void walls are exposed to wind, rain and oxygen, which favour their reaction and the diffusion of pollution through either dust or acid drainage. Miners have to plan for long-term containment and ensure the structural integrity of waste facilities. In extreme cases, a tailings dam failure can cause major impacts to local communities and ecosystems. The causes of these failures are often multiple and include human and management error as well as external factors such as heavy rains and earthquakes35. Fresh water here refers to high-quality water which is suitable for human consumption or would require limited treatment to make it suitable for human consumption. Access to fresh water can be a challenge in contexts of water scarcity and/or competing water uses29. Inadequate mine water management involving high withdrawal, low rates of water reuse and discharge of contaminated water can heavily impact local water resources and affect surrounding ecosystems and communities. The water dimension only quantifies the risk of not securing sufficient access to fresh water. The risk of discharge is partially covered in the waste dimension. There are other factors, such as the sensitivity of receiving environment, local regulatory frameworks and associated water quality objectives, that contribute to the risk of discharge but cannot be assessed at the selected global scale.Mining and mineral processing activities at mine sites usually have high fresh water requirements36. The Baseline Water Stress indicator and the Inter-annual Variability indicator were selected for their level of completeness and their complementarity in illustrating water supply risk, as they account for two main factors contributing to securing access to fresh water: persistent low fresh water availability and significant variations in fresh water availability with time.In terms of access to fresh water, the World Resources Institute\u2019s provides indicators of water supply risk relevant to mining37). The great majority of the planet\u2019s biodiversity is not currently under strict legal protection38, meaning it is potentially exposed to mining development and other human land uses. For this dimension, we use three nature conservation spatial data sets, the Key Biodiversity Areas, hosted by Birdlife International39, the Biodiversity Hotspots map by the Critical Ecosystem Partnership Fund40 and the Total Species Richness maps provided by Jenkins et al.41. The three data sets use different definitions of conservation priorities and complement each other. The first two are polygon data sets, and the measure used for them is the distance from mining project points to the closest polygon. The Total Species Richness data sets are raster data sets that provide further granularity on the distribution of centres of richness for vertebrate species.Extractive activities affect natural habitats both within and outside the mining lease. Mining infrastructure built to access and transport the ore creates large corridors that expand the disturbance beyond the mining area. The risks generated by the proximity between mines and critical biodiversity preservation areas have been flagged multiple times . According to these sources, each tonne of rare earth oxide produced corresponds to an average of about 12\u2009kg dysprosium and 180\u2009kg neodymium production, the two rare earth metals that are consistently forecast to experience high demand due to the energy transition. The demand for neodymium is typically forecast to be higher than for dysprosium (ratios of about 6:1), but the yield for dysprosium is so much lower (a ratio of about 1:15) that the demand for dysprosium would be the driving factor for rare earth production in these forecast scenarios. The demand for rare earths in Fig.\u00a0The demand for rare earths refers to the demand for rare earth oxide ore, which was estimated from the forecast demand for the constituent metal oxides using the relative composition of the world\u2019s major depositsTo translate the demand to an approximate ore tonnage, we divided these by an effective grade value calculated from the grades and production reported in the S&P database (see Supplementary Fig.\u00a0Figure\u00a0The top 15 country list in Fig.\u00a0Further information on research design is available in the\u00a0Supplementary InformationPeer Review FileDescription of Additional Supplementary FilesSupplementary Data 1Reporting Summary"}
+{"text": "Fusarium ear rot (FER) caused by Fusarium verticillioides is a major disease of maize that reduces grain yield and quality globally. However, there have been few reports of major loci for FER were verified and cloned.Fusarium cob rot (FCR) and Fusarium seed rot (FSR).To gain a comprehensive understanding of the genetic basis of natural variation in FER resistance, a recombinant inbred lines (RIL) population and one panel of inbred lines were used to map quantitative trait loci (QTL) for resistance. As a result, a total of 10 QTL were identified by linkage mapping under four environments, which were located on six chromosomes and explained 1.0\u20137.1% of the phenotypic variation. Epistatic mapping detected four pairs of QTL that showed significant epistasis effects, explaining 2.1\u20133.0% of the phenotypic variation. Additionally, 18 single nucleotide polymorphisms (SNPs) were identified across the whole genome by genome-wide association study (GWAS) under five environments. Compared linkage and association mapping revealed five common intervals located on chromosomes 3, 4, and 5 associated with FER resistance, four of which were verified in different near-isogenic lines (NILs) populations. GWAS identified three candidate genes in these consistent intervals, which belonged to the Glutaredoxin protein family, actin-depolymerizing factors (ADFs), and AMP-binding proteins. In addition, two verified FER QTL regions were found consistent with These results revealed that multi pathways were involved in FER resistance, which was a complex trait that was controlled by multiple genes with minor effects, and provided important QTL and genes, which could be used in molecular breeding for resistance. Fusarium ear rot (FER) is one of the most important food and feed safety challenges in global maize production  and F. graminearum are the two most important species which can cause FER and Gibberella ear rot, respectively [oduction . FER notium spp. . More thectively \u20135.Fusarium verticillioides is an important maize pathogen in the world, which can lead to serious economic losses [Fusarium verticillioides can survive in plant residue, healthy seeds and soil, and initiate the infection of maize from seedborne or airborne inoculum, causing seedling disease, Fusarium stalk rot and FER [F. verticillioides [c losses , particuc losses \u20139, the Uc losses  and Soutc losses , 12. Fus and FER , 13. FER and FER . Infecte and FER , 15. Che and FER . Moreove and FER  found th and FER . These sllioides .F. verticillioides in order to find a lasting solution to FER problems in maize production. Several studies have identified QTL associated with resistance to F. verticillioides and subsequent reduced fumonisin accumulation using cross-populations, such as F2, F2:3, RILs. Zhang et al. detected six and four QTL in a F2 population of 230 individuals in two environments, respectively, and two QTL were identified consistently in both environments [Ostrinia nubilalis) [Resistance to FER is complex because it is characterized by a quantitative inheritance in which additive, dominant, epistatic, and genotype by environment interaction effects are important \u201321. Baseronments . Using aronments  discoverronments  detectedronments  detectedbilalis) , 29.Recently, to uncover genomic regions associated with reduced FER and fumonisin B1 (FB1) mycotoxin contamination and identify molecular markers to perform marker-assisted selection, Maschietto et al.  used an GWAS has shown enormous potential for detecting QTL with high resolution in diverse germplasm . A largeIn this study, we reused linkage mapping to identify genomic regions associated with FER resistance in a biparental RIL population that was evaluated across four environments. Then, GWAS was performed based on the data collected from five environments to detect alleles associated with resistance to FER. Next, we validated four common genomic regions in NIL populations and analyzed the candidate genes in these regions. Last, we discussed the probable mechanism of resistance to FER and stable QTL for molecular breeding.First of all, we determined the best time of inoculation for ear rot. For determining the proper inoculation time, we evaluated the phenotype of six inoculation periods of the resistant materials, BT-1 and CML295, and susceptible N6 from the 5th to the 35th day after silking  and genotype-by-environment variance (\u03c32ge) of resistance were significant in both populations. Heritability for resistance was 0.81 in the RIL population, 0.79 in the GWAS population. The high heritability indicated that much of the phenotypic variance was genetically controlled in the populations and suitable for QTL mapping.Descriptive statistics for FER resistance in the RIL and GWAS populations are presented in Table\u00a0Fusarium ear rot, which could explain more than 9.3% of the phenotypic variation. Then the QTL, on bin 3.06/07 had the second largest resistance effect explaining about 4.5%. These 10 QTL showed both additive effects (A) and additive by environment effects (AbyE), but additive effects explained 25.1% of the phenotypic variation, whereas interaction effects explained only 5.5%.A total of 10 QTL were identified for FER resistance Table\u00a0, Fig. S4To determine the epistatic effect, epistatic QTL mapping was performed. A total of three pairs of QTL interactions were detected by the ICIM-EPI method at an LOD value of 7, which explained 3.2, 2.4, and 2.4% of the phenotypic variation Table S, Fig. S5p\u2009\u2264\u20091.0\u2009\u00d7\u200910\u2212\u20094  and it explained 10.2% of the phenotypic variation. The second SNP with the lowest P value was located on chromosome 4 and explained 6.8% of the phenotypic variation. Detailed information of 18 SNPs significantly associated with FER resistance is provided in Table P value was in agreement with the expected P value, whereas the observed P value was lower than the expected P value at a threshold greater than three  incorporating both the population structure (first three PCs) and K into the model. A total of 18 SNPs were significantly associated with FER resistance with \u20094 Table\u00a0, Fig.\u00a01.Gene Ontology (GO) annotation was carried out on 11 candidate genes identified by GWAS. The process of growth, stress response, and cell formation was significantly enriched. These processes feel into four main categories, including seven associated candidate genes. The first was the cytoskeleton process, including cytoskeleton and cellular component organization, and involved candidate genes GRMZM2G449160 and GRMZM2G463471. The second was the process of protein binding, which involved the most genes, including GRMZM2G107686, GRMZM2G086072, GRMZM2G463471, GRMZM2G134980, and GRMZM5G818643, which indicated the significance in FER in posttranslational regulation. The third category was the process of regulation of cellular processes, and contained GRMZM2G107686, GRMZM2G086072, and GRMZM2G449160. The last category was the process of stress response, involving GRMZM2G059381 and GRMZM2G134980.Ten QTL identified through linkage mapping and 18 significant single SNPs detected by GWAS were integrated to analyze the resistance, and four consistent loci were found Table\u00a0, locatedTo fine map the QTL  on chromosome 4, a NIL population with the genetic background of susceptible parent N6 was developed using a backcross and marker assistance selection with flanking markers. The percentage of infected kernels (PIK) was brought into the phenotype evaluation. The lines N-44 and N-54 with positive homozygous alleles  from the resistant parent BT-1 showed a lower PIK compared with N-55 and N6, and N-55 with only WQ5 and WQ6 was more resistant than parent N6, but more susceptible than lines N-44 and N-54, regardless of Zhengzhou and Xuchang. This indicated that WQ7 could decrease approximately 8 and 6 PIK. WQ5 and WQ6 together improved approximately 7 and 8% in resistance compared with N6 in Zhengzhou and Xuchang, respectively Table\u00a0, Fig.\u00a02.A segregation population was constructed for WQ3 by a backcross between the NIL, CP-1 with the target the fragment linked with umc2101 and umc2256, and recurrent parent N6. Finally, WQ3 was verified by a family with a total of 58 plants in 2017  were detected on the whole genome. Among them, four significant SNPs were located in four QTL, which represented three candidate genes, GRMZM2G449160, GRMZM2G463471, and GRMZM2G059381. GRMZM2G449160 is a member of glutaredoxins (GRXs), which belongs to the antioxidants involved in cellular stress responses. Proteomic analysis found that homologous OsGRX20 increased by 2.7-fold after infection by bacterial blight in rice [OsBIABP1 is involved in the regulation of the defense response through salicylic acid (SA) and/or jasmonic acid (JA) / ethylene (ET) signaling pathways [TaADF4, from wheat, was required for resistance to the stripe rust pathogen Puccinia striiformis f. sp. Tritici. These results indicate that the three candidate genes in this study may be associated with FER resistance in maize, which will be focused on in the following study.To decrease the loss from FER and explore the genetic mechanism, we begin to study resistance to FER more than a decade years ago. Today, we have formed a series of relatively perfect inoculating systems and phenotypic identification methods , and hav in rice . GRMZM2Gpathways . GRMZM2Gpathways  found a An accurate phenotype is the key to the study of FER. The acquisition of the phenotype was influenced by the inoculation method, date, and the inoculation dose. At present, there are three common inoculation methods used for the study of FER resistance, namely the silk channel inoculation method , 57, silIn the long-term study of FER, we explored and optimized the nail punch method . The keyFusarium resistance in different maize tissues [Fusarium cob rot resistance (FCR) and Fusarium seed rot resistance (FSR). Therefore, we compared the QTL identified for Fusarium resistance in ear, cob (FCR), and seed (FSR)  Fig.\u00a0a. These ulations . The canulations . It is wIn our previous study , four QTFusarium resistance traits.Previous studies , 61, 62 P\u2009<\u20091\u2009\u00d7\u200910\u2212\u20094. Four QTL of the five common loci in the RIL and GWAS were verified in NILs and three candidate genes may be associated with FER resistance. These results confirmed that FER resistance was strongly controlled by multiple genes with low effect and the QTL and candidate genes identified in this study could help to better understand the genetic basis and explore the mechanism of FER resistance. At the same time, it was feasible to select maize lines with higher Fusarium resistance because of the two stable QTL in different tissues and studies.In this study, a RIL populations and one GWAS population were used to identify and map QTL for FER resistance. A total of 10 QTL for FER resistance were detected by QTL mapping and 18 SNPs were identified by GWAS at Fusarium verticillioides [A biparental population composed of 250 recombinant inbred lines (RILs) was constructed by a cross between inbred lines BT-1 and N6 , was evaluated in Zhengzhou in 2014, 2015, and 2016  and Wenxian in 2015 (2015WX) and Xuchang in 2016 (2016XC).All the populations above were laid out in a randomized complete block design with two replications in each environment. Sixteen plants were planted in 4\u2009m row plots with 0.67\u2009m row spacing. Importantly, pesticide was artificially sprayed at the ten-leaf stage to control corn borers. Some other field management was performed according to the standard agronomic practices in each location.F. verticillioides was reproduced artificially on sterile mature maize kernels, incubated for 7 d at 28\u2009\u00b0C. Then, the spores were harvested, and the concentration was estimated using a hemocytometer and adjusted to 1\u2009\u00d7\u2009106 spores ml\u2212\u20091 in sterile distilled water with 0.2\u2009\u03bcl/ml Tween 80 surfactant. The top ear of each plant in each row was inoculated for 2\u2009ml spore suspension on the fifteenth day after silking using the sponge and the nail punch method [A single-spore isolate of h method  along wiResistance to FER was assessed by disease severity according to Reid et al.  using a The analysis of variance (ANOVA) of phenotype data was carried out using the multifunctional IciMapping version 4.2 . Best liIn our previous study, we constructed a linkage map of the RIL population (BT\u00a0\u00d7\u2009N6), which contained 207 polymorphic SSR markers and had a length of 1820.8\u2009cM with an average 11.7\u2009cM distance . In thisTo understand the QTL by environment interaction effects, the mapping strategy of MET  was performed in the IciMapping software. Two methods were used in QTL mapping, i.e., (i) ICIM-ADD: Inclusive Composite Interval Mapping of additive QTL (ii) ICIM-EPI: Inclusive Composite Interval Mapping of digenic epistatic QTL. The threshold value of LOD was 2.5 for ICIM-ADD and 7 for ICIM-EPI.http://cbsusrv04.tc.cornell.edu/users/panzea/download.aspx?filegroupid=4). The filtered parameters of SNPs, linkage disequilibrium (LD) between each pair of SNPs, the principal component analysis (PCA), Kinship matrix and population structure analysis were performed according to our previous study [Through the genotyping-by-sequencing (GBS) method conducted in Cornell University, a total of 955,650 SNPs were identified in the GWAS population , 68, andus study .http://www.maizegdb.org/) genome browser based on the physical position of significant SNPs in B73 RefGen_v2.Candidate gene information was obtained from the MaizeGDB (Additional file 1:Additional file 2:"}
+{"text": "The study aimed to assess the association between parental-reported vitamin D supplementation and caries in a national sample of 3-year-olds in Poland.p < 0.05).A total of 1900 children, representing all provinces of Poland, were invited. The questionnaires concerned vitamin D supplementation, socio-demographics, and oral health behaviours. Based on dental examination, caries scores (dmft/dmfs), prevalence of early childhood caries (ECC) and severe ECC (S-ECC) were calculated. The Spearman\u2019s correlation, linear regression and logistic regression were used to assess the association between various factors and caries (p < 0.05). Mean dmft/dmfs were lower in those with supplementation . After controlling for confounding factors, supplementation was not significantly associated with caries; only dt/ds were still associated. Maternal education, sweetened beverages before bedtime, bottle use were significantly associated with S-ECC.A total of 1638 children were tested. Of this number, 99.1% infants were supplemented with vitamin D. Supplementation had been continued seasonally in 55.2% children. ECC/S-ECC prevalence were significantly lower in children receiving vitamin D (ECC 38.3% vs. 44.7%, OR = 0.77; S-ECC 20.5% vs. 27.1%, OR = 0.69; Lower caries prevalence was observed in those with vitamin D supplementation. The association between parental-reported vitamin D and ECC/S-ECC was not significant in Polish children. Decayed teeth and supplementation were still associated. Dietary habits can modify the association with caries.There may be an association between vitamin D supplementation and lower caries in children. Parents should supplement their children during periods of significant growth and development. Early childhood caries (ECC) and severe ECC (S-ECC) represent a significant public health challenge in many countries , 2. TheySeveral possible mechanisms have been proposed to explain the role of vitamin D in reducing caries risk, such as the vital role of vitamin D in regulating serum calcium, phosphate and parathyroid hormone levels. Calcium and phosphate homeostasis is essential for the formation, calcification, mineralisation and health of hard tissues like oral bone and teeth , 19, 22.The secretion rate and saliva quality play a role in caries development and also in remineralization . Vitaminth and 12th month of age. In children and adolescents (1\u201318-year-olds) supplementation of 600\u20131,000 IU/day is recommended between September and April  in the blood provides a reliable indication of vitamin D levels \u201318, 38. p = 0.78), even after adjusting for sugar consumption (p = 0.46) [p = 0.54).Studies assessing the association between vitamin D and caries have not always high research quality, or they presented contradictory results , 43\u201345.  = 0.46) . The pre = 0.46)  concludeSchroth et al. \u201318 were The strengths and limitations must be taken into account. The strength of this study includes a large representative population at high-risk of low vitamin D status and ECC and homogenous social structure, without different cultures or ethnicities. There are no other similar Polish data. Another consideration is the use of both a questionnaire and a clinical examination for caries, and not reported-caries experience (RCE). Dental caries was determined by clinical evaluation and was scored by trained and calibrated, experienced paediatric dentists. The questionnaire findings were internally validated. The parental reports concerning caries could not be validated with the current data. Furthermore, since ECC has numerous causes, the study did not examine all of them, but focused on the factors with an important association. Naturally, this study was a cross-sectional study; therefore, has relatively low validation to draw conclusions regarding the causative association between parental-reported vitamin D supplementation and dental caries. In the future, longitudinal, prospective studies should be conducted to confirm categorically the beneficial association of vitamin D supplementation. In the present study, over-reporting is another limitation. Paediatricians provide parents or caregivers with instructions, and so the latter are aware of the necessity of supplementation. This is a potential risk of a response bias in the questionnaire reply, constituting a recognised limitation of parental-reported assessment in all such surveys. It is a fact that there are families that do not provide the supplementation consistently. The inability to validate vitamin D doses and regular intake, as well as the use of other supplements, was a significant limitation. The vitamin D supplementation was not categorised based on children\u2019s age. Another factor that has to be considered is that the study group represented populations supplemented with vitamin D in the first year of life. Investigated 3-year-old children continued the supplementation during autumn\u2013winter periods. The respondents were not asked specifically about supplementation in the second year of life, but about continuation. The authors of the present study encountered limitations due to a lack of information on several potentially important confounders, including information on seasonal variation, sun exposure, dietary intake of vitamin D-rich and fortified foods, prenatal vitamin D/multivitamin use. It may be explained, in line with surveys, by low UVB exposure (or \u201cvitamin D winter\u201d) lasting in Poland, and in similar geographic regions, and low intake of vitamin D\u2013rich food , 42, 47.Nevertheless, it has to be mentioned as a limitation of the study that parental reports were not verified/confirmed by taking blood samples to measure 25(OH)D level since no attempt was made to perform these tests due to lack of consensus regarding the indications for measurement of 25(OH)D in Poland . VitaminTherefore, in the interpretation of these findings, these limitations should be taken into account; however, they do not interfere with the statistical power as the large sample size provides sufficient statistical power, allowing greater confidence in these findings. The results should be interpreted with caution and evaluated in additional research with 25(OH)D measurement and information on getting vitamin D from food and sun exposure.The evidence from this cross-sectional study in favour of a high prevalence and intensity of dental caries experience was found in a nationally representative sample of 3-year-old Polish children. Parental-reported vitamin D intake was not compliant with recommendations for this age group. Dental caries was significantly lower in children with vitamin D supplementation in comparison with children not receiving such supplementation. An association between parental-reported supplementation and ECC and S-ECC was not significant after controlling for many confounding variables. There may be an association between vitamin D supplementation and lower caries in children living in a geographical region which is at risk of vitamin D deficiencies. Furthermore, the study confirmed that more children of mothers with higher education received vitamin D supplementation and had less caries. Maternal education, sweetened beverages before bedtime, bottle use were significantly associated with S-ECC. Greater emphasis should be placed on promoting vitamin D. Parents should supplement their children during periods of significant growth and development. Future longitudinal studies of such an association should be undertaken."}
+{"text": "Pythium oligandrum is able to control plant diseases through direct mycoparasite activity and boosting plant immune responses. Several P. oligandrum elicitors have been found to activate plant immunity as microbe-associated molecular patterns (MAMPs). Necrosis- and ethylene-inducing peptide 1 (Nep1)-like proteins (NLPs) are a group of MAMPs widely distributed in eukaryotic and prokaryotic plant pathogens. However, little is known about their distribution and functions in P. oligandrum and its sister species Pythium periplocum. Here, we identified a total of 25 NLPs from P. oligandrum (PyolNLPs) and P. periplocum (PypeNLPs). Meanwhile, we found that PyolNLPs/PypeNLPs genes cluster in two chromosomal segments, and our analysis suggests that they expand by duplication and share a common origin totally different from that of pathogenic oomycetes. Nine PyolNLPs/PypeNLPs induced necrosis in Nicotiana\u00a0benthamiana by agroinfiltration. Eight partially purified PyolNLPs/PypeNLPs were tested for their potential biocontrol activity. PyolNLP5 and PyolNLP7 showed necrosis-inducing activity in N. benthamiana via direct protein infiltration. At sufficient concentrations, they both significantly reduced disease severity and suppressed the in planta growth of Phytophthora capsici in solanaceous plants including N. benthamiana (tobacco), Solanum lycopersicum (tomato) and Capsicum annuum (pepper). Our assays suggest that the Phytophthora suppression effect of PyolNLP5 and PyolNLP7 is irrelevant to reactive oxygen species (ROS) accumulation. Instead, they induce the expression of antimicrobial plant defensin genes, and the induction depends on their conserved nlp24-like peptide pattern. This work demonstrates the biocontrol role of two P. oligandrum NLPs for solanaceous plants, which uncovers a novel approach of utilizing NLPs to develop bioactive formulae for oomycete pathogen control with no ROS-caused injury to plants.As a non-pathogenic oomycete, the biocontrol agent  Phytophthora capsici causes root, crown, foliar and fruit rot on important vegetables such as pepper (Capsicum annuum), tomato (Solanum lycopersicum), pumpkin and cucumber. Oomycete disease incidence and severity have increased significantly in recent decades and caused substantial losses in agriculture throughout the world  \u00d7 100 [For 9] \u00d7 100 . The symN. benthamiana leaves were stained with 1 mg/mL DAB solution for 8 h in the dark at 12 hpi and then decolored with ethanol for light microscopy examination. Samples were equilibrated with 70% (v/v) glycerol for photography using natural light. For electrolyte leakage assay, five leaf discs (9 mm in diameter) of N. benthamiana were soaked in 5 mL of distilled water for 2 h at room temperature. The conductivity of the bathing solution was then measured using a conductivity meter .For DAB staining, P. oligandrum and N. benthamiana leaves by using the RNA-simple Total RNA Kit (Tiangen) according to the manufacturer\u2019s instructions. cDNA was synthesized using the HiScript 1st Strand cDNA Synthesis Kit (Vazyme). Real-time PCR was performed by using the ChamQ SYBR qPCR Master Mix kit (Vazyme) and the ABI Prism 7500 Fast real-time PCR system, following the manufacturer\u2019s instructions. The gene-specific primers used for qRT-PCR and their purposes are listed in Total RNA samples were extracted from p < 0.05; **, p < 0.01; ns, no significant differences). The results are the means \u00b1 s.d. of replicates.SPSS 22 software was used for statistical analysis of all data. The results were analyzed by a median-edition Levene\u2019s test to determine the homogeneity of variances across groups, and then analyzed by one-way ANOVA with a post hoc Tukey\u2019s range test for groups with equal variances, or Kruskal\u2013Wallis test analysis for groups with unequal variance  was obtained from the PFAM database, and used to search the proteomes of P. oligandrum strain CBS 530.74 and P. periplocum strain CBS 532.74 [E) value of 10\u22125. Meanwhile, the SignalP v3.0 program was used to characterize N-terminal signal peptides with a cut-off value of 0.90 , likely from bacteria, not the other Pythium or Phytophthora pathogens [P. ultimum, the sister species of P. oligandrum, which only contains six NLPs. As shown in P. oligandrum. Both the 5\u2032 and 3\u2032 flanking sequences showed high collinearity with the pathogenic P. ultimum    A. Westerthamiana . Interesthamiana A. Quanti 72 hpi) C. PyolNLN. benthamiana by agroinfiltration could be successfully expressed and partially purified from Escherichia coli using the pET32a vector  and lipoxygenase (LOX) [2O2 accumulation in infiltrated plants as compared to the negative control (P. capsici showed consistent results (Oligandrins (Oli-D1 and Oli-D2) from se (LOX) ,22,23. I control D. The in results D. These P. capsici infection, including Cyp71D20 and PTI5 as involved in PTI [Enhanced disease susceptibility 1 (EDS1) and PR1 involved in salicylic acid signaling pathway [Ethylene Insensitive 3 (EIN3), plant defensin 1.2 (PDF1.2), LOX, PR2, PR3 and PR4 involved in jasmonic acid and ethylene signaling pathways [PDF1.2 and its upstream regulatory gene EIN3 [PDF1.2 and EIN3 can be attenuated/abolished by the M24 mutation  from these two non-pathogenic oomycetes, and reveal their underlying gene duplication events and an evolutionary theme distinct from that of previously defined NLPs in pathogenic Pythium and Phytophthora species. Nine PyolNLPs/PypeNLPs are characterized as novel species-specific MAMPs, in addition to previously described oligandrins and POD-1/2 [Phytophthora pathogens in solanaceous plants. We further reveal that their downstream acting mechanism is irrelevant to ROS burst but via inducing plant defensin gene expression. Our findings provide a non-ROS injury and transgene-free approach for Phytophthora pathogen control in solanaceous plants.omycetes ,7,49. P.ia MAMPs ,50. Both POD-1/2 ,18,20. IF. oxysporum that induces ethylene biosynthesis and necrosis in plants [P. oligandrum and P. periplocum belong to type 2, and are similar to a cytotoxic NLP homolog from the bacterium P. carotovorum. Hence, type 2 NLP genes in P. oligandrum are proposed to be horizontally transferred from bacteria [NLP genes undergo striking expansion, with most species harboring more than 10 NLPs [NLPs found in P. sojae are derived from recent duplication events occurring in closely proximal chromosomal segments [PyolNLPs and PypeNLPs are highly homologous within the group and closely clustered in two chromosomal segments of their respective genomes. Furthermore, most PyolNLP/PypeNLP genes clustered in the same group exhibit similar necrosis-inducing activity, suggesting their common origins are derived from extensive gene duplications. Consistent with the non-pathogenic nature of P. oligandrum and P. periplocum, their NLPs do not colocalize with effector or elicitin genes like their counterparts in pathogenic oomycetes, related gene families such as RXLR effectors, CRN effectors or elicitins within NLP genes in genomes. Our gene organization and evolutionary analysis results suggest that PyolNLPs and PypeNLPs genes expand by duplication and share a common origin totally different from that of pathogenic oomycetes. Gene duplications lead to genetic redundancy and thereby facilitate the emergence of novel or altered functions [Phytophthora pathogen suppression functions via this approach.The first NLP identified is from the vascular wilt fungus n plants . NLP-fambacteria ,35, whic 10 NLPs . For exasegments . Meanwhiunctions . CertainPhytophthora pathogens, which thrive on dead plant tissues at their necrotrophic infection stages [NLPs are found to express at the biotrophic-to-necrotrophic switch stages during infection. For example, cytolytic PiNPP1.1 in P. infestans is upregulated during the late stages of tomato infection [P. sojae NLPs are also highly expressed during late infection stages [PcNLPs are highly expressed when necrotic lesions occur in pepper leaves infected by P. capsici. On the other hand, the silencing of PcNLPs impairs P. capsici virulence in pepper [NLP knockout mutants of the bacterial pathogen P. carotovorum exhibit reduced virulence [V. dahliae are notable for their full virulence on the tomato, but not on cotton [M. oryzae is notable for its virulence on rice [The expansion and rapid diversion of NLPs also suggest their important roles in the oomycete infection process. Cytotoxic NLP-induced necrosis could be beneficial for hemibiotrophic n stages . Cytolytnfection . P. sojan stages . Most cyn pepper . These rn pepper . NLPs alirulence . Cytolytn cotton ,54. The  on rice .P. oligandrum, two cytolytic PyolNLPs (PyolNLP2 and PyolNLP7) are upregulated during the infection of N. benthamiana leaves until 48 hpi. Their subsequent downregulation at 60 and 72 hpi is coincident with the cellulose degradation of P. oligandrum [NLPs in pathogenic oomycetes whose expression is elevated at necrotrophic stages [PyolNLPs are significantly downregulated upon infection. All Pythium oomycetes can rapidly infect plant root tissues, but only pathogenic species  are able to kill host tissue within hours. The repression of cytolytic NLPs in non-pathogenic Pythium species might fail to induce host tissue damage during the infection process.For the nonpathogenic igandrum . Unlike c stages ,53, fourN. benthamiana, to further confirm the activity of these PyolNLPs/PypeNLPs, and to minimize potential influences on protein production by the A. tumefaciens-mediated expression system, we examined the ability of in vitro-purified recombinant proteins to induce necrosis in N. benthamiana. The results showed that only two partially purified proteins  produced in E. coli were able to induce cell death in N. benthamiana. MAMPs trigger broad resistance to diverse pathogens [V. dahliae (VdEIX3) can induce cell death and ROS burst, and increase resistance against oomycetes and fungal pathogens in N. benthamiana [POD-1/2 from P. oligandrum can induce cell death and ROS accumulation, which enhance plant resistance against several oomycetes and fungal pathogens [P. capsici in solanaceous plants, including N. benthamiana, tomato and pepper. This should be an advantage for the development of bioactive formulae for disease control, because significant necrosis or ROS injury caused by bioactive proteins may not be acceptable for practical use. Further tests also revealed that PyolNLP5 and PyolNLP7 proteins were effective in suppressing P.nicotianae infection in N. benthamiana. Together, the results suggest that PyolNLP5 and PyolNLP7 have a promising future for controlling P. capsici and P.nicotianae. However, further studies are needed to evaluate the efficacies of PyolNLP5 and PyolNLP7 in suppressing fungal pathogens.In the present study, agroinfiltration of 9 PyolNLPs/PypeNLPs showed necrotic activity in athogens , for exathamiana . The eliathogens ,22,23. Adefensins and EIN3, the upstream regulator of PDF1.2. Plant defensins are toxic to pathogens but not mammalian or plant cells [2+ signaling, MAPK activation, ROS production, and ultimately the death of fungal cells [Phytophthora species [Dahlia merckii defensin DmAMP1 exhibit improved resistance to Phytophthora palmivora by reducing pathogen vigor [P.nicotianae [defensins including PDF1.2, NbDef1.5, NbDef2.1 and NbDef2.2, but not genes involved in other typical defense pathways, suggesting that PyolNLP-mediated defense regulation is largely specific to defensins.Our gene expression analysis reveals that PyolNLP5/7 modulates plant defense via inducing the expression of nt cells ,47. Defent cells . For exaal cells . Defensi species . For exaen vigor . Transgecotianae . In thisA. thaliana, plant RLP23 can recognize the conserved nlp24 peptide pattern of NLPs to trigger plant immunity responses, including MAPK activation, ROS burst and defense gene expression [N. benthamiana. In addition, ROS burst is not one of the downstream responses induced by PyolNLP5/7. Thus, nlp24 may play a novel role in the recognition of PyolNLP5/7 by their partner(s). One possible scenario is that PyolNLPs can be recognized by unknown receptor(s) in N. benthamiana and other solanaceous plants, and then enhance Phytophthora resistance in a non-classical defensin-dependent manner. PyolNLP-receptor interactions are likely to be mediated by the conserved nlp24 pattern. The detailed mechanism of the interactions is yet to be determined.Our mutation analysis demonstrates that the key amino acid sequence of Pyolnlp24 is essential for the plant resistance enhancement function of PyolNLP5 and PyolNLP7. In pression ,32. HoweIn conclusion, our work represents the first comprehensive research on NLPs of biocontrol oomycetes. The phylogenetics of NLPs and their roles in necrosis induction and disease suppression have been investigated extensively. Among them, PyolNLP5 and PyolNLP7 are able to reduce oomycete infection in solanaceous plants, even in the form of isolated proteins. Their acting mechanisms are irrelevant to the ROS burst but are closely related to defensins, which makes them ideal candidates for developing novel biocontrol agents."}
+{"text": "In details, endothelial dysfunction, subintimal inflammation, hemorrhage, edema, dysregulation of vascular tone, as well as disseminated intravascular coagulopathy (DIC), sepsis induced coagulopathy (SIC), increased D-dimer/FDP (fibrin degradation factors) are all possible contributing factors to vascular thrombosis both on arterial and venous side.The cardiovascular complications of Coronavirus disease 2019 (COVID-19) constitute acute cardiac injury , cardiac arrhythmias and thromboembolic events including stroke, pulmonary embolism, cerebral venous thrombosis and venous thromboembolism (VTE.).Pakistan Journal of Medical Science (Pak J Med Sci) we read with great interest the article \u201cAggressive thromboprophylaxis improves clinical process and decreases the need of Intensive Care Unit in Covid-19\u201d by Ugur and colleagueset al. are an important contribution to the literature. However, we would like to add some further insights to their report, as well highlight the importance of increased arterial stiffness in COVID-19 patients in the present expert commentary.In the recent edition of the Mohamed Ali et al. 2021, unpublished observations).Our unpublished observations show that even in milder cases of COVID-19 recovered at home, patients may develop minor myocardial infarctions with typical symptoms, elevated cardiac troponins with or without ECG changes. A coronary angiography may show normal epicardial coronary arteries. Although global left ventricular ejection fraction is normal, a careful strain imaging on 2D speckle tracking echocardiography may show regional/segmental reduced global longitudinal strain reflecting ischemia. A cardiac MR in these cases is very useful and can reveal transmural late gadolinium enhancement (LGE) and microvascular obstruction by a thrombus in smaller transmural branches of the coronary arteries  and atherosclerosis has a bidirectional cause-effect relationship with COVID-19 severity.Ugur et al. are important and directly relevant for the management of COVID-19 patients showing that through their anticoagulant and anti-inflammatory effects, treatment with LMWH/enoxaparin in hospitalized patients reduces the risk of transfer to ICU as well as readmissions. Furthermore, some patients with milder disease may initially not require hospitalization. They are, however, still in risk of developing silent or clinically evident minor myocardial infarctions during convalescent period. Hence, in the absence of dedicated guidelines on antithrombotic treatment in COVID-19 patients, a more liberal practice of using an aspirin may be beneficial, and should be considered in every individual patient.Taken together, the results reported by Sahrai Saeed and \u00d8yvind Bleie wrote, edited and approved the manuscript."}
+{"text": "People who use drugs (PWUD) are considered vulnerable to COVID-19 exposure and the sequelae of infection due to their social circumstances, health conditions, drug purchasing, and substance use. They can depend on access to services that provide harm reduction, substance use treatment, recovery and support, and general healthcare. Social distancing measures and service restrictions posed significant challenges to the health and wellbeing of PWUD.Ethical approvals were secured. PWUD were recruited from voluntary sector homeless and housing, harm reduction, and recovery organisations across central Scotland. Data was collected via semi-structured interviews and analysed using the Framework Method.Twenty nine PWUD participated and reported mixed experiences of the impacts of COVID-19 lockdown. Several benefitted from policy and practice developments designed to sustain or increase access to harm reduction services. Some PWUD reported improved access to substitute prescribing and/or appreciated being trusted to manage multiple take-home doses. Others noted the loss of regular in-person contact with treatment providers and dispensers. Access to recovery support was challenging for many, especially those unable to access or uncomfortable with online provision who experienced greater isolation. Lack of access to general healthcare services was common, and especially problematic for PWUD with chronic physical and mental health conditions.This qualitative research describes the impacts of COVID-19 social and service restrictions on PWUD in Scotland. These impacts were anticipated by policy makers and service providers. Effective and acceptable developments were shown to maintain and even increase service provision for PWUD. Developments were geographically dependent and significant challenges remained for many people. The learning generated can inform responses to increase service access and uptake in post-pandemic times. COVID-19 lockdown had significant impacts on people who use drugs (PWUD).Access to harm reduction, treatment and recovery services was negatively affected.Positive developments included rapid treatment access and continuity of care.Loss of therapeutic relationships with services and peers was a challenge.Nimble, person-centred responses were welcome, but unequally distributed Novel coronavirus 2019 (COVID-19) is an infectious viral respiratory disease. Although anyone can become infected, the risks of experiencing the most serious disease outcomes are inequitably distributed among populations. A syndemic of COVID-19, chronic disease, and social determinants of health has been described in which the prevalence and severity of infection co-occurs, interacts with, and exacerbates, existing health and social conditions among already overburdened groups  to be safe\u201d.[I] just get clean works from in here off somebody ( \u2026 ) even these in here are giving out clean works, or they have been doing. However, two participants preferred to access their regular IEP service due to the relative anonymity this affords.I prefer to use the pharmacy I\u2019ve been using because I know, I know the way they work ( \u2026 ) I just try and keep myself away from this exchange, do you know what I mean? It\u2019s because somebody clocks you doing needle exchange, and then they automatically think, oh, he\u2019s, what\u2019s he wanting needles for? He must have stuff ( \u2026 ) I can\u2019t be doing with that. One participant observed a high-risk group injecting situation and suggested this was due to restricted IEP pharmacy provision caused by COVID-19.I\u2019ve seen it in a house, because they couldn\u2019t get the chemist, because it was shut with the Covid, they couldn\u2019t walk into the chemist to get needles, clean needles, and I seen people in a house, three fuckin people mate. One of they [those] people had HIV and they shared one needle between the three of them. Under lockdown, access to IEP was generally sustained, but arrangements and PWUDs\u2019 experiences were location dependent.Participants also commented favourably on the upscaling of IEP sites and novel delivery methods during the pandemic. These included outreach and home delivery of equipment to people who were shielding and an expansion of the number and type of outlets.Aye, there was a few of us that got rapid prescribed, the same day, or the following week, and one of my pals, it was the [Community Psychiatric Nurse: CPN] actually, went up where he was sitting begging, and she give him a drug test \u2026 and she went up and started him on a prescription that day \u2026 that stopped him begging and he\u2019s in [shelter name], he\u2019s doing alright now. Some treatment services switched patients from methadone to buprenorphine-containing products, including long-acting formulations and those containing naloxone, as a risk reduction strategy.I\u2019ve begged and begged and begged that doctor for months for to try and get onto to subbies [Subutex], for to get off that methadone stuff \u2026 since this Covid started, and then boom, straight away, when I walked into [centre name], when I heard it was only for methadone, I gets a phone call right after it, and then it was on my script for subbies, what I\u2019ve been trying to do for months and months and months. ORT dispensing arrangements also changed in response to the pandemic and several participants reported a shift from daily supervised consumption of their medication to being given multiple doses to take home. This shift was introduced to reduce interpersonal contact and potential COVID-19 transmission within Community Pharmacies. Some participants spoke favourably of this change, feeling more trusted to manage their own medication.I go every day, but I just take the bottle away with me, I get a wee measuring cup. I take half, I take half in the morning and take about, maybe about 7, 8 o\u2019clock at night \u2026 It\u2019s a bit of trust she\u2019s gave me as well, you know, because I could just skelp the lot or save it up or whatever, but what\u2019s the point in doing that. Others preferred the stability and structure provided by daily attendance and struggled with being given several days\u2019 medication to take away and the temptation of having multiple doses at home.I was supervised, and then with the Covid thing, they started giving you it to take away \u2026 now that they\u2019re trying to get us back in the chemist, I\u2019m no doing that, because it\u2019s still no safe, so I got to take away every day \u2026 I want to work towards picking up so many times a week \u2026 they were trying to put me down to twice a week, and I went no, 3 times a week, that\u2019s right enough for me the now, because 2 times a week, it\u2019s too much of a quantity for to be sitting there \u2026 I want to do it gradually, you know \u2026 I know what\u2019s good for me. The dispensing of large quantities of ORT also posed challenges and some participants reported their peers were being approached outside the pharmacy and pressured to sell or give away their medication.A lot of them are getting threatened for their script around there \u2026 people come to the chemist to watch for you, so it\u2019s pretty shit like. Some people reported tensions between substance use workers or prescribers and their patients. There were examples of whole groups of patients being penalised for the observed or suspected behaviours of others.The only thing that, that really I noticed changing was people getting it out maybe twice weekly or weekly or whatever, it\u2019s just depending how, how the workers how much the workers would trust them, some people, some people have still to go daily, you know, but they were few and far between I think that was for people that maybe was going into them, telling them a load of lies or whatever. Face-to-face contact with some workers in the community was disrupted and several participants reported cessation of contact with their healthcare team.Before the pandemic, [I saw my CPN] once a month, and I haven\u2019t seen her since all this happened. Consultations, where they took place, were generally conducted by telephone or online video calls. Several participants expressed their understanding of the significant pressures affecting NHS staff during the pandemic.I\u2019ve barely seen [CPN], or spoke to her, or whatever, because I imagine she\u2019s been run off her feet, I mean every time I was with her, she was having to get up, she was getting another call for somewhere else, and these calls were rapid, eh so, the lassie was run off her feet, so we barely got to see them. One person described their sense of isolation, disengagement from recovery, and an extended period of unplanned withdrawal that resulted from them not knowing how to contact their care provider. They were only able to alert their treatment service and reinstate their treatment through a family contact.I stopped, I tried to stop during lockdown I tried to stop taking heroin, diazepam, I was taking pregabalin at the time as well actually, and I was on methadone, and I just, because I wanted to stop, I stopped them all, I stopped going for my methadone, and didn\u2019t know how to get back, I had drugs in the house, I had drugs there, but I was, I\u2019m stubborn, and I was determined that I wasn\u2019t taking them, and I was ill for like 2 weeks, and because I didn\u2019t know how to contact anybody, because of lockdown, everywhere was shut, didn\u2019t know how to get in touch with my care manager \u2026 my cousin works in recovery \u2026 she knows my care manager, and she spoke to him and \u2026 he had a script in the chemist that day for me. COVID-19 developments in the sector included longer opening hours and more flexible service delivery e.g., support staff were able to liaise with designated General Practitioners (GPs) by text message and the GPs would provide outreach, seeing clients at the hostel or another service. Several participants spoke of the speed with which they, or people they knew, had been able to initiate ORT since the start of the pandemic, often taking days to have a prescription in place when previously it could have taken several weeks. In one city this was the result of service developments, planned pre-COVID and designed to reduce risk of drug-related deaths, whose introduction was accelerated due to the pandemic.a life saver for a lot of us\u201d. The issue of digital exclusion was identified as a key factor that determined whether participants and their peers were able to access peer-led community support.I found the online stuff okay, and that, I was okay that way, but for others I know it would be harder, especially the ones that weren\u2019t in the recovery community, or just about to start, it\u2019s, it would be more difficult for them to just go into a meeting what they had no idea about. It\u2019s just a nightmare, I hate it, I hate technology, I always, I hated it from day one. One interviewee spoke favourably of the welcome he received from staff at an online peer support group, and the accessibility of this form of support.One of the admin people that phoned me, phoned me that day that I joined and what have you, told me how it works and things like that, so aye, they made me really welcome, sort of thing, so I, that\u2019s been a huge part of help as well, that being there every day from Monday to Sunday sort of thing. Others appreciated the flexible response demonstrated by the development of online options to engage in recovery communities and activities, including the ability to access international online meetings at times when Scottish groups and services were not operating.Even the first Zoom meeting I went to a couple of weeks ago, I was like, you know, I\u2019ll go, but I\u2019ll no talk and then I went and when I spoke, I, see the way I felt after the meeting, like a weight had been lifted off my shoulders, it was, it was crazy, and again, I mean no drug in the world can give you that feeling. You can go into a Zoom meeting 24/7 basically ( \u2026 ) if you feel a wee bit low or you feel a wee bit maybe, an urge or a temptation or anything like that, there\u2019s always a Zoom meeting there, and it\u2019s open and you\u2019re always welcome in, so I\u2019ve found that quite good as well, I found myself in meetings in Boston and things like that, you know. This included examples of voluntary sector services providing digital access to people who would otherwise be excluded, including one person who received a data plan and access to digital entertainment to help them and their family during the pandemic.I had no Wi-Fi for a while, so even the [third-sector organisation] even gave me some data, so that my little boy had some data on his tablet, and I was able to connect into that to get on WhatsApp groups ( \u2026 ) they gave me a Now TV box, so the wee man [her son] had cartoons to watch, and they bought you blenders and you know, fruit to make smoothies and that after fitness, they done a lot. Conversely, several people reported experiences of loss and isolation when recovery group meetings ceased or became inaccessible due to moving online during the pandemic. Several of our participants lived alone or in hostel accommodation which was likely to have been isolating even before pandemic conditions.Yeah, well I was doing [mutual aid group] before the Covid and then, and that\u2019s something else that I miss too. Most interviewees reported being negatively impacted by the lockdown measures, particularly through the loss of, or reduced access to, social supports. Three participants who were active within their respective recovery communities pre-lockdown spoke of relapsing into illicit drug use due to significant reductions in community-based support and recovery-focused activities. One individual linked her relapse into using heroin directly to the physical closure of the services central to her recovery.Well I was actually off it [heroin], at the time, but it was only when you had to be stuck in the house that I started it again. A third of participants reported accessing non-statutory service group activities e.g. support groups delivered online using virtual platforms. One interviewee reflected on the significance of these groups, referring to them as \u201cAlmost all participants reported experiencing a range of health problems during the pandemic, including long-term conditions associated with poverty and substance use, and many with multiple coexisting problems. These included chronic pain, diabetes, weight loss and skin problems due to poor diet, hepatitis C infection and treatment side effects, respiratory and cardiovascular problems including breathing difficulties and chronic obstructive pulmonary disorder.I got a phone call this morning from going yesterday and I\u2019ve to go at 2 o\u2019clock today, to see a doctor and that\u2019s been a week, I\u2019ve been trying to get a doctor. Well I\u2019ve no been back for my scan to the hospital, my breathing\u2019s knackered, I know that there\u2019s problems with my heart, I\u2019ve not got, they\u2019ve no had me back to the hospital for that yet, well obviously my kidney, my kidney\u2019s been knackered for ages, that worries me because my ma was on dialysis eh, for nearly a year \u2026 I have been worried sick about it, and I\u2019ve no been able to see a doctor about it. A key concern for several participants was access to dental care, particularly for some who had long-term problems. One participant attributed their increased drug use to coping with tooth pain.I suffered from bad toothache, which again, when I suffered from toothache, I only knew one way to get, to get rid of the toothache and that was use \u2026 I used a lot, and then I eventually phoned the dentist, and I got put, I got emergency appointments, but they were only taking teeth out. Several participants appreciated healthcare providers who responded to lockdown by introducing telephone or online video consultations.I\u2019ve had great, I\u2019ve been on phone consultations when I needed them, when lockdown was on, but last week, or the week before, I think I got, I managed to get a consultation actually with the doctor now from, and it was the first consultation with my doctor, but I never worry, because every time I rang, or even if I couldn\u2019t get him, we\u2019d leave an email for him, and [he] would get straight back to us, because he knew my situation, so it was never a problem like no. Others, however, felt difficulty in speaking on the phone and felt that it was detrimental to their mental health.I was using [service name], and they would have to get me over the phone, or at, sometimes we be a video call \u2026 social work as well, they have to get me over the phone, so that kind of was a bit tricky \u2026 I\u2019ve got a lot of anxiety, that kind of, it made it kind of worse like, like I don\u2019t really like talking over the phone or anything like that, so it was kind of, aye. Several people reported problems caused by reduced access to healthcare services in community and hospital settings.This study explored the impacts of COVID-19 on PWUD in Scotland regarding the availability and quality of harm reduction, treatment, recovery, and general healthcare services. Despite contingency planning and policy responses, the early phase of the pandemic in Scotland was characterised by disruption to services and increased isolation for people experiencing homelessness and substance related problems , 19. TheIn recent years, Scottish policy developments have sought to increase the accessibility, quality and uptake of public health-informed services for PWUD including guidelines for IEP services, a national naloxone programme, and recovery-oriented systems of treatment and care \u201328. MacrAt the macro-level policymakers, European and Scottish organisations recognised the need to ensure continuity of care and to ameliorate the risks of harms that could result from reduced access to services for PWUD. Health and care commissioners and providers were advised to consider the impact that the withdrawal or interruption of service provision could have on this vulnerable section of society and to respond nimbly and flexibly where possible , 15, 16.Before the pandemic, loneliness and social isolation were recognised as challenges for PWUD and known to be associated with poor mental health and other adverse health outcomes . In lineThis study reported the experiences and views of PWUD from several areas in Scotland during the first 7 months of the lockdown. Participants included a balance of males and females aged between 28 to 56, people who were currently using drugs and/or in treatment and recovery. The range of participant viewpoints provided a rich picture of the impacts of COVID-19 for a cross section of PWUD. Recruiting current service users may have skewed the sample towards people who maintained service engagement in the pandemic, however most participants were recruited from housing services, so were not skewed towards those actively engaged in harm reduction, treatment, or recovery services.Several interviews were conducted by JD, who had dual roles as both a community/peer researcher with lived experience of problem drug use and a specialist support worker at the hostel in Edinburgh. JD\u2019s role included the provision of harm reduction information and support. Once the data collection had concluded, participants were provided with support and advice to help them to address urgent problems they had disclosed during the interview. We are confident that this additional support did not contaminate the data collected and was a highly important contribution to reducing acute risks for our participants.Policy makers, service planners and providers should review the experiences of PWUD under COVID-19 to understand and address the harms caused to some. Learning from the experience of rapid access to ORT, remote clinical care and peer-led recovery support could be applied to reduce barriers to care post-COVID, but issues of digital exclusion and personal preference should be considered.This study aimed to understand the impacts of COVID-19 on PWUD in Scotland. Many people experienced significant challenges resulting from the loss of access to key harm reduction, treatment, recovery and general health and care services and therapeutic relationships. In some cases, this loss of support led to relapse into substance use and exacerbation of pre-existing physical and mental health problems. Early in the pandemic, policy makers, service planners and providers noted the importance of ensuring continuity of access where possible, and several examples of contingency planning and innovation in delivery were apparent. Clients appreciated the\u00a0rapid introduction of improved access to ORT and the expansion of IEP and naloxone into new settings, although such developments were not equitably distributed across the areas included in our study. Providers attempts to ensure continuity of care through telephone and online consultations were welcomed by some clients, but digital exclusion and discomfort with impersonal channels were a barrier for others. Several participants reported a complete loss of ways to contact their care providers. The inaccessibility of general health and care provision, especially dental care, was a common challenge and reduced quality of life for many."}
+{"text": "Serum vitamin B12 and folate were low with serum ferritin raised (1027\u2009\u00b5g/L) suggesting a proinflammatory state. Admission liver function tests, coeliac serology, autoimmune panel , hepatitic , human immunodeficiency virus (HIV), toxoplasmosis, parvovirus, and CMV serology were normal. The monospot test on day 1 of the presentation was negative. Ultrasound (US) of the abdomen on day 3 of the presentation revealed isolated splenomegaly (16.8\u2009cm). Day 4 EBV serology  was negative as such haematological investigations including JAK2, serum free light chains, and BCR-ABL were undertaken alongside cervical lymph node core biopsy. Repeat Monospot testing on day 7 came back positive. Repeat EBV serology now showed equivocal EBV VCA IgG (0.77 OD) and positive VCA IgM (9.04 OD) with concurrent new hepatitis. Histopathology of the core biopsy revealed Sternberg-reed cells and a mixed immunoblastic reaction in keeping with resolving IM. This case highlights the need for physicians to have a strong clinical suspicion of IM and understand the multiple ways in which IM may be present as well as the time lag to positivity in serological testing.Epstein-Barr virus (EBV) is an ubiquitous DNA herpesvirus with >90% of adults >40\u2009years of age showing a serological response. While in their youth, primary EBV infection may pass unnoticed, young adults have a high incidence of infectious mononucleosis (IM). This is characterized by a triad of pharyngitis, cervical lymphadenopathy, and fever because of a self-limiting lymphoproliferative disease. Common complications include but are not limited to hepatitis, splenomegaly, encephalitis, and haemophagocytic lymphohistiocytosis (HLH) with evidence that Caucasian males and smokers are more likely to suffer severe disease. Here we present a 21-year-old male who presented with a 2-week history of fever, dry cough, and a 4-week history of pharyngitis. He had no exposure to unwell contacts and denied any new sexual partners. Examination revealed general pallor with tender bilateral cervical lymphadenopathy and pharyngeal erythema. Admission bloods revealed pancytopenia (WCC 1.5\u2009\u00d7\u200910 Epstein-Barr virus (EBV) is a linear double-stranded DNA gamma herpesvirus also known as human herpes virus 4 \u20134. It hain vitro and in vivo transformation of mammalian cells and was the first oncogenic virus identified.In the first steps of infection, EBV affects the epithelial cells of the oropharynx. This occurs through direct fusion of the viral envelope with the cell plasma membrane. After replication within the epithelial tissues, the virus is primed for entry into primarily B-cells but also multiple other cell types. For B-cell infection, this requires the use of viral gp350/220 to CD21 while gp42 binds to major histocompatibility complex 2 to initiate entry. Upon binding of the virion with the endosomal membrane viral tegument proteins are released into the host B-cell including BNRF1 and BZLF1 leading to activation of transcription and lytic gene expression this accompanied by apoptosis suppression via BHRF1 and BALF1 leading to a hyperproliferative state occurs akin to a germinal centre reaction . FollowiGlobally, EBV is implicated in \u223c200,000 malignancies each year including Hodgkin's disease, nasopharyngeal carcinoma, and Burkitt's lymphoma . In pathWhile primary EBV infection in children is often asymptomatic, this is not the case in adolescents, of whom up to 70% present with infection mononucleosis (IM), colloquially known as glandular fever. Overall, in young adults, IM occurs 1/1000 per year versus 1/50,000 in the general population . IM is cSevere important sequelae can occur however in both immunocompetent and immunocompromised hosts including meningoencephalitis, splenic rupture, aplastic anaemia, acalculous cholecystitis, and hemophagocytic lymphohistiocytosis (HLH) and thus EBV infection can present atypically and present a diagnostic challenge physicians , 14. WhiIn this case report, we present a 21-year-old homosexual man who presented with pancytopenia and a 4-week history of night sweats with cervical lymphadenopathy and negative viral screens which led to a diagnostic dilemma. Through repeated testing for EBV, seroconversion was demonstrated and a diagnosis was made.A 21-year-old male with a history of migraines presented to Morriston Hospital in August 2021 following a month's history of pharyngitis and odynophagia and a 2-week history of fever, night sweats, and dry cough which had not responded to amoxicillin therapy. He denied any significant weight loss and no recent sexual partners. There was no history of exposure to unwell contacts or any relevant family history including that for autoimmune disease. He had not left the UK in the preceding 5 years, and he owned no pets, but was in regular contact with his sister's cat.9/L, Plt 84\u2009\u00d7\u2009109/L, and neutrophils 1.0\u2009\u00d7\u2009109/L), macrocytosis (MCV 114\u2009fL), normal reticulocyte count, and raised CRP (30\u2009mg/l) with normal kidney and liver function tests. Coagulation tests revealed prolonged prothrombin time of 13.4 seconds with raised fibrinogen (4.5\u2009g/L). Blood film confirmed pancytopenia with no blast cells noted, hypersegmented neutrophils, and occasional teardrop poikilocytes. Serum vitamin B12 (167\u2009ng/L) and folate (<2.0\u2009\u00b5g/L) were very low and replacement was initiated. Serum ferritin was raised to 1027\u2009\u00b5g/L (15\u2013300\u2009\u00b5g/L) highlighting a proinflammatory state. Coeliac IgA TTG, ANA, ANCA, and anti-dsDNA titers were normal. Further history revealed no abnormal bleeding and an extremely poor diet prompting a further micronutrient screen to be sent.At presentation, clinical examination revealed ongoing pyrexia (>39\u00b0C), general pallor with tender bilateral submandibular lymphadenopathy. There was no evidence of inguinal lymphadenopathy, genital ulceration, or rash. Examination of the pharynx revealed no exudate, mild trismus alongside ulceration of the soft palate and tongue with hyperaemia. Admission blood tests revealed pancytopenia , was negative. Subsequent microbiological investigations to rule out important mimics including acute retroviral syndrome were performed. Hepatitis A, B, and E, syphilis, Q-fever, toxoplasmosis, Whipple's, parvovirus, cytomegalovirus (CMV), and human immunodeficiency virus (HIV) antibody tests were negative. Respiratory viral swabs including adenovirus and SARS-CoV2 respiratory PCR screens were negative, alongside negative peripheral blood cultures. Ultrasound (US) of the abdomen (day 3) revealed splenomegaly of 16.8\u2009cm but no hepatomegaly or intraabdominal lymphadenopathy.Initial glandular fever screening, utilizing a Due to ongoing neutropenia with pyrexia and rising inflammatory markers (CRP 83\u2009mg/L) and to protect from bacterial gut translocation, coamoxiclav and ciprofloxacin therapy were commenced. Computed tomography of the thorax, abdomen, and pelvis was subsequently performed (day 7), which highlighted marked splenomegaly only with no other intraabdominal findings and suggested possible haematological disease. JAK2, serum-free light chains, and BCR-ABL screens were normal; however, LDH was raised to 515U/l (<250u/L).monospot testing became positive, and EBV serology was resent. At this time, due to a lack of a unifying diagnosis and in consultation with our haematology colleagues, cervical node ultrasound and biopsy were undertaken in preference to bone marrow biopsy, although this had been discussed with the patient. US appearances showed bilateral multilevel enlarged pathological lymph nodes, the largest at left level 2, measuring 22\u2009mm in maximum diameter. A core biopsy was undertaken for the exclusion of lymphoma.EBV serology  was negative on day 4 of admission; however, on day 7, repeat \u00b5mol/L, ALP 57\u2009U/L), although he had no clinical features of this. Due to this, a diagnosis of infectious mononucleosis was made and conservative management was instituted alongside dietetic input. By day 11, he had bicytopenia , and by day 16, he was discharged from the hospital following near total resolution of his symptoms.Repeat EBV serology  revealed equivocal EBV VCA IgG (0.77 OD) and positive VCA IgM (9.04 OD). The patient was also found to have developed a new hepatitis . Repeat serology taken 110 days after reported symptom onset now showed VCA IgM 3.59OD and VCA IgG (31.82) with negative EBNA IgG confirming recent primary EBV infection.A literature review was conducted in February 2022 using the PubMed and Google Scholar databases. Searches were performed between 2014 and 2022.Keywords included \u201cEpstein-Barr Virus\u201d (EBV) OR \u201cInfectious Mononucleosis\u201d (IM) OR \u201cGlandular Fever\u201d AND \u201cPresentation\u201d OR \u201ccomplications\u201d OR \u201cMonospot\u201d OR \u201cHeterophile\u201d OR \u201cSerology\u201d OR \u201cYouth\u201d. These terms were used in isolation and in combination to identify search results. From this initial search, 112 research items were identified for review. All abstracts were screened by all authors. Papers were excluded if they were not written in English, duplicitous in nature, not peer reviewed, or had insufficient data regarding the clinicopathology of IM in youth. From these, 45 papers were identified. Following a secondary review of papers, 26 were selected for the final review.\u00b5g/L equivalent to 1024\u2009ng/mL, it is important to recall that serum ferritin is a nonspecific measure of systemic inflammation and not specific to HLH. In the pivotal HLH-94 study the median ferritin level in secondary HLH was 2950\u2009ng/mL. Indeed, in paediatric studies, ferritin levels of >10,000\u2009ng/mL were 90% sensitive, while in adults, an optimal cut-off of 16,000\u2009ng/mL has been proposed . If higher, further important tests would have included measures of soluble IL-2 receptor level and bone marrow biopsy [EBV is a ubiquitous herpesvirus of which >90% of adults by age 40 years have been exposed as evidenced by seroprevelance studies with evidence of later stage primary EBV acquisition in children from developed countries , 6, 7. Ww biopsy \u201321. Othew biopsy .There is an appreciable relationship between the age of acquisition of EBV and the severity of illness, with children often asymptomatic , 6. The As can be seen, in this case the patient had a severe and prolonged presentation of disease (5 weeks) with recovery expected within several weeks. Indeed, the median duration of odynophagia and lymphadenopathy is 7 and 21 days, respectively . It may Given the severity of symptoms, it was prudent to perform an US-node and biopsy to exclude underlying lymphoma. Indeed, the presence of Reed-Sternberg cells is common in the setting of IM and in one review of EBV; these were identified in 44% of lymph node biopsies, with all cases revealing immunoblastic proliferation and positive MUM1/IRF4 staining being present in our case .monospot test was created in 1932, well before EBV's discovery as the cause of IM and is among the most used. This test is a latex agglutination test which uses equine erythrocytes and tests for heterophile antibodies which are produced during EBV infection by the human immune system [Importantly, this case highlights the need to understand the role of serological tests, which can confirm primary infection when a high index of suspicion exists. The e system . While be system  with fale system . Due to e system . Throughe system , 30.In our patient, we can see the time-dependent changes in serology with the appearance of the positive monospot coinciding with the presence of IgM VCA and the occurrence of hepatitis, which occurs in 90% of patients. The presence of new hepatitis in the third week of illness, which this was from fever onset returning to normal at six weeks, agrees with a 6-year centre review of EBV hepatitis in 41 immunocompetent patients. This highlights the delayed nature of EBV hepatitis. Moreover, the pathophysiology of EBV hepatitis is not well understood, and it may be given that at this time when the VCA IgM became positive, immune related hepatotoxicity was occurring .The positivity of the monospot normally occurs 4\u20136 weeks from infection. While not used here, quantitative EBV-DNA measurement can be useful in differentiating between chronic asymptomatic infections where it is undetectable from active EBV disease, particularly within the immunosuppressed population, particularly transplant patients who develop posttransplant lymphoproliferative disorders. It is not recommended for immunocompetent individuals, as it offers no guidance on therapy. Peak viraemia is seen within 2 weeks of postprimary EBV infection with viraemia taking months to years to settle .In conclusion, this case represents an unusual presentation of IM, compounded by pancytopenia. While the initial presentation was very much in keeping with IM, there was diagnostic uncertainty, particularly concerning the absence of initial hepatitis, the presence of plausible alternate diagnoses, and negative initial monospot and more sensitive serological tests. This case highlights the need to understand the time lag to positivity and deficiencies in serology testing and the need for a high index of suspicion to enable the diagnosis. Physicians should be aware of the atypical features with which IM may present with a propensity for more severe disease in older, white patients who do not smoke."}
+{"text": "Ginkgo biloba extract and investigating its wound healing effect on full-thickness wounds in diabetic rats. The topical formulated oil-in-water emulsion-based cream contains Ginkgo biloba aqueous extract in an amount of about 1% to 5% as an active agent. The prepared formula was subjected to physicochemical assessment and pharmacotechnical characterization. Eighteen alloxan-induced diabetic rats completing full-thickness excisional skin wounds were randomly divided into three groups topically treated with either a normal saline (control group), the reference drug (\u201cCytol Centella cream\u00ae\u201d), and cream based on the Ginkgo biloba extract. The response to treatment was assessed by macroscopic, qualitative, and quantitative histopathological analysis. The prepared formula showed good physicochemical properties. The rheological behavior of the prepared cream followed a non-Newtonian pseudoplastic pattern at different storage temperatures. The cream, which is a macroemulsion with uniform size distribution, remained stable for 6 months. Skin tolerance studies confirmed the compatibility of the cream with the skin. During the experimental trial, the cream based on the Ginkgo biloba-treated group showed significant improvements over the control and reference groups for both general wound appearance and healing dynamics. This increased rate of closure of wounds in diabetic rats was associated with increased collagen synthesis. Our findings showed that the cream could be a promising and innovative topical treatment with Ginkgo biloba extract for the management of acute diabetic wounds.Despite advances in diabetes care, impaired diabetic wound healing remains a significant clinical problem. The present study was aimed at developing a novel cream based on  Type 2 diabetes is a polygenic disorder that involves an impairment of insulin secretion related to insulin resistance  \u00d7 100 .All experimental analyses were performed in a blinded manner.th day, the rats were euthanized and the autopsy samples were removed from the middle of the injured skin of the rat in all the groups. The samples were fixed in 10% neutral buffered formalin solution for a week. After dehydration, the specimens were embedded in paraffin beeswax and tissue blocks were sectioned at 5-micron thickness using a sledge microtome. Prepared tissue sections were then stained by hematoxylin and eosin stain for microscopic examination. Digital photomicrographs were captured at representative locations, and the tissue scar was analysed for the extent of dermis and epidermis formation and regeneration. A semiquantitative method was carried out to assess the following histological processes and structures: reepithelization, inflammatory cells, and new collagen. Masson's trichrome staining was used to detect collagen fibers. Sections were evaluated according to the scale: 0, 1, 2, 3, and 4 by two independent observers [After the 13bservers . The meap < 0.05 was considered significant.Data were reported as the mean \u00b1 standard\u2009deviation (S.D). Statistical analyses were performed with one-way analysis of variance (ANOVA) followed by Tukey and Fisher tests. The different rat groups were compared on the basis of the wound area contraction and the semiquantitative preestablished histological scores. A value of The physicochemical properties, regarding physical appearance, color, odor, texture, homogeneity, phase separation, immediate skin feel, and pH of the prepared cream kept at different storage conditions, are shown in The prepared cream showed good macroscopic quality characterized by a milky aspect, homogeneous appearance, semisolid consistency, and easy spreadability. Its application on the skin gave a moisturizing, nonsticky, and nongreasy touch. The pH was slightly acidic (5.43) and was regulated to stay within the narrow range of 6.36. The prepared cream was stable at different storage conditions. It did not show any visual degradation during 6 months. The cream was able to maintain its physicochemical characteristics at ambient temperature.The morphology of the prepared cream is shown in \u03bcm, with a D50 (diameter D50 at 50% of cumulative volume), was around 15\u2009\u03bcm.The droplet size distribution of the emulsion , assesseG\u2032) and loss modulus (G\u2033) as a function of frequency (f) (G\u2032 and G\u2033 are independent of the strain)   and in tency (f) . In the  strain) , G\u2032 and Neither erythema nor any kind of allergic reaction was noted in the dorsal back following dermal application during 24 hours.Ginkgo biloba creams.The mean sugar level for all rats was in the order of 2.5 \u00b1 0.3\u2009g/L; however, it was only 1 \u00b1 0.2\u2009g/L for normal rats. The blood glucose levels in the diabetic rats were not changed by topical treatment of the wound using either reference or Wounds were regularly photographed and evaluated from day 1 until the first group is completely healed. The healing process lasted 13 days in the GBAEC group. Photographs of the wounds of a representative rat from each group are shown in On the first day of injury induction, all wounds had a similar appearance. During the experiment, remarkable differences in wound area and morphology of different groups can be observed. From the third day, a scab formed by necrotic tissue remnants was present in the control and CCC groups. The scab persisted in the control group until the end of the experiment. The scab in the reference group was thinner than in the control group. The clinical signs of inflammation (redness and swelling) were greater in the control and the CCC groups when compared to the GBAEC group. From the fifth day, a very thin scab appeared in the GBAEC group. The scab started to fall off by the ninth day of the trial, and the epidermis was completely developed.In the GBAEC group, the size of scar tissue was also smaller and better than in the CCC group. In this group, healing was much faster than that in the control and CCC groups. Reepithelialization was faster in the GBAEC group when compared with other groups.st, 3rd, 5th, 7th, 10th, 11th, and 13th days of the study.The average wound surfaces of the three studied groups are presented in During the study, the GBAEC group was clearly distinguished from the other groups by a faster healing.At day 13 postinjury, the closure of the diabetic wounds treated with GBAEC (100%) was significantly faster than those of the control (80.28%) and CCC groups (89.07%).The histopathological studies were carried out to assess the wound healing process in different studied groups. The hematoxylin and eosin- and Masson's trichrome-stained skin tissue sections at 200x magnification are shown in Figures p < 0.05)  . In part < 0.05) . The tisDiabetes mellitus is a chronic hyperglycaemic disorder that leads to delaying wound closure. The application of phytochemicals could be a beneficial approach to improve the wound healing in diabetes .Ginkgo biloba leaf aqueous extract and at evaluating its healing effect in diabetic rats in comparison with a reference product, \u201cCytol Centella cream\u00ae.\u201dIn this context, our study is aimed at developing a topical healing cream based on The prepared cream is stable and showed good physicochemical properties. During the experimental trial, the GBAEC group showed significant improvements over the control and CCC groups for both general wound appearance and healing dynamics.Ginkgo biloba leaf aqueous extract. The pH of the cream was then regulated to 6.36. Such a pH stimulates the activity of immune cells and protects the wound from invading microorganisms [Ginkgo biloba extract [The study of the quality of the cream focused on the macroscopic characteristics of the formula, homogeneity, pH, and dynamic viscosity. The prepared cream is a semisolid emulsion that exhibited good macroscopic parameters and perfect stability. During 6 months, the prepared cream maintained its intended physical and chemical qualities, as well as functionality when stored under appropriate conditions. According to Medina-Torres et al. , the sodrganisms , 24. Thi extract .The centrifugation test is considered as an accelerated stability test for predicting the long-term stability of the emulsion. This assay uses centrifugal force to separate two substances with different densities . The pre\u03bcm with a D50 around 15\u2009\u03bcm (diameter D50 at 50% of cumulative volume). This distribution is typical of O/W emulsion cream stabilized with a conventional nonionic surfactant which promotes tissue regeneration and enhances skin penetration of the active ingredient [\u03bcm. The majority of emulsions belong to this category. This type of emulsion is kinetically stable but usually thermodynamically unstable as the two phases tend to break down and separate  due to the reduction in interfacial energies over time [The droplet size of the topical formula is an important characteristic for the physical stability of topical products . Dropletgredient , 30. Thiver time . Howeverver time . The diaver time . The absRheology deals with the manufacturing and application of semisolid topical formulas. The rheological properties are crucial in determining several technological aspects of the product especially the physical stability of the formula during the shelf life and its spreadability . Indeed,The viscosity test showed that the viscosity decreased with increasing shear rate which is typical of a shear-thinning behavior for pseudoplastic materials. This effect is presumably due to the disruption of the network generated by the thickening agent and to the alignment of oil droplets under the effect of applied shear rate which results in less interaction and a decrease in the viscosity. This rheological behavior ensures easy spreading on the skin . The chaGinkgo biloba extract was carried out on the model of a diabetic rat induced by alloxan. The use of the experimentally induced diabetes mellitus model by alloxan is one of the most used and convenient methods for studying and screening new drugs and new therapeutic modalities [\u03b2-cells of the islets of Langerhans by induction of necrosis [\u03b2-cells of the islets of Langerhans. It was reported that alloxan is toxic to pancreatic cells as it especially accumulates in the beta cells as glucose analogs. Thus, alloxan infiltrated the pancreatic \u03b2-cells through the GLUT2 transporter [\u03b2-cell cytosol, alloxan is reduced to dialuric acid and the reduction of alloxan leads to generate reactive oxygen species (ROS) [\u03b2-cells which leads to diabetes mellitus type 1 [\u03b2-cell that controls insulin secretion. This glycoregulatory disorder activates certain pathways for the generation of free radicals in oxygen. The oxidative stress thus generated could constitute the final mechanism at the origin of the oxidative complications associated with hyperinsulinemia [The in vivo study testing the wound healing effect of the cream based on dalities . Alloxandalities . The condalities , 21. Alldalities ; also, inecrosis . Alloxannecrosis  and has necrosis . The mecnsporter . In the es (ROS) . These os type 1 . Alloxanulinemia .The wounds in the GBAEC group contracted more rapidly and significantly than those in the control and CCC groups. This finding agrees with many studies in which the diabetic wounds of the untreated group always showed incomplete wound contraction than those treated with the tested healing principle \u201348.Punica granatum with an initial surface area of 150\u2009mm2 only against 160\u2009mm2 for the wounds in our study. Ginkgo biloba extract seems to accelerate the healing process thanks to its pharmacological properties linked to its bioactive compounds . Indeed, the antioxidant, anti-inflammatory, and vasoregulatory properties of Ginkgo biloba extract already reported by certain authors [Complete healing was observed after 13 days in the rats of the GBAEC group. This healing time is shorter than that observed by Pirbalouti et al.  . Indeed, according to Sun et al. [Ginkgo biloba promoted the expression of VEGF. VEGF is an endogenous stimulator of angiogenesis, and its receptors are upregulated during wound healing [In acute diabetes, the inability of wounds to heal is related to aberrations of the wound healing process. Indeed, according to Komesu et al. , acute dn et al. , the ext healing , 54. Ang healing .Ginkgo biloba extract seemed to provide a significant advancement in wound repair when compared with the control and reference groups. To the best of our knowledge, the results of this study show for the first time the efficacy of Ginkgo biloba-based cream treatment on wound healing in diabetic animals. Hence, the results open the way to future clinical applications. However, further biochemical investigations are required to determine the accurate mechanism of the wound healing effect of the cream.On the basis of the results of our study, the cream based on"}
+{"text": "After intravitrealinjection, the formulation is designed to undergo a sol\u2013gelphase transition at the administration site to obtain an intraoculardepot system for long-term sustained release of bioactives. A Diels\u2013Alderreaction was exploited to crosslink hyaluronic acid-bearing furangroups (HAFU) with 4 arm-PEG10K-maleimide (4APM), yielding stablehydrogels. Here, a systematic investigation of the effects of polymercomposition and the ratio between functional groups on the physicochemicalproperties of hydrogels was performed to select the most suitableformulation for protein delivery. Rheological analysis showed rapidhydrogel formation, with the fastest gel formation within 5 min aftermixing the hydrogel precursors. In this study, the mechanical propertiesof an ex vivo intravitreally formed hydrogel wereinvestigated and compared to the in vitro fabricatedsamples. Swelling and degradation studies showed that the hydrogelsare biodegradable by the retro-Diels\u2013Alder reaction under physiologicalconditions. The 4APM-HAFU (ratio 1:5) hydrogel formulation showedsustained release of bevacizumab > 400 days by a combination ofdiffusion,swelling, and degradation. A bioassay showed that the released bevacizumabremained bioactive. The hydrogel platform described in this studyoffers high potential for the sustained release of therapeutic antibodiesto treat ocular diseases.Retinal diseasesare the leading cause of visual impairment worldwide.The effectiveness of antibodies for the treatment of retinal diseaseshas been demonstrated. Despite the clinical success, achieving sufficientlyhigh concentrations of these protein therapeutics at the target tissuefor an extended period is challenging. Patients suffering from maculardegeneration often receive injections once per month. Therefore, thereis a growing need for suitable systems that can help reduce the numberof injections and adverse effects while improving patient complacency.This study systematically characterized degradable \u201c Themost prevalent ones include diabetic retinopathy (DR), diabetic macularedema (DME), and age-related macular degeneration (AMD). The numberof patients suffering from these diseases is rapidly increasing inboth low- and high-income countries, not only in the aging populationsbut also in younger individuals, representing a significant publichealth burden. DR is a retinal disease causing vision impairment orvision loss in diabetic patients.2 Overone-third of diabetic patients have signs of DR, with or without DME,making this condition one of the leading causes of visual impairmentin working-age adults aged 20\u201371. AMD is the leading causeof irreversible blindness in elderly Europeans. Around 30\u201350million people worldwide are affected by AMD, which is expected toincrease in the aging population.3Accordingto the World Health Organization, in 2019, approximately2.2 billion people lived with some sort of vision impairment worldwide.Of those, 1 billion have a preventable vision impairment and 39 millionare entirely blind.5 Therefore, besides photodynamictherapy and photocoagulation, many clinical approaches aim to blockVEGF signaling by delivering intravitreally injected anti-VEGF proteins.6 The current treatment for ocular vascular diseasesincludes full-length VEGF antibody , antibodyfragments , and soluble receptors .7Many studies have demonstrated that elevated levels of vascularendothelial growth factor (VEGF) play a critical role in these retinaldiseases\u2019 pathogenesis, resulting in neovascularization andvaso-permeability.9 This administration route\u2019s advantage is related to rapiddrug distribution to the back of the eye, increased therapeutic effect,and reduced systemic adverse events compared to other administrationroutes. Nevertheless, ophthalmologists consider current treatmentoptions insufficient, as repeated injections are required to controlthese chronic diseases. These injections can be given at a maximumfrequency of once a month because repeated intravitreal administrationsresult in poor patient compliance and are associated with severalrisks, such as bacterial endophthalmitis, retinal detachment, andhemorrhage.11 Intravitreal pharmacokinetics(PK) data show relatively rapid ocular clearance of the anti-VEGFagents .14 Consequently,a high drug dose is injected into the eye and the drug concentrationin the vitreous is oscillating above and below therapeutic levelsin time when multiple bolus injections are administered.Various studies have shownthe effectiveness of antibodies in significantlyslowing down DR and AMD progression by bolus intravitreal injections.Therefore,there is a growing need for suitable delivery systemsto tackle the current limitations of conventional drug formulationsby providing sustained release of the therapeutic agents to the backof the eye for an extended period of time, thus improving patientcompliance and reducing healthcare costs.15 Several drug delivery technologies, such as in situ forming hydrogels, micelles, liposomes, nanoparticles, dendrimers,microneedles, and ocular implants, are currently being investigatedfor ocular applications.18 However, despite these efforts,antibody-carrying implants are still currently limited on the market.7 Genentech\u2019s Susvimo, previously calledPort Delivery System,20 is the first and currently onlyFDA-approved refillable ranibizumab implant used for the treatmentof neovascular age-related macular degeneration.21 The system allows continuous diffusion of the protein fromthe reservoir into the vitreous.22In the past decades,tremendous efforts have been made to improvethe disposition of drugs, especially bioactive proteins, in the retinausing different drug delivery vehicles.23Although this implant can significantly prolong drug release tothe posterior segment of the eye, it requires invasive methods toinsert the device (2.6 mm in width and 8.4 mm in length) at the targetsite and also to remove it. Furthermore, during phase 1 and phase2 clinical evaluations, the occurrence of vitreous hemorrhage in asignificant number of cases was noted. Although this limitation wasovercome in phase 3 evaluation by modifying the surgical technique,time will tell how practical such a system will be in ocular therapy.28 This type of delivery system offers several benefitsfor ocular drug delivery compared to the current bolus injections,including less frequent administrations, patient comfort, and potentiallyalso cost reduction. Furthermore, hydrogels that gellify insitu allow entrapment of therapeutically active antibodiesduring network formation, facilitating local delivery and releasethrough a minimally invasive procedure. To obtain a formulation thatreleases the loaded antibody for a prolonged time, its initial mobilityin the gel matrix should be limited and increase in time due to swellingand degradation of the hydrogel matrix.The use of hydrogels has received increasedattention as ophthalmicformulations that deliver drugs to the posterior segments. Hydrogelsare three-dimensional hydrophilic polymeric networks with versatileand tunable characteristics such as biocompatibility, mechanical flexibility,tailorable release properties, and transparency.34 Hyaluronic acid (HA) is a polysaccharide that is abundantly presentin the vitreous of the eye.35 Therefore,HA has been used in vitreous substitution and to replace fluid duringcertain eye surgeries.40 Furthermore, HA has also been used in many ocular products designedto cleanse the eyes and offer relief from dryness in the form of eyedrops.41 HAFU was therefore selected asa building block because of its expected compatibility with the posteriorand anterior segments of the eye. Furthermore, poly(ethylene glycol)(PEG) is one of the most used polymers in drug delivery systems.43 After the first approved PEGylated products around 30 years ago,44 a vast amount of clinical experience has sincebeen gained with this polymer, making it an ideal building block forhydrogels for biomedical applications. In addition, solely PEG hydrogelformulations crosslinked with DA or Micheal-type reactions have alsobeen investigated for sustained protein release33 and potential ocular applications.45In this study, furan-modifiedhyaluronic acid (HAFU) was crosslinkedwith 4 arm-PEG10kDa-maleimide (4APM), yielding stable hydrogels dueto Diels\u2013Alder reaction (DA). Similar hydrogel formulationshave previously been used to enable the controlled release of extracellularvesicles, and for the encapsulation and three-dimensional (3D) cultureof cells in tissue engineering.15 However, slow crosslinking mechanism, permanent crosslinks,and the need for toxic catalysts and radical initiators still limitthe clinical use of such systems. A major advantage of DA chemicalcrosslinking is that it occurs under physiological conditions avoidingthe use of potentially toxic catalysts and initiators, commonly usedin many existing crosslinking strategies for controlled-release hydrogeldelivery systems.47 However, maleimide functionalgroups present in the furan-maleimide DA crosslinks can potentiallyreact with SH and NH2 groups of the loaded protein,48 creating protein conjugates. Despite this limitation,the unique properties and advantages of DA chemistry have been gainingincreasing recognition, especially when applied in biomedical applications.46 Although some DA-based hydrogels for oculardrug delivery have been previously studied as long-acting sustaineddelivery systems for bevacizumab32 with releaseprofiles up to 100 days, there is limited information available onthe influence of hydrogel composition on material\u2019s physicochemicaland structural properties and how that relates to the release profilesof therapeutic proteins.Different types of crosslinking chemistry have been studied inhydrogel systems to deliver proteins to the posterior segment of theeye, as previously reviewed by Ilochonwu et al.This study aims to fill this gap bysystematically examining theeffects of hydrogel polymer composition and the ratio of functionalgroups on a series of material properties, such as gelation kinetics,injectability, mechanical properties, mesh size, degradation, anddrug release kinetics for intraocular therapy. Specifically, the presentwork investigates a DA-crosslinked hydrogel based on HA and PEG polymerswith potential application as a long-acting sustained delivery systemfor bevacizumab .The formulation was designed and aimed to be injectable into the vitreouscavity using a small needle (29G). After injection, the aqueous polymericsolution formed a crosslinked hydrogel at the administration site,entrapping the antibody dissolved in the same solution to obtain anintraocular depot system.in situ gel formation in porcine eye explants. Uniquely to this study, theelastic moduli (E) of in vitro and ex vivo formed hydrogels were determined to calculate thehydrogel mesh size. Considering the size of the used intraocular modelprotein, the average mesh size (\u03beavg) of the hydrogelswas designed to allow controlled release of the antibody due to acombination of swelling, diffusion, and degradation. The cytocompatibilityof the formed hydrogel and its building blocks was evaluated usingretinal M\u00fcller cells (QMMUC-1).Furthermore, the potential prospectof HAFU-4APM hydrogels forintraocular protein therapy was examined by testing 22.1Lyophilizedsodium hyaluronate  was obtained from Lifecore Biomedical. The 4-arm PEG maleimide crosslinker  waspurchased from JenKem Technology USA, Inc. . StockPhosphate buffered saline 10\u00d7 (PBS) pH 7.4  BioReagents were purchased from B.Braun . 4--4-methylmorpholiniumchloride(DMTMM) was purchased from TCI EUROPE N.V. Alexa Fluor 750 C5 maleimidedye was obtained from Thermo Fisher Scientific . All other commercial chemicals were purchased from Sigma-Aldrich and used as received unless indicatedotherwise. Dialysis tube membranes (molecular weight cutoff (MWCO)10 kDa) were purchased from Fisher Scientific .Avastin (100 mg/4 mL), Roche (100 mg of Bevacizumab), 240 mg of trehalosedehydrate, 4.8 mg of sodium phosphate, 1.6 mg of polysorbate 20 (Tween20), and injection water; (pH 6.2) were kind gifts from the UMC Utrecht.2.2N-hydroxysuccinimide(NHS) was added while keeping the pH at 4.75. The solution was stirredat room temperature for 48 h, and the reaction was stopped by increasingthe pH to 7 using 5 M NaOH. The mixture was purified by dialysis (Mwcutoff = 14 kDa) against dilute HCl (pH 3.5) containing 100\u2013150mM of NaCl and finally against water at 4 \u00b0C. The final productwas obtained as a fluffy white powder after freeze-drying with a yieldof 70\u201380%. To obtain HA with a higher DS (50 and 83%), HAFUwas synthesized according to the procedure described by Nimmo et al.29 with modifications. Briefly, HA  was dissolved in 40 mL of MES buffer  to which DMTMM was added at 6 , or 2 molar ratio (relative to the \u2212COOH groupsin HA) and stirred for 10 min. Furfurylamine was subsequently addeddropwise at a 2 , or 1  molar ratio relative to the \u2212COOH groups in HA. The reactionwas conducted at room temperature for 24 h, and afterward, the pHwas raised to 7 (using 5 M NaOH) to stop the reaction. Compared toEDC coupling, it was possible to quickly isolate the HAFU polymerproduced by DMTMM coupling through precipitation in ethanol/wateras the reaction byproduct remained soluble. Briefly, the productswere precipitated in water/ethanol at RT with a ratio of 1:7.5 (reactionmixture H2O:ethanol) and washed three times with ethanol.The precipitate was vacuum-dried to obtain HAFU derivatives as a solidwhite powder with a yield of 84\u201388%. The different HAFU polymerswere characterized with 1H NMR spectroscopy using an Agilent400MR NMR spectrometer . Dataanalysis was performed using MestReNova, and the chemical shifts werecalibrated against the residual solvent peak (4.79 ppm for H2O). The ratios of the integrals of the N-acetylglucosamine peak on the HA-backbone were compared with the aromaticfuran peaks to determine the degree of substitution. 1HNMR \u03b4 (ppm): 7.5 , 6.4 , 4.10\u20133.0(protons of HA disaccharide), 2.0 .Furan-modified HA (HAFU) derivativeswere prepared by functionalizing hyaluronic acid with furfurylaminegroups by means of two methods. HAFU with a low degree of substitution(DS) (30%) was synthesized by dissolving sodium hyaluronate  in Milli-Q-water at a concentrationof 3.2 wt/v%. After dissolution, 1 mL  of furfurylaminewas added to the solution while stirring. The pH was adjusted with5 M HCl to 4.75, and subsequently, 1.35 g (7.0 mol) of 1-ethyl-3-(3-dimethylaminopropyl)carbodiimide(EDC) was added. Next, 724 mg (6.0 mmol) of 2.3Cylindrically shaped emptyHAFU-4APM hydrogels of 100 mg were prepared at 37 \u00b0C in a plasticmold . Specifically, equal amounts ofHAFU and 4APM crosslinker were weighed and dissolved separately inPBS  andmixed to obtain a total polymer concentration of 5, 10, 20 or 25 wt% unless indicated otherwise. Different molar ratios between the 4APM crosslinker and HAFU polymers corresponding to 1:1.9; 1:3.1; 1:5.2approximated to 1:2; 1:3; 1:5 ratios of maleimide:furan, respectively were used to prepare hydrogels with different properties.Subsequently, the samples were incubated at 37 \u00b0C for 4 h toallow crosslinking of the hydrogels.Bevacizumab-loaded HAFU-4APMhydrogels were prepared as described above with a slight modification.HAFU polymers were dissolved in a mixture of PBS  and bevacizumab solution , while the 4APM crosslinker was separately dissolvedin PBS. Upon dissolution, the 4APM crosslinker solution was mixedwith the HAFU-bevacizumab solution and incubated at 37 \u00b0C for4 h to enable crosslinking and protein entrapment. The HAFU-4APM hydrogelswere loaded with either 1.25 or 1.50 mg of bevacizumab in the 100mg hydrogels.2.4W0), after which 1 mL of PBS(pH 7.4) was added to the vial, which was subsequently incubated at37 \u00b0C. At regular intervals, hydrogel weight was determined (Wt) after removal of the PBS. Subsequently, 1mL of fresh PBS  was added for further incubation at 37 \u00b0C. The swellingratio (SR) is defined as the weight at a particular time point (Wt) divided by the initial hydrogel weight: SR= Wt/W0.Crosslinked empty hydrogels (100mg) were prepared as described in 2.5G\u2032) and loss (G\u2033)moduli of the different hydrogel formulations were measured duringa time sweep at 37 \u00b0C with a frequency of 0.1 Hz and 1% strain.The gelation time (defined as the crossover point between G\u2032 and G\u2033) of the differenthydrogel formulations was measured at different temperatures . Hydrogel average mesh size (\u03be) was calculatedfrom the G\u2032 using the following equation52NA is Avogadro\u2019s constant, R isthe molar gas constant (8.3 J/K\u00b7mol), and T isthe absolute temperature in K.The rheologicalproperties of the hydrogel were analyzed usinga Discovery HR-2 Rheometer  with aPeltier plate for temperature control. The samples were measured usinga 20 mm diameter aluminum plate-plate geometry at a loading gap of3000 \u03bcm and gap value of 200 \u03bcm. For each analysis, samplesof 180 \u03bcL of different liquid hydrogel formulations were preparedas described in 2.6Figure S4A.HAFU DS 30% (150 mg) was dissolved in 800 \u03bcLof PBS. Subsequently, 160 \u03bcL of an Alexa Fluor 750 C5 maleimidesolution in dimethyl sulfoxide  was added and leftto react overnight at room temperature by means of Diels\u2013Alderreaction. Next, the solution was dialyzed against DMSO/water (1/14)for 16 h with three times solvent exchange. The product was lyophilizedto obtain fluorescently labeled hyaluronic acid-furan (HAFU-750 dye)polymer as a glassy light green powder. The covalent conjugation ofthe dye to HA was analyzed by Shimadzu UV 2450 spectrophotometer.The HAFU-750 dye polymer (10.5 mg/mL) and the Alexa Fluor 750 C5 maleimidedye standards (0.001\u20130.005 mg/mL) were dissolved in 1:9 DMSO/PBS and the absorbanceUV/VIS spectra were recorded from 200 to 1000 nm with 0.5 nm resolution.Size exclusion chromatography (SEC) was used to discriminate the presenceof free dye in obtained HAFU-750 dye polymer, as shown in 2.753 Briefly,enucleation is the surgical procedure by which the entire eye is removed,including the sclera and the muscles that control eye movement areleft intact. HAFU-750 dye  through a pipetteafter removing the plunger. Before the injection, the eyes were broughtat 37 \u00b0C in a water bath for 30 min. Next, the formulation wasinjected into the eye (vitreous body). Images of the ex vivo porcine eye were taken before and 5 min after intravitreal injectionusing an LI-COR Pearl impulse imager  at37 \u00b0C. The in situ formed hydrogel was collectedfrom the vitreous as follows, the eyeball was held firmly with theuse of a gillies forceps, and after making a small incision with asharp blade, a spring scissor was used to cut the sclera around thecornea starting from the opening of the incision. Subsequently, thelens was removed, and the vitreous was carefully transferred intoa container. The hydrogels were isolated from the vitreous body, andthe mechanical properties were compared with the in vitro formed hydrogel  were prepared withapproximately 3 mm \u00d7 4 mm in height and diameter. The gels wereplaced between parallel plates, and a force ramp was applied at arate of 0.5 N/min up to a total force of 8 N at room temperature.The raw data were analyzed using TA Universal Analysis software, andYoung\u2019s modulus (E) was calculated from theslope of the linear section (from 0 to 22% strain) of the stress\u2013straincurve. Data are represented as mean \u00b1 standard deviation (SD)(n = 3 for in vitro gel and n = 6 in two porcine eyes for the ex vivo formed gels).A DMA 2980 Dynamic Mechanical Analyzer  was used to determine Young\u2019s modulus of the hydrogels.Hydrogel samples 2.9in vitro release buffer (IVRbuffer) consisted of PBS  supplemented with 0.02% NaN3. Bevacizumab-loadedhydrogels (100 mg) were first immersed in 500 \u03bcL of PBS. Afterincubation, the release samples of 200 \u03bcL were taken at predeterminedtime points, and 200 \u03bcL of fresh IVR buffer was added. The releasesamples were stored at 4 \u00b0C until analysis of protein contentby size exclusion ultra-performance liquid chromatography (SE-UPLC)on an Acquity UPLC  with an FLR-detector,operated at \u03bbex and \u03bbem of 276 and310 nm, respectively. BEH SEC column  was attached to the system and used for allmeasurements at room temperature. The filtered (0.2 \u03bcm) mobilephase consisted of an aqueous solution of sodium phosphate 100 mMand sodium sulfate 300 mM at pH 6.7 and was operated at a flow rateof 0.3 mL/min. Sample aliquots of 7.5 \u03bcL were injected, andthe retention time of bevacizumab was 4.90 min under these conditions.The bevacizumab calibration curve\u2019s linear range was from 7.8\u03bcg/mL (detection limit) to 1250 \u03bcg/mL.To determine the releaseof bevacizumab from the different hydrogels, bevacizumab-loaded hydrogelswere prepared as described in 2.10N-morpholino)ethanesulfonic acid) was used asa running buffer. The gels were stained with Coomassie blue  overnight and washed three times to remove excessstain. Photos were captured with the ChemiDoc .To study possiblestructural modifications of the protein with hydrogel precursors,sodium dodecyl sulfate polyacryl amide gel electrophoresis (SDS-PAGE)was performed. Bevacizumab PBS  solution (1 mg/mL) was incubated with5 mg of hydrogel precursors, either HAFU  or 4APM for1 h and 5 days. Bevacizumab solution (1 mg/mL) was used as a control,and Precision Plus Protein Unstained Protein Standards 10\u2013250kDa  were used for calibration. Possible graftingof the hydrogel polymer precursors to the antibody was studied underboth reducing and nonreducing conditions. Specifically, 2 \u03bcLof samples (bevacizumab-polymer solutions or bevacizumab solution)were mixed with 7.5 \u03bcL of solution of 250 mM Tris-HCl pH 6.5;8% SDS; 0,008% Bromophenol Blue; 40% glycerol with and without \u03b2-mercaptoethanol5% (100 mM), and PBS was added to obtain a final volume of 30 \u03bcL.The prepared solutions were heated to 90\u2013100 \u00b0C for 10min. Subsequently, samples (25 \u03bcL) and standard (3 \u03bcL)were loaded into the Bolt 4\u201312% Bis-Tris Gel  and run at 90 V for 65 min. Bolt MES were stimulated with 20 ng/mL VEGF. Atthis concentration, proliferation is maximal and enhanced approximately6 times compared to not stimulated cells.55 The ability of released bevacizumab relative to that of the nativeprotein to inhibit HUVECs VEGF-induced cell proliferation was determined.HUVECs  were cultured until passage 2\u20135in Endothelial Cell Basal Medium 2 (Promocell C-22211) supplementedwith Endothelial Cell Growth Medium 2 Supplement Mix (Promocell C-39216).Proliferation inhibition experiments were performed in assay medium in 96-wellplates coated with rat tail collagen .The bioactivityof released bevacizumab was evaluated with a previously describedcell proliferation assay.in vitro release IVR sample and 50 \u03bcL of assay buffersupplemented with 80 ng/mL VEGF  andpreincubated at 37 \u00b0C and 5% CO2 for 1 h. Next, 4000cells dispersed in 100 \u03bcL of assay medium were added resultingin a final volume of 200 \u03bcL per well (corresponding to 100 timesIVR sample dilution). Wells without cells and filled with 200 \u03bcLof assay medium served as blank. Wells with cells stimulated with0, 5, 10, 20, 30, 50, and 100 ng/mL  VEGF wereincluded as a reference to show that a VEGF concentration of 20 ng/mL,proliferation was maximal.Specifically, wells were filled with 50 \u03bcL of 25 times diluted 2 by adding 20 \u03bcL of the AlamarBlue reagent and another 4 h of incubation.56 Fluorescence was measured (\u03bbex 530 nm and \u03bbem 600 nm) with a microplate reader . Results are expressed as relative cell proliferation, whichis the proliferation normalized by the proliferation of unstimulatedcells. The concentration of bioactive bevacizumab was calculated fromthe bevacizumab dose-dependent inhibition of VEGF stimulated HUVECproliferation at a fixed concentration (20 ng/mL) of VEGF stimulatedHUVEC proliferation.Polymer solutions (3 mg/mL) of HAFU(DS 30 and 83%) and 4APM wereused as controls. Cell proliferation was assessed after 92 h of incubationat 37 \u00b0C/5% CO2.1257 The cells were cultured in Dulbecco\u2019smodified eagle medium   supplemented with 10% fetal calf serum  and 1% penicillin/streptomycin (PS) . The cells were maintained in a humidified atmospherewith 5% CO2 at 37 \u00b0C. HAFU (5 mg) with DS 30% and5 mg of 4APM crosslinker were dissolved separately in 50 and 40 \u03bcLof PBS, respectively. After dissolution, the hydrogel precursors weremixed to obtain a 10 wt % hydrogel . The formulation mixture was transferred into a 48-wellplate, partly covering the bottom of the well. After 3 h of incubationat 37 \u00b0C, the formed hydrogel adhered to the well\u2019s bottom.Next, QMMUC-1 cells suspended in DMEM were seeded into the wells at3000 cells/well. After 1 and 5 days of incubation, pictures of thecells were taken with a Leica DMi1 inverted microscope  to investigate their morphology.Possible cytotoxicity of hydrogelsand hydrogel precursors in contact with cells was evaluated usingQueen\u2019s University Murine M\u00fcller glia Clone-1 (QMMUC-1cells).n =6).Alamar Blue cell viabilityassay was used to evaluate the effect of polymers and hydrogel leachableson QMMUC-1 cells. Hydrogels were prepared by mixing 4APM aqueous solutionand HAFU (DS- 50%) aqueous solution (10 and 20 wt %) as describedin 33.1Figure S1). 1H NMR analysis showed that HAFU with DS 30% was successfullyobtained with this method, as shown in Figure S1. However, using this EDC/NHS method, the extent of the derivatizationof HA with furfurylamine is limited due to some drawbacks, suchas the necessity of accurate pH control of the reaction mixture andshort half-life of EDC (\u223c4 h) in water at pH 5.0 compared toDMTMM, which provides superior yields, as reported by D\u2019Esteet al.58 Therefore, to obtain a HAFU derivativewith a high DS, DMTMM was used as activation agent. By varying themolar ratios of HA(disaccharide units)/furfurylamine/DMTMM, HAFU withdifferent DS were synthesized. Molar ratios of 1:2:6 and 1:1:2 yieldedHAFU with DS of 83 and 50%, respectively, as shown by 1H NMR analysis . The conjugationof furfurylamine to the carboxylic acid on HA was further demonstratedby Fourier transform infrared (FTIR) spectroscopic analysis as shownin Figure S2. The successful grafting ofthe furan groups to HA is demonstrated by the increase and shift ofthe peaks at 741, 1652, and 1541 cm\u20131 correspondingto =C\u2013H\u2013 bend of furan moiety, amide I stretching,and amide II bending.HA 24 kDa was chosen over higher HA molecularweights, as it is important that the final formulations have an initiallylow viscosity to allow injectability through a small G needle. A HAFUderivative with a low degree of substitution was prepared by the activationof carboxyl groups of HA with EDC and NHS, followed by reaction ofthe formed activated NHS ester with the primary amine of furfurylamine.The degree of furan substitution of HA (DS) is defined as the numberof furan group residues per 100 HA disaccharide units  and cylindrically shaped hydrogels were formed after mixinga solution of HAFU and 4APM in PBS (pH 7.4) in a plastic mold at 37\u00b0C due to Diels\u2013Alder (DA) reaction between the furanand the maleimide moieties59 . The presence of the hydrolyzed (ring-opened) maleimidewas identified, in line with previous reports by Kirchhofet al.60Hydrogel swelling and degradation properties areessential factors to evaluate when developing long-lasting hydrogelsfor ocular/biomedical applications. Swelling and degradation of differenthydrogels during incubation in PBS (pH 7.4) and at 37 \u00b0C weremeasured gravimetrically. All gel formulations first absorbed water,which caused a mass increase in time up to a maximum swelling ratiofollowed by a gradual decrease in gel weight until they completelydissolved in the buffer 2. This i61 hydrogel degradation through this second pathway is not likely tooccur. Gregoritza et al. and Kirchhof et al. showed that DA hydrogelsbased on PEG or Poloxamine can be completely degraded under physiologicalconditions by retro-Diels\u2013Alder at 37 \u00b0C.61Another possible pathway is caused by the direct hydrolysis ofthe carbonyl moiety and ring opening of the DA adduct  and lossmoduli (G\u2033) as a function of time at differenttemperatures in relation to hydrogel compositions. A formulation composedof 15 wt % polymers was prepared with and without bevacizumab (1.25 mg/mL) and analyzedfor gel formation using a rheometer. This formulation (15 wt % polymers(ratio 1:3)) was chosen as a model formulation with intermediate gelationkinetics to verify if there are any interactions of the protein withthe hydrogel network.To be used as injectable, G\u2032, G\u2033, and complex viscosity (\u03b7*) were monitoredover time, as shown in G\u2032 and G\u2033 were low with a complex viscosity (\u03b7*) of0.07 Pa\u00b7s indicating a free-flowing liquid solution. Both modulisubsequently increased in time, and a crossover between G\u2032 and G\u2033 (defined here as the gelation timeand corresponding to tan(\u03b4) = 1, Figure S9) demonstrated network formation due to the reaction of themaleimide and furan functionalities. G\u2032 increase is dependent on thepolymer concentration . This observation indicates that overallfewer crosslinks are formed at higher temperatures, which can be attributedto a slight shift in the equilibrium of forming and breaking of DAadducts.65Interestingly, it was observed that at the gelation point,20 wt% 4APM-HAFU hydrogel formulations had lower storage modulus with an increasing temperature , and R and T are the universal gas constant (8.314 J/K\u00b7mol)and the reaction temperature (in K), respectively. The calculatedactivation energy was 54.5 \u00b1 1.1 and 53.4 \u00b1 1.9 kJ/mol for1:2 and 1:5 maleimide:furan ratios, respectively, used in the hydrogelformulations. The calculated activation energy is in agreement withpreviously reported values for furan-maleimide Diels\u2013Aldersystems (51.9 and 48.4 kJ/mol).69The temperature-dependent gelation time of the hydrogels 3F was us3.4Figure S4A. The chromatogram of the synthesizedHAFU-750 dye polymer showed a UV signal at 750 nm, which correspondsto the dye fluorophore . Fromthe spectrum, it is calculated that \u223c0.01% of the disaccharideunits were labeled with the fluorophore showing a coupling efficiencyof around 50%. The injectability of HA-PEG formulations was investigatedby intravitreal injection into vitreous humor of an ex vivo porcine eye at 37 \u00b0C, using a 29-gauge needle. After injection(5 min), the localized presence of the formulation (in green) wasobserved in the vitreous at the site of injection and 1 h incubation at 37 \u00b0C, the vitreous was isolated from theporcine eye to allow extraction of the formed hydrogel (in light blue),as shown in in situ upon injection inthe eye showed an irregular, bean-like shape after administrationof the liquid formulation through a 29 G needle. It was found thatthe ex vivo formed hydrogel had a width of 0.73 cmand a length of 0.83 cm, whereas as a comparison, a hydrogel prepared in vitro took the shape of the mold  diffusivityin the gel network,75 a crucial aspectto consider when developing an ocular drug delivery reservoir.To localize the formulation in the vitreous after injection, HAFUwas labeled with Alexa Fluor 750 C5 maleimide by means of Diels\u2013Alderreaction, resulting in the formation of HAFU-750 dye conjugate. Theabsence of free dye was demonstrated by SEC, as shown in in vitro and the isolated ex vivo formedhydrogels, theirYoung\u2019s moduli (E) were determined experimentallyby compression tests  taken at the plateau region ofa time sweep curve were also experimentally determined for 20 wt % in vitro formed hydrogels .To calculate the average mesh size (\u03be) of on tests 4F.76 FurE) and shear(G\u2032) moduli for the in vitro formedhydrogels was used to calculate the G\u2032 ofthe ex vivo formed hydrogel, as shown in in vitro hydrogels, a factorof 2.5 \u00b1 0.2 was experimentally determined for E and G\u2032 at a frequency of 1 Hz. This valueis close to the theoretical ratio, with E being 3times G\u2032.77 Consideringthat the G\u2032 of the ex vivo prepared hydrogels could not be experimentally determined, the samefactor for the in vitro formed hydrogels was used.As expected, in vitro and ex vivo gels formed at molar a ratio 1:5 maleimide/furan had a higher E  and G\u2032  compared to formulations of a molar ratio 1:2, E  and G\u2032  see E and G\u2032 values for the in vitro formed hydrogels (approximately 3 times higherthan the ex vivo gels) indicate a higher crosslinkingdensity. The obtained G\u2032 values were usedto calculate the average mesh sizes  was calculated to be smallerthan at the ratio of 1:2 (7.4 nm), as shown in The ratio between the elastic  between in vitro and ex vivo formedhydrogels. Although the ex vivo eye is not entirelycomparable to the in vivo situation, it providesa valuable method for preclinical intraocular hydrogel characterization.The calculated mesh sizes of the 3.5in vitro releaseof bevacizumab from the hydrogels was studiedin PBS (pH 7.4) at 37 \u00b0C. The chosen bevacizumab dose (1.25 and1.5 mg) corresponds to the typical amount administered in clinicsby bolus injection of 50 \u03bcL of Avastin (1.25 mg of bevacizumab).8182 as well as the gel geometriesafter swelling is not very different for these gels. From these results,it can be concluded that although the gelation time and the degradationkinetics largely depend on the initial polymer concentration for thegels formed based on a 1:2 maleimide/furan ratio, the release kineticsare hardly affected by these parameters.The 61 Gregoritza et al.31 reportedup to \u223c100 days of sustained bevacizumab release from DA-basedhydrogels.On the other hand, 4APM-HAFUhydrogels prepared at a molar ratioof 1:3 maleimide/furan showed a two-phase release profile. The 10%gel released approximately 46% of the loaded protein in \u223c16days in an almost linear way, followed by a slower release of up to74% of the loaded protein during the next \u223c54 days. The 16wt % 4APM-HAFU hydrogel  released \u223c60%of the loaded protein within the first 30 days, followed by slowerrelease kinetics of up to 77% of loaded bevacizumab to 70 days. Interestingly,bevacizumab was released from 4APM-HAFU hydrogels prepared at a molarratio of 1:5 for more than 329 days, also with a two-phase releasekinetics. In the first phase, 34% of the loaded protein was releasedfrom the 10 wt % gel during 30 days and from the 20 wt % gel during50 days, while 40% was released from 25 wt % gel during 60 days. Thiswas followed by the second phase of slower protein release. After329 days, approximately 53% of bevacizumab was released from the 10wt % gel, while 64% was released from the 20 wt % gel after 427 days.Remarkably, the 25 wt % gel prepared at a ratio of 1:5 4APM-HAFU showednearly complete bevacizumab release over the measured time frame of427 days. For comparison, previously Kirchhof et al.in vitro and ex vivo formedhydrogels\u2019 mesh size is between 3.9 and 7.4 nm, and these valuesincrease during hydrogel swelling and degradation. Therefore, it isexpected and also in agreement with the in vitro data,that the release of a monoclonal antibody such as bevacizumab witha hydrodynamic radius of around 6.5 nm83 is likely controlled by a combination of swelling, degradation,and diffusion and subsequently multiple phase release profiles canbe observed. However, for the ex vivo formed 4APM-HAFU(molar ratio 1:2) hydrogel, the calculated average \u03beavg is around 7.4 nm  and ex vivo (7.4\u20135.9nm), protein release kinetics could potentially be predicted basedon their diameter. Nevertheless, it is essential to note that protein-networkinteractions might also affect the drug release rate.In general, other proteins administeredthrough intravitreal injectionsdo not exceed a hydrodynamic radius of 10 nm, e.g., aflibercept (5.20nm); ranibizumab (4.1 nm).86 Second, the encapsulated protein can act asa chemical crosslinker when one protein molecule reacts with two ormore maleimide groups present in the polymer network. Amine and thiolresidues of proteins can react with maleimides by a Michael-type addition.87 For bevacizumab, reactivity with amines is morelikely since thiol functionalities are disulfide bridged in this protein.88 Free maleimide moieties available during theformation of Diels\u2013Alder crosslinks can potentially react withthe protein both during and after hydrogel formation. These graftedproteins can only be released upon the network\u2019s degradation.The occurrence of these grafting reactions, leading to protein-polymerconjugates, were indeed confirmed by SDS-PAGE analysis under reducingand nonreducing conditions. Incubation of bevacizumab for 1 h with4APM polymer resulted in the coupling of around one PEG chain after1 h, and more extensive modification was observed after five daysof incubation, and approximately, on average, three PEG chains werecoupled to the protein, as shown in SI-Figure 6A. As expected, the HAFU DS30 and 83 did not react with theprotein even after 5 days of incubation at 37 \u00b0C, justifyingthe choice to dissolve HAFU in the protein solution.The releasecurves of 89 For thisreason, bevacizumab was loaded in hydrogel formulations containinghigher ratios of furan functional groups compared to maleimide groupsto minimize the presence of the latter, thus limiting protein modification.The excess furan was also chosen to minimize possible side reactionsof the maleimide with biological systems as furan is considered tobe safer. During the release study, a significant extent of modificationwas still seen for the protein released after 21 days from the 1:24APM-HAFU hydrogels. Nevertheless, when proteins are linked to thehydrogels, the quantitative release of modified protein from a hydrogelmatrix can still occur upon complete degradation of the network. However,complete release was not observed in this study, likely because largesoluble conjugates composed of multiple PEG chains and protein moleculeslinked together are formed, which are captured by the precolumn inthe analysis method, and consequently, they are not detected. Importantly,the extent of modification was substantially reduced using a higherconcentration of furan polymer than maleimide polymer in a molar ratioof 5:1, respectively . In thishydrogel, the concentration of free maleimide groups is low and thusunwanted reaction with bevacizumab is minimized and prolonged-releaseof approximately 90% native protein after 3 months was achieved. When preparinga hydrogel at a molar ratio of maleimide and furangroups of 1:1, in principle, 100% conversion of both reactants ispossible. However, crosslinks are formed randomly, and the mismatchedreactive groups can result in the presence of free reactive maleimidegroups in the polymer network.ectively S6B. In tThebioactivity of released bevacizumab was analyzed by a cellproliferation assay as shown in in vitro release (IVR)samples 100 times to reach concentrations within the descending rangeof the dose-dependent inhibition curve (0.1\u20130.01 \u03bcg/mL),proliferation of HUVECs was measured. All groups showed a significantreduction (p < 0.05) of cell proliferation comparedto the maximal cell proliferation  placed on topof HA-PEG hydrogels remained round for the first 24 h, after whichthe cells began to adopt a flattened morphology, suggesting cell attachment.The authors discussed this was due to the expression of CD44 cellsurface antigen, a receptor for HA,91 allowingfor cell interaction and potential adhesion to the gel surface; however,a significant number of cells did not adhere to the gels and wereremoved during media exchange. Nevertheless, although CD44 cell surfaceantigen is expressed on mature M\u00fcller glial cells,92 the cells did not attach on top of the gel surfacebut were found in direct contact with the gel after the 5 days ofstudy. It is essential to note that intravitreally implanted hydrogelsare not required to have cell adhesion properties when used as drugreservoirs, as they are developed to have limited interaction withcellular tissue surrounding the vitreous environment.Possible cytotoxicityof the hydrogel polymer precursors and hydrogelon contacting cells was evaluated using the QMMUC-1 cell line. M\u00fcllerglial is a primary retinal glial cell type and contributes to maintainingretinal structure and homeostasis.Alamar Blue cell viability assay was used to evaluate the effectof hydrogel leachables and polymer precursors on QMMUC-1 cells. p < 0.0001) reduced to 75, 59, and 77% for HAFU polymerwith DS of 30, 50, and 83%, respectively, while more pronounced toxicitywas observed for the 4APM crosslinker, reducing the viability to 21%.Considering that the volume of the vitreous humor in the adult humaneye is approximately 4 mL,93 it is expectedthat after intravitreal injection of 50 \u03bcL of PEG-HA hydrogelpolymer precursors, the concentration of the individual componentsin the eye would be maximally between 0.625 and 1.25 mg/mL, whichis shown to be well tolerated by the QMMUC-1 cells.As discussed in 4in situ formingDA-crosslinked hydrogel based on HA and PEG polymers with potentialapplication as a long-acting sustained delivery system for bevacizumaband potentially for other anti-VEGF therapeutics was investigated.The prospect of the system for treating retinal diseases was examinedstep by step by testing hydrogel gelation kinetics, mechanical properties,injectability, biodegradability, sustained release of bevacizumab,and cytocompatibility to retinal cells. In summary, we showed thatgelation time and hydrogel final stiffness are strongly dependenton temperature and ratios of the reacting furan and maleimide groupspresent on HA and PEG, respectively. The obtained hydrogels were fullydegradable under physiological conditions due to the retro-Diels\u2013Alderreaction. Formulations could be easily injected into the vitreousbody of an ex vivo porcine eye through a 29G needle,and crosslinked hydrogels were obtained, whose mesh size was determinedby mechanical analysis. To the best of our knowledge, the reportedmethod was the first example of a direct comparison of hydrogel meshsize in vitro and ex vivo, providinga valuable tool for preclinical intraocular hydrogel characterization.The hydrogels showed no toxicity to QMMUC-1 at the used concentrations in vitro. Concluding, 4APM-HAFU hydrogels formed at a maleimide/furanmolar ratio of 1:3 provide sustained release of bevacizumab for 2months. This formulation can therefore potentially be used for therapyto replace the monthly injection by an injection every 2 months. Forprolonging chronic therapy, the hydrogel formulation with a maleimide/furanmolar ratio of 1:5 could be considered as this formulation showedsustained release of bevacizumab for up to a year. However, furtherresearch on whether indeed bioactive protein is released during thistime frame is needed.In this study, an intravitreal"}
+{"text": "Three DNA methylation modification patterns with distinct prognosis and biological behaviors were identified, consistent with three known phenotypes of immune-inflamed, immune-excluded, and immune-desert. We then determined a DNA methylation gene signature and constructed a DNA methylation score (DMS) to quantify modification patterns individually through principal component analysis algorithms. DMS-low group had characteristics of specific molecular subtypes, including microsatellite instability, CpG island methylator phenotype positive, and mutant BRAF, presented by increased mutation burden, activation of DNA damage repair and immune-related pathways, highly TME immune cells infiltration, and hence, a preferable prognosis. Further, low DMS was also demonstrated to be correlated to better response and prolonged survival of anti-PD-L1 antibody, indicating that DMS could be considered as an effective predictive tool for immunotherapy. In conclusion, our work presented a landscape of different DNA methylation modification patterns, and their vital role in the formation of TME diversity and complexity, which could help to enhance understanding of TME immune infiltration characteristics and more importantly, guide immunotherapy strategies more effectively and personalized.Emerging evidence implies a non-negligible role of DNA methylation in tumor immunity, however, its comprehensive impact on tumor microenvironment (TME) formation and immune activation remains unclear. In this study, we integrated 24 DNA methylation regulators among 754 colon cancer patients to distinguish different modification patterns  Colon cancer is common worldwide and remains one of the leading causes of cancer-related mortality . As a biEpigenetics, referring to heritable alterations in gene expression that are not dependent on changes in the DNA sequence, plays an important role in the pathogenesis of colon cancer . ThereinRecently, immunotherapy, especially the inhibitor targeting immune checkpoints like CTLA-4, PD-1, or PD-L1, has achieved durable anti-tumor activity in a range of cancer types. However, there are many patients, particularly in colon cancer with microsatellite stable (MSS), do not benefit from this advanced treatment . The majHowever, to date, the majority of studies focus on the function of one or two DNA methylation regulators, which cannot reflect the whole landscape of DNA methylation in the formation of tumor-permissive immune environment. Therefore, comprehensive recognition of the TME immune characteristics mediated by multiple DNA methylation regulators, including TME infiltrating immune cells and activity of immune/inflammatory-related pathways, could enhance our understanding of TME immune regulation, and further provide novel perspectives for cancer immunotherapy. In this study, we integrated the transcriptomic and clinical information of 754 colon cancer samples to identify DNA methylation modification patterns with distinct TME immune characteristics, which were highly consistent with three known immune phenotypes, including immune-inflamed, immune-excluded, and immune-desert phenotype, respectively. In addition, we determined the DNA methylation gene signature and constructed a scoring system to quantify modification patterns for individual patients, which could be served as an effective biomarker for predicting the efficacy and prognosis of immunotherapy.n = 562), GSE38832 (n = 122), GSE39084 (n = 70), GSE72970 (n = 124), GSE103479 (n = 155), GSE87211 (n = 196), and TCGA-colon adenocarcinoma cohort ], including 1,659 patients, were collected for our further analysis  by the \u201cTCGAbiolinks\u201d R package directly (https://xenabrowser.net).analysis . For thedirectly . And forn = 348), urothelial carcinoma treated with anti-PD-L1 antibody atezolizumab, to evaluate the effect of DNA methylation modification in immunotherapy. The expression data and clinical information were available from the \u201cIMvigor210\u201d R package  , 3 erasers , and 18 readers . The protein-protein interactions (PPI) network among 24 regulators were analyzed by the STRING interaction database (db.org/)  and visudb.org/) .n = 754) to identify different DNA methylation modification patterns mediated by 24 regulators  method was used to determine different DNA methylation modification patterns through the \u201cNMF\u201d R package  with the same microarray platform and no prognostic differences were integrated as meta-cohort  among three DNA methylation modification patterns . Subsequently, based on the expression of these prognostic DEGs, we conducted the second NMF clustering algorithm to obtain DNA methylation gene clusters as well as validate their stability. Furthermore, through the principal component analysis (PCA) method, we used these prognostic DEGs to construct the DNA methylation gene signature, termed DNA methylation score (DMS), which could quantify the DNA methylation modification pattern for each patient. The procedure of establishing the DMS was similar to a previous study, and we added the principal component 1 and 2 to acquire the signature scores . All enrichment p-values were adjusted by the Benjamini-Hochberg methods and less than 0.05 were considered statistically significant  < 0.05.To investigate the difference in the biological processes among different DNA methylation modification patterns, gene clusters, and DMS groups, we performed gene set variation analysis (GSVA) and gene set enrichment analysis (GSEA) analyses through the \u201cectively . The halnificant . MoreoveWe additionally collected 18 classical biological processes constructed by GSVA\u201d R package, the CIBERSORT method, and the Tumor Immune Estimation Resource (TIMER) database, to evaluate the infiltrating abundance of various TME immune cells, such as B cell, CD8+ T cell, dendritic cell, and macrophage et al. The gene sets of each type TME infiltrating cell were extracted from the study of Charoentong and listed in We used three different algorithms, including the single-sample gene-set enrichment analysis (ssGSEA) algorithm of the \u201cxCell\u201d and \u201cESTIMATE\u201d methods, we calculated the TME stromal score, immune score, estimate score, and microenvironment score based on signature gene expression to infer the fraction of stromal and immune cells in colon cancer samples. The calculation was performed by the \u201cxCell\u201d and \u201cestimate\u201d R packages, respectively  with same condition.The colorectal cancer cell line HCT116 and normal colonic epithelial cell line NCM460 were purchased from Type Culture Collection of the Chinese Academy of Science . HCT116 cells were cultured in McCoy\u2019s 5A Medium  with 10% fetal bovine serum  in 5% CO\u00ae 480 II system . The mRNA expression of ACTB was used as a reference. The primers used in this study were listed in Total RNA was isolated using TRIzol\u2122 Reagent  and quantified with a NanoDrop 2000\u2122 . 1 \u03bcg RNA was used for the reverse transcription reaction to generate cDNA through the PrimeScript\u2122 RT Reagent Kit with gDNA Eraser  according to the manufacturer\u2019s protocols. The mRNA expression was determined by rt-qPCR, which was performed using Ultra SYBR Mixture  and a LightCyclerThe normality of data was tested by the Shapiro-Wilk test. For the comparison of two groups, we used the t-test to detect the significant difference between normally distributed data, and the Wilcoxon test for skewed distributed data. For the comparison of three or more groups, one-way ANOVA and Kruskal-Wallis tests were conducted to detect the significant difference between normal distributed and skewed distributed data, respectively. A chi-squared test was used to compare the frequency differences between the two groups. Correlation coefficients were calculated by the Spearman and distance correlation analyses.survcutpoint\u201d function of the \u201csurvminer\u201d R package. Kaplan-Meier method was used to depict the survival curves, and the log-rank test was utilized to identify significant survival differences between groups. Univariate Cox proportional hazards regression model was applied to calculate the hazard ratio (HR) and 95% confidence interval (95% CI) for each DNA methylation regulator and DNA methylation related gene. And the multivariate Cox model was performed to determine the independent prognostic factors when adjusted by clinical characteristics. The results of Cox regression analyses were visualized by the \u201cforestplot\u201d R package. The prediction performance of DMS to evaluate the OS probability at distinct times was assessed by the receiver operating characteristic (ROC) curves and quantified by the area under the curve (AUC), which were conducted via the \u201ctimeROC\u201d R package.For the survival analysis, we focused on the overall survival (OS) and recurrence-free survival (RFS), and we obtained the best cut-off value through the \u201cp-values were two-sided, with p-value < 0.05 as statistically significant.All statistical analyses were accomplished in R 3.6.1 software, and all reported waterfall\u201d function of the \u201cmaftools\u201d R package. Among 399 available samples in the TCGA-COAD cohort, a total of 113 (28.3%) mutations occurred in 24 regulators , and vice versa , suggesting that the alteration of CNV might be the prominent factor resulting in the abnormal expression of DNA methylation regulators . To furtThirdly, we explored the interaction relationship between 24 regulators from the proteomics perspective. The PPI network depicted the extensive protein interactions among these regulators . ComprehTo clarify the role of 24 DNA methylation regulators in colon cancer clinical prognosis and TME cell infiltration characterization, we gathered three GEO datasets  without prognostic differences as meta-cohort for further analyses . The CoxTME infiltrating immune cells had been widely reported to display an epigenomic reprogramming, especially in aberrant DNA methylation . TherefoCollectively, above results exhibited crosstalk among 24 DNA methylation regulators and their significant impact on tumor immunity. The MBD2 expression was positively correlated to TME immune cells infiltration and might be a potential prognostic biomarker in immunotherapy.n = 306), pattern-B (n = 227), and pattern-C (n = 221), in meta-cohort , cluster-B (n = 183), and cluster-C (n = 299), respectively  to quantify the DNA methylation modification pattern of each patient.p < 0.05, p < 0.05, We first evaluated the prognostic value of DMS in colon cancer, and determined \u221273.8 as the cut-off value to divide patients into low and high DMS groups. Prognostic analysis showed patients with low DMS had a prominently prolonged survival and recurrence-free time . Besidesp < 0.001, p < 0.05, Next, we explored the characteristics of DMS in different clinical and molecular subtype traits and fixed our attention on the GSE39582 cohort, which had comprehensive clinical information. We found DMS rose gradually by increasing the tumor TNM stage (Then, we investigated the distribution differences of somatic mutation between DMS-low and -high groups. As shown in To better illustrate the underlying relevance between DMS and different molecular traits of colon cancer, we first compared DMS among different DNA methylation modification patterns and gene clusters. Pattern-B and gene cluster-C, representing the immune-inflamed phenotype, both had the lowest median DMS . A similSubsequently, we analyzed the correlation between DMS and several known biological processes signatures constructed by We then examined the relationship between TME infiltrating cells and DMS using different immunocytes associated algorithms, including ssGSEA, CIBERSORT, and TIMER database, and we found the majority of immune cells, especially CD8+ T cells, presented a high infiltrating abundance in the DMS-low group . BesidesImmunotherapy represented by anti-PD-1/PD-L1 or CTLA-4 antibody had broadened the field of cancer treatment and brought huge clinical benefits in recent years. Here, we explored whether DMS could predict the therapeutic response and prognosis of patients treated with immunotherapy. In the IMvigor210 cohort, the DMS-low group presented a remarkably prolonged survival, and the multivariate Cox regression analysis also determined that higher DMS was an independent risk factor for prognosis . The ROCAlthough we did not find a significant difference in PD-L1 expression level, a potential biomarker for immunotherapy, between DMS-low and -high groups in IMvigor210 cohort , the panMore importantly, the biological processes signatures analyses showed that DNA damage repair-related pathways were significantly activated in the DMS-low group, while EMT and Pan-F-TBRS pathways were highly activated in the DMS-high group, indicating DMS was closely related to the DNA damage repair and stromal signatures in the setting of patients receiving immunotherapy . Lastly,In this study, based on 24 DNA methylation regulators, we first identified three DNA methylation modification patterns with distinct TME infiltrating characteristics and biological behaviors in colon cancer. Moreover, we obtained prognostic DEGs among three modification patterns and established the DNA methylation gene signature, termed DMS, to quantify the DNA methylation modification profile of individual colon cancer, and more importantly, predict the efficacy and clinical outcome of immunotherapy.Increasing evidence revealed tumors commonly hijacked various epigenetic mechanisms to escape the supervision of the immune system. Particularly, certain regulator mediated DNA methylation and demethylation played an indispensable role in adaptive immune response, including generation of tumoral neoantigen, dysregulation of antigen-presenting machinery, and suppression of anti-tumor cytokine production . HoweverWe next screened DEGs among three patterns, and GO functional annotation revealed they were significantly associated with DNA modification and damage repair related pathways, suggesting the different clinical and biological characteristics among three patterns might be the results of differentially expressed of these genes. We further identified prognostic DEGs, termed as DNA methylation signature genes, to perform unsupervised clustering. Likewise, we found three genomic subtypes, named DNA methylation gene clusters, whose clinical outcomes and immune cell infiltrating traits were similar to three modification patterns. Our comprehensive analyses strongly revealed three immune phenotypes in colon cancer with distinct clinical and TME immune characteristics, which enhanced our understanding of the non-negligible impact of DNA methylation in shaping different TME landscapes.Whereas, above analyses were performed based on the patient population, which could not accurately predict the specific modification pattern in individual patients. As a consequence, based on the above signature genes, we developed the DNA methylation score, DMS, to quantify the certain modification pattern for each colon cancer patient. We found DMS could precisely discriminate three immune phenotypes, with the lowest median DMS in immune-inflamed type and the highest median DMS in immune-desert type. Additionally, we revealed a markedly positive relation between DMS and tumor stage, with DMS increasing gradually from the stage I to IV. Moreover, DMS was an independent prognostic risk factor, and patients with high DMS presented an inferior survival, which was validated in multiple colon cancer cohorts. Integrally, above results indicated DMS was a reliable tool to reflect the individual DNA methylation modification pattern, and predict clinical outcomes of colon cancer.V600E oncogene mutation, and CIMP-associated methylation of MLH1 induced mismatch repair deficiency and resulted in a genomic instability status, also known as MSI, to generate more mutation burden and neoantigen (Colon cancer was a highly heterogeneous disease, resulting from a series of distinct genetic and epigenetic changes, and a subset of molecular alterations was considered to drive the cellular and clinical behavior of cancer, including MSI, CIMP, CIN, BRAF, and KRAS mutations . The CIMoantigen . In addioantigen . Here, wEmerging evidence demonstrated that MSI and elevated TMB could heighten the anti-tumor activity of immunotherapy , and henA major limitation of this work was the public survival and transcriptomic data of colon cancer immunotherapy was not accessible yet. Therefore, the predictive performance of DMS needed to be further certified in the colon cancer immunotherapeutic cohort.In conclusion, for the first time, we uncovered three distinct DNA methylation modification patterns in colon cancer, and illustrated their extensive regulatory mechanism in tumor immune environment formation, which was a non-negligible factor to cause individual TME heterogeneity and different clinical outcomes. Our integrated analyses of DNA methylation modification would contribute to enhancing the understanding of tumor immune characteristics, and providing novel insights to guide immunotherapy more effectively."}
+{"text": "Growing evidences indicate DNA methylation plays a crucial regulatory role in inflammation, innate immunity, and immunotherapy. However, the overall landscape of various DNA methylation regulatory genes and their relationship with the infiltration of immune cells into the tumor microenvironment (TME) as well as the response to immunotherapy in gliomas is still not clear. Therefore, we comprehensively analyzed the correlation between DNA methylation regulator patterns, infiltration of immune cell-types, and tumor immune response status in gather glioma cohorts. Furthermore, we calculated the DNA methylation score (DMS) for individual glioma samples, then evaluated the relationship between DMS, clinicopathological characteristics, and overall survival (OS) in patients with gliomas. Our results showed three distinct DNA methylation regulator patterns among the glioma patients which correlated with three distinct tumor immune response phenotypes, namely, immune-inflamed, immune-excluded, and immune desert. We then calculated DMS for individual glioma samples based on the expression of DNA methylation-related gene clusters. Furthermore, DMS, tumor mutation burden (TMB), programmed death 1 (PD-1) expression, immune cell infiltration status in the TME, and Tumor Immune Dysfunction and Exclusion (TIDE) scores were associated with survival outcomes and clinical responses to immune checkpoint blockade therapy. We also validated the predictive value of DMS in two independent immunotherapy cohorts. In conclusion, our results demonstrated that three DNA methylation regulator patterns that correlated with three tumor immune response phenotypes. Moreover, we demonstrated that DMS was an independent predictive biomarker that correlated with survival outcomes of glioma patients and their responses to immunotherapy therapeutic regimens. DNA methylation is of the most extensively studied epigenetic modifications that plays a crucial role in the regulation of several biological processes; abnormal changes in DNA methylation are associated with several human diseases, including cancers \u20133. DNA mGlioblastoma (GBM) is the most common primary brain tumor in adults . DespiteImmune checkpoint blockade (ICB) therapies have been approved for many malignant tumors, including GBM, but their efficacy is observed in less than 20% of the patients \u201315. TumoIn this study, we comprehensively analyzed the correlations between DNA methylation regulator patterns, characteristics of infiltration of the immune cell types into the tumor microenvironment (TME), and response to ICB therapies using clinicopathological and transcriptome information from five independent glioma datasets. We also constructed a risk score system based on the DNA methylation status of the glioma samples and analyzed if the DNA methylation score (DMS) accurately predicted clinical responses to ICB therapy using two immunotherapy datasets.We selected 20 DNA methylation regulators, containing 3 writers, 3 erasers, and 14 readers after literature survey , 23. TheWe then analyzed tumor somatic mutations and copy number variations (CNV) in these DNA methylation regulatory genes in the glioma samples. Somatic mutations in the DNA methylation regulatory genes were observed in only 32 patients; tumor mutation burden (TMB) rate of the 20 regulators was < 1% in the glioma patients . We obseOur results indicated most DNA methylation regulators  with amplificated CNV demonstrated markedly higher expression in GBM, which revealed that the alterations of CNV could be an important element resulting in perturbations on the DNA methylation regulators expression in glioma. This suggested crucial roles for these 20 DNA methylation regulatory genes in glioma progression.Next, we investigated the role of these DNA methylation regulators in the TME. Spearman\u2019s correlation analysis showed that the expression of UNG, ZBTB33, MECP2, and DNMT3A genes was positively associated with the proportion of several immune cell types in the glioma . BecauseThese results demonstrated association between the expression of DNA methylation regulatory genes and the infiltration of immune cell types into the TME. Our analysis also suggested that UNG regulated the tumor immune microenvironment and is a potential marker for evaluating the efficacy of immunotherapy in glioma patients.n = 1007), pattern B (n = 694), and pattern C  into three clusters based on the expression of the 20 DNA methylation regulators using the package of ConsensusClusterPlus  of each glioma, based on the expression of 5679 prognosis-related DEGs. Our results showed significant difference in the DMS between the three DNA methylation modification patterns and DNA methylation-related gene clusters, with pattern B and gene cluster B showing the lowest median DMS , 4F. WHOP < 0.001; P < 0.001), survival status (P < 0.001), age (P < 0.05), 1p/19q status (P < 0.001), and isocitrate dehydrogenase (IDH) status  in the entire cohort of glioma patients and the TCGA glioma dataset based on the expression levels of the 20 DNA methylation regulatory genes. Moreover, these three DNA methylation regulatory gene expression patterns correlated with three distinct tumor immune response phenotypes, namely, immune-excluded for pattern A, immune-desert for pattern B, immune-inflamed phenotype for pattern C. Glioma patients belonging to the DNA methylation regulatory gene expression pattern C were significantly enriched with immune cell types such an activated DCs, CD8+ T cells, co-stimulatory T cells, activated mast cells, and activated NK cells. They were also significantly enriched in immune-related pathways, such as the chemokine signaling pathway and cytokine-cytokine receptor interactions. This suggested that pattern C represented an active tumor immune microenvironment with activated adaptive immune system, which also correlated with better prognosis. In contrast to pattern C, pattern B was associated with poor prognosis and showed significantly higher stromal activity including activation of EMT and pan-F-TBRS, thereby suggesting presence of a cold or inactive tumor immune microenvironment. Although pattern A was markedly enriched in immune-related pathways, it was classified as immune-excluded phenotype because it was characterized by innate immune cell infiltration and stromal activation.We identified 8291 DEGs by comparing the three distinct DNA methylation regulatory gene expression patterns. The expression of these DEGs correlated with the status of DNA methylation and immune-related pathways. Furthermore, we identified the three DNA methylation-related gene clusters based on the expression of prognosis-related DEGs, which were associated with immune or stromal activation. This confirmed three distinct immune subtypes in the gliomas.We then developed a risk score system (DMS) to identify and quantify heterogeneity in the DNA methylation modifications between various glioma samples. The immune-inflamed subtype and WHO II subgroup showed the highest median DMS. In addition, DMS was associated with several clinicopathological characteristics of glioma samples such as WHO grade, age, 1p/19q co-deletion status, survival status, and IDH status. Multivariate Cox regression analysis confirmed that DMS was an independent prognostic biomarker for evaluating OS of glioma patients.Our data also showed that glioma patients with low DMS were associated with higher TMB, and positively correlated with expression of EMT and pan-F-TBRS. Previous studies have shown that stromal activation correlates with resistance to immunotherapy , 36. ThiDistinct stromal activation and immune infiltration landscape of the three patterns suggested DMS correlated with clinical responses to immune checkpoint blockade therapy. Furthermore, our study showed that DMS was an independent predictive biomarker for immunotherapy outcomes, in addition to other well-established biomarkers such as TME, neoantigen load, PD-L1 expression, stromal and immune status, and TIDE. This implied that integration of DMS with other predictive biomarker may provide more effective strategy for immunotherapy. DMS also showed good predictive value in the two independent cohorts of cancer patients that underwent anti-PD-1/PD-L1 immunotherapy. Thus, our study suggested that the DNA methylation regulator patterns regulated tumor immune response phenotypes and might guide therapeutic strategies.In conclusion, we systematically analyzed the expression levels of 20 DNA methylation regulatory genes in 2228 glioma patients and identified three DNA methylation modification patterns. We demonstrated significant association between the three DNA methylation modification patterns with the immune cell infiltration status TME of the glioma tissues. Furthermore, we estimated DMS of individual glioma samples based on the expression levels of DNA methylation-related DEGs and identified three distinct immune phenotypes that could guide therapeutic strategies and immunotherapeutic responses. We also demonstrated that DMS was an independent biomarker for predicting prognosis of glioma patients.n = 648), CGGA1 (n = 309), CGGA2 (n = 593), and GEO: GSE16011 (n = 263), GSE108474 (n = 415)) were included for further analysis. The mRNA expression and clinicopathological information for the TCGA glioma datasets were downloaded from the University of California Santa Cruz (UCSC) Xena browser. The mRNA expression and clinicopathological information for the glioma samples in the GSE16011 and GSE108474 datasets were downloaded from the GEO database (https://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?) and those from the CGGA1 and CGGA2 datasets were downloaded from CGGA database (http://www.cgga.org.cn/). We also downloaded mRNA expression and clinicopathological data of patients in the two independent anti-PD-L1 immunotherapy cohorts, namely, IMvigor210, which included 298 urothelial cancer patients that underwent atezolizumab treatment ; and GSE78220, included 26 metastatic melanoma patients that underwent treatment with pembrolizumab  [2 (N+1).The flow chart of our research strategy is shown in cc.cgi?) . Then thWe collected 10 NBTs and 10 LGG tissues from the Second Affiliated Hospital of Nanchang University from June 2020 to April 2022. Our study was approved by the Ethics Committee of this hospital. We performed the immunohistochemistry assay on human tissues by methods described preciously.We retrieved the literatures databases and identified 20 DNA methylation regulatory genes for analysis in this study, containing 3 writers, 3 erasers, and 14 readers. The STRING and Cytoscape databases were used to construct the protein-protein interaction (PPI) network between these 20 DNA methylation regulatory proteins , 45.The samples in the five integrated glioma datasets were classified according to distinct DNA methylation modification patterns based on the expression levels of various DNA methylation regulatory genes using the R package \u201cConsensusClusterPlus\u201d . The EucP < 0.05 as the cut-off value [The gene set variation analysis (GSVA) R package was used to identify molecular functions related to different patterns of DNA methylation modifications. The gene signatures were obtained from the Molecular Signature Database (MSigDB) using the gene set \u201cc2.cp.kegg.v6.2 symbols\u201d . The difff value .The single-sample gene-set enrichment analysis (ssGSEA) formula was performed using the \u201cGSVA\u201d R package to determine the relative abundance of the immune cell types in the glioma TME. A list of representative marker genes that represent different immune cells types were acquired from Charoentong\u2019s study  that sumi + PC2i), where i, represents the expression of survival-associated DEGs expression in the cohort of glioma patients [We developed a risk score system based on the DNA methylation modification in the glioma samples. The DNA methylation score (DMS) was calculated by: first identifying survival-associated DEGs using the \u201csurvival\u201d R package, PCA was used to evaluate DMS by selecting PC1 and PC2, DMS was based on the largest block of highly correlated survival-associated DEGs and was calculated as follows: DMS = \u2211 (PC1patients , 53.t tests, whereas, the Wilcoxon rank-sum test was used to analyze non-normally distributed variables. Kruskal-Wallis or one-way ANOVA tests were used to compare differential gene expression between the three subgroups [P < 0.05 was considered statistically significant.The Shapiro-Wilk normality test was used to analyze normality of the variables . The expubgroups . Spearmaubgroups . Log-ranubgroups . StatistSupplementary FiguresSupplementary Table 1Supplementary Table 2Supplementary Table 3Supplementary Table 4Supplementary Table 5"}
+{"text": "All dogs received concurrent standard-of-care therapy, including intravenous fluids and anti-emetics; no dogs received antimicrobials. The fecal score, disease severity scores, and serum lipopolysaccharide were measured on days 0, 3, and 14. Fourteen of eighteen enrolled dogs completed the study . Lipopolysaccharide decreased on days 3 and 14 from baseline and correlated with fecal and disease severity scores. There was no difference in the duration or severity of clinical signs in dogs with AHDS following an enema-administered FMT compared to probiotic treatment. Further evaluation of serum lipopolysaccharide as a marker of disease severity and recovery is warranted.Probiotics and fecal microbiota transplants (FMTs) are two microbiome-targeted therapies that have been investigated for use in gastrointestinal diseases associated with dysbiosis. The aim of this study was to compare the effects of an oral multi-strain probiotic and enema-administered FMTs on clinical signs and serum lipopolysaccharide in dogs with acute hemorrhagic diarrhea syndrome (AHDS). A total of 18 client-owned dogs with a diagnosis of AHDS were enrolled in a randomized, blinded study at the time of hospital admission. The dogs were randomized into two groups: the probiotic group received a daily oral probiotic (200 \u00d7 10 Clostridium perfringens) (Clostridium perfringens) (Acute hemorrhagic diarrhea syndrome (AHDS) is a common cause of severe, hemorrhagic diarrhea and vomiting in dogs associated with gastrointestinal (GI) bacterial dysbiosis \u20134 and hyringens) \u20135, endotringens) \u20138, and dringens) , but theringens) \u201311 and iringens) . Thereforingens) , 13, makDisruption of the normal microbiome, along with subsequently increased GI permeability, could allow the translocation of intraluminal GI bacteria into the bloodstream and result in increased measurable LPS concentrations. Through the potential to restore normobiosis and decrease GI hyperpermeability, microbiome-targeted therapies could improve clinical signs more rapidly and decrease hospitalization time.Microbiome-targeted therapies have been investigated as the treatment for both acute and chronic GI diseases in humans and veterinary species. Treatments do not have equal efficacy among disease processes \u201317; diffAlthough there have been preliminary investigations of FMT and probiotics in different AHDS populations, FMT and probiotics have not been directly compared. This study was designed to compare FMT vs. probiotic effects on duration and severity of clinical signs  and serum LPS, as a marker of GI permeability, in a single population of AHDS dogs. A secondary objective was to determine whether serum LPS concentrations correlated with fecal scores or disease severity scores.This prospective, randomized single-site study enrolled client-owned dogs at the time of hospitalization for AHDS following informed owner consent. No direct financial incentive was provided to owners for study participation; although, costs of screening CBC and biochemistry profile, rechecking CBC, and 72-h and 14-day recheck examination fees were covered by the study. Procedures were approved by the Kansas State University IACUC (protocol 4237.1).9/L or < 5.0 \u00d7 109/L plus \u2265 1 additional systemic inflammatory response criteria (via Doppler) following fluid resuscitation, were excluded. Other exclusion criteria were chronic GI signs , treatment to control historical GI signs , or administration of antimicrobials, steroids, or probiotics within the previous month, as well as other clinical signs or documented biochemical or imaging evidence of systemic, non-GI disease. Criteria for withdrawal and rescue antimicrobial administration included the development of new fever in-hospital or persistent fever (>39.7\u00b0C) > 8 h after admission, hypotension refractory to intravenous fluids, or development of neutropenia, degenerative left shift, or thrombocytopenia.Inclusion criteria were defined as < 48 h duration hemorrhagic diarrhea and/or vomiting, Hct > 50% with normal serum total protein prior to treatments, including intravenous fluids, and exclusion of systemic illness based on CBC and serum biochemistry panel demonstrating the absence of clinically significant systemic disease ; urine specific gravity (USG) was performed to confirm prerenal azotemia (USG \u2265 1.035), as needed. Dogs had a negative fecal flotation for GI parasites  and parvovirus antigen test . Additional tests, based on screening blood work  or abdominal imaging, were performed at the discretion of the attending clinician, and dogs with positive results were excluded. Dogs with severe disease, defined as total leukocyte count >18.0 \u00d7 10criteria  or persiGiardia antigen ELISA , and fecal infectious disease PCR panel  within 2 weeks of fecal donation. No FMT donors received raw diets or raw treats. Three donors were enrolled to allow the utilization of fecal material within the desired storage time, with a subsequent donor enrolled after the maximum storage time was reached.Three healthy dogs were recruited prospectively from staff pets. Dogs were determined healthy based on normal physical examination, including a body condition score (BCS) 4\u20136/9 , absenceDonor fecal samples were collected at the time of defecation, refrigerated, and prepared within 4 h. Sample preparation and storage were based on techniques described in human and veterinary literature , 29. Sama priori sample size calculation was based on a human dysbiosis model demonstrating 70% recovery of the normal GI microbiota following FMT vs. 15% with probiotic, (via simple randomization (coin-flip at the time of patient presentation), blocked into four groups of 4 and one group of 2 until nine dogs were included in each group. Each block consisted of an equal number of dogs in each treatment group. Enrolling dogs in blocks allowed efficient utilization of stored fecal material uniformly over the course of the study, accounting for maximum storage time. Study investigators  played no role in patient admission and were contacted following patient hospitalization. Owners and investigators performing fecal scoring were blinded to the treatment group. Attending clinicians were not blinded to the treatment group; the investigator performing fecal scoring was not involved in patient treatment. At enrollment, owners completed a questionnaire detailing diet and treatment history, medications, supplements, dietary indiscretion, and historical medical conditions.As there was no available veterinary literature evaluating shifts in GI microbiota following FMT at the time of study design, obiotic,  with theStreptococcus thermophiles, Bifidobacterium breve, B. longum, B. infantis, Lactobacillus acidophilus, L. plantarum, L. paracasei, L. delbrueckii bulgaricus) at 200 \u00d7 109 CFU/10kg q 24 h on food throughout the 14-day study , with the rate adjusted for the individual dog, and maropitant  during hospitalization. All dogs received a standardized canned commercial diet  in-hospital, which was fed at 1/4 resting energy requirement (RER) every 6 h, beginning 12 h after admission. Dogs were discharged with a recommendation to continue this diet through day 14. Recommended criteria for discharge included the resolution of vomiting, eating >75% RER, and improvement but not the resolution of diarrhea.Blood was drawn on admission , day 3 (LPS), and day 14 (LPS). Blood for CBC was collected into EDTA tubes. Blood for the biochemistry profile and LPS were collected into two separate plastic serum clot-activator vacutainer tubes. CBC and biochemistry profiles were analyzed at the time of sample collection through the Kansas State Veterinary Diagnostic Laboratory.P > 0.99).Blood for LPS was allowed to clot, centrifuged , serum separated manually with pipettes, and frozen immediately or refrigerated overnight, and stored at \u221280\u00b0C. LPS concentrations were analyzed in bulk at study completion using a commercially available canine ELISA according to manufacturer instructions  , 34. TheFresh fecal samples were scored on days 0, 3, and 14 using a 1\u20135 scoring system  based onDisease severity scoring was performed on days 0, 3, and 14 using a canine AHDS scoring system based on clinical signs, including appetite, vomiting frequency, stool consistency, defecation frequency, and estimated dehydration, with a higher cumulative score indicating more severe disease ; the actp < 0.05. Analysis was performed on an intention-to-treat basis.Statistical analysis was performed using commercial software  Data were assessed for normality using the Shapiro\u2013Wilk test and reported as mean \u00b1 SD for normally distributed data or median (range) for nonnormally distributed data. Significance was set at d), where a value >0.25 was considered to indicate a difference between groups (s) was used to compare fecal score and disease severity score with LPS. The correlation was defined as previously described   were compared between groups using standardized differences  . Fisher'n = 1 FMT; n = 4 probiotic), one intact male (FMT), eight spayed females , and four intact females . Breeds included three Labrador retrievers, three Pitbull Terriers, two German shepherds, two Chihuahuas, two Shih Tzu, and one each border collie, boxer, French bulldog, husky, Maltese, and whippet. The mean study population weight was 19.4 +/\u2013 11.0 kg and median BCS 6/9 , with no difference in weight between groups . The median population age was 3.7 years , with a median age of 2.7 years in FMT dogs  and 8.5 years  in probiotic dogs (standardized difference 1.12). Most dogs normally received a standard, commercial diet. Duration of clinical signs prior to presentation ranged from 4 to 48 h . One FMT dog received a raw diet; this dog had no other signs consistent with acute Salmonellosis . Five owners reported diet change (n = 2), introduction of new commercial treats (n = 2), or known dietary indiscretion (n = 1) within 1 week of clinical sign onset. Four dogs were receiving chronic medications  with no new medications or dose adjustments within the 3 months prior to presentation.Following AHDS diagnosis and exclusion of concurrent diseases, 18 client-owned dogs were enrolled from January 2020 to March 2021 with informed owner consent. The study population included five castrated males  and disease severity score .The average ELISA intra-assay CV was 11.2%, and the inter-assay CV was 12.1%. Baseline LPS did not differ between groups . LPS concentrations decreased over time, regardless of treatment group  and probiotic dogs . Disease severity score decreased over time in both groups and was lower on days 3 [median 4 ] and 14 [median 0 ] vs. baseline and day 14 vs. day 3 , began eating the standardized diet within 24 h of hospitalization, and the percent intake gradually improved. No appetite stimulants or enteral feeding  were used.n = 9 probiotics; n = 5 FMT; p = 0.08; 95% confidence interval 1.09\u20138.68). All 18 dogs were included in day 3 analyses and 14 dogs on day 14. The median days to discharge was 3  for FMT dogs and 2  for probiotic dogs (p = 0.09).Fourteen of 18 enrolled dogs completed the study , pitting edema of all limbs, and hematologic evidence of systemic inflammation and consumptive coagulopathy; it was withdrawn from the study at this time. Abdominal ultrasound findings were consistent with non-specific gastroenteritis, and humane euthanasia was elected on day 7.While no dogs were euthanized as part of the study, two FMT dogs were euthanized on days 4 and 7, respectively. While both dogs initially improved, owners declined continued hospitalization on day 3 due to financial constraints. At the time of discharge, vomiting had resolved in both dogs, but the fecal score was 5, defecation frequency was 4\u20135 times per day, and dogs were eating \u2264 50% RER. One dog was re-presented on day 4 for inappetence and weakness. It was euglycemic (7.1 mmol/L), with stable Hct from discharge (46%). The owners elected humane euthanasia, and necropsy demonstrated necrohemorrhagic, fibrinoulcerative enteritis with intralesional bacilli, fibrinosuppurative pneumonia with intralesional cocci, and pulmonary vasculitis. PCR on GI tissue was negative for Salmonella, canine enteric coronavirus, canine parvovirus 2, canine distemper virus, Two additional FMT dogs were withdrawn on days 4 and 10. One was withdrawn due to continued diarrhea following discharge on day 3, owner dissatisfaction with the clinical improvement rate, and subsequent metronidazole prescription by the dog's primary veterinarian. The last dog was withdrawn due to amoxicillin administration for a urinary tract infection diagnosed based on clinical lower urinary tract signs and positive urine culture.This prospective study evaluated an oral multi-strain probiotic vs. enema-administered FMT for the treatment of non-septic canine AHDS, with the goal of comparing two microbiome-targeted therapies on clinical response and serum LPS, as a marker of GI permeability. In this population, both treatments were well-tolerated during administration, and LPS concentrations correlated with fecal scores and disease severity scores.Probiotic and FMT impact on canine AHDS were preliminarily evaluated in separate populations, in one study each , 25. ThoAlthough population size limited statistical significance, time to fecal score normalization and disease duration based on severity scores were higher in FMT vs. probiotic dogs. Furthermore, the day 3 fecal score was higher in FMT dogs and more probiotic dogs completed the study, with three FMT dogs withdrawn due to progressive disease or owner dissatisfaction with the improvement rate. Study completion was unlikely related to differences in disease severity, as there were no differences in biomarkers of GI permeability or standardized severity scores at baseline. While there were minor biochemical differences between groups based on standardized differences, these were considered clinically insignificant. Had the three withdrawn dogs completed the study, differences between groups in the rate of improvement in those parameters might have been further emphasized. Although positive metabolome effects were previously reported following FMT , differeTwo FMT dogs were euthanized during the study. While the necropsy was only performed in one dog, no concurrent diseases were identified, making death likely due to AHDS complications. One dog had GI transmucosal bacterial involvement on histopathology, as well as evidence of hematogenous pneumonia. However, mucosal bacterial involvement is consistent with previous findings in AHDS dogs . Both doDecreased GI barrier function has been demonstrated in canine AHDS based on GI protein loss  and histThere are several population and study design criteria important to consider in relation to this study's results. Dogs in the FMT group were younger than the probiotic group. As dogs were randomized to the treatment group based on sequential presentation, this is likely due to random chance. The median age of 2.67 years in FMT dogs is more similar to other canine AHDS studies  than theThis study had several important limitations. Fecal microbiome analysis was not performed in either the study population or FMT donors. This limits assessment in the study population to clinical signs and indirect measures of treatment effect . However, fecal scores are repeatable when performed by a single observer . While mMicrobiome-targeted treatments are not interchangeable; this includes probiotic type, dose, and duration,  as well Post-hoc power analysis comparing average days to achieve a fecal score of 3, demonstrated that 27 dogs per group would be needed. We speculated that differences between groups would have been highlighted had several FMT dogs not withdrawn, as those dogs continued to have high severity scores and fecal scores at the time of withdrawal and were not included in outcome measures. A larger study cohort will allow the assessment of whether the trends in the normalization of fecal scores, improvement in disease severity scores, and days to discharge become statistically significant. The inclusion of additional dogs will also provide further evidence for tolerance of these therapies or potential side effects . Most dogs were not maintained on a single diet throughout the course of the study, as recommended but rather were transitioned back to their normal diets by owners. While diet affects the GI microbiome (Small study sizes likely impacted the ability to determine a significant difference between treatment groups. crobiome \u201362, dietcrobiome , 19, 36 crobiome  when comIn this prospective, single-site trial, there was no difference in the clinical disease course in AHDS dogs receiving a single enema-administered FMT in the initial treatment period compared to probiotic supplementation at a dose of 200 CFU/10 kg; though, the small study population limited statistical ability to detect a meaningful difference. Association of LPS with fecal consistency and disease severity warrants further evaluation of LPS as a biomarker of disease severity and recovery. Future studies should evaluate different FMT administration methods in AHDS dogs and directly compare microbiome and metabolome impact, as well as clinical significance in an untreated control group.The raw data supporting the conclusions of this article will be made available by the authors, without undue reservation.The animal study was reviewed and approved by Kansas State University Institutional Animal Care and Use Committee. Written informed consent was obtained from the owners for the participation of their animals in this study.MJ was responsible for the development of the study idea, study design, data collection and analysis, and manuscript preparation/review. KK was involved in study design, data collection, and manuscript preparation/review. LF was involved in data collection and manuscript preparation/review. All authors contributed to the manuscript and approved the submitted version."}
+{"text": "There are limited studies investigating the use of fecal microbial transplant (FMT) in dogs with inflammatory bowel disease (IBD). The aim of this preliminary study was to assess the feasibility of adding FMT to standard therapy  for dogs with IBD and to and to describe the changes in measured outcomes after 30 days of treatment.Thirteen client-owned dogs with IBD were enrolled in this double blinded, randomized clinical trial. All dogs received corticosteroid therapy and a hypoallergenic diet; dogs were randomized to receive either placebo or FMT. Measured outcomes included the canine chronic enteropathy clinical activity index (CCECAI) at 1 week and 1 month after enrolment. Fecal microbiota were analyzed after extracting DNA from fecal samples and profiling using 16S amplicon sequencing. Dogs in the placebo group not responding to treatment after 1 month were offered FMT.The CCECAI significantly decreased over time in both groups (p = 0.001). There were no significant differences between the CCECAI of the placebo and FMT group at each time point . No adverse effects were reported in the 30 days following FMT.The addition of FMT to standard therapy for IBD was feasible. No significant differences were observed in the CCECAI between groups at each time point. Large scale clinical trials can be performed using these methods to evaluate the longer term effect of FMT on clinical signs, microbial diversity, and other outcomes. Inflammatory bowel disease is one of the most frequent causes of chronic vomiting, anorexia and diarrhea in dogs ,2. The gThere is a lack of consensus on the most appropriate treatment for dogs with IBD. Empirical treatment is largely employed, with various antimicrobial, dietary, and immunomodulatory therapies . DespiteClostridioides difficile infection, with mean cure rates of up to 90% after FMT [Fecal microbial transplantation has been beneficial in people with refractory fter FMT \u201314. Morefter FMT \u201317. Fecafter FMT ,19.The primary objective of this study was to examine feasibility of adding FMT to the treatment of dogs diagnosed with IBD and treated with standard treatment . The second objective was to describe the outcome of treatment with either standard treatment plus FMT versus standard treatment plus placebo after 30 days of treatment. Additionally, a goal of this preliminary study was to assess for potential adverse effects of FMT after 30 days, as well as to gather information to aid in planning larger, long-term studies on FMT in dogs.In this randomized, parallel, double-arm, single-centre clinical trial, a convenience sample of client owned dogs with IBD were recruited from the Ontario Veterinary College Health Sciences Centre between September 2018 and August 2020. All dogs were privately owned, the owners signed an informed consent, and the study was approved by the Institutional Animal Care Committee.Dogs were eligible for inclusion if they had a greater than 3-week history of clinical signs consistent with IBD, as defined by the CCECAI , and hisE.coli-related histiocytic ulcerative colitis  were excluded from the study.Animals were excluded from enrollment if any evidence of primary lymphangiectasia was present in the gastrointestinal tract histologically or if there was evidence of comorbidities that could cause clinical signs of chronic enteropathy. Breeds predisposed to Giardia ELISA, and negative for Salmonella, Clostridium difficile, and Campylobacter spp. on fecal culture. Fecal samples were collected as voided and frozen at -20\u00b0C within 24 hours of collection for up to 3 months for later FMT preparation.Ten healthy canine fecal donors were recruited from the Guelph community  throughout the study period. Fecal donors were deemed to be of appropriate health status based on normal physical examination, CBC and serum biochemistry within the preceding 3 months. Fecal donors had no history of vomiting or diarrhea in the past 6 months, skin disease, exposure to raw food diets, antimicrobial use in the previous 6 months, or major medical conditions including bacterial infections. Donor fecal samples were negative for parasites via fecal flotation and Escherichia coli (E. coli) was initiated in October 2019 and performed throughout the remainder of the study.For preparation of FMT aliquots, fecal samples were selected from five donors and pooled to decrease the effect of individual donors on treatment outcome. Feces were thawed at room temperature for 2 hours prior to preparation and then 10g of feces from five donors were obtained . Fecal material was blended with sterile saline at a ratio of 1 part feces to 5 parts sterile saline. This solution was sieve filtered then stored in 60mL syringes at -20\u00b0C until usage. Fecal microbial transplant preparations and fecal donor samples were discarded after 3 months and donor samples underwent no more than one freeze-thaw cycle prior to FMT preparation. Fecal donors were retested yearly as described above. Additional screening for extended-spectrum beta-lactamase (ESBL)-producing https://www.sealedenvelope.com) into either the FMT or the placebo group. All dogs were prescribed standard therapy for IBD, comprised of immunosuppressive doses of prednisone (approximately 2mg/kg/day) and a hypoallergenic (hydrolyzed or novel protein) diet. Fecal microbiota transplant or placebo was administered within 2 weeks of initiating standard therapy.Enrolled dogs were randomized using an online randomization program (All investigators except one (SLB) remained blinded to group allocation throughout the study. Following randomization, dogs were admitted into the hospital to undergo infusion of either the FMT preparation or saline via retention enema by the unblinded investigator. Aliquots of FMT were thawed at room temperature for approximately 1-hour prior to administration. Placebo was a similar volume of sterile saline at room temperature. The FMT or placebo enema was administered via a sterile lubricated Red Rusch tubing in the descending colon over 1\u20135 minutes. A total infusion volume of 10mL/kg of FMT or sterile saline was administered and retained within the colon for at least 10 minutes following infusion. Gauze was inserted in the rectum in dogs, if needed, to facilitate retention. Dogs were discharged the same day following the procedure. Early in the study, the FMT or placebo enema was administered within 2 weeks of endoscopy after confirmation of a diagnosis of IBD. Due to challenges retaining dogs in the study with this approach, beginning in January 2020 enemas were administered during general anesthesia following endoscopy in dogs where the clinician had a high suspicion of IBD. Any dog receiving FMT or placebo immediately following endoscopy that ultimately did not have histologic evidence of IBD was excluded from further study visits or any data analysis.Enrolled dogs were subsequently evaluated at 1 week and then at 1 month following FMT or placebo treatment. At each evaluation, the clinical status was scored by a blinded investigator (AJC), utilizing the CCECAI. Feces were obtained within 12 hours of each visit either following natural voiding or via digital rectal examination and stored at -80\u00b0C until further analysis. At each recheck, serum biochemistry or other diagnostics were performed at the discretion of the attending clinician, based on the dog\u2019s clinical status and in consultation with the client. Immunomodulatory and other therapies were adjusted at each evaluation based on patient status at the discretion of the primary clinician.Dogs not responding to treatment  were offered to have their treatment groups revealed 3 months after enrolment. Beginning in November 2019, it was elected to shorten the time period of unblinding to 1 month following treatment to facilitate earlier FMT or other interventions for dogs having previously received a placebo if no significant response was noted. Owners of dogs in the placebo group were given the option of having FMT administration via retention enema as previously described and were then reevaluated 1 week and 1 month following FMT. These dogs were labeled as FMT2 and were included only in specified analysis below. Responders were continued to have their treatment group blinded to the owner and study investigator performing patient assessment.Serum biochemistry , CBC , or other diagnostics unless otherwise specified were performed at the Animal Health Laboratory at the Ontario Veterinary College.Prior to deoxyribonucleic acid (DNA) extraction, fecal samples were brought to room temperature for 1\u20132 hours. Fecal samples underwent DNA extraction using the E.Z.N.A. Stool DNA Kit Pathogen Detection Protocol , performed as per the manufacturer\u2019s instructions. DNA samples were then stored at -20C until polymerase chain reaction (PCR).-AYTGGGYDTAAAGNG-3) and reverse (S-D-Bact-0785-b-A-18 5-TACNVGGGTATCTAATCC-3) primers (10 pMol/\u03bcL) [Following this, the 16S rRNA genes were amplified through targeting the V4 region. The PCR reaction mixture contained 12.5\u03bcL of Kapa HiFi Ready Mix , 9.5\u03bcL of nuclease-free water, 2\u03bcL of DNA and 0.5\u03bcL of forward (S-D-Bact-00564-a-S-15 \u2032\u2032\u2032\u2032 5 pMol/\u03bcL) . A molecThe PCR products were then purified with magnetic beads and then were amplified by PCR with Illumina adapters . They were then purified a second time. The NanoDrop\u00ae , Waltham, Massachusetts, USA) was used to quantify DNA through spectrophotometry . Gel eleData analysis was carried using the software Mothur v.1.39.5 , throughFor all statistical analyses, significance was set at p <0.05. Data were checked for normality with the Shapiro Wilk test. Non-normal data were log transformed to meet the assumptions of normality.A general linear model that accounted for the repeated effect of measuring the same dog over time was used to test for differences in the CCECAI between the placebo and the FMT group. Examination of the residuals assessed the data distribution and checked for possible outliers. Data for the CCECAI were normally distributed and there were no outliers. Fixed effects included in the model were group and day, as well as their interaction. Post hoc Dunnett\u2019s tests were applied to compare the effect of day back to baseline.For statistical analyses, dogs in the placebo group that subsequently received FMT were labelled as \u2018FMT2\u2019 for each timepoint from when they received FMT onwards. The FMT2 group was excluded from further analysis except where explicitly indicated.Alpha diversity was assessed using the Chao-1 index, Inverse Simpson, and Shannon Evenness indices. Statistical analysis of alpha diversity was performed using JMP 15.2 . Beta diversity was assessed using the Yue and Clayton index to assess community structure, and Jaccard index to assess community composition.To assess for significant differences between groups in beta diversity, the analysis of molecular variance (AMOVA) was utilized in Mothur . StatistThirteen dogs with clinically and histologically confirmed IBD were prospectively enrolled. Dogs were randomly assigned into the placebo group (n = 6) or the FMT group (n = 7). Age at presentation ranged from 1\u201311 years of age. Breeds represented included a Yorkshire terrier (2), German shepherd (3), mixed breed (6), pug (1), and Labrador retriever (1). Ten dogs were female, and three were male. Characteristics of the study patients in each group are shown in The median dosage of prednisone received was 2.02mg/kg/day (range 1.01\u20132.31) amongst all dogs . One dogAll 7 patients in the FMT group were available for reassessment at 7 days, and 6/7 were available at 30 days. All 6 patients in the placebo group were available for reassessment at 7 and 30 days. Three dogs received FMT at 30 days, and an additional 2 dogs received FMT at 90 days after enrolment due to incomplete treatment response at these times and were included in the FMT2 group. In total, 5/6 patients in the placebo group subsequently received FMT treatment due to insufficient response at 1 month (3 dogs) or at 3 months (2 dogs) following enrolment. No adverse effects were reported after FMT. One dog was euthanized within 1 month following enrolment due to suspected osteosarcoma development of the right forelimb and was thereby unavailable for further follow-up.The CCECAI scoring throughout the study is shown in In 6/7 dogs that received FMT, the CCECAI at day 30 was lower than at baseline, and in no dog that received FMT did it worsen over time. Additionally, in all dogs that received FMT (n = 7), the CCECAI at day 30 was 3 or less (considered insignificant disease) . In 4/6 There were no differences between the FMT and placebo group at each time point (F test from ANOVA p = 0.40). The mean CCECAI in the placebo group (5.75) did not differ from that of the FMT group (6.32) at baseline (p = 0.82) or at day 30 (p = 0.12). However, there were trends for the FMT group to have a significantly lower CCECAI (1.78) at 30 days compared to baseline (p = 0.02). The mean CCECAI of the placebo group (4.83) at 30 days was not significantly different from baseline (p = 0.61). Time remained a significant factor for CCECAI, with the lowest scores achieved by day 30 (p = 0.01).A total of 9753672 good quality reads were utilized for final analysis . Based on the sample with the smallest number of reads, a subsample of 129748 reads was used.When comparing the microbiota at baseline compared to one week post FMT in patients that received FMT, there were no significant differences in alpha diversity between baseline and one-week post FMT samples for Chao  Shannon Community membership , and structure  were not significantly different between pre and one-week post FMT samples. This is further illustrated by the lack of clustering of samples in the associated principal coordinate analyses (PCoA) and dendrograms  and remission rates following FMT in dogs with IBD remains unknown. However, FMT was found to be an easily applicable treatment option in this study. Therefore, this preliminary study demonstrated that studies investigating the benefit of FMT over a longer time frame with a larger sample size are warranted and that this is an area worthy of further exploration. Additionally, the response rate and other data from this study can be used to inform more precise sample size calculations for future investigations of FMT in dogs with IBD.The addition of FMT to standard therapy of IBD did not significantly change fecal microbial diversity in recipients in this study. This contrasts with other reports of FMT in veterinary medicine. In a case series of FMT in 9 dogs with IBD, the fecal microbiota 2 weeks following FMT was more diverse with increased proportion of Fusobacteria . AnotherFaecalibacterium compared to baseline samples. Some members of Firmicutes, particularly members of Ruminococcaceae, and genus Faecalibacterium are essential SCFA-producing bacteria, and SCFA are proposed to have numerous beneficial and anti-inflammatory effects in the gastrointestinal tract [Although measures of overall diversity did not significantly change following FMT in the present study, fecal samples 1-week after FMT were significantly enriched in Firmicutes, particularly family Ruminococcaceae and genus al tract ,36. TherThere are limitations to the present study. As a preliminary study, the sample size is small and limited the power and therefore the safety and efficacy conclusions that can be drawn, particularly at the interaction level. However, this study helped evaluate feasibility, acceptability, and uptake of FMT and will inform methodology for a larger clinical to make more robust conclusions regarding the longer term efficacy and safety of FMT in canine patients with IBD. Given that only 13 dogs were enrolled in a 2-year period in the present trial, multicentre trials are encouraged to help recruit a larger sample size for future larger-scale studies of FMT efficacy and safety. Additionally, a significant proportion of patients in the present study were panhypoproteinemic, and it is possible patients with IBD and panhypoproteinemia have a different response to FMT than patients without panhypoproteinemia. Adjunctive treatments  were not standardized, and thereby could have impacted the microbiota and influenced results or treatment outcome ,38. FutuAdditionally, it is possible that the single administration of FMT in dogs with IBD in this study could be insufficient to result in changes to the microbiota where ongoing intestinal inflammation could perpetuate continued dysbiosis. A recent meta-analysis in people showed a higher clinical remission rate in people that received 10 or more FMT infusions in people with ulcerative colitis . As wellIn conclusion this preliminary study was able to identify that addition of FMT is feasible and was well tolerated in this group of dogs 30 days after administration. Dogs receiving FMT in addition to standardized therapy did not have significant differences in the CCECAI at day 30 compared to the placebo group. Exploration of the utility of FMT for more rapid clinical improvement in IBD is warranted in future investigations of greater power, and over a longer time frame. In addition, further studies are required to assess the efficacy, safety, optimal FMT donor/patient characteristics, and utility of FMT in a larger group of patients, as well as comparing different FMT administration methods and protocols.S1 Table(XLSX)Click here for additional data file.S1 Appendix(DOCX)Click here for additional data file."}
+{"text": "Human Kidney Injury Molecule-1, also known as HAVCR-1 (Hepatitis A virus cellular receptor 1), belongs to the cell-surface protein of immunoglobulin superfamily involved in the phagocytosis by acting as scavenger receptor epithelial cells. The study focused on pinpointing the mechanisms and genes that interact with KIM-1.This in-silico study was done from March 2019 to December 2019. The Enrichment and protein-protein interaction (PPI) network carefully choose proteins. In addition, the diagramed gene data sets were accomplished using FunRich version 3.1.3. It was done to unveil the proteins that may affect the regulation of HAVCR1 or may be regulated by this protein. These genes were then further considered in pathway analysis to discover the dysregulated pathways in diabetic nephropathy. The long list of differentially expressed genes is meaningless without pathway analysis.P\u2009<\u20090.05), Innate Immune System , Cytokine Signaling Immune system , Adaptive Immune System  and Neutrophil degranulation .Critical pathways that are dysregulated in diabetic nephropathy patients have been identified. These include Immune System .The top 5 genes that are interacting directly with  Diabetic nephropathy (DN) is well identified because of its potential to lead to end-stage renal disease (ESRD) that commonly occurs due to complications related to diabetes mellitus . GeneralIn patients, early detection of the tubular lesion can help to manage DN through glycemic control. Further, glomerular involvement is followed mainly by tubular involvement as various tubular enzymes and proteins are noticeable even before serum creatinine levels increase and the appearance of microalbuminuria . MoreoveA HAVCR1 protein with receptors on the surface of the immunoglobulin superfamily was found to be involved in phagocytosis, acting as scavenger receptor epithelial cells . There iThe study used a network-based pathway enrichment methodology for detecting KIM-1 associated biological processes. This method was performed based on a known pathway network and biological network analysis. Dysregulated pathways were also identified based on pathway network and target network analysis to elaborate the importance of KIM-1 in diabetic nephropathy.This is an in-silico study, completed in between March, 2019 to December, 2019. Enrichment and protein-protein interaction (PPI) network exploration of the notorious proteins, alongside mapped gene datasets, was executed using FunRich version 3.1.3.n\u2009=\u200985 subjects as duplicate samples from the diabetic unit of Jinnah Post-graduate Medical Center (JPMC) and Nephrology department in cooperation with Aga Khan University Hospital (AKUH) from November, 2016 to September, 2017. The ethical evaluation board of Basic Medical Sciences Institute, JPMC Karachi (Ref NO.F.2\u201381-IRB/2017/GENL/419/JPMC), Pakistan, granted the study\u2019s ethical approval.This study was followed by a study done by one of the authors on KIM-1 . Kidney This study obtained the E-GEOD-30529 gene expression profile\u00a09  from theSeries matrix of the dataset with accession to E-GEOD is downloaded from geo and is processed to convert to an .xlsx file as SAM accepts the input file in this format. The DEG was identified through the SAM  method . The genDEG  pair\u2019s possible functional relationships were investigated through the search tool STRING database for retrieving the interacting genes/proteins . This neCytoscape 3.8.2, a free software tool, was used for analyzing, modeling, and visualizing the interactions network at molecular and genetic levels . In thisSTRING is an online application devoted to protein-protein interactions. It comprises physical (direct) and functional (indirect) interactions. It contains publicly available databases, experimental sources, co-expression, and genomic perspectives. In this database, 24,584,628 proteins from 5090 organisms were included at this time . The REAStatistically significant genes in diabetic nephropathy are discovered using the SAM technique. About 2571 genes are discovered as differentially expressed 1765 genes and are up-regulated in the diseased as compared to control, whereas 805 genes are down-regulated in the diseased group. HAVCR1 is positively differentially expressed with a delta value of 2.544952, and a fold changes the value of 1.353374. Top 2000 genes are considered for further analysis.Two thousand genes are given to STRING to create an interaction network. The STRING network consisting of 21,975 edges and 1634 nodes is retrieved with the confidence of 0.400.The interaction file is later imported into Cytoscape network analysis. Network analysis is performed to compute the topological parameters of the networks. After performing the network analysis, only the genes interacting directly or indirectly with the gene of interest, i.e. HAVCR1, are selected. The selection is completed in two steps. The nodes and edges directly connected to HAVCR1 are selected at the first point. The nodes and edges connected to the first neighbors are selected in the next step. We cannot analyze the complete network obtained from STRING, only the nodes connected directly or indirectly to our gene of interest are extracted.The top 5 genes interacting directly with HAVCR1 include CASP3, CCL2, SPP1, B2M, and TIMP1 with degrees 161, 144, 108, 107, and 105, respectively. The top ten genes and their genes are displayed in Table P-Value <\u20090.05 were found using this pathway analysis. Out of these, 26 pathways have neighboring genes. Later, the number of neighboring genes is calculated by taking the intersection of genes in the pathway and the neighboring genes. The top 5 pathways include Immune System, Innate Immune System, Cytokine Signaling in Immune System, Adaptive Immune System, and Neutrophil Degranulation, with a neighbouring gene count of 237, 140, 116, 85, and 78 respectively. The top 8 pathways and the number of neighboring genes are shown in Table\u00a0Approximately 85 pathways enriched in differentially expressed genes with Pathogenesis of DN is complex, and pathological renal lesions are diverse. Diagnosis and progression of diabetic nephropathy (DN) have long been monitored through glomerular filtration rate (GFR); the kidney\u2019s best functional marker. But it was time consuming and was typically calculated from equations that rested on serum creatinine and cystatin C. Microalbuminuria and proteinuria have been another non-invasive biomarker. Still, their limitations include that patients having advanced kidney disease and microalbuminuria detected in them do not respond to therapy, as it would be at an earlier stage. Further, the ultra-filtered proteins cause advanced tubulo-interstitial damage to the kidney , 20. DiaOther disparities include mesangial cell expansion, Kimmelstiel\u2013Wilson nodules, glomerulosclerosis, and interstitial tubular fibrosis . ReasonsAnother main pathway is the metabolic pathway. It contributes to the pathogenesis of diabetic nephropathy by excessive glucose degradation among cells \u2013 a process called \u2018glycolysis\u2019. This enhances the polyol pathway in which there is an excessive formation and storing of sorbitol in cells. Sorbitol lowers nitric oxide, thus leading to intracellular stress and apoptosis. Next to this impact is the formation of fructose from sorbitol which is highly nephrotoxic. Fructose directly causes protein loss from kidneys and lowers the glomerular filtration rate and abundance of superoxide ions and other inflammatory cytokines . Second Advanced glycation end-products also are capable of attaching to pro-inflammatory receptors; altering the actions of renal cells also gives rise to cytokines and reactive oxygen species (ROS) which are nephrotoxic . The lasIt has also been documented that activated protein kinase C leads to glomerular basement membrane stiffening and the buildup of the extracellular matrix, which both affects the permeability of capillaries and, in turn, large amounts of albumin enter the vessels . Lastly,Many diabetic patients are observed to suffer from kidney-related diseases and inflammation. In several experimental studies, CCL2 is proposed as a potential healing target and biomarker in renal tissue-impaired patients having diabetes . LCN2 isIn this study, crucial mechanisms were brought to focus using protein-protein interaction of networks, centered on the top 5 genes interacting directly with HAVCR1, consisting of CASP3, CCL2, SPP1, B2M, and TIMP1. These are essential for immune system pathways , and were established to be amplified in diabetic nephropathy through protein interaction studies. These signaling pathways and associated proteins serve to be a potential target for novel beneficial agents to decrease the burden of diabetic nephropathy resulting from chronic diabetes mellitus."}
+{"text": "Microglia, the main immune modulators of the central nervous system, have key roles in both the developing and adult brain. These functions include shaping healthy neuronal networks, carrying out immune surveillance, mediating inflammatory responses, and disposing of unwanted material. A wide variety of pathological conditions present with microglia dysregulation, highlighting the importance of these cells in both normal brain function and disease. Studies into microglial function in the context of both health and disease thus have the potential to provide tremendous insight across a broad range of research areas. In vitro culture of microglia, using primary cells, cell lines, or induced pluripotent stem cell derived microglia, allows researchers to generate reproducible, robust, and quantifiable data regarding microglia function. A broad range of assays have been successfully developed and optimised for characterizing microglial morphology, mediation of inflammation, endocytosis, phagocytosis, chemotaxis and random motility, and mediation of immunometabolism. This review describes the main functions of microglia, compares existing protocols for measuring these functions in vitro, and highlights common pitfalls and future areas for development. We aim to provide a comprehensive methodological guide for researchers planning to characterise microglial functions within a range of contexts and in vitro models. Microglia are brain-resident macrophages and act as the main immune modulator cells of the central nervous system (CNS). In the healthy adult brain they are formed with a small cell body and numerous branched processes or ramifications . Microglia, which make up ~0.5\u201316.6% of the total cell population in the human brain . These cDuring development, microglia have key roles in shaping healthy neuronal networks . This inIn vitro microglia cultures provide an incredibly valuable tool to study the functions of these cells, both in the context of health and disease. In vitro models of microglia can be broadly categorised as immortalised microglial cell lines, primary isolated cell cultures from either rodents, macaque or humans, and induced pluripotent stem cell (iPSC) derived microglia-like cells. Each model has advantages and disadvantages, and none successfully recapitulates all characteristics of adult human homeostatic microglia, as is reviewed elsewhere ,21. In bThe expression profile of microglia is shaped by the local micro-environment and their unique ontogeny. Although they are considered the \u2018macrophages of the CNS\u2019, microglia originate from precursors of the primitive yolk sac via PU.1, IRF8 and CSF1R dependent pathways ,25. CommFurther confirmation of microglia can be shown through the absence of certain markers. For instance, expression of CD206 is characteristic for periventricular macrophages, choroid plexus macrophages and meningeal macrophages, but not microglia, allowing the cell types to be distinguished from one another . RelativIt is important to be wary of some marker discrepancies across microglia models, some key changes have been summarised in Microglial morphology, first described in pioneering research by P\u00edo del R\u00edo-Hortega in 1919 , is incrHistological staining with various markers can accurately delineate the cytoplasm and processes of microglia, with confocal microscopy often used to obtain high quality Z-stack images of these cells. While both fluorescence and 3,3\u2032-diaminobenzidine can be used to obtain images, fluorescence staining often allows for superior visualization of microglial processes, and is therefore preferred . FluoresHaving obtained a clear image highlighting microglial structure, a variety of image analysis software can be used to perform semi-automated quantification of morphological characteristics. While in vitro monocultured microglia morphology can be quantified using either 2D or 3D images, 3D analysis reduces the likelihood of cell structure misrepresentation. Imaris is one such software . Using ITo conclude, an understanding of microglial morphology can act as a powerful tool when looking to understand the biology of these cells, and a variety of different semi-automated software exist to aid morphological quantification. However, researchers should be careful not to infer function from morphology, particularly as microglial morphology is highly diverse and transient . FurtherMicroglia are the major mediators of the inflammatory response in the CNS. Neuroinflammation is initiated following binding of either damage-associated molecular patterns (DAMPs), pathogen-associated molecular patterns (PAMPs), or neurodegeneration-associated molecular patterns (NAMPs) by pattern-recognition receptors (PRRs) on microglia ,72. PRRsIn brief, binding of ligands to pro-inflammatory PRRs on microglia results in the release of numerous mediators of the inflammatory response including cytokines , chemokines , nitric oxide synthase (NOS2) and reactive oxygen species (ROS) . FollowiSeveral stimuli are utilised by researchers in order to induce an inflammatory response prior to characterization. The most well-studied microglial activator in vitro is the bacterial cell wall component lipopolysaccharide (LPS), which acts via TLR4, and is suggested to induce a pro-inflammatory phenotype . HoweverTo assess cytokine or chemokines secreted by microglia in vitro, it is common to collect conditioned cell media to perform assays. A summary of the different techniques used to quantify cytokine release from microglia, as well as pros and cons of each technique, is presented in 2\u2212. For more in depth analysis, spin trap techniques and Electronic Paramagnetic Resonance (EPR) spectroscopy can be used. However, EPR spectroscopy is an expensive and highly specialised technique, thus limiting its use in many lab settings [ROS and nitric oxide, other key mediators of the microglial inflammatory response, can be measured using several easy to use, relatively cheap, commercially available kits ,85,86. Tsettings .To conclude, when performing in vitro assays for neuroinflammatory effects of microglia, a variety of assays exist that focus on different types of inflammatory effects. Key considerations include choosing the most appropriate stimulus for the research question. The most commonly used stimulus, LPS, may be considered less-physiologically relevant when attempting to model non-bacterial driven neuroinflammation. Furthermore, choosing a relevant stimulus concentration and exposure time can be difficult, due to a lack of consensus in the literature. Future studies comparing the inflammatory reactions of microglia to different immune-relevant stimuli would help the field identify the most physiological stimulus, concentration, and exposure conditions. The endocytic pathway is required for effective sorting and recycling of cellular components and is the mechanism by which cells internalise external or plasma membrane bound cargos. However, the role and impact of the endocytic pathway is far more wide reaching. Like all cells microglia require efficient endocytosis and employ it in the internalisation of nutrients, antigen presentation, motility, lipid homeostasis, synapse pruning and membrane receptor regulation ,89. One Endocytosis can be split into clathrin mediated endocytosis (CME), macropinocytosis and phagocytosis . Each paOnce cargoes are internalised, they are then shuttled to the early endosome to begin the intracellular trafficking process. Cargo can then be passed onto either the sorting endosome, where cargoes can be recycled back to the plasma membrane, or to the late endosome, which marks cargos for eventual degradation. Microglia, like other cell types, can be assessed for endosomal network properties such as number of early/late/recycling endosomes, cellular positioning of endosomes and size of different endosomal compartments using immunocytochemistry or electron microscopy ,101,102.Endocytosis is a dynamic process, and in vitro studies can take advantage of this through the use of live imaging to quantify uptake and turnover of specific cargoes over time. Such cargos can be used to distinguish different forms of endocytosis. For example, CME can be investigated using transferrin or epidermal growth factor labelled with pHrodo or permanent fluorescent dyes, using similar methodology to phagocytosis assays, as will be discussed in more detail later ,111,112.In neurodegenerative diseases such as Alzheimer\u2019s and Parkinson\u2019s Disease, microglia endocytose specific misfolded proteins such as \u03b2-amyloid, tau, and \u03b1-synuclein ,120,121.In conclusion, it is possible to investigate the different endocytic pathways through the careful choice of cargo ensuring the correct size for the pathway of interest. This should always be coupled with control compounds, e.g., dynasore to further validate results. Where aggregate-prone proteins such as \u03b2-amyloid are used for endocytic uptake experiments, they require full characterisation so that the experimenter is certain of the species being used, as this will impact the pathway of uptake. Phagocytosis is an important function of microglia during development and disease. Phagocytosis is defined as the recognition and ingestion of particles larger than 0.5 \u00b5m . MicroglE. coli or Zymosan  [Phagocytosis of different cargo can result in different phenotypic outcomes for the microglia. For example, phagocytosis of bacteria generally leads to pro-inflammatory activation and slow degradation that allows antigens to be preserved for presentation, conversely recognition of apoptotic cells suppresses inflammation and cargo is rapidly degraded . Phenoty glucan) .E. coli and Zymosan bioparticles are popularly used for phagocytosis studies due to their being commercially available conjugated to a pH-sensitive dye, offering convenience and homogeneity. E. coli is recognised by scavenger receptors such as BAI1 and MARCO, and PRRs such as CD14 and SR-A, whereas Zymosan is primarily recognised by Dectin-1 (CLEC7A) receptors [eceptors . Zymosaneceptors . The maiMicroglial phagocytosis of apoptotic cells, also known as \u201cefferocytosis\u201d, is important in both development and disease. Apoptotic cells universally expose a phosphatidylserine \u201ceat-me\u201d signal, recognised directly by TREM2 and GPR56 receptors, and indirectly (with specific opsonins) by other microglial receptors including MERTK, MEGF10, \u03b1V\u03b23/5 integrin, LRP1, and complement receptors . A simplMyelin debris is also cleared by microglia via phagocytosis. Microglial receptors for myelin include MERTK, AXL and TREM2 , and comMicroglia phagocytose the presynaptic terminals of viable neurons in a process known as \u201csynaptic pruning\u201d, which is normally highly active during development to refine neuronal circuits, and appears to be reactivated in multiple models of neurological disease ,147. SynOther important considerations for phagocytosis assay development include the duration of phagocytosis (if not using a kinetic assay) and the ratio of cargo particles to microglia. Phagocytosis needs to be captured at a point in time where the rate of phagocytic uptake is constant, and the signal has not yet reached saturation, this should be determined experimentally by testing multiple cargo doses and incubation times. Saturation occurs when additional uptake of particles contributes to a weaker increase in fluorescence signal, so will be affected by instrument sensitivity, resolution and dynamic range . SaturatThe accuracy and reproducibility of the data can be improved by sampling more cell events or capturing more image fields. However, if live cells are measured then increasing the sampling could lead to unacceptably long delay in data capture. Therefore, sampling depth needs to be balanced by speed. Instruments with higher levels of automation can improve processing speed and additionally have the benefit of reducing operator bias. Image-based methods with the ability to resolve intracellular structures (recommend 40X magnification or higher) allow for more phagocytosis parameters to be measured, which can improve detection accuracy.Finally, consideration should be given to the choice of fluorescent labels in the assay. To allow intracellular events to be detected, the microglial cells are usually stained with a fluorescent chemical or lectin dye to highlight the whole cell body, or else they are fluorescently labelled with an antibody for a microglia-specific marker after phagocytosis has occurred. For high-content imaging, microglia staining is particularly important to ensure that cells are \u2018segmented\u2019 accurately in the automated image analysis pipeline. Furthermore, cargo can be labelled prior to phagocytosis with a permanently fluorescent dye  or a pH-sensitive dye . pH-sensitive dyes are weakly fluorescent at neutral pH and increase their fluorescence with reduced pH, such as occurs with phagosome acidification . This caTo conclude, phagocytosis assays can provide important insights into the effect of chemical or genetic manipulations upon microglia function. Phagocytic cargo should be chosen carefully with the intended biological question in mind, and ideally several types should be tested. Flow cytometry and imaging readouts are commonly used, and robust data can be obtained from relatively inexpensive equipment if the assay is carefully optimised. However, high-content imaging is advantageous when the perturbation of phagocytosis is expected to be subtle, because it more accurately quantifies the amount of phagocytosed material per cell.Microglia are highly dynamic cells that are constantly in motion. In their resting state, healthy microglia extend and retract their processes constantly to survey their local neuronal network, whilst largely retaining their cell body in the same position and maintaining distance from other microglia . This \u201csMethods of assaying macrophage chemotaxis in vitro have been reviewed extensively elsewhere, and would apply to microglia ,165. HerTranswell assays are adapted from the original Boyden chamber, which is a well containing chemoattractant solution, with cells placed in an insert with a porous membrane base that is in contact with the chemoattractant . Due to In microglia literature the transwell assay is by far the most popular chemotaxis method. Mouse microglia migration towards ATP , ADP 16, CCL2 1, CCL19 , CCL21 , Tau 17, and \u03b1-SThe undirected or \u2018random\u2019 motility of microglia is important for their homeostatic surveillance of the brain environment. Random motility employs similar downstream cytoskeletal effectors to chemotaxis, however the upstream signalling appears to be distinct, being P2Y12-independent . TherefoDirect time-lapse imaging of cultures can be used to track the movements of individual cells and cell processes moving randomly in culture. Microglia are visualised with a fluorescence reporter or live-cell stain. Monocultures can be monitored, however microglia motility is blunted in the absence of neurons , so the Wound-healing scratch assays involve a fine linear scratch being drawn through a dense monolayer of cells in culture, and live imaging is used to monitor the width of the scratch as cells migrate into it, or the number of individual invading cells. Scratch assays may damage cells, but no chemotactic gradient is sustained in the well, therefore closure of the wound is governed by random motility . ScratchIn conclusion, microglia motility can be chemotactic\u2013directed towards a stimulus\u2013or random/undirected. Easy medium-throughput assays are available for measuring chemotaxis and random motility\u2013transwells for the former, and scratch assays for the latter\u2013but these have limitations that should be weighed up. A more detailed study of motility should include multiple complementary assays, and consideration given to the biological relevance of any stimuli. Kinetic information is particularly important for motility studies, therefore it is advantageous to use a good time-lapse imaging microscope with environmental control.Microglia are highly plastic cells, displaying rapid physiological changes in response to a wide variety of external stimuli. Functionally, these changes include gross morphological changes, release of inflammatory and anti-inflammatory molecules, phagocytosis, endocytosis, chemotaxis and migration to sites of injury. Executing these processes requires energy from metabolism ,180,181.Microglia are capable of generating energy via both glycolytic and oxidative metabolism ,186. TheFor microglia, increased demand often occurs following recognition of an external stimuli, such as DAMPs, PAMPs, or NAMPs . ATP is Sustained glycolysis results in increased mitochondrial membrane potential (\u0394\u03a8m), and likewise increased reliance on OXPHOS results in a decrease in \u0394\u03a8m . In macrA wide variety of assays exist that can be used to examine mitochondrial function in vitro, which have been reviewed extensively elsewhere ,196,197.The Agilent Seahorse XF analyser acts as an incredibly powerful tool for examining mitochondrial function ,196. ThiAn additional method to examine mitochondrial function in vitro is to assay \u0394\u03a8m . SeveralImmunometabolism can be indirectly assayed by visualizing mitochondrial network structure, using fluorescent staining , immunocytochemistry or electron microscopy . Within Immunometabolism can be more comprehensively assessed with metabolomics. Metabolomics characterises and quantifies the metabolome: the total set of metabolites, substrates, intermediates and products of cellular metabolism. This process requires the use of mass-spectrometry in conjunction with liquid or gas chromatography and/or nuclear-magnetic resonance. While this technique is expensive and requires specialist equipment and expertise, it generates a large quantity of data about the current state of metabolic processes within a culture. However, it should be noted that metabolism is a highly dynamic process, and metabolomics only provides a snapshot at one point in time .The importance of immunometabolic switching with regard to microglia function highlights the value of studying this process when investigating microglial phenotypes in vitro. Using more than one method to assess mitochondrial function in vitro is advised for more robust conclusions.It is clear that microglia exhibit numerous important and complex functions within the brain. Fortunately, a large number of well-developed methods exist by which to measure each of these functions in vitro. When choosing which method to use for assessing each function, it is important to take into consideration the research aims.Upon selecting stimuli or cargo, the most relevant choice should be used. In addition, future studies should aim to move the field towards more physiologically relevant stimuli when studying microglia activation. Broadly, accuracy and reproducibility of the data can be improved by having sufficient technical replicates, and sampling more cell events for flow cytometry, or capturing more image fields for microscopy readouts. Moreover, performing multiple assays for one or more related functions can provide a more nuanced picture of the effect of an experimental perturbation.We hope that this review will provide microglia researchers with all the information they require to perform a comprehensive evaluation of this highly important cell type."}
+{"text": "The aim of this cross-sectional study was to examine the relationship between social factors and COVID-19 protective behaviors and two outcomes: depressive and perceived stress symptoms.In September 2020, 1,064 randomly selected undergraduate students from a large midwestern university completed an online survey and provided information on demographics, social activities, COVID-19 protective behaviors , and mental health symptoms. Mental health symptoms were measured using the Center for Epidemiological Studies Depression-10 questionnaire for depression and the Perceived Stress Scale-10 for stress symptoms.The results showed respondents who were males and also the respondents who were \u201changing out\u201d with more people while drinking alcohol reported significantly lower depressive symptoms and lower stress symptoms. On the contrary, staying home from work or school \u201cvery often\u201d was associated with higher stress symptoms, compared with \u201cnever/rarely\u201d staying home from work/school. Similarly, having a job with in-person interaction was also associated with increased stress.These findings suggest that lack of social engagement was associated with depression and stress symptoms among college students during the COVID-19 pandemic. Planning social activities that align with recommended safety precautions, as well as meet students\u2019 social needs, should be an important priority for higher education institutions. With the emergence of the Coronavirus Disease 2019 (COVID-19) pandemic, the public received stay-at-home orders and recommendations to wear masks, reduce participation in large social events, and maintain six feet of physical distance, among other protective behaviors to reduce the risk of severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2) transmission. In addition to the risk to physical health posed by the virus, approximately 80% of adults reported that the COVID-19 pandemic was a significant source of stress . StressoCollege student life is also characterized by the consumption of alcohol. Drinking alcohol is viewed as a social activity, influenced by time spent with peers . AlcoholThe COVID-19 pandemic has brought new challenges to the efforts of keeping college students safe and healthy. There has been limited research related to past epidemics and their effects on mental health , making However, it is unknown whether social activities  and COVID-19 protective behaviors  are associated with symptoms of depression and stress among young adults in college. A particular challenge is finding the right balance between having people engage in COVID-19 protective behaviors, but without it leading to negative consequences for their mental health . COVID-1There is a need for this research because the pandemic is still ongoing, and we continue to be at risk for future pandemics. Although there is substantial existing literature on mental health and college students, there is a research gap around sociodemographic and behavioral activities and their relationship with students\u2019 mental health during the pandemic context. This knowledge is valuable to support university efforts focused on improving the mental health of college students.The primary objective of the current study was to examine the relationship between social factors and COVID-19 protective behaviors and two measures of mental health status: depressive and stress symptoms. We used the Strengthening the Reporting of Observational Studies in Epidemiology (STROBE) for cross-sectional studies checklist.A cross-sectional study design was used to identify the prevalence of depressive and stress symptoms among undergraduates in September 2020 . All data were retrieved from the online self-reported baseline survey collected through REDCap (Research Electronic Data Capture) , 29. ParUndergraduate students at a large midwestern university were randomly sampled to participate in a parent SARS-CoV-2 antibody study during the fall 2020 semester using simple random sampling . ParticiThe Office of the Vice Provost for Undergraduate Education generated a random list of undergraduates to be representative of the undergraduate student population . To be eligible for the parent antibody study, participants had to be 1) enrolled as an undergraduate student, 2) aged 18 years or older, and 3) residing in the same county where the university is located .The 10-item Center for Epidemiological Studies Depression (CES-D-10) previously validated questionnaire was used to capture self-reported symptoms of depression \u201333. RespSymptoms related to stress were captured using the 10-item Perceived Stress Scale (PSS-10), a reliable and previously validated instrument . All tenSex. On the baseline survey, participants were asked, \u201cWhat sex were you assigned at birth, on your original birth certificate?\u201d with options \u201cmale\u201d and \u201cfemale.\u201dAcademic factors. Participants reported total overall credit hours and total in-person credit hours using a drop-down menu ranging from zero to 30; both were recorded as continuous variables.Social factors. Participants were asked whether they had a job or internship that involved in-person interactions (1 = yes vs. 0 = no). Participants were also asked whether they \u201cever used any of the following inhaled tobacco products before today? Cigarettes, e-cigarettes, other inhaled products, and none of the above\u201d and were asked to mark all that apply. Past 30-day e-cigarette use was categorized into 0 = \u201cnone/zero days,\u201d 1 = \u201c1\u20135 day(s),\u201d and 2 = \u201c>5 days\u201d from responses ranging from 1 to 30 for the \u201cDuring the last 30 days, on how many days did you use e-cigarettes?\u201d question. Related to alcohol drinking behaviors, participants were asked to enter a numerical value of the number  of persons/partners they typically \u201chung out\u201d with while drinking alcohol. Non-alcohol drinkers were recoded with zero for the number of drinking partners. A separate group that was restricted to only the participants that reported drinking alcohol was also created for the reported number of drinking partners/ number of people the participants \u201chung out\u201d with.COVID-19 protective behaviors. Participants were asked if they practiced a series of protective behaviors in the past 7 days to prevent infection of COVID-19. The two included in this study are: how often they \u201cavoided a social event I wanted to attend\u201d followed by how often they \u201cstayed at home from work/school\u201d with options 1 = \u201calways,\u201d 2 = \u201cvery often,\u201d 3 = \u201csometimes,\u201d 4 = \u201crarely,\u201d and 5 = \u201cnever\u201d for both questions. The responses to both questions were reverse coded, and \u201crarely\u201d and \u201cnever\u201d were collapsed.The following models were conducted: 1) unadjusted and sex-adjusted logistic regression models for the relationship between each of the four social and behavioral variables and depressive symptoms, and 2) unadjusted and sex-adjusted linear regression models to test for the association between the four social and behavioral variables and stress symptoms. Sex is associated with both prevalence and severity of reported depressive symptoms  and diffOf the 7,499 undergraduate students randomly sampled to participate in the COVID-19 antibody study, 3,430 were ineligible because they were not living in the same county as the university or not enrolled as an undergraduate student. Of the 4,069 eligible individuals, 1,397 (34.4%) provided voluntary electronic consent. One hundred thirty-three discontinued their involvement in the study by not answering any of the survey questions and were therefore excluded from this analysis.For the mental health symptoms outcomes, 108 of the 1,264 participants had missing values for the CES-D-10 and PSS-10 questions and were removed. Of the 1,156 with complete mental health symptoms data, 91 (7.9%) participants had missing self-reported background information: age (missing 68), sex at birth (missing 1), school year (missing 3), credit hours (missing 1), in person credit hours (missing 11), job with in-person interaction (missing 2), number of alcohol drinking partners (missing 3), and COVID-19 protective behaviors (missing 2) and were removed. One participant entered zero for the total credits enrolled in and was also removed, yielding n = 1,064 for the final sample.Four hundred forty-seven (42.0%) participants reported having significant depressive symptoms. Based on the PSS-10, most of the respondents  experienced moderate stress symptoms, followed by 23.9% with low stress and 9.9% with high stress. The mean score on the PSS-10 was 18.28 (SD 6.52) and ranged from zero to 38.As shown in Past 30-day e-cigarette use was also not found to be associated with depressive symptoms. In contrast, the number of people the students \u201chungout\u201d with while drinking alcohol was negatively associated with depressive symptoms. Similarly, among the restricted sample of students who reported drinking, the number of people the students \u201chung out\u201d with while drinking alcohol was also negatively associated with depressive symptoms. On the other hand, those who avoided social events either \u201cvery often\u201d or \u201calways\u201d had higher odds of reported significant depressive symptoms compared to those who reported \u201cnever/rarely\u201d avoiding those social events.No significant relationship was found between the number of total credit hours and in-person credit hours and depressive symptoms, after adjusting for sex. However, sex largely accounted for the association between having an in-person facing job or internship and significant depressive symptoms. After adjusting for sex, there was no longer a significant association between having an in-person facing job or internship and depressive symptoms.The relationship between past 30-day e-cigarette use and depressive symptoms remained relatively unchanged and was still not significant, after controlling for sex. The significant association between the number of people the students \u201chung out\u201d with while drinking alcohol and depressive symptoms remained unchanged after controlling for sex in the model. Likewise, in the restricted sample of participants who reported drinking alcohol, the significant association between the number of people the students \u201chung out\u201d with while drinking alcohol and depressive symptoms was also identical after controlling for sex. However, both of the COVID-19 protective behaviors  were not significantly associated with having significant depressive symptoms when controlling for sex in the models.As shown in There was no statistically significant relationship between the past 30-day e-cigarette use and stress. Students who reported hanging out with an increased number of people while drinking reported less stress; the same was true for the restricted sample of students who reported drinking. Among the restricted sample of students who reported drinking, the increased number of reported people \u201changing out\u201d with while drinking alcohol was similarly negatively associated with stress.Among the COVID-19 protective behaviors, participants who \u201calways\u201d avoided social events reported greater stress symptoms compared to those who \u201cnever/rarely\u201d attended social events. In addition, staying home from work/school \u201cvery often\u201d was associated with reporting greater stress symptoms compared to \u201cnever/rarely\u201d staying home from work/school.After controlling for sex, there was no relationship between the number of total credit hours and in-person credit hours and stress symptoms. However, the association between having a job or internship with in-person interaction and increased stress remained significant. The relationship between the increased number of people the respondents \u201chung out\u201d with while drinking alcohol and increased stress symptoms also remained significant. Similarly, among the restricted sample of participants who reported drinking alcohol, the increased number of people the respondents \u201chung out\u201d with while drinking alcohol and increased stress was significant after controlling for sex. Lastly, the relationship between \u201calways\u201d staying home from work/school compared to \u201cnever/rarely\u201d remained significant after controlling for sex in the model.In this study, we found that fewer than half of the undergraduate student participants reported depressive symptoms, and the majority reported moderate to high levels of stress symptoms in Fall 2020. We also found that key social and behavioral variables were associated with these negative health outcomes. Namely, these included having a job or internship with in-person interaction, the number of people students \u201chung out\u201d with while drinking alcohol, avoiding social events, and staying home from work or school. The relationship between the number of people students \u2018hung out\u2019 with while drinking alcohol and both depressive and stress symptoms persisted even after accounting for the expected and strong sex differences in our two mental health outcomes.The percentage of reported high stress scores in our sample (9.9%) was lower than the July/August 2020 PSS-10 scores from undergraduates at a Southeastern US university where 26.9% reported high stress . BesidesFor some students, returning to the university came at a financial cost that required taking on either an internship or part-time job to survive financially. Participants who reported having a job or internship with in-person interaction reported significantly increased stress. Students employed or interning in a position that required interacting with people in-person were potentially presented with unique stressors brought on by balancing work responsibilities, as they also had to engage in COVID-19 protective behaviors. This finding is significant because as universities make efforts to protect their students, there are limitations to those efforts such as the workplace that falls outside of their jurisdiction. Possible recommendations include outreach programs dedicated to providing behavioral health, financial, and academic support to the students who are employed in client-facing jobs.For the COVID-19 protective behaviors, there was significant increased perceived stress among participants who reported they \u201cvery often\u201d stayed home from work/school compared to those who \u201crarely/never\u201d stayed home from work/school. However, this association was not observed for participants who reported \u201calways\u201d staying home. The undergraduates who reported staying home \u201cvery often\u201d may have had ambivalent feelings towards whether to stay home that might have created stress. Alternatively, the fear of contagion as a result of those few occasions on which they went out might have also led to increased stress. Future studies might consider exploring this further by collecting qualitative data on individuals\u2019 feelings and perceptions regarding the risk and stress of social engagement activities during the pandemic.Aspects of our study design influence the interpretation of our study findings. First, as an observational cross-sectional study, there are issues with directionality of effects. Responses were collected at a single point in time, near the start of the semester, making it difficult to discern whether other unreported factors were associated with the selected social and behavioral activities or their mental health symptoms. Furthermore, we cannot determine whether increased social engagement led to reduced depressive symptoms or whether decreased social engagement was a consequence of those mental health symptoms. Aside from consuming alcohol, we are unaware of what additional in-person social exchanges occurred. Previous research found that very frequent in-person social connections during the pandemic were associated with lower depression .Another limitation of this study was the use of self-reported data collected via an online survey instrument. There is a possibility of bias due to under-reporting for some of our key selected variables. For instance, due to the legal age of tobacco and nicotine products having been raised to 21, matching the legal age of consumption for alcohol, there may have been some under-reporting of substance use of individuals between age 18 and 20 . HoweverDuring the regular college experience, college students experience a breadth of challenges, whether personal, academic, financial, or otherwise. The COVID-19 pandemic worsened some of those existing challenges and introduced new ones. Having conducted this study at the start of the Fall 2020 academic semester, as students returned from an all-online curriculum to a hybrid learning mode, is not representative of all the different stages of the pandemic. However, it offers some insight into students\u2019 mental health and well-being for future public health crises.Strengths of this study includes the simple random sampling of the students, reducing the risk of sampling bias. However, it was vulnerable to volunteer bias. It is possible that eligible students who were experiencing extreme hardships were unable to participate in this study. Therefore, although our study findings might be representative of the general undergraduate student body, it might not be generalizable to some subgroups that were at severe risk of depression or stress.The findings of this current study may have some implications for future university public health communications and prevention efforts. Universities need to provide opportunities for social interaction that maintain safety from infectious disease transmission. For example, this may include hosting social activities in an outdoor space where students can maintain a safe distance from each other while interacting with one another, rather than staying in their dorm or apartment in social isolation. This may also include establishing peer support groups that regularly meet and provide each other with guidance on how to safely socialize. Our study contributes to the existing mental health and COVID-19 among college student literature by identifying a negative relationship between the recommended refrain of social activities and protective behaviors and two mental health outcomes: depression and stress during a time when the requirements were no longer as strongly enforced.Future research could further investigate the relationship between these social factors, COVID-19 protective behaviors, and the mental health of students who, now years into the pandemic, have continued to refrain from social activities. Furthermore, additional research could review university pandemic incident response plans and the available support systems and existing interventions aimed at preventing depression and stress.These findings suggest that social engagement was associated with lower levels of depressive symptoms among college students during the fall 2020 semester. It may be that social engagement acted as a protective factor for depression during this time. Offering social activities that align with recommended safety precautions and meet students\u2019 social needs should be considered as an important priority for higher education institutions as they continue to address the COVID-19 pandemic and plan for future public health emergencies. This study provides additional information about undergraduate mental health outcomes during the ongoing pandemic to inform policies, interventions, and the provision of services needed to address top college and university leadership concerns.S1 Data(XLSX)Click here for additional data file. 14 Sep 2022 <div> PONE-D-22-20107 </div>  <div> Social factors associated with college students' depression and stress during the COVID-19 pandemic: A cross-sectional study </div>  <div> PLOS ONEDear Dr. Garcia Colato,Thank you for submitting your manuscript to PLOS ONE. After careful consideration, we feel that it has merit but does not fully meet PLOS ONE\u2019s publication criteria as it currently stands. Therefore, we invite you to submit a revised version of the manuscript that addresses the points raised during the review process.plosone@plos.org. When you're ready to submit your revision, log on to https://www.editorialmanager.com/pone/ and select the 'Submissions Needing Revision' folder to locate your manuscript file.Please submit your revised manuscript by Oct 29 2022 11:59PM. If you will need more time than this to complete your revisions, please reply to this message or contact the journal office at\u00a0 </div> A rebuttal letter that responds to each point raised by the academic editor and reviewer(s). You should upload this letter as a separate file labeled 'Response to Reviewers'.A marked-up copy of your manuscript that highlights changes made to the original version. You should upload this as a separate file labeled 'Revised Manuscript with Track Changes'.An unmarked version of your revised paper without tracked changes. You should upload this as a separate file labeled 'Manuscript'.Please include the following items when submitting your revised manuscript:If you would like to make changes to your financial disclosure, please include your updated statement in your cover letter. Guidelines for resubmitting your figure files are available below the reviewer comments at the end of this letter.https://journals.plos.org/plosone/s/submission-guidelines#loc-laboratory-protocols. Additionally, PLOS ONE offers an option for publishing peer-reviewed Lab Protocol articles, which describe protocols hosted on protocols.io. Read more information on sharing protocols at https://plos.org/protocols?utm_medium=editorial-email&utm_source=authorletters&utm_campaign=protocols.If applicable, we recommend that you deposit your laboratory protocols in protocols.io to enhance the reproducibility of your results. Protocols.io assigns your protocol its own identifier (DOI) so that it can be cited independently in the future. For instructions see: We look forward to receiving your revised manuscript.Kind regards,Michio MurakamiAcademic EditorPLOS ONEJournal Requirements:When submitting your revision, we need you to address these additional requirements.1. Please ensure that your manuscript meets PLOS ONE's style requirements, including those for file naming. The PLOS ONE style templates can be found at\u00a0https://journals.plos.org/plosone/s/file?id=wjVg/PLOSOne_formatting_sample_main_body.pdf and\u00a0https://journals.plos.org/plosone/s/file?id=ba62/PLOSOne_formatting_sample_title_authors_affiliations.pdf.2. Please state the full name of the Institutional Review Board that approved your study.3. You indicated that you had ethical approval for your study. In your Methods section, please ensure you have also stated whether you obtained consent from parents or guardians of the minors included in the study or whether the research ethics committee or IRB specifically waived the need for their consent.http://journals.plos.org/plosone/s/data-availability.4. In your Data Availability statement, you have not specified where the minimal data set underlying the results described in your manuscript can be found. PLOS defines a study's minimal data set as the underlying data used to reach the conclusions drawn in the manuscript and any additional data required to replicate the reported study findings in their entirety. All PLOS journals require that the minimal data set be made fully available. For more information about our data policy, please see http://journals.plos.org/plosone/s/data-availability#loc-recommended-repositories. Any potentially identifying patient information must be fully anonymized.\"Upon re-submitting your revised manuscript, please upload your study\u2019s minimal underlying data set as either Supporting Information files or to a stable, public repository and include the relevant URLs, DOIs, or accession numbers within your revised cover letter. For a list of acceptable repositories, please see http://journals.plos.org/plosone/s/data-availability#loc-unacceptable-data-access-restrictions. Note that it is not acceptable for the authors to be the sole named individuals responsible for ensuring data access.Important: If there are ethical or legal restrictions to sharing your data publicly, please explain these restrictions in detail. Please see our guidelines for more information on what we consider unacceptable restrictions to publicly sharing data: We will update your Data Availability statement to reflect the information you provide in your cover letter.5. Your ethics statement should only appear in the Methods section of your manuscript. If your ethics statement is written in any section besides the Methods, please delete it from any other section.\u00a0[Note: HTML markup is below. Please do not edit.]Reviewers' comments:Reviewer's Responses to Questions <font color=\"black\"> Comments to the Author1. Is the manuscript technically sound, and do the data support the conclusions? </font> The manuscript must describe a technically sound piece of scientific research with data that supports the conclusions. Experiments must have been conducted rigorously, with appropriate controls, replication, and sample sizes. The conclusions must be drawn appropriately based on the data presented. Reviewer #1:\u00a0PartlyReviewer #2:\u00a0Yes********** <font color=\"black\"> 2. Has the statistical analysis been performed appropriately and rigorously?  </font> Reviewer #1:\u00a0NoReviewer #2:\u00a0Yes********** <font color=\"black\"> 3. Have the authors made all data underlying the findings in their manuscript fully available?PLOS Data policy requires authors to make all data underlying the findings described in their manuscript fully available without restriction, with rare exception (please refer to the Data Availability Statement in the manuscript PDF file). The data should be provided as part of the manuscript or its supporting information, or deposited to a public repository. For example, in addition to summary statistics, the data points behind means, medians and variance measures should be available. If there are restrictions on publicly sharing data\u2014e.g. participant privacy or use of data from a third party\u2014those must be specified. </font> The Reviewer #1:\u00a0NoReviewer #2:\u00a0Yes********** <font color=\"black\"> 4. Is the manuscript presented in an intelligible fashion and written in standard English? </font> PLOS ONE does not copyedit accepted manuscripts, so the language in submitted articles must be clear, correct, and unambiguous. Any typographical or grammatical errors should be corrected at revision, so please note any specific errors here.Reviewer #1:\u00a0NoReviewer #2:\u00a0Yes********** <font color=\"black\"> 5. Review Comments to the Author </font> Please use the space provided to explain your answers to the questions above. You may also include additional comments for the author, including concerns about dual publication, research ethics, or publication ethics. Reviewer #1:\u00a0General commentsThe study is good, but the write-up needs restructuring and editorial improvement to be coherent and easily flow.Major issues &#x0f0fc;  The title should be self-explanatory and need to specify the place of the study. The title is not in line with the stated objective i.e. at least the relationship between social factors and COVID-19 protective behaviours is missing from the title.\ufffd &#x0f0fc;  The abstract did not follow the journal guideline showing introduction, method, result and conclusion. In addition, there is not any effect size reported in the abstract. As it stands now, it is wordy and includes unnecessary details.\ufffd &#x0f0fc;  The background section is not focused, and it does not show what were known, what were unknown and the need for the study, justification was shallow and not well developed.\ufffd &#x0f0fc;  The authors have mentioned that the tools used were validated. Where were the tools validated? The cited references showed that the validation is somewhere else. Tools should be validated in the country where they are used for data collection. Otherwise there might be still cross-cultural differences and the use of non-validated tool should be mentioned as limitation.\ufffd &#x0f0fc;  Where is the sample size calculation. as it stands now it seems that authors have approached students who were planned for COVID-19 antibody test were asked to participate in the survey. This may have its own impact in the generalizability. Detail information on how they were initially recruited for that study must be at least cited.\ufffd &#x0f0fc;  The study seems outdated as the data is collected in 2020. While the COVID-19 pandemic is the very pressing issue until now, there are several evidence on mental health impacts among different segments of population including students. The importance of this study should be clearly justified.\ufffd &#x0f0fc;  Authors have dichotomized the depressive symptoms outcome but used as it is for stress symptoms. What was the reason to go for dichotomizing in the analysis of factors for depressive symptoms?\ufffd &#x0f0fc;  Authors mentioned that they have used random sampling as a strength, which specific type of random sampling did they use?\ufffd &#x0f0fc;  What were the implications? The discussion seems straight jacketed, and it seems the repetition of the result section as it stands now.\ufffd &#x0f0fc;  The discussion lacks recommendation based on the results.\ufffd &#x0f0fc;  Authors have mentioned that they have paid up to $30 per questionnaire, introducing financial issues in survey participation has its own problem. Please comment on this.\ufffdMinor issues &#x0f0fc;  Keywords should be written in alphabetical order. The use of mental health as keyword do not add any information as the mental health symptoms dealt with were only depressive symptoms and perceived stress.\ufffd &#x0f0fc;  Background lines 79-80, needs citation\ufffd &#x0f0fc;  Objectives lines 100-103, is not objective it should be moved to introduction section. In addition there are several studies on mental health problems among students all over the globe.\ufffd &#x0f0fc;  Lines 216 to 217 is incomplete sentence.\ufffd &#x0f0fc;  Line 265 \u201ckey results\u201d is unnecessary sub heading, check journal guideline.\ufffd &#x0f0fc;  Line 275 to 276 repeating the objective once again in the discussion section is meaningless.\ufffd &#x0f0fc;  Several limitations have been mixed up with the strength of the study section in the discussion.\ufffd &#x0f0fc;  Tables should be named appropriately i.e. play and year has to be mentioned.\ufffdReviewer #2:\u00a0This paper is very interesting and easy to read. However, I recommend to improve the discussion and conclusion sections. The discussion should be in-depth and contains not only summaries of research results, but above all their significance and implications for university practice********** <font color=\"black\"> 6. PLOS authors have the option to publish the peer review history of their article (what does this mean?). If published, this will include your full peer review and any attached files.If you choose \u201cno\u201d, your identity will remain anonymous but your review may still be made public.Do you want your identity to be public for this peer review? For information about this choice, including consent withdrawal, please see our Privacy Policy. </font> Reviewer #1:\u00a0NoReviewer #2:\u00a0No**********https://pacev2.apexcovantage.com/. PACE helps ensure that figures meet PLOS requirements. To use PACE, you must first register as a user. Registration is free. Then, login and navigate to the UPLOAD tab, where you will find detailed instructions on how to use the tool. If you encounter any issues or have any questions when using PACE, please email PLOS at\u00a0figures@plos.org. Please note that Supporting Information files do not need this step.While revising your submission, please upload your figure files to the Preflight Analysis and Conversion Engine (PACE) digital diagnostic tool,\u00a0AttachmentManuscript_commented.docxSubmitted filename: Click here for additional data file. 3 Nov 2022Response to the Review TeamReviewer Comment Response1. The title should be self-explanatory and need to specify the place of the study. The title is not in line with the stated objective i.e. at least the relationship between social factors and COVID-19 protective behaviours is missing from the title. Response: We appreciate the reviewer\u2019s feedback on how to improve the original title. Based on the provided feedback we have revised the original title \u201cSocial factors associated with college students' depression and stress during the COVID-19 pandemic: A cross-sectional study\u201d to the title listed below.New title: The association between social factors and COVID-19 protective behaviors and depression and stress among midwestern US college studentsPage 1, lines 4-5 2. The abstract did not follow the journal guideline showing introduction, method, result and conclusion. In addition, there is not any effect size reported in the abstract. As it stands now, it is wordy and includes unnecessary details. Response: We thank the reviewer for the comment regarding the structure for the abstract. Upon reviewing the PLOS ONE journal submission guidelines as well as the most recently published articles, our take on PLOS ONE\u2019s guideline for the abstract format is that the abstract is unstructured. However, as per your request we have revised the abstract to a structured format showing the purpose, methods, results, and conclusions as follows.Purpose: The aim of this cross-sectional study was to examine the relationship between social factors and COVID-19 protective behaviors and two outcomes: depressive and perceived stress symptoms. Methods: In September 2020, 1,064 randomly selected undergraduate students from a large midwestern university completed an online survey and provided information on demographics, social activities, COVID-19 protective behaviors , and mental health symptoms. Mental health symptoms were measured using the Center for Epidemiological Studies Depression-10 questionnaire for depression and the Perceived Stress Scale-10 for stress symptoms. Results: The results showed respondents who were males and also the respondents who were \u201changing out\u201d with more people while drinking alcohol reported significantly lower depressive symptoms and lower stress symptoms. On the contrary, staying home from work or school \u201cvery often\u201d was associated with higher stress symptoms, compared with \u201cnever/rarely\u201d staying home from work/school. Similarly, having a job with in-person interaction was also associated with increased stress. Conclusions: These findings suggest that lack of social engagement was associated with depression and stress symptoms among college students during the COVID-19 pandemic. Planning social activities that align with recommended safety precautions, as well as meet students\u2019 social needs, should be an important priority for higher education institutions.Page 2, lines 28-46 3. The background section is not focused, and it does not show what were known, what were unknown and the need for the study, justification was shallow and not well developed. Response: We have re-organized the introduction to show what is known from pages 3-4 lines 52 to 94, what is unknown on page 5 lines 95 to 104, and the need for the study from lines 105 to 110. 4. The authors have mentioned that the tools used were validated. Where were the tools validated? The cited references showed that the validation is somewhere else. Tools should be validated in the country where they are used for data collection. Otherwise there might be still cross-cultural differences and the use of non-validated tool should be mentioned as limitation. Response: Thank you for the comment regarding the location of the population for the validation studies. The references have been updated accordingly to show that the original CES-D 20 has been previously validated with young adults and college students who are age 18-25 located within the United States. \u201cThe CES-D-20 has been validated on young adults and college students ages 18-25 [34].\u201dPage 7, lines 148-149As for the PSS-10, reference #35 is the validation study for the scale using US college students that showed it was a valid and reliable measure of perceived stress.Page 7, line 155Reference #35: Cohen S, Kamarck T, Mermelstein R. A Global Measure of Perceived Stress. J Health Soc Behav. 1983;24(4):385-96.5. Where is the sample size calculation. as it stands now it seems that authors have approached students who were planned for COVID-19 antibody test were asked to participate in the survey. This may have its own impact in the generalizability. Detail information on how they were initially recruited for that study must be at least cited. Response: We thank the reviewer for their question regarding the sample size calculation. We have updated the text found in the methods-data analysis section clarifying that the sample size calculation for the parent RCT study was calculated based on the parent study aims; however, there was no sample size calculation conducted for this current study\u2019s analysis of the baseline survey data.Text now reads: \u201cThe sample size calculation for the parent RCT study was calculated for the parent study aims [29]; however, there was no sample size calculation conducted for this current study\u2019s analysis of the baseline survey data.\u201dPage 9, lines 196 - 1996. The study seems outdated as the data is collected in 2020. While the COVID-19 pandemic is the very pressing issue until now, there are several evidence on mental health impacts among different segments of population including students. The importance of this study should be clearly justified. Response: We appreciate the reviewer\u2019s comment regarding the age of the data. Yes, we acknowledge that the data is from two years ago. However, as the pandemic is still ongoing and there is always a risk for a future pandemic, the insights learned from the time of this study are still relevant for our current situation as well as important for future events. Although there are many studies that have focused on mental health problems among students, few have focused on the relationship between the social factors and COVID-19 protective behaviors  and the mental health of university students. We have revised the sentences in the introduction and discussion to delineate the contribution of our study to existing literature.Revised statement in the introduction: \u201cThere is a need for this research because the pandemic is still ongoing, and we continue to be at risk for future pandemics. Although there is substantial existing literature on mental health and college students, there is a research gap around sociodemographic and behavioral activities and their relationship with students\u2019 mental health during the pandemic context. This knowledge is valuable to support university efforts focused on improving the mental health of college students.\u201dPage 5, lines 105-110Revised statement in the discussion: \u201cOur study contributes to the existing mental health and COVID-19 among college student literature by identifying a negative relationship between the recommended refrain of social activities and protective behaviors and two mental health outcomes: depression and stress during a time when the requirements were no longer as strongly enforced.\u201d Page 20-21, lines 366-3707. Authors have dichotomized the depressive symptoms outcome but used as it is for stress symptoms. What was the reason to go for dichotomizing in the analysis of factors for depressive symptoms? Response: Thanks for highlighting this question. In the text, we added these clarifying sentences:The new text for CES-D-10 reads: \u201cBased on previous literature , the cut-off point of 10 was used for the CES-D-10 to identify clinically significant depressive symptoms\u2026\u201dPage 7, lines 145-147The new text for PSS-10 \u201cThe PSS-10 scores are categorized for descriptive purposes and do not translate into clinical diagnostic significance [37]\u201dPage 8, lines 161-1628. Authors mentioned that they have used random sampling as a strength, which specific type of random sampling did they use? Response: We thank the reviewer for their inquiry on the specific type of random sampling used by the office that provided the random sample of potential students. Based on your feedback we have updated the text to state it was simple random sampling. \u201cUndergraduate students at a large midwestern university were randomly sampled to participate in a parent SARS-CoV-2 antibody study during the fall 2020 semester using simple random sampling [30].\u201dPage 6, line 130-1339. What were the implications? The discussion seems straight jacketed, and it seems the repetition of the result section as it stands now.Response: Based on the reviewer\u2019s feedback, we updated the discussion section by removing repetitive text from the results section and further elaborated on the significance and explanation of the findings within the discussion section. \u201cThis finding is significant because as universities make efforts to protect their students, there are limitations to those efforts such as the workplace that falls outside of their jurisdiction. Possible recommendations include outreach programs dedicated to providing behavioral health, financial, and academic support to the students who are employed in client-facing jobs.\u201dPage 18, lines 313-317And\u201cThe findings of this current study may have some implications for future university public health communications and prevention efforts. Universities need to provide opportunities for social interaction that maintain safety from infectious disease transmission. For example, this may include hosting social activities in an outdoor space where students can maintain a safe distance from each other while interacting with one another, rather than staying in their dorm or apartment in social isolation. This may also include establishing peer support groups that regularly meet and provide each other with guidance on how to safely socialize. Our study contributes to the existing mental health and COVID-19 among college student literature by identifying a negative relationship between the recommended refrain of social activities and protective behaviors and two mental health outcomes: depression and stress during a time when the requirements were no longer as strongly enforced.\u201d Page 20, lines 360-37010. The discussion lacks recommendation based on the results. Response: Thank you to the reviewer for their comment. Based on the comment, we have added a paragraph on recommendations for future research right before the conclusion section.\u201cFuture research could further investigate the relationship between these social factors, COVID-19 protective behaviors, and the mental health of students who, now years into the pandemic, have continued to refrain from social activities. Furthermore, additional research could review university pandemic incident response plans and the available support systems and existing interventions aimed at preventing depression and stress.\u201dPage 21, lines 371-37511. Authors have mentioned that they have paid up to $30 per questionnaire, introducing financial issues in survey participation has its own problem. Please comment on this. Response: We agree with the reviewer that it is important to be transparent about participant compensation and thoughtful about any undue influence this compensation might introduce. The total possible participant incentive for the longitudinal parent study was $30, with partial payments for completing partial study procedures. This compensation amount and structure was developed to reflect the time and energy involved in responding to six survey waves, and two rounds of SARS-CoV-2 antibody testing with fingerpricks. It was also reviewed and approved by our Office of Human Subjects.We have updated the text to clarify that $30 was the total possible compensation for all the study procedures from the longitudinal parent study. We now note that the compensation for the study procedures giving rise to the baseline data used in this study was $10. We hope this alleviates concerns that we might have been overcompensating participants for a single survey.New text found under the Materials and methods -study design section: \u201cParticipants received up to $30 for completing all the parent study activities, from which they would have received $10 for completing the baseline survey information used in this study.\u201dPage 6, lines 121-12312. \"Keywords should be written in alphabetical order. The use of mental health as keyword do not add any information as the mental health symptoms dealt with were only depressive symptoms and perceived stress. Response: We appreciate the reviewer\u2019s comment about excluding mental health from the list of keywords. As suggested, we removed the term \u201cmental health\u201d from the list and the remaining keywords are in alphabetical order. As our fourth key word, we added \u201cuniversity students\u201d to account for the population our study focuses on. Page 2, line 4813. Background lines 79-80, needs citation Response: Thank you to the reviewer for highlighting the need for a reference. To support the statement, \u201cThese reductions in substance use could be suggestive of fewer opportunities for social gatherings among students as a result of COVID-19 prevention policies,\u201d we have now cited the following reference: Layman HM, Thorisdottir IE, Halldorsdottir T, Sigfusdottir ID, Allegrante JP, Kristjansson AL. Substance Use Among Youth During the COVID-19 Pandemic: a Systematic Review. Curr Psychiatry Rep. 2022;24(6):307-24.doi: 10.1007/s11920-022-01338-zPage 4, lines 78-8014. Objectives lines 100-103, is not objective it should be moved to introduction section. In addition there are several studies on mental health problems among students all over the globe. We have revised and relocated the sentences  originally found at the start of the objectives to the end of the background section . As for the second portion of the comment, we have addressed it in an earlier mention of the comment above at comment #6. We have pasted it below for quick review:Although there are many studies that have focused on mental health problems among students, few have focused on the relationship between the social factors and COVID-19 protective behaviors  and the mental health of university students. We have revised the sentences in the introduction and discussion to delineate the contribution of our study to existing literature.Revised statement in the introduction: \u201cThere is a need for this research because the pandemic is still ongoing, and we continue to be at risk for future pandemics. Although there is substantial existing literature on mental health and college students, there is a research gap around sociodemographic and behavioral activities and their relationship with students\u2019 mental health during the pandemic context. This knowledge is valuable to support university efforts focused on improving the mental health of college students.\u201dPage 5, lines 105-11015. Lines 216 to 217 is incomplete sentence. Response: We have gone ahead and revised the sentence to improve readability. It now reads as, \u201cIn contrast, the number of people the students \u201chung out\u201d with while drinking alcohol was negatively associated with depressive symptoms.\u201dPage 15, lines 235-236 16. Line 265 \u201ckey results\u201d is unnecessary sub heading, check journal guideline. Response: As per the reviewer\u2019s preference, we removed the \u201ckey results\u201d header we originally had in the discussion section.17. Line 275 to 276 repeating the objective once again in the discussion section is meaningless. We agree with the reviewer and have now removed the text highlighting the objective that we had in the discussion section.18. Several limitations have been mixed up with the strength of the study section in the discussion. Response: We appreciate the reviewer\u2019s comment regarding the current organization of the limitations section. We have re-organized the text by moving up the limitations that previously followed the strengths mentioned: Another limitation of this study was the use of self-reported data collected via an online survey instrument. There is a possibility of bias due to under-reporting for some of our key selected variables. For instance, due to the legal age of tobacco and nicotine products having been raised to 21 matching the legal age of consumption for alcohol, there may have been some under-reporting of substance use of individuals between age 18 and 20 [40]. However, self-response surveys for nicotine use and mental health symptoms are conventional for this type of research . Further, an additional limitation of our cross-sectional design of the study is the inability to capture the fluidity of mental health symptoms. Lastly, unlike in the Charles et al. study [26], there were no pre-pandemic matched mental health scores to compare changes in symptoms among our sample. During the regular college experience, college students experience a breadth of challenges, whether personal, academic, financial, or otherwise. The COVID-19 pandemic worsened some of those existing challenges and introduced new ones. Having conducted this study at the start of the Fall 2020 academic semester, as students returned from an all-online curriculum to a hybrid learning mode, is not representative of all the different stages of the pandemic. However, it offers some insight into students\u2019 mental health and well-being for future public health crises.Pages 19-20, lines 337-35319. Tables should be named appropriately i.e. play and year has to be mentioned. Response: We thank the reviewer\u2019s feedback regarding the titles used for Tables 1 and 2. As per their feedback we have updated the title for Table 1 to include Fall 2020 and the title for Table 2 to mention university students from a midwestern US university and the time Fall 2020. Table 1Original title: Table 1. Depressive Symptoms and Perceived Stress Scores in a Sample of Undergraduate Students from a Midwestern UniversityNew title: Table 1. Depressive Symptoms and Perceived Stress Scores in a Sample of Undergraduate Students from a Midwestern US University, Fall 2020Page 11Table 2Original title: Table 2. Results for Logistic Regression for Depressive Symptoms (CES-D-10) and Linear Regression for Stress Symptoms (PSS) by Predictors (95% CI)New title: Table 2. Results for Logistic Regression for Depressive Symptoms (CES-D-10) and Linear Regression for Stress Symptoms (PSS) by Predictors (95% CI), Undergraduate Students from a Midwestern US University, Fall 2020 Page 1320. Reviewer #2: This paper is very interesting and easy to read. However, I recommend to improve the discussion and conclusion sections. The discussion should be in-depth and contains not only summaries of research results, but above all their significance and implications for university practice Response: We thank Reviewer #2 for the feedback and suggestions. We have addressed a similar comment above under Reviewer #1\u2019s comment #9. For quick reference, we have copied and pasted the response below:The findings of this current study may have some implications for future university public health communications and prevention efforts. Universities need to provide opportunities for social interaction that maintain safety from infectious disease transmission. For example, this may include hosting social activities in an outdoor space where students can maintain a safe distance from each other while interacting with one another, rather than staying in their dorm or apartment in social isolation. This may also include establishing peer support groups that regularly meet and provide each other with guidance on how to safely socialize. Our study contributes to the existing mental health and COVID-19 among college student literature by identifying a negative relationship between the recommended refrain of social activities and protective behaviors and two mental health outcomes: depression and stress during a time when the requirements were no longer as strongly enforced. Future research could further investigate the relationship between these social factors, COVID-19 protective behaviors, and the mental health of students who, now years into the pandemic, have continued to refrain from social activities. Furthermore, additional research could review university pandemic incident response plans and the available support systems and existing interventions aimed at preventing depression and stress.Page 20-21, lines 360-377Additional Journal Requirements 21. Please ensure that your manuscript meets PLOS ONE's style requirements, including those for file naming. The PLOS ONE style templates can be found at https://journals.plos.org/plosone/s/file?id=wjVg/PLOSOne_formatting_sample_main_body.pdfand https://journals.plos.org/plosone/s/file?id=ba62/PLOSOne_formatting_sample_title_authors_affiliations.pdf. Response: We have reviewed the PLOS ONE style requirements and file naming and have ensured that the manuscript and file names meet the requirements.22. Please state the full name of the Institutional Review Board that approved your study. Response: We updated the Methods-study design section in the manuscript to state the full name of the Institutional Review Board to now include \u201cIndiana University Human Subjects Office.\u201d23. You indicated that you had ethical approval for your study. In your Methods section, please ensure you have also stated whether you obtained consent from parents or guardians of the minors included in the study or whether the research ethics committee or IRB specifically waived the need for their consent. Response: There were no minors included in this study. To be eligible, all participants had to meet the minimum age requirement of 18. Therefore, since minors were not eligible, we did not include any text on obtaining consent from parents or guardians for minors.http://journals.plos.org/plosone/s/data-availability.24. In your Data Availability statement, you have not specified where the minimal data set underlying the results described in your manuscript can be found. PLOS defines a study's minimal data set as the underlying data used to reach the conclusions drawn in the manuscript and any additional data required to replicate the reported study findings in their entirety. All PLOS journals require that the minimal data set be made fully available. For more information about our data policy, please see http://journals.plos.org/plosone/s/data-availability#loc-recommended-repositories. Any potentially identifying patient information must be fully anonymized.\"Upon re-submitting your revised manuscript, please upload your study\u2019s minimal underlying data set as either Supporting Information files or to a stable, public repository and include the relevant URLs, DOIs, or accession numbers within your revised cover letter. For a list of acceptable repositories, please see http://journals.plos.org/plosone/s/data-availability#loc-unacceptable-data-access-restrictions. Note that it is not acceptable for the authors to be the sole named individuals responsible for ensuring data access.Important: If there are ethical or legal restrictions to sharing your data publicly, please explain these restrictions in detail. Please see our guidelines for more information on what we consider unacceptable restrictions to publicly sharing data: We will update your Data Availability statement to reflect the information you provide in your cover letter. Response: We provide the minimal data set underlying the results described in the manuscript as a supplemental document (Excel file).25. Your ethics statement should only appear in the Methods section of your manuscript. If your ethics statement is written in any section besides the Methods, please delete it from any other section. Response: We removed the ethics statement from the of the manuscript and now it is found only in the Methods section.AttachmentResponse to Reviewers.docxSubmitted filename: Click here for additional data file. 6 Dec 2022The association between social factors and COVID-19 protective behaviors and depression and stress among midwestern US college studentsPONE-D-22-20107R1Dear Dr. Garcia Colato,We\u2019re pleased to inform you that your manuscript has been judged scientifically suitable for publication and will be formally accepted for publication once it meets all outstanding technical requirements.Within one week, you\u2019ll receive an e-mail detailing the required amendments. When these have been addressed, you\u2019ll receive a formal acceptance letter and your manuscript will be scheduled for publication.http://www.editorialmanager.com/pone/, click the 'Update My Information' link at the top of the page, and double check that your user information is up-to-date. If you have any billing related questions, please contact our Author Billing department directly at authorbilling@plos.org.An invoice for payment will follow shortly after the formal acceptance. To ensure an efficient process, please log into Editorial Manager at onepress@plos.org.If your institution or institutions have a press office, please notify them about your upcoming paper to help maximize its impact. If they\u2019ll be preparing press materials, please inform our press team as soon as possible -- no later than 48 hours after receiving the formal acceptance. Your manuscript will remain under strict press embargo until 2 pm Eastern Time on the date of publication. For more information, please contact Kind regards,Michio MurakamiAcademic EditorPLOS ONEAdditional Editor Comments :Reviewers' comments:Reviewer's Responses to Questions <font color=\"black\"> Comments to the Author </font> 1. If the authors have adequately addressed your comments raised in a previous round of review and you feel that this manuscript is now acceptable for publication, you may indicate that here to bypass the \u201cComments to the Author\u201d section, enter your conflict of interest statement in the \u201cConfidential to Editor\u201d section, and submit your \"Accept\" recommendation.Reviewer #1:\u00a0All comments have been addressed********** <font color=\"black\"> 2. Is the manuscript technically sound, and do the data support the conclusions? </font> The manuscript must describe a technically sound piece of scientific research with data that supports the conclusions. Experiments must have been conducted rigorously, with appropriate controls, replication, and sample sizes. The conclusions must be drawn appropriately based on the data presented. Reviewer #1:\u00a0Yes********** <font color=\"black\"> 3. Has the statistical analysis been performed appropriately and rigorously?  </font> Reviewer #1:\u00a0Yes********** <font color=\"black\"> 4. Have the authors made all data underlying the findings in their manuscript fully available?PLOS Data policy requires authors to make all data underlying the findings described in their manuscript fully available without restriction, with rare exception (please refer to the Data Availability Statement in the manuscript PDF file). The data should be provided as part of the manuscript or its supporting information, or deposited to a public repository. For example, in addition to summary statistics, the data points behind means, medians and variance measures should be available. If there are restrictions on publicly sharing data\u2014e.g. participant privacy or use of data from a third party\u2014those must be specified. </font> The Reviewer #1:\u00a0Yes********** <font color=\"black\"> 5. Is the manuscript presented in an intelligible fashion and written in standard English? </font> PLOS ONE does not copyedit accepted manuscripts, so the language in submitted articles must be clear, correct, and unambiguous. Any typographical or grammatical errors should be corrected at revision, so please note any specific errors here.Reviewer #1:\u00a0Yes********** <font color=\"black\"> 6. Review Comments to the Author </font> Please use the space provided to explain your answers to the questions above. You may also include additional comments for the author, including concerns about dual publication, research ethics, or publication ethics. Reviewer #1:\u00a0(No Response)********** <font color=\"black\"> 7. PLOS authors have the option to publish the peer review history of their article (what does this mean?). If published, this will include your full peer review and any attached files.If you choose \u201cno\u201d, your identity will remain anonymous but your review may still be made public.Do you want your identity to be public for this peer review? For information about this choice, including consent withdrawal, please see our Privacy Policy. </font> Yes:\u00a0Henok Dagne DersoReviewer #1:\u00a0********** 12 Dec 2022PONE-D-22-20107R1 The association between social factors and COVID-19 protective behaviors and depression and stress among midwestern US college students Dear Dr. Garcia Colato:I'm pleased to inform you that your manuscript has been deemed suitable for publication in PLOS ONE. Congratulations! Your manuscript is now with our production department. onepress@plos.org.If your institution or institutions have a press office, please let them know about your upcoming paper now to help maximize its impact. If they'll be preparing press materials, please inform our press team within the next 48 hours. Your manuscript will remain under strict press embargo until 2 pm Eastern Time on the date of publication. For more information please contact plosone@plos.org. If we can help with anything else, please email us at Thank you for submitting your work to PLOS ONE and supporting open access. Kind regards, PLOS ONE Editorial Office Staffon behalf ofDr. Michio Murakami Academic EditorPLOS ONE"}
+{"text": "This systematic review aims to review research manuscripts during the COVID-19 pandemic that focus on the relationship between self-efficacy, adversity quotient, COVID-19-related stress and academic performance on a range of undergraduate student.The authors will perform comprehensive searches of published studies in electronic databases such as PMC, PubMed, Scopus, Cochrane Library and Web of Science by using the following search terms: \u2018self-efficacy\u2019 AND \u2018adversity quotient\u2019 AND \u2018stress\u2019 AND \u2018academic performance\u2019 AND \u2018student\u2019 AND \u2018COVID-19 pandemic\u2019. Only full-text articles in English language are included. Two reviewers will independently conduct the article selection, data extraction, and quality assessment. Any possible disagreement will be resolved by discussion, and one arbitrator (NA) will adjudicate unresolved disagreements.This review will provide an updated overview of investigating the relationship between self-efficacy, adversity quotient, COVID-19-related stress and academic performance on a range of undergraduate student during the COVID-19 pandemic. Ultimately, based on this systematic review, we will recommend the direction for future research.The result of the study may help the researchers to find an updated overview of various studies in related topic.Data from published studies will be used. Therefore, ethical approval is not required prior to this systematic review. The results will be published in a peer-reviewed journal. Generally, stress refers to a person\u2019s physical or emotional response to the demands or pressures of daily life . Stress According to Gunawati, and Listiara , factorsDuring the COVID-19 outbreak, a population-based survey showed post-crisis mental health among the students . From thIn most cases, the literature has documented the negative influence of COVID-19 pandemic on the first-year undergraduate students\u2019 stress to academic. For instance, Sundarasen et al.  investigAccording to Son, Hegde, Smith, Wang, and Sasangohar , there wCOVID-19 outbreak may enhance fear among the students such as their own health and their loved ones. They were worried about the family and relatives who were more susceptible to the virus such as older adults, those who have existing severe health problems, pregnant women, and women who have just gave birth. Students were also concerned about their family whose jobs increased the risk of exposure to COVID-19 such as social and health care workers.There are various changes in terms of educational approaches which potentially lead to difficulty in concentrating on academic work. Son et al.  found thStudents reported that their sleep patterns were disrupted due to COVID-19 pandemic. Further, they mostly stated that they tended to stay up later or wake up later they did before the pandemic. It could be associated with the need to be having online meeting through online platforms which could be carried out anytime and anywhere. Another irritative impact brought by the COVID-19 pandemic was irregular sleep patterns such as inconsistent time to go to bed and to wake up from day to day.Son et al.  stated tFurthermore, in 2020, Son et al.  found thMajority of students revealed their concerns about the financial situations which were impacted by COVID-19. Some students stated that COVID-19 has affected employment opportunities such as part-time jobs and internships. Others expressed the financial difficulties of their family members, mostly parents, who got laid off and got pay cut during the pandemic.Regarding the impact of the COVID-19 pandemic, the study by Son et al. Reviewers' comments:Reviewer's Responses to Questions <font color=\"black\"> Comments to the Author1. Does the manuscript provide a valid rationale for the proposed study, with clearly identified and justified research questions? </font> The research question outlined is expected to address a valid academic problem or topic and contribute to the base of knowledge in the field.Reviewer #1:\u00a0YesReviewer #2:\u00a0Yes********** <font color=\"black\"> 2. Is the protocol technically sound and planned in a manner that will lead to a meaningful outcome and allow testing the stated hypotheses? </font> The manuscript should describe the methods in sufficient detail to prevent undisclosed flexibility in the experimental procedure or analysis pipeline, including sufficient outcome-neutral conditions  to test the proposed hypotheses and a statistical power analysis where applicable. As there may be aspects of the methodology and analysis which can only be refined once the work is undertaken, authors should outline potential assumptions and explicitly describe what aspects of the proposed analyses, if any, are exploratory.Reviewer #1:\u00a0YesReviewer #2:\u00a0Yes********** <font color=\"black\"> 3. Is the methodology feasible and described in sufficient detail to allow the work to be replicable? </font> Descriptions of methods and materials in the protocol should be reported in sufficient detail for another researcher to reproduce all experiments and analyses. The protocol should describe the appropriate controls, sample size calculations, and replication needed to ensure that the data are robust and reproducible.Reviewer #1:\u00a0YesReviewer #2:\u00a0Yes********** <font color=\"black\"> 4. Have the authors described where all data underlying the findings will be made available when the study is complete?PLOS Data policy requires authors to make all data underlying the findings described in their manuscript fully available without restriction, with rare exception, at the time of publication. The data should be provided as part of the manuscript or its supporting information, or deposited to a public repository. For example, in addition to summary statistics, the data points behind means, medians and variance measures should be available. If there are restrictions on publicly sharing data\u2014e.g. participant privacy or use of data from a third party\u2014those must be specified. </font> The Reviewer #1:\u00a0YesReviewer #2:\u00a0No********** <font color=\"black\"> 5. Is the manuscript presented in an intelligible fashion and written in standard English? </font> PLOS ONE does not copyedit accepted manuscripts, so the language in submitted articles must be clear, correct, and unambiguous. Any typographical or grammatical errors should be corrected at revision, so please note any specific errors here.Reviewer #1:\u00a0YesReviewer #2:\u00a0Yes********** <font color=\"black\"> 6. Review Comments to the AuthorPlease use the space provided to explain your answers to the questions above and, if applicable, provide comments about issues authors must address before this protocol can be accepted for publication. You may also include additional comments for the author, including concerns about research or publication ethics.You may also provide optional suggestions and comments to authors that they might find helpful in planning their study. </font> Reviewer #1:\u00a0Your study is quite reasonable, intellectual and informative but in this review article many time every statement or heading start with \" This review article\" , so instead of this statement use suitable word. overall this manuscript is acceptedReviewer #2:\u00a01. Include Cochrane library in Information source2. Include months with years in Information source3. Please provide details list of keywords with Boolean expression4. Please provide detail and separate heading of data extraction methods.5.Please cite literature properly where necessary such as a systematic narrative synthesis. Cite reference.6. Please provide operational definition of variables.7.Please explain or define what does undergraduate students means? Detail operational information is mandatory.8. Justify tool using for Bias assessment? Please add Cochrane bias tool or some more tool and compare your findings in actual study.9. Please discuss the methodology of your proposed study and mention under the heading of discussion?10. What will be expected limitation of the study?********** <font color=\"black\"> 7. PLOS authors have the option to publish the peer review history of their article (what does this mean?). If published, this will include your full peer review and any attached files.If you choose \u201cno\u201d, your identity will remain anonymous but your review may still be made public.Do you want your identity to be public for this peer review? For information about this choice, including consent withdrawal, please see our Privacy Policy. </font> Reviewer #1:\u00a0NoYes:\u00a0Saima NisarReviewer #2:\u00a0**********https://pacev2.apexcovantage.com/. PACE helps ensure that figures meet PLOS requirements. To use PACE, you must first register as a user. Registration is free. Then, login and navigate to the UPLOAD tab, where you will find detailed instructions on how to use the tool. If you encounter any issues or have any questions when using PACE, please email PLOS at\u00a0figures@plos.org. Please note that Supporting Information files do not need this step.While revising your submission, please upload your figure files to the Preflight Analysis and Conversion Engine (PACE) digital diagnostic tool,\u00a0 14 Sep 2022Journal Requirements:1. Please ensure that your manuscript meets PLOS ONE's style requirements, including those for file naming.File naming was edited to comply with the style requirements. 2. PLOS ONE does not copy edit accepted manuscripts.The manuscript has been submitted for proofreading by an English language expert.3. Please amend either the title on the online submission form (via Edit Submission) or the title in the manuscript so that they are identical.The title in the submission form has been revised as follow (please refer to the page 1)The revised title: Relationship between self-efficacy, adversity quotient, covid-19-related stress and academic performance among the undergraduate students: a protocol for a systematic review.4. Please include captions for your Supporting Information files at the end of your manuscript, and update any in-text citations to match accordingly.The captions for Supporting Information are amended. The changes are described on lines 414-415.\u201cS1 Fig. PRISMA Flow Chart.\u201d\u201cS1 Table. PRISMA-P Checklist.\u201d5. Thank you for submitting the above manuscript to PLOS ONE. During our internal evaluation of the manuscript, we found significant text overlap between your submission and the following previously published works.The sentences were rephrased. The revision could be found on lines 57-60 and 153-157.Insertion:57-60: Indeed, The United Nations Educational, Scientific and Cultural Organization (UNESCO) reported that in consequence of the massive universities\u2019 closure, the scheduled activities and student\u2019s accommodations were suspended, all interactions were shifted to online platforms, leading to a major change in students\u2019 academic life [5].154-158: Oboth and Odiemo [12] found that that only 35.6% of students experiencing low level of stress while the rest 64.4% were experiencing moderate to high levels of stress. The result showed that stress level and academic performance had a significant relationship within age and gender groups. Regression analysis showed that the higher the level of stress, the lower the academic performance among the students.Academic Editor:1. Please provide background of the study.The background was provided on lines 44-71.Revision:Generally, stress refers to a person\u2019s physical or emotional response to the demands or pressures of daily life [1]. Stress among students could be associated to various factors such as individual factors and environmental factors. The example of individual factors are physical condition, motivation, and personality type of the students themselves. In addition, environmental factors cover several aspects such as family, work, facilities, environment, lecturers, and others [2].According to Gunawati, and Listiara [3], factors related to stress among students are namely internal factors and external factors. The internal factors include mindset, personality, and beliefs meanwhile the external factors cover heavy lessons workloads, pressure to achieve high academic excellence, social status encouragement, and parent competition with each other.During the COVID-19 outbreak, a population-based survey showed post-crisis mental health among the students [4]. From this perspective, the academic context was a\ufb00ected by the lockdown worldwide. Indeed, The United Nations Educational, Scientific and Cultural Organization (UNESCO) reported that in consequence of the massive universities\u2019 closure, the scheduled activities and student\u2019s accommodations were suspended, all interactions were shifted to online platforms, leading to a major change in students\u2019 academic life [5].In most cases, the literature has documented the negative influence of COVID-19 pandemic on the first-year undergraduate students\u2019 stress to academic. For instance, Sundarasen et al. [6] investigated the psychological impact of COVID-19 pandemic on university students in Malaysia. The stress was measured by using Zung\u2019s [7] self-rating anxiety scale (SAS). Out of 359 first-year undergraduate students studied, 93.6% reported low stress, 3.9% reported moderate stress, and 2.5% reported high stress. Furthermore, similar study was conducted by Putri and Ariana in Indonesian context where the stress level was measured by Student-life Stress Inventory [8]. The stress level was measured by using Student-life Stress Inventory. The Findings show that out of 252 first-year undergraduate students studied, 110 of them (43.6%) reported low stress, 89 respondents reported moderate stress (35.3%), and 53 respondents (21%) reported high stress.2. Please provide a theoretical foundation of the study.The literature review was provided on lines 72-124.Revision:According to Son, Hegde, Smith, Wang, Sasangohar [9], there were stressors which affected the academic\u2019s life among students during COVID-19 pandemic. These are their own health and the health of loved ones, difficulty in concentration, sleeping habits, social relation/social isolation, academic performance, financial difficulties, depressive thoughts, suicidal thoughts. COVID-19 outbreak may enhance fear among the students such as their own health and their loved ones. They were worried about the family and relatives who were more susceptible to the virus such as older adults, those who have existing severe health problems, pregnant women, and women who have just gave birth. Students were also concerned about their family whose jobs increased the risk of exposure to COVID-19 such as social and health care workers. There are various changes in terms of educational approaches which potentially lead to difficulty in concentrating on academic work. Son et al. [9] found that most of the students  stated that their home is distractive. For them, home is more appropriate place to than to study . In fact, students were easier to be bothered by their family members at home. Other factors influencing students\u2019 concentration were social media, internet, and video games . Some students  mentioned that online classes were subject to diversion due to social interaction deficiency and continuous attention to computer screen. In addition, monotone life patterns mentioned by some students could negatively affect concentration on academic work .Students reported that their sleep patterns were disrupted due to COVID-19 pandemic. Further, they mostly stated that they tended to stay up later or wake up later they did before the pandemic. It could be associated with the need to be having online meeting through online platforms which could be carried out anytime and anywhere. Another irritative impact brought by the COVID-19 pandemic was irregular sleep patterns such as inconsistent time to go to bed and to wake up from day to day.Son et al. [9] stated that most students  answered that the COVID-19 pandemic increased the social isolation. Over half of students  stated that it limited their interactions with friends significantly. Some students  stated that they worried about a lack of in-person interactions. Others  mentioned that disturbance to their outdoor activities have affected their mental health.Furthermore, Son et al. [9] found that majority of students  concerned on their academic performance impacted by the COVID-19 pandemic. Fear of lower performance and delay in completion of studies are also the reasons to induce stress among students during COVID-19. The biggest challenge was the transition to classes through online platforms . In particular, students concerned on sudden changes in the syllabus, the quality of the classes, technical issues with online applications, and the difficulty of online learning. Some students  worried about progress in research and class projects because of social restrictions to keep social distancing and the lack of physical interactions with other students. Others  stated the uncertainty about their grades on the learning through online platforms to be a major stressor. In addition, others  indicated their lower motivation to learn and tendency to procrastinate.Majority of students revealed their concerns about the financial situations which were impacted by COVID-19. Some students stated that COVID-19 has affected employment opportunities such as part-time jobs and internships. Others expressed the financial difficulties of their family members, mostly parents, who got laid off and got pay cut during the pandemic.Regarding the impact of the COVID-19 pandemic, the study by Son et al. [9] found that 44% of students mentioned that they were having some depressive thoughts. Most students attributed the depressive thoughts to factors such as loneliness (33%), insecurity (12%), hopelessness (10%), academic performance concerns (8%), and overthinking (5%).Out of 195 students, 16 students revealed that the pandemic led to suicidal thoughts with 5% experiencing these thoughts as low level and 3% as moderate level. The reasons were dealing to academic performance, problems with family as they returned home, and fear of insecurity and uncertainty.3. Please provide a literature review of the study. The literature review was provided on lines 125-195.Revision:Lazarus and Folkman [10] defined that psychological stress is a relationship between an individual and the environment which is valued by the way people exceed their sources and endanger their well-being. This relationship is going through two significant phases that are cognitive appraisals and coping. The cognitive appraisal is defined as \u201cthe process of categorizing an encounter, and its various facets, with respect to its significance for well-being\u201d . Furthermore, cognitive appraisal covers primary appraisal and secondary appraisal. Primary appraisal manages to answer \u201cAm I trouble or being benefited, now or in the future, and in what ways?\u201d. When people answer \u201cyes\u201d, it means that the situation can be classified as threat, challenge or loss. Loss suggests harms occurred meanwhile threat and challenge can be meant past experiences. Threat refers to physical and psychological potential while challenge means that someone\u2019s concern on his achievement, reward, and growth; however, this threat and challenge are not correspondent with. Lazarus and Folkman [10] mentioned that threat and challenge appraisals are not two ends of a single continuum. For example, Folkman and Lazarus [10] showed that students waiting for an exam evaluate it as threatening and challenging event. Secondary appraisal refers to an assessment of coping resources. It has an attempt to answer \u201cCan I cope with this situation?\u201d. It reflects someone\u2019s ability to deal with the situation because one has the resources .Lazarus and Folkman [10] proposed that coping has two main functions. First is to regulate emotions or distresses in the stressful situation (emotion-focused coping). The second one is to manage the problem causing the stress by directly changing the elements of the stressful encounter (problem-focused coping). Even though both are used in most stressful situation, they are nevertheless dependent in terms of the way one appraises the situation and of the antecedents of the model. Students who experience stressful conditions will have a negative impact on the performance. For instance, when the students experience prolong stress, the stress may affect their academic achievement and lead into loss of enthusiasm which could be associated with low GPA [11].Oboth and Odiemo [12] found that that only 35.6% of students experiencing low level of stress while the rest 64.4% were experiencing moderate to high levels of stress. The result showed that stress level and academic performance had a significant relationship. Regression analysis showed that the higher the level of stress, the lower the academic performance among the students. This finding is consistent with other studies which were conducted in Malaysia and Indonesia. In Malaysia, Elias, Ping, Abdullah [13] study which was conducted at Universiti Putra Malaysia, revealed that stress is shown to be significantly correlated to academic performance. On the other hand, in Indonesia, in Tumonggor, Sutanti, Evan, Winata [14] study which was conducted among the students of Krida Wacana Christian University class of 2017 to 2019 during the COVID-19 pandemic, shown that there is a relationship between stress and student\u2019s academic performance.Furthermore, to define protective factors of stress among the students, some studies were initiated. Majority of researches investigated the relationship between self-efficacy and adversity quotient. Somaratne, Jayawardena, Perera [15] found that level of adversity quotient was significantly related to the level of stress indicating that the higher level of adversity quotient, the lower level of stress. By using Pearson Product-Moment correlation analysis, the results showed that there was a strong negative relationship between perceived stress and all the sub-dimensions of AQ . By having higher levels of control sub-dimensions, students could be proactively dealing with adverse events and are competent to turn obstacles into opportunity. The negative relationship of ownership sub-dimensions indicates that students with high AQ levels tend to feel liable to improve the obstacles and face them responsibly. Besides that, the negative relationship between reach sub-dimensions and stress indicates that the respondents with high AQ levels do not let obstacles to reach other areas of life that restrict the negative impacts to that particular event. Similarly, as implied by the negative relationship between endurance sub-dimensions and stress, the respondents with high AQ tend to find solutions to overcome the obstacles.On the other hand, Lee, Kim and Wachholtz [16] found that perceived stress was negatively associated with both self-efficacy among the 279 undergraduate students from three universities in Seoul, and Dae Jeon Korea. In terms of gender distribution, 188 (67.4%) of the participants were female and 91 (32.6%) students were male. It was reported that that self-efficacy and stress among students showed a negative significant relationship indicating also that the higher self-efficacy, the lower stress level of individual. This means if students were confident in their ability to meet the challenges, they would experience positive interpretation of current situation, leading to enhance the chance to avoid having stress.The rational of conducting current systematic review on the relationship between self-efficacy, adversity quotient, COVID-19-related stress and academic performance is to enhance knowledge on stress among the students during COVID-19 pandemic and to examine the methodological approach in researching student\u2019s stress during the COVID-19 pandemic.Hence, the present systematic review aims to review research manuscripts during the COVID-19 pandemic which focus on the relationship between self-efficacy, adversity quotient, COVID-19-related stress and academic performance on a range of undergraduate student. Ultimately, based on this systematic review, we will recommend the direction for future research.Reviewer #1:1. Your study is quite reasonable, intellectual and informative but in this review article many times every statement or heading start with \" This review article\", so instead of this statement use suitable word. Over-all this manuscript is accepted.The similar statements were replaced with suitable words. The changes could be found on lines 37, 39, and 210.Insertion:37: The result of the study\u202639: Data from published studies will be used\u2026210: It should cover\u2026Reviewer #21. Include Cochrane library in Information sourceWe added Cochrane Library source on lines 26, 223, and 314.Revision: The authors will perform comprehensive searches of published studies in electronic databases such as PMC, PubMed, Scopus, Cochrane Library and Web of Science\u20262. Include months with years in Information sourceMonths and years were added on lines 224 and 232.Revision: \u2026 these are the PubMed Central (PMC), PubMed, Scopus, Cochrane Library and Web of Science databases and published between December 2019 until August 2022.3. Please provide details list of keywords with Boolean expression.The keywords for the search were amended on lines 27-29, 225-227 and 230-231.Revision: The keywords for the search are: \u2018self-efficacy\u2019 AND \u2018adversity quotient\u2019 AND \u2018stress\u2019 AND \u2018academic performance\u2019 AND \u2018student\u2019 AND \u2018COVID-19 pandemic\u2019.4. Please provide detail and separate heading of data extraction methods.Data extraction method was added with separated heading. Changes are described on lines 257-263.Revision: Data extractionEach accepted manuscript for review will be analyzed through a systematic and careful process. The full text of the articles will be read, exploring their methodology and results. Information on the study\u2019s design, sampling method, sample size, psychological tools used, and operational definitions will be recorded. A risk of bias analysis will be carried out for each individual study. The summary of the PRISMA checklist and a sample for electronic search strategy for the present systematic review will be presented accordingly.5. Please cite literature properly where necessary such as a systematic narrative synthesis. Cite reference.The citation was amended on lines 275.Revision: By using a systematic narrative synthesis [24] \u20266. Please provide operational definition of variables.The operational definition of variables was added on lines 265-274.Revision: Some key terms are clarified in this study. Firstly, Pajares and Miller [19] assume that self-efficacy refers to student\u2019s beliefs in their ability to master new skills and tasks. Secondly, Adversity Quotient (AQ) is defined as the ability to surmount life\u2019s adversities, and to turn every challenge into opportunities for personal success [20]. Thirdly, stress refers to a person\u2019s physical or emotional response to the demands or pressures of daily life [21]. In academic background, stress pervades the life of students, and tends to affect their mental and physical health, as well as their ability to perform schoolwork effectively [22]. Lastly, academic performance defined by grade point average (GPA). In addition, undergraduate students refer to students at a college or university who has not received a first and especially a bachelor's degree [23].7. Please explain or define what does undergraduate students means? Detail operational information is mandatory.The definition of undergraduate students was described on lines 272-274.Revision: In addition, undergraduate students refer to students at a college or university who has not received a first and especially a bachelor's degree [23].8. Justify tool using for Bias assessment? Please add Cochrane bias tool or some more tool and compare your findings in actual study.The tool justification for bias assessment was added on line 285-289. The Cochrane Collaboration\u2019s tool for assessing risk of bias was also added on lines 292-293.Insertion:285-289: Systematic reviews aim to collate and synthesise all studies that meet prespecified eligibility criteria using methods that attempt to minimise bias [25]. To get reliable conclusions, review authors must carefully consider that the potential limitations of the included studies  are appropriate to answer its research question. Many tools for assessing the quality of the study such as the risk of bias assessment tool.292-293: \u2026and The Cochrane Collaboration\u2019s tool for assessing risk of bias [27].9. Please discuss the methodology of your proposed study and mention under the heading of discussion?The Discussion heading was added on lines 308-325.Revision: Discussion The systematic review focuses on the published journal articles discussing the relationship between self-efficacy, adversity quotient, COVID-19-related stress, and academic performance among undergraduate students. It should cover published full-text English articles and studies which examine the undergraduate student population during the COVID-19 pandemic. Five databases will be used, namely the PubMed Central (PMC), PubMed, Scopus, Cochrane Library and Web of Science databases. the articles selected for this study are the articles published between December 2019 until August 2022. Reviewers will select articles against the inclusion criteria based on their title, abstract and full-text copies. Each accepted full-text manuscript will be analyzed by using narrative synthesis to explore their methodology such as study design, sampling method, sample size, psychological tools used, and their result on the relationship between self-efficacy, adversity quotient, COVID-19-related stress, and academic performance among the undergraduate students during the COVID-19 pandemic.To reach the reliable conclusions, the risk of bias of each individual study is determined using two tools. The first is the National Heart, Lung, and Blood Institute Quality Assessment Tool for Observational Cohort and Cross-Sectional Studies and the second is The Cochrane Collaboration\u2019s tool for assessing risk of bias.10. What will be expected limitation of the study?The expected limitations were added on lines 326-330.Revision: Expected limitationThe findings of this review may be restricted by a limitation. The review process inevitably identifies studies that are different in their design, quality of methodology, specific interventions used, also educational background and types of respondents studied. There is potential subjectivity when deciding how similar studies must be.AttachmentResponse to Reviewers.docxSubmitted filename: Click here for additional data file. 24 Oct 2022 <div> PONE-D-22-14527R1 </div>  <div> Relationship between self-efficacy, adversity quotient, covid-19-related stress and academic performance among the undergraduate students: a protocol for a systematic review </div>  <div> PLOS ONEDear Dr. Amit, </div>  <div> Thank you for submitting your manuscript to PLOS ONE. After careful consideration, we feel that it has merit but does not fully meet PLOS ONE\u2019s publication criteria as it currently stands. Therefore, we invite you to submit a revised version of the manuscript that addresses the points raised during the review process.plosone@plos.org. When you're ready to submit your revision, log on to https://www.editorialmanager.com/pone/ and select the 'Submissions Needing Revision' folder to locate your manuscript file.Please submit your revised manuscript by Dec 08 2022 11:59PM. If you will need more time than this to complete your revisions, please reply to this message or contact the journal office at\u00a0 </div> A rebuttal letter that responds to each point raised by the academic editor and reviewer(s). You should upload this letter as a separate file labeled 'Response to Reviewers'.A marked-up copy of your manuscript that highlights changes made to the original version. You should upload this as a separate file labeled 'Revised Manuscript with Track Changes'.An unmarked version of your revised paper without tracked changes. You should upload this as a separate file labeled 'Manuscript'.Please include the following items when submitting your revised manuscript:If you would like to make changes to your financial disclosure, please include your updated statement in your cover letter. Guidelines for resubmitting your figure files are available below the reviewer comments at the end of this letter.https://journals.plos.org/plosone/s/submission-guidelines#loc-laboratory-protocols. Additionally, PLOS ONE offers an option for publishing peer-reviewed Lab Protocol articles, which describe protocols hosted on protocols.io. Read more information on sharing protocols at https://plos.org/protocols?utm_medium=editorial-email&utm_source=authorletters&utm_campaign=protocols.If applicable, we recommend that you deposit your laboratory protocols in protocols.io to enhance the reproducibility of your results. Protocols.io assigns your protocol its own identifier (DOI) so that it can be cited independently in the future. For instructions see: We look forward to receiving your revised manuscript.Kind regards,Muhammad Shahzad Aslam, Ph.D.,M.Phil., Pharm-DAcademic EditorPLOS ONE[Note: HTML markup is below. Please do not edit.]Reviewers' comments:Reviewer's Responses to Questions <font color=\"black\"> Comments to the Author1. Does the manuscript provide a valid rationale for the proposed study, with clearly identified and justified research questions? </font> The research question outlined is expected to address a valid academic problem or topic and contribute to the base of knowledge in the field.Reviewer #3:\u00a0Yes********** <font color=\"black\"> 2. Is the protocol technically sound and planned in a manner that will lead to a meaningful outcome and allow testing the stated hypotheses? </font> The manuscript should describe the methods in sufficient detail to prevent undisclosed flexibility in the experimental procedure or analysis pipeline, including sufficient outcome-neutral conditions  to test the proposed hypotheses and a statistical power analysis where applicable. As there may be aspects of the methodology and analysis which can only be refined once the work is undertaken, authors should outline potential assumptions and explicitly describe what aspects of the proposed analyses, if any, are exploratory.Reviewer #3:\u00a0Yes********** <font color=\"black\"> 3. Is the methodology feasible and described in sufficient detail to allow the work to be replicable? </font> Descriptions of methods and materials in the protocol should be reported in sufficient detail for another researcher to reproduce all experiments and analyses. The protocol should describe the appropriate controls, sample size calculations, and replication needed to ensure that the data are robust and reproducible.Reviewer #3:\u00a0Yes********** <font color=\"black\"> 4. Have the authors described where all data underlying the findings will be made available when the study is complete?PLOS Data policy requires authors to make all data underlying the findings described in their manuscript fully available without restriction, with rare exception, at the time of publication. The data should be provided as part of the manuscript or its supporting information, or deposited to a public repository. For example, in addition to summary statistics, the data points behind means, medians and variance measures should be available. If there are restrictions on publicly sharing data\u2014e.g. participant privacy or use of data from a third party\u2014those must be specified. </font> The Reviewer #3:\u00a0No********** <font color=\"black\"> 5. Is the manuscript presented in an intelligible fashion and written in standard English? </font> PLOS ONE does not copyedit accepted manuscripts, so the language in submitted articles must be clear, correct, and unambiguous. Any typographical or grammatical errors should be corrected at revision, so please note any specific errors here.Reviewer #3:\u00a0Yes********** <font color=\"black\"> 6. Review Comments to the AuthorPlease use the space provided to explain your answers to the questions above and, if applicable, provide comments about issues authors must address before this protocol can be accepted for publication. You may also include additional comments for the author, including concerns about research or publication ethics.You may also provide optional suggestions and comments to authors that they might find helpful in planning their study. </font> Reviewer #3:\u00a0Dear Authors,Thank you for the opportunity to review an interesting article entitled: \u2018Relationship between self-efficacy, adversity quotient, covid-19-related stress and academic performance among the undergraduate students: a protocol for a systematic review\u2019. Overall, manuscript is written clearly and sensibly, but the following points should be noted:[1]. In the abstract at lines 27-29, the search terms used should be in apostrophes, as they are in the text - lines 225-227.[2]. In lines 67-69 the same information are repeated in two consecutive sentences.[3]. In lines 84-111, the figures in brackets will be better understood if the authors choose to present the percentages themselves, or replace the comma with a dash - e.g. (173 - 89%).[4]. In line 314, the sentence should start with a capital letter.********** <font color=\"black\"> 7. PLOS authors have the option to publish the peer review history of their article (what does this mean?). If published, this will include your full peer review and any attached files.If you choose \u201cno\u201d, your identity will remain anonymous but your review may still be made public.Do you want your identity to be public for this peer review? For information about this choice, including consent withdrawal, please see our Privacy Policy. </font> Yes:\u00a0Wojciech Marcin CzerskiReviewer #3:\u00a0**********https://pacev2.apexcovantage.com/. PACE helps ensure that figures meet PLOS requirements. To use PACE, you must first register as a user. Registration is free. Then, login and navigate to the UPLOAD tab, where you will find detailed instructions on how to use the tool. If you encounter any issues or have any questions when using PACE, please email PLOS at\u00a0figures@plos.org. Please note that Supporting Information files do not need this step.While revising your submission, please upload your figure files to the Preflight Analysis and Conversion Engine (PACE) digital diagnostic tool,\u00a0 10 Nov 2022Reviewer #31. Have the authors described where all data underlying the findings will be made available when the study is complete? NO.Response: The description on the availability of data was inserted on lines 319-320.Revision: The data supporting the findings of this study will be made available within the article and/or its supplementary materials.2. In the abstract at lines 27-29, the search terms used should be in apostrophes, as they are in the text - lines 225-227.Response: The apostrophes for search terms were inserted on lines 27-28.Revision: \u2026\u2018self-efficacy\u2019 AND \u2018adversity quotient\u2019 AND \u2018stress\u2019 AND \u2018academic performance\u2019 AND \u2018student\u2019 AND \u2018COVID-19 pandemic\u2019.3. In lines 67-69 the same information are repeated in two consecutive sentences.Response: The repeated sentence  was removed from the paragraph on lines 65-69.Revision: Furthermore, similar study was conducted by Putri and Ariana in Indonesian context where the stress level was measured by Student-life Stress Inventory [8]. The findings show that out of 252 first-year undergraduate students studied, 110 of them (43.6%) reported low stress, 89 respondents reported moderate stress (35.3%), and 53 respondents (21%) reported high stress.4. In lines 84-111, the figures in brackets will be better understood if the authors choose to present the percentages themselves, or replace the comma with a dash - e.g. (173 - 89%).Response: The figures and percentages in brackets were revised as follows.80-88: There are various changes in terms of educational approaches which potentially lead to difficulty in concentrating on academic work. Son et al. [9] found that most of the students (173 - 89%) stated that their home is distractive. For them, home is more appropriate place to than to study (79 - 46%). In fact, students were easier to be bothered by their family members at home. Other factors influencing students\u2019 concentration were social media, internet, and video games (19 - 11%). Some students (18 - 10%) mentioned that online classes were subject to diversion due to social interaction deficiency and continuous attention to computer screen. In addition, monotone life patterns mentioned by some students could negatively affect concentration on academic work (5 - 3%).95 \u2013 99: Son et al. [9] stated that most students (167 - 86%) answered that the COVID-19 pandemic increased the social isolation. Over half of students (91 - 54%) stated that it limited their interactions with friends significantly. Some students (52 - 31%) stated that they worried about a lack of in-person interactions. Others (9 - 5%) mentioned that disturbance to their outdoor activities have affected their mental health.100-110: Furthermore, in 2020, Son et al [9] found that majority of students (159 - 82%) concerned on their academic performance impacted by the COVID-19 pandemic. Fear of lower performance and delay in completion of studies are also the reasons to induce stress among students during COVID-19. The biggest challenge was the transition to classes through online platforms (61 - 38%). In particular, students concerned on sudden changes in the syllabus, the quality of the classes, technical issues with online applications, and the difficulty of online learning. Some students (36 - 23%) worried about progress in research and class projects because of social restrictions to keep social distancing and the lack of physical interactions with other students. Others (23 - 14%) stated the uncertainty about their grades on the learning through online platforms to be a major stressor. In addition, others (12 - 8%) indicated their lower motivation to learn and tendency to procrastinate.5. In line 314, the sentence should start with a capital letter.Response: The capital letter was inserted in the revision of this sentence (on lines 312-313).Revision: The articles which will be selected for this study are the articles published between December 2019 until August 2022.Additional Review:1. Please upload a copy of Figure 1 which you refer to in your text on page 11. Or if the figure is no longer to be included as part of the submission please remove all reference to it within the text.Response: As the guidelines say, which:\u2022 each figure caption should appear directly after the paragraph in which they were first cited, and\u2022 all figures should be uploaded separately as individual files,Revision: \u2022 the caption has added on page 11 lines 241 as \u201cFig 1. PRISMA Flow Chart.\u201d,\u2022 the figure has uploaded and attached as individual files namely \u201cFig1.tiff\u201d.AttachmentResponse to Reviewers.docxSubmitted filename: Click here for additional data file. 21 Nov 2022Relationship between self-efficacy, adversity quotient, COVID-19-related stress and academic performance among the undergraduate students: a protocol for a systematic reviewPONE-D-22-14527R2Dear,We\u2019re pleased to inform you that your manuscript has been judged scientifically suitable for publication and will be formally accepted for publication once it meets all outstanding technical requirements.Within one week, you\u2019ll receive an e-mail detailing the required amendments. When these have been addressed, you\u2019ll receive a formal acceptance letter and your manuscript will be scheduled for publication.http://www.editorialmanager.com/pone/, click the 'Update My Information' link at the top of the page, and double check that your user information is up-to-date. If you have any billing related questions, please contact our Author Billing department directly at authorbilling@plos.org.An invoice for payment will follow shortly after the formal acceptance. To ensure an efficient process, please log into Editorial Manager at onepress@plos.org.If your institution or institutions have a press office, please notify them about your upcoming paper to help maximize its impact. If they\u2019ll be preparing press materials, please inform our press team as soon as possible -- no later than 48 hours after receiving the formal acceptance. Your manuscript will remain under strict press embargo until 2 pm Eastern Time on the date of publication. For more information, please contact Kind regards,Muhammad Shahzad Aslam, Ph.D.,M.Phil., Pharm-DAcademic EditorPLOS ONEAdditional Editor Comments :Reviewers' comments:Reviewer's Responses to Questions <font color=\"black\"> Comments to the Author1. Does the manuscript provide a valid rationale for the proposed study, with clearly identified and justified research questions? </font> The research question outlined is expected to address a valid academic problem or topic and contribute to the base of knowledge in the field.Reviewer #3:\u00a0Yes********** <font color=\"black\"> 2. Is the protocol technically sound and planned in a manner that will lead to a meaningful outcome and allow testing the stated hypotheses? </font> The manuscript should describe the methods in sufficient detail to prevent undisclosed flexibility in the experimental procedure or analysis pipeline, including sufficient outcome-neutral conditions  to test the proposed hypotheses and a statistical power analysis where applicable. As there may be aspects of the methodology and analysis which can only be refined once the work is undertaken, authors should outline potential assumptions and explicitly describe what aspects of the proposed analyses, if any, are exploratory.Reviewer #3:\u00a0Yes********** <font color=\"black\"> 3. Is the methodology feasible and described in sufficient detail to allow the work to be replicable? </font> Descriptions of methods and materials in the protocol should be reported in sufficient detail for another researcher to reproduce all experiments and analyses. The protocol should describe the appropriate controls, sample size calculations, and replication needed to ensure that the data are robust and reproducible.Reviewer #3:\u00a0Yes********** <font color=\"black\"> 4. Have the authors described where all data underlying the findings will be made available when the study is complete?PLOS Data policy requires authors to make all data underlying the findings described in their manuscript fully available without restriction, with rare exception, at the time of publication. The data should be provided as part of the manuscript or its supporting information, or deposited to a public repository. For example, in addition to summary statistics, the data points behind means, medians and variance measures should be available. If there are restrictions on publicly sharing data\u2014e.g. participant privacy or use of data from a third party\u2014those must be specified. </font> The Reviewer #3:\u00a0Yes********** <font color=\"black\"> 5. Is the manuscript presented in an intelligible fashion and written in standard English? </font> PLOS ONE does not copyedit accepted manuscripts, so the language in submitted articles must be clear, correct, and unambiguous. Any typographical or grammatical errors should be corrected at revision, so please note any specific errors here.Reviewer #3:\u00a0Yes********** <font color=\"black\"> 6. Review Comments to the AuthorPlease use the space provided to explain your answers to the questions above and, if applicable, provide comments about issues authors must address before this protocol can be accepted for publication. You may also include additional comments for the author, including concerns about research or publication ethics.You may also provide optional suggestions and comments to authors that they might find helpful in planning their study. </font> Reviewer #3:\u00a0Dear Authors,Thank you for the further opportunity to review an interesting article entitled: 'Relationship between self-efficacy, adversity quotient, covid-19-related stress and academic performance among the undergraduate students: a protocol for a systematic review'. All the comments I have indicated have been taken into account.However, numerical contained in brackets on lines 82-109 will be better readable as separated by semicolons rather than by dashes, as I suggested earlier.********** <font color=\"black\"> 7. PLOS authors have the option to publish the peer review history of their article (what does this mean?). If published, this will include your full peer review and any attached files.If you choose \u201cno\u201d, your identity will remain anonymous but your review may still be made public.Do you want your identity to be public for this peer review? For information about this choice, including consent withdrawal, please see our Privacy Policy. </font> Yes:\u00a0Wojciech Marcin CzerskiReviewer #3:\u00a0********** 23 Nov 2022PONE-D-22-14527R2 Relationship between self-efficacy, adversity quotient, COVID-19-related stress and academic performance among the undergraduate students: a protocol for a systematic review Dear Dr. Amit:I'm pleased to inform you that your manuscript has been deemed suitable for publication in PLOS ONE. Congratulations! Your manuscript is now with our production department. onepress@plos.org.If your institution or institutions have a press office, please let them know about your upcoming paper now to help maximize its impact. If they'll be preparing press materials, please inform our press team within the next 48 hours. Your manuscript will remain under strict press embargo until 2 pm Eastern Time on the date of publication. For more information please contact plosone@plos.org. If we can help with anything else, please email us at Thank you for submitting your work to PLOS ONE and supporting open access. Kind regards, PLOS ONE Editorial Office Staffon behalf ofDr. Muhammad Shahzad Aslam Academic EditorPLOS ONE"}
+{"text": "DNA methylation (5-methylcytosine (5mC)) is critical for genome stability and transcriptional regulation in mammals. The discovery that ten-eleven translocation (TET) proteins catalyze the oxidation of 5mC to 5-hydroxymethylcytosine (5hmC), 5-formylcytosine (5fC), and 5-carboxylcytosine (5caC) revolutionized our perspective on the complexity and regulation of DNA modifications. However, to what extent the regulatory functions of TET1 can be attributed to its catalytic activity remains unclear. Here, we use genome engineering and quantitative multi-omics approaches to dissect the precise catalytic vs. non-catalytic functions of TET1 in murine embryonic stem cells (mESCs). Our study identifies TET1 as an essential interaction hub for multiple chromatin modifying complexes and a global regulator of histone modifications. Strikingly, we find that the majority of transcriptional regulation depends on non-catalytic functions of TET1. In particular, we show that TET1 is critical for the establishment of H3K9me3 and H4K20me3 at endogenous retroviral elements (ERVs) and their silencing that is independent of its canonical role in DNA demethylation. Furthermore, we provide evidence that this repression of ERVs depends on the interaction between TET1 and SIN3A. In summary, we demonstrate that the non-catalytic functions of TET1 are critical for regulation of gene expression and the silencing of endogenous retroviruses in mESCs. DNA methylation is essential for the regulation of gene expression and genome stability in mammals . During TET1 and TET3 possess a CXXC-type zinc finger domain that promotes their targeting to CpG-rich sequences, whereas TET2 associates with IDAX, an independent CXXC domain-containing protein . The expTcf21 promoter . Similarly, TET2 can activate gene expression independent of its catalytic activity via the direct interaction with the O-linked N-acetylglucosamine (O-GlcNAc) transferase (OGT)  .TET1 binds through its CXXC domain, both active and bivalent promoters and can act as either a transcriptional repressor or activator depending on the associated chromatin modifying complexes . At thisIn addition to gene regulation, TET1 has also been implicated in the repression of transposable elements (TEs) . In vertTaken together, these findings suggest that TET1 can mediate transcriptional regulation in a catalytically independent manner. However, the underlying molecular mechanisms as well as the extent of TET1\u2019s non-catalytic functions remain poorly understood.Here, we systematically dissected the non-catalytic role of TET1 in mESCs. We used genome engineering and a quantitative multi-omics approach to compare a TET1 KO with a catalytically inactive TET1 mESC line. In particular, we find that (i) a large proportion of transcriptional changes are independent of TET1-mediated DNA demethylation; (ii) TET1 associates with different chromatin modifiers and is important for the establishment of specific histone modifications, namely H3K27me3, pan histone 4 lysine 5\u00a0+\u00a08\u00a0+\u00a012\u00a0+\u00a016 acetylation (pH4Kac) and H4K20me3\u00a0and (iii) that loss of the TET1 protein but not its catalytic activity causes a specific loss of H3K9me3 at ERV1, ERVK\u00a0and ERVL elements. Finally, we highlight that the interplay between TET1 and SIN3A is a main driver of ERV repression. Our results demonstrate that TET1 has a pivotal non-catalytic role in regulating gene expression and ERV silencing in mESCs.The generation of Tet1 KO (clone H9) and Tet1 CM (clone D7) mESC lines was described previously ,29.l-glutamine (Sigma), 1\u00d7\u00a0MEM Non-essential amino acids (Sigma), 100 U/ml penicillin, 100 \u03bcg/ml streptomycin (Sigma), homemade recombinant LIF tested for efficient self-renewal maintenance.Mouse ESCs were cultured in \u2018Serum LIF\u2019 conditions and as independent replicates for 6 days prior to experiments. Here the cells were maintained on 0.2% gelatin-coated dishes in Dulbecco's modified Eagle's medium (Sigma) supplemented with 16% fetal bovine serum , 0.1 mM \u00df-mercaptoethanol (Invitrogen), 2 mM For the generation of piggybac doxycycline inducible cell lines, mESCs were cultured in \u2018Serum LIF 2i media\u2019. Those were the same conditions as described above, but supplemented with 2i ).All cell lines were regularly tested for Mycoplasma contamination by PCR.The piggybac dox inducible TET1 (#102421) and TET1 CM (#102422) vector constructs were obtained from addgene . To genePrimers:Sin3a_PsyI_FWD: 5\u2019 gtccatggactgcagtagacgtggtcatggggaagaagagc 3\u2019Sin3a_NheI_REV: 5\u2019 ttactatactctatagctagctgctcttgcttcttctgatc 3\u2019Sin3a_SID_FWD: 5\u2019 caagtggtagccatagaagccGCCactcagGCCtcagaag 3\u2019Sin3a_SID_REV: 5\u2019 cttctgaGGCctgagtGGCggcttctatggctaccacttg 3\u2019The resulting DNA fragments were cloned into the TET1 or TET1 CM piggybac vector digested with PsyI and NheI (Thermo Fisher Scientific) using a Gibson Cloning Kit (NEB).Tet1, Tet1CM or Tet1 Sin3a mut., Tet1 KO mES cells were seeded at 0.5 mio mESCs in a 6-well plate and transfected with 1.5 \u03bcg of the pPB-tetO(hCMV1)-HA-Tet1mHxD(201R2)-IV  or pPB-tetO(hCMV1)-HA-Tet1(201R2)-IV  or pPB-tetO(hCMV1)-HA-Tet1Sin3a(201R2)-IV plasmid, 0.5 \u03bcg of the PiggyBac transposase vector  and 0.5 \u03bcg of the pPB-CAG-rtTA-IRES-Hygro  plasmid using Lipofectamine 3000 (Thermo Fisher Scientific) according to manufacturer's instructions. Two days after transfection, cells were plated at 10% confluency into a p100 plate and selected with Hygromycin (125 \u03bcg/ml) for 5\u20136 days. To enrich positive clones, cells were induced with doxycycline (1\u00a0\u03bcg/ml) for 24\u00a0h then sorted with flow cytometry on thresholded levels of mVenus expression. The mVenus fluorophore is under the control of the same promoter as Tet1 via an IRES sequence and therefore a fluorescent readout of successful induction. To ensure a stable pool the cell lines were sorted twice for mVenus expression. Post sorting, cells were plated back into media without doxycycline for 7 days before commencing experiments.To generate stable mESC lines carrying doxycycline-inducible forms of Western blots for TET1 rescue and HP1\u03b2 were performed as described previously  using moThe quantitative multiplexed ChIP experiments were conducted as previously described . In shorhttps://github.com/NBISweden/minute).We conducted the MINUTE-ChIP data analysis as previously described . The bioSequencing was performed using 50:8:34 cycles (Read1:Index1:Read2) Illumina bcl2fastq was used to demultiplex paired-end sequencing reads by 8nt index1 read (PCR barcode). NextSeq lanes were merged into single fastq files, creating the primary fastq files. Read1 starts with 6nt UMI and 8nt barcode in the format NNNNNNABCDEFGH.https://github.com/NBISweden/minute. Main steps performed are described below.MINUTE-ChIP multiplexed FASTQ files were processed using minute, a data processing pipeline implemented in Snakemake . In ordeRead pairs matching parts of the adaptor sequence (SBS3 or T7 promoter) in either read1 or read2 were removed using cutadapt v3.2 .Reads were demultiplexed using cutadapt v3.2 allowing only one mismatch per barcode. Demultiplexed reads were written into sample-specific fastq files used for subsequent mapping and GEO submission.Sample-specific paired fastq files were mapped to the mouse genome (mm10) using bowtie2 (v2.3.5.1) with \u2013fast parameter. Alignments were processed into sorted BAM files with samtools (v1.10). Pooled BAM files were generated from replicates using samtools.https://github.com/gbcs-embl/Je/). Read pairs are marked as duplicates if their read1 (first-in-pair) sequences have the same UMI  and map to the same location in the genome. Blacklisted regions were then removed from BAM files using BEDTools (v2.29.2).Duplicate reads are marked using UMI-sensitive deduplication tool je-suite (v2.0.RC) (Input coverage tracks with 1bp resolution in BigWig format were generated from BAM files using deepTools (v3.5.0) bamCoverage and scaled to a reads-per-genome- coverage of one . ChIP coverage tracks were generated from BAM files using deepTools (v3.5.0) bamCoverage. Quantitative scaling of the ChIP-Seq tracks amongst conditions within each pool was based on their Input-Normalized Mapped Read Count (INRC). INRC was calculated by dividing the number of unique mm10-mapped reads by the respective number of Input reads: #mapped[ChIP]/#mapped[Input]. This essentially corrected for an uneven representation of barcodes in the Input and we previously demonstrated that the INRC is proportional to the amount of epitope present in each condition . WildtypFastQC was run on all FASTQ files to assess general sequencing quality.Picard (v2.24.1) was used to determine insert size distribution, duplication rate, estimated library size. Mapping stats were generated from BAM files using samtools (v1.10) idxstats and flagstat commands. Final reports with all the statistics generated throughout the pipeline execution are gathered with MultiQC .We analysed published ChIP-seq reads of TET1 , SIN3A , SETDB1 Three cell lines  were cultured as independent triplicates. The genomic DNA was isolated using the QIAamp DNA Mini Kit (QIAGEN). DNA concentration was measured using Nanodrop . The gDNA was then diluted to 10 ng/\u03bcl in 200 \u03bcl TE buffer. To control the conversion efficiency 0.01 ng pUC19 methylated DNA and 0.2 ng unmethylated lambda DNA were added. The DNA was sheared into 350\u2013400 bp fragments using the Bioruptor Plus sonication device (Diagenode) . Bioanalyzer (Agilent) was used to control for the shearing efficiency. For library preparation 200 ng of the sheared DNA were used. The final EM-seq library preparation was performed according to the manufacturer's instructions (New England Biolabs).P <0.05 and a difference in methylation means between two groups >20%. DNA methylation browser track figures were created using IGV (v2.9.2).The EM-seq library was a paired end sequencing run, 2 \u00d7 150 bp (Novogene). Raw reads were first trimmed using Trim Galore (v.0.3.1). Alignments were carried out to the mouse genome (mm10) using bsmap (v.2.90) using the parameters \u2018-s 12 -v 10 -r 2 -I 1\u2019. CpG-methylation calls were extracted from the mapping output using bsmaps methratio.py. Analysis was restricted to CpG with a coverage >10. methylKit  was used\u25cbC) and washed twice in ice-cold hypotonic lysis buffer w/o NP-40. Nuclei were resuspended in 5\u00d7 nuclei pellet volumes of ice-cold 0.2 M sulfuric acid and mixed on a rotation wheel for 120 min at 4\u00b0C. Insolubilized nuclear debris was pelleted by centrifugation . Supernatant was transferred to a fresh low-protein binding Eppendorf tube and histone proteins were precipitated by adding ice-cold trichloroacetic acid (TCA) to the final concentration of 20% (v/v) followed by 60 min incubation on ice. Precipitated histone proteins were pelleted by centrifugation , washed 3 times with acetone (\u201320\u00b0C) and resuspended in MS grade water.Histones were acid extracted as described previously . In brie\u25cbC. A 1% v/v solution of phenyl isocyanate (PIC) in acetonitrile was freshly prepared and 6 \u03bcl added to each sample and incubated for 60 min at 37\u00b0C. Samples were acidified by adding trifluoroacetic acid (TFA) to the final concentration of 1%. Peptides were de-salted with C18 spin columns (Pierce\u2122) following the manufacture protocol. Peptides were eluted from C18 spin columns with 70% acetonitrile, partially dried in a speedvac and resuspended in 30 \u03bcl 0.1% TFA.Extracted histones were prepared for LC\u2013MS/MS analysis using hybrid chemical derivatization method as described previously . In briem/z 400), and product ions spectra were collected in a \u2018top 15\u2019 data-dependent scan cycle at 15 000 resolution.The resulting peptide mixtures were analyzed using nano-flow liquid chromatography\u2013tandem mass spectrometry (LC\u2013MS/MS) on a Q-Exactive HF mass spectrometer coupled to an Ultimate 3000 nano-UPLC  in data-dependant acquisition (DDA) mode. \u223c300 ng peptide aliquot was used per one sample per one injection. Peptides were loaded automatically on a trap column  prior to C18 reversed phase chromatography on the analytical column . Peptides were separated at flow rate of 0.250 \u03bcl per minute by a linear gradient from 1% buffer B (0.1% (v/v) formic acid, 98% (v/v) acetonitrile) to 25% buffer B over 40 min followed by a linear gradient to 40% B in 20 min, then to 85% B in 5 min. After 5 min at 85% buffer B, the gradient was reduced to 1% buffer B over 2 min and then allowed to equilibrate for 8 min. Full mass range spectra were at 60 000 resolution . WT J1, Tet1 KO and Tet1 CM mESCs lines were cultured in Serum LIF media as described. The Cellwatcher was placed inside the incubator and images with a large field of view of 10 mm\u00b2 were automatically recorded every 30 min. The cell proliferation and morphology data were gained with PHIO\u2019s automatic AI-based analysis platform and were accessed through PHIO\u2019s data dashboard www.phio-cells.com.The time evolution of cell growth and cell morphology was determined using the PHIO Cellwatcher .For RNA-seq, three different cell lines  were cultured as independent quadruplicates. RNA was isolated using the NucleoSpin Triprep Kit (Machery-Nagel) according to the manufacturer's instructions. Isolated total RNA was normalised and subjected to RNA sequencing using a version of the prime-seq method . This meP <0.05 and an LFC >abs(1) were considered to be differentially expressed. Differential expression analysis over transposable elements was performed using TEtranscript (RNA-seq libraries were processed and mapped to the mouse genome (mm10) using the zUMIs pipeline . UMI couanscript .2HPO4, 1.5 mM KH2PO4) prewarmed to 37\u00b0C, cells fixed for 10 min with 4% paraformaldehyde  by heating in PBS up to 60\u00b0C; stored at \u201320\u00b0C), washed three times by dipping in PBST , permeabilized for 5 min in PBS supplemented with 0.5% Triton X-100, and washed two times by dipping in PBS. Primary and secondary antibodies were diluted in blocking solution . Coverslips were incubated with primary and secondary antibody solutions  in dark humid chambers for 1\u00a0h and washed three times by dipping in PBST after primary and secondary antibodies. For DNA counterstaining, coverslips were incubated 6 min in PBST containing a final concentration of 2 \u03bcg/ml DAPI (Sigma-Aldrich) and washed three times for 10 min with PBST. Coverslips were mounted in antifade medium  and sealed with colorless nail polish.For immunostaining, mESCs were grown on coverslips coated with Geltrex (Life Technologies), thereby allowing better visualization during microscopic analysis. All steps during immunostaining were performed at room temperature. Coverslips were rinsed two times with PBS , monoclonal mouse anti-HP1\u03b1 , monoclonal mouse anti-HP1\u03b3  and monoclonal rat anti-TET1 . Following secondary antibodies were used: polyclonal donkey anti-rabbit Alexa 488 , polyclonal donkey anti-rat 488 , polyclonal donkey anti-rabbit Alexa 647 , polyclonal donkey anti-mouse Alexa 647 .Images were acquired on the Leica TCS SP8 X using 63\u00d7\u00a0glycerol immersion objective and high-content screening Operetta microscope using a 20\u00d7\u00a0objective. DAPI or fluorophores were excited with 405, 488\u00a0or 594\u2009nm laser lines. Within each experiment, cells were imaged using the same settings on the microscope  to compare signal intensities between cell lines.Images were analyzed using Fiji software (ImageJ 1.51j) for SP8 images and Harmony software package for Operetta images.The coefficient of variance (CV) of the respective fluorescent signal was calculated as follows: (standard deviation/mean)\u00a0\u00d7\u00a0100. The mean fluorescence and standard deviation of the fluorescence signal was acquired and calculated with the Operetta microscope and Harmony software package. To calculate the CV of the KO\u00a0+\u00a0TET1 and KO\u00a0+\u00a0TET1 SIN3A mut. rescue experiments, we used a TET1 antibody staining to identify cells with TET1 expression. The cells were separated into TET1 positive (488 nm mean intensity\u00a0>\u00a01500) and TET1 negative (488 nm mean intensity\u00a0<\u00a01500) and the CV calculated of the respective population.Chromatin immunoprecipitation coupled to Mass Spectrometry (ChIP-MS) of TET1 was performed in triplicates for WT and TET1 KO mESCs under Serum LIF condition. For the pulldown a direct TET1 antibody  was employed. ChIP-MS was performed as described previously, but without MNase digestion . After e6 and the resolution was at 60 000. The m/z range was adjusted to 400\u20131650 m/z and the maximum injection time was limited to 20 ms.300 ng of each peptide solution was analyzed on a quadrupole Orbitrap mass spectrometer  after nanoflow liquid chromatography on an in-house packed 50 cm column  coupled to an Easy-nLC 1200 (Thermo Fisher Scientific) over a linear acetonitrile gradient for 120 min. Data-dependent acquisition was employed and thereby the most abundant 12 peptides were selected for MS/MS scans. The target value for full scan MS spectra was set to 3\u00a0\u00d7\u00a010t-test of the log2 transformed LFQ intensities was performed to obtain significantly enriched proteins. By definition, a permutation-based false discovery rate of 5% and a fold change cut-off of log2 = 1 was applied.Subsequent data analysis of raw MS files was first accomplished by the MaxQuant software package (version 1.6.0.7) . ProteinTet1 knockout (Tet1 KO) and Tet1 catalytic mutant (Tet1 CM) mESCs  mESCs ,29. All M) mESCs . While bM) mESCs . To deteM) mESCs ) on Tet1M) mESCs , in lineM) mESCs . StrikinM) mESCs , stronglM) mESCs . This diM) mESCs . In lineM) mESCs . These fEts2, Mbp and Nog, Figure Zfp42 and Prdm14) were upregulated after re-expression of either TET1 or TET1 CM . We. We23). M Figure . Taken tM Figure ,33,76 anFinally, we asked whether the transcriptional dysregulation in TET1 mutant ESCs might be attributable to changes in DNA methylation. To address this question we performed enzymatic methylome sequencing EM-seq, . StrikinEZH2 transcript level. However, in total these global reductions in histone modification levels in Tet1 KO mESCs cannot be explained by transcriptional deregulation of the responsible histone modifying enzyme complexes , compared to ERV1 (n = 522) and ERVK (n = 50)  Figure . Further) Figure , suggestPreviously, TET1 binding was shown to strongly correlate with CpG density . In lineZscan4 , suggesting additional pathways independent of SIN3A  state  state . Intereshylation . In contke cells . One expDespite hypermethylation at ERVs in Tet1 KO mESCs, we could rescue normal ERV repression when reintroducing either TET1 or TET1 CM. Our finding that TET1 regulates ERV expression independently of its DNA demethylation function is in line with the observation that ERV silencing mediated by TRIM28 and SETDB1 is DNA methylation independent ,114,115.Using immunofluorescence, we demonstrate for the first time that loss of TET1 leads to a displacement of HP1\u03b2, HP1\u03b3, and HP1\u03b1 from heterochromatin foci. Our data does not show that HP1 proteins are lost at ERVs in Tet1 KO mESCs. However, the loss of H3K9me3 and H4K20me3 at ERVs could explain the displacement of HP1 proteins from heterochromatic regions, prompting the question how TET1 influences the maintenance of heterochromatin in mESCs. The current model of heterochromatin formation proposes that site specific KRAB-Znf transcription factors recruit TRIM28 and its interaction partner SETDB1 to DNA. The latter installs H3K9me3, which is bound by HP1 and subsequently recruits SUV39H and SUV4-20H for spreading of H3K9me3 and H4K20me3 ,117. We It is important to note that deacetylation and heterochromatin establishment are tightly connected ,118\u2013122.Tet mutations and their molecular consequences in cancer and disease.Collectively, our results demonstrate that TET1 regulates gene expression independently of active DNA demethylation in mESCs. We provide novel insights into the mechanisms underlying TET1\u2019s non-catalytic functions in transcriptional regulation, including identifying TET1 as a global regulator of histone modifications. Moreover, we show that TET1 associates with different proteins involved in heterochromatin formation to suppress the expression of ERV1, ERVK and ERVL elements. Finally, we provide evidence that the mechanism of TET1-mediated silencing of ERV1, ERVK and ERVL elements critically depends on the interaction between TET1 and SIN3A but not the catalytic activity of TET1. Our study reveals the importance of disentangling the non-catalytic and catalytic roles of TET enzymes in different biological contexts. This will be of particular relevance for furthering our understanding of https://www.ebi.ac.uk/arrayexpress/ via the accession numbers E-MTAB-10933 and E-MTAB-10937, respectively. ChIP-seq data is available under the accession number GSE183465 at https://www.ncbi.nlm.nih.gov/geo/. The mass spectrometry proteomics data have been deposited to the ProteomeXchange Consortium via the PRIDE (EM-seq and RNA-seq data generated in this study is available at he PRIDE  partner gkac642_Supplemental_FilesClick here for additional data file."}
+{"text": "Transmembrane protein 106B (TMEM106B), a protein that is localized to the lysosome, is genetically linked to many neurodegenerative diseases and forms fibrils in diseased brains. The reproducibility of TMEM106B research would be enhanced if the community had access to well-characterized anti-TMEM106B antibodies. In this study, we characterized six commercially available TMEM106B antibodies for their performance in Western blot, immunoprecipitation, and immunofluorescence, using a standardized experimental protocol based on comparing read-outs in knockout cell lines and isogenic parental controls. We identified many high-performing antibodies and encourage readers to use this report as a guide to select the most appropriate antibody for their specific needs. TMEM106B major risk allele, rs1990622, is suspected to be a risk factor and disease modifier for Frontotemporal Dementia (FTD), with few studies investigating its potential role in Amyotrophic Lateral Sclerosis (ALS) pathogenesis.\u2013Transmembrane protein 106B (TMEM106B) is a genetic risk variant for many neurodegenerative diseases. The presence of the,TMEM106B is a transmembrane endosomal and lysosomal glycoprotein. The protein has garnered interest lately, with the discovery that a 135 amino acid portion of the protein from its luminal C-terminal domain forms fibrils in the brains of patients with frontotemporal lobar degeneration, progressive supranuclear palsy, and dementia with Lewy bodies. Mechanistic studies would be greatly facilitated with the availability of high-quality validated antibodies. Here, we compared the performance of a range of commercially available antibodies for TMEM106B and characterized several high-quality antibodies for Western blot, immunoprecipitation and immunofluorescence, enabling biochemical and cellular assessment of TMEM106B properties and function.The roles of TMEM106B fibrils in normal lysosomal function or disease pathogenesis are not known, nor is the mechanism by which the protein is proteolyzed, or forms fibrils., The first step was to identify a cell line(s) that expresses sufficient levels of TMEM106B to generate a measurable signal. To this end, we examined the DepMap transcriptomics databases to identify all cell lines that express the target at levels greater than 2.5 log2 (transcripts per million \u201cTPM\u201d +1), which we have found to be a suitable cut-off . Commercially available HAP1 cells expressed theTMEM106B at RNA levels above the average range of cancer cells analyzed. The parental and KO HAP1 cell lines were obtained from Horizon Discovery (Our standard protocol involved comparing readouts from wild-type (WT) andknockout (KO) cells.scovery .TMEM106B KO cell extracts and probed them side-by-side with all antibodies in parallel . Alexa-555 conjugated secondary goat anti-rabbit and anti-mouse antibodies are from Thermo Fisher Scientific (cat. number A21429 and A21424)All TMEM106B antibodies are listed inTMEM106B KO cell lines used are listed in Cells were cultured in DMEM high glucose  containing 10% fetal bovine serum , 2 mM L-glutamate , 100 IU penicillin and 100 \u03bcg/mL streptomycin .Both HAP1 WT and HAP1 WT andTMEM106B KO were collected in RIPA buffer  from Thermo Fisher Scientific (cat number 0089901), supplemented with 1x protease inhibitor cocktail mix from MilliporeSigma (cat. number 78429). Lysates were sonicated briefly and incubated for 30 min on ice. Lysates were spun at ~110,000 x g for 15 min at 4\u00b0C and equal protein aliquots of the supernatants were analyzed by SDS-PAGE and Western Blot. BLUelf prestained protein ladder from GeneDireX (cat. number PM008-0500) was used.Western blot experiments were performed as described in our standard operating procedure.Western blots were performed with pre-cast mini 4-15% gradient polyacrylamide gels from Bio-Rad (cat. number 4561084) and transferred on nitrocellulose membranes. Proteins on the blots were visualized with Ponceau staining which is scanned to show together with individual Western blots. Blots were blocked with 5% milk for 1 h, and antibodies were incubated overnight at 4\u00b0C with 5% bovine serum albumin (BSA)  in TBS with 0,1% Tween 20 (TBST) . Following three washes with TBST, the peroxidase conjugated secondary antibody was incubated at a dilution of ~0.2 \u03bcg/mL in TBST with 5% milk for 1 hr at room temperature followed by three washes with TBST. Membranes are incubated with Pierce ECL from Thermo Fisher Scientific (cat. number 32106) prior to detection with HyBlot CL autoradiography films from Denville (cat. number 1159T41). Antibody-bead conjugates were prepared by adding 2 \u03bcg of antibody to 500 \u03bcL of Pierce IP Lysis Buffer from Thermo Fisher Scientific (cat. number 87788) in a 1.5 mL microcentrifuge tube together with 30 \u03bcL of Dynabeads protein A- (for rabbit antibodies) or protein G- (for mouse antibodies) from Thermo Fisher Scientific . Tubes were rocked ~2 hours at 4\u00b0C followed by several washes to remove unbound antibodies.Immunoprecipitation was performed as described in our standard operating procedure.HAP1 WT were collected in Pierce IP buffer  from Thermo Fisher Scientific (cat. number 87788), supplemented with protease inhibitor from MilliporeSigma (cat. number P8340). Lysates were rocked for 30 min at 4\u00b0C and spun at 110,000 x g for 15 min at 4\u00b0C. 0.5 mL aliquots at 2.0 mg/mL of lysate were incubated with an antibody-bead conjugate for ~2 hrs at 4\u00b0C. The unbound fractions were collected, and beads were subsequently washed three times with 1.0 mL of IP lysis buffer and processed for SDS-PAGE and Western blot on a pre-cast mini 4-15% polyacrylamide gel. Prot-A:HRP  was used as a secondary detection system at a dilution of 0.4 \u03bcg/mL. HAP1 WT andTMEM106B KO were labelled with CellTracker green  or CellTracker deep red  fluorescence dye, respectively. The nuclei were labelled with DAPI  fluorescent stain. WT and KO cells were plated in 96 well glass plates  as a mosaic and incubated for 24 hrs in a cell culture incubator at 37oC, 5% CO2. Cells were fixed in 4% paraformaldehyde (PFA)  in phosphate buffered saline (PBS)  for 15 min at room temperature and then washed three times with PBS. Cells were permeabilized in PBS with 0.1% Triton X-100  for 10 min at room temperature and blocked with PBS containing 5% BSA, 5% goat serum  and 0.01% Triton X-100 for 30 min at room temperature. Cells were incubated with IF buffer  containing the primary TMEM106B antibodies overnight at 4\u00b0C. Cells were then washed 3 \u00d7 10 min with IF buffer and incubated with the corresponding Alexa Fluor 555-conjugated secondary antibodies in IF buffer at a dilution of 1.0 \u03bcg/mL for 1 hr at room temperature with DAPI. Cells were washed 3 \u00d7 10 min with IF buffer and once with PBS.Immunofluorescence was performed as described in our standard operating procedure. Masks were used to generate cell outlines for intensity quantification. Figures were assembled with Adobe Illustrator.Images were acquired on an ImageXpress micro widefield high-content microscopy system (Molecular Devices), using a 20x/0.45 NA air objective lens and scientific CMOS camera , equipped with 395, 475, 555 and 635 nm solid state LED lights (Lumencor Aura III light engine) and bandpass emission filters  to excite and capture fluorescence emission for DAPI, CellTracker Green, Alexa fluor 555 and CellTracker Red, respectively. Images had pixel sizes of 0.68 \u00d7 0.68 microns. Exposure time was set with maximal (relevant) pixel intensity ~80% of dynamic range and verified on multiple wells before acquisition. Since the IF staining varied depending on the primary antibody used, the exposure time was set using the most intensely stained well as reference. Frequently, the focal plane varied slightly within a single field of view. To remedy this issue, a stack of three images per channel was acquired at a z-interval of 4 microns per field and best focus projections were generated during the acquisition . Segmentation was carried out on the projections of CellTracker channels using CellPose v1.0 on green (WT) and far-red (KO) channels, using as parameters the \u2018cyto\u2019 model to detect whole cells, and using an estimated diameter tested for each cell type, between 15 and 20 microns. This manuscript describes the various antibodies available for the study of TMEM106B. This is a useful methodological paper. The work is well organized, and the methodologies appropriately presented. I would like to suggest comparing the methods and results with those suggested by the vendors and discuss advantages to use the methodologies presented by the authors.Are sufficient details of methods and materials provided to allow replication by others?YesIs the rationale for creating the dataset(s) clearly described?YesAre the datasets clearly presented in a useable and accessible format?YesAre the protocols appropriate and is the work technically sound?YesReviewer Expertise:NAI confirm that I have read this submission and believe that I have an appropriate level of expertise to confirm that it is of an acceptable scientific standard, however I have significant reservations, as outlined above. In their article, Ayoubi and colleagues are reporting about their quality tests of six different commercial anti-TMEM106B antibodies using Western blotting, immunoprecipitation, and immunocytochemistry.\u00a0 The article is interesting and useful for groups working with this protein. Doing KO controls to test antibodies is considered the gold standard of validation tests. Nevertheless, unfortunately it is not done very often. That\u2019s why I appreciate the work of these authors. I would consider the following concerns.MAJOR CONCERNS:In my experience it is common to describe the results in the result chapter instead of just referring to the figures.There is no discussion in this chapter yet. The authors should interpret their results in a more concrete way. Which antibodies do they recommend for which method? Interesting to mention in my eyes: 2 out of 6 tested antibodies don\u2019t work in Western blotting, as they don\u2019t bind the protein of interest, but they nonspecifically bind other proteins. One further antibody (60333-1-lg) nonspecifically binds other proteins in addition to binding the protein of interest. In total, half of the antibodies show unspecific binding, which could harm result interpretation when using this antibody without having a KO control.1) Chapter: \u201cResults and discussion\u201d:Article type \"Data Note\": In my perspective this article is not a \"data note\" in the classical sense . The authors do not present a classical data set however. To me, an analysis and conclusions are necessary. Hence, I would ask the authors to consider another article type. Is there something like a \"Technical note\"?MINOR CONCERNS:In their introduction, the authors speak of \u201ca 135 amino acid portion of the protein from its luminal C-terminal domain\u201d, that might play a pathophysiological role. Given this information, it might be interesting which of the six antibodies have epitopes in that specific domain. I there any information available? Some ideas to address this questions methodologically ?Results and discussion: \u201cFor Western blot experiments, we resolved proteins from WT and TMEM106B KO cell extracts and probed them side-by side with all antibodies in parallel .\u201d What means \u201cside-by side\u201d here? Do they come from the same membrane in order to avoid membrane-to-membrane variation? In the best case, in future experiments, the authors could even considering cutting the lanes vertically in order to even avoid lane-to-lane variation (cf. Pubmed ID 30768763).Figure 1, panel PA5-34353: I am a bit surprised that the \u201cscratches\u201d and inhomogenities in protein transfer is not equally visible in the total protein staining (ponceau). I would kindly ask the authors to check in their data files that the ponceau staining is really originating from the same membrane, because the loading control would be invalid otherwise.\u00a0Figure 2: Why is \u201cHC\u201d (antibody heavy chain) only shown in the second panel? I would recommend showing it in the first panel only, or in all panels.Figure 2: I do not understand why there is written \u201cWB: 93334**\u201d below each of the 6 Western blots.Figure 3: Is the Alexa-fluor 555 not interfering with the fluorescence stainings that were applied to distinguish WT from KO?Concluding sentence in the results section: \u201cwe have screened many TMEM106B commercial antibodies\u201d I recommend avoiding vague words like \u201cmany\u201d where a more concrete indication (\u201csix\u201d) is possible. Same for the word \u201cseveral\u201d in the same sentence.Are sufficient details of methods and materials provided to allow replication by others?YesIs the rationale for creating the dataset(s) clearly described?YesAre the datasets clearly presented in a useable and accessible format?YesAre the protocols appropriate and is the work technically sound?YesReviewer Expertise:Western blotting, antibodies, autoantibodies, ELISA, method developmentI confirm that I have read this submission and believe that I have an appropriate level of expertise to confirm that it is of an acceptable scientific standard, however I have significant reservations, as outlined above. This is a useful paper, highlighting the need for antibody validation. There is important information here for TMEM106B antibody users and clear methodology for those wishing to test antibodies in their own area. Experiments are well carried out and well controlled, and figures are clear. The lack of results analysis means that figures can be interpreted by the reader for their own experimental needs, however, any misinterpretation by a reader could be avoided by adding a column to Table 2 showing the study findings alongside \u2018Vendors recommended applications\u2019. The number of technical replicates for each method should be stated. Full blots could be shown for immunoprecipitation results . I would have found figures easier to understand with consistent naming of HAP1 WT and KO cells as HAP1 WT and HAP1 KO rather than a combination of WT and THEM106B KO , HAP1  and WT and KO . Units could be added to the markers in Figures 1 and 2.Are sufficient details of methods and materials provided to allow replication by others?YesIs the rationale for creating the dataset(s) clearly described?YesAre the datasets clearly presented in a useable and accessible format?YesAre the protocols appropriate and is the work technically sound?YesReviewer Expertise:Molecular biology, cell culture, medical geneticsI confirm that I have read this submission and believe that I have an appropriate level of expertise to confirm that it is of an acceptable scientific standard."}
+{"text": "TARDBP leading to aggregation, are suspected to be a characteristic feature of various neurogenerative diseases. The lack of well-characterized anti- TDP-43 antibodies acts as a barrier to establish reproducible TDP-43 research. In this study, we characterized eighteen TDP-43 commercial antibodies for Western blot, immunoprecipitation, and immunofluorescence using a standardized experimental protocol based on comparing read-outs in knockout cell lines and isogenic parental controls. We identified many well-performing antibodies and encourage readers to use this report as a guide to select the most appropriate antibody for their specific needs.TAR DNA-binding protein 43 (TDP-43) is a DNA/RNA binding protein playing a critical role in the regulation of transcription, splicing and RNA stability. Mutations in TARDBP gene, is a DNA/RNA-binding protein implicated in RNA metabolism and processing. Belonging to the heterogeneous nuclear ribonucleoprotein (hnRNP) family of proteins that bind to RNA via highly conserved RNA recognition motifs, TDP-43 binds to UG-repeats with high specificity.,TDP-43, encoded by theTARDBP that result in TDP-43 aggregation and neuropathology have been observed in distinct neurodegenerative diseases, known as TDP-43 proteinopathies., Various studies have identified a subset of amyotrophic lateral sclerosis (ALS) patients that possessTARDBP mutations, suggesting that TDP-43 gain of toxic function or loss of function is a causative factor in sporadic and/or familial ALS.\u2013 Mechanistic studies would be greatly facilitated by the availability of high-quality antibodies.Mutations inHere, we compared the performance of a range of commercially available antibodies for TDP-43 and characterized high-quality antibodies for Western blot, immunoprecipitation and immunofluorescence, enabling biochemical and cellular assessment of TDP-43 properties and function.TARDBP knockout (KO) cells., The first step was to identify a cell line(s) that expresses sufficient levels of TDP-43 to generate a measurable signal. To this end, we examined the DepMap transcriptomics database to identify all cell lines that express the target at levels greater than 2.5 log2 (transcripts per million \u201cTPM\u201d +1), which we have found to be a suitable cut-off . Commercially available HAP1 cells expressed theTARDBP transcript at RNA levels above the average range of cancer cells analyzed. Parental andTARDBP knockout HAP1 cells were obtained from Horizon Discovery (Our standard protocol involved comparing readouts from wild-type (WT) andscovery .TARDBP KO cell extracts and probed them side-by-side with all antibodies in parallel . Alexa-555-conjugated goat anti-mouse and anti-rabbit secondary antibodies are from Thermo Fisher Scientific (cat. number A21424 and A21429).All TDP-43 antibodies are listed inTARDBP KO cell lines used are listed in Cells were cultured in DMEM high glucose  containing 10% fetal bovine serum , 2 mM L-glutamate , 100 IU penicillin and 100 \u03bcg/ml streptomycin (Wisent cat. number 450201).Both HAP1 WT and HAP1 WT andTARDBP KO were collected in RIPA buffer  from Thermo Fisher Scientific (cat. number 0089901), supplemented with protease inhibitor from MilliporeSigma (cat. number P8340). Lysates were sonicated briefly and incubated for 30 min on ice. Lysates were spun at ~110,000 x g for 15 min at 4\u00b0C and equal protein aliquots of the supernatants were analyzed by SDS-PAGE and Western blot. BLUelf prestained protein ladder from GeneDireX (cat. number PM008-0500) was used.Western blots were performed as described in our standard operating procedure.Western blots were performed with precast midi 4-20% Tris-Glycine polyacrylamide gels from Thermo Fisher Scientific (cat. number WXP42012BOX) and transferred on nitrocellulose membranes. Proteins on the blots were visualized with Ponceau staining which is scanned to show together with individual Western blots. Blots were blocked with 5% milk for 1 hr, and antibodies were incubated overnight at 4\u00b0C with 5% bovine serum albumin (BSA)  in TBS with 0,1% Tween 20 (TBST) . Following three washes with TBST, the peroxidase conjugated secondary antibody was incubated at a dilution of ~0.2 \u03bcg/ml in TBST with 5% milk for 1 hr at room temperature followed by three washes with TBST. Membranes were incubated with ECL  prior to detection with the iBright\u2122 CL1500 Imaging System . Antibody-bead conjugates were prepared by adding 2 \u03bcg to 500 \u03bcl of Pierce IP Lysis Buffer from Thermo Fisher Scientific (cat. number 87788) in a 1.5 ml microcentrifuge tube, together with 30 \u03bcl of Dynabeads protein A- (for rabbit antibodies) or protein G- (for mouse antibodies) from Thermo Fisher Scientific . Tubes were rocked for ~2 hrs at 4\u00b0C followed by two washes to remove unbound antibodies.Immunoprecipitation was performed as described in our standard operating procedure.HAP1 WT were collected in Pierce IP buffer  , supplemented with protease inhibitor . Lysates were rocked for 30 min at 4\u00b0C and spun at 110,000\u00d7 g for 15 min at 4\u00b0C. 0.5 ml aliquots at 2.0 mg/ml of lysate were incubated with an antibody-bead conjugate for ~2 hrs at 4\u00b0C. The unbound fractions were collected, and beads were subsequently washed three times with 1.0 ml of IP lysis buffer and processed for SDS-PAGE and Western blot on precast midi 4-20% Tris-Glycine polyacrylamide gels. Prot-A: HRP  was used as a secondary detection system at a dilution of 0.4 \u03bcg/ml for an experiment where a rabbit antibody was used for both immunoprecipitation and its corresponding Western blot. HAP1 WT andTARDBP KO were labelled with CellTrackerTM green  or CellTrackerTM deep red  fluorescence dye, respectively. The nuclei were labelled with DAPI  fluorescent stain. WT and KO cells were plated on glass coverslips as a mosaic and incubated for 24 hrs in a cell culture incubator at 37\u00b0C, 5% CO2. Cells were fixed in 4% paraformaldehyde (PFA)  in phosphate buffered saline (PBS)  for 15 min at room temperature and then washed 3 times with PBS. Cells were permeabilized in PBS with 0,1% Triton X-100  for 10 min at room temperature and blocked with PBS with 5% BSA, 5% goat serum  and 0.01% Triton X-100 for 30 min at room temperature. Cells were incubated with IF buffer  containing the primary TDP-43 antibodies overnight at 4\u00b0C. Cells were then washed 3 \u00d7 10 min with IF buffer and incubated with corresponding Alexa Fluor 555-conjugated secondary antibodies in IF buffer at a dilution of 1.0 \u03bcg/ml for 1 hr at room temperature with DAPI. Cells were washed 3 \u00d7 10 min with IF buffer and once with PBS.Immunofluorescence was performed as described in our standard operating procedure.TM Green, Alexa fluor 555 and CellTrackerTM Red, respectively. Images had pixel sizes of 0.68 \u00d7 0.68 microns. Exposure time was set with maximal (relevant) pixel intensity ~80% of dynamic range and verified on multiple wells before acquisition. Since the IF staining varied depending on the primary antibody used, the exposure time was set using the most intensely stained well as reference. Frequently, the focal plane varied slightly within a single field of view. To remedy this issue, a stack of three images per channel was acquired at a z-interval of 4 microns per field and best focus projections were generated during the acquisition . Segmentation was carried out on the projections of CellTrackerTM channels using CellPose v1.0 on green (WT) and far-red (KO) channels, using as parameters the \u2018cyto\u2019 model to detect whole cells, and using an estimated diameter tested for each cell type, between 15 and 20 microns. Masks were used to generate cell outlines for intensity quantification. Figures were assembled with Adobe Illustrator.Images were acquired on an ImageXpress micro widefield high-content microscopy system (Molecular Devices), using a 20\u00d7/0.45 NA air objective lens and scientific CMOS camera , equipped with 395, 475, 555 and 635 nm solid state LED lights (Lumencor Aura III light engine) and bandpass emission filters  to excite and capture fluorescence emission for DAPI, CellTracker Various antibodies against TDP-43 are now commercially available from several companies, but their validation is still insufficient. This study comprehensively validated the performance of various antibodies, which will provide important information for researchers when they select TDP-43 antibodies for their studies. The procedures are detailed and carefully described, and together with the references, are well reproducible. Pathological TDP-43 is generally aggregated, fragmented, and hyperphosphorylated, which may affect antibody recognition. Thus, although it would be beyond the scope of this study, future validation using human patients\u2019 samples, as recommended by the reviewer #1, or of the recognition sites of each antibody would make this data even more valuable. The references 9, 12, and 13 were found to be available on Zendo, but it is difficult to reach them because of a lack of direct links. It is recommended that the DOI be appended.Are sufficient details of methods and materials provided to allow replication by others?YesIs the rationale for creating the dataset(s) clearly described?YesAre the datasets clearly presented in a useable and accessible format?YesAre the protocols appropriate and is the work technically sound?YesReviewer Expertise:Amyotrophic Lateral Sclerosis, Protein Aggregation, Organelle ContactI confirm that I have read this submission and believe that I have an appropriate level of expertise to confirm that it is of an acceptable scientific standard. Due to the continuing significance of morphological assay to clarify TDP-43 proteinopathy, the characteristics of the antibody are crucial to drawing convincing and replicable results. Numerous antibodies against TDP-43 are commercially available to meet the needs. As is often the case, however, the results could be misleading unless the antibodies are used with a sufficient understanding of their properties. However, such information is hardly accessible until our use. In this work, the authors comprehensively investigated the specificity and affinity of commercially available antibodies against TDP-43 by analyzing Western blotting, immunoprecipitation, and immunofluorescence. Another advantage of their work is adopting HAP1 cells through careful screening from transcription levels and TARDBP-KO cells. They successfully suggested several antibodies, which are conformation- and sequence-specific with high reactivity. Experimental protocols are clearly written, and the data presentation is compelling. This work deserves considerable attention because such information may help researchers minimize the time for optimization and acquire solid and replicable results. The weak points of their work is a lack of experiments using ALS-linked TDP-43 mutations or immunohistochemistry of ALS patients. However, those are beyond their scope, which awaits future validation.Are sufficient details of methods and materials provided to allow replication by others?YesIs the rationale for creating the dataset(s) clearly described?YesAre the datasets clearly presented in a useable and accessible format?YesAre the protocols appropriate and is the work technically sound?YesReviewer Expertise:Motor neuron disease, protein misfolding, antibody generationI confirm that I have read this submission and believe that I have an appropriate level of expertise to confirm that it is of an acceptable scientific standard. Thank you to Makoto Urushitani for your review of our publication. Although there is an abundance of commercial antibodies available for TDP-43, there lacks guidance to help researchers find the appropriate antibody for their experimental need. \u00a0Accordingly, we too agree that the characterization of antibodies is a determinant factor when drawing convincing and replicable results. As such, the YCharOS initiative has set out to solve the antibody reproducibility crisis by characterizing commercially available antibodies for human proteins. In terms of scoring the antibodies based on performance, we have found that for the most part, scientists interested in our reports have the expertise to interpret the antibody characterization data. Moreover, because we tested the antibodies under one set of conditions, and the scoring/recommendation would be valid only under this precise experimental setup and in the cell line used. That said, YCharOS reports serve as an invaluable guide pointing scientists to appropriate antibodies for their experimental needs. In the future, we hope to study the ALS protein-network in ALS patients, using the YCharOS reports as a guide to select the appropriate antibodies. As for now, our aim for this publication is to assist researchers in selecting high-quality TDP-43 antibodies for studying TDP-43 proteinopathies."}
+{"text": "SOD1, responsible for regulating oxidative stress levels by sequestering free radicals. Identified as the first gene with mutations in Amyotrophic lateral sclerosis (ALS),SOD1 is a determinant for studying diseases of aging and neurodegeneration. With guidance on well-characterized anti-SOD1 antibodies, the reproducibility of SOD1 research would be enhanced. In this study, we characterized eleven SOD1 commercial antibodies for Western blot, immunoprecipitation, and immunofluorescence using a standardized experimental protocol based on comparing read-outs in knockout cell lines and isogenic parental controls. We identified many high-performing antibodies and encourage readers to use this report as a guide to select the most appropriate antibody for their specific needs.Superoxide dismutase [Cu-Zn] 1 (SOD1), is an antioxidant enzyme encoded by the gene A hallmark of SOD1-associated ALS is the misfolding and aggregation of SOD1 into neurotoxic species induced by gene mutations. The disease mechanism in which this occurs remains unknown. Mechanistic studies would be greatly facilitated with the availability of high-quality antibodies.Here, we compared the performance of a range of commercially available antibodies for SOD1 and validated several antibodies for Western blot, immunoprecipitation and immunofluorescence, enabling biochemical and cellular assessment of SOD1 properties and function.\u2013 To identify a cell line that expressed adequate levels of SOD1 protein to provide sufficient signal to noise, we examined public proteomics databases, namely PaxDB and DepMap. HeLa was identified as a suitable cell line and thus HeLa was modified with CRISPR/Cas9 to knockout the correspondingSOD1 gene (Our standard protocol involved comparing readouts from wild-type (WT) and knockout (KO) cells.D1 gene .SOD1 KO cell extracts and probed them side-by-side with all antibodies in parallel, . Alexa-555-conjugated goat anti-mouse and anti-rabbit secondary antibodies are from Thermo Fisher Scientific (cat. number A21424 and A21429).All SOD1 antibodies are listed inSOD1 KO clone was generated with low passage cells using an open-access protocol available on Zenodo. Two guide RNAs were used to introduce a STOP codon in theSOD1 gene .HeLaSOD1 KO cell lines used are listed in Cells were cultured in DMEM high-glucose  containing 10% fetal bovine serum , 2 mM L-glutamate (Wisent cat. number 609065), 100 IU penicillin and 100 \u03bcg/mL streptomycin (Wisent cat. number 450201).Both HeLa WT and HeLa WT andSOD1 KO were collected in RIPA buffer  supplemented with 1x protease inhibitor cocktail mix . Lysates were sonicated briefly and incubated for 30 min on ice. Lysates were spun at ~110,000 x g for 15 min at 4\u00b0C. To quantify the HeLa cell lysates, a BCA protein assay kit  was used to measure protein concentration. Once the concentration was determined, equal protein aliquots of the supernatants were analyzed by SDS-PAGE and Western blot. BLUelf prestained protein ladder from GeneDireX (cat. number PM008-0500) was used.Western blots were performed as described in our standard operating procedure.Western blots were performed with large 8-16% polyacrylamide gels and transferred on nitrocellulose membranes. Proteins on the blots were visualized with Ponceau S staining  which is scanned to show together with individual Western blot. Blots were blocked with 5% milk for 1 hr, and antibodies were incubated overnight at 4\u00b0C with 5% bovine serum albumin (BSA)  in TBS with 0,1% Tween 20 (TBST) . Following three washes with TBST, the peroxidase conjugated secondary antibody was incubated at a dilution of ~0.2 \u03bcg/mL in TBST with 5% milk for 1 hr at room temperature followed by three washes with TBST. Membranes were incubated with Pierce ECL  prior to detection with the HyBlot CL autoradiography films . Antibody-bead conjugates were prepared by 2.0 \u03bcg of antibody to 500 \u03bcL of phosphate-buffered saline (PBS)  with 0,01% triton X-100  in a 1.5 mL microcentrifuge tube, together with 30 \u03bcL of protein A- (for rabbit antibodies) or protein G- (for mouse antibodies) Sepharose beads. Tubes were rocked overnight at 4\u00b0C followed by two washes to remove unbound antibodies.Immunoprecipitation was performed as described in our standard operating procedure.HeLa WT were collected in HEPES lysis buffer  supplemented with protease inhibitor. Lysates were rocked 30 min at 4\u00b0C and spun at 110,000 x g for 15 min at 4\u00b0C. One mL aliquots at 0.5 mg/mL of lysate were incubated with an antibody-bead conjugate for ~2 hours at 4\u00b0C. The unbound fractions were collected, and beads were subsequently washed three times with 1.0 mL of HEPES lysis buffer and processed for SDS-PAGE and Western blot on 8-16% polyacrylamide gels, as described above. Prot-A:HRP  and VeriBlot for IP Detection Reagent HRP  were used as secondary detection systems for an experiment where a rabbit antibody was used for both immunoprecipitation and its corresponding Western blot. Similarly, anti- mouse IgG for IP HRP  was used for an experiment where a mouse antibody was used for immunoprecipitation and it\u2019s corresponding Western blot.,, HeLa WT andSOD1 KO were labelled with a green and a far-red fluorescence dye, respectively. The fluorescent dyes used are from Thermo Fisher Scientific (cat. number C2925 and C34565). WT and KO cells were plated on glass coverslips as a mosaic and incubated for 24 hrs in a cell culture incubator at 37oC, 5% CO2. Cells were fixed in 4% paraformaldehyde (PFA)  in PBS for 15 min at room temperature and then washed 3 times with PBS. Cells were permeabilized in PBS with 0,1% Triton X-100 for 10 min at room temperature and blocked with PBS with 5% BSA, 5% goat serum  and 0.01% Triton X-100 for 30 min at room temperature. Cells were incubated with IF buffer  containing the primary SOD1 antibodies overnight at 4 \u00b0C. Cells were then washed 3 \u00d7 10 min with IF buffer and incubated with corresponding Alexa Fluor 555-conjugated secondary antibodies in IF buffer at a dilution of 1.0 \u03bcg/mL for 1 hr at room temperature. Cells were washed 3 \u00d7 10 min with IF buffer and once with PBS. Coverslips were mounted on a microscopic slide using fluorescence mounting media (DAKO).Immunofluorescence was performed as described in our standard operating procedure.Imaging was performed using a Zeiss LSM 880 laser scanning confocal microscope equipped with a Plan-Apo 40x oil objective (NA = 1.40). Analysis was done using the Zen navigation software (Zeiss). All cell images represent a single focal plane. Figures were assembled with Adobe Photoshop (version 24.1.2) to adjust contrast then assembled with Adobe Illustrator (version 27.3.1). In this Data Note, Ayoubi et al. tested eleven commercially available SOD1 antibodies in WT and CRISPR/Cas9-mediated knockout HeLa cells. They presented a comprehensive comparisons among these antibodies in Western blot, immunoprecipitation, and immunofluorescence staining using a well-defined experimental protocols. They identified some high-performing antibodies which seem to be appropriate for these experiments while a few other of them failed to produce satisfactory results. This report should be useful for readers who plan to perform the above experiments for selection of suitable antibodies.Please carefully check the whole text for typos, e.g. \u201c\u2026 an common \u2026\u201d; \u201cAn earlier version of this of this article\u2026\u201d.https://zenodo.org/record/5717516/files/2021-11-21-SOP-IP.pdf?download=1\u201d to ref#19. Same for references #13, 14, 15, 18.In the reference section, it may be better to add the ULR links for the papers. For example,\u00a0 they may add\u00a0\u201cIn the first paragraph of the Introduction, the authors mentioned that Sod1 is largely cytosolic but also found in the mitochondrial intermembrane space\u2026\u201d. Sod1 is also present in the nucleus. Please add the citation below and clarify this point.Nature Communications 5, 3446.  Tsang CK, Liu, Y., Thomas, J., Zhang, Y., Zheng, X.F. (2014) Superoxide dismutase 1 acts as a nuclear transcription factor to regulate oxidative stress resistance. \u00a0\u00a0\u00a0\u00a0\u00a0\u00a0 In general, the report was well-written and a few comments and recommendation are listed below:Are sufficient details of methods and materials provided to allow replication by others?YesIs the rationale for creating the dataset(s) clearly described?YesAre the datasets clearly presented in a useable and accessible format?YesAre the protocols appropriate and is the work technically sound?YesReviewer Expertise:Molecular and Cellular Biology, Molecular Neuroscience, CNS diseases, Stroke.I confirm that I have read this submission and believe that I have an appropriate level of expertise to confirm that it is of an acceptable scientific standard. Thank you for the revised manuscript.\u00a0I have no further comments to make.Are sufficient details of methods and materials provided to allow replication by others?YesIs the rationale for creating the dataset(s) clearly described?YesAre the datasets clearly presented in a useable and accessible format?YesAre the protocols appropriate and is the work technically sound?YesReviewer Expertise:Neuroscience, Antibody development, Antibody engineering, NanobodyI confirm that I have read this submission and believe that I have an appropriate level of expertise to confirm that it is of an acceptable scientific standard. Quantification of HeLa lysates: The authors need to provide information on how the HeLa lysates were quantified. Adding details about the quantification method will enhance the reroducibility and accuracy of the results.Elaboration of the results section: The results section needs to be more detailed and informative. Currently, it lacks clarity regarding the outcomes for each technique and the identification of the best-suited antibodies for each application.Table of tested antibodies: To facilitate better understanding for readers, the authors should consider providing a table that lists the antibodies tested along with the techniques they were evaluated in. This table could highlight which antibodies performed best for each technique, making it easier for researchers to identify suitable antibodies for their experiments. By addressing these minor comments and enhancing the results section, the study's findings will become more accessible and beneficial to the scientific community.In this study, Ayoubi et al, have characterized commercially available SOD1 antibodies for use in biochemical techniques, including Western Blotting, Immunoprecipitation, and Immunofluorescence, utilizing lysates from knockout cell lines and isogenic parental controls. The aim was to identify high-performing antibodies suitable for specific applications. While the authors have screened and compared the antibodies using different applications, there are some areas that require improvement, as outlined below:Are sufficient details of methods and materials provided to allow replication by others?YesIs the rationale for creating the dataset(s) clearly described?YesAre the datasets clearly presented in a useable and accessible format?YesAre the protocols appropriate and is the work technically sound?YesReviewer Expertise:Neuroscience, Antibody development, Antibody engineering, NanobodyI confirm that I have read this submission and believe that I have an appropriate level of expertise to confirm that it is of an acceptable scientific standard, however I have significant reservations, as outlined above. Thank you to Nishant N Vaikath for reviewing this article and providing a peer-review report. To respond to your first suggestion, we have added a short description of the quantification method used. Please review the Western Blot methods section of the second version of the article we have uploaded. As for your second and third points, YCharOs does not engage in result analysis nor do we offer explicit antibody recommendations. The primary goal of our initiative is to deliver high-quality antibody validation data to the scientific community. We have found that, for the most part, scientists viewing our articles have the expertise to interpret the characterization data independently, enabling them to make informed choices regarding the most suitable antibodies for their specific experimental needs. Recognizing the potential ambiguity of this point within the article, we have taken proactive measures to rectify the situation. As such, \u00a0a new paragraph has been added to the Results and Discussion section, explaining our reasonings as to why we do not recommend or score the antibodies tested. Thank you again for your suggestions, we always appreciate feedback on how to improve the reproducibility of our data. After reviewing the second version of the article, newly submitted, we hope that you chose to reconsider your approval status."}
+{"text": "Over the past several years, resonance energy transfer involving noble metallic nanoparticles has received considerable attention. The aim of this review is to cover advances in resonance energy transfer, widely exploited in biological structures and dynamics. Due to the presence of surface plasmons, strong surface plasmon resonance absorption and local electric field enhancement are generated near noble metallic nanoparticles, and the resulting energy transfer shows potential applications in microlasers, quantum information storage devices and micro-/nanoprocessing. In this review, we present the basic principle of the characteristics of noble metallic nanoparticles, as well as the representative progress in resonance energy transfer involving noble metallic nanoparticles, such as fluorescence resonance energy transfer, nanometal surface energy transfer, plasmon-induced resonance energy transfer, metal-enhanced fluorescence, surface-enhanced Raman scattering and cascade energy transfer. We end this review with an outlook on the development and applications of the transfer process. This will offer theoretical guidance for further optical methods in distance distribution analysis and microscopic detection. In the past few decades, nanomaterials science ,2,3,4,5 Noble metallic nanoparticles (NMNPs) have excellent resistance in corrosive environments and maintain oxidation resistance even at high temperatures. They were first reported as acceptors for energy transfer in 2001 . In addiIn energy transfer involving NMNPs, most of the energy donors are inorganic semiconductor quantum dots or organic fluorescent small molecules, while gold and silver NPs can be regarded as both donors and acceptors. The common energy transfer techniques, which can be divided into fluorescence resonance energy transfer (FRET), nanometal surface energy transfer (NSET), plasmon-induced resonance energy transfer (PIRET), metal-enhanced fluorescence (MEF), surface-enhanced Raman scattering (SERS) and cascade energy transfer (CET), have been widely applied and investigated in numerous fields. Among them, FRET describes the physics of energy transfer between two photosensitive molecules, facilitating real-time dynamic research on molecules under a variety of physiological conditions, but it is usually blind to distances above 10 nm, thus hampering the study of phenomena over long distances ,32. NSETIn recent years, the field has witnessed the rapid development of energy transfer involving NMNPs and their practical applications. In this review, firstly, we present the basic characteristics of NMNPs. Next, we examine and compare the progress of typical RET methods in recent years. Finally, we discuss the prospects for future trends in RET applications, as well as propose new paths for exploring the transfer process between materials and light.With the in-depth study of nanomaterials, NMNPs such as gold or silver have been gradually shown to have unique properties in the fields of biology, chemical sensing and nonlinear optics. When the size of NMNPs is reduced to the micrometer or even nanometer scale, the structure will experience numerous physical effects, which makes these materials different from bulk materials in optics. The basic characteristics of NMNPs are as follows:(1) Physical properties: The optical properties, such as scattering and extinction, of metallic particles attributed to surface plasmon resonance (SPR) were theorized by Mie\u2019s significant contribution in 1908. According to Mie\u2019s work , the totAs a typical property, fluorescence quenching can be investigated under various conditions, including femtosecond excitation and the stable state, to explore the interaction between fluorescence groups and NPs. In addition, noble metallic nanomaterials also have large specific surface areas and electrochemical properties.(2) Chemical properties: Covalent bonds can be formed in the reaction between noble metallic NPs and some mercapto ligands , which l(3) Radiative properties: Noble metallic NPs scatter strongly when they are near the frequency of SPR. There is a competitive relationship between scattering and absorption. The scattering intensity increases rapidly with increasing volume.(4) Non-radiative properties : The nonOwing to the special optical properties of noble metallic NPs, the signal can be captured at the level of only one particle by monitoring the change in plasmon resonance scattering in the process of energy transfer ,46,47. FIn 1949, F\u00f6rster put forward a theory to describe long-range molecular interactions and derived the transfer rate equation related to the molecular distance and spectral properties , so fluoR0 is the F\u00f6rster radius, which is the distance between the donor and acceptor for an efficiency of 50%. The F\u00f6rster distance R0 can be calculated with the following equation [N is Avogadro\u2019s number, n is the medium\u2019s refractive index, and J(\u03bb) is the spectral overlap integral of the donor\u2019s emission spectrum and the acceptor\u2019s absorption spectrum. The spectral overlap integral can be calculated according to Equation (3):\u22121cm\u22121, and \u03bb is in nanometers. The unit of J(\u03bb) is M\u22121cm\u22121nm4.When the distance between molecules is much smaller than the wavelength, FRET is dominant in the subwavelength range. The FRET efficiency is determined by the distance between acceptor and donor molecules, and it is inversely proportional to the sixth power of the distance. It is calculated as follows :(1)kT=1\u03c4equation :(2)R06=9At present, metallic NPs are widely used as substrates and studied with inorganic fluorescent materials to generate FRET systems. Among them, the diameter of gold or silver NPs ranges from 1 to 100 nm, which is similar to most biomolecules\u2019 sizes , so these NPs can be used as probes of the interior of biological tissues to detect the properties of biomolecules, which in turn reveals life processes at the molecular scale. However, the main disadvantage of FRET is the dependence on the photophysical properties of the fluorophores, which depend on the probe\u2019s interaction with the environment and the uncertainty in the position and orientation relative to biomolecules .Dvadyusha et al.  used theWang et al.  proposedDvadyusha et al.  first reWang et al.  designedPeng et al.  construc2+)-detecting sensor with high sensitivity was constructed by Wang et al. [2+-induced aptamers forming G-quadruplexes when Pb2+ is present in the environment, and the detection limit was as low as 4.1 nM, which demonstrated high selectivity in practical application, as shown in Similarly, a lead ion  as a spacer layer and dye bonding layer. The obtained multilayer concentric structure can simultaneously adjust the distance of donor\u2013acceptor pairs from the Ag core. Meanwhile, due to the presence of the Ag core, the F\u00f6rster efficiency increases by 4 times, and the range increases by nearly 30%, as can be seen in Using a core\u2013shell structure, Lessard-Viger et al.  fabricat2 monolayer. Rhodamine 590 perchlorate (R590) and oxazine 725 perchlorate (Ox725), two dyes dispersed randomly in the SiO2 monolayer, were connected by chemical bonds, as illustrated in Wang et al.  construcFor a planar structure, using a layer-by-layer assembly technique, a polymer electrolyte is used as a spacer layer, which can effectively adjust to the distance between semiconductor quantum dots and the layers of the noble metal, which not only makes the adjustment of the layer more precise but also eliminates the influence of energy transfer inside the quantum dot layer, which is caused by an uneven size. Lunz et al.  first prAfzalinia et al.  fabricatZhang et al.  confirme3N4) nanosheets and Ag\u2212C3N4/ZnO plasmonic hybrid heterojunctions. The prepared nanorod heterojunctions exhibited a good photoconductance response, which is due to the energy transfer from g-C3N4 to ZnO through sufficient band arrangement when the electron concentration is excessive, as illustrated in Bayan et al.  proposedIn all, as a molecular ruler, FRET involving noble metallic NPs has been widely used in applications such as biological analysis, fluorescence imaging and plasmon sensing. However, FRET is not sensitive when the distance is more than 10 nm, and the study of the long-distance range based on noble metallic NPs is still ongoing.Similar to fluorescence resonance energy transfer, when NMNPs act as the energy acceptor for resonance energy transfer, the process can be called nanometal surface energy transfer (NSET). NMNPs or nanopores can accept molecular dipoles as isotropically distributed dipole vectors due to the LSPR effect, opening the curtain on the NSET system. Compared with FRET, the best feature of NSET is that it overcomes the distance limitation, and it shows unique sensitivity when the distance is greater than 10 nm.Chance et al.  studied n = 6 and r0 = R0, and in the case of dipole\u2013surface energy transfer, n = 4 and r0 = d0 (characteristic distance length) [In the dipole\u2013dipole energy transfer case (FRET),  length) .In a study involving NSET published in 2001, Dubertret et al.  describe2+)-induced hammerhead ribozyme conformational changes through NSET for the first time; in addition, it was pointed out that when the distance is greater than 10 nm or dye quenching is used, NSET is more practical and useful than FRET. In 2008, Griffin et al. [2+ with AuNPs based on NSET to detect the transition state of the RNA unfolding reaction. They confirmed that NSET\u2019s time-dependent ability to clearly distinguish structural transitions between folded and unfolded states also confirmed that NSET is able to track transition states at a distance of more than 10 nm between the donor and acceptor, and the distances, which were used to track RNA folding transition states, were more than double those of the traditional dipole\u2013dipole coulombic energy transfer method, as illustrated in Since then, with the rapid development of gene technology, DNA has been linked to noble metallic NPs with fluorescent molecules, which is being used by more and more people. In 2005, Yun et al.  proposedn et al.  first st0 from 8 nm ) to nearly 40 nm. When the size of the particles increased from 5 nm to 70 nm, the quenching efficiency increased by more than three orders of magnitude.In 2009, Griffin et al.  reportedIn the next year, 2010, Chen et al.  used gol2) shell. The LSPR of the metal core was excited by light and generated a strong plasmonic near-field around the core\u2013shell\u2013shell NPs, and it was expected that the absorption efficiency of the dye molecules would be significantly improved, as depicted in In 2015, Prajapati et al.  introducLiu et al.  demonstr0 value of the NSET process from dye molecules to 2 nm gold nanospheres and compared resonance energy transfer (RET), Gersten\u2013Nitzan (GN) and CPS-Kuhn. It was concluded that NSET was the best model to measure the dye\u2019s quenching efficiency.Simultaneously, David\u2019s  group anMandal et al.  also obtSen et al.  first re2+) were included in the test solutions, DNA hybridization occurred between two probes, leading to the quenching of QDs. Furthermore, the system exhibited good selectivity for Hg2+ in the presence of other metal ions. Krishna et al. [2+ ions enabled rhodamine B adsorbed on the surface of gold NPs to desorb, which restored the blocking of the NSET process, as shown in 2+ ions in the range of 0 to 1 ppb and also found a detection limit of 100 ppt, as shown in Due to the rapid establishment of the theoretical NSET system, it has become increasingly popular for a great number of applications, such as analysis and detection. Li et al.  construca et al.  preparedKurdi et al.  presenteIn sum, as a molecular-scale technology, NSET has been widely used in applications such as optical biological imaging, specific ion detection, quantitative analysis, disease diagnosis, photocatalysis and energy storage, among others, and further in-depth research will broaden its application prospects.Plasmon-induced resonance energy transfer (PIRET) is a process in which surface plasmons transfer energy from the plasma nanostructure to the adjacent semiconductor through dipole\u2013dipole interactions. Similar to FRET, PIRET has wide applications in biomedical imaging, photocatalysis and molecular-scale analysis.Compared with dye donor molecules in FRET, NMNPs as PIRET plasmon donors have three main advantages: Firstly, the excitation intensity of the noble metallic NP donors is lower than that required by the dye molecule, which is due to the cross-section of the NMNPs being larger than that of the dye molecule . Secondly, compared with FRET, PIRET\u2019s energy transfer efficiency decays more slowly with increasing nanomolecular distances. Last but not least, PIRET is able to enhance molecular fluorescence through long-wavelength excitation light , rather than the excitation light of the molecular absorption peak. The earliest reports about PIRET date back to 2007. Liu et al.  successf2 @ Cu2O, which can be used to experimentally examine PIRET and FRET between Au and Cu2O. FRET and PIRET could be determined by measuring whether the coherent light was transferred from the plasmon to the semiconductor (PIRET) or from the semiconductor to the plasmon (FRET). The results demonstrated that PIRET might effectively use energy below the semiconductor\u2019s band edge to obtain visible and near-infrared sunlight, which is helpful to overcome the limitation of the band-edge energetics of a single semiconductor in photochemical and photovoltaic cells and improve the efficiency of solar energy collection.PIRET can also efficiently harvest sunlight due to its advantages of a large absorption coefficient, wide absorption spectrum and good stability. Li et al.  proposed2 cells through ethanol-induced apoptosis. They deliberately designed the absorption spectrum of dye molecules to effectively overlap with the scattering spectra of AuNPs, which can be seen in Although current research cannot clarify the occurrence and mechanism of PIRET, it is generally believed that the process of PIRET is similar to FRET. Namely, the energy exchange between NPs and small chromophore molecules is carried out through the interaction of dipoles. Choi et al.  describe2+) and Hg2+, respectively. When the closed-ring structure of the prepared rhodamine is consistent with the target, a specific reaction occurs with the ring-shaped rhodamine, with strong absorption at 550 nm. Additionally, through theoretical simulations, they also concluded that the quenching of scattered light was due to the increased dielectric constant of the coupled system.Gao et al.  prepared2 core\u2013shell NPs, as seen in 2 @ TiO2, the localized surface plasmon resonance band overlapped with the edge of the TiO2 absorption band, leading to PIRET, while the hot-electron transfer process was prevented by the SiO2 carrier.Similar research was conducted by Cushing et al. , who achYou et al.  concludeHsu et al.  deduced 2Ti2O7  enabled the generation of PIRET by inducing charge separation in NLTO with 600 nm solar radiation. The AuNPs not only acted as photosensitizers but also changed the flat-band potential, inhibited charge recombination and improved the charge extraction efficiency. The Au@Pt-NLTO/reduced graphene oxide (rGO) composite can be seen in oc increased by 0.37.Meng et al.  successfTherefore, as a new direction, PIRET continues to play a consistently significant role in the development of spectroscopy, photonics, biosensors and energy storage devices.Since Drexhage et al.  first re2 structure, can effectively improve the strength and stability, which is due to the modulation between fluorophores and the nanometal surface, which is the key to achieving maximum fluorescence enhancement. Lu et al. [2 core\u2013shell nanoflares. When the thickness of the SiO2 shell was changed, the fluorophore was limited to the surface. The distance could be precisely controlled, and the enhancement factor in a solution was up to 32 times, as shown in Guzatov et al.  systematu et al.  adopted 2 and Al2O3) were used, and the optimal radius of each wavelength was determined to achieve maximum fluorescence enhancement in both air and water media, which can be seen in Similarly, the transfer matrix method was put forward by Sun et al. to simulate the optimal conditions of the largest fluorescence induced on the metal\u2013dielectric core\u2013shell particles\u2019 surface through large-scale simulations . PlasmonZhang et al.  demonstr2 core\u2013shell structure that binds any fluorophore to the SiO2 shell. When an organic fluorophore (Rh800) was linked to the shell, the fluorescence signal was enhanced by 20 times (with Rh800) and the particle detectability was increased by 200 times, as illustrated in Aslan et al.  synthesi2@SiO2 + X  and varied the size of the core, the thickness of the silica shell and the concentration of the fluorophore. They derived the conditions under which the key parameters affected the optimal values through traditional spectroscopy, such as time-resolved fluorometry, UV-VIS spectrometry and transmission electron microscopy.On this basis, Asselin et al.  developeWith the development of the mechanism of MEF, researchers have prepared various fluorescent substrates through different methods. Yang et al.  fabricatFu et al.  used theZhao et al.  studied 2 polycaprolactone (PCL) substrates. The preparation process included the Stober process, photoreduction and electrospinning, as shown in 2 core\u2013shell. These core\u2013shell-structured NPs achieved MEF, with good water dispersibility, easy conjugation, excellent stability and strong fluorescence emission. When the separation distance was about 10 nm, the fluorescence enhancement could be up to 3.21-fold. Based on the switching characteristics of MEF, it was further applied to the detection of Cu2+ and inorganic pyrophosphate (PPi), as illustrated in Yun et al.  proposedFurthermore, the enhanced fluorescence signal can also be used for smartphone-based surface-plasmon-coupled emission (SPCE) ,132,133.Since the early achievement by Lakowicz\u2019s group ,136, SPCCommonly, research on MEF will be enhanced with existing biosensing methods related to cryosoret technology ,141, ferWith the study of plasmon-enhanced spectroscopy, the plasmon resonance characteristics of the metal surface have been widely used to realize the breakthrough of enhanced fluorescence. This kind of surface-enhanced fluorescence with high sensitivity, high efficiency and convenience has become an important research direction in the field of nanophotonics and plasmon sensing.6 times stronger than the measured Raman scattering signal in a solution, according to a large number of experiments and systematic theoretical calculations. They considered that this was a new kind of surface-enhanced effect caused by the rough surface and defined it as surface-enhanced Raman scattering (SERS). The corresponding spectrum was the SERS spectrum.In the 1970s, Fleischmann et al.  performeOver the years, researchers have conducted a large number of studies in the field of SERS-active substrates. The earliest SERS-active substrates were rough metal electrodes and metal island films . The sizAs new SERS substrates, metal nanocomposite structures have the physical properties of multiple materials and have been widely studied. Anema et al. prepared metal NPs with a core\u2013shell structure coated with a thin silicon dioxide film as an active substrate, which not only retained the structure\u2019s electromagnetic enhancement effect but also eliminated the spectral interference caused by the metal surface being exposed .4) and Ag nanocubes. The SERS enhancement effect and chemical stability were greater than those of individual silver nanocubic components, as shown in Samal et al.  describeChang et al.  observedQu et al.  analyzed2 @ Ag core\u2013shell structure that was modified with gold nanospheres to create isotropic hot spots to form a heterosatellitallic shell\u2013satellite structure, which acted as the SERS probe, and the enhancement factor was as high as 106, which can be seen in Chang et al.  developeIn addition, SERS technology has significant advantages in the field of cell monitoring. Xu et al.  presenteFurthermore, Kim et al.  reportedZhang et al.  analyzedIn short, SERS plays an important promoting role in life science, chemical materials, optical physics and other related disciplines due to its many advantages.As for traditional RETs, when the donor chromophore is stimulated, part of the energy obtained is transferred to the energy acceptor in a non-radiative way, thus completing the whole energy transfer process. In the process, the presence of energy donors and acceptors is relatively fixed, and the energy is transferred in a single direction . In fact, there is also another kind of energy transfer system, that is, cascade energy transfer (CET) ,162,163.The common different cascade energy transfer mechanisms can be divided into three types : (1) theCascade energy transfer involves more than one set of FRETs; this multistep energy transfer system has some advantages compared with single-step energy transfer: for example, a higher efficiency in a wide wavelength range, a larger Stokes shift and the easier detection of the final acceptor, though this process may need a longer reaction time.Belus\u00e1kova et al.  describe2 complexes, in which the cascade occurred between dyes coated on the surface of a nanosheet. The energy transfer rate was also systematically studied, as shown in Tsukamoto et al.  investigThe CET process based on the participation of metal NPs is worthy of further exploration for bionic optical synthesis, bioactivity analysis and cell membrane multivalence.It can be clearly observed that the above resonance energy transfer process is tied to the participation of noble metal NPs, as illustrated in In sum, the different resonance energy transfer processes involving plasmonic NPs from noble metals with their advantages, disadvantages and applications are shown in In conclusion, resonance energy transfer involving noble metallic NPs has become the focus of extensive applications in various fields. Here, the research progress based on resonance energy transfer involving noble metallic NPs, including fluorescence resonance energy transfer, nanometal surface energy transfer, plasmon-induced resonance energy transfer, metal-enhanced fluorescence, surface-enhanced Raman scattering and cascade energy transfer, is extensively reviewed, and the advantages, disadvantages and applications are all presented. This paper shows that the process of energy transfer has been not only used for synthesis and functionalization but also preliminarily proven to be superior for realizing analysis and detection to develop new transfer systems, which have important research value and practical significance.However, although many attempts have been made to apply resonance energy transfer to practice, there are still many unsolved problems with resonance energy transfer involving noble metallic NPs. Future work can be further expanded and deepened from the following aspects:(1) Under different energy transfer conditions, methods to adjust the physical morphology of the NPs and optimize the distance and coupling system between the NPs and the fluorescent group are frequently discussed. However, the way to obtain optimal transfer efficiency remains an urgent research target.(2) The mechanism of energy transfer between the local electric field around the NMNPs, the emission field near the fluorescent group and the emission field of the incident light remains to be further explored.(3) Methods to select the appropriate structure, such as core\u2013shell, flat layer, sandwich and other models, to obtain the optimal efficiency still needs more attention.(4) A series of energy conversion processes may be triggered in different kinds of energy transfer, such as photon-thermal-electricity  and phot"}
+{"text": "Dendrobium nobile, the NAC gene family was identified and analyzed by bioinformatics methods. In this study, we identified 85 NAC genes in Dendrobium nobile genome, and systematically analyzed the NAC gene family. We found that they were distributed unevenly in the nineteen chromosomes. The amino acid length of D. nobile NAC gene family (DnoNACs) ranged from 80 to 1065, molecular weight ranged from 22.17 to 119.02 kD, and isoelectric point ranged from 4.61~9.26. Its promoter region contains multiple stress responsive elements, including light responsive, gibberellin-responsive, abscisic acid responsiveness, MeJA-responsiveness and drought-inducibility elements. Phylogenetic analysis indicates that the D. nobile NAC gene family is most closely related to Dendrobium catenatum and Dendrobium chrysotoxum. Analysis of SSR loci indicates that the fraction of mononucleotide repeats was the largest, as was the frequency of A/T. Non-coding RNA analysis showed that these 85 NAC genes contain 397 miRNAs. The collinearity analysis shows that 9 collinear locis were found on the chromosomes of D. nobile with Arabidopsis thaliana, and 75 collinear locis with D.chrysotoxum. QRT-PCR experiment under different salt concentration and temperature conditions verified the response mechanism of DnoNAC gene family under stress conditions. Most DnoNAC genes are sensitive to salt stress and temperature stress. The results of this study provide a reference for further understanding the function of NAC gene in D. nobile.NAC transcription factors are an important genes that regulate plant growth and development, and can regulate functions such as fruit ripening in plants. Based on genome data of  Dendrobium nobile, a perennial herb of the genus Dendrobium in the Orchidaceae family, is a traditional herbal medicine found primarily in tropical and subtropical Asia  is a protein molecule with a specific structure in eukaryotes that has a regulatory influence on gene transcription , and tra domains . NAC tral domain . A typicar level . Meanwhielopment . The C-telopment , which ielopment .NAC family perform some functions similarly, they have distinct roles during various stages and parts of plant growth and development , and the resulting DnoNAC proteins were compared in multiple sequences to construct an phylogenetic tree to analyze their molecular evolutionary relationships, with the goal of laying the groundwork for future research on the functions of the D. nobile NAC.Since the first discovery of thaliana , Zanthoxungeanum , potato ungeanum , melon   Co.,Ltd. The qRT-PCR experiments in this study were all completed on fluorescence quantitative PCR instrument (qToWer3G) of the Analytick Jena AG. The number of replicates of biological samples in each treatment group and control group is 3, and the number of machine replicates on fluorescence quantitative PCR is 3. All DnoNAC gene primers designed by TBtools Batch q-RT-PCR primer design tool used in the qRT-PCR validation experiment in this study are shown in The whole genome sequences, protein sequences and gene annotation files of nih.gov) . The NACab.org/) . The genhttp://smart.embl-heidelberg.de/)  . The famerg.de/) . ChromosD. nobile NAC protein sequences were aligned using the Clustalx2.1 program, and the NGPhylogeny.fr online tool (https://NGPhylogeny.fr) was used to build a phylogenetic tree of D. nobile NAC proteins, which was subsequently ornamented using the ITOL online website (https://itol.embl.de/) (NAC gene structure of D. nobile was mapped using the GSDS2.0 (http://gsds.cbi.pku.edu.cn/) tool to analyse its exon and intron structures (http://meme-suite.org/tools/meme) was used to examine the conservative motifs in the D. nobile NAC protein sequences (DonNAC genes were identified on NCBI\u2019s Conserved Domain Database(https://www.ncbi.nlm.nih.gov/Structure/bwrpsb/bwrpsb.cgi)  for prediction of cis-acting element types, positions, and numbers, filtered and counted in Excel 2019, and the obtained cis-acting element position information was used for visualization in TBtools v1.108 (mbl.de/) . The samructures . MEME(htequences . The maxequences . Conservpsb.cgi) . The upss v1.108 .http://web.expasy.org/protparam/) was used to analyze the number, molecular weight(MW), isoelectric point information(pI), total number of positively or negatively charged residues, instability index, grand average of hydropathicity(GEAVY), and aliphatic index (https://www.genscript.com/wolf-psort.html) (The ExPASY website\u2019s ProtParam tool (ic index  of aminort.html) .https://services.healthtech.dtu.dk/services/TMHMM-2.0)  (https://npsa-prabi.ibcp.fr/cgi-bin/npsa_automat.pl?page=npsa_sopma.html) was used to predict the secondary structure of DnoNAC proteins (https://swissmodel.expasy.org/)  , and thetscale/) . The SOPproteins . The tersy.org/) .NAC gene family in D. nobile , codon adaptation index (CAI), codon bias index (CBI) and effective number of codons (ENC) were obtained using the software CodonW1.4.2. The software TBtools v1.108 was used to create a Heatmap clustering of codons RSCU of . nobile .D. nobile proteins themselves to obtain blast results. The GFF3 Gene Position(Info.) Parse tool was used to acquire all genes\u2019 positions, and the Advanced Circos tool was used to visualize the data  in Tbtools v1.120 was used to compute the nonsynonymous substitution rate(Ka), synonymous substitution rate(Ks) and selective strength(Ka/Ks) values.The TBtools software Fasta Stats tool was used to process the genome sequence to obtain chromosome length files, the Gene Density Profile tool was used to process the gene structure annotation information to obtain gene density files, and the One Step MCScanX-Super Fast tool was used to compare the the data . The simDnoNAC genes were predicted using online software psRNATarget (https://www.zhaolab.org/psRNATarget/) with default parameters  with default parameters . The NAC gene family in D. nobile and Arabidopsis thaliana were separated into 15 subclades (designated Group1 to Group15), with 85 DnoNAC genes dispersed on 14 subclades excluding Group4. Group15 contains the most members at 14 subclades, followed by Group5 with 11 and Group9 with 10 DnoNAC members, Group6 contains 3 DnoNAC members, Group3 and Group13 contain the least number of members at 2. In general, Group 1 members are the most primitive, while Group 15 members are the most rapidly developing , each containing 2 to 15 members. Group6 contains the most members at 15, followed by Group9 with 14 and Group2 with 11 DnoNAC members, Group5 contains 5 DnoNAC members, Group7 and Group11 contain the least number of members at 2. In general, Group 1 members are the most primitive, while Group 12 members are the most rapidly developing , each containing 1 to 23 members. Group4 contains the most members at 23, followed by Group1 with 15 and Group9 with 13 DnoNAC members, Group2 contains 2 DnoNAC members, and Group7 contains the least number of members at 1. In general, Group 1 members are the most primitive, while Group 9 members are the most rapidly developing , with 85 DnoNAC genes dispersed on 10 subclades excluding Group1 and Group7. Group6 and Group8 contain the most members at 20, followed by Group3 with 10 and Group10 with 9 DnoNAC members. Combined with the distribution of these genes on the phylogenetic tree, it is known that the D. nobile NAC gene family is most closely related to Dendrobium catenatum and Dendrobium chrysotoxum, followed by Brachypodium distachyon, and Zea mays is the most distant elements. Abscisic acid responsiveness element was found in 71 family members, with the promoter region of DnoNAC78 having the highest (13 light responsive elements). MeJA-responsiveness element was found in 67 family members, with the promoter region of DnoNAC54 having the highest (18 light responsive elements). Anaerobic induction element was found in 64 family members, with the promoter region of DnoNAC11 having the highest (5 light responsive elements). Gibberellin-responsive element was found in 43 family members, with the promoter region of DnoNAC17 and DnoNAC27 having the highest (3 light responsive elements). Drought-inducibility element was found in 40 family members, with the promoter region of DnoNAC15 having the highest (3 light responsive elements). Salicylic acid responsiveness element was found in 40 family members, with the promoter region of DnoNAC7 and DnoNAC68 having the highest (3 light responsive elements). Auxin-responsive element was found in 36 family members, with the promoter region of DnoNAC13, DnoNAC21, DnoNAC30, DnoNAC47, DnoNAC54 and DnoNAC65 having the highest (2 light responsive elements). Zein metabolism element was found in 36 family members, with the promoter region of DnoNAC73 having the highest (3 light responsive elements). Root specific element was only found in 1 family members, with the promoter region of DnoNAC10. Seed-specific regulation element was found in 36 family members, with the promoter region of DnoNAC18 having the highest (3 light responsive elements). Low-temperature responsiveness element was found in 31 family members, with the promoter region of DnoNAC30 having the highest (4 light responsive elements). Meristem expression element was found in 30 family members, with the promoter region of DnoNAC42 having the highest (3 light responsive elements). Defense and stress responsiveness element was found in 27 family members, with the promoter region of DnoNAC22 and DnoNAC47 having the highest (3 light responsive elements). Endosperm expression element was found in 23 family members, with the promoter region of DnoNAC19 having the highest (4 light responsive elements). Anoxic specific inducibility element was found in 9 family members, with the promoter region of DnoNAC29, DnoNAC50, DnoNAC54 and DnoNAC55 having the highest (2 light responsive elements). Flavonoid biosynthetic genes regulation element was found in 6 family members, with the promoter region of DnoNAC1, DnoNAC4, DnoNAC51, DnoNAC64, DnoNAC72 and DnoNAC80 having the highest (1 light responsive elements). Wound-responsive element was found in 5 family members, with the promoter region of DnoNAC4, DnoNAC15, DnoNAC66, DnoNAC74 and DnoNAC77 having the highest (1 light responsive elements). Members of the DnoNAC family contain a variety of cis-elements, and it is anticipated that these family members serve critical roles in D. nobile\u2019s response to environmental stress and hormone control  were expected to have the highest number of TFBSs. The prediction of TFBSs provides a basis for further identification and validation of target genes.The analysis of transcription factor binding sites revealed that all D. nobile NAC protein sequences were submitted to the ProtParam online program to calculate its length, Mw, pI, and other properties. The results showed that the total number of amino acids of D. nobile NAC protein family members ranged from 80 aa to 1065 aa, with DnoNAC21 having the highest number of amino acids (1065 aa) and DnoNAC27 having the lowest number of amino acids (80 aa). The average length of amino acid is 349, and the molecular weight ranges from 22.17 to 119.02 kD. Its pI ranges from 4.61 to 9.26, covering a wide range, with 29 members of its family having a theoretical isoelectric point greater than 7 and the remaining family members having a theoretical isoelectric point less than 7. As a result, the majority of members are acidic proteins. The majority of the 85 family members have instability coefficients above 40%, with only 16 members having instability index between 27.53% and 39.88%, the range of Aliphatic index of the family members between 51.78 and 86.85 indicates the wide variation in the thermal stability of the family proteins. The grand average of hydropathicity of the family members were all negative, with the greatest being -0.352 for member DnoNAC44 and the lowest being -0.918 for member DnoNAC14. 54 members have a greater number of negatively charged residues than positively charged residues, indicating a negative charge, 8 members have an equal number of negatively charged residues as positively charged residues, indicating electric neutrality, and the remaining 23 members have a greater number of positively charged residues than negatively charged residues, indicating a positive charge.The The subcellular localization results of the DnoNAC protein family shows that 70 DnoNAC members were found in the nucleus, six members are found in chloroplast , three members were found in cytoplasm . three members were found in the mitochondria, including DnoNAC55, DnoNAC76 and DnoNAC83, three members were found in the peroxisome, including DnoNAC16, DnoNAC17 and DnoNAC43 Table\u00a01.The analysis of transmembrane structural domains of the protein members encoded by the DnoNAC protein family revealed that only DnoNAC11, DnoNAC37, DnoNAC42, DnoNAC59, DnoNAC74, and DnoNAC80 of the 85 DnoNAC family members have transmembrane structural domains, implying that the family proteins are transmembrane proteins to 73.62% (DnoNAC20), the proportion of alpha helix is 12.84% (DnoNAC34) to 33.90% (DnoNAC21), the proportion of extended strand structure is 6.28% (DnoNAC20) to 21.59 (DnoNAC36), and the lowest proportion of beta turn is 1.25% (DnoNAC27) ~ 8.74% (DnoNAC24). Except for DnoNAC14, DnoNAC26, DnoNAC27, DnoNAC34, DnoNAC36, DnoNAC40, DnoNAC46, and DnoNAC54, whose secondary structure ratios were random coil > extended strand \u2265 alpha helix > beta turn, the remaining 74 members\u2019 secondary structure ratios were random coil > alpha helix > extended strand > beta turn, indicating that side chain interactions have a significant impact on DnoNAC proteins. Groups D, E, and F each have one family member. In conclusion, the D. nobile NAC family members have a higher fraction of random coil, whereas other structures are scattered across the protein structure, which is consistent with the secondary structure predictions  varied from 0.11 to 0.22, with a mean value of 0.17, showing that the D. nobile NAC gene family has a low preference for codon selection. The frequency of optimal codons(Fop) varied from 0.31 to 0.50, with a mean value of 0.37. The codon bias index(CBI) ranged from 0.16 to 0.15, with a mean value of -0.07. The effective number of codons(ENc) varied from 45.56 to 59.70, with a mean value of 53.32, indicating that family members are more varied from one another, have relatively modest levels of expression, and show a low preference for codons when encoding amino acids. The number of synonymous codons (L_sym) ranged from 97 to 12736, with a mean of 1616.54. Total number of amino acids (L_aa) ranged from 100 to 13179, with a mean of 1674.25, and the aromaticity of protein (Aromo) ranged from 0.06 to 0.19, with a mean of 0.12 (The average content of the third base of the codon was T3s > A3s > C3s > G3s. The average GC content(GC) of the codon was 0.29-0.58, with a mean value of 0.40. GC of silent 3rd codon posit(GC3s) was 0.27-0.58, with a mean value of 0.38. According to an analysis of codon-related parameters of the D. nobile NAC family members have a strong preference for this codon (There are 27 high-use codons(RSCU>1), 13 codons of which end in U, 11 end in A, 2 end in G, and 1 end in C.. In 32 low-usage codons, 16 end in C, 10 end in G, 3 end in A and 3 end in U. This indicates that the preference for high-use codons ends in U and the preference for low-use codons ends in C. In addition, the RSCU value for AGA is greater than 2, revealing that is codon Table\u00a03NAC gene family in D. nobile revealed that DnoNAC67 and DnoNAC85 were clustered separately, DnoNAC30 and DnoNAC35 were clustered together, and the remaining genes were clustered together. Members of the same clade show similar codon usage biases, and codons in the same clade have essentially identical RSCU value sizes among different members  during organism evolution, with duplicated genes providing control over the physiological and morphological evolution of plants . The linelopment Figure\u00a08Ka/Ks is the ratio of the non-synonymous substitution rate (Ka) to the synonymous substitution rate (Ks) of two protein-coding genes, and it may be used to evaluate if this protein-coding gene is under selection pressure. The Ka/Ks ratios were all less than 1, so the genes were subject to purifying selection in evolution Table\u00a04.NAC genes in various species, collinearity analysis of D. nobile and Arabidopsis NAC gene family was performed. The results revealing that 8 members of the D. nobile NAC gene family have a source relationship with Arabidopsis , and the most homologous gene pairs exist in chr14. The majority of miRNA mature sequences (5\u2019 \u2013 3\u2019) were 21 bp in length, accounting for 76.20% of all sequences. The miRNA mature sequences (5\u2019 \u2013 3\u2019) were 19 bp and 26 bp in length each accounting for 0.03% of all sequences , suggesting that A/U(T) was utilized more frequently than G/C in the coding sequence codon.NAC gene family in D. nobile, it can be seen that the D. nobile NAC gene family can be divided into 11 subfamilies and the family members are unevenly distributed in each subfamily. Combining the results of collinearity analysis and the phylogenetic tree of NAC gene family in D. nobile and Arabidopsis NAC gene family, it was discovered that there are eight pairings of genes with a high degree of similarity. Except for DnoNAC46 and AT1G76420.1, which are found in neighboring subclades, the remaining seven pairs of genes are found on the same subclade and are quite near together, presumably their biological functions are also similar. Based on the phylogenetic tree of D. nobile and other typical species, it is known that the D. nobile NAC gene family is most closely related to Dendrobium catenatum and Dendrobium chrysotoxum.From the phylogenetic tree of NAC family has a substantial amount of cis-acting elements associated to light sensitivity, hormone response, biotic and abiotic stress response that are speculated to have a role in D. nobile growth and development, stress tolerance, and hormone signaling. This is consistent with the findings of Saidi et\u00a0al. on the NAC gene family in other plants  were 21 bp in length. Analysis of SSR loci through MISA-web software indicates that the fraction of mononucleotide repeats was the largest, as was the frequency of A/T. AT/GC is the prominent motif for dinucleotides. Excluding compound nucleotides, The SSR motif type grow with the number of motif, while the number of SSR loci decreases with the number of motif.DnoNAC genes in D. nobile genome were identified, with its amino acid length ranged from 80 to 1065. Its promoter region contains multiple stress responsive elements, including light responsive, gibberellin-responsive, abscisic acid responsiveness, MeJA-responsiveness and drought-inducibility elements. NAC gene family in D. nobile is most closely related to that of Dendrobium catenatum and Dendrobium chrysotoxum. The fraction of mononucleotide repeats in its SSRs was the largest, as was the frequency of A/T. These 85 DnoNAC genes contain 397 miRNAs. The collinearity analysis shows that 9 collinear locis were found on the chromosomes of D. nobile with Arabidopsis thaliana, and 75 collinear locis with D.chrysotoxum. The response mechanism of DnoNAC gene family in leaves of D. nobile seedlings to salt stress, low temperature and high temperature stress was verified by qRT-PCR experiment. These results provide a reference for further understanding the function of NAC gene family in D. nobile.In this study, 85 The datasets presented in this study can be found in online repositories. The names of the repository/repositories and accession number(s) can be found in the article/CF: Experimental design, Resources, Funding acquisition, Writing-original draft,Writing-review & editing. MYL: Investigation, Experimental operations, Formal analysis, Visualization, Writing-original draft. All authors contributed to the article and approved the submitted version."}
+{"text": "The small \u03b8E and faintness of the lensing galaxy are very unusual, highlighting the importance of supernovae to fully characterize the properties of galaxy-scale gravitational lenses, including the impact of galaxy substructures.Detecting gravitationally lensed supernovae is among the biggest challenges in astronomy. It involves a combination of two very rare phenomena: catching the transient signal of a stellar explosion in a distant galaxy and observing it through a nearly perfectly aligned foreground galaxy that deflects light towards the observer. Here we describe how high-cadence optical observations with the Zwicky Transient Facility, with its unparalleled large field of view, led to the detection of a multiply imaged type Ia supernova, SN Zwicky, also known as SN 2022qmx. Magnified nearly 25-fold, the system was found thanks to the standard candle nature of type Ia supernovae. High-spatial-resolution imaging with the Keck telescope resolved four images of the supernova with very small angular separation, corresponding to an Einstein radius of only  SN 2022qmx, dubbed SN Zwicky, is a rare, gravitationally lensed type Ia supernova, magnified by a factor of 25, discovered by the Zwicky Transient Facility. Follow-up Keck observations reveal four multiple images with unusually small separation. In this pioneering work he considered the case where both the lens and the magnified background source were stars in our Galaxy. Einstein concluded that the deflection angles were too small to be resolved with astronomical instruments. It was Zwicky2 who one year later pointed out that, if the source was extragalactic, entire galaxies or clusters of galaxies could be considered as gravitational deflectors. Hence, the image separation between multiple images of the source could be large enough to be resolved by astronomical facilities, as the size of the image separation scales with the lens mass and distance as the Einstein radius, M\u2299 is the mass of the Sun, Ml and Dl are the lensing mass and lens angular size distance and Ds and Dls are the distances from the observer to the source and between the lens and the source, respectively.Our understanding of gravitational lensing due to the curvature of spacetime, and the analogy with the deflection of light in optics, dates back to the work of Einstein in 19365 and references therein). PS1-10afx was the first highly magnified type Ia supernova (SN Ia) discovered. However, the lensing interpretation was made three years after the explosion7; by then the SN was too faint to resolve multiple images. Since then, the use of wide-field optical cameras in robotic telescopes at the Palomar Observatory has led to notable breakthroughs. In ref. 8 we reported the discovery of a multiply imaged SN Ia, iPTF16geu (SN 2016geu), by the intermediate Palomar Transient Factory (iPTF), a time-domain survey using a 7.3\u00b02 camera on the P48 (1.2\u2009m) telescope from 2013 to 2017. In 2018, a new camera was installed9 with a field of view of 47\u00b02. The project, known as the Zwicky Transient Facility (ZTF)11, has been monitoring the northern sky with a 2\u20133\u2009d cadence in at least two optical filters for the past four years12. The very large sky coverage makes ZTF well suited to search for rare phenomena, such as gravitational lensing of supernovae. On the other hand, the distance (redshift) probed by ZTF is limited by the relatively small mirror of the telescope, light pollution, non-optimal atmospheric conditions and only having three optical filters at the P48 telescope. Furthermore, ZTF typically obtains an image quality (angular resolution) of 2\u2033 full-width at half-maximum (FWHM), and the camera has relatively large 1\u2033 pixels. Hence, in most instances, it is practically impossible to spatially resolve multiple-image systems with ZTF. Instead, the search for lensed sources makes use of the standard candle nature of type Ia supernovae, that is, they have nearly identical peak luminosities. These explosions are used as accurate distance estimators in cosmology, which led to the discovery of the accelerated expansion of the universe (ref. 13 and references therein).Besides the many observations of lensed galaxies and quasars, the feasibility of observing strong gravitational lensing of explosive transients in the distant universe has only been demonstrated in recent years , used to spectroscopically classify about ten supernovae every night as part of the Bright Transient Survey (BTS), where transients brighter than 19\u2009mag are classified within timescales of a few days, aiming to obtain >95% spectroscopic completeness to 18.5\u2009mag or brighter15. Besides providing the classification of the transients, the SEDM spectrum is used to measure the SN redshift.In addition to an imaging survey telescope, ZTF has access to a low-spectral-resolution integral-field spectrograph, the SED Machine (SEDM)z\u2009=\u20090.2, where there is essentially negligible sensitivity for detection in the BTS, unless the SN is greatly magnified by an intervening deflector. This was the case for SN Zwicky , located at right ascension 17\u2009h 35\u2009min 44.32\u2009s and declination 4\u00b0 49\u2032 56.90\u2033 (J2000.0), where an SEDM spectrum from 2022 August 21 showed it to be an SN Ia at z\u2009=\u20090.35, as shown in Fig. 16.Lensed system candidates are selected by ZTF for further spectroscopic screening when an SN Ia is found at a redshift above z\u2009=\u20090.3544, as shown in the bottom panels of Fig. ii doublet \u03bb\u03bb3,933,\u20093,968 was found in absorption lines redshifted to z\u2009=\u20090.22615, the location of the deflecting galaxy.Spectroscopic observations following the time evolution of the SN were carried out using multiple facilities: the 2.56\u2009m Nordic Optical Telescope in the Canary Islands, the Keck observatory in Hawaii, the 11\u2009m Hobby\u2013Eberly Telescope at the McDonald Observatory in Texas and the European Southern Observatory (ESO)\u2019s 8\u2009m Very Large Telescope (VLT) at the Paranal Observatory in Chile. In particular, multiple narrow emission and absorption lines of the SN host galaxy were found with the Low Resolution Imaging Spectrometer (LRIS)/Keck and the Multi-Unit Spectroscopic Explorer (MUSE)/VLT, refining the source redshift to 17, yielding an image quality of 0.09\u2033 FWHM in the J band centred at 1.2\u2009\u03bcm, shown in Fig. The discovery from ZTF was also followed up with high-spatial-resolution instruments. Observations with laser guide star enhanced seeing at the VLT with the High Acuity Wide-field K-band Imager (HAWK-I) imaging camera in the near infrared, and optical spectrophotometry with MUSE, reduced the point spread function (PSF) width to about 0.4\u2033. However, this was still not enough to resolve the system. On 2022 September 15, multiple images of the system were resolved at near-infrared wavelengths at the Keck telescope, using the Laser Guide Star Aided Adaptive Optics (LGSAO) with Near-IR Camera 2 (NIRC2)16, a previously approved programme aimed to target lensed supernovae by the LensWatch collaboration resolved the multiple images of SN Zwicky using the optical filters F475W, F625W and F814W  on the UVIS/WFC3 camera on the Hubble Space Telescope (HST)18. A detailed description of the HST observations of SN Zwicky is presented in ref. 19.On September 21, following our announcement of the discovery20, including corrections for lightcurve shape and colour excess given the SN redshift, as well as the extinction in the Milky Way in the direction of the SN . Furthermore, the four resolved SN images were used to explore the possibility of additional reddening by dust in the lensing galaxy. Unaccounted-for dimming of light would lead to an underestimation of the lensing amplification. The HST and NIRC2 observations for each SN image were compared with the SN Ia spectral template from ref. 21, allowing for possible differential dust extinction in the lens following the reddening law in ref. 22.Figure x1 and c. The time delays were constrained by a prior on the image flux ratios from the NIRC2 observations shown in Fig. tAB\u2009=\u2009\u22120.4\u2009\u00b1\u20092.9, \u0394tAC\u2009=\u2009\u22120.1\u2009\u00b1\u20092.3 and \u0394tAD\u2009=\u2009\u22120.1\u2009\u00b1\u20092.7 (in units of days), where the indices A\u2013D refer to the SN images in Fig. No evidence for differential extinction between the different images was found. The lightcurve fit model included the four individual SN images, described by the SALT2 model with arbitrary time delays, but otherwise sharing the same lightcurve shape and colour parameters, x1\u2009=\u20091.083\u2009\u00b1\u20090.094 and c\u2009=\u2009\u22120.007\u2009\u00b1\u20090.007. The lack of colour excess confirms that differential extinction is negligible. Since the lightcurve parameter errors do not include the model covariance, we conservatively add the SALT2 model error floor of \u03c3(x1)\u2009=\u20090.1 and \u03c3(c)\u2009=\u20090.027\u2009mag (ref. 23) in quadrature to the fit errors. Using the inferred apparent magnitude and the SALT2 parameters above, we find a total magnification of \u0394m\u2009=\u2009\u22123.44\u2009\u00b1\u20090.14\u2009mag, assuming standard cosmological parameters from ref. 24 and a restframe B-band SN Ia peak absolute magnitude of \u221219.4\u2009mag for the average SN Ia lightcurve width and colour, and intrinsic brightness scatter of 0.1\u2009mag. Since the inferred stellar mass of the host galaxy is M\u2605\u2009\u2272\u20091010\u2009M\u2299, mass-step corrections for the SN Ia absolute magnitude as suggested in ref. 25 are not required. In summary, we find that, including the four images, SN Zwicky is 23.7\u2009\u00b1\u20093.2 times brighter than the observed flux of normal type Ia supernovae at the same redshift, after applying colour and lightcurve shape corrections.The fitted SN model parameters are 27 for the lens potential, we report an ellipticity \u03f5e\u2009=\u20090.35\u2009\u00b1\u20090.01 and \u03b8E\u2009=\u20090.1670\u2009\u00b1\u20090.0006\u2033. The mass enclosed within the ellipse with semi-major axis 0.78\u2009kpc and semi-minor axis 0.51\u2009kpc is M\u2009=\u2009(7.82\u2009\u00b1\u20090.06)\u2009\u00d7\u2009109\u2009M\u2299. The lens model predictions for the time delays are in excellent agreement with the fitted values from the lightcurves in Fig. The Keck NIRC2 J-band image was used to obtain a lens model to account for the observed SN image positions, irrespective of their fluxes. Assuming a singular isothermal ellipsoid29. Since microlensing effects are capable of perturbing magnifications without altering image locations, these were also put forward to explain the observed flux ratios of iPTF16geu30, displaying differences between the observed and modelled image flux ratios of similar magnitudes. Probing microlensing in these central regions opens a new window to directly measure the central stellar initial mass function31 and test claims that the initial mass function may be heavier in the centres of galaxies32. As detailed in M\u2299, if the discrepancy from the smooth lens model is caused by microlensing. From the lack of further image splitting of the four individual SN images, we infer an upper limit for the substructure mass of 3\u2009\u00d7\u2009107\u2009M\u2299.Interestingly, the individual image magnifications predicted for SN Zwicky by the smooth macro lens model are inconsistent with the observed flux ratios. According to the lensing model, the observed fluxes of the SN images A and C are factors of >4 and >2 too large, respectively, compared with images B and D. Given the small time delays, this discrepancy cannot be accounted by different phases between the SN images. Other explanations need to be considered: for example, excess magnification and demagnification from milli- and microlensing effects arising from stars and substructure in the lens galaxyTo check the impact of added macro lens model complexity, we have studied cases where the lens mass distribution is modelled with two matter components; one where the surface mass density follows the lens light distribution , and a second one introducing a dark matter halo with additional flexibility on density profiles. In spite of the added extra complexity, the quality of the fit to the SN image positions does not improve, and induces shifts in the predicted flux ratios only below 5%, that is, very small in comparison with the observed flux ratio anomalies.33 to use time delays for strongly lensed supernovae to measure the Hubble constant. This will require systems with time delays of several days, that is, longer than for SN Zwicky. The small physical scale of the lens probed by SN Zwicky, as well as iPTF16geu8, make these supernovae unique tracers for uncovering a population of systems that otherwise would remain undetected, as shown in Fig. The demonstrated ability to discover multiply imaged supernovae makes it feasible to accomplish Refsdal\u2019s pioneering proposal 34. SN Zwicky16 was discovered under the BTS programme15. The first detection of the SN was in a ZTF g-band image from 2022 August 1. It was saved to the BTS as an SN candidate by on-duty scanners on August 335 and subsequently assigned to the queue for spectroscopic follow-up with SEDM mounted on P60 under standard BTS protocols. The SEDM spectrum, obtained on August 2136, shows an excellent match to a normal SN Ia at a redshift of z\u2009=\u20090.35 close to maximum light. The redshift and spectral classification were confirmed with a higher-resolution spectrum obtained at the Nordic Optical Telescope in La Palma on the following night. We followed up SN Zwicky with P48 in the g and r bands. For our analysis we use the forced photometry provided by the Image Processing and Analysis Center as detailed in ref. 34. Observations in the Sloan Digital Sky Survey g, r, i and z filters were taken with the IO:O optical imager on the Liverpool Telescope37. The Liverpool Telescope photometric data are processed with custom data-reduction and image-subtraction software . Image subtraction is performed using the Panoramic Survey Telescope and Rapid Response System 1 (Pan-STARRS1) reference image. Images were stacked using SWarp to combine multiple exposures where required. The photometry is measured using a PSF fitting methodology relative to Pan-STARRS1 standards and is based on techniques in ref. 38.The ZTF has been monitoring the transient sky at optical wavelengths since 201839 for inferring the restframe B-peak magnitude, the lightcurve shape and colour SN Ia SALT2 parameters23 and the time delays between the SN images. Data points with \u22653\u03c3 detections from the g and r filters from P48 and the g, r, i, z filters from the Liverpool Telescope were included in the fit. We adopted an iterative procedure in two steps. First, all the data were used. Next, only data points in the range where the SALT2 model is defined, that is, \u221220 to +50\u2009d, were kept for the second iteration. The final lightcurve fit parameters were derived from data in this phase range.We used the publicly available, Python-based software SNTDj, each one with its own time of B-band maximum, x1\u2009=\u2009,\u2009c\u2009=\u2009, but assume them to be the same for all four images. This is an excellent approximation in the absence of appreciable differential reddening in the lensing galaxy, confirmed by the result of the fit, c\u2009=\u2009\u22120.01\u2009\u00b1\u20090.01, consistent with no colour excess.We estimated the time delays, that is, the relative phase between the SN images, by fitting the unresolved ground-based flux data with the model that includes the flux contributions from the four sets of SN lightcurves, FE(B\u2009\u2212\u2009V)MW\u2009=\u20090.1558\u2009mag, based on the extinction maps in ref. 40. We used the wavelength dependence from the dust from ref. 22 and the measured mean value of the total to the Galactic selection extinction ratio, RV\u2009=\u20093.1. From the location of the fitted restframe B-band peak luminosity in the SALT2 model for the summed fluxes we inferred the time of maximum for SN Zwicky, t0\u2009=\u200959808.67\u2009\u00b1\u20090.19, corresponding to 2022 August 17. The total lensing magnification, \u03bc\u2009=\u200924.3\u2009\u00b1\u20092.7, was calculated after standardizing the SN Ia fitted B-band peak magnitude with the standard SALT2 lightcurve shape and colour correction parameters, \u2009=\u2009. Throughout the analysis of SN Zwicky, we adopted a flat \u039b cold dark matter cosmological model with H0\u2009=\u200967.4\u2009km\u2009s\u22121\u2009Mpc\u22121 and \u03a9M\u2009=\u20090.315 (ref. 24).Galactic extinction was included in the model, adopting https://www.wiserep.org/object/21343. It should be emphasized that the lightcurve and time-delay fits were carried out completely independently from the lens modelling.The uncertainties we report for the time delays account for parameter degeneracies in the fit. Corner plots with posteriors for the relative time delays of B, C and D with respect to A are illustrated in Supplementary Fig. 42. Flux calibration and correction of telluric bands were carried out using a standard star taken at a similar airmass. The details of all spectroscopic observations are listed in Supplementary Table The first classification spectrum of SN Zwicky was obtained with the integral field unit on the SEDM on 2022 August 21. The data were reduced using a custom integral field unit pipeline developed for the instrumenthttp://www.not.iac.es/instruments/alfosc for further information). Observations were taken using grism 4, providing wavelength coverage over most of the optical spectral range . Reduction and calibration were performed using PypeIt version 1.8.144.We obtained three epochs of spectroscopy between 2022 August 21 and September 11 with ALFOSC on the 2.56\u2009m Nordic Optical Telescope at the Observatorio del Roque de los Muchachos in La Palma (Spain) . All observations, except of the first epoch, were performed with the ground-layer adaptive optics offered by the GALACSI module52 to improve the image quality. The first three were observed in YJH filters and the next four in YJHKs filters. For the first three epochs we exposed for 3\u2009\u00d7\u200960\u2009s in the Y and J bands and 6\u2009\u00d7\u200960 s in the H\u2009band. For the fourth epoch we also observe for 10\u2009\u00d7\u200960\u2009s in the Ks band. To account for the brightness evolution, we exposed for 10\u2009\u00d7\u2009100\u2009s and 6\u2009\u00d7\u200960\u2009s for epochs 5 and 6. For the final epoch we also increased H-band exposure times to 10\u2009\u00d7\u200960\u2009s. For the HAWK-I observations we used offsets of  to place the target on the optimal detector chip.We obtained seven epochs of near infrared in YJHK between 2022 August 23 and September 30 with HAWK-I53. The data reduction included subtracting bias and flat fielding. The world coordinate system was calibrated against stars from Gaia.The data used in our work have been reduced using the HAWK-I pipeline version 2.4.11 and the Reflex environment54 at the ESO VLT. Each pointing has an approximately 1\u2032\u2009\u00d7\u20091\u2032 field of view with spatial sampling of 0.2\u2033 per pixel and covers the wavelength range from 4,700 to 9,300\u2009\u00c5 with a spectral resolution of 1,800\u20133,600. All observations were performed with the ground-layer adaptive optics offered by the GALACSI module52 to improve the image quality. The integration time of each epoch was 1,800\u2009s.We obtained four epochs of integral-field spectroscopy between 2022 August 24 and September 30 with MUSE55 and the Reflex environment53. The data reduction included subtracting bias, flat fielding, wavelength calibration and flux calibration against spectrophotometric standard stars. Afterwards, we improved the sky subtraction with the Zurich Atmosphere Purge56 module in the ESO MUSE pipeline. The world coordinate system was calibrated against stars from Gaia.The data used in our work have been reduced using the MUSE pipeline version 2.8.7The NIRC2 J-band observations consist of nine images in a five-point dither pattern based on a 2\u2033\u2009\u00d7\u20092\u2033 grid size, to facilitate sky background subtraction. At the first dither location we obtained two images: one co-added 600\u2009s exposure and one 200\u2009s exposure. At the second location we obtained one 200\u2009s exposure. At each of the third, fourth and fifth dither locations, we obtained two 200\u2009s exposures. To correct for flat fielding and bias we acquired a set of ten bias frames (flat lamp off) and ten dome flat frames (flat lamp on). Sky background and dark current were removed as part of the sky subtraction, which utilized a different sky map for each dither position, created by median combining the frames from all other dither positions, excluding the current dither position. The final combined image was created by aligning each dither position to each of the others using the centroid of the brightest SN image (image A), and median combining. The reduction was carried out using custom Python scripts. The NIRC2 J-band data  and orientation angle \u03d5. The mass profile used in our analysis is a singular isothermal ellipsoid27:\u03ba corresponds to the convergence (that is the dimensionless projected surface mass density) and the coordinates  are centred on the position of the lens centre and rotated anticlockwise by \u03d5. The projected mass M inside an isodensity contour of the singular isothermal ellipsoid is given by27Dl, Ds and Dls, we assumed a flat \u039b cold dark matter cosmology with H0\u2009=\u200967.4\u2009km\u2009s\u22121\u2009Mpc\u22121 and \u03a9M\u2009=\u20090.315 (ref. 24).The Keck NIRC2 J-band image was used to model the lens galaxy in terms of its Ie is the intensity at the half-light radius Re, bn\u2009=\u20091.9992n\u2009\u2212\u20090.3271 (ref. 57) andqS the axis ratio of the S\u00e9rsic profile. The SN images were modelled as point sources. We used a Moffat PSF with power index 2.94 and FWHM 0.091\u2033 to model the full image. We simultaneously reconstructed the lens mass model, SN images and surface brightness distributions of the lens and host galaxy. The lens mass model is constrained only by the positions of the lensed SN images and not by their fluxes, since the latter may be considerably affected by substructures, such as stars, in the lensing galaxy. Our model contains 13 nonlinear free parameters: \u03b8E, \u03d5, q, x, y for the lens mass model, Re, n, \u03d5S, qS, xS, yS for the lens light model and xSN, ySN for the SN position in the source plane. Our results are obtained using lenstronomy (https://lenstronomy.readthedocs.io/en/latest/), an open-source Python package that uses forward modelling to reconstruct strong gravitational lenses57. The result of the fit and comparison with the observations is shown in Supplementary Fig. 59, which produced consistent results.In addition to the lens mass model, we included light models for the lens galaxy and SN host galaxy in the form of elliptical S\u00e9rsic profiles:entclass1pt{minima\u03b8E\u2009=\u20090.167\u2033, corresponding to 0.628\u2009kpc) to be M\u2009=\u2009(7.82\u2009\u00b1\u20090.06)\u2009\u00d7\u2009109\u2009M\u2299.The resulting best-fit values for the lens mass and light profiles are summarized in Supplementary Table tobs and fobs), compared with the predictions from the lens model (tmod and fmod). Here, time delays are given with respect to image A: for example, ti\u2009\u2261\u2009ti\u2009\u2212\u2009tA. The observed fractional flux ratios are measured from the Keck J-band image after subtracting the lens galaxy light, and the model predictions, fmod, are computed from the magnifications predicted by the lens model, fi\u2009\u2261\u2009\u03bci/\u2211j\u03bcj. In addition to the uncertainties obtained from the J-band image analysis, we make a conservative error estimate by also including the scatter in fobs and fmod obtained when modelling the system using data from the HST optical filters F475W, F625W and F814W, as well as the Keck near-infrared J-band data. Using this approach, we also take into account possible error contributions from uncertainties in dust extinction, lens galaxy subtraction and lens mass modelling.Supplementary Table fobs by multiplying the individual fractional fluxes by the total observed SN magnification of 8). However, the predicted flux ratios remain approximately constant, which means that to first approximation we can multiply the derived fmod by an arbitrary The observed individual image magnifications can be obtained from To check the impact of added macro lens model complexity, we have studied cases where the lens mass distribution is modelled with two matter components: one where the surface mass density follows the lens light distribution , and a second one introducing a dark matter halo with additional flexibility on density profiles. In spite of the added extra complexity, the quality of the fit to the SN image positions does not improve, and induces shifts in the predicted flux ratios only below 5%, that is, very small in comparison with the observed flux ratio anomalies.M\u2299.We do not detect any time dependence in the flux ratios between the Keck and HST images, observed just a month after the lightcurve peak, 6\u2009d apart, or any other anomalous variation in the unresolved ~80-d-long lightcurve shown in Fig. A and PSFBCD. Using equation magnifications for a range of lens density slopes will be investigated in a future lens modelling paper.We conclude that, similarly to the case of iPTF16geu, a smooth lens density fails to explain the individual image magnitudes and additional substructure lensing is needed. Since the observed properties of lens systems to first order depend only on the integrated mass within the images and/or the surface mass density of the lens at the image positions or in the annulus between the images61. Using a circular aperture with a radius of 1.1\u2033, we obtain the following apparent magnitudes of the lens galaxy: g\u2009=\u200922.09\u2009\u00b1\u20090.09, r\u2009=\u200920.71\u2009\u00b1\u20090.02, i\u2009=\u200920.14\u2009\u00b1\u20090.02, z\u2009=\u200919.84\u2009\u00b1\u20090.02 and y\u2009=\u200919.63\u2009\u00b1\u20090.05 . We model the spectral energy distribution with the software package Prospector version 1.162. Prospector uses the Flexible Stellar Population Synthesis (FSPS) code63 to generate the underlying physical model and Python-FSPS64 to interface with FSPS in Python. The FSPS code also accounts for the contribution from the diffuse gas  based on the Cloudy models from ref. 65. Furthermore, we assumed a Chabrier initial mass function66 and approximated the star-formation history by a linearly increasing star-formation history at early times followed by an exponential decline at late times ). The model was attenuated with the ref. 67 model.We retrieved science-ready co-added images from Pan-STARRS DR1M\u2605/M\u2609\u2009=\u200910.1\u2009\u00b1\u20090.3. The other parameters, such as star-formation rate, attenuation and age are poorly constrained and we report their values only for the sake of completeness: star-formation rate\u2009=\u2009The best-fit galaxy model points to a moderately massive galaxy with stellar mass log\u200925). Although the host and the lens galaxy are well separated in the HST images, both galaxies have diffuse emission extending well beyond the separation of the two galaxies. To first order, we can remove the contribution of the lens by subtracting the lens images predicted by lenstronomy from the HST images. Using a circular aperture with a 1\u2033 radius and appropriate zero points from HST, we measure for the host 22.31\u2009\u00b1\u20090.11, 21.81\u2009\u00b1\u20090.06 and 21.13\u2009\u00b1\u20090.06\u2009mag in F475W, F625W and F814W, respectively. Fitting the spectral energy distribution with Prospector with the same assumptions as in the previous section gives a galaxy stellar mass of Numerous studies have shown that the peak absolute magnitudes of type Ia supernovae depend on their host galaxy masses (see, for example, ref. Supplementary InformationSupplementary Figs. 1 and 2 and Tables 1\u20133."}
+{"text": "Under Sect.\u00a015 of the Public Health (Alcohol) Act 2018, Ireland has banned alcohol advertising in or on the sports area during a sports event, except for branded clothing. The restrictions commenced on 12th November 2021, but concerns have been raised that alcohol branding continues to feature in the now-prohibited sporting area.To examine the frequency and nature of alcohol brand references in or on the sporting area during two rugby union tournaments played in Ireland after Sect.\u00a015 had commenced.n\u2009=\u200911 matches; \u2018ERCC\u2019) and 2022 Six Nations Championship (n\u2009=\u20093 matches). Highlights were obtained from the official YouTube channels of each tournament.A frequency analysis recorded visual references to alcohol brands in or on the sporting area (lasting\u2009\u2265\u20091\u00a0s) during highlights of fixtures played in Ireland during the 2021/2022 European Rugby Champions Cup . Most references were advertising for zero-alcohol variants  but using similar brand iconography as their \u2018regular-strength\u2019 counterparts (e.g. brand names and logos). The remaining references were classified as alibi marketing for \u2018regular-strength\u2019 alcohol products , as alcohol brand logos were presented without explicit reference to a zero-alcohol variant.Alcohol branding continued to feature in or on the sporting area after the commencement of Sect.\u00a015 of the Public Health (Alcohol) Act. Clarification is needed over whether the promotion of zero-alcohol products and alibi marketing is compatible with Sect.\u00a015 of the Act. Televised sporting events provide a high-reach and salient opportunity to market alcohol , 2, and A frequency analysis was conducted on visual references to alcohol brands that appeared in or on the sporting area during highlights of fixtures played in Ireland during two rugby union tournaments: the 2021/2022 European Rugby Champions Cup and the 2022 Six Nations Championship. The design was informed by previous studies of marketing during televised sports \u201315, incln\u2009=\u200911 matches, hereafter \u2018ERCC\u2019) and the 2022 Six Nations Championship (n\u2009=\u20093 matches)  which tournament it related to; (ii) which fixture it related to; (iii) the time stamp it began, using the YouTube media function; (iv) the maximum number of identical references visible at the same time ; (v) duration, in seconds; and (vi) which alcohol brand/variant was referenced. A free-text item recorded information about reference format and location. All coding was conducted by NC. Once the full sample had been coded, all coding was reviewed against the original footage a second time to ensure consistency within and between highlights.Mdn) and inter-quartile ranges (IQR) examined reference duration and the maximum number of identical references visible at the same time. Relative frequency was computed for each highlights video by dividing the video length (in seconds) by the number of references observed. Although relative frequency may not represent the exact distribution in each highlights package, it provided a standardised means of comparing videos of varied length, within and between tournaments.All data was coded into, and analysed using, SPSS version 28. For each tournament, frequencies examined the number of alcohol brand references observed in or on the sporting area and which brands and variants featured. Medians . The cumulative number of video likes was 14,578 .The 14 matches were played between 11th December 2021 and 14th May 2022. The length of highlights ranged from 05:01 to 12:52 (mm:ss) , and the median duration of references was 3\u00a0s (IQR: 2\u20135\u00a0s).All alcohol brand references observed in or on the sporting area during the Six Nations were for the tournament\u2019s title sponsor, Guinness. Most references (83.6%) related to Guinness 0.0%, as branding for this variant was featured on protective covers around the goalposts. These references featured the brand name in white font, \u20180.0\u2019 in blue font, and the \u2018gold harp\u2019 brand logo on a black background. These references also featured branding for DrinkAware at the base, but this was only sporadically visible in close-up shots. The remaining references were coded as Guinness (16.4%). These references related to flags and flagpoles that marked the edge of the pitch, which featured the Guinness \u2018gold harp\u2019 brand logo on a black background without reference to the zero-alcohol variant. These flags and flagpoles also displayed the tournament name and logo.Mdn\u2009=\u200934; range: 20\u201388). Relative frequency ranged from once, on average, every 8\u00a0s in the semi-final featuring Leinster versus Stade Toulousain to once every 18\u00a0s in Munster versus Castres Olympique and Connacht versus Leinster. The median number of identical references visible at the same time was 2 (IQR: 1\u20134), and the median duration was 3\u00a0s (IQR: 2\u20135\u00a0s).Across highlights of the 11 matches played in Ireland during the 2021/2022 ERCC, 420 alcohol brand references were observed in or on the sporting area  were for Heineken 0.0%, as branding for this variant featured on protective covers around the goalposts in all matches. For the quarter and semi-finals , there were also static adverts for Heineken 0.0% printed on the pitch behind the goal lines. References on the protective covers and pitch featured the brand name and \u20180.0\u2019 in white font, with the \u2018red star\u2019 brand logo between them, on a blue background. The remaining references were coded as Heineken (22.9%). These references mostly related to flags and flagpoles marking the edge of the playing area. These displayed the ERCC tournament logo, which also featured the Heineken \u2018red star\u2019 brand logo in the middle, without explicit reference to the 0.0% variant. This tournament logo was also occasionally visible on the ball and, in the quarter-finals and semi-finals, on a large static logo in the centre of the pitch.This analysis demonstrates that alcohol branding continued to appear in or on the sporting area during both club and international rugby union matches played in Ireland after Sect.\u00a015 had commenced. Most references were for brand variants with zero alcohol, albeit incorporating similar brand iconography to their \u2018regular strength\u2019 counterparts. Approximately a quarter of references were coded as promoting a \u2018regular strength\u2019 alcohol product, as the brand logos were presented without explicit reference to the zero-alcohol variants. These findings build on research examining alcohol marketing in Ireland before the restrictions commenced and further contribute to understanding of how the alcohol industry responds to marketing controls .In both tournaments, advertising for zero-alcohol products used branding similar to their \u2018regular-strength\u2019 counterparts, such as the same brand names, fonts, and logos. For Guinness 0.0% branding in the Six Nations, the brand name (in white font) and \u2018gold harp\u2019 logo featured on a black background, thus creating livery akin to the branding used to promote the \u2018regular strength\u2019 variant prior to the restrictions , 5. For Legal clarification is also required for the references considered to be promoting \u2018regular strength\u2019 alcohol products. In both tournaments, such references are best described as \u2018alibi marketing\u2019 because the brand logos were presented without reference to either the brand name or the zero-alcohol brand variant. Alibi marketing has been observed in other countries with statutory alcohol marketing controls , 20, incA key limitation is that the data underestimate the volume and frequency of alcohol brand references in two ways. First, in line with the objective of examining compliance with Sect.\u00a015, coding only focused on branding that was\u00a0in or on the sporting area. The myriad other forms of marketing observed in the videos, but not coded, included: (i) advertising boards around the pitch border/stadium; (ii) branded clothing worn by players and match officials; (iii) advertising on electronic screens (e.g. scoreboards); (iv) supporters with branded merchandise or packaging; (v) graphics superimposed onto videos; and (vi) branding in\u00a0the video descriptions. Second, by only focusing on highlights, the coding does not capture \u2018out-of-play\u2019 references from the original (longer) television broadcasts. In such broadcasts, the pre-match build-up and post-match analysis may have featured archive footage from previous tournaments when alcohol marketing was permitted in or on the sporting area in Ireland or footage of matches from the current tournament played in countries where such marketing is still permitted (e.g. highlights of matches from England or Scotland). The original broadcasts may have also contained advertisements for alcohol products during commercial breaks.In conclusion, alcohol brand references continued to appear in or on the sports area during club and international rugby union fixtures played in Ireland after the commencement of Sect.\u00a015 from the Public Health (Alcohol) Act 2018. Most references were for zero-alcohol variants that featured similar brand iconography to their \u2018regular strength\u2019 counterparts, although some references were adjudged to be alibi marketing for a \u2018regular strength\u2019 variant. Clarification is needed over the extent to which these marketing practises are compatible with Sect.\u00a015 and how the Act defines alcohol advertising."}