diff --git "a/deduped/dedup_0750.jsonl" "b/deduped/dedup_0750.jsonl"
new file mode 100644--- /dev/null
+++ "b/deduped/dedup_0750.jsonl"
@@ -0,0 +1,48 @@
+{"text": "In free community science, where large numbers of scientists participate as volunteers in a single project, the ideal of scientific cooperation finds a new expression. Free community science was inspired by the free software movement, which itself was inspired by the application of the ideal of scientific cooperation, as it was applied to software development by the operating system developers of the Massachusetts Institute of Technology Artificial Intelligence Lab in the 1970s. This ideal has suffered for two decades from corporate pressure to privatize science, so it is very gratifying to see that the free software movement can today help reinvigorate the principle that inspired it.The ideal of scientific cooperation goes beyond the conduct of individual projects. Scientific cooperation is also being reinvigorated today through the open-access movement, which promotes the public's freedom to redistribute scientific and scholarly articles. In the age of the computer networks, the best way to disseminate scientific writing is by making it freely accessible to all and letting everyone redistribute it. I give a vote of thanks to the Public Library of Science for leading the campaign that is now gaining momentum. When research funding agencies pressure journals to allow free redistribution of new articles they fund, they should apply this demand to the old articles \u201cowned\u201d by the same publishers\u2014not just to papers published starting today.Journal editors can promote scientific cooperation by adopting standards requiring internet publication of the supporting data and software for the articles they publish. The software and the data will be useful for other research. Moreover, research carried out using software cannot be checked or evaluated properly by other scientists unless they can read the source code that was used.A significant impediment to publication and cooperation comes from university patent policies. Many universities hope to strike it rich with patents, but this is as foolish as playing the lottery, since most \u201ctechnology licensing offices\u201d don't even cover their operating costs. Like the Red Queen, these universities are running hard to stay in the same place. Society should recognize that funding university research through patents is folly, and should fund it directly, as in the past. Meanwhile, laws that encourage universities to seek patents at the expense of cooperation in research should be changed.Another impediment comes from strings attached to corporate research funding. Universities or their public funding agencies should ensure private sponsors cannot block research they do not like. These sponsors must never have the power to veto or delay publication of results\u2014or to intimidate the researchers. Thus, sponsors whose interests could be hurt by publication of certain possible results must never be in a position to cut the funding for a specific research group.The free software movement, the free redistribution policy of this journal, and the practice of free community science for developing diagnostic disease classifications  are all"}
+{"text": "Feller J, Fitzgerald B, Hissam SE and Lakhari KR (Editors)Perspectives on Free and Open Source SoftwareCambridge, MA: MIT Press, 2005538 pages, ISBN 0-262-06246-1Perspectives on Free and Open Source Software is a collection of articles by researchers, advocates and critics of the Free and Open Source Software (FOSS) movement and its way of building and distributing software. The book represents a serious attempt to assess the current state of FOSS and discuss its future.free. The question appears to be framed initially in terms of explaining \"free as in free beer\" rather than \"free as in freedom\" [status quo. Part 5 also includes an enlightening legal analysis of FOSS licenses, focusing on the most famous of them, the General Public License (GPL), and chapters on broader cultural, economic and policy issues, such as the increasingly important topic of the role FOSS plays and might play in the governmental and public sectors.The volume is structured along 5 parts, some containing cohesive sets of articles, some loosely related ones. The three chapters that make up part 1 report on attempts to explain the FOSS phenomenon from the perspective of the psychology and sociology of its main actors. In particular, these articles try to explain what leads FOSS developers not to sell the software they create, but rather regard that software as freedom\" . Part 3 Although the book encompasses several perspectives, it appears to target primarily managers, particularly those who feel they ought to learn more about FOSS in order to be able to draw advantage from it. The predominance of articles on business models and open-source as a potentially superior development methodology over articles on the political and philosophical background of free software seems designed to give the book an air of business friendly pragmatism. While this might serve to allay instinctive fears business readers might feel in relation to FOSS, it also has the effect of making the text seem at times rather dull (loaded with economic jargon) to the more technically-minded reader such as myself and, I suspect, \"not dull enough\"  to book's target audience. Moreover, by attempting to avoid the pitfalls of ideology, many of the articles in the book end up making tacit ideological assumptions. One such assumption is explicitly stated in the preface: \"The business of selling software products will live on, along with free and open source programs. This is most likely how it will be, and it is how it should be.\" Tacit adherence to premises such as this might have contributed to narrowing the scope of the book beyond what is needed to analyse a movement the editors describe in the introduction as \"a revolution\".Attaining objectivity in an incipient field fraught with controversy, passionate stances and conflicting interests is an ambitious goal. Despite the above mentioned shortcomings, the book makes a welcome contribution toward achieving that goal."}
+{"text": "The result? Most spend far too much time wrestling with software, instead of doing research, but have no idea how reliable or efficient their programs are.\u201d \u2014Greg Wilson American Scientist article [As Greg Wilson's  article  circulatWhy opine on best practices for scientific software projects now? Computational biologists are taking on increasingly important roles in this Internet-enabled, information-rich, high-throughput era of biology . Analytin-tiered architecture to some and an expensive waste of resources to others. We want to avoid fanning controversy over interdisciplinary science [We are starting with the premise that scientific software development brings together different cultures. A \u201ccertified technology stack\u201d might mean a robust  science ,5 and mi science ,7. We hoWe see important similarities between the way scientists and software engineers approach and attack problems which may provide a general framework for successful scientific software development. Scientists are taught the scientific method from the time they perform their first experiments. Similarly, software engineers are taught about the software development life cycle before they write their first \u201cif\u201d statement. By understanding similarities between these approaches, we can layer some practical methods from the software development life cycle onto computational biology projects to build a solid foundation for success.Two of us are card-carrying software engineers; two of us are formally trained as scientists. We are all battle-scarred veterans of large scientific software development projects, while working in business, nonprofit, government, and academic settings. Many of those projects were successful; some were not. We think that the best practices learned and employed on large scientific software projects can also instruct smaller development projects carried out by single-investigator laboratories or small teams.  to medium-  sized projects. We debated, solicited advice, reread some of our favorite books ,9, and tGood scientists do not perform experiments before developing a hypothesis, then describing materials and methods to test that hypothesis. Similarly, before the first line of code is written, software projects should be proactively and thoughtfully designed. This does not necessarily require a voluminous tome, but it should answer two key questions: \u201cWhat will the program(s) do?\u201d and \u201cHow will the results produced by the program be verified?\u201d The most simple design documents describe inputs, how those inputs will be transformed by the program(s), and outputs.http://www.scipy.org. Website and coursework written with scientific software development in mind.Basic software development practices: Software carpentry. Seminal book on object-oriented design patterns for developers aiming to reuse code bases.Gamma E, Helm R, Johnson R, Vlissides J (1995) Design patterns: Elements of reusable object-oriented software. Boston: Addison-Wesley. 395 p. Squarely addresses testing and quality in a maintenance environment; of particular use to developers supporting long-lived code bases.Lewis WE (2004) Software testing and continuous quality improvement. 2nd edition. New York: Auerbach. 560 p. Easy-to-read book filled with many \u201clessons learned,\u201d to read rather than to have to experience.Berkun S (2005) The art of project management. Sebastopol : O'Reilly Media. 488 p. Iterative methodology aimed at keeping plans in sync with what is really going on in software development projects.Schwaber K (2004) Agile project management with Scrum. Redmond (Washington): Microsoft Press. 192 p. Based on the purpose of the software, identifying the appropriate technologies or programming languages is a vital decision during the design phase. While typically driven, often mistakenly, by the current in-house expertise of the software developers, there should be careful analysis in addressing the problem with the most practical selection of technologies. For example, if ease of distribution is considered important, the platform-independent nature of Java may make the most sense; if the software deals with a great deal of text manipulation, Perl may be best suited; if speed of execution is essential, C or C++ may be the way to go. In addition to considering the built-in strengths of a particular language, most offer a vast array of canned libraries (whether included in the distribution or preexisting as an open source project) developed to handle all but the most arcane technological issues. It is at this design juncture that much time can be saved in building software components that could be acquired for almost nothing through relatively minimal research. Additionally, plugging in trusted, reusable code bases lends credibility to the overall quality of the software and streamlines the testing phase.The team should develop test plans and create data to test their code. In the development of test plans, it is also good practice to consider independent variables, such as how long the program might take to run on a certain platform, how it will work with a real-world-sized input file, or how well it will interface or interoperate with other programs that are not a part of your project.The design phase should also address software usability requirements. If the software under development will be used only by the programmer, usability might not be a large concern. However, as funding agencies emphasize dissemination, collaborative teams aim to share tools; and to use statistics to help justify renewal of funding, usability should be a higher priority in scientific software development. Designing facile user interfaces, interactive feedback cycles, maintenance and release plans, or easy reuse of code or tools requires careful thought, due diligence, and resourcing up-front.Typically, the proposal writing or management approval process provides a mechanism to force project design. Before coding begins, projects can discover existing tools and data standards and articulate the planned functionality and testing of the software. No matter the scale of the software project, it is important to incorporate feedback from key stakeholders  in this process to ensure that the design meets expectations.One of the foundations of scientific research is the lab notebook, where materials, methods, and results are recorded so that experiments can be repeated. Similarly, all computer programs and code bases should be well-documented, modular, and easy to read and follow even by users who did not write the program. Modularity can be a complex issue, but at a basic level it refers to coding in a way so that the overall task being performed is divided into small, discrete units of work. This design paradigm promotes reusability and flexibility . A modesOne cornerstone of good science is reproducibility of results. Similarly, being able to consistently reproduce the results of a computer program is the yardstick used to measure the validity of that program. Reproducibility requires three things: ensuring a program works the way it should (testing), knowing exactly what was used to produce the results (version control), and recognizing and tracking program bugs.Programs should be thoroughly tested according to the test plans developed in the design phase. Well-designed unit tests may be used to address whether a particular module of code is working properly and allows testing to proceed piecemeal and iteratively throughout the development process. This enables bugs to be identified and handled early so as to avoid major problems during integration and final testing.Undeniably, computational biology projects are fluid: there are always newer, better data files and standards available, requiring continual updates to the code base. Consequently, it is critical to track exactly which version of software and which set of input files and parameters were used to produce a specific set of results. This is especially important six months later, when the original programmer has moved on to another project. Developers should use version control for both data and source code, tying results to specific versions. Subversion  and CVS Beyond application of functional testing, quality can be addressed further through performance optimization using bounds checkers . These issues are typically overlooked during software development as problems with memory leaks and poor memory management hide behind software functionality and may long go unnoticed.Disseminating to and sharing results with the broader research community is critical and often provides the basis for new scientific progress. The same is true for computer programs. The inputs, outputs, and \u201cresults\u201d of computer programs are often data files. Whether included as supplementary materials for a manuscript or as subtables in an enterprise level relational database, scientific data should be supplied in accepted, standard formats wherever possible. Admittedly, biology is a fast-moving target. However, the increasing need to share, compare, and integrate data and tools is driving communitywide initiatives to standardize biological data formats ,17. As oIn scientific research, principal investigators ensure that experiments are performed according to defined procedures, while making progress in the context of a schedule and a budget. For software development projects, a project manager performs a similar function. Principal investigators who are not themselves software engineers may find themselves filling a project manager role because they supervise people in their labs who write software. Project management for a modest algorithm-development project involving one or two programmers might involve informal design and code reviews, regular meetings to track progress against an established timeline, and review (and sign-off) of testing results.Larger, collaborative projects, however, can become hopelessly chaotic without more disciplined project management. A commonly used approach to managing larger projects is to break them into manageable subprojects, with a series of release cycles interleaved with user or stakeholder feedback. A simple project website, wiki, or more sophisticated solutions such as Xplanner  and BaseOutside our own anecdotal experiences, we think there is growing evidence that software best practices can effectively meet real-life, scientific needs. We can point to heavyweight projects, such as the cancer Biomedical Informatics Grid (caBIG) , and to enabler and not as a burdensome side effect.Specifically, the Bioconductor project has adopted practical techniques that are instructive for small software projects . The BioReading back over this article, we recognize that there are many \u201cshoulds\u201d in our guidelines. In our defense, we write from our collective, heartbreaking experiences watching wheels reinvented, finding dead or unusable programs, and, worse, inheriting rancid and labyrinthine code bases. We are of the opinion that community adherence to the guidelines described here will increase the impact and usability of computational biology work, without placing undue burden on the creators of rapidly evolving, scientific code bases."}
+{"text": "Significant technical advances in imaging, molecular biology and genomics have fueled a revolution in cell biology, in that the molecular and structural processes of the cell are now visualized and measured routinely. Driving much of this recent development has been the advent of computational tools for the acquisition, visualization, analysis and dissemination of these datasets. These tools collectively make up a new subfield of computational biology called bioimage informatics, which is facilitated by open source approaches. We discuss why open source tools for image informatics in cell biology are needed, some of the key general attributes of what make an open source imaging application successful, and point to opportunities for further operability that should greatly accelerate future cell biology discovery. Imaging is used as a tool for discovery throughout basic life science, and biomedical and clinical research. In these domains, advances in light and electron microscopy have transformed biological discovery, enabling visualization of mechanism and dynamics across scales of nanometers to millimeters and picoseconds to many days. Fluorescent protein (FP)-tagged fusions can be used as reporters of biomolecular interactions in cultured living cells All of these methodologies produce complex, multi-dimensional data sets that must be transformed into reduced representations that scientists can manipulate, analyze, share with colleagues, and ultimately understand. Despite the diversity of applications of imaging in biology, there are common unifying challenges such as displaying a multi-gigabyte time-lapse movie on a laptop screen, or identifying, tracking, and measuring the objects in that movie and presenting the resulting measurements in a graph that reveals the mechanisms that drive their movements. These requirements have spawned the new field of bioimage informatics Almost all commercially provided image acquisition systems include software tools that provide sophisticated image visualization and analysis functions for the images recorded by the instrument they control. However, in recent years, many non-commercial projects have appeared, almost always based in research laboratories that require functionality not available in commercial products. Here, we discuss the application of bioimage informatics in cell biology and focus specifically on the development of open source solutions for bioimage informatics that have emerged over the last few years.Given the rapid development in image acquisition systems in the last 20 years, it is worth considering why a corresponding rapid development of informatics tools has occurred only recently. Certainly, one of the barriers to providing universal tools for bioimage informatics is the diversity of data structures and experimental applications that produce imaging data. In optical microscopy alone there are a substantial number of different types of imaging modalities and, indeed, a method like fluorescence microscopy encapsulates a huge and rapidly growing field of image acquisition approaches A deeper challenge resides in each individual laboratory that uses imaging as part of its experimental repertoire. The sheer size of the raw data sets and the rate of production mean that individual researchers can easily generate many tens of gigabytes of data per day. This means that large laboratories or departmental imaging facilities generate many hundreds of gigabytes to terabytes per week, and are now enterprise-level data production facilities. However, the expertise for developing enterprise software tools or even simply running the hardware necessary for this scale of data management and analysis rarely exists in individual laboratories. In short, the sophisticated systems and development expertise that are used to deliver genomics databases and applications are required in individual imaging laboratories and facilities. The delivery of tools that provide access to a broad range of data types, manage and analyze large sets of data, and help run the systems that store and process this data is the challenge that bioimage informatics seeks to address.A critical development in the field of bioimage informatics has been the introduction of many open source projects in the last few years http://www.linuxfoundation.org/), Java (http://java.sun.com/), MySQL (http://www.mysql.com/products/database/), and Apache (http://www.apache.org/). A fundamental tenet of open source software projects is that the copyright holder  determines the software license, which defines how the software is distributed and what end-users may do with the software. For open source software, the original source code is made available under the terms of this license. An open source license usually allows end-users to use the software for any purpose, make changes to the software source code or link their own software to it and, if they desire, distribute those \u2018derivative works. However, the software license also defines under what terms and license derivative works may be distributed. Open source software is a well-established movement with strong paradigms in many very successful projects such as Linux  and, if necessary, build upon it. This is a key and often overlooked part of open source software. Successful open source software development projects are dynamic, evolving enterprises allowing input, feedback, and often contributions from their community.http://java.sun.com/j2se/javadoc/) and software specifications (http://java.sun.com/products/ejb/docs.html). These specifications ensure that developers can understand and use each other's code and, most importantly, that two independent software packages can use a specified, common interface. This software \u2018interoperability\u2019, enforced by the community either formally or informally, is a general hallmark of open source software, and perhaps one of its most underappreciated strengths. Because standardization is so well established in the open source community, open source software has a critical role in providing the specifications and tools for common file formats or common interfaces that enable two otherwise incompatible packages to communicate their input and output data to one another. This type of interoperability is critical to support the rapidly evolving needs of bioimage informatics. For all these reasons, many of the recent developments in bioimage informatics are based on an open source foundation.This evolving, adaptable aspect makes open source software particularly useful for scientific discovery and, more specifically, for the rapidly evolving and diverse set of imaging applications used in biological research. Commercial and closed source applications have certainly supported many significant advances in imaging. However, an essential part of bioimaging data analysis is the ability to easily try new methodology and approaches or even to combine existing ones to generate a derivative result based on the combination of two approaches. Open source approaches make this possible. As such, there is a natural fit between open source software and the process of scientific discovery. In addition, a consequence of the growth of the open source community is a de facto establishment of standardized documentation methods (http://www.oss-watch.ac.uk/resources/odm.xml). Open development projects take the open source concepts and add a significant role for the community in the development process. In truth, community interaction and feedback was a component of most initial open source projects, but as open source projects have expanded, not all have included efforts to engage and respond to their user community. Community interaction and support is expensive, it takes precious developer time and often requires the use of forums, mailing lists, and other resources to manage the interactions with the project's community. However, open source, and open development approaches in particular, have proven to be particularly attractive for funding agencies supporting biomedical research. They provide a way to measure the success of the project, by providing measures of uptake and participation. As the community grows around an open development project, it provides a measure of protection for the research investment and sustainability of the software past the duration of the initial award. Many agencies are now requiring that applicants have a software sharing plan in their grant application and, if an open source approach is not possible, justify this decision. In our opinion, the value for the developers, the community and the funding investment will be maximized if open development models are also followed.Recently, a subclass of open source project know as \u2018open development\u2019 has been defined  or a commercial arm (e.g. http://www.kitware.com and http://glencoesoftware.com) that can directly access funding from user communities through licensing and customization fees that support the targeted customer base and help finance additional code development and maintenance for the open source package. However, there are still few examples of this maturation in scientific software. An important question for the scientific community is what priority funding agencies should place on the continued funding of software development tools for its use. If continued funding is to be considered, the application and reviewing processes will need to be modified to properly capture and assess the value of these projects. In our opinion, in exchange for periodic review and consideration for sustained funding, publicly funded scientific software projects should be required to follow open development models, where engagement and support for the community is required. This can occur only if funding for support and community engagement is available, and if career development and evaluation include publication record and delivery of useful tools to and engagement with the community.Any open project must be viable, it must deliver valuable products to its community, and it must be sustainable and have a strategy for long-term funding. In academic science, many projects receive grant funding to initiate their work, but it is common for software development to require more than three years to achieve a fully developed product that can be distributed and used by the community. Sustaining these efforts exclusively through grants is possible, but requires convincing demonstration of the software's utility, and must accept the reality that continued funding is subject to variations in availability of funding and the priorities of funding organizations. As they mature, most open source software efforts develop a non-profit foundation , we use project management tools such as Subversion (http://subversion.tigris.org/) to manage our source code repository, Trac  for all project management and issue and revision tracking, Jabber (http://www.jabber.org) for real-time communication, Hudson (https://hudson.dev.java.net/) for continuous integration, Plone for managing our web site (http://plone.org/), and PHPBB for running our user forums (http://www.phpbb.com/). In addition to these tools, we hold annual user meetings to assess progress and define roadmaps for future works. We participate as presenters or exhibitors in large meetings of the community in order to capture as much feedback as possible. These tools and activities help support and engage a very broad user and developer community and are an important part of ensuring community wide adoption, but installing, running, and maintaining these tools, as well as answering queries and moderating discussions, requires time and resources (both people and money). Many successful open source packages have shown the importance of transforming the conventional user base into an additional support mechanism where the user community interacts with the original developers and with each other for support and new code developments. Users and developers that are new to the project are often supported by the community, and not just the main development team. This transformation takes some time and investment because it results from releasing useful software and investing a moderate amount of resources in support. However, we strongly advocate that direct funding of support personnel and tools be made available for research-based open source software development. In our experience, many of our academic colleagues hesitate to release their software because of the burden of supporting use of their software, thus preventing the synergies that should occur within the scientific community.In comparing open source and commercial software products, one of the biggest differences is support for the software itself. In general, commercial software packages are supported with instructions, manuals, and direct user support, and this is a key advantage of using commercial software. The cost of such support is either included in the original purchase price or paid for by purchase of a software maintenance agreement. Covering the costs of user support is difficult for open source projects because there is no corresponding fee structure to cover such support costs and, often, the academic grants that fund open source projects cover only the innovative research components and do not support the personnel or infrastructure needed. This is gradually changing with funding agencies and scientists alike realizing the importance of producing innovative and feature-rich code but ensuring that it is well supported and maintained. There are well-established standards and tools in the open source community for support, mailing lists, user forums, screencast demos, and wiki-based user documentation, that all contribute to making software successful. Within our own Open Microscopy Environment Consortium  and the Open Microscopy Environment Most of the imaging systems in biological laboratories are commercially developed and provided, and thus driven by commercially licensed, closed software. These powerful tools are the workhorses of modern biological research. There are many examples of companies using open source specifications to increase the functionality and value of their products, including major vendors such as Red Hat and IBM. In addition, the expertise and know-how in commercial companies is valuable, and open source projects are often aided by commercial partners working as supporters and as active developers. We therefore strongly advocate partnerships between commercial providers and open source software projects. With the appropriate licensing models, companies can be actively involved in open source imaging software for the benefit of all. Micromanager (The rapid innovation in imaging technology for biomolecules, cells, and tissues requires a parallel development in software tools for managing visualizing and analyzing image data. Open source software has an important role in this development, as open code development and sharing enable rapid exchange and experimentation with new tools and ideas. As open source software tools become more sophisticated, funding mechanisms that enable laboratories to provide long-term support to a broad user and developer community must be made a priority by funding bodies. The open community is very interactive and evaluates performance based on merit; i.e. good software is used by its target audience. Thus, further funding can be tied to feedback from and uptake by the community. Our experience is that academic software should follow an open development model, even if this approach deviates from the standard models used for academic research. It is important that any funded open source program be managed efficiently and integrate previous efforts and community specifications. Finally, the community must understand that a development project does \u2018develop\u2019; it grows, matures, and ultimately, if properly run and integrated with its user community, delivers useful tools. The community's comments and feedback during this growth is critical. This process is slow and iterative, but the paradigms are well established and can be used to deliver successful tools and ultimately new discoveries."}
+{"text": "Increased systemic cytokines and elevated brain levels of monoamines, and hydroxyl radical productions are thought to aggravate the conditions of cerebral ischemia and neuronal damage during heat stroke. Dexamethasone (DXM) is a known immunosuppressive drug used in controlling inflammation, and hydroxyethyl starch (HES) is used as a volume-expanding drug in cerebral ischemia and/or cerebral injury. Acute treatment with a combined therapeutic approach has been repeatedly advocated in cerebral ischemia experiments. The aim of this study is to investigate whether the combined agent (HES and DXM) has beneficial efficacy to improve the survival time (ST) and heat stroke-induced cerebral ischemia and neuronal damage in experimental heat stroke.Urethane-anesthetized rats underwent instrumentation for the measurement of colonic temperature, mean arterial pressure (MAP), local striatal cerebral blood flow (CBF), heart rate, and neuronal damage score. The rats were exposed to an ambient temperature (43 degrees centigrade) to induce heat stroke. Concentrations of the ischemic and damage markers, dopamine, serotonin, and hydroxyl radical productions in corpus striatum, and the serum levels of interleukin-1 beta, tumor necrosis factor-alpha and malondialdehyde (MDA) were observed during heat stroke.After heat stroke, the rats displayed circulatory shock , decreased CBF, increased the serum levels of cytokines and MDA, increased cerebral striatal monoamines and hydroxyl radical productions release, and severe cerebral ischemia and neuronal damage compared with those of normothermic control rats. However, immediate treatment with the combined agent at the onset of heat stroke confers significant protection against heat stroke-induced circulatory shock, systemic inflammation; cerebral ischemia, cerebral monoamines and hydroxyl radical production overload, and improves neuronal damage and the ST in rats.Our results suggest that the combination of a colloid substance with a volume-expanding effect and an anti-inflammatory agent may provide a better resuscitation solution for victims with heat stroke. Unless immediately recognized and treated, heat stroke is often lethal, and victims who do survive may sustain permanent neurological damage . The cli\u03b2 (IL-1\u03b2) and tumor necrosis factor-\u03b1 (TNF-\u03b1)) in circulation of heat stroke rats ; BioAnalytic Systems, West Lafayette, IN, U.S.A.] was used, and the mobile phase consisted of a mixture of 75 mmol/l monochloroacetic acid, 0.7 mmol/l disodium EDTA, 1.5 mmol/l sodium 1-octanesulphonate and 45 ml/l acetonitrile (pH 3.0). The retention times of 2,3-DHBA and 2,5-DHBA were 9.07 and 5.44 min respectively.The concentrations of hydroxyl radicals were measured by a modified procedure based on the hydroxylation of sodium salicylate by hydroxyl radicals, leading to production of 2,3-dihydroxybenzoic acid  and 2,5-DHBA. These two compounds were then measured in dialysates by HPLC with electrochemical detection. A Ringer's solution . To 1 mL of the supernatant was added 0.5 mL of 0.6% TBA, and the mixture was heated at 95\u00b0C for 30 min. After cooling the mixture was extracted with 1.5 mL of n-butanol, and 20 \u03bcL of the butanol layer was injected to a C-18 (4.6 \u00d7 150 mm) column fitted with a guard and eluted at 1 mL/min by using 65% (v/v) 50 mM KH2PO4-KOH and 35% (v/v) methanol with spectrophotometric (532 nm) detector.0.25 mL of serum was added to 25 \u03bcL of 0.2% BHT and 12.5 \u03bcL of 10 N NaOH (to adjust to pH~13) and incubated at 60\u00b0C for 30 min in a shaking water bath. To this was added 1.5 mL of 0.44 mol/L (or 7.2%) TCA containing 1% KI, and the mixture was placed in ice for 10 min and centrifuged  Development System rat IL-1\u03b2 or TNF-\u03b1 kit  was used for measuring the levels of active rat IL-1\u03b2 or TNF-\u03b1 present in serum. This assay employs the quantitative colorimetric sandwich ELISA technique.The blood samples were acquired 100 min after the initiation of heat exposure (or 20 min after the onset of heat stroke) in heat stroke rats or the equivalent time in normothermic controls. 5 ml of blood was withdrawn from the femoral vein of each rat for measurement of serum IL-1At the end of each experiment, the brain was removed, fixed in 10% neutral buffered formalin and embedded in paraffin blocks. Serial (10 \u03bcm) sections through the striatum were stained with hemotoxylin and eosin for microscopic evaluation. The extent of striatal neuronal damage was scored on a scale of 0-3, modified from the grading system of Pulsinelli et al. (1982) , in whicP value less than 0.05 was considered as statistical significance.Data are presented as the mean \u00b1 SEM. Repeated-measures analysis of variance was used for factorial experiments, whereas Duncan's multiple-range test was used for post hoc multiple comparisons among means. For scoring neuronal damage, the Wilcoxon signed rank test was used when only two groups were compared. The Wilcoxon tests which convert the scores or values of a variable to ranks, require calculation of a sum of the ranks and provide critical values for the sum necessary to test the null hypothesis at a given significant level. The data were given by \"median\", and first and third quartile. A Table The effects of heat exposure (42\u00b0C for 80 min) on several physiological parameters in NS-, DXM-, HES- and the combined agent-treated rats are shown in Figure In separate experiments, 25 min after the onset of heat stroke, rats were sacrificed for determination of neuronal damage score in the corpus striatum. The data are summarized in Table As shown in Figure The serum IL-1\u03b2 and TNF-\u03b1, and MDA levels for normothermic controls, NS-, DXM-, HES-treated heat stroke rats, and the combined agent-treated heat stroke rats are summarized in Figure It has been reported that pretreatment with DXM (4 mg/kg) single dose, but not immediate treatment with DXM, before heat stress could increase the ST in rats by attenuating serum levels of interleukins ; howeverThere were many evidences ,14,28 th\u03b2 and TNF-\u03b1) are elevated in humans and animals with heat stroke [\u03b2 and TNF-\u03b1 in both rats and rabbits [\u03b2 and TNF-\u03b1 levels is observed in heat stroke rats. The increase in the levels of these inflammatory cytokines is associated with arterial hypotension, cerebral ischemia and neuronal damage. Administration of IL-1 receptor antagonists could prevent arterial hypotension and cerebral ischemic damage, and improve survival in heat stroke. Furthermore, the present results show that treatment with the combined agent significantly attenuates the heat stroke-induced overproduction of IL-1\u03b2 and TNF-\u03b1 in the serum. Meanwhile, both arterial hypotension and cerebral ischemic damage are attenuated and survival of heat stroke rats is ameliorated following acute treatment with the combined agent. The immediate administration of this combined agent might exert its protective effects by attenuating the increased plasma level of IL-1\u03b2 and TNF-\u03b1 during heat stroke.The serum concentrations of inflammatory cytokines , in addition to attenuating the elevating levels of IL-1\u03b2, TNF-\u03b1 and MDA in blood stream, diminishes monoamines, glutamate, and hydroxyl radical formation, and ischemia injury in the brain, and improves ST in rats with heat stroke. Our results suggest that the combination of a colloid substance with a volume-expanding effect and an anti-inflammatory agent may provide a better resuscitation solution for victims with heat stroke.In the present study, the heat stroke-induced increases in arterial hypotension, cerebral ischemia and neuronal damage are associated with elevated levels of DA, 5-HT, glutamate and hydroxyl radicals in rat brain, and increased circulating IL-1\u03b2 : interleukin-1\u03b2; MAP: mean arterial pressure; NS: normal saline; ST: survival time; Tco: colon temperature; TNF-\u03b1: tumor necrosis factor-\u03b1; ICP: intracranial pressure; CPP: cerebral perfusion pressure.CBF: cerebral blood flow; DA: dopamine; DHBA: dihydroxybenzoic acid; DXM: dexamethasone; ELISA: enzyme-linked immunosorbent assay; HES: hydroxyl starch; HR: heart rate; 5-HT: serotonin; IL-1The authors declare that they have no competing interests.All authors have read and approved the final manuscript. YTH and WMY operated the animals, assessed the neuron damage score and interpreted the data. HWY and LKL collected blood samples and performed the ELISA. SMF and WYS provided DXM and HES, and finalized the manuscript. YTH and LCC conceived the experiments, funded the project and wrote the manuscript."}
+{"text": "Until now, there is no effective biomarker which can predict the upcoming disease (or pre-disease state) before disease onset or disease deterioration. Further, the detail molecular mechanism for such deterioration of the disease, i.e., dynamical network biomarker (DNB) which forms a specific module for marking the time period just before the drastic deterioration of T1D.In this study, we detected early-warning signals of T1D and its leading biomolecular networks based on serial gene expression profiles of NOD (non-obese diabetic) mice by identifying a new type of biomarker, Two dynamical network biomarkers were obtained to signal the emergence of two critical deteriorations for the disease, and could be used to predict the upcoming sudden changes during the disease progression. We found that the two critical transitions led to peri-insulitis and hyperglycemia in NOD mices, which are consistent with other independent experimental results from literature.The identified dynamical network biomarkers can be used to detect the early-warning signals of T1D and predict upcoming disease onset before the drastic deterioration. In addition, we also demonstrated that the leading biomolecular networks are causally related to the initiation and progression of T1D, and provided the biological insight into the molecular mechanism of T1D. Experimental data from literature and functional analysis on DNBs validated the computational results. In addition, DNB is of significance from both biological and medical viewpoints since it has been proven to be the leading network of the disease, which makes the first move from the normal state to the disease state, and therefore is strongly related to the driver genes or causal genes of the disease. As shown in Figure Biomarkers or biological markers in biology are indicators of biological state for living organisms, which are objectively used to measure and evaluate normal biological processes, pathogenic processes, or pharmacologic responses to a therapeutic intervention. In medicine, a biomarker as an indicator is used to examine organ function or other aspect of health. However, traditional molecular biomarkers are usually used to examine only the current disease status of an organ based on the measurements of individual proteins or metabolites. It means that a traditional biomarker measures the disease state of an organ, after the organ has presented the characteristic of disease. In other words, it is to distinguish disease state from normal state, rather than early diagnosis. Generally, a disease progression can be divided into three stages, se state , as showse state -3, most se state , based ne.g., driver genes or causal network of the disease, is still unclear.Type 1 diabetes (T1D) is a form of diabetes mellitus that is a clinically heterogeneous group of glucose intolerance syndromes, and usually has an autoimmune T cell-mediated etiology in which the pre-diabetic state is characterized by development of autoantibodies against certain proteins expressed by \u03b2 cells, including insulin ,5. T1D ii.e., dynamical network biomarker which forms a specific module of molecules  for marking the time period just before the drastic deterioration of T1D. Specifically, we detected early-warning signals of T1D and its leading networks based on the serial gene expression profiles of pancreatic lymph nodes in NOD mice by identifying two dynamical network biomarkers (DNB) in two different time points. By the theory of early-warning signals of complex diseases [The non-obese diabetic (NOD) mouse strain -7 is a udiseases ,6. In adThe non-obese diabetic (NOD) mouse is a useful and important model for autoimmune T1D. The pancreatic lymph nodes are the site of islet-cell-specific self-antigen presentation and important for the development of T1D. The gene expression profiles of pancreatic lymph nodes for T1D were obtained from GEO database (ID: GSE15150). The dataset includes the expression profiles of pancreatic lymph nodes of 35 female NOD mice samples at 6 different time points (10 days (7 samples), and 4 weeks (6 samples), 8 weeks (4 samples), 12 weeks (7 samples), 16 weeks (6 samples), and 20 weeks of age (5 samples)).The original data was normalized by the logarithm ratios: Log10 , but this ratio cannot be directly used to calculate the correlation between genes. So the normalized data was transformed back to the general ratio  by exponent 10 operation.e.g., gene expression, protein expression, or metabolite expression data) based on three conditions, which are both theoretically and numerically proven [DNB can be detected from high throughput data .1. Pearson correlation coefficients (PCCs) between any pair of members in DNB become very high .2. PCCs between one member of DNB and any other molecule of non-DNB become very low .3. Standard deviation (SD) for any member of DNB becomes very high  as described next in details. Note that DNB is also the leading network, which makes the first move into the disease state from the normal state, and therefore, is causally related to the initiation and progression of the disease [Actually, it can also be shown that SD for any member of non DNB, and the PCCs between non-DNB members have no significant change. Clearly, the molecules in the dominant group are strongly and dynamically correlated in the pre-disease state. These molecules in the dominant group are expected to form a subnetwork or functional module from a network viewpoint, .e., eqn. as descrIn every time point, the gene expression data was used to produce the modules or candidate DNBs by hierarchical clustering based on the distance of Pearson Correlation Coefficient (PCC), according to the three conditions of the DNB. In the hierarchical clustering, two modules can be combined into a new module, only if the average PCC inside the new module was greater than threshold PCC. The threshold also was used to control the end of clustering Figure . For bali.e., a composite index) by the following formula:The dynamic network biomarkers (DNB) were identified by a new method ,17 whichwhere For every time point, the score of every module was calculated by the above formula based on the gene expression of the module in this time point and the best module with the highest score was regarded as the potential DNB in this time point. Then, these identified potential DNBs in every time point were compared each other, and the highest score DNB in all time points was the DNB for detecting the early-warning signals before the disease onset Figure . The timThe regulated genes by the identified DNB module are picked up from the onset time point. The genes, which are highly correlated with DNB module in onset time point and are also differential expression genes between the critical point and onset time point, are regarded as regulated genes by the DNB module. If a gene is highly related with at least 10 genes of DNB, we deem that the gene is highly related to the DNB module. Here the threshold of high relation is set to 0.05 of P-value of PCC and the threshold of differential expression is 0.05 of P-value of student's t test.http://www.genome.jp/kegg/), and these pathways can be related to the disease initiation and progression. First, the genes of the DNB were mapped to pathways by the KEGG Mapper tools (http://www.genome.jp/kegg/mapper.html) which are the online tools for KEGG mapping. Subsequently, the correlations between the DNB and each pathway in KEGG were calculated in two time points that are the critical point and the disease onset point.The confidence of the identified DNB which is associated with early-warning signals before the disease onset can be proven by the evidence of disease phenotype from published references. The genes in the identified DNB have been linked and correlated to some pathways of KEGG (http://david.abcc.ncifcrf.gov/). The second DNB in the third time point included 96 genes , and the module of the highest score was regarded as a candidate or potential DNB in this time point. Therefore, we got 6 potential DNBs in 6 different time points and the scores of the potential DNBs were shown in Figure , and theThe two identified DNBs were exhibited by the score of module in every time point of T1D development, shown as Figure From the score of the second DNB in every time point Figure , we can For analyzing the mechanism of DNB during the development of T1D, the genes of the first DNB were mapped to the pathways of mouse in KEGG, and only 12 genes were identified from 21 pathways in KEGG. It means that many genes in the DNB would take part in more than one pathway and could affect the cross-talking among different pathways. In these pathways, the \"Insulin signaling pathway\" is an important one that regulates many metabolism and signal pathways, and is also associated with T1D development. It also includes some virus related pathway in the DNB mapped pathways, such as \"Epstein-Barr virus infection\". It is consistent with the theory which considers that T1D is a virus-triggered autoimmune response .The genes of the second DNB were also mapped to the pathways of mouse in KEGG, and 11 genes were identified from 23 pathways in KEGG. There were also many genes which took part in more than one pathway, and they could affect the cross-talking among different pathways. There were three immune related pathways in which the genes of the second DNB participate, such as \"T cell receptor signaling pathway\", \"NF-kappa B signaling pathway\" and \"Intestinal immune network for IgA production\". Because T1D is an autoimmune disease and pancreatic lymph nodes are a major tissue to preserve T cell in pancreas, the \"T cell receptor signaling pathway\" would play an important role in the disease onset of T1D. The \"NF-kappa B signaling pathway\" is an important pathway in the T cell autoimmune and related to the onset of T1D ,15.T1D is a form of diabetes mellitus that results from autoimmune destruction of insulin-producing beta cells of the pancreas, and usually has an autoimmune T cell-mediated process in which insulin would be against by autoantibodies . \"T cellhttp://www.t1dbase.org/). Finally, 20899 genes were mapped to T1Dbase database from 21000 genes of NOD mouse genome, and 3458 of these genes were identified as T1D related genes based on existing databases and publication literature. The number of the regulated genes by two DNBs were separately 1049  are also in the second DNB, so it is possible that the second DNB can be affected by the first DNB and there is a bridge link between the two DNBs. We picked up the high correlation genes with the second DNB from the regulated genes by the first DNB, and differential expression was used to filter the selected genes. Finally, 110 genes (additional file During the development of T1D, the disease progression will pass a pre-disease stage which is a critical transition period from normal stage to disease stage. After it passes through the critical point, the disease progression is generally irreversible [We consider that there are two kind of potential mechanisms for the DNB triggering the disease deterioration or phenotype change. On the one hand, the genes in the DNB were gathered together in the critical point, so they could interact and affect one another. Because most genes in DNB take part in more than one pathway, so these interactions and effects could make these genes deviate from the major pathway and regulate the disease related pathway together in disease onset point. For example, the genes in the two DNB modules were highly correlated with the three pathways on Table On the other hand, the genes in the DNB were gathered together to form a module by upstream signal in the critical point, the module can also regulate a small number of genes in some pathway in the critical point. These genes which were mediated by the module in the critical point could play important role in corresponding pathways and trigger the change of the disease phenotype in the disease onset point. For example, we can see from Table i.e., dynamical network biomarkers. Specifically, we found two dynamical network biomarkers which can be used to detect the early-warning signals and predict the upcoming disease onset of T1D by the theory of early-warning signals of complex disease [Traditional biomarkers are usually used to distinguish disease state from normal state, rather than pre-disease state -20. It m disease . Based oThe authors declare that they have no competing interests.LC designed research. XL, RL and XMZ performed data analysis. XL and CL wrote the paper. All authors read and approved the final manuscript.function annotations for the genes of the two DNBs. The first DNB contains 95 genes, but only 85 genes can be annotated by DAVID online tool. The second DNB contains 96 genes, but only 80 genes can be annotated by DAVID online tool.Click here for filethe genes are regulated by the first DNB in next time point of the DNB appearance. \"Gene_Name\" represents the gene symbol. \"Gene_ID\" means Entrez Gene ID. \"T1D_Publication\" indicates the number of T1D-specific publications associated with the gene. \"In_Beta_Cell_or_Islets\" indicates that the gene is expressed in beta cells/islets. \"In_Mouse_Genetic_Region\" indicates that the gene was found in a mouse linkage region.Click here for filethe genes are regulated by the second DNB in next time point of the DNB appearance. \"Gene_Name\" represents the gene symbol. \"Gene_ID\" means Entrez Gene ID. \"T1D_Publication\" indicates the number of T1D-specific publications associated with the gene. \"In_Beta_Cell_or_Islets\" indicates that the gene is expressed in beta cells/islets. \"In_Mouse_Genetic_Region\" indicates that the gene was found in a mouse linkage region.Click here for filethe genes linked the two DNBs. \"Gene_Name\" represents the gene symbol. \"Gene_ID\" means Entrez Gene ID. \"T1D_Publication\" indicates the number of T1D-specific publications associated with the gene. \"In_Beta_Cell_or_Islets\" indicates that the gene is expressed in beta cells/islets. \"In_Mouse_Genetic_Region\" indicates that the gene was found in a mouse linkage region.Click here for fileThis file showed the correlation between DNB and every pathway of mouse from KEGG database. Connection Count is the number of high correlation gene pairs between DNB and pathway. Source number is the number of DNB genes which highly correlated with some genes in pathway. Target number is the number of pathway genes which highly correlated with some genes in DNB. DNB genes count is the number of genes in this DNB. Pathway genes count is the number of genes in this pathway.Click here for file"}
+{"text": "The zoonotic potential of paramyxoviruses is particularly demonstrated by their broad host range like the highly pathogenic Hendra and Nipah viruses originating from bats. But while so far all bat-borne paramyxoviruses have been identified in fruit bats across Africa, Australia, South America, and Asia, we describe the detection and characterization of the first paramyxoviruses in free-ranging European bats. Moreover, we examined the possible impact of paramyxovirus infection on individual animals by comparing histo-pathological findings and virological results. Organs from deceased insectivorous bats of various species were sampled in Germany and tested for paramyxovirus RNA in parallel to a histo-pathological examination. Nucleic acids of three novel paramyxoviruses were detected, two viruses in phylogenetic relationship to the recently proposed genus Jeilongvirus and one closely related to the genus Rubulavirus. Two infected animals revealed subclinical pathological changes within their kidneys, suggestive of a similar pathogenesis as the one described in fruit bats experimentally infected with Hendra virus.Microchiroptera compared to Megachiroptera can be assumed. Given that the infected bats were either found in close proximity to heavily populated human habitation or areas of intensive agricultural use, a potential risk of the emergence of zoonotic paramyxoviruses in Europe needs to be considered.Our findings indicate the presence of bat-born paramyxoviruses in geographic areas free of fruit bat species and therefore emphasize a possible virus\u2013host co-evolution in European bats. Since these novel viruses are related to the very distinct genera Rubulavirus and Jeilongvirus, a similarly broad genetic diversity among paramyxoviruses in other  Paramyxoviridae are divided into two subfamilies, Paramyxovirinae and Pneumovirinae, comprising a vast variety of animal- and human-pathogenic viruses Paramyxovirinae, five genera have been classified, Respiro-, Morbilli-, Rubula-, Avula-, and Henipavirus, as well as a fast-growing group of unclassified viruses. The increased molecular characterization of recently isolated paramyxoviruses indicates a much greater genetic diversity within the subfamily Paramyxovirinae than previously assumed. Furthermore, the detection of highly human-pathogenic paramyxoviruses has also influenced the attention drawn to paramyxovirus research and to the isolation of further novel paramyxoviruses from hosts that are suggested as likely species to transmit newly emerging viruses. Bats are among this highly suspected group of animals Pteropus spp. (flying foxes) fruit bats Paramyxoviridae so far detected in bat species have been identified in fruit bats across Africa, Australia, South America, Asia, and Madagascar Scotophilus kuhlii) Members of the virus family The present study aimed to detect and isolate novel paramyxoviruses in free-ranging European insectivorous bats and to estimate a possible impact of paramyxovirus infection on infected individual animals by comparing histo-pathological findings and virological results.Eptesicus nilssoni, E. serotinus, Myotis bechsteini, M. daubentonii, M. mystacinus, M. nattereri, Nyctalus leisleri, N. noctula, Pipistrellus kuhli, P. nathusii, P. pipistrellus, P. pygmaeus, Plecotus auritas, P. austriacus, Vespertilio murinus) were examined. The bat carcasses originated from 4 different geographic regions in Germany, i.e. Berlin greater metropolitan area (n\u200a=\u200a83), Bavaria (n\u200a=\u200a30), Brandenburg (n\u200a=\u200a5), and Baden-Wuerttemberg (n\u200a=\u200a2). Bat carcasses were stored at \u201320\u00b0C for transportation before performing a full necropsy. For histo-pathological examination, a small piece of tissue from all organs was fixed in buffered 4% formalin, processed routinely and embedded in liquid paraffin. Paraffin blocks were cut at 2\u20135 \u00b5m thickness and stained with hematoxylin-eosin As part of a study to investigate diseases in free-ranging bats in Germany TM Viral RNA/DNA Mini Kit, Invitrogen, Germany) and further cDNA synthesis according to the manufacturer\u2019s instructions . Broadly reactive paramyxovirus-specific RT-PCR assays were applied 2 (Invitrogen), 2.5 pmol desoxynucleoside triphosphates (Invitrogen), 2 \u00b5l of cDNA, and 1.25 U of Platinum\u00ae Taq polymerase (Invitrogen). Water was then added to a final volume of 25 \u00b5l. The PCR mixture was sequentially incubated at 94\u00b0C for 2 min for denaturation, and then 40 cycles at 94\u00b0C for 15 s, 50\u00b0C for 30 s, 72\u00b0C for 30 s, and a final extension at 72\u00b0C for 7 min. For the second amplification in the seminested PCR assay, 1\u00d7Platinum\u00ae Taq buffer, 25 nmol MgCl2, 2.5 pmol desoxynucleoside triphosphates, 3 pmol each of forward and reverse primers, 1.25 U Platinum\u00ae Taq, 1 \u00b5l PCR product from the first reaction, adding water to a final volume of 25 \u00b5l. The cycling conditions were identical to the ones of the first round.Pooled organ tissue from each bat was used for RNA/DNA extraction . Amplicons from the PCR reaction were purified using the MSB\u00ae Spin PCRapace kit . Both strands of the amplicons were sequenced with a BigDye Terminator v 3.1 Cycle Sequencing kit on an ABI Genetic Analyzer 3500 \u00d7l D\u00d7 automated sequencer  using the corresponding PCR primers. Remaining reaction conditions were performed in accordance to the manufacturer\u2019s protocol.On the basis of newly acquired sequence information, specific qPCR assays were designed  to screeAdditional primers were designed using conserved regions between Jeilongviruses and Henipaviruses to extend the sequence obtained by PAR primers (primers and protocol are available on request).Paramyxoviridae taxonomy using MrBayes, version 3.1.2 jModelTestBayesian reconstruction of phylogenetic trees was performed in concordance with the current proposals of For confirmation of virus isolation and determination of the infected organs, RNA/DNA extraction and PCR analysis including sequencing was performed on all individual organs from infected bats. For two isolates, a second RT-PCR with primers RES-MOR-HEN Paramyxoviridae from GenBank  Paramyxovirinae the extent of minimal nucleotide homology for the partial polymerase gene between different viruses in the same genus ranges from 64.1% (Rubulavirus) to 76.8% (Henipavirus), whereas the extent of nucleotide similarity between viruses from different genera is between 40.3% (Morbillivirus) and 58.1% (Henipavirus). Analysing the nucleotide homology of the partial polymerase gene of the new insectivorous bat paramyxoviruses, no definite correlation to one of the other paramyxovirus genera could be obtained. The comparison of sequences of BatPV/Myo.mys/E20/09 (Accession number JN086953) and BatPV/Pip.pip/E95/09 (Accession number JN086954), obtained from the PCR assay with RES-MOR-HEN primers (The modified PCR protocol (PAR primers) resulted in a 10-fold increase of sensitivity compared to the published protocol which was applied as a two-step PCR . With th GenBank . Phyloge primers , confirmMyotis mystacinus) found in Bavaria. Histological examination of the internal organs revealed multifocal mild interstitial nephritis with lymphoplasmacytic infiltrates and occasional neutrophiles. Lungs had mild non-suppurative interstitial pneumonia and marked leucocytostasis in most blood vessels. Additionally, there was distinct activation of the lymphoreticular tissue of the spleen with moderate follicular hyperplasia and sparse irregularly distributed small foci of lymphocytes and plasma cell aggregations within the liver.The first paramyxovirus termed BatPV/Myo.mys/E20/09 was detected in pooled organs and was subsequently confirmed in the kidney only of one adult male whiskered bat (Pipistrellus pipistrellus) also found in Bavaria. No specific infected organ could subsequently be determined due to sample size limitations. Histologically the animal had multifocal moderate interstitial nephritis with segmental infiltrates of lymphocytes, plasma cells, and occasional single neutrophiles (The second virus (BatPV/Pip.pip/E95/09) was detected in the pooled organs of an adult female common pipistrelle bat  found in Berlin. Histologically the bat revealed marked follicular hyperplasia of the spleen without further inflammatory organ lesions. The lung was severely congested, and oedematous fluid was present in the lung parenchyma.The third virus (BatPV/Nyc.noc/E155/09) was detected in pooled organs and was subsequently confirmed in the lung of only one adult female noctule bat .After screening all 120 bats of 15 species with three virus-specific qPCR assays, an identical paramyxovirus to BatPV/Myo.mys/E20/09 was detected in the spleen of one additional During the past decade, bats have increasingly been recognized as members of the animal group with the highest relative risk to harbour novel emerging zoonotic pathogens With this study, we were able to describe the detection and characterization of the first three paramyxoviruses in insectivorous bats. The genetic distance between these three novel paramyxoviruses and the closest related member known is higher than that of members within other paramyxovirus genera, suggesting that all three viruses might be considered as unassigned paramyxoviruses. Thus the two viruses BatPV/Myo.mys/E20/09 and BatPV/Pip.pip/E95/09 might even be considered as members of a new putative genus, as they contain an amino acid identity of 79.5% of the partial L-gene, the highest conserved region of the paramyxovirus genome. Further precise genetic analyses will have to prove whether they ought to be integrated into the proposed new genus Jeilongvirus remains open it is important to note, that nephritis is a rare finding in insectivorous bats. Out of 500 examined deceased bats only 3% had inflammatory changes within their kidneys, while 20% of these respective cases were clearly associated to bacterial disease Besides virus detection, our study allowed a direct correlation of virology and histo-pathology results. In previous studies in which bats were examined for paramyxovirus infections, no overt clinical disease was noted Emerging paramyxoviruses from fruit bats in spill-over hosts have regularly been associated with ecosystem and land-use changes resulting in an increased overlap of bats, domestic animals, and human ecologies and thereby increased opportunities for bat-borne zoonotic diseases to emerge Is there a possibility for paramyxoviruses of insectivorous bats to emerge as zoonotic pathogens? Before any answer to this question can be attempted, further research on paramyxovirus diversity and distribution combined with the understanding of dynamics of pathogen cycles within bat populations will be needed as well as investigations into pathogenicity factors of these viruses, like receptors for host invasion. Particularly as so far transmission of bat related paramyxoviruses did not occur directly between bats and humans but depended on a secondary host species like horses or pigs."}
+{"text": "In the United States, approximately 9% of the measles cases reported from 2012 to 2014 occurred in vaccinated individuals. Laboratory confirmation of measles in vaccinated individuals is challenging since IgM assays can give inconclusive results. Although a positive reverse transcription (RT)-PCR assay result from an appropriately timed specimen can provide confirmation, negative results may not rule out a highly suspicious case. Detection of high-avidity measles IgG in serum samples provides laboratory evidence of a past immunologic response to measles from natural infection or immunization. High concentrations of measles neutralizing antibody have been observed by plaque reduction neutralization (PRN) assays among confirmed measles cases with high-avidity IgG, referred to here as reinfection cases (RICs). In this study, we evaluated the utility of measuring levels of measles neutralizing antibody to distinguish RICs from noncases by receiver operating characteristic curve analysis. Single and paired serum samples with high-avidity measles IgG from suspected measles cases submitted to the CDC for routine surveillance were used for the analysis. The RICs were confirmed by a 4-fold rise in PRN titer or by RT-quantitative PCR (RT-qPCR) assay, while the noncases were negative by both assays. Discrimination accuracy was high with serum samples collected \u22653 days after rash onset . Measles neutralizing antibody concentrations of \u226540,000 mIU/ml identified RICs with 90% sensitivity  and 100% specificity . Therefore, when serological or RT-qPCR results are unavailable or inconclusive, suspected measles cases with high-avidity measles IgG can be confirmed as RICs by measles neutralizing antibody concentrations of \u226540,000 mIU/ml. Despite continued importations of measles virus into the United States, the elimination of indigenous measles has been maintained for over 15 years because of sustained high coverage with two doses of measles-mumps-rubella (MMR) vaccine 13. Many cLaboratory confirmation of measles virus infection is a critical component of the surveillance required to support measles control and elimination programs. Though detection of measles virus-specific IgM by enzyme immunoassay (EIA) is the most widely used method to confirm measles virus infection, suspected measles cases in highly vaccinated populations may require additional testing. Inconclusive results obtained by IgM testing can be confirmed by detection of measles virus RNA by reverse transcription (RT)-PCR.A suspected measles case in a previously vaccinated individual can be classified as a primary vaccine failure (PVF) by measurement of low-avidity measles IgG antibody . Individ10\u201314\u2013Serum samples collected at or near the onset of rash from RICs often have undetectable measles-specific IgM while high levels of measles-specific IgG are present \u201318. Ther\u201318\u2013In this study, persons suspected of having measles with high-avidity measles IgG antibody in serum were tested by standard laboratory methods and were classified as having either a RIC or a rash illness not attributable to measles (noncase). Receiver operating characteristic (ROC) curve analysis was performed by using measles neutralizing antibody concentrations from these two groups as the discriminating variable to evaluate the use of neutralizing antibody concentrations to distinguish between RICs and noncases.Clinical samples from persons with suspected cases of measles included in this study were submitted to the Centers for Disease Control and Prevention (CDC) for routine confirmatory testing during 2006 to 2014. As part of routine surveillance, serum samples were tested for measles-specific IgM with the CDC measles IgM capture EIA and measles-specific IgG was detected with either the CDC measles IgG indirect EIA  or a comIn this report, RIC is used to define a confirmed case of measles in an individual with high-avidity measles IgG, and the definition applies whether the previous immune response was elicited by vaccination or by wild-type infection. In the absence of a gold standard assay for measles virus reinfection, the criteria for inclusion of a suspected measles case as a RIC required the measurement of high-avidity measles IgG in serum and laboratory confirmation of acute measles by detection of measles virus RNA by RT-qPCR or measurement of a 4-fold rise in PRN titer between two paired serum samples . A suspeMeasles IgG avidity was measured in serum samples with an assay developed at the CDC by using a commercial measles IgG EIA  modified for use with the denaturing agent diethylamine as previously described .Serum was tested for measles neutralizing antibody by the PRN assay . The WorROC curve analysis was used to estimate the accuracy of the parameter  to distinguish between a RIC and a noncase on the basis of the area under the ROC curve (AUC). ROC analysis was used to establish a cutoff based on the measles neutralizing antibody concentration and to estimate sensitivity and specificity . The nulP value of \u22640.05 was considered significant. Geometric mean concentrations (GMCs) were determined by using the measles neutralizing antibody concentrations obtained with the PRN assay. Therefore, GMC refers to the GMC derived from PRN titers expressed in mIU/ml.ROC analysis was performed and graphs were prepared with MedCalc for Windows, version 13.1.1.0 . The significance of the differences between the groups defined in this study was determined with the t statistic for comparison of two small sample means. All tests of significance were two tailed and unpaired. A The box-and-whisker plots and comparison tests were generated with GraphPad Prism 5 software . Outlier and extreme outlier values were identified on the basis of the standard parameters for box- and-whisker plots. The values for Q1 \u2212 1.5 \u00d7 IQR (interquartile range) and Q3 + 1.5 \u00d7 IQR are the \u201cinner\u201d fences, and the values for Q1 \u2212 3 \u00d7 IQR and Q3 + 3 \u00d7 IQR are the \u201couter\u201d fences. The outliers (shown as solid circles) are between the inner and outer fences, and the extreme outliers (shown as squares or triangles) are outside the outer fences.n = 22), or the avidity result was in the intermediate range (n = 3). These 25 suspected cases, which could include noncases, primary cases, and RICs, and the 27 cases with low-avidity measles IgG antibody measured in serum were excluded from the ROC analysis  cases for which a viral specimen had been tested by RT-qPCR and two serum samples were available to test for the presence of a 4-fold rise in PRN titer. Specimens from 20 of the 77 suspected cases were negative by RT-qPCR and had no 4-fold rise in PRN titer and therefore met the criteria for noncases.Fifty-seven persons with suspected cases whose serum samples contained high-avidity measles IgG were laboratory confirmed as having acute measles by one or both of the methods required for inclusion as a RIC . Forty-eP < 0.0001) than that of the noncases (30 versus 10.5 years). The gender composition of the RICs was equally divided, with 29 males and 28 females, whereas there were only 6 (30%) females among the 20 noncases (data not shown). Among the RICs, the proportion of positive IgM results increased from 51 to 68% after testing of the second serum sample, while the number of IgM-positive samples decreased slightly among the noncases between the first and second samples . The median age of the RICs was significantly greater  . Five  from the GMC  of the 31 follow-up samples (ROC2) (The GMC of the 57 RICs with serum samples collected between 0 and 11 days after rash onset (ROC1) was 12,281 mIU/ml. This was significantly different (s (ROC2) . No signP = 0.0112; ROC2, P < 0.0001).Two data points were identified as extreme outliers in each ROC analysis. These two measles neutralizing antibody concentrations were from the same noncase (case X). The first serum sample, collected on day 3, had a concentration of 107,712 mIU/ml; the second serum sample (day 10) had a concentration of 94,860 mIU/ml (n = 49), 41 (83.7%) had measles neutralizing antibody concentrations of \u226540,000 mIU/ml.Measles neutralizing antibody concentrations of \u226540,000 mIU/ml were obtained from the first serum sample collected from 18/57 (31%) RICs and from 28/31 (90%) RICs with a second serum sample collected . Thirty-n = 31), the sensitivity of the cutoff to identify RICs was 90% .A cutoff of 40,000 mIU/ml had a specificity of 95%  for confirmation of RICs. Furthermore, this cutoff accommodates the 3-fold variation inherent in the PRN assay . The speP = 0.1821) .Measles neutralizing antibody concentrations were available from the two groups that were excluded from the ROC analysis . Serum samples from 17 of the 20 suspected cases with high-avidity measles IgG antibody had at least one serum sample with a concentration of \u226540,000 mIU/ml and were designated confirmed RICs (cRICs). Eight of the 25 IgG-positive suspected cases with inconclusive avidity results (not tested or intermediate avidity) had at least one serum sample with a concentration above the 40,000-mIU/ml cutoff. Because the eight cases with concentrations of \u226540,000 mIU/ml could include primary measles cases, these cases were described as probable RICs (pRIC) . The GMCs of all of the serum samples from the 17 cRICs  and the 8 pRICs  were not significantly different . Two of the RICs (cases 33 and 34) showed no change in titer with intervals of 7 and 18 days between sample collections. There was no correlation between the magnitude of the fold change in PRN titer and the length of the interval between sample collections, nor was there a correlation between the magnitude of the measles neutralizing antibody concentration and detection of IgM (data not shown).Multiple serum samples were collected from two of the RICs  included in the ROC analyses . Case 7 n = 20), RICs (n = 57), cRICs (n = 17), and pRICs (n = 8), were 1,385, 24,325, 130,205, and 41,345 mIU/ml, respectively (data not shown). The serum samples from these four groups were stratified into four intervals based on the timing of serum collection after rash onset for analysis of the GMCs (P = 0.1773) or the pRICs (P = 0.8258) for the time interval of 0 to 2 days. After 3 days, the measles neutralizing antibody concentrations increased among all of the cases identified as RICs, cRICs, and pRICs. All three of these RIC groups demonstrated a trend of decreasing concentrations at 8 days after rash onset.The GMCs of all of the serum samples, regardless of the timing of collection from the noncases  IgM result from an acute-phase serum sample is difficult to interpret and a sample for RT-PCR may not be available. Therefore, additional assays to confirm measles reinfections may prove useful, particularly in elimination settings.The evaluation of the RICs and noncases by ROC analysis confirmed that high concentrations of measles neutralizing antibodies can accurately identify RICs among suspected cases of measles that have high-avidity measles IgG. A measles neutralizing antibody concentration of 40,000 mIU/ml was selected as the minimum concentration for confirmation of a RIC among suspected measles cases. In this study, concentrations of \u226540,000 mIU/ml confirmed 41 (83.7%) of 49 RICs with serum collected \u22653 days after rash onset. Many of the RICs in this study had measles neutralizing antibody concentrations of \u226540,000 mIU/ml as early as the day of rash onset, which is not surprising, since exposure to virus typically occurs 12 to 14 days prior to the appearance of a rash. However, since a larger proportion of the serum samples that reached the threshold antibody concentration were collected \u22653 days after rash onset, a second serum sample may need to be tested to confirm a RIC. Collection of serum at day 3 or later is consistent with the surveillance recommendation  to colleWhile many RICs may be confirmed as measles cases by epidemiologic association with another confirmed case, other situations may require laboratory confirmation. Detection of measles virus RNA by RT-PCR has become a widely available method for case confirmation, but failure to promptly collect appropriate specimens may reduce the utility of RT-PCR. Most of the follow-up serum samples in this study were late acute-phase serum samples rather than convalescent-phase samples, which are usually collected at least 2 weeks after the acute-phase serum sample for evaluation of a 4-fold rise in antibody titer. Collection of a standard convalescent-phase serum sample among suspected RICs would not be advantageous, since a rise in titer may not be observed because of the early and robust anamnestic response in most RICs. Rapid increases in measles neutralizing antibody concentrations in RICs were observed with intervals as short as 1 to 3 days between serum sample collections. However, a concentration of \u226540,000 IU/ml in a single serum sample with high-avidity measles IgG from a suspected measles case is sufficient to confirm a RIC.n = 21) had a positive IgM result. Although many of the RICs in this study had early acute-phase serum samples that were strongly positive in the measles IgG EIA, individuals with rash illnesses attributable to other etiologic agents may also show strong reactivity in the measles IgG EIA as a result of immunologic stimulation and production of polyclonal IgG  in this study were recorded as unvaccinated yet had high-avidity measles IgG. These individuals may have received a vaccination early in life, or it is possible that they had measles in childhood. Three of the RIC patients were \u226552 years of age, and two of these were born overseas in a country where measles was endemic. There are reports of individuals who have been reinfected despite natural measles in childhood; however, documentation of measles disease is not usually available and prior vaccination is difficult to rule out , 36, 38.This study has several limitations. Eight (14%) of the RIC patients had neutralizing antibody concentrations of <40,000 mIU/ml at \u22653 days after rash onset. The measles neutralizing antibody concentrations of these individuals ranged from 402 to 29,367 mIU/ml, and the samples were collected on days 3 to 24 after rash onset. This suggests that a proportion of RICs may not elicit a robust neutralizing antibody response regardless of the interval from rash to serum sample collection. Therefore, a neutralizing antibody concentration of <40,000 mIU/ml should not be used to rule out measles in an individual with high-avidity measles IgG that has clinically compatible symptoms.Another limitation is that the RICs and noncases included in the ROC analyses may have been misclassified. A gold standard assay for measles reinfection does not exist. Instead, high-avidity measles IgG and either a positive RT-PCR result or a 4-fold rise in titer between paired serum samples (or both) were considered valid methods to confirm a RIC. The criteria for a noncase required both the absence of a 4-fold rise in PRN titer and a corroborating negative RT-PCR result. However, negative results by either or both assays among suspected cases with high-avidity IgG could result in misclassification of a RIC as a noncase. Indeed, a negative result by RT-qPCR and a very high measles neutralizing antibody level in the first serum sample eliminated the ability to demonstrate a rise in titer and resulted in the inclusion of a RIC among the noncases (case X). The other noncases had a low suspicion of measles and had been ruled out following extensive investigations. The presence of high-avidity measles IgG antibody in serum from the noncases would exclude the possibility of a primary infection with measles.Finally, the noncases in our study may have had lower levels of measles neutralizing antibody concentrations than what is typical in the general population. The measles neutralizing antibody concentrations calculated for the 20 noncases (excluding a misclassified RIC) ranged from 165 to 13,083 mIU/ml , which is consistent with data from other studies, many of which measured measles antibody titers shortly after vaccination or revaccination \u201359. In o\u2013The PRN assay is only available in a few reference or research laboratories, since the test requires specialized reagents and training. The need for PRN testing to confirm RICs would be limited to those settings in which endemic measles has been eliminated. Even in such settings, it is not anticipated that many suspected cases of measles would require PRN testing, since measles reinfections occur infrequently and RT-PCR is widely available. If inconclusive IgM results are obtained, RT-PCR should be utilized to confirm suspected cases of measles whenever possible. Under some circumstances, highly suspicious cases of measles that have negative RT-PCR results may require additional testing. While measles neutralizing antibody concentrations below the threshold level cannot be used to rule out a case, concentrations of \u226540,000 mIU/ml can confirm the case, albeit retrospectively. Since the PRN assay takes 7 to 10 days to complete, case investigations should not be delayed while specialized additional testing is under way. However, in an elimination setting, this additional method can aid in confirming RICs that cannot be resolved by standard techniques and have no epidemiologic link to a laboratory-confirmed measles case.High vaccination coverage has successfully prevented measles from reestablishing endemic circulation in the United States despite continuous importation of the virus . As immu"}
+{"text": "Measles is a highly contagious viral infection causing large outbreaks all over the world. Despite the availability of safe and cost effective vaccine, measles remained endemic with persistent periodic outbreaks in the Horn of Africa. The aim of this study is to characterize laboratory confirmed measles cases in Amhara Regional State, which was one of the highly affected regions in Ethiopia.A suspected measles case was defined as any person presenting with fever, maculopapular rash and one or more of the three symptoms cough, coryza or conjunctivitis or a patient in whom a clinician suspects measles. A blood sample was collected for any measles suspected patient with a case based investigation form and specimen transported to the National Measles Laboratory in good condition where\u00a0it was to be tested for Measles IgM antibody by ELISA technique. Data was entered and analyzed using Epi-Info 3.5.4 software.A total of 6579 samples were tested for measles IgM among 7296 samples collected in Amhara Regional State over 11 years (2004\u20132014). Of the tested samples, 2412 (36.7\u00a0%) were found positive, while 3965 and 202 samples were found to be negative and equivocal (compatible) respectively. Patients with age \u226510\u00a0years were the most affected. The highest number of laboratory confirmed measles cases were detected in 2014 and cases were occurred in all of the 11 zones of the state. A seasonal peak was noted in the hot-dry season of the year.Measles remains to be a public health problem in Amhara Regional State of Ethiopia, mostly affecting people \u226510\u00a0years of age. Measles virus was detected in all zones of the state, reaching its peak in the hot-dry season. To reduce the incidence of measles, it is highly recommended to improve routine immunization, and conduct a wide age group campaign.Additional research to evaluate the knowledge, attitudes and practices of the general population and health care professionals about measles infection and vaccination is important. Genotyping of circulating measles virus strain is recommended. Measles is one of the most contagious vaccine preventable viral diseases and is known to cause severe complications such as encephalitis, pneumonia, ear and sinus infections, persistent diarrhea, upper airway obstruction, mouth ulcers and death. It is caused by the genus Morbillivirus within the family Paramyxovirus for which humans are the only reservoir . TransmiGlobally, an estimated 197,000 measles deaths occurred in 2007, with 136,000 (69\u00a0%) and 45,000 (23\u00a0%) occurring in Southeast Asia and Africa respectively. Generally in Africa, the\u00a0measles case fatality rate ranges from 3 to 5\u00a0%, reaching up to 30\u00a0% during severe outbreaks and outbreaks in closed communities such as refugee camps [Following the initiation of accelerated measles control, Ethiopia has conducted a series of emergency and catch-up measles immunization campaigns between 2002 and 2004 which were conducted in a phased manner throughout the country, with average national coverage of 92\u00a0%. Measles case based surveillance, including laboratory confirmation, was initiated in 2004 to enhance detection, investigation and control of outbreaks. Since 2005 sub-national level follow-up SIAs have been carried out in an interval of 2\u20134 years .Among others the case-based surveillance for measles requires that all suspected measles cases are investigated\u00a0during initial contact with the case using an individual case investigation form; a blood specimen is collected for serologic confirmation of measles infection. The laboratory plays a central role in the confirmation of suspected cases and outbreaks, and in the identification of circulating strains of measles virus .The WHO African measles elimination goals aim at improving case based surveillance and achieving and sustaining high measles vaccination coverage to reduce measles incidence\u2009<\u20091 confirmed cases per million by 2020 in the African region including Ethiopia \u20139. The p2 and is located in the North Western and North central part of Ethiopia. The State shares common borders with Tigray, Afar, Oromia and Benshangul Gumuz regional states in North, East, South and South-West respectively and the Republic of South Sudan in the west. Administratively the region is divided into 11 zones and further sub-divided into woredas and kebeles  cough, 2) coryza), or 3) conjunctivitis OR any person in whom a clinician suspects measles. A case of laboratory confirmed measles is a suspected measles case that is investigated (including the collection of blood specimen), and has serological confirmation of recent measles virus infection (presence of measles IgM antibody) who has not received measles vaccination in the 30\u00a0days preceding the specimen collection. Measles confirmed by epidemiological linkage is a suspected measles case that has not had a specimen taken for serologic confirmation and is linked  to\u00a0a lab confirmed cases. A clinically confirmed/compatible measles case is defined as a suspected measles case that has not had a blood specimen taken for serologic confirmation and is not linked epidemiologically to any lab confirmed outbreak of measles. A confirmed outbreak of measles is defined as 3 or more laboratory confirmed cases of measles in a health facility or district in a one month period [All patients regardless of age and sex that fulfilled the case definition for measles during the study period (2004\u20132014) were included in this analysis.Between 1 January 2004 and 31 December 2014, blood samples were collected from suspect measles cases in all zones of Amhara Regional State and transported to the National Measles Laboratory, located at the Ethiopian Public Health Institute (EPHI) in Addis Ababa for laboratory confirmation. Samples were collected and transported in good laboratory condition . Demographic and clinical information about the patient was captured through the case based investigation form.Samples were tested for measles virus specific IgM antibody by indirect enzyme linked immuno-sorbent assay (ELISA) using a commercially available test kit . Standard operational procedures (SOPs), and job aids are available for the laboratory activities. All the instruments and materials of the laboratory were supplied by WHO.The Ethiopian National Measles Laboratory is a member of the global WHO vaccine-preventable disease laboratory network and works according to WHO standards and protocols, receives external quality assessment (EQA) panel samples annually, sends 10\u00a0% quality control (QC) samples to regional reference laboratory (RRL) quarterly and is\u00a0accredited annually. The laboratory also applied external (kit) and internal (in house) control samples in each run and results were reported only when the run was valid based on the controls. The national laboratory scored \u226595\u00a0% performance for both EQA and QC during this study period.The laboratory test result and demographic information provided on the case investigation form were entered into the measles case-based surveillance system database. Data were consolidated, cleaned, analyzed and disseminated to stake holders for action using Epi-Info software version 3.5.4. Demographic characteristics of reported cases and trends in cases reported over time were assessed. The study was ethically approved by institutional review board of EPHI.Between 01 January 2004 and 31st December 2014, 7296 suspected measles cases investigated had both case report forms and blood samples available through the case-based surveillance system. Of these cases, 3781 (51.2\u00a0%) were males. The information on gender was unavailable for 17 cases. The mean age of suspected cases was 9.7\u00a0years, ranging from a month to 68\u00a0years (SD\u2009=\u2009\u00b18.8\u00a0years).Measles was detected in all 11 zonal administrations with the lowest number of cases (75) and positivity rate 3.1\u00a0%) in Bahir Dar special zone. Higher number of cases and positivity rate were noted in North Gonder  and South Wello 392, 16.3\u00a0%) zones  samples were tested by the laboratory for measles virus specific IgM antibody. Of these 2412 (36.7\u00a0%) were IgM positive (laboratory confirmed measles): 3965 cases were negative for the presence of measles IgM antibody and 202 specimens had equivocal lab results.Among 2412 lab confirmed measles, 1251 (51.9\u00a0%) were males and 9 cases had no information on sex available on the case report. The number of lab confirmed measles cases increased from 7 cases in 2004 to 611 in 2014  in 2014. The proportion of discarded cases (measles IgM negatives) decreased dramatically from 70\u00a0% in 2004 to 12\u00a0% in 2014. 23,842 epidemiologically-linked (Epi-linked) cases were reported between 2004 and 2014. The number of Epi-linked cases reached its peak in 2014 at 5701 , and a non-measles febrile rash (measles IgM negative or discarded case) rate of at least 2 per 100,000 population at national level indicating a high surveillance performance are two of the strategies needed to achieve this goal [From January 2004 through December 2014, a total of 2412 laboratory confirmed measles cases were found from all the 11 zones of Amhara Regional State, Ethiopia. A total of 717 samples were not tested during 2009\u20132011 and in 2014 due to shortage of measles kit. During this same time period, 23,842 cases were classified as epidemiologically linked and an additional 9699 cases were defined as clinically compatible.In general, the laboratory confirmed, clinically confirmed and epi-linked measles cases increased in the study period. The number and percentage of laboratory confirmed measles cases increased from 7 (5.7\u00a0%) in 2004 to 611 (65.9\u00a0%) in 2014 despite an increasing report of administrative measles vaccination coverage , 12. TheWe also noted a fluctuation of laboratory confirmed measles cases in the study years, high incidence of cases following a low incidence period detected in the area. This was a similar finding to a study in South West Nigeria , typicalIt was revealed from the result that there were a\u00a0lower number of lab confirmed cases in 2009 relative to 2008 and 2010. This might be related to the high measles vaccination coverage (96\u00a0%) achieve during the\u00a0SIA in the regional state during 2008 . This fiWith high coverage of routine measles vaccination, outbreaks are expected to stop altogether and transmission interrupted. However, in this region outbreaks did not\u00a0stop and\u00a0transmission\u00a0was not interrupted despite increasing vaccination coverage reported in routine immunization\u00a0and SIAs . There wIn this study, there was a gradual increase in the number of laboratory confirmed measles cases and persistent high measles positivity rate among patients \u226510\u00a0years age group and a decrease of cases among children under one year. This may reflect low immunization coverage in the region in previous years, and as a result more susceptibles accumulated in these age groups, which created a favorable condition for measles outbreaks to occur and\u00a0measles to circulate in these age groups. On the other hand the lower positivity rate among <1\u00a0year children may indicate the improvement of routine immunization. This higher measles positivity rate among adults was similar finding with studies in South Africa  and EuroMeasles infection in adults may have\u00a0serious consequences for children. Infected adults will be unable to work and care for their children and will transmit the virus to their susceptible children  as measlIn addition, our study revealed seasonality of measles confirmed cases during the period of analysis (2004\u20132014), with higher number of cases during February\u2013March (hot dry season) and lower numbers\u00a0in the rainy season of the region (July-September). This might be related with the population movement and many traditional ceremonies  during this season that created a favorable condition for measles transmission. Seasonal variation in the\u00a0hot dry season was\u00a0also noted in a study finding in Nigeria .The analysis also indicated that a high proportion (60\u00a0%) of suspected measles cases reported and tested in this surveillance system had negative results for measles IgM throughout the study years. This high IgM negativity rate may be a good sign for\u00a0the laboratory surveillance system.Measles cases  and outbreaks are increasing from year to year in the region. However, still there is no genotype data available to map circulating strain of the\u00a0measles virus. Virus isolation and genotyping of measles virus to identify source of infection is one of the strategies recommended by WHO AFRO to achieve the\u00a0measles elimination goal by 2020 [The findings of our study are\u00a0subjected to some limitations. First, not all measles suspected cases, especially during confirmed outbreaks, were reported through the laboratory case-based surveillance data. Only three laboratory confirmed measles were enough to declare a measles outbreak in that district; after that\u00a0no additional samples are collected\u00a0for the\u00a0next one month in that district. Secondly, our results may not be representative of all cases of measles and may be biased toward zones that have a good surveillance system and populations with more access to care. Finally, our analysis is limited by the limited demographic and clinical information collected on each reported case.In conclusion, the number and percentage of laboratory confirmed measles cases are increasing from year to year in the study area. Measles is widely circulating in the region primarily affecting age groups \u226510\u00a0years. We also noted a seasonal peak during February-May. Based on this finding, measles will\u00a0remain a public health problem in the Amhara Regional State of Ethiopia unless concerted efforts are made in the region and implemented to increase the vaccination coverage and continuing sensitive case based surveillance performance.We also recommend conducting a wide age group vaccination campaign in the region as there is more case in the age group >10\u00a0years. Additional study is needed in the region to better understand the age shift, and the knowledge, attitude and practices of the general population and health care professionals about measles infection and vaccination. As Ethiopia gets closer to measles elimination targets, it will be important to introduce genotyping to determine circulating measles virus strains."}
+{"text": "Before licensure of a measles vaccine in 1963, more than 500,000 measles cases on average were reported in the United States each year during 1951\u20131962  of an unvaccinated Salt Lake County resident aged 16 years with generalized rash (onset April 4) and a 3-day history of sore throat and fever (101.7\u00b0F [38.7\u00b0C]) . When inOn May 24, 2011, a Cache County resident notified the Bear River Health Department that her unvaccinated child aged 7 years had signs and symptoms compatible with measles, including generalized rash (onset May 23) and fever (101.5\u00b0F [38.6\u00b0C]) , Figure.During the two measles outbreaks, local health departments collaborated with the state health department in investigating and initiating active surveillance and outbreak response. Confirmed cases were defined using the 2010 Council of State and Territorial Epidemiologists measles case definition . Case-fiIn the two outbreaks, separated by 36 days, 13 persons were confirmed to have measles; nine (69%) were unvaccinated and had personal belief exemptions,For both outbreaks, approximately 13,000 contacts of patients were notified by visit, phone, letter, or e-mail. Health officials reviewed vaccination records of approximately 8,700 exposed persons, conducted 253 measles IgG antibody tests, and administered 484 MMR vaccine and 28 measles immunoglobulin doses as postexposure prophylaxis. Voluntary home quarantine of 192 exposed persons without presumptive evidence of immunity was requested.Because measles remains endemic in many regions of the world, the United States continues to be at risk for measles importations and outbreaks. In 2011, a total of 220 measles cases were reported in the United States, the highest number of reported measles cases since 1996; 89% were associated with importations , health-care providers and public health officials should consider measles in the differential diagnosis of febrile rash illness and should consider other potential exposures, including parvovirus, when ordering laboratory tests. Because measles now occurs so rarely in the United States, interpretation of measles tests can be challenging, especially during outbreaks, and confirming and correctly classifying measles in vaccinated persons can be particularly difficult. False-positive measles IgM results might be obtained in response to infections caused by parvovirus ,9 and otWhat is already known on this topic?Since introduction of the measles vaccine in 1963, the incidence of measles has declined significantly, such that measles is no longer endemic in the United States, and many U.S. health-care providers currently practicing have never seen a patient with measles. Measles remains common in parts of the world, however, and international travel\u2013related outbreaks are becoming more common.What is added by this report?During March\u2013June 2011, Utah investigated two measles outbreaks comprising 13 confirmed cases. One outbreak was associated with an unvaccinated U.S. resident who traveled internationally; the source was unknown for the second outbreak. Genotype D4 sequences obtained from the two outbreaks differed by a single nucleotide, suggesting separate importations; each of the sequences was identical to one of two predominant sequence variants of genotype D4 circulating in Europe during 2011.What are the implications for public health practice?Health-care providers should remind their patients of the importance of being current with measles, mumps, and rubella vaccination, especially before international travel. Recognition of suspected measles cases by health-care providers and immediate reporting to public health officials can help prevent illness and associated costs. False-positive measles serologic test results can be obtained in infections caused by parvovirus and other viruses, including enteroviruses, Epstein-Barr virus, and varicella zoster virus.Measles cases and outbreaks can have considerable impact on communities in the United States and often require substantial resources for public health response. Recognition of suspected measles cases by health-care providers and immediate reporting to public health officials can help limit illness and associated costs. For the two Utah outbreaks combined, those costs were estimated from multiple sources to exceed $330,000 for public health personnel time at state and local levels, vaccine administration, laboratory testing, and outbreak control efforts. Unvaccinated persons put themselves and their communities at risk for measles. Maintaining high vaccination coverage and rapid public health response is critical to ensuring continued measles elimination in the United States."}
+{"text": "The sensitivity and the agreement of the VIDAS\u00ae Measles IgG assay compared to the Enzygnost\u00ae Anti-measles Virus/IgG assay and the Measles IgG CAPTURE EIA\u00ae assay are 100%, 97.2% and 99.0%, 98.4%, respectively. The very low number of negative sera for IgG antibodies does not allow calculation of specificity. As a secondary objective, we have evaluated the ability of the VIDAS\u00ae Measles IgG assay to measure anti-measles virus IgG antibody avidity with the help of the VIDAS\u00ae CMV IgG Avidity reagent, using 76 sera from subjects with measles and 238 other sera. Different groups of populations were analyzed. In the primary infection measles group, the mean IgG avidity index was 0.16 (range of 0.07 to 0.93) compared to 0.79 (range of 0.25 to 1) in the serum group positive for IgG antibodies and negative for IgM. These data allow to define a weak anti-measles virus IgG antibody avidity as an avidity index (AI) < 0.3 and a strong avidity as an AI > 0.6. The VIDAS\u00ae Measles IgG assay has a performance equivalent to that of other available products. Its use, individual and quick, is well adapted to testing for anti-measles immunity in exposed subjects.The objective of this study is primarily to compare the performance of the VIDAS Paramyxoviridae family. Although measles is primarily considered to be a childhood disease, it can affect people of all ages. The introduction of a live measles vaccine has been associated with a dramatic reduction in measles. However, despite the vaccination programs adopted by many developed countries and advancements towards the goal of measles elimination, outbreaks continue to occur in Europe and more recently in the USA [Measles is one of the most contagious infectious diseases, caused by the measles virus (MeV), a single-stranded RNA virus of the  the USA ,5,6,7,8.Lifelong immunity is generally reported after a wild-type measles infection, while in vaccinated people a waning immunity has been reported in correlation with lower levels or more rapid decrease of measles specific antibodies ,10,11. AThe risk of measles complications makes it important to rapidly detect the immunological status of the contact patients suffering from measles in order to identify those not immunized and exposed, and to vaccinate when necessary. In previously immunized and inadequately immunized individuals, laboratory confirmation of acute measles infection is a challenge. IgM response may be absent or short-lived, and RNA detection very limited. In this case, an IgG avidity test could help clinicians to distinguish between primary and secondary measles infection. The avidity test is a technique that enables weak avidity antibodies, produced at the early stages of a primary infection, to be differentiated from high avidity antibodies, which are characteristic of a reinfection.Sensitive and specific commercial kits are widely available for the detection and the quantification of measles antibodies, and enzyme immunosorbent assay (EIA) is the most widely used test format. Nevertheless, others kits where adapted to evaluate the avidity of IgG measles antibodies ,17. \u00ae Measles IgG assay is an individual, qualitative, and automated assay, allowing for the detection of anti-measles virus IgG using the enzyme-linked fluorescent assay (ELFA) method [\u00ae CMV avidity test  exists and is routinely used to determine the date of infection in case of suspicion of a cytomegalovirus (CMV) infection. The VIDAS) method . A comme\u00ae Measles IgG assay to those of two other serological assays, Enzygnost\u00ae Anti-measles Virus/IgG , and Measles IgG capture EIA\u00ae  and, second, to study whether the VIDAS\u00ae Measles IgG assay, used with the VIDAS\u00ae CMV IgG Avidity reagent (bioM\u00e9rieux) to determine the avidity of anti-measles virus IgG antibody, yields consistent results on serum with recent or past immunity profiles.The objective of this study was, first, to compare the performance of the VIDAS\u00ae Measles IgG test (bioM\u00e9rieux) is a qualitative, individual, and automated assay allowing a rapid analysis of serum samples to confirm the presence or absence of anti-measles IgG. This assay combines an immunoenzymatic sandwich technique with an enzyme-linked fluorescent assay (ELFA) on a specific instrument. A pipette tip-like disposable device coated with the antigen, constitutes the solid phase and serves as the pipettor. All of the other reagents are presented in a 10-well foil-sealed strip. The results are expressed in assay values: negative, equivocal, and positive for the assay values <0.50, \u22650.50 to <0.70, and \u22650.70 respectively. The VIDAS\u00ae Anti-measles Virus/IgG assay  is an indirect enzyme-linked immunosorbent assay (ELISA) assay on a microtitration plate coated with inactivated measles antigen, which is read on an ELISA processor. The calculation of the results takes into account the absorption of the cellular system used to produce the virus. Results are expressed in mean absorbance values (\u0394A), negative, equivocal, and positive for the assay values <0.100, \u22650.100 to \u22640.200, and >0.200, respectively. A quantitative result can be obtained for samples where the mean absorbance was superior to the limit value (0.100), calculated using the \u03b1 method and expressed in mIU/mL. The Enzygnost\u00ae assay (Microimmune), a serum is added to anti-human IgG coated microtitre wells. IgG in the specimens binds to the wells, and, recombinant measles nucleoprotein (rMVN) antigen is added after washing. Measles specific IgG in the sample, if present, binds to the rMVN. Then, a monoclonal antibody anti-rMVN conjugated to horseradish peroxidase (HP) is added. The presence of specific IgG is revealed by a color change after adding the HP substrate. The color change and intensity are monitored using a spectrophotometric plate reader. Negative, equivocal and positive results are expressed in optical density values (OD) established from threshold values defined for each series of assays (from 0.098 to 0.135).In the Microimmune Measles IgG capture EIA\u00ae CMV IgG Avidity assay was used with the solid phase reagents and strips from the VIDAS\u00ae Measles IgG kit. Each serum was treated using two VIDAS\u00ae Measles IgG tests. One test served as the reference. In the other, the wash buffer in well 4 of the strip was replaced with the buffer containing 6 M urea from the VIDAS\u00ae CMV IgG Avidity kit. The avidity index (AI) was determined by calculating the ratio between the relative fluorescent values (RFV) obtained with the reference strip and the RFV obtained with the strip containing urea. The avidity test is based on the functional binding or avidity of IgG antibodies increasing progressively over time after immunization, known as maturation of the humoral immune response. Presence of low avidity IgG antibodies may indicate a primary infection whereas high percentage of high avidity IgG antibodies may indicate a recurrent infection. To determine anti-measles IgG avidity, the urea reagent of the VIDASAll the techniques were performed following manufacturers\u2019 instructions except for the above-mentioned measles avidity assay.\u00ae Anti-measles Virus/IgG and Enzygnost\u00ae Anti-measles Virus/IgM assays. Group B included 125 sera from two types of patients with a suspicion of measles based on clinical symptoms: patients for which the serological tests performed in different laboratories using different tests did not confirm the measles infection, and patients having measles in their family circle and in which a serology was performed to establish if these people were immunized against measles or not. Group C included 120 sera, originating from blood donors, subjects without of any suspicion of measles infection or contact cases. The three serum groups were formed to have equivalent mean age.In order to constitute a representative panel, three different groups of sera  comprising a total of 321 human sera were selected for this study. The sera were collected from January 2011 to December 2012. Group A included 76 sera from subjects with laboratory confirmed measles. For these patients, the clinical symptoms suggested measles and were confirmed by the presence of specific IgM and IgG antibodies in EnzygnostAll serum samples were conserved at \u221220 \u00b0C. Analyses by the different assays were performed in parallel for each sample. \u00ae Anti-measles Virus/IgG assay were selected . These sera were tested using the protocol described above. To assess the intra-assay precision of this protocol, two serum samples\u2014with low and high MeV-IgG avidity\u2014were tested three times each with the VIDAS\u00ae instrument. For the avidity study, 314 sera with a positive result for IgG measles antibodies  for the Enzygnost\u00ae Measles IgG and Enzygnost\u00ae Anti-measles Virus/IgG assays. This standard contains 3000 mIU/mL of measles virus neutralizing antibodies and is prepared using the plaque reduction technique. Dilutions of this standard were made in a pool of sera negative for anti-measles IgG and tested three times with each reagent. For each reagent, the results were graphically analyzed by representing the average of the three assay values as a function of the international standard concentration. An international standard  code: 97/648) was used to define the threshold concentration of neutralizing antibodies corresponding to the positive result in the VIDASp < 0.05. IBM SPSS software, version 22, was used for the analysis. Ninety-five percent exact binomial confidence intervals (95% CI) were computed for sensitivity, specificity and agreement measures. Mean avidity indexes were compared between the three groups using an analysis of variance. Statistical significance was defined as A receiver operating characteristic (ROC) curve analysis was used and the area under the curve (AUC) was calculated to evaluate diagnosis ability of the avidity index to discriminate group A from group C, and group B from group C, finding the optimal cut-off values along with sensitivity and specificity.Group A included four children less than 10 years old and 72 adults: mean age 33.1 years (17 to 83 years). Group B included seven children less than 10 years old and 118 adults: mean age 32.5 years (17 to 78 years); Group C comprised 120 adults: mean age 35.5 years (18 to 61 years). The female to male ratio was 1.1, 2.4, and 1.0 in the three groups A, B, and C, respectively.\u00ae Measles IgG and Enzygnost\u00ae Anti-measles Virus/IgG assays reagents, 309 (96.3%) were found to be positive by the VIDAS\u00ae Measles IgG assay and 304 (94.7%) by the Enzygnost\u00ae Anti-measles Virus/IgG assay (\u00ae Measles IgG assay and the 10 (3.1%) sera equivocal by Enzygnost\u00ae Anti-measles Virus/IgG were considered as negative in the performance analysis. Whenever viral serology was performed, an equivocal result led to a confirmatory test on a second serum sampled a few days later after the first serum. The relative sensitivity and the agreement of the VIDAS\u00ae Measles IgG assay compared to the Enzygnost\u00ae Anti-measles Virus/IgG assay were 100%  and 97.2% , respectively. All 76 sera from Group A  were positive for anti-measles IgG using both the VIDAS\u00ae Measles IgG and Enzygnost\u00ae Anti-measles Virus/IgG assays.Out of the 321 sera analyzed by the VIDASgG assay . The fiv\u00ae Measles IgG and Microimmune Measles IgG capture EIA\u00ae assays. In total, 309 (96.3%) were found to be positive by the VIDAS\u00ae Measles IgG assay and 311 (96.9%) by the Microimmune Measles IgG capture EIA\u00ae assay (\u00ae Measles IgG assay and three (0.9%) sera were found to be equivocal by Microimmune Measles IgG, and these results were considered as negative in the performance analysis of the test. The relative sensitivity and the agreement of the VIDAS\u00ae Measles IgG assay compared to the Microimmune Measles IgG capture EIA\u00ae assay were 99.0%  and 98.4% , respectively. All 321 sera were also analyzed in parallel by the VIDASA\u00ae assay . Five se\u00ae Measles IgG (>0.7) and Enzygnost\u00ae Anti-measles Virus/IgG (>0.2) assays corresponds to the same international standard concentration, i.e., 100\u2013150 mIU/mL of antibodies neutralizing the Edmonston virus strain of measles . The IgM antibodies were negative by the Measles IgM capture EIA\u00ae Microimmune assay . Seventy-three sera had an AI \u2264 0.30; two sera had an avidity range from 0.30 to 0.60 and 1 serum had an AI > 0.60. Group B included 125 sera that were IgG positive and IgM negative. The mean AI for IgG was 0.79 (range of 0.25 to 1). Group C, from 113 blood donors, presented a mean AI of 0.67 (range of 0.24 to 0.98). One serum had an AI < 0.30. Mean avidity indexes were significantly different between the three groups  . Out of the three sera having an AI > 0.30, two had an equivocal AI, from 0.33 to 0.49, and one serum had strong avidity IgG, AI = 0.92. The specificity corresponds to the percentage of sera with strong avidity over the total samples in Groups B and C, where measles was not confirmed by biology, and it was 85.3% (203/238) . The serums from Groups B and C did not have IgM specifically detectable by the Enzygnostp < 0.001)  and a specificity of 99.1%, CI 95%  for the best threshold who maximize the sensitivity and the specificity, 0.24. The AUC for the avidity index was 0.986  (< 0.001) .When groups B and C were compared, the best threshold that maximized the sensibility and the sensitivity was 0.74. This value shows a sensibility of 75.2%, CI 95%  and a specificity of 74.3%, CI 95% . For this score the AUC was 0.787  .A successful immunization program must be able to quickly identify system weakness and target susceptible subjects. A wild-type measles infection or a 2-dose measles vaccination is correlated with lifelong immunity. Disease or vaccination histories are based on maternity reports, clinical records, or a vaccination notebook. Sometimes this information is not available or it is subject to error and bias. The rapid detection of the immunological status of contact patients with measles is important in some clinical situations such as pregnancies, immunosuppressed patients and patients with other underlying medical conditions, and families with children too young to be vaccinated.\u00ae Measles IgG assay, a qualitative, individual, and automated assay allowing for a rapid analysis of the serum samples compared to those of two other serological assays, Enzygnost\u00ae Anti-measles Virus/IgG (Siemens), and Measles IgG capture EIA\u00ae (Microimmune). Measles IgG capture EIA\u00ae (Microimmune) is a test developed for the detection of measles antibodies in saliva and it can also be used for serum samples. The relative sensitivity and the agreement of the VIDAS\u00ae Measles IgG assay were 100% and 97.2%, respectively when compared to the Enzygnost\u00ae Anti-measles Virus/IgG assay and 99% and 98.4%, respectively when compared to the Microimmune Measles IgG capture EIA\u00ae assay. The very small number (eight to 11) of negative sera for anti-measles virus IgG antibodies, does not allow to interpret the relative specificity percentages for the VIDAS\u00ae Measles IgG assay compared to the two other assays. Recently, Gonz\u00e1lez-Escalada compared the Enzygnost\u00ae EIA test to the VIDAS Measles IgG test. In this study the sensitivity reported for VIDAS\u00ae test was 98% and its specificity was 78.1% [This study evaluated the performance of the VIDASas 78.1% . Although the significant increase in specific IgG antibodies that accompanies measles infection can be confirmed using measles IgG assay, time-to-result is too long and, in practice, a confirmed diagnosis relies on detection of the viral RNA by reverse transcription PCR (RT-PCR) in the saliva or nasopharynx swabs, and/or on detection of both specific IgG and IgM in the serum or saliva of the patient .\u00ae Measles IgG assay is an individual assay, that is easy-to-use, rapid and which can be used, for example, on people in contact with a patient infected by measles so as to identify who is not immunized and exposed, and to vaccinate when necessary. Protection against measles generally means that the subject will not have the disease again; it does not guarantee that a subject cannot be infected again. It has been shown that measles virus reinfections or measles disease were observed in subjects whose immune system had been strained by the wild virus or the vaccine [The VIDAS vaccine ,22,23. T vaccine .In comparison to protection against measles disease, protection against reinfection by the measles virus requires a higher level of neutralizing antibodies. The study by Chen et al. shows that none of the seven children with a neutralizing antibody level higher than 1.025 mIU/mL contracted an asymptomatic infection [\u00ae Measles IgG assay, completed with VIDAS\u00ae CMV IgG Avidity assay reagents. The measurement of anti-measles virus IgG antibody avidity was developed in order to differentiate primary infections from re-infections [Measuring the antibodies to determine who has seroconverted one month after immunization could be logistically difficult and expensive. Alternatively, avidity testing allows the measurement of the functional affinity of anti-viral IgG concomitant with measles laboratory diagnosis in individuals whose immunization has failed. In the second part of our study, we assessed the possibility of measuring anti-measles virus IgG avidity with a VIDASfections , and alsfections ,27. A wefections . Moreovefections . \u00ae assay and had an AI > 0.77. These sera came from young adults with a mean age of 32.5 years. These were cases of contracted measles in which the diagnosis was not initially confirmed by serology, and could be attributed to a false negative. The avidity assay is also important for characterizing measles in populations vaccinated by the MMR vaccine. In this case, measles disease corresponds either to a failure of primary vaccination (weak IgG avidity), or to that of the booster (strong IgG avidity) . In Grou\u00ae Measles IgG assay, in the present study we have defined thresholds by defining weak, i.e., <0.3, and strong anti-measles virus IgG antibody avidity, i.e., >0.6. These thresholds correspond to those published in the literature with other tests, which vary between <0.3 [With the aim of measuring IgG avidity on a modified VIDASeen <0.3 ,17,27 aneen <0.3  for weakeen <0.3  and 0.7 een <0.3 ,17 for s\u00ae Measles IgG assay was tested in populations with different immunological status, patients with laboratory confirmed measles, patients with measles symptoms which were not confirmed by serology and blood donors with IgG antibodies. In all these situations the performance of VIDAS\u00ae Measles IgG assay showed over 97% agreement with two other commercial immunoassays. These characteristics, together with the individual/single-dose format and rapidity of the test, make the VIDAS\u00ae Measles IgG assay suitable for testing exposed subjects for measles immunity. This study also shows that a modified protocol of the VIDAS\u00ae Measles IgG assay combined with VIDAS\u00ae CMV avidity test reagents allows for the determination of IgG measles antibody avidity. The results of detection of IgG antibody avidity are particularly useful for the serological diagnosis of measles infection when performed late, in a context of secondary infection, in pregnancy, and in patients with underlying pathologies. The performance of the VIDAS"}
+{"text": "Although the measles vaccine has been part of routine national childhood vaccination programs throughout Europe, measles remains a public health concern. High numbers of cases and outbreaks have occurred throughout the European continent since 2011, and an increasing number of cases have been reported in Turkey since 2012. During a recent measles outbreak in Turkey, 2 pregnant women contracted measles prior to delivering preterm infants at Hacettepe University Hospital. Measles virus genomic RNA and IgM antibodies against measles were detected in the cord blood of infants and mothers in both cases. The infants were treated with intravenous immunoglobulin (IVIG) and vitamin A. Transient thrombocytopenia was present in 1 infant and treated with an additional dose of IVIG and vitamin A. The infants were discharged, without complications, within 10 days of birth. The successful treatment of these cases suggests that infants who have been exposed to, or infected with, measles may benefit from cotreatment of vitamin A and IVIG. Prior to the introduction of measles vaccination programs, a majority of individuals contracted the measles virus early in childhood and developed lifelong immunity; thus, measles infection during pregnancy was an unusual event. The distribution of infected individuals has shifted to older age groups in the vaccine era, with proportionately more adolescent and young adults affected owing to a lack of complete vaccination coverage as well as primary and secondary vaccine failure. The potential risk for measles infection in women of childbearing age has therefore increased . MaternaAt the end of 2011, measles resurged throughout Turkey and further increased during 2012 through May 2013. At the time of this publication, 4,172 cases have been reported, constituting an epidemic. In this case report, we describe 2 preterm infants who contracted measles during this epidemic and their successful treatment with combined IVIG and vitamin A.Two mothers who had contracted measles during an outbreak gave birth to preterm infants at Hacettepe University Hospital in Ankara, Turkey, in February 2013. We describe both cases and their course of treatment below and in 1/7 weeks, because of fetal distress, from a 38-year-old mother with measles pneumonitis. She was born on the sixth day after her mother's exanthema necessitated noninvasive ventilation because of severe pneumonia  was delivered by caesarean section at 34neumonia . The mot\u03bcL and had dropped to 44,000/\u03bcL after 4 days (3/kg thrombocyte transfusion. The newborn was discharged in a good condition on the tenth day.Cord blood and serum samples were collected from the infant and mother soon after delivery. An enzyme-linked immunosorbent assay (ELISA) indicated the presence of measles-specific IgM and IgG antibodies in the mother. The infant's serum was positive by ELISA for the presence of measles specific IgM but negative for the presence of IgG antibodies. However, RNA extracted from cord blood mononuclear cells for use in a measles virus-specific reverse transcriptase-PCR assay indicated the presence of measles virus . On her r 4 days . ThromboA preterm female infant (weight 2630\u2009g) was delivered by vaginal route from a 27-year-old mother with measles pneumonitis at 36 weeks, on the fourth day after her mother's exanthema had disappeared. The mother's medical history indicated that she had received only 1 dose of the measles vaccine, and the serum obtained 1 month previously was negative by ELISA for antimeasles IgG and IgM. The infant showed no clinical signs of the disease at birth.Cord blood and serum samples were collected from the infant and mother soon after the delivery and serum specimens were tested for the presence of measles-specific IgM, IgG, and RNA as described above. The infant's serum was positive by ELISA for both measles-specific IgM and IgG antibodies. Measles-virus-specific RNA extracted from cord blood mononuclear cells was positive as well . The infThe widespread availability of the 2 dose measles vaccine program has led to a marked decrease in the incidence of measles and resulted in less natural boosting of antibody levels. However, depending on the schedule of immunization, immunity declines in late childhood and adolescence leading to gaps in the immunity of adults. Further, measles outbreaks may occur in susceptible individuals despite widespread childhood vaccination . Indeed,Primary protection against infectious diseases at birth is provided mainly by maternal antibodies and several factors determine the amount of maternal antibodies in young infants. The coverage of universal immunization programs influences the amount of maternal antibodies and a higher level of coverage reduces the probability of natural antibody boosting. Infants of vaccinated women were born with significantly fewer antibodies compared to infants of naturally immune women. Because increased childbearing age is directly related to the prolongation of the time between childhood vaccination and childbirth, maternal antibodies are prone to be low. The rate of decay of maternal antibodies after birth determines the duration of protection in infants , 9\u201311. YThe effect of measles during pregnancy on the fetus has been the focus of several studies. Limited data is available regarding the spectrum of neonatal illness, but it can range from mild to rapidly fatal forms. Early studies have documented adverse fetal outcomes including increased mortality during the first two years of life, and it appears that the mortality rate of congenital measles is higher in preterm than in full-term infants , 8. InteThe low morbidity of recent cases of congenital measles may reflect the effects of prophylactic immunoglobulin . These tIn conclusion, the two cases of congenital measles reported here highlight the need to improve immunization strategies for adolescents and young adults, which could decrease the incidence of maternal measles. Additionally, the survival of these preterm infants suggests that cotreatment with vitamin A and IVIG is a successful strategy for vulnerable individuals who have low levels of protective measles antibodies."}
+{"text": "According to WHO estimates, 35% of global measles deaths in 2011 occurred in India. In 2013, India committed to a goal of measles elimination by 2020. Laboratory supported case based measles surveillance is an essential component of measles elimination strategies. Results from a case-based measles surveillance system in Pune district (November 2009 through December 2011) are reported here with wider implications for measles elimination efforts in India.Standard protocols were followed for case identification, investigation and classification. Suspected measles cases were confirmed through serology (IgM) or epidemiological linkage or clinical presentation. Data regarding age, sex, vaccination status were collected and annualized incidence rates for measles and rubella cases calculated.Of the 1011 suspected measles cases reported to the surveillance system, 76% were confirmed measles, 6% were confirmed rubella, and 17% were non-measles, non-rubella cases. Of the confirmed measles cases, 95% were less than 15 years of age. Annual measles incidence rate was more than 250 per million persons and nearly half were associated with outbreaks. Thirty-nine per cent of the confirmed measles cases were vaccinated with one dose of measles vaccine (MCV1).Surveillance demonstrated high measles incidence and frequent outbreaks in Pune where MCV1 coverage in infants was above 90%. Results indicate that even high coverage with a single dose of measles vaccine was insufficient to provide population protection and prevent measles outbreaks. An effective measles and rubella surveillance system provides essential information to plan, implement and evaluate measles immunization strategies and monitor progress towards measles elimination. Recent estimates indicate that global measles mortality has declined by 71% between 2000 and 2011 Given India's large burden of estimated measles cases and deaths, successful measles control efforts in the country are paramount to attaining regional and global measles elimination goals. India's existing strategy for measles control has the objective of mortality reduction and not elimination and as such it depends on measles outbreak surveillance rather than case based surveillance http://ctri.nic.in/Clinicaltrials/login.php]. Study subjects were recruited from 94 villages spread over three contiguous Talukas or Blocks (1st sub-district level administrative division in India) \u2014 Haveli, Khed and Shirur of Pune. To systematically investigate and quantify the intensity of measles virus transmission in these three blocks of Pune included in the trial, it was deemed necessary to set up a case based surveillance system that would meet international performance standards and would run concurrently but independently of the trial. The National Polio Surveillance Project of WHO-India Country Office (WHO-NPSP) provided technical assistance to Government of Maharashtra to establish a case-based measles surveillance system in the MAVP Blocks . Concurrence from Government of India and Maharashtra state government was obtained to design and establish such a surveillance system. Apart from the immediate needs of the aerosol vaccine project in 2009, we believed that setting up this case based measles surveillance system in Pune would also serve as a model for scaling up later, as India takes on more aggressive measles control goals in future.In December 2009, the Measles Aerosol Vaccine Project (MAVP) of World Health Organization began a phase-II/III trial for measles vaccine administered as an aerosol in Pune district located in Maharashtra state [Clinical Trials Registry, India no.: CTRI/2009/091/000673 available at India had introduced one dose of measles vaccine between 9 and 12 months of age in its infant immunization programme in 1985. The latest evaluated coverage estimate for first dose of measles containing vaccine (MCV1) among infants in India was 74% From 2010, India introduced a second dose of measles-containing vaccine (MCV2) through catch-up campaigns targeting children 9 months to 10 years of age in 14 states (which had MCV1 coverage below 80%) and through routine immunization programme for 16\u201324 month old children in 21 remaining states (with MCV1 coverage at or above 80%) including Maharashtra This paper describes the epidemiology of measles in three MAVP blocks of Pune for the period November 2009 through December 2011. Surveillance system performance is assessed against WHO internationally accepted indicators. Incidence rates and burden of measles and policy implications for measles control and elimination strategies for India are discussed. Design issues that were critical for the success of this case based surveillance system have been elaborated. We also discuss below why this model of case based measles surveillance can be taken as an example of legacy planning envisaged in the polio endgame strategic plan Measles case-based surveillance was built on the platform of pre-existing network of reporting sites for Acute Flaccid Paralysis (AFP) surveillance for polio in Pune. In 2010, Pune district had 451 AFP reporting sites in the polio surveillance network. The vast majority of these reporting sites (85%) were private health care facilities. All the AFP reporting sites and some additional clinical care-givers were included in the network for measles surveillance and were required to submit AFP plus suspected measles case reports following a standard reporting protocol. Government and WHO staff conducted periodic surveillance workshops to sensitize and train clinical and other categories of personnel at the network reporting sites.A suspected measles case was defined as any person in whom a clinician suspected measles infection or any person with fever and maculo-papular rash with cough or coryza (running nose) or conjunctivitis (red eyes).Based on laboratory and/or epidemiological criteria as described below, a suspected measles case was classified into one of the following categoriesLaboratory confirmed measles or rubella case if the person's serum sample tested positive for either measles or rubella IgM antibody;Epidemiologically confirmed measles or rubella case if the person's serum could not be tested in a laboratory for measles or rubella IgM  but the case was related geographically and temporally (dates of rash onset within 21 days of each other) to another confirmed measles or rubella case ;Clinically confirmed measles case if the person's serum was could not be tested in a laboratory  and the case was also not epidemiologically linked to any other confirmed measles or rubella case;Discarded case if the serum sample tested negative for both measles and rubella IgM or if no serum sample was tested but the case was epidemiologically linked to an outbreak that was negative for both measles and rubella.For outbreak classification, please see below.In this report, laboratory, epidemiologically or clinically confirmed cases of measles have been collectively referred to as \u2018confirmed measles cases\u2019 and laboratory or epidemiologically confirmed rubella cases of rubella as \u2018confirmed rubella cases\u2019.A measles death was defined as a death which occurred within 30 days of onset of rash in a confirmed measles case For every suspected case of measles of any age resident in an MAVP block, a case investigation form (CIF) was completed and a blood sample was collected for serologic confirmation (either at the reporting site or at the home of the case).All suspected cases were offered appropriate clinical care including therapeutic doses of vitamin A as per Govt. of India guidelines Each suspected measles case reported from a reporting site and resident in an MAVP block served to trigger a community search for additional suspected measles cases by public health staff. Additional cases detected were also investigated as described above or as described below if an outbreak was identified.All suspected measles cases from MAVP blocks were followed up to ascertain their vital status  up to 30 days after onset of rash. Health workers visited home of case (or clinic if admitted) between 30 and 40 days after rash onset or earlier if death was reported before 30 days.An outbreak was defined as a cluster of two or more suspected measles cases in a village in a week or if there was a continuous occurrence of cases every week over a 3\u20134 week period. Identification of a suspected outbreak prompted active searches in the community to identify additional cases by visiting all houses, supplementary nutrition centres for children, and schools in the village to detect more suspected measles cases of any age. Regular visits by District Health staff and WHO staff continued until there was a continuous period of three weeks during which no further cases were reported or the lab results showed that the outbreak was not due to measles Blood samples were collected through venepuncture from every suspected measles case that was reported as a sporadic case in any of the MAVP blocks. The system aimed at collecting one serum sample from every sporadic case within 28 days from onset of rash.In the event of a suspected measles outbreak, blood samples were collected from the initial cases of an outbreak until at least 5 samples had been collected or at least 2 samples from that outbreak tested positive for either measles or rubella. The National Institute of Virology (NIV), Pune tested blood samples for measles immunoglobulin-M (IgM) through EIA with Enzygnost Anti-Measles-Virus/IgM as per WHO protocol. Samples testing negative for measles were tested for rubella IgM Epidemiological data from surveillance and lab results from NIV laboratory in Pune were linked through a unique identifier assigned by the District Immunization Officer (DIO), Pune and WHO Pune unit of the WHO National Polio Surveillance Project (WHO-NPSP). WHO-NPSP central unit circulated summary tables and charts to relevant stakeholders monthly.If an outbreak or a suspected measles case was reported from any of the villages from where subjects were recruited for the measles aerosol vaccine trial, DIO, Pune and/or WHO Pune unit immediately informed the local coordinator of the MAVP trial area.Incidence rates for suspected measles, confirmed measles, confirmed rubella and discarded cases were calculated per 100 000 person-years. Case fatality ratio (CFR %) for confirmed measles cases was calculated as the ratio of measles deaths to the number of confirmed measles cases, expressed as a percentage.Performance indicators for measles surveillance were calculated as recommended by WHO The Kruskal-Wallis H test  was applied to compare the difference between medians and the Cornfield 95% confidence limits for odds ratio. Epi Info for Windows version 3.5.3 released January 26, 2011 was used for analysis.The case based measles surveillance system in Pune was set up as part of public health disease surveillance of Govt. of Maharashtra and as such explicit review by an ethics committee was deemed unnecessary. Public health surveillance being a state issue, permission was sought and obtained from Additional Director of Health Services Govt. of Maharashtra before initiating surveillance. Govt. of India guidelines for measles surveillance were followed or adapted for all surveillance activities including blood sample collection and clinical care of suspected measles cases The descriptive epidemiology of the measles cases identified from surveillance week 45 of 2009 (starting 1 November 2009) until week 52 of 2011 (ending 1 January 2012) is presented below . In addiIn total, 1011 suspected measles cases were reported through the surveillance system. Of these, 169 (17%) were laboratory negative for both measles and rubella and discarded and 772 (76%) were classified as confirmed measles cases. Of confirmed measles cases, 509 were serum IgM positive, 228 were epidemiologically-linked in time and space to a lab confirmed or an epidemiologically confirmed measles case and 35 were confirmed by meeting the clinical case definition only. An additional 58 cases (6%) were confirmed rubella. Twelve cases (1%) were epidemiologically linked to an outbreak of both measles and rubella.Frequent measles outbreaks characterised measles transmission in Pune. The surveillance system detected 21 suspected measles outbreaks of which 20 were subsequently laboratory confirmed as measles outbreaks . One outDuring the 113-week period under observation, confirmed measles cases occurred in 81% (91/113) of the weeks. Forty-five per cent of (349/772) of confirmed measles and 52% (30/58) of confirmed rubella cases were female. The median age, inter-quartile range and the minimum and maximum age in months for confirmed measles cases , for confirmed rubella cases  and for discarded cases  are shown in Overall 43% (437/1011) of the suspected measles cases reported vaccination with at least one dose of measles containing vaccine (MCV). Of the 437 cases who had a history of vaccination with MCV, only 98 (22%) had supporting documents  in addition to historical recall, while the rest had no such supporting documents.Of the 772 confirmed measles cases, 298 (39%) reported vaccination with at least one dose of MCV; of the 227 non-measles cases (confirmed rubella and discarded), 135 (59%) were vaccinated . Only 34The odds ratio for vaccination with an MCV between a confirmed measles case and a non-measles case was 0.43 (Cornfield 95% confidence limits for odds ratio: 0.31 to 0.59).Of the 1011 suspected measles cases, 986 (98%) were followed up 30 days from onset of rash to ascertain vital status. Two of the 1101 cases died within 30 days of rash onset. Both were confirmed measles cases. The observed CFR in confirmed measles cases was 0.26% (2/772) and the 95% confidence interval for CFR was 0.00%\u20130.62%.The measles surveillance system in Pune met globally recommended performance indicators for case based measles surveillance Every week more than 80% of 451 reporting units submitted complete and timely reports . Except To our knowledge this is the first report from an active case based laboratory supported measles surveillance system in India. Earlier reports in India were mostly from special studies, outbreak investigations or from passive reporting The World Health Assembly (WHA) in 2010 declared interim milestones towards measles elimination to be achieved by 2015 Reported measles incidence rate for India in 2011 was 24 per million persons Simons et al. note the lack of reliable case based measles surveillance data as a constraint in deriving realistic modelled estimates of incident measles cases and deaths in India. Their model estimated 65 500 (95% CI: 53 600\u201378 800) measles deaths in India in 2010 Owing to paucity of reliable laboratory confirmed surveillance data, estimates of measles cases and deaths for India are thus affected by large levels of uncertainty. By providing additional population based estimates of confirmed measles incidence, our data will possibly contribute to more robust and accurate estimates of measles diseases burden in India.In September 2013 India became a party to the WHO South East Asia Regional declaration for measles elimination by 2020 As of 2013, 11 states of India maintain laboratory supported measles outbreak surveillance system with technical assistance from WHO-NPSP. However, there is no national system for laboratory supported case based measles surveillance. As India has just completed the first round of measles catch-up campaigns in 2013, targeting 134 million children in 14 of its 35 states, transitioning to laboratory supported case based measles surveillance system will be necessary to substantiate the impact of the intervention in these states At the time of this report, Pune district had not introduced a second dose of MCV in its immunization program. Despite high coverage (>90%) achieved with a single dose of measles vaccine through routine immunization, endemic measles transmission with periodic measles outbreaks continued to occur with nearly half of confirmed measles cases associated with outbreaks. These findings demonstrate that high level of vaccination coverage with one dose of measles vaccine is insufficient to reach threshold levels of herd protection required to interrupt measles transmission. This locally derived empirical evidence provides additional support to current Government of India policy and WHO guidance for the need to sustain high coverage with two doses of MCV for sustained measles control We also explored whether lowered effectiveness of one dose of measles vaccine under field conditions could be the cause of continued measles transmission and outbreaks in Pune. In our data, 39% of the confirmed measles cases in the 1\u20134 year age group were vaccinated. Applying the Orenstein curves and equations to our observed data of 39% of cases vaccinated (PCV) and 94% of population vaccinated (PPV) with MCV1, estimated measles vaccine effectiveness is 96% In Pune district, 78% of measles disease burden is borne by children under 10 years and 95% of cases occur by 15 years of age. Data from measles outbreak surveillance in other states of India with MCV1 coverage equal or greater than 85% show a similar pattern. In Tamil Nadu and Kerala, 80% and 71% of cases respectively, occurred in children below 10 years of age in 2010 This has important policy implications. Between 2010 and 2013, India has implemented large scale measles catch-up campaigns to vaccinate children between 9 months and 10 years of age in 14 (out of 35) states with MCV1 coverage less than 80% Several limitations to our data should be noted. The reporting network was geographically restricted to the district of Pune. Measles cases (from the three MAVP blocks) that sought clinical care at sites outside Pune district might well have been missed. In India, as in other countries, the number of measles cases and associated deaths may be underreported as measles cases may not seek treatment at medical care facilities or cases are not reported through the surveillance systems Case-based measles surveillance achieved most of the globally recommended cardinal indicators of measles surveillance performance  includinIn summary, the Pune case based measles surveillance system was built on the pre-existing sensitive and robust system of AFP surveillance for polio. Close coordination between Govt. staff and Surveillance Officers of WHO-NPSP, periodic sensitization workshops conducted for clinicians and public health staff, and active search for suspected measles cases in health facilities and in the community during outbreaks were critical elements in the success of the surveillance system. Operationally, this was similar to the surveillance system in place since the early 1990's in the Region of the Americas for measles surveillance in an elimination setting This surveillance system was a tangible example of how polio resources can be leveraged to support other vaccine preventable disease control activities. WHO-NPSP has a country-wide network of Surveillance Medical Officers supporting Government of India and state governments in polio and measles outbreak surveillance. The experience of establishing and supporting this surveillance system in Pune with the direct involvement and collaboration between Government staff and the WHO-NPSP polio surveillance network can be replicated relatively easily in other states of India to establish measles case based surveillance to monitor progress towards measles elimination and inform immunization policy.Globally, opportunities should also be explored to transition the existing polio eradication infrastructure and trained human resources to support broader immunization strengthening activities including integrated surveillance systems for measles and other vaccine preventable diseases. This is a concrete example demonstrating the feasibility of legacy planning objective of the 2013\u20132018 Polio Endgame Strategic Plan"}
+{"text": "Morbillivirus of the family Paramyxoviridae. Vaccination has played a critical role in controlling measles infection worldwide. However, in the recent years, outbreaks of measles infection still occur in many developing countries. Here, we report an outbreak of measles among healthcare workers and among the 60 measles infected patients 50 were healthcare workers including doctors, nurses, staff, and medics. Fifty-one patients (85%) tested positive for IgM antibodies against the measles virus and 50 patients (83.3%) tested positive for measles virus RNA. Surprisingly, 73.3% of the infected individuals had been previously immunized against measles. Since there is no infection division in our hospital, the fever clinics are located in the Emergency Division. In addition, the fever and rash were not recognized as measles symptoms at the beginning of the outbreak. These factors result in delay in isolation and early confirmation of the suspected patients and eventually a measles outbreak in the hospital. Our report highlights the importance of following a two-dose measles vaccine program in people including the healthcare workers. In addition, vigilant attention should be paid to medical staff with clinical fever and rash symptoms to avoid a possible nosocomial transmission of measles infection. Measles is caused by measles virus belonging to genus Measles is a highly infectious respiratory disease that occurs worldwide, which mainly causes morbidity and mortality among children. Its causative agent, the measles virus, is a single stranded negative sense RNA virus belonging to the Paramyxoviridae family . The cliOn March 16, 2015, a patient admitted to the Emergency Department with high fever was diagnosed as having a measles infection. On the day of March 20, 2016, three nurses from Emergency Department who had direct and (or) indirect contact with the patient displayed similar clinical signs including fever and rash that were determined to be positive for measles infection. The hospital noticed that it might be a break of measles infection with possibility of nosocomial transmission, and the first case on March 16, 2015, was suspected to be the source of this outbreak. Immediately, a series of measures for the prevention and control of nosocomial measles according to Guidelines of the People's Republic of China on the Prevention and Control of Infectious Diseases have been set up as follows.Measures for the Prevention and Control of Nosocomial Measles. Consider the following:Setting up isolation wards in a well-ventilated old building.Enhancing ventilation, isolation, and disinfection measures in isolation areas.Isolating those patients with great transmission potentials including severe-ill patients and students.Providing measles immunization to a total of 2,400 hospital staff.Close monitoring of the measles infected patients, paying much more attention to patients with severe complications, and canceling multidisciplinary team meetings and treatment.First, the isolation ward was set up with a well-ventilated system to prevent possible transmission among community people and the first patient (case number 1) was hospitalized two weeks before discharge. Second, Emergency Department is the unit with serious and multiple illness in which the healthcare staff from other departments who went to consultation directly or indirectly were exposed to the Emergency Department patients with measles; they were infected with measles and/or spread it to other staff in their departments. Therefore, more medical staffs from other departments with similar symptoms and close contact with the known measles cases were searched. Third, reimmunization probably played important roles in containing measles transmission and a total of 2400 hospital staff were given a measles immunization before March 27, 2015. Since then, new measles case numbers began to decrease and the last two cases were reported on April 4, 2016  and for measles virus RNA using a real-time reverse transcription PCR kit . Finally, 60 suspected measles cases were confirmed as the diagnosis of measles infection among whom there were 51 (85.00%) cases positive for measles IgM, 50 (83.33%) for measles virus RNA, and 41 (68.33%) for both measles IgM and virus RNA. Among the 60 positive cases, 39 (65.00%) and 21 (35.00%) were in female and male patients, respectively. Seven cases (11.66%) were aged 1\u201318 years, 50 cases (83.33%) were aged 21\u201340 years, and 3 cases (5.01%) were aged >40 years . There wThe results of a recent study of measles infections in China indicated that measles usually occurred in young unvaccinated children ; howeverIn summary, our study reports a measles outbreak that occurred among adult healthcare workers who were previously underimmunized against measles. It highlights that healthcare workers need to be fully vaccinated through a 2-dose measles vaccine program, which could greatly prevent nosocomial outbreak of measles. Equally important, fever clinics should be separated from other divisions in the hospital. Vigilant attention should be paid to the patients with the clinical fever and rash symptoms and early isolation and definite diagnosis of the measles suspected medical staff patients to avoid a possible nosocomial transmission of measles infection."}
+{"text": "In Ethiopia, measles case-based surveillance was introduced in 2004 as one strategy for measles control by laboratory confirmation of suspected cases. In this article, epidemiological distribution of laboratory-confirmed measles cases were reported from the Southern Nation Nationalities and Peoples Region (SNNPR) of Ethiopia between 2007 and 2014, as the region is one of the highly measles affected areas in Ethiopia.A serum sample was collected from all measles suspected cases, and patient information was captured by case reporting format (CRF). Samples were transported to the National Measles Laboratory for Measles IgM testing by ELISA technique. Data entry and analysis were done using Epi-Info 3.5.4 software.A total of 4810 samples were tested for measles IgM using ELISA technique and 1507 (31.3%) were found positive during 2007\u20132014 in SNNPR of Ethiopia. Patients with age 1\u20134 years were the most affected regardless of sex. The incidence of measles confirmed cases increased from 15 in 2007 to 180 in 2013 per million population. The highest percentage of laboratory-confirmed cases were found in 2014. Measles was found distributed throughout the regional state.Measles was found a public health important disease in SNNPR of Ethiopia, mostly affecting children 1\u20134 years. The incidence of measles cases is increasing from time to time. Additional research to determine the genotype of circulating measles virus, knowledge, attitude and practice of professionals and the population for measles vaccination and infection in the region is important. A wide age group measles vaccination campaign is highly recommended. The primary transmission is person-to-person via aerosolized droplets or by direct contact with nasal and throat secretions of infected persons. When measles virus infect a non-immune population, nearly 100% of individuals will become infected and develop clinical illness. The incubation period of measles is about 10 to 12\u00a0days. Malnourished children are at higher risk of developing complications and mortality from this infection [Measles is an acute, highly infectious viral disease caused by Measles remained as one of the vaccine-preventable diseases still causing major mortality and morbidity in developing countries. The severity of disease is higher among infants and adults than children and results complications from viral replication or bacterial superinfection including otitis media, pneumonia, laryngo-tracheo-bronchitis (croup), diarrhoea, encephalitis and blindness .Global measles control has been very successful. Worldwide, an estimated 60% measles-associated mortality reduction with 75% reduction in the African region were achieved following implementation of the 2001 World Health Organization (WHO) member states goal of 50% measles mortality reduction by 2005, compared with the 1999 estimate \u20135. FolloThe African region technical advisory group (TAG) reviewed the measles control progress and set a new measles reduction target called a pre-elimination goal, aimed to reduce the annual incidence to <5 measles cases per million population in all African countries , 6. NatiIn 1980, Ethiopia introduced measles vaccination as part of the routine extended program of immunization (EPI) with first dose administration at 9\u00a0months of age. The measles vaccine coverage remained below 50% until 2003. Following augmented efforts to improve performance by the Federal Ministry of Health (FMOH) and EPI support partners, administrative measles vaccination coverage improved from 44% in 2003 to 81% in 2010 at the national level .th month of age. Of these, more than 60% children were from India (6.4 million), Nigeria (2.7 million), Pakistan (1.7 million), Ethiopia (1.1 million), Indonesia (0.7 million) and Democratic Republic of Congo (0.7 million). More than 70% of the global measles-related deaths occurred in these 6 countries in 2013 showing developing countries affected utmost [In 2014, there were 114,900 measles deaths globally . In 2013Although the vaccination coverage is increasing from year to year in Ethiopia, the country continued reporting a higher number of measles cases and outbreaks in all regional states and city administrations. According to WHO, Ethiopia is experiencing an ongoing measles outbreak by reporting more than 14,000 confirmed cases in 2014 only  and beinThe study was carried out in SNNPR. SNNPR is the third most populous region in Ethiopia, with a population of 15 million, a growth rate of 2.9 per annum and a child mortality rate of 85 per 1000 livebirths in 2007 and the region covers an estimated area of 105,887.18 square kilometers, . The SNNThe WHO African Regional Office/AfRO measles case-based surveillance guidelines were adjusted for use in Ethiopia as well in SNNPR as of 2004. All age groups were included in this study using the case definition. A suspected measles case is defined as any person with generalized maculopapular rash and fever plus one of the following: cough or coryza (runny nose) or conjunctivitis (red eyes) or any person a clinician suspects to have measles. Laboratory confirmed measles case is a case that has recent measles virus-specific immunoglobulin M (IgM) antibody in blood by serological test and did not receive a measles vaccine within the last 30\u00a0days. Confirmed measles by epidemiological linkage is a measles case from which a specimen had not taken for serologic confirmation but linked  to lab-confirmed cases. Clinically confirmed/compatible cases are individuals without blood and no epi-linkage with lab-confirmed cases or have equivocal measles IgM test results in blood, this will be high in seasons of no lab testing. Discarded cases are individuals with negative measles IgM lab result or IgM positive with a vaccination history within 2\u00a0weeks of blood drawn. Measles outbreaks are defined as the occurrence of 3 or more lab-confirmed measles cases reported from the same district or catchment area of a health facility with rash onset within 4\u00a0weeks. Incidence is the total number of confirmed measles cases by lab confirmation and epidemiological linkage per million population .At first contact with suspected cases, about 5\u00a0ml blood was drawn by venipuncture into a sterile anticoagulant-free tube. Almost all (99.6%) samples in this study were collected within 28\u00a0days of rash onset from suspected cases. Serum was separated from whole blood and transferred aseptically to a sterile vial. The serum specimens with completed case reporting form (CRF) were transported in cold boxes to the testing laboratory, National Measles Laboratory is located in Ethiopian Public Health Institute (EPHI), Addis Ababa, Ethiopia.Enzyme-linked immunosorbent assay (ELISA) technique was done for measles-specific IgM antibody identification according to the manufacturer\u2019s protocol . Samples and reagents were manually dispensed using a micropipette . A 5 micro liter (\u03bcl) serum was diluted with 205\u00a0\u03bcl working solution (diluted blue solution and reconstituted rheumatoid factor). 150\u00a0\u03bcl of this diluted solution was transferred to a double (antigen coated and control) well of ELISA plate and incubated for an hour to allow patient\u2019s antibody (if any) bind antigen coated surface. Test plates were washed using a microplate washer  to remove unbound antibody. 100\u00a0\u03bcl of enzyme-labeled antihuman IgM working solution was added to each well and incubated for an hour to allow the attachment of enzyme-labeled antibody with patient\u2019s antibody, then washed to remove unbound antihuman IgM. 100\u00a0\u03bcl chromogen substrate solution was added to each well and allowed 30\u00a0min for enzyme labeled antibody (if any) to break the substrate and produce a color change. The optical densities (OD) were read at 450\u00a0nm with a 630-nm reference filter using an ELISA reader . The change in Od was found by subtracting the OD of the control well from OD of antigen well. Samples with a change in OD <0.1 were recoded negative and >0.2 were positive and equivocal when OD between 0.1 and 0.2. Samples with equivocal results were retested to be reported. Based on the surveillance protocol, samples with equivocal or negative measles IgM result were further tested for rubella virus IgM.The laboratory was evaluated regularly for quality control, sends 10% quality control (QC) samples quarterly, receives external quality assurance (EQA) proficiency test (PT) samples annually and accredited yearly by WHO Global Measles and Rubella Laboratory Network for the purpose of generating credible lab results for the program. Job aids and standard operational procedure (SOP) were available in lab.During this study period, the lab maintain its accreditation, scored\u2009\u2265\u200995% accuracy for both QC and PT samples and applied internal and external control samples with each run. Patient results were reported when the run was valid based on the controls used. Due to kit shortage, samples collected after mid October 2014 were not tested for measles IgM antibody.Patient information and laboratory results were entered into Epi-Info database. In the surveillance, data were shared every Fri-day to the FMOH, WHO-Ethiopia, WHO-AfRO and all concerned for action . Data for this study purpose, 2007\u20132014, were extracted and analyzed using Epi-Info .A total of 4810 suspected patients were notified with blood and tested in the lab during 2007\u20132014 from SNNPR State of Ethiopia. The mean age of study participants was 6.3\u00a0years ranging from a month to 84\u00a0years with 51.6% males. Evidence on sex was unavailable for 20 cases. The highest proportion of tested persons (36%) were children 1\u20134 years age followed by children 5\u20139 years (29.3%). The highest number of samples (976) were collected in 2013 and the lowest (466) in 2007  samples were found positive for measles-specific IgM and the rest 3196 (66.4%) and 107 2.2%) were negatives and equivocal (compatibles) respectively  were found positive for rubella virus-specific IgM antibody, another rash febrile illness. Most of the rubella positive cases were found in the period 2012\u20132014 with no zero reports in all the study years (13 \u2013 227 reports)  were found from patients above 15\u00a0years and infants respectively throughout the study period Fig.\u00a0.Measles was found endemic throughout the year and all zones of the region with the highest number (246) of positives in January and the lowest (39) in June during the study period Fig.\u00a0.Fig. 5DiSimilar to the laboratory confirmed cases, the epidemiologically linked measles cases increased linearly through the study period, from 36 cases in 2007 to 2928 in 2013 and the highest number of clinically confirmed cases were in 2014  cases was found increasing strictly in the study years, 15 in 2007 to 180 in 2013 , with the peak in January and February. This is in line with an earlier study finding from Abia State of Nigeria  and WHO According to WHO-AfRO Measles and Rubella surveillance guideline, measles suspected cases that were tested and had negative or equivocal result will be tested for rubella virus-specific IgM, another rash febrile illness. In this study, 17.3% of non-measles cases were found positive for rubella virus and children 5\u20139 years were affected greatly. This finding was much lower than a 37.6% positivity rate of rubella from Zimbabwe [The highest number of clinically confirmed and the lowest number of epidemiologically linked measles cases in 2014 was due to a shortage of kit in the fourth quarter and the incidence of measles cases was seen dropped in this year as no sample was tested after the mid of October Figs.\u00a0 and 6. TIn general, decreased incidence is normal to increasing vaccine coverage report of a specific disease. Unfortunately in SNNPR both reports of administrative measles vaccine coverage and measles incidence were found increasing at the same time . This maOur study had the following limitations. First, data presented here was mainly related to the lab-confirmed measles cases giving little emphasis to clinically confirmed and epi-linked cases as the details of these not submitted to the lab. Second, there was no data on the clinical presentation and severity of cases, vaccination status and case fatality rate as these information rarely submitted to the laboratory.In SNNPR, measles continued as an important public health problem. The incidence of confirmed measles was found increasing from year to year mostly affecting children aged a month to 4\u00a0years. Measles is a seasonal infection reaching a peak during January and February. We recommend wide age range measles campaign for the region and additional study to understand the knowledge, attitude, and practice of the professionals and the population for measles infection and vaccination is advisable. Finally genotyping of circulating measles virus strain is paramount important."}
+{"text": "Disease surveillance is a critical component in the control and elimination of vaccine preventable diseases. The Uganda National Expanded Program on Immunization strives to have a sensitive surveillance system within the Integrated Disease Surveillance and Response (IDSR) framework. We analyzed measles surveillance data to determine the effectiveness of the measles case-based surveillance system and estimate its positive predictive value in order to inform policy and practice.An IDSR alert was defined as \u22651 suspected measles case reported by a district in a week, through the electronic Health Management Information System. We defined an alert in the measles case-based surveillance system (CBS) as \u22651 suspected measles case with a blood sample collected for confirmation during the corresponding week in a particular district. Effectiveness of CBS was defined as having \u226580% of IDSR alerts with a blood sample collected for laboratory confirmation. Positive predictive value was defined as the proportion of measles case-patients who also had a positive measles serological result (IgM +). We reviewed case-based surveillance data with laboratory confirmation and measles surveillance data from the electronic Health Management Information System from 2012\u20132015.A total of 6,974 suspected measles case-persons were investigated by the measles case-based surveillance between 2012 and 2015. Of these, 943 (14%) were measles specific IgM positive. The median age of measles case-persons between 2013 and 2015 was 4.0 years. Between 2013 and 2015, 72% of the IDSR alerts reported in the electronic Health Management Information System, had blood samples collected for laboratory confirmation. This was however less than the WHO recommended standard of \u226580%. The PPV of CBS between 2013 and 2015 was 8.6%.In conclusion, the effectiveness of measles case-based surveillance was sub-optimal, while the PPV showed that true measles cases have significantly reduced in Uganda. We recommended strengthening of case-based surveillance to ensure that all suspected measles cases have blood samples collected for laboratory confirmation to improve detection and ensure elimination by 2020. Having an effective measles surveillance system is vital in planning, prompt outbreak response, monitoring and evaluation of control measures . The UgaDuring passive surveillance, data are collected from suspected measles patients during visits to health centers and then reported routinely using weekly, monthly and quarterly reports , 6. DuriCase-based laboratory backed surveillance was rolled out in all districts of Uganda, in October 2003 . The estThe CBS also requires that all suspected outbreaks are investigated and confirmed by collecting blood samples from the first reported 5 cases , while oIn 2011, countries in the African region agreed to eliminate measles by 2020 by reducWe analyzed eHMIS and measles case-based surveillance data between 2012 and 2015 to determine the effectiveness and PPV of the measles surveillance system.confirmed measles case was a suspected case with positive IgM antibody or who was epidemiologically linked to a confirmed case in an outbreak.A suspected case of measles was defined as any person with fever and generalized maculo-papular rash plus one of the following: cough, coryza or conjunctivitis; or any person in whom a clinician suspects measles. A We defined effectiveness of the measles case-based surveillance system as having \u2265 80% of suspected measles IDSR alerts with blood samples collected for laboratory confirmation . The assThe PPV was defined as the proportion of measles case-patients identified by CBS who also had a positive measles serological result (IgM +) , 13. It An IDSR alert was defined as \u22651 suspected measles case reported by a district through eHMIS in a week. An alert in the case-based surveillance system was defined as \u2265 1 suspected measles case with a blood sample collected for laboratory confirmation from a corresponding district during a particular week.Measles surveillance data (2012\u20132015) were accessed from Uganda\u2019s electronic Health Management Information System using DHIS2 software.Approval to use the surveillance data was sought from Ministry of Health of Uganda which is responsible for utilization of health and health-related data/information in the health sector for the betterment of the population of Uganda. The office of the director general determined that this activity was not human subjects\u2019 research and its primary intent was public health practice or a disease control activity . To protect patient confidentiality, personal information were de-identified during extraction and data analysis. Therefore none of the authors had access to identifying information.A total of 1,769 serum specimens were obtained from suspected measles case-patients, using the CBS in 2012. Of these, 61were excluded from further analysis because they had indeterminate serological evaluation. Of the remaining 1,708 suspected measles cases, 504 (28%) were measles specific IgM positive. Of the 1,190 suspected measles case-patients investigated by CBS in 2013, 21 (2%) had indeterminate serological evaluation. Of the remaining 1,169 suspected measles case-patients, 100 (8.6%) were measles specific IgM positive case-patients. Of the 1,652 suspected measles case-patients investigated by CBS in 2014, 20 (1.2%) had indeterminate serological evaluation and were not included in further analysis. Of the remaining 1,632 suspected measles case-patients, 144 (8.8%) were measles specific IgM cases-patients. Of the 2,363 suspected measles case-patients investigated in 2015, 78 (3.3%) had indeterminate serology results and were also excluded from further analysis. Of the remaining 2,285 suspected measles case-patients, 195 (8.5%) were measles IgM case-patients .In 2013,713 (63%) of the alerts reported in eHMIS had blood samples collected for laboratory confirmation. In 2014, the percentage of alerts with blood samples collected increased to 916 (84%) achieving the recommended WHO standard of \u226580%, this proportion however decreased in 2015 . The PPVOur review of measles surveillance data showed that the proportions of IDSR measles alerts with blood samples collected for laboratory confirmation 72%) through case-based measles surveillance were sub-optimal to detect measles outbreaks between 2013 and 2015. Secondly, the average PPV of the measles case-based surveillance system was within the recommended target of <10% by the World Health Organization African Region (WHO-AFRO) [2% througIn 2012, all districts were transitioning from paper based reporting to electronic Health Management Information System . During Surveillance systems that are functioning optimally should collect blood specimens from \u2265 80% of all suspected measles cases for laboratory confirmation if they are to detect outbreaks in time . Having Other studies elsewhere have found similar results in measles surveillance systems, 22. A sThe low PPV of the measles case-based surveillance system (8.6%) indicates that most of the suspected measles cases  that were reported between 2012 and 2015 were not true measles cases. This usually happens when the incidence of disease is rare. When the incidence increases the PPV also increases . The lowAmong the suspected measles alerts that had blood samples collected for laboratory confirmation, the year 2012 registered the highest positive predictive value. During this period, several measles outbreaks were detected across the country before implementation of the measles mass campaign in November 2012. Following this campaign, the positive predictive value of the surveillance system reduced significantly.. AlthougFindings from this analysis should be interpreted with a grain of salt. A measles alert as used in this study does not put into consideration the number of cases reported during a particular week or the number of positive measles cases identified. Secondly, we lacked information external to the system to determine the true frequency of measles cases. The strength of this study was that we compared two national databases; the electronic Health Management Information System and the case-based surveillance system, which is the gold standard for measles diagnosis in Uganda.The effectiveness of measles case-based surveillance was sub-optimal, while the PPV showed that true measles cases have significantly reduced in Uganda. We recommended strengthening of case based surveillance to ensure that all suspected measles cases have blood samples collected for laboratory confirmation or line listed in case of confirmed outbreaks as an important part of measles control and elimination program in Uganda."}
+{"text": "The restoration of dentine lost in deep caries lesions in teeth is a routine and common treatment that involves the use of inorganic cements based on calcium or silicon-based mineral aggregates. Such cements remain in the tooth and fail to degrade and thus normal mineral volume is never completely restored. Here we describe a novel, biological approach to dentine restoration that stimulates the natural formation of reparative dentine via the mobilisation of resident stem cells in the tooth pulp. Biodegradable, clinically-approved collagen sponges are used to deliver low doses of small molecule glycogen synthase kinase (GSK-3) antagonists that promote the natural processes of reparative dentine formation to completely restore dentine. Since the carrier sponge is degraded over time, dentine replaces the degraded sponge leading to a complete, effective natural repair. This simple, rapid natural tooth repair process could thus potentially provide a new approach to clinical tooth restoration. Dentine is a vital tooth mineral that is produced by highly specialised mesenchymal cells called odontoblasts. When tooth mineral is compromised either following trauma or infection (caries), the inner cellular soft pulp tissue can become exposed to the external environment and become infected. Clinical repair of tooth damage currently involves the use of mineral aggregates that are used to fill the space in dentine created following removal of decay or trauma1234678The activation of Wnt/\u03b2-cat signalling is an immediate early response to tissue damage and appears to be essential for stimulating the cellular-based repair in all tissues101112151617181920222317IA4 mouse dental pulp cells were incubated with a range of concentrations of the three inhibitors and cytotoxicity analysed with the MTT assay after 24\u2009h in culture 2526. The25in vivo, experimental tooth damage was created, by drilling and making 0.13\u2009mm holes in mouse maxillary first molars to expose the pulp  scanning was used to visualise and quantify mineral deposition at the drill site. Analysis at both 4 and 6 weeks revealed increased mineralisation with all three agonists when compared to controls with no obvious increases between 4 to 6 weeks . These iModern dental practice for carious lesions aims to remove decay and restore tooth structure by using mineral aggregate filling materials. Preservation of undamaged dentine forms an integral part of this practice since maintenance of as much of the natural mineral as possible is deemed important for tooth vitality. Mineral aggregates such as MTA and Biodentine are reported to aid the formation of tertiary dentine, although the deposition of this dentine is not at the sites of damage but rather internal in the pulp space2728151617181920An important consideration is the effect Wnt agonists may have following their release into the circulation. The small localised doses of these agonists used were effective at increasing the formation of reparative dentine to the extent that almost complete repair of the lesion was observed after 6 weeks. These doses are substantially lower that those used in clinical trials of Tideglusib where 500\u20131000\u2009mg were delivered systemically daily for 26 weeksSmall molecule Wnt signalling agonists delivered via a biodegradable collagen sponge provide an effective repair of experimentally-induced deep dental lesions by promotion of reparative dentine formation. The simplicity of this approach makes it ideally translatable into a clinical dental product for treatments requiring dentine restoration and pulp protection that are currently treated with non-organic cements.The purpose of this study was to investigate whether natural dentine repair could be enhanced by stimulating the formation of reparative dentine. Adult CD1 wild-type mouse first molars were used and damage stimulated by controlling drilling (see below). The drugs of choice and vehicle were based on previous reports in the literature and also translational potential into a simple, cost effective dental therapy.in vivo gene expression assay. The reparative time points used in this study were in accordance with UK Home Office animal regulations. This study was not blind and sample selection was not random.In order to evaluate the reparative capacity of the drugs, six to nine teeth were evaluated per time point and a sample size of 20\u201330 teeth per group was used for the All animals used in this study were handled in accordance to UK Home Office Regulations project license 70/7866 and personal license I6517C8EF. Experimental procedures were approved by the King\u2019s College Ethical Review Process. The mice were anaesthetized with a solution made with Hypnorm (Fentanyl/fluanisone - VetaPharma Ltd.), sterile water and Hypnovel (Midazolam - Roche) in the ratio 1:2:1 at the rate of 10\u2009ml/kg intraperitonially. A rounded carbide burr FG 1/4 coupled to a high speed hand piece was used to access the dentine of the mouse superior molar teeth. Once the burr cut exposed the dentine, a 30G needle was used to penetrate the pulp. In order to protect the pulp from external contamination and stimulate dentine repair, the injury was capped either with ProRoot Mineral Trioxide Aggregate (MTA) (Maillfer Dentsply), or Kolspon (Fish Collage Type 1- Eucare Ltd) alone, or in association with 50\u2009nM BIO (SIGMA), 5\u2009\u03bcM CHIR99021 (SIGMA), or 50\u2009nM Tideglusib (SIGMA) dissolved and diluted in DMSO, in contact with the pulp. A layer of 3\u2009M Ketac-Cem Radiopaque was used as a capping material to seal the injured site. The damage was performed on the two upper first molars. For incisor damage a fine needle was inserted through the mouse lower tooth into the pulp. Post-op the mice were given Vetergesic (Buprenorphine \u2013 Ceva) at the rate of 0.3\u2009mg/kg by intraperitoneal injection as analgesic. The animals were sacrificed after 1\u2009day, 4 weeks and 6 weeks.2 and incubated  for 24\u2009hrs using standard culture medium. Thereafter, the medium was replaced with conditioned (drugs\u2009+\u2009media) and control media  for another 24\u2009hrs. . To determine the cell metabolic activity, MTT -2,5- diphenyltetrazolium bromide, Sigma) was added to the controls and the conditioned media after 24\u2009hrs. The resulting formazan product was then dissolved in 200\u2009\u03bcl of dimethyl sulfoxide per well . A colorimetric plate reader (Thermo Multiskan Ascent 354 microplate reader) was used to read the absorbance at 540\u2009nm with background subtraction at 630\u2009nm.17IA4 cells were plated in 96 well plates at 20,000\u2009cells/cm2/95% air, 100% humidity) for 24\u2009h using standard culture medium. FalconTM cell culture inserts for use with 24-well plates (3\u2009\u03bcm pore size) were placed in the wells carrying 96\u2009mm2 Kolspon cubes either dry or soaked in 30\u2009\u03bcl of the drug optimal concentration for 15 and 30\u2009minutes, 1, 6, and 12\u2009hours. The cells were collected with TRIzol and stored at \u221220\u2009\u00b0C.17IA4 cells were plated in 24-well plates and incubated  and 1\u2009day after injury using TRIzol. (Thermo Fisher Scientific) as recommended by the manufacturer. The RNA was quantified using Nanodrop and reverse transcribed into cDNA. Beta-actin was used as housekeeping gene  and Axin2 was the read-out for Wnt pathway activity .Mice upper molars were dissected and fixed with PFA 4% overnight and scanned using a Bruker Skyscan1272 micro-CT scanner. After scanning, Microview software programme (GE) was used for visualization and analysis. Two dimensional (2D) images were obtained from micro-CT cross-sectional images of superior first molar internal part, to evaluate if the drilling was successful and mineral formation. In order to assay tissue mineral content a ROI of X\u2009=\u20090.2\u2009mm, Y\u2009=\u20090.4\u2009mm, and Z\u2009=\u20090.2\u2009mm was set as standard for all the samples and the mineral analysis was performed. The region measured comprised only of the injury site. ROI complete filled with mineral\u2009=\u20090.0017\u2009mg.After 4 weeks decalcification in 19% EDTA the teeth were embedded in wax blocks and sectioned using 8\u2009\u03bcm thickness. Sections were stained using Masson\u2019s Trichrome.2 in PBS) and washed in wash buffer . \u03b2-galactosidase staining was visualized using a staining solution of 1\u2009mg/ml X-gal substrate (Invitrogen) in wash buffer containing 5\u2009mM potassium ferrocyanide andpotassium ferricyanide at 37\u2009\u00b0C for 16-hour. Sections were dehydrated, cleared in Neo-Clear and mounted with Neo-Mount.Teeth were fixed in 0.4% paraformaldehyde (PFA) for 24-hours at 4\u2009\u00b0C, washed with PBS and decalcified in 19% EDTA pH 8 for 4-weeks. Teeth were immersed in 30% sucrose/PBS overnight at 4\u2009\u00b0C before embedding in OCT  using dry ice and ethanol. Sections were cut at a thickness of 12-\u03bcm and were refixed .Publisher's note: Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations."}
+{"text": "Overthe next 8 months, approximately 3,000 oral opium users were evaluated at LHHPC, andfound to have elevated BLLs . During February\u2013November 2016, 14 drugcouriers who acknowledged transporting illicit substances across international bordersin their gastrointestinal tracts  in 20-g to 250-gpacks. The packs were expelled intact; a pooled sample of the contents was sent to thechemistry laboratory of Shahid Beheshti University of Medical Sciences in Tehran, wherethe lead content was found to be 3,553 ppm  by atomicabsorption. The study was approved by the Shahid Beheshti University of Medical SciencesInstitutional Review Board.On February 14, 2016, a patient with known addiction to oral opium and no occupational orother lead exposure was admitted to Loghman-Hakim Hospital and Poison Center (LHHPC) inTehran, Iran, with abdominal pain, anemia, constipation, and a blood lead level (BLL) of137 \u03bcg/kg body weight . Clinicians should be awarethat persons using opium products that appear to have been smuggled through Iran couldbe at risk for lead poisoning."}
+{"text": "Over the last decade, studies have implicated the cerebellum not only in motor functioning, but also in cognition and social cognition. Although some aspects of cognition have been explored in the five most common forms of Spinocerebellar Ataxia (SCA), social cognition in these patients has rarely been examined. The present study provides a preliminary characterisation of the severity of cognitive and social cognitive impairments in patients with SCA2, SCA1 and SCA7 using an identical battery to the one previously used in SCA3 and SCA6 patients for comparison. The cognitive profiles of SCA1 and SCA7 patients were comparable to that of SCA6 patients; SCA1 patients had relatively intact profiles, while SCA7 patients demonstrated only some selective deficits. In contrast, SCA2 patients showed the greatest impairments, similarly to SCA3 patients. On tests of social cognition, SCA2 and SCA7 patients were impaired on a task of emotion attribution, whereas one SCA1 patient had a Theory of Mind deficit, which has also been documented in SCA3 and SCA6. We provide preliminary evidence that the neuropsychological profiles of SCA patients correspond well with the severity of pathological and clinical features. Moreover, these patients may also have social cognition impairments. Overall, we suggest that there is a degree of heterogeneity in the types of cognitive and social cognitive impairments in SCA patients."}
+{"text": "Europe has been challenged with an intense rise of aging populations facing for example multiple chronic health problems, functional limitations and social and psychological challenges. With increasing age people may become vulnerable, nevertheless, they can still report high levels of well-being despite their deficits. Older adults\u2019 strengths and resources can balance negative experiences and increase positive well-being outcomes. These resources can be personal (e.g. have sufficient income) or stemming from the social environment of the older person . Hence, this symposium focusses on these strengths and resources and how they might (positively) affect the well-being of vulnerable groups ageing in place. The main objective of the symposium is to give insights into different aspects and strategies that can protect older adults against negative outcomes. Four different studies from Belgium will be presented: Sarah Dury starts with explaining the potential buffering predictor of leisure and civic activities, by uncovering the mechanisms underlying the relationship between multidimensional frailty and well-being. Lise Switsers examines if the absence of social and emotional loneliness can act as a buffer to maintain a good well-being for older adults at risk of frailty. An-Sofie Smetcoren examines how \u2018living in solidarity\u2019 in a co-housing project can contribute to ageing in place. Finally, Sylvia Hoens explores the experiences of the older care users and their informal caregivers with live-in migrant care workers and examines how this care can increase their well-being."}
+{"text": "Propionibacterium acnes (PA) was used to induce sarcoidosis-like granulomatous inflammation in a mouse model. Wild-Type (WT) C57BL/6 mice were divided into three groups: (1) WT-PA group; (2) WT-PA + Incomplete Freund's Adjuvant (IFA) group; and (3) WT-PBS group. Loose granuloma formation was observed in the lungs on day 56 in the WT-PA and WT-PA + IFA groups. The proportions of peripheral Th17 cells in the WT-PA (p = 0.0004) and WT-PA + IFA groups (p = 0.0005) were significantly higher than that in the WT-PBS group. The proportions of peripheral Treg cells in the WT-PA (p < 0.0001) and WT-PA + IFA groups (p < 0.0001) were lower than that in the WT-PBS group. Then, to explore the mechanism of IL-17, Wild-Type (WT) C57BL/6 mice were divided into three groups: (1) WT-PBS group (2) WT-PA group; (3) WT-PA + mouse IL-17A neutralizing antibody (IL-17Ab) group. IL-17A gene knockout mice (KO) were divided into two groups: (1) KO -PA group; (2) KO-PBS group. The KO-PA and WT-PA + IL-17Ab groups showed reduced inflammation and no loose granuloma formation on day 56. As compared to the WT-PA group, the ratio of peripheral Th17 in the KO-PA (p < 0.0001) and WT-PA + IL-17Ab groups (p < 0.0001) decreased, while the ratio of peripheral Treg in the KO-PA (p < 0.0001) and WT-PA + IL-17Ab (p = 0.0069) groups increased on day 56. Hence, PA can be used to establish a mouse model of sarcoidosis-like granuloma. IL-17A plays an important role in experimental sarcoidosis-like granuloma formation.The etiology of sarcoidosis is unknown. In this study,  Propionibacterium acnes (PA) might be a causative pathogen for sarcoidosis  to perform intraperitoneal pre-sensitization, followed by multiple low-dose intratracheal inoculations of inactivated PA to establish a mouse model of sarcoidosis-like granulomatosis. In addition, we also performed a long-term observation of granuloma dissipation in the mouse model. We aimed to establish a simple and practical mouse model of sarcoidosis-like granulomatosis that resembles human sarcoidosis, and used IL-17A\u2212/\u2212) (Tokyo University of Science) were maintained up to 6\u20138 weeks of age, with free access to water and food. All animal handling and experimental procedures were approved by the Experimental Animal Center of Tongji University (No. K17-016).Specific pathogen-free (SPF) female C57BL/6 mice  and female IL-17A knockout mice  was cultured in Clostridium Perfringens medium at 37\u00b0C for 48 h. The bacterial suspension of PA was prepared, and then PA was inactivated at 65\u00b0C for 30 min. The OD600 of the PA suspension was measured using a spectrophotometer (BioTek Epoch2). Mouse IL-17A neutralizing antibody was purchased from BioXcell (BP0173-5MG).n = 114), in which mice were pre-sensitized by intraperitoneal injection of inactivated PA  and then intratracheally inoculated with inactivated PA  at day 14, 28, and 42 after the pre-sensitization; WT-PA + IFA group (n = 42), in which mice were pre-sensitized by intraperitoneal injection of inactivated PA plus IFA  and then received intratracheal inoculation in the same manner as the WT-PA group; and WT-PBS group (n = 42), in which mice received intraperitoneal injection of PBS (0.25 mL) and intratracheal inoculation of PBS (0.05 mL) in the same manner as the WT-PA group. Peripheral blood, BALF, and lung tissue samples of each group were collected on day 15, 17, 19, 21, 28, 42, and 56, respectively.Wild-type C57BL/6 mice were randomized into three groups : WT-PA gn = 36), in which mice were intratracheally inoculated with PA at day 56, 70, 84, 98, 112, and 126 after the pre-sensitization in addition to the earlier PA inoculations, and the WT-PA-B group (n = 36), in which mice did not received extra intratracheal inoculation. The lung tissue samples were collected on day 70, 84, 98, 112, 126, and 140, respectively, to observe granuloma dissipation in the lung tissue.Our preliminary results showed that the two modeling methods (with or without IFA) had similar effects on mouse model establishment. Hence, we did not use IFA in the final experiments. The WT-PA group was further divided into two groups : WT-PA-A\u2212/\u2212 mice were used to investigate the role of IL-17A in PA-induced granulomatosis (\u2212/\u2212 mice were divided into the KO-PA group (n = 24), in which the mice were intratracheally inoculated in the same manner as the WT mice, and the KO-PBS group (n = 24), in which the mice were intratracheally inoculated with PBS. In the WT-PA + IL-17Ab group (n = 24), the WT mice were pre-sensitized with intraperitoneal injection of inactivated PA , and then intraperitoneally injected with IL-17Ab (30 \u03bcg/20 g) at day 14 after the pre-sensitization, and intratracheally inoculated with inactivated PA  4 h after the IL-17Ab injection. Then the mice were challenged with inactivated PA on day 28 and 42 after the pre-sensitization. Peripheral blood, BALF, and lung tissue samples were collected on day 17, 21, 28, and 56, respectively.IL-17Aomatosis . The IL-Lung tissue samples were fixed with universal tissue fixative  for 24 h and then paraffin-embedded for sectioning. The tissue sections were stained with hematoxylin and eosin. The stained tissue sections were scanned with Leica pathological slice scanner (LEICA SCN400). Two experienced pathologists independently reviewed the staining results.Lung tissue sections were incubated with the primary antibodies anti-CD4  at 1:1,000 and anti-CD68  at 1:300, and then incubated with the HRP-goat anti-rabbit secondary antibody  at 1:200 dilution. Color was developed by DAB. The tissue sections were observed under a microscope.Lung tissue samples were fixed with universal tissue fixative  for 24 h, embedded in paraffin, and sectioned. Gram staining was performed on the tissue sections. The stained tissue section was observed under a microscope.Bronchoalveolar lavage (BAL) cells were collected by five injections of 0.8 ml of sterile PBS containing 2% fetal calf serum  and 2 mmol/L ethylenediaminetetraacetic acid. The total number of BAL cells was counted with a hemocytometer and used for flow cytometry detection. The supernatants from BAL were used for ELISA detection.The cells were resuspended in FACS solution and the cell suspension was divided into three aliquots for the following antibodies: (1) surface-staining with anti-mouse CD4 antibody followed by permeabilization and staining with anti-mouse IFN-\u03b3 and IL-17A antibodies; (2) surface staining with anti-mouse CD4 and CD25 antibodies followed by permeabilization and staining with anti-mouse Foxp3 antibody; (3) surface staining with anti-mouse CD3, CD4, and CD8 antibodies. All fluorescent antibodies were purchased from eBioscience . The stained cells were analyzed by flow cytometry (Beckman Coulter). Mouse peripheral blood was collected, and peripheral mononuclear cells were separated after lysing the red blood cells.BALF supernatant was collected from at least five mice in each group and analyzed by ELISA (Neobioscience) to determine IL-17A, IL-23, TGF-\u03b21, and IL-10 levels.P < 0.05 was considered statistically significant.The Graphpad Prism 6 software was used for statistical analysis. Continuous variables were presented as mean \u00b1 standard deviation. Multi-group comparison was analyzed by one-way ANOVA followed by Tukey test. p = 0.0004; WT-PA + IFA vs. WT-PBS: p = 0.0005), Th1 cells%  and Th17/Th1 ratio , significantly reduced Treg cells% , and significantly elevated Th17/Treg ratio  as compared to the WT-PBS group. The BALF samples of both PA groups showed significantly reduced Treg cells%  as compared to the WT-PBS group. Th17%, Th1%, Th17/Th1 ratio, and Treg% of peripheral blood had no statistical difference  and IL-23  as compared to the WT-PBS group. In contrast, the levels of Treg-associated inflammatory factors, including TGF-\u03b21  and IL-10  were significantly lower in the two PA groups as compared to the WT-PBS group. There was no significant difference in IL-17A, IL-23, and IL-10 in BALF collected on day 56 , significantly higher Th1%  and Treg cells% , and significantly lower Th17/Th1  and Th17/Treg ratios .As compared to the WT-PA group, the KO-PA and WT-PA + IL-17Ab groups had significantly reduced Th17% in the peripheral blood collected on day 56 , higher Th1%  and Treg% , and lower Th17/Th1  and Th17/Treg  ratios. The total cell numbers and Lymphocytes numbers in KO-PA and WT-PA + IL-17Ab groups were decreased in BALF samples on the 56th day  and IL-23 , but higher levels of Treg-associated inflammatory factors including TGF-\u03b21  and IL-10 .As compared to the WT-PA group, the KO-PA and WT-PA + IL-17Ab groups showed significantly lower levels of Th17-associated inflammatory factors in the BALF collected on day 56, including IL-17A  or recombinant M. tuberculosis catalase\u2013peroxidase (mKatG) to induce granulomas in female Lewis rats or C57BL/6 mice. However, lack of direct clinical correlation in the induction of granulomas by conjugated beads may limit generalized use of this model , which may cause sarcoidosis  was used for animal experiments . Howevercoidosis , 19, wascoidosis . Howevercoidosis . Liu percoidosis . WhetherRecent studies have demonstrated that PA is associated with sarcoidosis , 8, 23. In this study, we used multiple intratracheal inoculations of low-dose PA to establish a mouse model of sarcoidosis-like granulomatosis. We observed this model for up to 140 days. The advantage of this model is that it mimics the hispathological and immunological characteristics of the inflammation stage of human sarcoidosis. In contrast to the previously reported paw pad injection  and vein\u2212/\u2212 mice and IL-17A neutralizing antibody. In our preliminary experiments, we used isotype mouse IgG1 (WT-PA-isotype control group) and found no difference in lung histopathology and inflammatory factors as compared to the WT-PA group (propionibacterium acne model group) (data not shown). Therefore, we excluded the non-specific combination of IgG1 and anti-IL-17A antibody in this study. Hence, isotype control IgG1 group was not included in the final experiment.The pathogenic mechanisms underlying sarcoidosis are very complex, and multiple types of cells and cytokines are involved in sarcoidosis initiation. Th17/Treg cell imbalance may play an important role in the initiation and development of sarcoidosis , 30. IdaHawkins et al. found that sarcoidosis CD4+ T cells exhibited loss of cellular function during progressive disease that follows the archetype of T cell exhaustion . They alIn this study, we detected CD4+IFN-\u03b3+ Th1 cells by flow cytometry. However, we did not detect IFN-\u03b3 and TNF-\u03b1 expression by ELISA in this experiment. In this study, we mainly focused on Th17 and Treg-related cytokines . However, IFN-\u03b3 and TNF-\u03b1 are important cytokines for granuloma formation. We will include detection of IFN-\u03b3 and TNF-\u03b1 in our future study.Jiang et al.  found thIn the current study, the mouse model showed elevated peripheral Th17% and IL-17A levels in BALF . IL-17A In summary, a mouse model of PA-induced sarcoidosis-like granulomatosis was successfully established in this study. IL-17A may play an important pro-inflammatory role in the development of sarcoidosis-like granulomatosis.The study was approved by the institutional ethics committee of Shanghai Pulmonary Hospital (No. K17-016).HL, DW, JS, MZ, and QL: experimental design. JS, MZ, QL, YZho, YZha, TC, DT, LL, NZ, CY, DW, and HL: data acquisition and analysis. JS, MZ, and HL: writing the manuscript. All authors read and approved the final manuscript.The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest."}
+{"text": "In chromosome conformation capture experiments (Hi\u2010C), the accuracy with which contacts are detected varies due to the uneven distribution of restriction sites along genomes. In addition, repeated sequences or homologous regions remain indistinguishable because of the ambiguities they introduce during the alignment of the sequencing reads. We addressed both limitations by designing and engineering 144\u00a0kb of a yeast chromosome with regularly spaced restriction sites (Syn\u2010HiC design). In the Syn\u2010HiC region, Hi\u2010C signal\u2010to\u2010noise ratio is enhanced and can be used to measure the shape of an unbiased distribution of contact frequencies, allowing to propose a robust definition of a Hi\u2010C experiment resolution. The redesigned region is also distinguishable from its native homologous counterpart in an otherwise isogenic diploid strain. As a proof of principle, we tracked homologous chromosomes during meiotic prophase in synchronized and pachytene\u2010arrested cells and captured important features of their spatial reorganization, such as chromatin restructuration into arrays of Rec8\u2010delimited loops, centromere declustering, individualization, and pairing. Overall, we illustrate the promises held by redesigning genomic regions to explore complex biological questions. At leptotene, a subset of loops becomes tethered to the underlying chromosomal axis and Spo11\u2010induced meiotic DSBs then occur within these complexes  and the corresponding parental strain BY4742) using DpnII and HindIII . The raw using Dps (bp) in the Syn\u2010HiC region and in its parental counterpart for DpnII and HindIII  or from the measured object itself . When the number of events becomes large enough, the differences between the re\u2010ligation probabilities of different loci will start to kick in and the distribution of contacts should switch from a Poisson to a Gaussian behavior, assuming that the contact probabilities associated with these factors follow a Gaussian distribution. The standard deviations (\u03c3) of those two distributions (Poisson and Gaussian) scale respectively as the square root of the mean (\u221a\u03bc) or as the mean (\u03bc). We took advantage of the fact that the overall contact number \u03bc decreases with increasing genomic distances (s) to check whether these relations between \u03bc and \u03c3 hold for real data  and that the standard deviation for the Syn\u2010HiC experiment is lower than in the wt counterpart for all the values of \u03bc, as expected from the analysis done in Fig\u00a0s, the value of \u03bc can arbitrarily be increased by increasing the bin size, at the expense of the resolution.We first aggregated the results from 12 Hi\u2010C experiments performed in G1/early S phase and with or without the Syn\u2010HiC region  curves were computed for two pre\u2010meiotic replicates (0\u00a0h), three mitotic G1 and from pre\u2010meiotic cells released into SPM for 3, 4, and 6\u00a0h  of pachytene (ndt80\u0394\u2010arrested) cells was also computed, displaying a pattern very similar to wild\u2010type cells after 6\u00a0h in SPM, as well as to mitotic metaphase (cdc20\u2010arrested) cells  curves of meiotic cells  display sharp differences compared to pre\u2010meiotic and G1 cells. First, contact frequencies increase between loci positioned 20 to 50\u00a0kb apart, with a peak around ~50\u00a0kb. For longer distances, the contact frequencies sharply decrease, although a small increase in long\u2010range contact can be observed as cells progress toward pachytene (red curve versus pink curve). This result is compatible with the structuring of the chromosome into arrays of loops which would favor such medium\u2010range contacts while disfavoring long\u2010distance contacts. Mitotic metaphase and meiotic prophase chromosomes are strikingly similar, pointing at a similar internal structure  displays a relatively regular contact pattern similar to those observed during G1 . This signal provides direct molecular evidence for the presence of chromatin loops of various sizes along the chromosomes during meiosis prophase.We took advantage of this pilot study to investigate the presence of loops and address their demarcation by cohesin. First, we investigated whether Rec8\u2010mediated loops were visible on the different meiotic chromosomal contact maps by plotting the Rec8 binding regions along chromosome lengths  cells. The ratio between the average contact maps (2.5\u2010kb bins) centered on Rec8 binding sites with the average maps computed on sites which are not bound by Rec8 displays no significant enrichment in pre\u2010meiotic (t\u00a0=\u00a00\u00a0h) conditions , but much less contacts with regions positioned closer (between 2.5 and 10\u00a0kb). The elongated shape of the enriched contact signal supports a heterogeneity in the size of the loops over the genome, in agreement with the heterogeneity of distances separating Rec8 deposition sites  within each of the two homologous regions, which are distinguishable from each other thanks to the SNPs introduced in the synthetic design, reveals a similar trend than the ones computed over the whole genome for the three time points  chromosomal segment (Syn\u2010HiC design) in yeast that incorporates regularly spaced restriction sites alleviates this limitation. The polymorphisms introduced into the redesigned region allowed to distinguish it from its native counterpart, in an otherwise isogenic background. Not only do these polymorphisms allow tracking both homologs, but the regular spacing of restriction sites also improves the quality of Hi\u2010C data, which in turn provides a new definition of the resolution in Hi\u2010C experiments.et\u00a0al, et\u00a0al, et\u00a0al, et\u00a0al, et\u00a0al, et\u00a0al, et\u00a0al, et\u00a0al, et\u00a0al, Here, we took advantage of the Syn\u2010HiC design to track the large and dynamic structural changes of chromosomes during the meiotic prophase using Hi\u2010C. Replicated meiotic chromosomes reorganize as arrays of chromatin loops anchored along a chromosomal axis. In budding yeast, the limited resolution of cytological approaches failed to yield detailed characterization of the structuring mechanism and of the loop features   start and stop codons of known ORFs; (ii) regulatory transcription pre\u2010initiation complexes binding regions identified through ChIP\u2010Seq exo, encompassing TATA\u2010box binding sites .For each window, we computed all possible changes to apply to the genome so that all combinations of five out of the eight chosen 6\u2010cutter enzymes were repositioned to generate all expected new restriction patterns. For each combination of five enzymes, all sites were first removed from the genome before being reintroduced at ideal positions. A margin of error in the positioning of the \u201cideal\u201d position was tolerated (10% of the window size) to maximize the probability of introducing only synonymous mutations within the coding sequence. Once a RS was positioned, the position of the adjacent RS was adjusted based on the newly positioned site so that overall, the distribution of RFs remains as close as possible to the theoretical distribution. Overall, for each enzyme, a quality score was computed for each window based on the difference between the expected distribution of the site and the real distribution. For each combination of enzyme, a global score corresponding to the sum of the individual scores of each enzyme was computed , followed and was performed on the genome windows presenting the best quality scores.et\u00a0al, et\u00a0al, et\u00a0al, We chose the final window based also on our research interests, i.e., containing at least two early replicating replication origins  and blocks 11, 28, and 47 (LEU2), followed by 200\u2010bp sequences of the wt neighboring chromosomal region. The replacement of the native sequence of strains BY4742 and SK1 with the redesigned blocks was performed through a succession of six transformations, up to 11 blocks at a time , with 200\u00a0bp overlaps between them. In addition, sequences corresponding to either of the auxotrophic marker genes After each transformation, independent colonies were sampled and PCRs performed at the PCR tag positions to identify the transformants that have replaced all of the native sequence with the redesigned one Fig\u00a0. Upon thGrowth assays were performed to see whether the transformants exhibited changes in fitness. Little to no growth defect could be identified when blocks 1\u201347 replaced the native sequence in both BY and SK1 backgrounds. The final transformation with blocks 48\u201352 led repeatedly to the recovery of transformants exhibiting a slow\u2010growth, petite phenotype . A single colony was used to inoculate 5\u00a0ml YPD liquid culture and grown at 30\u00b0C up to saturation. The saturated culture was used to inoculate 350\u00a0ml of a freshly made (<\u00a048\u00a0h) pre\u2010sporulation medium  and grown with robust agitation (320\u00a0rpm) in 2.5\u2010l baffled flasks at 30\u00b0C. The cells were washed with 200\u00a0ml and resuspended in 500\u00a0ml of pre\u2010warmed sporulation media  and put back with robust agitation at 30\u00b0C. Samples were collected for Hi\u2010C or Southern blot analysis (below) at 0, 3, and 4\u00a0h for the wild\u2010type strain (YRSG190), and at 6\u00a0h for the wild\u2010type (YRSG190) and ndt80\u0394\u2010arrested cells (strain YRSG154). Note that t\u00a0=\u00a06\u00a0h on the one hand and t\u00a0=\u00a00, 3, and 4\u00a0h on the other are from two different meiotic time courses. Since t\u00a0=\u00a06\u00a0h and pachytene\u2010arrested cells gave very similar Hi\u2010C patterns, we moved forward to compare these datasets with the ones obtained from the 0\u2010, 3\u2010, and 4\u2010h kinetics.Pre\u2010growth and synchronous sporulation was adapted from Oh et\u00a0al . Briefly6 cells/ml until they reached 2\u00a0\u00d7\u00a0107 cells/ml. The cells were pelleted by spinning at \u223c3,300 g at 4\u00b0C for 5\u00a0min. The pellet was resuspended in 0.5\u00a0ml of Tris\u2013HCl  and transferred to a microfuge tube. The cells were pelleted again by spinning briefly and discarding the supernatant. The cells were resuspended in 400\u00a0\u03bcl RNA TES buffer . RNA were treated with DNase TURBO (Invitrogen) and extracted twice with acid phenol/chloroform before precipitated and suspended in 50\u00a0\u03bcl of water.Three independent RNA\u2010seq libraries were generated for BY4742, SK1, and Syn\u2010HiC strains. For each library, a single colony was grown in a 2\u00a0ml YPD culture overnight at 30\u00b0C. The next morning, 10\u00a0ml cultures in YPD were started from 10S.\u00a0cerevisiae BY4742 and YRSG181 (Syn\u2010HiC) genome. Gene differential expression was measured using DESeq2, with standard parameters.Single\u2010end non\u2010strand\u2010specific RNA\u2010seq of the YRSG181 (Syn\u2010HiC) and its parental strain BY4742 was performed using Illumina NextSeq and standard TruSeq preparations kits, after depletion of ribosomal RNA. Reads were mapped using Bowtie2  to the reference et\u00a0al, et\u00a0al, 9 cells were resuspended in 10\u00a0ml sorbitol 1\u00a0M and incubated 30\u00a0min with DTT 5\u00a0mM and Zymolyase 100T  to digest the cell wall. Spheroplasts were washed with 5\u00a0ml of sorbitol 1\u00a0M, then with 5\u00a0ml of 1\u00d7 restriction buffer (depending on the restriction enzyme used). Spheroplasts were then resuspended in 3.5\u00a0ml of the corresponding restriction buffer and split into three tubes (V\u00a0=\u00a0500\u00a0\u03bcl) before a 20\u00a0min at 65\u00b0C incubated in SDS (3%). Cross\u2010linked DNA was digested at 37\u00b0C overnight with the appropriate restriction enzyme . The digestion mix was then centrifuged and the pellets suspended and pooled into 400\u00a0\u03bcl of cold water. Depending on the sequence of the restriction site overhangs, extremities of the fragments were repaired in the presence of either 14\u2010dCTP biotin or 14\u2010dATP biotin (Invitrogen). Biotinylated DNA molecules were then incubated for 4\u00a0h at 16\u00b0C in the presence of 250\u00a0U of T4 DNA ligase . DNA purification was achieved through an overnight incubation at 65\u00b0C in the presence of 250\u00a0\u03bcg/ml proteinase K in 6.2\u00a0mM EDTA followed by the precipitation step in the presence of RNase.Hi\u2010C libraries were generated as described . Fragments of sizes between 400 and 800\u00a0bp were purified using a Pippin Prep apparatus (SAGE Science). Biotinylated molecules were purified using Dynabeads MyOne Streptavidin C1 beads, PCR\u2010amplified, and paired\u2010end\u2010sequenced on an Illumina platform .S.\u00a0cerevisiae reference genome (native genome) or against the S.\u00a0cerevisiae reference adapted for the Syn\u2010HiC region on chromosome IV (Syn\u2010HiC genome). For SK1 strains, the new reference genome was recovered from Yue et\u00a0al  as a function of the genomic distance s along chromosomes was computed for individual Hi\u2010C experiments as follows: First, intra\u2010chromosomal pairs of reads were partitioned by chromosome arms. Pairs oriented toward different directions or separated by less than 1.5\u00a0kb were discarded, as they\u00a0may correspond to self\u2010circularization events. For each chromosome, the remaining pairs were log\u2010binned as a function of their genomic distance s using the following formula: bin\u00a0=\u00a0[log1.1(s)]. The histogram was computed from the number of read pairs for each bin. This sum is weighed by the bin size 1.1bin). As for other Hi\u2010C Illumina libraries, custom paired\u2010end adaptors were used and ligated to the ends. Biotinylated fragments were pulled down using Dynabeads MyOne Streptavidin C1 beads prior to pre\u2010capture PCR amplification (six cycles). Biotinylated DNA matrix was separated from amplified DNA using a magnetic rack and stored for future usages. Capture of the genomic region of interest from the amplified DNA was performed according to the manufacturer's instructions using the custom\u2010made SureSelect library corresponding to both the Syn\u2010HiC and native chromosome IV regions. DNA was captured using Dynabeads MyOne Streptavidin T1 beads before the final post\u2010capture PCR amplification using PE1 and PE2 primers for 16 cycles. Cleaned DNA was verified for size and quality on Bioanalyzer before paired\u2010end (PE) sequencing on an Illumina platform .s; to take into account the finite\u2010size effect, we discarded bins at the edge of the contact matrix in order to keep the statistics (number of bins) for different values of s constant, up to s\u00a0<\u00a015,000\u00a0bp in DpnII and s\u00a0<\u00a070,000\u00a0bp in HindIII datasets. To show that the improvement is specific to the new restriction pattern and is unlikely to be found spontaneously within the genome, we compared the Syn\u2010HiC results with seven regions of similar size along chromosome IV . The quality improvement was assessed by computing the logarithm of the ratio of the CVs of the Syn\u2010HiC and native regions  with a 1,104\u2010bp\u2010long radiolabeled probe corresponding to the rightmost region common to both the native and the Syn\u2010HiC restriction fragments (obtained from SK1 genomic DNA with primers 5\u2032\u2010TGGTGAAGAACTCAGGATTC\u20103\u2032 and 5\u2032\u2010CAGTTACAATGAAGTCCAGG\u20103\u2032) and radiolabeled phage lambda DNA (molecular ladder). Radiolabeling was performed with 32P\u2010\u03b1dCTP with the High Prime labeling kit (Roche) following the manufacturer's instructions. The membrane was washed and exposed overnight, and the storage Phosphor Screen  was scanned on a Typhoon PhosphorImager (Molecular Dynamics). The length of the native and Syn\u2010HiC parental fragments is 5,135 and 6,157\u00a0bp, respectively. CO formation generates two recombinants of 4,453 and 6,839\u00a0bp. Quantifications were performed with ImageJ 1.49v.The https://www.ncbi.nlm.nih.gov/bioproject/?term=PRJNA464299).The datasets and computer code produced in this study are available in the following databases: Hi\u2010C and RNA\u2010seq data: Bioproject PRJNA464299 (The fasta sequences of the Syn\u2010HiC region and its native counterpart are available as a supplementary file .Previously published datasets used in this work are described in Table\u00a0HM, SDD, BL, OE, NA, GF, and RK designed the sequence. HM assembled the Syn\u2010HiC regions. HM and AP ran the meiotic time courses. AT did the Hi\u2010C experiments with help from GM. VS analyzed the data and did the resolution analysis, with contributions from JM and LLS. AP analyzed meiotic recombination. RK conceived the study and wrote the manuscript, with contributions from JM, VS, HM, AP, and BL.The authors declare that they have no conflict of interest.Expanded View Figures PDFClick here for additional data file.Dataset EV1Click here for additional data file.Source Data for Expanded ViewClick here for additional data file.Review Process FileClick here for additional data file."}
+{"text": "Crowding in the emergency department (ED) is associated with increased mortality, increased treatment cost, and reduced quality of care. Crowding arises when demand exceed resources in the ED and a first sign may be increasing waiting time. We aimed to quantify predictors for departure from the ED, and relate this to waiting time in the ED before departure.N\u00a0=\u200917,520). We build a transition model for each time step using the number of past departures and pre-specified risk factors  to predict the expected number of departures and from this the expected waiting time in the ED. The model was validated with data from the same ED collected March through August 2014.We utilised administrative data from the ED and calculated number of arrivals, departures, and the resulting queue in 30\u2009min time steps for all of 2013  corresponding to additional 7\u2009min waiting time per new arrival in a 30\u2009min time interval with an a priori time spend in the ED of two hours. The serial correlation of departures was present up to one and a half hour previous but had very little effect on the estimates of the risk factors. Boarding played a negligible role in the studied ED.We present a transition regression model with high predictive power to predict departures from the ED utilising only system level data. We use this to present estimates of expected waiting time and ultimately crowding in the ED. The model shows good internal validity though further studies are needed to determine generalisability to the performance in other settings.The online version of this article (10.1186/s12874-019-0710-3) contains supplementary material, which is available to authorized users. Crowding in the emergency department (ED) can be defined as a situation where demand exceed the resource supply  and is associated with increased mortality, increased treatment cost, and reduced quality of care \u20137. AspliWhile several studies \u201315 have https://www.strobe-statement.org).The aim of the present study was to model the probability of a departure from the ED dynamically as a function of the number of arrivals and the queue length given weekday or weekend and work shift  thus quantifying the effect of these previously identified risk factors for crowding in the ED . We willWe obtained data from the ED unit at Aarhus University Hospital, Denmark. The ED attends to approximately 40,000 patients per year from an uptake area of 330,000 inhabitants and receives all acute orthopaedic, trauma, and unstable medical patients from this area. Patients with other surgical and medical needs are also attended in the studied ED though not exclusively in this unit. Patient groups that are not received in the ED include medical paediatric and psychiatric patients as well as patients with cardiac arrest and myocardial infarction . When admitted to the ED unit patients are treated and discharged or admitted to the hospital. See Additional\u00a0file\u00a0We used an open cohort design including patients from 1. January 2013 to 31. December 2013. From the Electronic Health Records (EHR) we obtained data on arrivals to and departures from the ED including time stamps. The total number of arrivals was 41,693.N\u00a0=\u200924 * 2 * 365\u2009=\u200917,520). The queue length at the beginning of a new interval (t\u2009+\u20091) was calculated from the queue length, number of arrivals and departures in the previous interval (t):We created an aggregate data set with census of arrivals A(t) and departures D(t) in 30\u2009min intervals \u2009=\u20090.To mirror the clinical setting we defined a day as beginning with the day shift at 7\u2009a.m. with each work shift lasting eight hours. To reduce the effect of the arbitrary choice of the initial queue length (Q(0)\u2009=\u20090) the first three shifts of the study period were excluded in the statistical analysis.| t-1) is the probability of a departure in time step t dependent on past values.We expected serial or lagged correlation of the departures  and thus utilised a transition model for each time step (present departures) with conditional analyses on past departures (as predictor variables) together with the pre-specified predictor variables (risk factors) to predict the expected number of present departures . The traIn binomial regression models it is standard to express the probability p for given values of the predictors through the logit function (as in logistic regression):In our setting we used this expression for each time step with predictors that include both the number of past departures to handle the time dependent transition step and the pre-specified predictor variablesDue to the logit model each regression parameter can be expressed as an odds ratio (OR) by exp(\u03b2(i))\u2009=\u2009OR(i).The pre-specified predictor variables were new arrivals, weekday/weekend and shift  since these have been shown to be important risk factors for crowding . We alsoWe will use \u201cwaiting time\u201d in the meaning of \u201cwaiting to leave the ED\u201d, synonymously with the term \u201clength-of-stay\u201d (ED LOS), counting from the time of arrival until the time of departure from the ED disregarding the fact that much imperative work - such as assessment, treatment etc. - is being done during this time. Thus, here \u201cwaiting time\u201d is a matter of queueing terminology and should not be taken literally.Assuming that the queue length is in steady state the number of departures will follow a geometric distribution and hence the expected time spend from arriving to the ED in a given 30\u2009min time interval until leaving the ED (immediate waiting time) can be estimated in hours aswhere p is the probability of a departure. The ratio between waiting time in two scenarios with departure probabilities p(1) and p(0) isthat is, the inverse OR between the departure probabilities can be interpreted as the factor by which the expected waiting time changes.From the binomial model we calculated for each time step the expected number of departures (fitted) as E(t\u2009+\u20091)\u2009=\u2009E(D(t\u2009+\u20091))\u2009=\u2009n(t\u2009+\u20091) * p(t\u2009+\u20091 | t), where p(t\u2009+\u20091 | t) is considered as the one-step-ahead prediction for the probability of departure and is estimated through the logit-expression given above. We plotted the standardised residuals against the fitted values to check for the assumptions of linearity, homoscedasticity, and independent errors Fig.\u00a0. To confWe used a new dataset from the same ED but collected during 6 month of 2014 (March 1st to August 31st) to evaluate how well our final model captures the observed data. We evaluated the model fit the same way as for the model presented above but using parameter estimates from the original data . The code is available together with a constructed example of the dataset in the GitHub repository In the study period, approximately 3% of the patients stayed less than 30\u2009min in the ED and 5% stayed longer than 5\u2009h. The ED had 19 beds and was staffed with 4 to 8 nurses depending on time of day and week. A detailed description of the study population and site can be found in .The serial correlation on previous departures was present up to one and a half hour previous (OR\u2009=\u20091.008 to 1.012).New arrival (OR\u2009=\u20090.942) and change in queue length (OR\u2009=\u20090.978) had the greatest impact on lowering the odds of a departure. In a \u201cstandard scenario\u201d of weekday day shift, with an empty queue for at least the past one and a half hour the waiting time for one patient arriving to the ED is given by the transition model asSee Table\u00a0p\u00a0<\u2009\u00a00.0001) with a higher probability for a departure in weekends evening and night shift as compared to weekday day shift  and unpredictable (e.g. accidents and unrecognised epidemics) events. This number will, to a high degree, be random and hence hard to predict and to base any action upon. Contrary, a rise in the queue length as compared to the past 30\u2009min time interval is easily monitored and is associated with a decreased probability of a departure as well. It indicates a vicious cycle beginning  and may very well be an early sign of crowding in the ED which can be countered. The Plan-Do-Study-Act tool could be utilised in implementing such intervention .The pre-determined predictors\u2019 coefficients were nearly unchanged when we did not include the serial (departure) correlation in the model. This indicates that it is to a lesser degree the throughput processes that affects whether or not a patient is likely to spend a long time in the ED: The \u201cinternal system\u201d (throughput processes) remains the same through 30\u2009min intervals. This is in accordance with our previous results and other studies , 11 thouContrary to the conclusion of Bashkin et al.  we foundThe chosen binomial model assumes that the probability of departure is homogeneous across patients in a given time interval, but it seems likely, that heterogeneity in e.g. triage scores (red patients) can cause heterogeneity in the departure probabilities. Due to the number of missing values on the triage score this predictor could not be included in the model.All diagnostics as well as Fig. The EHR contains prospectively collected data to be used in a clinical setting. This makes EHR a secondary data source when used in research: We (the researchers) had no control over the data collection process, which might make EHR data questionable for research . The timWe present a regression model to predict departures from the ED in the absence of boarding. We use this to present estimates of expected waiting time and ultimately crowding in the ED. Our model follows the recommendations by McCarthy et al.  for measAdditional file 1:Table of characteristics of the emergency department and the patients. Friday and Saturday nights were considered part of the weekend. *The ED unit has two additional beds reserved for trauma call patients. Adapted from Eiset et al. (TIF 1490 kb)Additional file 2:Figure of diagnostic plot for the validation data (six month of 2014). See main text, Figs.\u00a0Additional file 3:Figure of arrivals, departures (observed and expected), and queue length in the study period. The 12\u2009days have been randomly chosen (one for each month in 2013) eight times. Departures are plotted as negative for visualisation. Abbreviations: obs., observations; expt., expected; arr., arrivals. (PDF 1111 kb)Additional file 4:Table of the expected waiting time in a scenario with few and many arrivals. Two examples of the number of arrivals and departures, the resulting queue length and probability of departure, and the waiting time estimate based on this data. The examples are chosen to show the contrast of a day with few arrivals and a day with many arrivals  of the waiting time on the 20th October and 5th September 2013. The median estimated waiting time was 1\u2009h and 48\u2009min (IQR\u2009=\u200927\u2009min) on the 20th October and 2\u2009h and 13\u2009min (IQR\u2009=\u200940\u2009min) on the 5th September. The notch indicates the estimated 95% confidence interval for the median. The individual observations are jittered. See Additional file"}
+{"text": "Regression analysis identified eye fatigue  and dryness  as significantly correlated with the macular GCC thickness, while the full macular thickness showed no significant correlation. In conclusions, eye fatigue and dryness were positively associated with thickness of the macular GCC. Nonvisual symptoms might therefore play a role in the development of eye fatigue.Eye fatigue is a common health problem across all age groups. Herein, we explored the correlation between eye fatigue and thickness of the retinal nerve fiber layer (NFL). Included in the NFL are intrinsically photosensitive retinal ganglion cells (ipRGCs), which are associated with trigeminal pain. This retrospective cross-sectional study included outpatients with best-corrected visual acuity above 20/30 in both eyes and without dry eye, glaucoma, or retinal disease. A total of 1981 patients were initially enrolled and 377 patients were declared as eligible for the study analysis. We tested subjects for the presence of major ocular symptoms and measured thickness of ganglion cell complex (GCC) using optical coherence tomography. A total of 377 outpatients  were enrolled for analysis, based on the interview-reported prevalence of six eye symptom, as follows: 31.5% for eye fatigue, 19.2% for blurring, 18.6% for dryness, 15.7% for photophobia, 13.5% for irritation, and 4.6% for pain. The macular GCC was significantly thicker in subjects with eye fatigue compared to the group not reporting eye fatigue (103.8\u2009 Eye fatigue can be a serious problem for people of any age. Even in the absence of an ocular disorder, many people feel eye fatigue during intensive and near visual tasks or light exposure, and it is exacerbated in cases of dry eye disease (DED) , 2. Eye This signaling system provides another possible explanation for the protective effects of blue-light shield eyewear against DED-associated and general eye fatigue. Eye closure and darkness are the most effective ways to reduce or avoid eye fatigue through reducing dryness of the ocular surface and relieving the visual load, while shading of blue-light and reducing light scattering are sufficiently effective in reducing eye fatigue \u201327. The Thickness of the retinal nerve fiber layer (NFL), which includes ipRGCs, is now easily measured in eye clinics using optical coherence tomography (OCT), which is noninvasive, rapid, and highly reproducible. NFL thickness has also been used by ophthalmologists to diagnose glaucoma and positively associated with ipRGC activity . FinallyWe therefore hypothesized that ipRGCs might be involved in the development of common ocular symptoms since these cells are associated with both visual and nonvisual responses; however, human data are limited to pupillary responses in retinal degeneration, cataract, and glaucoma, as well as electroretinography findings for glaucoma . This stOutpatients were consecutively recruited to the study from January 2014 to March 2017 from six general eye clinics in Japan. The Institutional Review Boards and Ethics Committees of Shinseikai Toyama Hospital (Permit Number: 150503) and Komoro Kosei General Hospital (Permit Number: 2705) approved this study, and the study was performed in accordance with the principles of the Declaration of Helsinki. Informed consent was obtained from all participants.A total of 1981 patients were initially enrolled during the study period. Following application of the inclusion and exclusion criteria, 254 patients without eye fatigue and 124 patients with eye fatigue were declared as eligible for the study analysis . InclusiR eye drops  were prescribed for the treatment of eye fatigue.None of the patients had undergone any nonmedical interventions, such as punctal plug insertion or punctal occlusion, or any surgical interventions. In six patients, SancobaParticipants were first interviewed regarding major ocular symptoms related to eye fatigue to determine the presence or absence (yes/no) of six common ocular symptoms, namely eye fatigue, blurring, photophobia, pain, dryness, and irritation. These symptoms were selected as the six most prevalent of outpatients visiting the eye clinic of Keio University Hospital in 2012.Board-certified ophthalmologists with specialist expertise in retinal, glaucoma, and corneal disorders submitted all subjects to a routine examination comprising visual acuity and intraocular pressure testing, biomicroscopy with vital corneal staining, and ophthalmoscopy. Examinations were also conducted to exclude DED according to the Asia Dry Eye Society , which dR; Nidek, Gamagori, Japan). After determining the patient's distance refractive correction, the minimal additional power required to achieve near acuity better than 20/25 was measured in 0.25-D increments and recorded as near add power.A blinded examiner measured binocular near add power at a distance of 30\u2009cm using a Bankoku near-acuity chart  or an automatic optometry system , and all OCT imaging was performed using the raster-scan protocol. Data obtained during apparent eye movements, influenced by involuntary blinking or saccade, or with a Signal Strength index < 7 were excluded, as recommended by the manufacturer. The macular ganglion cell complex  + ganglion cell layer (GCL) + inner plexiform layer (IPL)) diameter of 9\u2009mm and the full retinal thickness in the central macular area diameter of 1\u2009mm were analyzed as follows. The fovea was automatically identified as the pixel with the least retinal thickness close to the fixation point, and a square imaging area (9 \u00d7 9\u2009mm) was centered on the fovea. Using software supplied from the manufacturer, the thicknesses of (i) NFL, (ii) GCL +IPL, (iii) internal limiting membrane (INL) + outer plexiform layer (OPL), (iv) ONL + inner segment layer (IS), and (v) outer segment layer (OS) + retinal pigment epithelium (RPE) were exported as a pixel image (512 \u00d7 128 pixels), and the mean thickness values of the whole analysis area  and excluding the optic disc and peripapillary atrophy were calculated.Spectral domain OCT data were obtained using the RS 3000R  with P < 0.05 considered significant.Where appropriate, data are given as the mean \u00b1 SD. We analyzed the data from the right eye for TBUT, Schirmer test, refraction, and the full retinal thickness of whole macula. To identify which ophthalmic parameters were correlated with the six symptoms, regression analysis was performed with potential symptoms including eye fatigue used as dependent variables, while demographic (age and sex) and ophthalmic parameters  were used as independent variables. The regression line was computed for age and left superior macular GCC thickness of subjects with and without eye fatigue by the least-square method. Pearson's correlation coefficient was used as a measure of association between age and left superior macular GCC. The difference in two regression line slopes was analyzed by t-test. All analyses were performed using StatFlexA total of 377 outpatients  were enrolled for analysis. Prevalence of the six symptoms reported by interview was 31.5% for eye fatigue, 19.2% for blurring, 15.7% for photophobia, 18.6% for dryness, 13.5% for irritation, and 4.6% for pain. Before exclusion of suspected DED cases (n = 661) from the cohort , 356 (34P=0.008). The results of comparison of ocular surface parameters and retinal thickness between subjects with and without the other five symptoms are shown in P=0.007), whereas there was no difference for the other symptoms. The full macular thickness was not different between groups.We next compared each parameter between subjects with and without eye fatigue . The oth\u03bcm) than in those without (0.17\u2009\u03bcm) (P = 0.222)  .The present study demonstrated a significant correlation between eye fatigue and thickness of the macular GCC, but not the full macula thickness, suggesting that ipRGCs contained within the GCC could have a role in the development of eye fatigue. In such a scenario, subjects with a thick macular GCC might feel eye fatigue with exposure to blue-light emitting lamps and displays. This analysis thus proposes a unique insight into the pathophysiology of eye fatigue whereby subclinically decreased photoreception and visual function might be involved in developing eye fatigue, potentially accounting for the universal effectiveness of eye closure in relieving eye fatigue. Interestingly, younger subjects with less presbyopia reported more eye fatigue and this might be related to their higher intraocular light transmittance  and thic\u03bcm in the superior hemisphere and 98.57 \u00b1 7.64\u2009\u03bcm in the inferior hemisphere for a Japanese population, while Ooto et al. [\u03bcm/year in Japanese subjects, comparable with our results. The eye fatigue group was statistically 4 years younger, implicating an estimate of 0.68\u2009\u03bcm thickness difference. Thus we speculate that the difference in GCC thickness between the groups was significant, and thus hypothesize that lower amounts of degeneration, edema, and scarring of retinal neurons are implicated in increased GCC volume for patients with eye fatigue.Age-thickness plotting showed a similar annual decrease across the two groups . Kita eto et al.  describeMigraine and eye fatigue share the common symptom of allodynia (photophobia) and thus might be evoked by the trigeminal circuit driven by ipRGC activity. Allodynia in migraine is also evoked by many other triggers including heat and touch. Lack of insular thinning with age was described in female migraineurs compared with nonmigraineurs , while iDryness was also significantly correlated with the macular GCC thickness, despite no significant correlation with a short BUT and the higher Schirmer test results in subjects with eye fatigue. Dryness in such cases is seemingly not due to corneal pathologies and we have no explanation thus far for the correlation with GCC thickness, except that subjects with corneal hyperesthesia can report dryness , 39 evenSubjects with eye fatigue report a wide variety of symptoms including tiredness, focusing difficulty, blurring, brightness, dryness, foreign body sensation, headache, neck and shoulder pain, mental stress, glare, heaviness, and itching , as alsoThis study has some limitations. The present patient population may include subclinical DED even after exclusion of short TBUT and keratoepitheliopathy cases, as it is known that eye fatigue and corneal dryness present heterogeneously and that treatments have varying efficacy, suggesting a complexity beyond simple correlations. Visual acuity corrected with participants' spectacles should have been examined since unsuitable correction is a major cause of eye fatigue. Eye pain should also be further evaluated with a validated questionnaire  and esthesiometers. Of note, the anatomy, physiology, and function of human ipRGCs remain unclear and further studies are needed to determine how ipRGC activity levels might contribute to visual and nonvisual symptoms in humans. The difference in GCC thickness between groups should be further confirmed with quantitative pupillary light reflex measurements by direct measurement of ipRGC function.Eye fatigue was positively associated with thickness of the macular GCC. We thus hypothesize that trigeminal activation might occur in conditions with photophobia/photoallodynia as a presenting symptom of eye fatigue, involving systems that alter melanopsin-based signaling without specification of the originating cell types including retinal, iris, and trigeminal. Nonvisual symptoms might therefore play a role in the development of eye fatigue."}
+{"text": "The potential release of hazardous substances from polymer-based products is currently in the focus of environmental policy. Environmental simulations are applied to expose such products to selected aging conditions and to investigate release processes. Commonly applied aging exposure types such as solar and UV radiation in combination with water contact, corrosive gases, and soil contact as well as expected general effects on polymers and additional ingredients of polymer-based products are described. The release of substances is based on mass-transfer processes to the material surfaces. Experimental approaches to investigate transport processes that are caused by water contact are presented. For tailoring the tests, relevant aging exposure types and release quantification methods must be combined appropriately. Several studies on the release of hazardous substances such as metals, polyaromatic hydrocarbons, flame retardants, antioxidants, and carbon nanotubes from polymers are summarized exemplarily. Differences between natural and artificial exposure tests are discussed and demonstrated for the release of flame retardants from several polymers and for biocides from paints. Requirements and limitations to apply results from short-term artificial environmental exposure tests to predict long-term environmental behavior of polymers are presented. Many materials are exposed to the ambient environment, so that there is a need to understand how such exposure might affect the environment and vice versa. To come up to growing demands, plastics must be optimized using several additives. As long as such additives stay within the materials over the whole life cycle, they do not pose a problem to the environment, even if they are classified as hazardous. Whether, and if so in what quantity, such substances are released into the environment during a product\u2019s service life, depends on the conditions of use. For example, building materials can be exposed to the ambient atmosphere, sunlight, and precipitation, can be in direct contact with soil, or can be submerged in groundwater or marine environments. Government regulatory agencies can be concerned with the release of potentially harmful substances embedded in or on the surface of a material, such as a biocide in paint. Manufacturers, on the other hand, might be interested in the reciprocal impact of environmental exposure on the material itself, which could influence its longevity and/or efficacy. The interface of these two perspectives\u2014how releasing a key component to the environment affects the material and how changes to material properties due to environmental exposure influence the release of a chemical of concern\u2014can also be important. For purposes of this review, we use the term \u201cchemical\u201d to mean a substance that either was added to a material by the manufacturer, is a residual constituent of the manufacturing process, or is a product resulting from transformation of the material upon environmental exposure. From an environmental perspective, such chemicals might be regarded as contaminants, whereas to the manufacturer they may be key ingredients necessary to achieve the desired material properties, unanticipated byproducts of material manufacture, or unavoidable transformation products resulting from normal service in the field.Regulatory agencies often require testing to evaluate the potential environmental impact of a material exposed to the ambient environment. Standardized tests have been developed for such purposes, either by the agency itself or by standardization bodies . In some cases, there might not be a standardized test, but protocols have been developed that are widely adopted. Apart from regulatory constraints, manufacturers concerned about effects of the environment on a particular material or an ingredient in a material can have more freedom to develop de novo tests, though more in the context of research and development than in creating a standard protocol.The development of a standardized test is typically subject to considerable stakeholder involvement, with the aim to optimize relevance while accounting for user concerns regarding time and cost. Although environmental exposures occur over a period of years, testing is by necessity conducted over much shorter time scales. Short-term tests can also be useful to quickly compare the potential impacts on two or more materials.A typical question, then, in developing a standard testing method is how to condense the time frame for a certain type of environmental exposure (such as exposure to ambient precipitation) into a time frame that is both practical and cost-effective. Doing this inherently involves tradeoffs between expediency and the extent to which the resulting test fits the purpose for which it was designed. The results of such tests are the basis for regulatory processes. How to assess the results, e.g., development of criteria for assessment, will not be considered here.Plastics are currently in the focus of environmental policy due to their long-term behavior and therefore to their persistence. Not only do they appear as visible particles in the sea and on the beach, the almost unknown behavior of their additives and the related transformation products are of environmental concern. Therefore, this review focuses on the simulation of the environmental behavior of polymer-based products. Examples of such studies carried out by the authors are given. To our knowledge the combination of environmental exposure of polymer-based products to induce aging processes with the transfer of chemicals to environmental compartments in one experiment is quite rare. We believe that this combination is crucial for a better understanding and risk assessment and is therefore highlighted in this review article.Photochemical, chemical, and biological processes have the potential to transform a chemical in a material into one or more products whose identities and properties might not be known yet, but might be of environmental concern ,2,3 Fig. Such prThe degradation of polymers is a known reason for the release of additives and other chemicals from the material into the environment ,8. For tOften, the release of hazardous substances changes with the aging status of the plastic material. Aging\u2014which is defined as the entirety of irreversible chemical and physical processes within a material over time \u2014can be cFor polymeric systems, weathering exposure causes mainly photochemical aging ,12,13. SThere are several concepts for simulating outdoor weathering effects in artificial laboratory tests; each has specific advantages and disadvantages.2 under wet conditions; under the too-dry Xenon arc conditions, these polyenes remain, noticeable as an unrealistic, strong discoloration . A. A108]. Despite efforts to accelerate the release of a chemical from a material during material testing, there will always be a difference between time scales relevant to actual environmental exposures and the time scale necessary for testing. This might be less important if the test captures the release of most of the chemical over the shorter time scale; in this case, it provides a reasonable estimate of impact, particularly acute impact. If intra-material diffusion governs the rate at which a substance of concern is released; however, the time scale of a test procedure might be too short to estimate environmental impact, depending on the thickness of the material.Short-term tests can provide useful information even if only a small fraction of a substance of interest is released over the duration of the test.It is not common for testing methods to be subject to validation procedures to verify the efficacy of the test relative to actual, longer-term environmental exposures. Leaching tests for soil and waste materials, for example, have been compared with results from field lysimeters operated over longer periods ,113,114,Several laboratory tests have been developed in recent decades to investigate the effects of environmental exposure on the release of possible hazardous substances from polymer-based products. As they can focus only on a single or a limited number of test parameters, artificial environmental exposure tests can show high acceleration factors, but always risk decreasing relevance to reality. Furthermore, acceleration factors are sometimes reached under unrealistic conditions, which may allow different chemical reactions or degradation mechanisms than those observed under natural conditions. In contrast to this, natural environmental tests are close to reality per se, but are very specific regarding the exposure site and time. Especially because they are hardly reproducible even in the same location, much more effort should be made to document all possibly necessary exposure parameters to facilitate the interpretation of results.Both approaches are necessary to assess the release of hazardous substances and are best combined to obtain complementary information, see The artificial environmental exposure tests should be defined based on this knowledge. The test parameter limits should be adapted (within reasonable limits), aiming at accelerated material degradation and maximum release. If the test setup makes it possible to measure both the release during the exposure and the residual concentration within the material after various exposures, mass balances can be established. With useful test durations, the progress of the release, which need not be monotonic, can be followed.Such release progress from artificial environmental exposure tests must be correlated with (long-term) natural environmental tests to get an impression of time scales in natural environment."}
+{"text": "KRAS mutation that was not identified either in ctDNA or tissue biopsy. Furthermore, to assess the exact location of sEV-associated DNA (outside or inside the vesicle), we treated with DNase I sEVs isolated with three different methodologies. We found that the DNA inside the vesicles is only a small fraction of that surrounding the vesicles. Its amount seems to correlate with the total amount of circulating tumor DNA. The results obtained in our experimental setting suggest that integrating ctDNA and sEV-associated DNA in mCRC patient management could provide a complete real-time assessment of the cancer mutation status.It is widely accepted that assessing circular tumor DNA (ctDNA) in the plasma of cancer patients is a promising practice to evaluate somatic mutations from solid tumors noninvasively. Recently, it was reported that isolation of extracellular vesicles improves the detection of mutant DNA from plasma in metastatic patients; however, no consensus on the presence of dsDNA in exosomes has been reached yet. We analyzed small extracellular vesicle (sEV)-associated DNA of eleven metastatic colorectal cancer (mCRC) patients and compared the results obtained by microarray and droplet digital PCR (ddPCR) to those reported on the ctDNA fraction. We detected the same mutations found in tissue biopsies and ctDNA in all samples but, unexpectedly, in one sample, we found a  Circulating tumor DNA (ctDNA) belongs to the pool of the total circulating free-DNA (cfDNA) in blood, but it primarily derives from tumors. ctDNA provides real-time molecular information to monitor treatment response and relapse as it contains genetic alteration of both primary and metastatic lesions, such as point mutations, copy number variations and insertions/deletions. The mechanism of the release of ctDNA is not completely understood; it derives from apoptotic or necrotic cells as well as from living cells through a mechanism of active secretion.It has been demonstrated that tumor cells have to shed a larger number of small extracellular vesicles (sEVs) than normal cells to elude the immune-systems or prepare a metastatic niche . TherefoThe population of sEVs comprises diverse subpopulations  that differ in size, morphology, composition, or biogenic mechanisms .In particular, exosomes are 40\u2013120 nm nanovesicles of endosomal origin secreted by cells into bodily fluids. Their specific cargo  and membrane proteins are a signature that reflects the cell of origin . ExosomeFew and controversial studies have been conducted until now on DNA content in extracellular vesicles and specifically on the class of particles called exosomes.In 2014, Thakur et al. demonstrated for the first time that the majority of DNA associated with tumor exosomes is double-stranded (dsDNA) and represents the whole genomic DNA . SubsequIn the literature, there is no consensus on the presence of dsDNA in exosomes, and the topic is still open for discussion.Our group is actively involved in developing methods to detect point mutation in liquid biopsy ,15,16. TKRAS and BRAF mutations in cell-free circulating and sEV-associated DNA, in particular a higher concentration and fractional abundance is detected in ctDNA.Our data confirm the presence of Surprisingly, we identified in one patient a mutation in the DNA associated with sEVs that was not detected in ctDNA. We hypothesize that mutated sequence in cell free DNA (cfDNA) was not concentrated enough to be revealed by the techniques used for the analysis despite their excellent sensitivity.Moreover, our data confirm a significant reduction in the amount of DNA found in sEVs after treatment with DNase I. In some cases, the drop is so substantial that the DNA detection becomes challenging unless the total amount of circulating DNA is high. A profound analysis of the results provided by the analysis of DNA from different sources proved to be useful.Our results suggest that besides ctDNA, the tumor-derived fragmented DNA in the bloodstream that is not associated with cells, sEV-associated DNA fractions can help to identify and monitor mutations in mCRC patients.Recently, we have introduced a new microarray approach to detect point mutations in the ctDNA of patients with metastatic colorectal cancer . DropletKRAS G12C (patient n. 7), KRAS A146T (patient n. 13), and KRAS G13D (patient n. 14) mutations. In the latter case, as shown in KRAS G13D, in agreement with the results of tissue biopsy and ctDNA analysis, but also the mutation KRAS G12D, which was not detected previously, either in ctDNA or in tissue biopsy  belonging to patient n. 22 were analyzed by ddPCR. Western blotting was used to confirm the presence of EV transmembrane protein (tetraspanins CD63 and CD9) before starting with molecular analysis . We repoThe immunoprecipitation approach we adopted in this work was recently introduced by our group . It is bTo release the sEVs, the DNA-linker is cleaved by DNase I. This immunoprecipitation approach implies that the DNA surrounding the vesicles is removed at the end of the separation. The results of the mutational analysis on exosomes obtained with the three purification methods are reported in To confirm the significant reduction in DNA in the sEVs treated with DNase I, from 294 or 574  to 22 copies, we determined in parallel the content of DNA in sEVs isolated from a plasma sample by ultracentrifugation and precipitation before and after the DNase I treatment and by immunoprecipitation with DNase I sEVs release.BRAF V600E mutation. The supernatant fraction (no DNase I) of the ultra-centrifuged sample were also analyzed in duplicate as reported in DNA extracted from purified sEVs in patient n. 2 was analyzed by ddPCR, specifically looking for the The results in HEK cells\u2019 supernatant were submitted to different treatments  and analyzed by TEM. We used extracellular vesicles derived from HEK cells as a model to prove that the membrane of sEVs submitted to DNase I treatment and inactivation remains intact. EVs from HEK cells are from a sample that is cleaner than the plasma, allowing us to avoid artefacts and contaminations. In the presence of membrane rupture, DNase I, if not correctly inactivated, could degrade the DNA inside the vesicles. The images corresponding to the collected sEVs, untreated, after thermal treatment, and after treatment with the DNase I are reported in Since the DNase I acts only outside the vesicles, we checked for the integrity of the membrane to exclude a potential rupture induced by the different purification steps. The sEVs isolated from EV) per \u00b5m2 to assess if the treatments might have caused a significant reduction in intact sEVs. We analyzed by TEM suspensions of identical initial EV concentration. We calculate the EV density (NEV/\u00b5m) on the TEM grid for each sample obtaining values of 5.1 for the untreated sEVs, 5.2 for thermal treated sEVs and 3.4 NEV/\u00b5m for the sEVs treated with DNase I. Considering that in the last case, the presence of EV agglomerate made the counting process difficult, we can assert that neither the thermal treatment nor the DNase I treatment had a dramatic effect on the EV number.From the TEM characterization, it is evident that the EV morphology was not influenced either by the thermal or by the enzymatic treatments. The size distribution does not change significantly, as reported in sEVs are increasingly used as biomarkers in several types of cancer due to their functional roles in tumorigenesis, metastasis, and invasion . ExosomeRAS and BRAF mutational status to assess the most useful therapeutic treatment. It is widely recognized that genotyping ctDNA in the plasma of cancer patients is a promising practice to evaluate somatic mutations from solid tumors in a non-invasive way. The role of exosome-associated DNA is still debated. Furthermore, in the literature, there is no consensus on the presence of DNA inside the vesicles yet, and the topic is still open for discussion.Recently, it was also reported that plasma isolation of sEVs improves the detection of mutant DNA in metastatic patients . CombiniIn this work, we analyzed by DNA microarray and ddPCR the sEV-associated DNA in the plasma of eleven mCRC patients and compared the results obtained with those reported in a previous analysis on the ctDNA fraction. In all samples, we found the expected mutation with a fractional abundance often lower compared to that retrieved in ctDNA. However, an unexpected result emerged during the study: in a sample out of eleven, we found a mutation that was not previously identified either in ctDNA or in tissue biopsy. This result could suggest that minimally represented mutations could be below the limit of detection of the methodologies used for the analysis of ctDNA. However, enriching the sEV fractions would allow also revealing mutations present in the circulation at low concentration.KRAS and BRAF mutations detection in mCRC patients. The mutations detected in both DNA sources also coincide in samples with a low fractional abundance. Moreover, sEV-associated DNA represents an enriched source of tumoral DNA providing more complete information on all the mutations present in the plasma of a tumor patient, as in the case of one of the samples investigated in our study.The results of our investigation demonstrate that sEV-associated DNA in plasma can be used as a DNA source for However, the findings on the DNA fraction inside sEVs are less conclusive. It would be extremely important to unequivocally demonstrate that the DNA exists in two forms: externally associated to sEVs, and as cargo. This because DNA inside an EV could have a different role due to its active release from cells instead of a release by apoptosis or necrosis.To determine if the sEV-associated DNA was outside or inside to the vesicles and to exclude contamination from the ctDNA fraction, we treated one of the samples . When the ctDNA concentration and the mutation fractional abundance are high in plasma and the method used for the mutational analysis is extremely sensitive, as in the case of ddPCR, it is possible to discriminate two fractions of sEV-associated DNA  were stored at \u221280 \u00b0C until successive analysis. We avoided thawing the same sample several times and used only the plasma volume necessary for each analysis, leaving the other aliquots untouched at \u221280 \u00b0C. All subjects gave their informed consent for inclusion before they participated in the study. The study was conducted in accordance with the Declaration of Helsinki, and the protocol was approved by the Institutional Review Board of the San Raffaele Hospital (ctDNA/2017). The clinical data were collected and previously reported .TM at 150,000\u00d7 g for 120 min at 4 \u00b0C with a TLA-55 Rotor  to pellet sEVs, mostly exosomes. After careful removal of the supernatant, the sEV-containing pellet was resuspended with PBS (50 \u03bcL) and the DNA was extracted.One milliliter of plasma (or 250 \u03bcL for the experiment with the DNase I treatment) was diluted 1:1 with PBS, and then was filtered with 0.22 mm filters  and centrifuged in a Optima\u2122 TLX Preparative Ultracentrifuge, Beckman CoulterTwo hundred and fifty microliters of plasma were diluted 1:1 with PBS then filtered with 0.22 mm filters . Subsequently, the exosomes were isolated using the kit \u201cExosome Precipitation Solution\u201d by Macherey-Nagel according to the manufacturer\u2019s instructions.sEVs were immuno-captured on DNA-directed antiCD63. Immobilization of antibodies through a DNA-linker improves the capture efficiency, increasing the probe flexibility. Additionally, the DNA linker can be cleaved using DNase I, enabling the release of extracellular vesicles under mild conditions. The synthesis of ssDNA-antiCD63 conjugate and the DNA sequences used for immunoprecipitation of sEVs are described in .DNA tagged antibodies were immobilized on the surface of magnetic beads and used to immunocapture sEVs. Prior to their use, streptavidin-coated magnetic beads  were washed three times with binding and washing buffer  according to the manufacturer\u2019s protocol. Then, 500 \u00b5g of beads were added to 100 \u00b5L of 1\u00b5M biotinylated ssDNA-Probe solution. The suspension was stirred for 30 min at 23 \u00b0C, then the solution was removed, and the beads were washed twice with B&W buffer, then once with PBS.Oligonucleotide modified beads (500 \u00b5g) were incubated with 100 \u00b5L of ssDNA-antiCD63 antibody (160 \u00b5g/mL) for 1h at 25 \u00b0C, then the solution was removed, and the beads were washed twice in PBS.2 and 130 \u00b5M CaCl2. At the end of the incubation, which was performed at 37 \u00b0C for 1 h under stirring, the beads were separated using a magnetic stand and the buffer was recovered and used in subsequent analysis.DNA-directed ssDNA-antiCD63 functionalized magnetic beads (500 \u00b5g) were incubated with 250 \u00b5L of plasma. After 2.5 h of incubation at room temperature under stirring, the supernatant was removed, and the beads were washed twice with PBS. Then beads were incubated with 50 \u00b5L of 250 mKunitz/\u00b5L solution of DNase I from bovine pancreas in 10 mM Tris/HCl, pH 7.5 buffer, containing 5 mM MgCl\u00ae RSC ccfDNA Plasma Kit (AS1480) and eluted with 60 \u03bcL of Elution Buffer.Exosomal DNA was extracted using the Maxwell RSC instrumentation  combined with the MaxwellFor the experiment performed with DNAse treatment, 250 \u03bcL of plasma were used for the isolation of sEVs, as reported above. EV pellets was resuspended in a digestion mix containing 40 \u03bcL of PBS, 5 \u03bcL of RQ1 RNase-free DNase I, and 5 \u03bcL of RQ1 RNase-free DNase I Reaction Buffer , and incubated for 30\u2032 at 37 \u00b0C. After incubation, the DNase I activity was blocked by adding 5 \u03bcL of RQ1 DNase I Stop Solution and samples were heated at 65 \u00b0C for 10 min to inactivate the enzyme before further analysis.KRAS codon 12, 13, 146 and BRAF codon 600, were amplified using 5\u2032-biotin forward and 5\u2032-tagged reverse primers. The PCRs were performed in 50 \u00b5L solutions containing 15 \u00b5L of DNA extracted from purified exosomes, 200 \u00b5M deoxynucleotide triphosphates, 10 mM Tris\u2013HCl (pH 8.3), 50 mM KCl, 1.5 mM MgCl2, 1.3 U of DNA polymerase  and 20 pmoles of each primer.The DNA sequences encompassing the most frequent mutations of Cycling conditions were as follows: 95 \u00b0C for 4 min; 47 cycles at 95 \u00b0C for 30 s, 58 \u00b0C for 30 s, 72 \u00b0C for 30 s and finally 72 \u00b0C for 10 min.Detailed descriptions of the silicon chips coating, the preparation of the microarray and the hybridization assay along with image-scanning and data analysis steps were previously provided in .We employed the QX100\u2122 Droplet Digital\u2122 PCR System . Eight microliters of eluted exosomal DNA were mixed with primers and fluorophore labeled commercial probes  specific for each of the mutations analyzed as previously reported . The fraHuman embryonic kidney HEK293 cells were cultured in DMEM  supplemented with 10% FBS, 2 mM L-glutamine and antibiotics (100 U/mL penicillin and 100 \u03bcg/mL streptomycine-sulphate). Cells were grown in incubation at 37 \u00b0C under 5% CO2 for maintenance.TM WX Ultracentrifuge  at 150,000\u00d7 g for 2 h at 4 \u00b0C with a SureSpinTM 630 swinging bucket rotor (ThermoFisher Scientific) to pellet EV. After supernatant was carefully removed, the EV-containing pellet was resuspended in PBS and stored at \u221280 \u00b0C until use.Three-day-conditioned media from HEK cells cultured in exosome-depleted medium were harvested and centrifuged at 300 g for 25 min. Supernatants were filtered with 0.22 \u00b5m filters  and centrifuged in a SorvallThe isolated sEVs were aliquoted and submitted to three different protocols. Thirty micrograms of sEVs were treated with 1 \u03bcL of DNase I, 1 \u03bcL of reaction buffer and then incubated and heated as described above for the DNase I treatment procedure. As a control, thirty micrograms of sEVs were treated in same way, excepted the supplementation of DNase I and heated at 65 \u00b0C for 10 min to consider the thermal effect on isolated sEVs , while the last aliquot of exosomes remained untreated and used as control.w/v) skimmed milk in T-TBS .Isolated EVs were resuspended in non-reducing Laemmli buffer and boiled for 5 min at 95 \u00b0C. Proteins were resolved by SDS-PAGE on the basis of an equivalent quantity of proteins per lane and electrotransferred onto a nitrocellulose membrane. Nonspecific sites were blocked with 5%  and mouse anti-CD63 , After washing with T-TBS, membranes were incubated with goat anti-mouse  IgG conjugated to horse-radish peroxidase for 1 h. Positive immunoreactive bands were detected by the enhanced chemiluminescence method .sEV samples obtained with different separation approaches were analyzed using Nanosight NS300 . Videos were analyzed by the in-built NanoSight Software NTA 3.2 Dev Build 3.2.16. The camera type, camera level, and detection threshold were sCMOS, 14, and 4, respectively. The number of completed tracks in NTA measurements was 5 (a 60 s movie was registered for each measurement). Sample was diluted in PBS to a final volume of 1 mL. The ideal concentration was assessed by pre-testing the optimal particle per frame value (20\u2013100 particles per frame).The TEM images were collected through ZEISS Libra 200 FE 200 kV equipped with Omega filter in column. The samples were prepared by dropping the EV suspension on a TEM grid covered with formvar/carbon film. After blotting with filter paper, the samples were negative stained using UranyLess (EMS-Electron Microscopy Science) . The EV"}
+{"text": "Pygathrix nigripes, and analysed its phylogenetic status. The circular mitogenome was 16,534\u2009bp in length, and contained 13 protein-coding genes (PCGs), two rRNA genes, 22 tRNA genes and one non-coding control region (D-loop). These genes except ND6 and 8 tRNA genes were encoded on the H-strand. The phylogenetic analysis exhibited that our sequence formed a sister branch with P. cinereal and P. nemaeus of genus Pygathrix, which showed a closer genetic relationship of the three species. These information contribute to molecular, phylogenetic studies and genetic diversity conservation for this species.In this study, we first characterized the complete mitogenome of  Pygathrix nigripes), taxonomically affiliated to the subfamily Colobinae in the family Cercopithecidae , and it was returned to the zoology lab and stored at \u221280\u2009\u00b0C in Sichuan Agricultural University. Genomic DNA was extracted by phenol-chloroform extraction method  was 16,534\u2009bp, including 13 PCGs, two rRNA genes (12S rRNA and 16S rRNA), 22 tRNA genes and one control region (D-loop). Genes encoding on the genome were similar among all primates  as an outgroup (P. cinereal and P. nemaeus of genus Pygathrix, which showed a closer genetic relationship of the three species. Furthermore, the homology of 13PCGs between P. nigripes with P. nemaeus, P. cinereal is 92.75%, 92.51%, respectively, while 98.97% between P. cinereal and P. nemaeus, it suggested that P. cinereal and P. nemaeus have a closer genetic relationship. The result is in line with the topology of phylogenetic tree. This study provides new and comprehensive insight into the evolutionary and biogeographic history of this species, and contributes additional molecular information to species conservation.Phylogenetic analysis included mitogenome of outgroup . The nei"}
+{"text": "HEP21) was chosen as the candidate gene to conduct following experiment. The variations in HEP21 were screened and association analyses between rs315156783 and reproductive traits were investigated in fifth-generation Ningdu Yellow chickens from a closely bred population. These results demonstrated that HEP21 is a candidate gene for sexual maturity and ovary development in chickens. However, the underlying mechanism of how HEP21 regulates chicken sexual maturity needs further focused studies.Chicken meat and egg productions are essential for human beings. Sexual maturity is important for both egg production and meat flavor. It is necessary to elucidate the genetic mechanism of chicken sexual maturity. In current study, we used digital gene expression (DGE) RNA-sequencing analysis to investigate differential expression of genes in pre-pubertal and post-pubertal ovaries in two different sub-breeds of chicken with different onsets of sexual maturity. After the analysis of RNA-sequencing data, numerous differentially expressed genes were found in both comparisons  vs. 103 day old early-sexual-maturity laying hens (P-F-O2), and 32 day old late-sexual-maturity pre-laying hens (L-F-O1) vs. 153 day old late-sexual-maturity pre-laying hens (L-F-O2)). With the bioinformatic analysis, hen egg protein 21 kDa (GH), integrin subunit beta 3 (ITGB3), thyroid stimulating hormone subunit beta (TSHB), prolactin (PRL), and transforming growth factor beta 3 (TGFB3), play indispensable roles in sexual maturity. As a gene unique to poultry, hen egg protein 21 kDa (HEP21) was chosen as the candidate gene. Differential expression and association analyses were performed. RNA-seq data and qPCR showed that HEP21 was significantly differentially expressed in pre-pubertal and pubertal ovaries. A total of 23 variations were detected in HEP21. Association analyses of single nucleotide polymorphisms (SNPs) in HEP21 and reproductive traits showed that rs315156783 was significantly related to comb height at 84 and 91 days. These results indicate that HEP21 is a candidate gene for sexual maturity in chickens. Our results contribute to a more comprehensive understanding of sexual maturity and reproduction in chickens.The age of onset of sexual maturity is an important reproductive trait in chickens. In this study, we explored candidate genes associated with sexual maturity and ovary development in chickens. We performed DGE RNA-sequencing analyses of ovaries of pre-laying  and laying  hens of two sub-breeds of Ningdu Yellow chicken. A total of 3197 genes were identified in the two comparisons, and 966 and 1860 genes were detected exclusively in comparisons of P-F-O1 vs. P-F-O2 and L-F-O1 vs. L-F-O2, respectively. Gene ontology (GO) and Kyoto Encyclopedia of Genes and Genomes (KEGG) enrichment analyses showed that genes involved in transmembrane signaling receptor activity, cell adhesion, developmental processes, the neuroactive ligand\u2013receptor interaction pathway, and the calcium signaling pathway were enriched in both comparisons. Genes on these pathways, including growth hormone ( In animals, sexual maturity is accompanied by aging, changes in tissue morphology, increased body weight, and reproductive competence . OvariesChickens are a common domesticated animal with the largest breeding stock, and are gradually becoming the most important model in poultry research. The age of onset of sexual maturity is an important reproductive trait in chickens. Sexual maturity in chickens is associated with body weight ,7. In ChIn the present study, we used digital gene expression (DGE) RNA-sequencing analysis to investigate differential expression of genes in pre-pubertal and post-pubertal ovaries in two different sub-breeds of chickens with different onsets of sexual maturity. The Ningdu Yellow chicken is a Chinese breed characterized by early sexual maturity and meat with good flavor. This breed has been used for studies on reproductive traits in chickens, such as egg production and broodiness ,12. AfteThe animal experiments in this study complied with the ethical standards and regulations of Jiangxi Agricultural University (JXAULL-2017002). Effort was made to minimize the suffering of the chickens.Two sub-breeds of Ningdu Yellow chicken with different onsets of sexual maturity, provided by the College of Animal Science and Technology, Jiangxi Agricultural University, Nanchang, China, were used for the DGE RNA-seq in this study. Briefly, all chickens had free access to water and were fed a standard diet. Four groups of birds were used: 32 day old early-sexual-maturity pre-laying hens (P-F-O1), 103 day old early-sexual-maturity laying hens (P-F-O2), 32 day old late-sexual-maturity pre-laying hens (L-F-O1), and 153 day old late-sexual-maturity pre-laying hens (L-F-O2). All chickens were sacrificed and their ovaries were collected, quick-frozen in liquid nitrogen, and stored at \u221280 \u00b0C until RNA extraction.To validate the differentially expressed gene from DGE sequencing, a dozen 143 day old Baier Yellow chickens\u2014that is, six pre-laying hens and six laying hens\u2014from the Baier Yellow Chicken Breeding Farm, Shangrao, China were also used. Hens were sacrificed painlessly and their ovaries were collected, frozen in liquid nitrogen, and kept at \u221280 \u00b0C.Fifth-generation Ningdu Yellow chickens from a closely bred population from Guangdong Wens Foodstuff Company, Guangdong, China, were used to analyze associations between SNPs and reproductive traits. All birds were fed and immunized following the standard procedure of Guangdong Wens Foodstuff Company. After rearing, chickens were raised individually, and all egg production and reproductive traits were recorded, including age at first egg; body weight and comb height (measuring the distance from the root of comb to the peak of the highest sawtooth of the comb) at 77, 84, and 91 days; weight of first egg; and the total egg amount from the age at first egg to 300 days old. Samples of genomic DNA, which were used for genotyping and association analyses, were extracted from EDTA-anticoagulated blood samples of 1300 hens.We extracted total RNA from the ovaries of chickens using Trizol reagent  according to the manufacturer\u2019s instructions. We evaluated RNA degradation by loading on 1% agarose gels. The concentration and quality of all RNA samples were examined with a NanoDrop 2000 spectrophotometer . All samples were kept at \u221280 \u00b0C.Subsequently, five ovary RNA libraries of the same group were mixed in equal amounts. Four pooled samples  were produced in this way and then sent to Shanghai Majorbio Bio-Pharm Biotechnology  for DGE RNA sequencing. Briefly, cDNA libraries were prepared based on Illumina\u2019s protocols, and each library was sequenced with the Illumina Hiseq 2000  to obtain paired-end 21 bp reads. The rest of the cDNA libraries were stored at \u221280 \u00b0C for qPCR validation of differential gene expression.https://github.com/jstjohn/SeqPrep) and Sickle (https://github.com/najoshi/sickle) to remove reads containing adapters, unknown bases, and low-quality bases to obtain high-quality reads. We then used TopHat (http://tophat.cbcb.umd.edu/) to align the clean reads with the chicken reference genome Gallus_gallus-4.0/galGal4 . Based on the mapped reads, genes were annotated, and the expression of all genes was calculated using fragments per kilobase of transcript per million (FPKM) mapped reads. We analyzed the differential expression of P-F-O1 and P-F-O2 and of L-F-O1 and L-F-O2 using Cuffdiff (http://cufflinks.cbcb.umd.edu/); genes with greater than two-fold changes between the two samples (FPKM \u2265 0.3 and |log2FC| \u2265 1) or p < 0.05 were considered differentially expressed. We calculated the false discovery rate to judge the significance of the difference in gene expression. Using Goatools (https://github.com/tanghaibao/GOatools), we subjected all expressed genes to GO analysis with Bonferroni-adjusted p < 0.05. Using KOBAS (http://kobas.cbi.pku.edu.cn/home.do), we performed KEGG pathway enrichment analyses of all differentially expressed genes (pathways with p < 0.05 were considered significantly enriched).All sequencing data were submitted to the Gene Expression Omnibus with accession number GSE136329. For raw data from RNA sequencing, we used SeqPrep  and synthesized with Sangon . Details on all primers used in this study are shown in We reverse-transcribed the total RNA extracted from ovaries using the Primescript RT reagent kit with gDNA eraser  with a random primer, per the manufacturer\u2019s instruction. We then diluted synthesized cDNA in RNase-free water at a ratio of 1:4. Relative mRNA expression was detected by qRT-PCR using SsoFast EvaGreen Supermix . The \u03b2-actin gene was used as an internal control. qRT-PCR was performed on a CFX96 system (Bio-Rad) in a total volume of 20 \u00b5L:10 \u00b5L SsoFast EvaGreen Supermix, 0.5 \u00b5L each primer (10 \u00b5M), 8.0 \u00b5L RNase-free water, and 1 \u00b5L cDNA. The PCR procedures were as follows: 39 cycles at 94 \u00b0C for 2 min, 94 \u00b0C for 15 s, and Tm \u00b0C for 30 s; fluorescence was then determined at 65 \u00b0C to 95 \u00b0C. Each sample was examined in triplicate, and the expression fold was calculated using the comparative 2HEP21 (NCBI accession number: NM_204521.2) in Genbank, primers P1 to P5 were used to amplify HEP21. Twenty samples of genomic DNA from fifth-generation Ningdu Yellow chicken were used to identify variations in HEP21 by direct sequencing. We analyzed sequences using DNASTAR (http://www.dnastar.com). Variations that occurred more than twice were regarded as mutations. The SNP rs315156783 was recognized by the restriction enzyme Kpn I. Primer P6 was used for subsequent association analyses of fifth-generation Ningdu Yellow chickens by polymerase chain reaction/restriction fragment length polymorphism (PCR-RFLP). All PCR products were digested by Kpn I  at 37 \u00b0C over 2 h and then loaded on 1.5% agarose gels for genotyping. Association analyses of rs315156783 and reproductive traits were conducted with SAS 9.0  with the following general linear model.Y represents the trait\u2019s phenotypic value, \u03bc represents the overall population mean, G represents the fixed effect of genotype, D represents the random effect of dam, H represents the fixed effect of hatch, and e represents the random residual.Based on the sequence of In this study, four libraries, P-F-O1, P-F-O2, L-F-O1, and L-F-O2, were constructed for RNA sequencing. After sequencing, more than 8 million reads were obtained from each sample. As shown in To analyze differential gene expression in P-F-O1 and P-F-O2 (P-F-O1 vs. P-F-O2) and in L-F-O1 and L-F-O2 (L-F-O1 vs. L-F-O2), we compared the expression profiles of each group using a Poisson distribution model. The results showed that 5083 genes were differentially expressed in P-F-O1 vs. P-F-O2: 2895 were upregulated and 2188 were downregulated , inhibin subunit alpha (INHA), inhibin subunit beta A (INHBA), and prostaglandin-endoperoxide synthase 1 (PTGS1). The expression of the selected genes was in concordance with the results of sequencing in terms of the fold changes and the directions in each comparison (BMP5) and bone morphogenetic protein 15 (BMP15)\u2014from early sexual maturity and SRY-Box 14 (SOX14) from late sexual maturity were also chosen for qPCR to validate the results of sequencing, as these genes play crucial roles in ovary development and sex determination, respectively [BMP5 and BMP15 was in agreement with the results of RNA sequencing . A total of 151 GO terms were identified, including 101 in P-F-O1 vs. P-F-O2, 123 in L-F-O1 vs. L-F-O2, and 73 in both comparisons  but was not significantly associated with body weight at 77 days, body weight at 84 days, body weight at 91 days, comb height at 77 days, amount of eggs at 300 days, age at first egg, or weight of first egg , E74 is a prognostic marker of ovarian cancer and can suppress the proliferation of ovarian cancer cells [ADORA1) plays a role in fertilization by blocking adenylyl cyclase, and genome-wide transcriptome analysis has shown that ADORA1 is a candidate gene for sexual precocity in goats [CRHR1), platelet activating factor receptor (PTAFR), and 5-hydroxytryptamine receptor 4 (HTR4) are all highly expressed in ovaries, are involved in proliferation and apoptosis of ovarian cells, and play important roles in the development of the ovaries [A large number of differentially expressed genes were identified, and several GO terms and pathways were enriched in the present study. GO analyses showed that the differentially expressed genes were enriched in single-multicellular organisms, multicellular organisms, single organisms, and developmental processes associated with cell metabolism and tissue development. Some key genes in these groups may play crucial roles in ovary development. Like ETS transcription factor 3 , bone morphogenetic protein 3 (BMP3), and BMP binding endothelial regulator (BMPER) were identified in both comparisons; BMP5 and BMP15 were detected in P-F-O1 vs. P-F-O2 only (BMP6), a regulator associated with the formation and secretion of steroid hormones, can interact with melatonin [BMP5 and BMP15 were differentially expressed in P-F-O1 vs. P-F-O2 in the RNA-seq data but were significantly differentially expressed in both comparisons in qPCR validation. The results suggest that BMP5 and BMP15 might have strong effects on puberty and reproduction in chickens. INHA and INHBA have been implicated in regulating cell proliferation and hormone secretion and have been identified as candidate genes for abnormal ovarian development in female humans [INHA and INHBA have indispensable functional roles in the recruitment and ordered progression of follicles in avian ovary development [Of the differentially expressed genes, bone morphogenetic protein 2 (-O2 only . The bonelatonin ,39. Moreelatonin ,41. In te humans ,43,44. Telopment ,46. Our HEP21 was significantly differentially expressed in pre-pubertal and pubertal ovaries, which suggests that HEP21 might play a crucial role in ovary development and the onset of puberty in chickens. Association analyses of SNPs in HEP21 and reproductive traits showed that rs315156783 was significantly related to comb height at 84 and 91 days. Comb mass, which is an important reproductive trait, is a secondary sexual characteristic of chicken and associated with sexual maturity and reproduction in chickens [HEP21, a member of the uPAR/Ly6 protein superfamily, was first identified in 2003 and secreted into egg white . HEP21 ichickens . rs31515HEP21, INHA, INHBA, RRH, BMP5, BMP15, GH, ITGB3, TSHB, and TGFB3 may play important roles in sexual maturity in chickens. Association analyses demonstrated that HEP21 is a candidate gene for sexual maturity. Our results contribute to a more comprehensive understanding of sexual maturity and reproduction in chickens.Collectively, these results provide a comprehensive transcriptome analysis of the ovaries of pre-laying and laying hens."}
+{"text": "Duzhong Butiansu (DZBTS) prescription contains many traditional Chinese medicines and has been shown to have a curative effect on male fertility. However, the efficacy and mechanism of DZBTS in the treatment of male infertility induced by heat stress have not been reported. The aim of the present study is to elucidate the effect and mechanism of DZBTS on spermatogenic function of a heat stress model in rats.  Male Wistar rats (280\u2013320\u2009g) were given different doses of DZBTS (0.4853\u2009g/kg/d or 0.9707\u2009g/kg/d), Shengjing capsule (0.56\u2009g/kg/d), or double distilled water for 15 days. A 43\u00b0C hot water bath for 30 minutes was used to stimulate the testis of rats. Sperm count, sperm motility, the organ index of kidney and gonadal organs, serum sex hormone levels, and serum oxidising reaction index were measured. Haematoxylin and eosin (HE) staining was used to observe the morphology of the testis and kidney. The expression of Hsp70 in testes was observed by immunofluorescence. The changes in heat stress, reproductive-related protein, and mRNA were measured by western blot assay and RT-qPCR. P < 0.05 or P < 0.05 or P < 0.05 or P < 0.05 or P < 0.05 or P < 0.05 or P < 0.05 or  Heat stress downregulated the levels of sex hormone ( Our results for the first time have found that DZBTS can improve spermatogenesis disorder in a heat stress model in rats, which may be mainly by regulating AR, sperm regulatory protein CREB1, and the HSF/Hsp70 signaling pathway to decrease oxidative stress. Heat stress response (HSR) refers to the stress reaction of the body in a high-temperature environment. It has been found that the mechanism of temperature regulation in the male scrotum in high-temperature environments will be damaged, resulting in compromised sperm quality and viability . Some stEucommia ulmoides Oliv., Cuscuta australis R. Br., Cistanche deserticola Y. C. Ma, Epimedium brevicomu Maxim., and other traditional Chinese medicines for tonifying the kidneys and reinforcing yang [Angelica sinensis (Oliv.) Diels., Rehmannia glutinosa Libosch., Dioscorea opposita Thunb., and other traditional Chinese medicines for tonifying the blood and qi [Pharmaceutical Standards of the Ministry of Health of the People's Republic of China Traditional Chinese medicine prescription (Volume 12). The traditional Chinese medicine prescription, which works by tonifying the kidneys and reinforcing yang and tonifying the blood and qi, has a therapeutic effect on sperm dysfunction [Cuscuta australis R. Br. [Morinda officinalis How [Epimedium brevicomu Maxim [Duzhong Butiansu (DZBTS) prescription, which has been approved by the China Food and Drug Administration (license number: YBZ13402009), contains function  and contfunction , Shugan n Volume . The trafunction . The thes R. Br. , Morindaalis How , and Epimu Maxim . After nSeven-week-old male (280\u2013320\u2009g) Wistar rats (SPF) were purchased from Beijing Vital River Laboratory Animal Technology Co., Ltd. The animal license number was SCXK (Beijing) 2016-0006. The rats had free access to rodent chow and drinking water in the SPF grade animal facilities with 23\u00b0C\u2009\u00b1\u20092\u00b0C temperature and a 12-hour light/dark cycle. The experiment was approved by the Animal Ethics Committee of Henan University of Chinese Medicine.Nelumbo nucifera Gaertn. and Dioscorea opposita Thunb. were ground to a fine powder. Water was added six times into Citrus reticulata Blanco and Amomum villosum Lour., and these were extracted for 3 hours to obtain the volatile oil. Water was added into the dregs, Eucommia ulmoides Oliv., and other herbs, 12 times, and they were boiled twice for 1.5 hours each time. The decoction was concentrated to a relative density of 1.5 to 1.18 and then cooled. Ethanol was added to the decoction in the amount of 1.5 times, followed by stirring evenly and setting overnight. Ethanol in the supernatant was recovered. The liquid was concentrated to a relative density of approximately 1.30. The fine powder of Nelumbo nucifera Gaertn. and Dioscorea opposita Thunb. was added. The mixture was mixed, dried, and crushed. The volatile oil was sprayed into the mixture and mixed. SJc was provided by Zunyi Liaoyuanhetang Pharmaceutical Co., Ltd. All drugs were dissolved with distilled water.The DZBTS was provided by Guizhou Hanfang Pharmaceutical Co., Ltd. The prescription has been approved by the China Food and Drug Administration, license number: YBZ13402009. n\u2009=\u200911), model group , positive control Shengjing capsule (0.56\u2009g/kg/d) group , DZBTS low-dose group , and high-dose group . The rats in each group were given 10\u2009mL/kg of medicine soup by gavage once a day for 15 days. The normal control group and the model group were given the same dose of double-steamed water.The male Wistar rats were divided into five groups according to their body weight: normal control group  was injected intraperitoneally (40\u2009mg/kg body weight). The rats were fixed, and the testes were placed in a water bath at 43\u00b0C for local heat stress (30\u2009min) to establish the thermal stimulation model. After the model was established, the blood was taken immediately from the abdominal aorta. The kidneys, testes, and epididymis were weighed. One kidney and testis were immersed in formalin; the other epididymis was immediately evaluated for sperm quality. The kidney, testis, and epididymis were weighed and then frozen in liquid nitrogen and stored at \u221280\u00b0C.The kidney and testis were soaked in formalin for 2 days, and then paraffin sections were prepared and stained by HE staining. The HE solution is alkaline, which causes the chromatin in the nucleus and the nucleic acid in cytoplasm to be purple-blue. Eosin is an acid dye, which mainly causes the components in the cytoplasm and the extracellular matrix to be red. The changes in the testis and kidney tissue structure were observed. At the same time, the effect of DZBTS on the pathological changes of the testes and kidneys in heat stress rats was evaluated.\u03bcm filter membrane  with 4\u2009mL of saline. Next, 20\u2009\u03bcL of the filtrate was dropped onto the slide, and the sperm motility was evaluated on the sperm quality analyser. Another 100\u2009\u03bcL of filtrate was added to 5\u2009mL 5% NaHCO3 for fixation, and 20\u2009\u03bcL of fixed solution was used to count the sperm.The epididymis was taken from one side and added to 1\u2009mL of saline. After shredding, the epididymis was incubated at 37\u00b0C for 8 minutes and then filtered by a 70-E2) and testosterone (T) in the serum of rats were determined by the competitive method . Samples or standard samples, horseradish peroxidase-labelled antibodies, and anti-antibodies were added to form complexes with the secondary antibodies on the carrier to colour and detect OD values. The activity of superoxide dismutase (SOD) was determined by the WST-1  method. WST-1 was reduced to purple dye, and this reaction was inhibited by SOD. The content of malondialdehyde (MDA) was determined by TBA (thiobarbituric acid). MDA in lipid peroxide degradation products can be condensed with TBA to form red products. GSH-Px (glutathione peroxidase) promoted the oxidation of GSH, and GSH reacted with dithiodidinitro benzoic acid to form yellow. Finally, the enzyme activity of SOD and GSH-Px and the content of MDA were calculated by colourimetric analysis .The blood samples of rats in each group were centrifuged for 10 minutes at 3000\u2009rpm and 4\u00b0C, and the serum was obtained. The enzyme-linked immunosorbent assay  double-antibody sandwich method was used to detect the binding of the rat follicle-stimulating hormone (FSH) and rat luteinizing hormone (LH). The sample or standard was added and bound to the corresponding antibody on the carrier. Then, the biotinylated antibody was added and bound specifically to the antigen, which was tested on the carrier. Horseradish peroxidase-labelled avidin and biotin were specifically combined to form an immune complex, which developed a colour and detected the optical density (OD) value. The levels of estradiol  instruction, the gel of the target protein was retained. When the PVDF membrane  was activated with anhydrous ethanol, the membrane was infiltrated in the transposed solution. Imprinted with the protein by the semidry method, the PVDF membrane was rinsed by PBS  and then sealed in 5% skimmed milk powder for 1 hour. The androgen receptor rabbit antibody , CREB1 rabbit antibody , HSF1 rabbit antibody , Hsp70 mouse antibody , and \u03b2-actin mouse antibody  were incubated overnight at 4\u00b0C. The PVDF membrane was washed by PBST for 5 times and then put in the IRDye\u00ae 680 RD Goat anti-Rabbit  and IRDye\u00ae 800CW Goat anti-Mouse  for 1 hour. Next, the membrane was cleaned by PBST for 3 times. The ODYSSEY CLx double infrared laser imaging system was used to analyse the protein bands at 680\u2009nm and 800\u2009nm, and the protein expression was analysed according to the fluorescence intensity.PMSF (phenylmethanesulfonyl fluoride) and RIPA (radio immunoprecipitation assay) lysis buffer  were added to the testes of each group of rats. These homogenates were centrifuged for 5 minutes at 4\u00b0C, 12000\u2009g. The supernatant was extracted, and the protein was quantified by BCA Protein Assay Kit . The supernatant was diluted with the 5\u00d7 loading buffer according to the volume ratio of 4\u2009:\u20091, and the sample concentration of each group was 60\u2009Lysate was added to the 100\u2009mg testis of rats in each group. The RNA was extracted with a total RNA extraction kit . The extracted samples were detected by a limited protein accounting analyser, and the RNA was reversed to cDNA by the Hiscript \u0399\u0399 1st Strand cDNA Synthesis Kit . Finally, the QuantiNova\u2122 SYBR Green PCR Kit  was used to detect the fluorescence quantitative PCR (qPCR) .P < 0.05 or P < 0.01 was considered to be statistically significant.The data were analysed by SPSS 18.0 software, and the data were expressed in the form of mean\u2009\u00b1\u2009standard deviation (SD). Single-factor analysis of variance (ANOVA) was used to compare the differences between groups. The statistically significant differences between groups were determined by one-way ANOVA. Heat stress is a physical factor, and immersion time is short; thus, there is no significant change in the organ index, but the trend of testicular change has already appeared. After heat stress, the visceral coefficients of the kidney, epididymis, and testis of rats decreased and there was a tendency to improve the organ coefficient of testis after administration of DZBTS. The results suggest that DZBTS may have a tendency to improve the testis of heat stress rats .P < 0.01), whereas DZBTS significantly increased the concentration and motility of sperm (P < 0.01). This suggested that DZBTS could significantly reduce the damage of spermatogenic function induced by heat stress , and DZBTS could increase the level of sex hormone (P < 0.05 or P < 0.01). The results indicated that DZBTS could upregulate the level of sex hormone in heat stress rats and improve its spermatogenic function (Heat stress decreased the level of function .P < 0.05 or P < 0.01). After administration of DZBTS, the enzyme activity of SOD and GSH-Px in serum was increased (P < 0.05 or P < 0.01) and the content of MDA in serum was decreased (P < 0.01). This indicated that DZBTS could reduce oxidative damage induced by heat stress in rats (Heat stress could decrease the enzyme activity of SOD and GSH-Px and increase the content of MDA in the serum of model rats ( in rats .As shown in As shown in P < 0.01) which was involved in spermatogenesis. Meanwhile, the expression of the AR protein was decreased (P < 0.01). Then, the binding rate of T to its receptor (AR) became lower, and the production of sperm was reduced. Heat stress could upregulate the expression of the HSF1 protein (P < 0.05 or P < 0.01) and then affect the HSF1/Hsp70 protein pathway. DZBTS could reverse the decrease of CREB1 and AR expression (P < 0.05 or P < 0.01) and increase the receptor action rate. DZBTS could also inhibit the activation of the HSF1/Hsp70 pathway (P < 0.01) and reduce the oxidative damage of spermatozoa. These results suggest that DZBTS may reverse the damage of seminiferous function induced by heat stress by regulating the CREB1, AR, and the HSF1/Hsp70 signaling pathway (Heat stress downregulated the levels of the CREB1 protein ( pathway .P < 0.01), and DZBTS could significantly reduce the expression of Hsp70 (P < 0.01). It was further verified that DZBTS may improve spermatogenic function of heat stress rats by regulating the expression of heat shock proteins . There was also an upward trend of CREB1 mRNA level after administration. These results suggest that the drug can reverse the changes of spermatogenic function induced by heat stress by regulating sperm formation and androgen binding rate to its receptor and reducing the oxidative damage of spermatozoa  . AndrogeOur results for the first time found that DZBTS can increase the binding rate of the androgen receptor by upregulating the sex hormone level and androgen receptor expression and promote the transcriptional activity of the androgen receptor complex in the nucleus by upregulating the transcription enhancer factor CREB1. In addition, DZBTS downregulated heat stress-related protein to reduce oxidative damage, improving the spermatogenic function of heat stress rats. These results indicate that DZBTS could be used for the diagnosis and treatment of male infertility induced by heat stress."}
+{"text": "As a matter of fact, the statistical literature lacks of general family of distributions based on the truncated Cauchy distribution. In this paper, such a family is proposed, called the truncated Cauchy power-G family. It stands out for the originality of the involved functions, its overall simplicity and its desirable properties for modelling purposes. In particular, (i) only one parameter is added to the baseline distribution avoiding the over-parametrization phenomenon, (ii) the related probability functions  have tractable expressions, and (iii) thanks to the combined action of the arctangent and power functions, the flexible properties of the baseline distribution  can be really enhanced. These aspects are discussed in detail, with the support of comprehensive numerical and graphical results. Furthermore, important mathematical features of the new family are derived, such as the moments, skewness and kurtosis, two kinds of entropy and order statistics. For the applied side, new models can be created in view of fitting data sets with simple or complex structure. This last point is illustrated by the consideration of the Weibull distribution as baseline, the maximum likelihood method of estimation and two practical data sets wit different skewness properties. The obtained results show that the truncated Cauchy power-G family is very competitive in comparison to other well implanted general families. The main mathematical properties of the truncated Cauchy distribution can be found in [The general version of the truncated Cauchy distribution is defined by the following cumulative distribution function (cdf):duced by , with a found in ,3,4.The found in , with apfound in ,7.a and b can be performed in a similar manner (but remains to study in an extensive way).By the use of well-known general families of distributions, one can extend the truncated Cauchy distribution in multiple theoretical or applied directions. For instance, one can use the exp-G family proposed by , the KumAnother way to exploit the features of the truncated Cauchy distribution is to use it as a generator of new families of distributions. In the special case of the half-Cauchy distribution, this is performed by  which induced by  and defiThese two families show practical merits, producing skewness for symmetrical distributions, constructing heavy-tailed distributions, generating distributions with various shapes on their probability functions, providing better fits than other families of distributions under the same baseline\u2026. However, the study of their theoretical properties is not an easy task. One common drawback remains in the complexity of the corresponding probability functions, which can afraid the occasional practitioner, and the mathematical complexity of some related measures. In particular, the corresponding probability density function has a linear decomposition with non-closed form coefficients with sophisticated recurrence structures . Thus, q-entropies and order statistics. Then, the estimation of the TCP-G model parameters is investigated by the maximum likelihood method, with an emphasis on the one defined with the Weibull distribution as baseline. To evaluate the performance of the obtained estimates, two sampling schemes are considered, namely the simple random sampling and the ranked set sampling. As expected, nice numerical results are obtained for both. Then, two practical data sets are employed to show the modelling ability of the TCP-G family. More precisely, with the consideration of the Weibull distribution as baseline, we show that the TCP-G family generates very competitive models compared with other widely known general families, such as the Kumaraswamy-G and beta-G families with however one more parameter.In this paper, we offer a comprehensible alternative by introducing the truncated Cauchy power-G (TCP-G) family. It is defined on the basis on the truncated Cauchy distribution on the interval The rest of the paper is organized as follows. In This section is devoted to the description of the main probability functions of the TCP-G family, namely the probability density, hazard rate and quantile functions, with discussions on some of their analytical properties. A special member of the family is presented as example.The probability density function (pdf) of the TCP-G family can be obtained upon differentiation the cdf given by . Thus, iSome analytical properties of When The critical point(s) of The nature of Hence, if The hazard rate function (hrf) of the TCP-G family is defined by We present some of its immediate analytical properties below.When The possible shapes for The nature of The quantile function (qf) of the TCP-G family is the functional solution The standard quantiles can be deduced. Among them, the median defined by n values n values randomly and independently obtained from the corresponding TCP-G distribution.The quantile function is useful to simulate values from distributions belonging to the TCP-G family. Indeed, for a given baseline cdf Furthermore, the quantile function allows defining some skewness and kurtosis measures. They have the advantage to always exist contrary to those defined with moments.If n 3.4 of .By construction, the TCP-G family is rich and contains numerous new distributions with a potential interest from a statistical point of view . Here, we focus our attention on the member of the TCP-G family defined with the Weibull distribution as baseline. For the purpose of this paper, it is called the truncated Cauchy power Weibull (TCPW) distribution.In this study, the cdf of the Weibull distribution is defined by Thus defined, As immediate facts, the following asymptotic properties hold. When The hrf of the TCPW distribution is obtained asThe following asymptotic properties hold. When Also, when Numerical investigations of the critical points can be performed for After some algebra, the quantile function of the TCPW distribution is defined byThis tractable expression is an undeniable plus to simulate values from the TCPW distribution and to defined skewness and kurtosis measures, wherever the existence or not of moments. These points will be discussed later.In this section, some notable properties of the TCP-G family, and of the TCPW distribution in particular, are derived.Simple expansion series for the pdf and cdf of the TCP-G family are obtained according to the cdf and pdf of the exponentiated-G family by  given bySince Upon differentiation of One can remark that the coefficients in these series expansions are readily computed numerically using any standard mathematical software. Also, in any numerical calculations using these series expansions, infinity should be substituted by a large integer number. In this sense, some properties of the exponentiated-G family can be useful to determine those of the TCP-G family, as developed for the moments and related functions in the next section.In this study, we will use them to provide series expansions for the moments and related functions. Also, for a given baseline cdf owing to  and the X be a random variable with the cdf given by .As previously mentioned, one can define measures of skewness and kurtosis based on quantiles. In comparison to those defined with moments, they are more simple to calculate and not influenced by the eventual extreme tails of the distribution. One of the most useful skewness based on quantile is the MacGillivray skewness introduced by . In the We can use this robust function to describe efficiently the effect of the parameters udied by . The sigAlso, the kurtosis of the TCP-G family can be studied by considering the Moors kurtosis proposed by . It is dA high value for We now investigate the skewness and kurtosis of the TCPW distribution. In this case, thanks to , the Macq-entropy, of the TCP-G family, as introduced by [Entropy is a fundamental measure to quantify the amount of informations in a distribution, finding applications in information science, thermodynamics and statistical physics. Here, we investigate two different and complementary kinds of entropy arising from various physical experiments: R\u00e9nyi entropy and duced by ,33, respduced by .R\u00e9nyi entropy is defined byOwing to  and the Therefore, we can expressed For given functions and parameters, mathematical software can be useful to evaluated numerically this last integral.If we consider the case of the TCPW distribution, we can formulate q-entropy is defined byIn the general context of the TCP-G family, the q, we can express the integral term as in  of n is large enough and some regularity conditions hold, we can construct asymptotic confidence intervals of the model parameters. In this regard, we need the approximate inverse of the observed information matrix. By setting r be the number of components in the vector In general, these non-linear equations cannot be solved explicitly. However, the corresponding MLEs can be evaluated by using any well-know numerical numerical optimization technique. Thanks to the well-established theory of the maximum likelihood maximum method, by assuming that Then, the asymptotic confidence intervals of For the special case of the TCPW model, we recall that The same for the approximate inverse of the observed information matrix, i.e., n and that number of cycles is n. In this scheme, let n sets of n units each. On each set, we rank the n elements. In the first set, we select the element with the smallest ranking, denoted by n-th set and selected the element with the largest ranking, denoted by First of all, let us briefly present the considered RSS as introduced by  in our dAdopting the framework above, the corresponding likelihood function is defined byThus, the corresponding log-likelihood function is defined byThen, the maximum likelihood estimates (MLEs) of In general, these non-linear equations cannot be solved explicitly, but the corresponding MLEs can be obtained by using appropriated numerical technique. Also, the well-known theory of the maximum likelihood method can be applied. In particular, one can construct asymptotic confidence intervals of the model parameters as for the SRS case. In this regard, we need to defined the inverse of the observed information matrix as  but withthose in  with thiAs a logical sequel of the previous subsection, we provide a numerical study on the MLEs of the TCPW model parameters based on simple random sampling (SRS) and ranked set sampling (RSS). A comparison study between the estimates is performed by considering the mean squared errors (MSEs) and relative efficients (REs) defined by RE = MSE(RSS)/MSE(SRS). Also, lower bounds (LBs), upper bounds (UBs) of the related asymptotic confidence intervals, as well as their average lengths (ALs) defined by AL = UB - LB at the levels 90% and 95%, are calculated based on RSS and SRS via Mathematica 9. The simulation procedure follows the following six steps.Step 1: We consider Set1: Set2: Set3: Set4: Step 2: The parameters values are selected asn, the MLEs are computed under SRS and RSS as described in the above subsection.Step 3: For the chosen set of parameters and each sample of size N times representing with different samples, where Step 4: Repeat the previous steps from 1 to 3, Step 5: The LB, UB and AL for selected values of parameters are calculated based on SRS and RSS.Step 6: Numerical outcomes are given in From n increases.For both of the sampling schemes, the MSEs decrease as n increases.For both of the sampling schemes, the AL of the CI become decreases as The estimates based on RSS have smaller MSE than the corresponding based on SRS. For this reason, in case of a high level of precision is required, RSS is preferable.The TCPW model finds a concrete interest in the precise modelling of real life data sets. Here, we illustrate this aspect by considering the two following data sets.The first data set is taken from tests on the endurance of deep-groove ball bearings. The measurements represent the number of millions revolutions reached by each bearing before fatigue failure (see ). The fiFrom The second data set refers to a lifetime data set taken from  (p 105).From Then, we compare the TCPW model to the following well-established models: the Kumaraswamy\u2013Weibull-exponential (KwWE) model by , the Kump-value. The obtained results are summarized in p-value . Then, standard measures are taken into account, namely: the Cram\u00e9r-Von Mises (CVM) statistic, the Anderson-Darling (AD) statistic and the Kolmogorov-Smirnov (KS) statistic along with the corresponding To solidify this claim, we provide the minus estimated log-likelihood function  family. A focus was put on the special member of the family defined with the Weibull distribution as baseline, called the TCPW distribution. Its cdf has the feature of being simply defined with the arctangent and power functions, allowing tractable expressions for the other corresponding functions . In addition to its simplicity, we revealed the desirable properties of the family, such as very flexible shapes for the pdf and hrf, skewness, kurtosis, moments, entropy\u2026. By considering the special TCPW model, a full simulation study illustrates the nice performance of the maximum likelihood method in the estimation of the model parameters. The deep analysis of two famous data sets shows all the potential of the new family, with fair and favorable comparison to well-established models in the same setting.From the perspective of this work, one can apply the TCP-G family in a regression model framework (creating new possible distributions on the error term). Also, one can investigate some natural (and not too complicated) extensions of the TCP-G family as those defined bythe cdf given bythe cdf given byThese extensions needs further investigations; there is no guarantee as to their superior efficiency over the former TCP-G family is provided at this stage, opening new work chapters for the future."}
+{"text": "In view of this, the current review summarizes the mechanisms by which Ca2+ is transported into and out of cells and organelles, such as the cell, endoplasmic reticulum, mitochondrial and lysosomal membranes to affect the balance of intracellular Ca2+ levels. In addition, dyshomeostasis of Ca2+ plays an important role in modulating the pathogenesis of AD by influencing the production and aggregation of A\u03b2 peptides and tau protein phosphorylation and the ways that disrupting the metabolic balance of Ca2+ can affect the learning ability and memory of people with AD. In addition, the effects of these mechanisms on the synaptic plasticity are also discussed. Finally, the molecular network through which Ca2+ regulates the pathogenesis of AD is introduced, providing a theoretical basis for improving the clinical treatment of AD.Alzheimer\u2019s disease (AD) is a neurodegenerative disease with a high incidence rate. The main pathological features of AD are \u03b2-amyloid plaques (APs), which are formed by \u03b2-amyloid protein (A\u03b2) deposition, and neurofibrillary tangles (NFTs), which are formed by the excessive phosphorylation of the tau protein. Although a series of studies have shown that the accumulation of metal ions, including calcium ions (Ca Alzheimer\u2019s disease (AD), commonly known as dementia, is a neurodegenerative disease with a high incidence rate. AD may share common biological pathways and is often associated with diabetes and other comorbidities  Clinical2+ metabolic disorder was evident before the formation of APs or NFTs [2+ located in the cytoplasm might be the cause of AD. Based on this hypothesis, previous studies have shown that Ca2+ influx can increase the production and aggregation of A\u03b2 and phosphorylated tau protein and thus affect the learning and memory of patients with AD [A series of studies have shown that the onset of AD is related to aging; an unhealthy lifestyle, including smoking and drinking; health status, such as degree of heart disease, hypertension, obesity and diabetes; and genetic factors, such as APOE4 expression ,9,10,11. or NFTs , This ob or NFTs ,19,20, w with AD ,21,22.2+ leads to dysregulated metabolism that affects many neurophysiological functions related to AD, including the regulation of neuroinflammation, response to neuronal injury, neuronal regeneration, neurotoxicity, autophagy and synaptic plasticity [2+ may be directly or indirectly mediated by A\u03b2 and/or phosphorylated tau proteins. As the main pathological features of AD, monomeric or aggregate A\u03b2 and phosphorylated tau proteins show regulatory effects on neuroinflammation, neuronal injury, neuronal regeneration, neurotoxicity, neuroprotection, autophagy and neural plasticity [2+ is involved in the regulation of these neuropathological functions through its specific transporters. Therefore, this review mainly explores the molecular mechanisms by which a Ca2+ imbalance in AD affects the regulation of A\u03b2, tau, and neural plasticity, specifically from the perspective of Ca2+ transporters in cell, mitochondrial, endoplasmic reticulum (ER) and lysosomal membranes.Moreover, the imbalance of Caasticity ,25,26,27asticity . Either 2+ is strictly regulated under physiological conditions, whereas Ca2+ concentration is obviously elevated in the brains of AD patients and APP/PS1 Tg mice [2+ is significantly increased in the dendrites and dendritic spines of neurons of APP/PS1 Tg mice [2+ elevation during the course of AD development and progression? It has been reported that A\u03b21\u201340 has the ability to upregulate the influx of Ca2+ in rat cortical synaptosomes and cultured cortical neurons [25\u201335 peptide has an effect similar to that of A\u03b21\u201340, which can promote Ca2+ influx by activating L- and T-type Ca2+ channels in rat hippocampal slices [2+ influx in PC12 and SH-SY5Y cells in vitro [2+ influx through L-VGCCs by activating calcium-binding proteins [The concentration of Ca Tg mice . Kuchibh Tg mice . In view neurons ,30. Morel slices . Similarin vitro ,33. In aproteins .2+ in neurons, Bacskai and his colleagues quantitatively measured the resting-state Ca2+ concentration in astrocytes of APP/PS1 mice and observed the overall response of astrocytes to AP deposition. The results showed that the concentration of Ca2+ in the astrocytes of 6-month-old mutant mice was elevated compared to that of the WT controls [2+ reached 247 nmol/L in the cortical neurons of 3\u00d7Tg mice, which is twice that of the cortical neurons of non-Tg controls (110 nmol/L) [2+ was found to be elevated in neurites, which were 20 \u03bcm from the central AP region, indicating the critical roles of APs in the homeostasis of Ca2+ in the spines and dendrites of neurons [2+ was elevated in response to the deposition of APs [2+ colocalized with APs and was deposited in the thalamus [1\u201340 and A\u03b21\u201342 can form a cation channel on the surface of an artificial lipid membrane that allows the passage of Ca2+ [+, K+ and Na+ [2+ permeability of cellular membranes, thereby increasing both Ca2+ influx from the extracellular space and Ca2+ leakage from intracellular Ca2+ stores [+, K+ and Ca2+ through this highly conductive channel [2+ in neurons [2+, because Zn2+ can form a complex with A\u03b2 to prevent the aggregation of A\u03b2, which inhibits the insertion of A\u03b2 oligomers into the membrane, leading to the formation of pores [2+ influx [Because of the self-aggregating characteristics of A\u03b2, the concentration of Ca2+ in the spines and dendrites of cortical pyramidal neurons around APs is higher than the normal value in adjacent resting neurons . In addicontrols . It was  nmol/L) . Taking  neurons . In astrn of APs . In tranthalamus . Arispe  of Ca2+ . However and Na+ . In SH-S+ stores . The por+ stores ,42 and a+ stores ,44. For + stores . In addi channel . This ob neurons ,47,48. T neurons . Howeverof pores ,51,52,53of pores . In cont+ influx .2+. For instance, sAPP mediates the effects of glutamate on the regulation of the homeostasis of Ca2+ by increasing the production of cyclic (c) GMP to activate K+ channels, which results in reduced Ca2+ levels in hippocampal neurons [2+ in hippocampal neurons [2+ signaling system [T122R mutated SH-SY5Y cells [2+ released from ER in an ER-dependent mechanism [In addition to A\u03b2, sAPP is involved in regulating the homeostasis of Ca neurons . In addi neurons . A possi neurons . The APPg system ,60. As t5Y cells . Howeverechanism .2+ transporters on the surface of the nerve cell membrane (2+ influx and was the first Food and Drug Administration (FDA)-approved drug for the treatment of moderate to severe AD in patients [2+ channels in the cell membrane to increase NMDAR-dependent Ca2+ influx [2+ and decreasing the activity of PI3-K/Akt/GSK-3\u03b2 pathways in primary cultured rat cerebellar granule and hippocampal neurons [2+ influx through NMDAR channels in a short period of time [2+ influx and the glutamate current in neurons [2+ influx in AD animal models [In addition, there are many natural Camembrane . As an apatients . This dr+ influx . On the  neurons . Althoug of time , sustain neurons ,67,68. Il models ,70,71,722+ channels (VGCCs) on the surface of the cell membrane that mediate the transportation of Ca2+. For example, A\u03b2 blocked presynaptic P/Q-VGCC, which resulted in reduced Ca2+ influx into hippocampal neurons [1\u201340 concurrently enhanced the high threshold and low conductance of N- and T-VGCC and the high conductance of L-VGCC, which resulted in an increasing postsynaptic Ca2+ response in cortical neurons [2+ and impaired Ca2+-ATPase, which resulted in inhibited Ca2+ efflux in primary cultured neurons and synaptosomes of an adult post-mortem hippocampus [2+ influx, and it is regulated by the voltage and extracellular Ca2+ concentration of mouse cortical neurons [2+ transporter, it is further confirmed in CALHM1 knocking out mice [2+ influx as a canonical cation channel, but it can promote the influx of Ca2+ by activating P/Q-VGCC in neurons [\u2212/\u2212 mice, APOE4 was found to be responsible for impairing neurons after brain injury [In addition to glutamate receptors, there are a series of voltage gated Ca neurons . In cont neurons ,74,75. Ipocampus . Althoug neurons . As a poout mice . As an i neurons ,80. In pn injury .2+ in neurons, endoplasmic Ca2+ can pass through InsP3Rs and ryanodine receptors (RyRs) to enter the cytosol , where the concentration of Ca2+ is approximately 100\u2013500 nM and can be released into the cytoplasm through InsP3R and RyR [25\u201335 induces the transportation of Ca2+ in association with the activation of phospholipase C (PLC) and the production of inositol triphosphate (InsP3) [2+ response induced by InsP3R [1\u201342 increases the probability of channel opening, which results in an increased Ca2+ flux [2+ flux from the ER via InsP3R and RyR in human brain tissues and cells and in hippocampal CA1 pyramidal neurons [As an important reservoir of Ca cytosol . In the  and RyR ,83. Prev (InsP3) . In neury InsP3R . More spa2+ flux . Similar neurons ,83,87,882+ signaling cascade, namely, InsP3R [2+ even though there is no increase in Ca2+ in the lumens of the ER [3, which results in the release of Ca2+ from the ER [2+ release from the ER via InsP3R and RyR [2+ [2+ from the ER, from which it entered the cytosol [2+ via RyR, which promotes the formation of APs and NFTs [In addition to A\u03b2, PS1 exhibits the ability to interact with three key components of the Ca, InsP3R ,90, RyR , InsP3R ,92,93 an, InsP3R . Recentlm the ER . Similar and RyR ,97. In t RyR [2+ . In 3 \u00d7  cytosol . Interesand NFTs ,100,1012+ induces a continuous influx of extracellular Ca2+ into the cytoplasm by activating a classical store operated Ca2+ entry (SOCE) pathway. This process initially requires the sensor molecule of canonical systemic Ca2+ interactions in the ER  to sense ER Ca2+ depletion, which leads to activated Ca2+ channels on the surface of the cell membrane, such as Ca2+ release-activated Ca2+ (CRAC) channels, also known as calcium channel protein 1  channels [2+ transportation because of their close relationship with the ER. As expected, SOCE disruption by the Stim1D76A mutation attenuated Ca2+ entry in primary neurons from AD mice with human mutant-PS1-knock-in skin fibroblasts from familial AD patients [2+ when Ca2+ was depleted from the ER [\u0394E9 mutation induces the influx of Ca2+ via activating Stim1 in a SOCE-dependent mechanism in mouse hippocampal neurons [2+ [However, the depletion of ER Cachannels ,103. Altpatients ,105. Othm the ER . Moreove neurons . Althougrons [2+ ,109,110.2+ homeostasis, which has been reviewed in detail in a previous study [L286V mutant can promote disorders in Ca2+ homeostasis in neurons by damaging mitochondria [M146L mutant lymphoblasts, activation of InsP3R results in opening mPTP transporters in mitochondria [2+ [+/Ca2+ exchanger is critical for Ca2+ export across the inner mitochondrial membrane (IMM) [2+ from neuronal mitochondria [2+ transportation, A\u03b2 has the ability to open the mPTP, leading to the release of cytochrome C and caspases from mitochondria [2+ homeostasis. In contrast to that internalized by mitochondria, the Ca2+ uptake into lysosomes is mainly realized by the cooperation of a vacuolar type H+-ATPase (v-ATPase) and a putative Ca2+/H+ exchanger (CAX) [2+ from lysosomes is mainly realized by TRPML and TPC [2+ flows out of lysosomes through these VGCCs, defective autophagic lysosomes form, leading to autophagy [2+ by reducing the activity of the v-ATPase proton pumps on the lysosome, leading to AD pathogenesis [2+ stores were significantly decreased, which resulted in a damaged autophagy process [In addition to the ER, mitochondria and lysosomes play important roles in the regulation of Caus study   ,118,119;chondria . Althougchondria ,121. Thier (CAX) ,123. The and TPC . When Cautophagy . Furtherogenesis . In PS1  process . The imb2+ levels is functionally related to most pathological features and pathogenic factors of AD, such as presenilin and APP mutations, APOE4 expression, CALHM1 mutation, A\u03b2 plaque formation, tau hyperphosphorylation, apoptosis and synaptic dysfunction [2+ metabolism during the production and deposition of A\u03b2 and phosphorylation of tau protein  AMPAR was abnormally expressed in the brains of APP/PS1 Tg mice [P86L polymorphic protein also increased the production of A\u03b2 [2+ influx [Since Caon of A\u03b2 ,142. Thion of A\u03b2 . In addi Tg mice ,165. In  Tg mice ,165. The Tg mice . In addion of A\u03b2 ,145. In + influx ,166 In t+ influx ,146.2+ influx, the ER, as an intracellular reservoir, plays a regulatory role in the production of A\u03b2. For example, knocking out the expression of InsP3R in Sf9 and DT40 cells significantly reduced A\u03b2 production [2+ transporter on the surface of the ER membrane, also regulates A\u03b2 production [2+ leakage from the ER, leading to reduced production of A\u03b2 from APP [2+ from the RyR2 channel, leading to the formation of fewer APs [2+ channel in the ER, resulted in a decrease in A\u03b2 production, while SERCA overexpression increased A\u03b2 production [2+ uptake into the ER through SERCA, can increase the effects of caffeine on stimulating the release of A\u03b2 by increasing the level of Ca2+ in the cytoplasm [In addition to extracellular Caoduction . In addioduction . RyR, anoduction . By inhioduction ,149. In oduction ,168. In from APP . In addiewer APs . In addiewer APs ,148,149.ewer APs . By knocewer APs ,169. Thaoduction . Thapsigytoplasm . These cytoplasm .M146V-overexpressing hippocampal neurons, SOCE is required for maintaining the morphology of mushroom spines, which results in modulating the production of A\u03b2 and promoting memory functions [2+ mediated by SOCE can reduce the secretion of A\u03b2, suggesting that the loss of SOCE in the pathogenesis of AD leads to the production of A\u03b2 and accelerates the onset of AD [1\u201342 in SH-SY5Y and human neuroglioma H4 cells, suggesting a potential way to rescue the defects of AD and prevent the formation of APs by downregulating the expression of Orai2 [On the basis of SOCE, the overexpression of Stim1 and Orai1 can accelerate the production and deposition of A\u03b2 . In PS1Munctions ,154. In et of AD ,156,157.of Orai2 . 2+ from mitochondria, which enhances the pathogenesis of AD. In support of this hypothesis, a report suggested that reduced VDAC1 expression in VDAC1+/\u2212 mice decreased the mRNA expression levels of AD-related genes, including \u03b2APP, Tau, PS1, PS2 and BACE1, compared with their expression levels in VDAC1+/+ mice [KM670/671NL and PS1L166P mutants, treatment with dutasteride decreased the formation of APs by disrupting the function of the mPTP [In mitochondria, the abnormal interaction of voltage-dependent anion channel 1 (VDAC1) with A\u03b2 and phosphorylated tau has the ability to induce the dysfunction of mitochondria during the course of AD development and progression . In addi+/+ mice . Furtherthe mPTP .2+ also induced the phosphorylation of tau via the GSK3\u03b2-activating pathway in SH-SY5Y cells [2/EPs/CDK5/p35/p25 signaling cascades mediated the effects of Ca2+ in stimulating the phosphorylation of tau in n2a and APP/PS1 Tg mice [2+ triggered Ca2+-activated kinases, which mediated the phosphorylation of tau, leading to the formation of NFTs in AD mouse models [2+ on the phosphorylation of tau, there is evidence suggesting that AMPAR mediates the effects of Ca2+ on the phosphorylation of tau in PS1mut-knock-in mice [2+ release channel correlate with the formation of NFTs in AD patients [2+ on the production and deposition of A\u03b2 and hyperphosphorylated tau during the course of AD development and progression.Apart from the production and deposition of A\u03b2, Ca5Y cells ,161. In 5Y cells . Similar Tg mice . Furthere models ,163. Alt-in mice ,141. Furpatients . On the 2+ has been observed to be critical for the production and deposition of A\u03b2 and hyperphosphorylated tau via its transporters, we also address its roles in the learning ability and memory of AD patients and experimental models , the effects of A\u03b2 in inducing deficits in learning and memory were blocked by inhibitors of CaN in APP/PS1 Tg mice [2+-dependent protein phosphatase calcineurin (CaN) potentially impaired the cognition of AD by eliminating both NMDA and AMPA receptors through endocytosis [2+ in AD patients and AD mouse models [2+ transporter, CP-AMPAR, in the early stage of AD accelerated the onset of neuronal network dysfunction and neuronal excitotoxicity, leading to successive cognitive decline by dysregulating the flux of Ca2+ [2+ dysregulation on the learning ability of AD patients.Since the levels of Ca Tg mice . Activatocytosis . In addiocytosis ,183. Cone models ,185. The of Ca2+ . These o2+ currents in CA1 synapses leads to a decrease in cognitive function in 3 \u00d7 Tg AD mice [2+ in mice with traumatic brain injury (TBI) [2+ channels enhanced learning ability by reducing intracellular Ca2+ levels [2+ transporter, APOE4 shows the ability to worsen cognitive function by increasing serum Ca2+ levels in older people [P86L polymorphic protein has been found to be associated with AD in the ethnic Chinese Han population, even though no direct evidence has shown a relationship between Ca2+ and learning ability [In addition, the increase in L-type Ca AD mice . Further AD mice . These o AD mice ,208. Sim AD mice . As an iry (TBI) . In Cav + levels . SB36679+ levels . Althougr people . Moreove ability .2+ through a metabotropic glutamate receptor-activating mechanism [2+ from the ER in AD patients [2+ from the ER [2+ depletion by InsP3R and RyR stimulates SOCE. Accordingly, the reduced expression of synaptic STIM2 and impaired SOCE destabilized mushroom spines, which resulted in reduced LTP-mediated memory formation in PSmut mice [For intracellular stores, the generation of InsP3 can enhance memory loss by activating the release of intracellular Caechanism . As the patients . In addipatients . For exapatients . In addipatients . To clarpatients . This repatients . These om the ER . Ca2+ demut mice ,107,201.mut mice .2+ from mitochondria and lysosomes and the learning ability of AD patients, to the best of our knowledge, VDAC1 is a hub protein that interacts with more than 150 other proteins, including phosphorylated tau, A\u03b2, and \u03b3-secretase, and it contributes to their toxic effects, triggering cell death and potentially leading to the dementia characteristic of AD [2+ uptake in mitochondria by MCU, which resulted in the inhibition of Ca2+-induced mPTP opening and rescued cells from apoptotic death [2+ has the ability to modulate the learning ability of AD patients via the functions of its transporters.Although there is no direct evidence to show the relationship between Caic of AD . In addiic death . For lysic death , which iic death ,210. On 2+ in mediating the synaptic dysfunction in AD [2+ in producing A\u03b2, mutations of APP and PS1 have shown led to disruptions of synaptic processes by controlling the homeostasis of Ca2+ during the course of AD development and progression [2+ influx, which results in activating LTD, leading to erased memories in the early cognitive decline of AD patients [2+ on LTP in hippocampal slices [2+ leakage and reduction in the ER Ca2+ pool in AD [2+, induced LTP in aged rat hippocampal slices [2+ on synaptic plasticity.In neuroscience, synaptic plasticity refers to the connection between nerve cells, whose strength can be adjusted by cell-adhesion molecules, cytoskeletal proteins, ion channels and various receptor proteins ,212. Indon in AD . Given tgression . In addigression . In factpatients . Similarl slices . By knocol in AD . In contl slices . All thi2+ and calmodulin. Currently, it is a multifunctional signaling enzyme, especially in regulating synaptic plasticity. For example, overexpressing CaN in young animals induces aging-like deficits of LTP, and deactivating CaN increases the synaptic strength in aged animals, which facilitates LTP [2+-dependent CaN activation results in LTD by removing NMDAR and AMPAR via endocytosis in aged or APP Tg mice [CaN is a member of the serine/threonine protein phosphatase family. It is a unique serine/threonine protein phosphatase that is regulated by Caates LTP . Similar Tg mice ,219. By  Tg mice ,180.2+ transporters in the cell membrane, A\u03b2 oligomers induce the dysfunction of Ca2+ and inhibit LTP in an NMDAR-dependent mechanism [2+ into spines and dendrites, which resulted in insufficient activation of LTP in the rat hippocampus [2+-permeable (CP)-AMPAR into the synapse, which is mediated by AKAP150-anchored PKA and calcineurin [2+, increasing not only LTP but also LTD. The mutation of GluR2, a subunit of AMPAR, obviously induced LTP in hippocampal slices [2+/calmodulin binding to PSD-95 induced the loss of synaptic PSD-95 and surface AMPARs, which resulted in activated LTD [With respect to Caechanism . In addipocampus . Interescineurin . Consistcineurin . More dil slices . CP-AMPAl slices . In addil slices . In cultated LTD .2+ transporters in the cell membrane, TRPs are involved in regulating synaptic plasticity. For example, TRPV1 activation by capsaicin and resiniferatoxin induces a switch from LTD to LTP by enhancing Ca2+ influx [\u2212/\u2212 or TRPV1\u2212/\u2212 mice [In addition to NMDAR and AMPAR, the activation of VGCC induced LTP via CaMKII in hippocampal slides . In addi+ influx . Treatme\u2212/\u2212 mice ,231. In \u2212/\u2212 mice . In cont\u2212/\u2212 mice .2+, LTD is induced via InsP3-mediated Ca2+ influx mechanisms [2+ from internal stores, which resulted in promoting LTD in hippocampal slices [2+ release from the ER [2+ depletion from the ER induces SOCE, it is reasonable to speculate that SOCE is involved in regulating synaptic plasticity. In FVB/NJ mice, reduction of SOCE-mediated Ca2+ entry reduced CaMKII activity, leading to destabilization of the mushroom spine and reducing LTP-mediated memory formation [2+ stores, knocking out the expression of VDAC1 disrupts synaptic plasticity [2+ on synaptic plasticity (With respect to intracellular Cachanisms . Similarl slices . Blockinl slices ,236. In l slices ,238. As m the ER . As Ca2+ormation . In the ormation . With reasticity . Similarasticity . Based oasticity .2+ is elevated in the cytosol of neuronal cells via its transportation from the extracellular space and intracellular stores through transporter-dependent mechanisms. Ca2+ accumulated in neuronal cells has the ability to induce the production and deposition of A\u03b2 and hyperphosphorylated tau in APs and NFTs, leading to impaired learning ability in AD patients. Moreover, transporters in the cell membrane, endoplasmic reticulum, mitochondria and lysosomal membranes are critical for mediating the effects of Ca2+ on synaptic plasticity, which contribute to the cognitive decline associated with AD.During the development and progression of AD, Ca"}
+{"text": "The deterioration of Portland cement pervious concrete (PCPC) subjected to wet-dry cycles in the simulated acid rain solution was investigated; 4% silica fume (SF) and 8% fine aggregate (FAG) were used to replace part of cement and the coarse aggregates (weight by weight), respectively. The wear resistance, the compressive, and flexural strength of PCPC were measured. The results show that after 12 wet-dry cycles in acid rain solution the compressive strength and the flexural strength of control PCPC are decreased by 30.7% and 40.8%. The final compressive strength of PCPC with 4% SF and PCPC with 8% FAG is increased by 6.9% and 30.3%, and the final flexural strength is increased by 25.4% and 72.3%, respectively. The wear loss of PCPC is decreased by 58.8% and 81.9% when 4% SF and 8% FAG is added to PCPC, respectively. The microstructures of PCPC with wet-dry cycles are also discussed. Portland cement pervious concrete (PCPC) can be used to reduce the urban waterlogging problems , the hea+) in the acid solution react with Ca(OH)2 and the external calcium carbonate in the hydrated cement paste, which will cause the dissolution of cement hydration products. In China, the excessive emission of SO2 is the main reason for the acid rain, and the anions in the rain are mainly sulfate ions (SO42\u2212) [42\u2212 in acid rain can also cause a corrosion damage to concrete. Usually, sulfate will react with 3CaO\u2219Al2O3 to form ettringite and gypsum, and the volume expansion of ettringite will damage the internal structure of concrete [+ dissolved corrosion occurred in the corroded area of concrete, the SO42\u2212 swelling corrosion mainly occurred in the severely corroded area.However, industrialization and urbanization bring serious acid rain problems to the world. More than one-third of China\u2019s territory is covered by the acid rain . Once th (SO42\u2212) . SO42\u2212 iconcrete . Zhou etconcrete  reportedSome papers have studied the degradation mechanism and the failure products of cementitious materials subjected to an acid rain. Chen et al. , Xie et Several researchers have offered solutions to eliminate or control the acid rain\u2019s effects. Zivica and Krizma  observedCompared with the conventional concrete, the coarse aggregates in PCPC are only wrapped by a very thin hardened cement paste, which causes a larger porosity and a lower strength. Therefore, PCPC is currently used in the sidewalks, parks, parking lots, and other places. PCPC has hardly been used in the actual automobile roads. In addition, more than one-third of China\u2019s territory is covered by acid rain. The erosion effect of acid rain on PCPC may be more serious. In order to realize the application of PCPC on the pavements with the vehicle loading, both the strength and the acid rain resistance of PCPC need to be improved.In the study, the wet-dry cycles were used to simulate the action of acid rain. The addition of SF and FAG was tried to enhance the mechanical properties and the acid rain resistance of PCPC. The weight change, compressive strength, flexural strength, and abrasion resistance of PCPC subjected to acid rain cycles were investigated. The microstructures were also discussed to reveal the deterioration. The results are expected to promote the application of PCPC in the construction of the sponge cities in the acid rain region.2/kg is used. The SiO2 content in SF is 95%. The particle size range of coarse aggregates with an apparent density of 2631 kg/m3 is 4.75\u20139.5 mm. The fineness modulus of river sands with an apparent density of 2650 kg/m3 is 2.54. The fineness modulus is an index indicating the gradation and the coarseness of sands. The larger the fineness modulus is, the coarser the sand is. A superplasticizer is used to improve the workability.The chemical composition of Portland cement of 42.5 grade is shown in +, SO42\u2212, and NO3. Wang et al. [42\u2212 to the acidity of acid rain was much higher than that of NO3\u2212. The acid rain with a pH value between 3.0 and 5.0 will seriously affect the mechanical properties and the durability of concrete [The long-term exposure experiment can better simulate the corrosion of concrete by acid rain. However, it will take a long time to reveal the deterioration . Therefog et al.  found thconcrete . In thisThe mixing proportions of PCPC are listed in The compressive strength was determined by three cubes with a size of 100 mm. Cube with a size of 150 mm was used to measure the surface wear resistance. The flexural strength was measured by three prisms. The size of the prism was 100 mm \u00d7 100 mm \u00d7 400 mm. The specimens were demolded and cured for 28 days under the standard condition.The compressive strength and the flexural strength of PCPC were determined according to GB/T 50081-2019 . The comThe abrasion resistance was measured according to a JTG E30-2020 . The loaThe water permeability coefficient was measured according to CJJ/T135-2009 . Figure K is the water permeability coefficient (mm/s), A is cross-sectional area of the specimen (mm2), t is the experiment time (s), H is the difference of water head (mm), Q is the seepage quantity at the time t (mm), and d is the height of the specimen (mm).The water permeability coefficient is calculated by Equation (1).In each wet-dry cycle, the specimens were completely immersed in acid rain solution for 3 days. Then, they were dried at 80 \u00b0C for 1 day. The pH value of the solution was measured and adjusted every day to ensure its stability; the solution was refreshed after each cycle. The weight change of the prism specimens was measured every cycle. The total number of the specimens in wet-dry cycles is shown in The relative weight of 4% SF PCPC or 8% FAG PCPC has a similar trend to that of the control PCPC. However, the change magnitude of the relative weight is smaller than that of the control PCPC, which indicates that the addition of 4% SF or 8% FAG tends to improve the acid resistance of PCPC. Usually, the hydration products of cement can remain stable in an alkaline pore solution . However2 [The addition of SF will increase the Si/Ca and refine the pore structures of the hydrated cement paste, which finally increases the content of C\u2013S\u2013H and decreases the content of the Ca(OH)2 ,40. FAG 2 ,26,27,302 and the decalcification of C\u2013S\u2013H decrease the Ca/Si ratio [42\u2212 could also accelerate the penetration of the H+ into concrete. The calcium hydroxide and C\u2013S\u2013H lose Ca2+ to form gypsum, and the later reaction between gypsum and the hydration products may also generate ettringite with a significant expansion in volume, which will decrease the strength of concrete.The strength reduction of the control PCPC subjected to wet-dry cycles in acid rain solution can be clearly explained by the corrosion of acid solution to the hardened cement paste. The neutralization reaction between the calcium hydroxide and the acid rain solution will reduce the alkalinity of the pore solution when PCPC is located in the acid rain environment. The low alkalinity of pore solution may lead to a decrease in the stability of C\u2013S\u2013H or even the degradation of C\u2013S\u2013H . In addiSi ratio ,41 and iSi ratio . This prSi ratio  and MoriSi ratio  found thUsually, PCPC subjected to the wet-dry cycles in water will show a periodic shrinkage and expansion deformation , which c2 increases the content of C\u2013S\u2013H and decreases the content of the Ca(OH)2 [Among the cement hydration products, the calcium hydroxide is the most easily corroded by the acid solution. The reaction between SF and Ca(OH) Ca(OH)2 ,40. In a Ca(OH)2 ,46.SiO2For PCPC without silica fume, cement paste is easy to segregate, bleed, and accumulate on the bottom of PCPC during the casting process. The hardened cement paste will block some voids. For PCPC with SF, SF improves the cohesion of the cement paste  which caThe compressive strength and the flexural strength of 8% FAG PCPC are shown in 3 to 2020 kg/m3 when 8% FAG is used to replace the coarse aggregates (weight by weight). The increase of the apparent density improves the acid rain resistance, which leads to a certain loss of the water permeability, as shown in However, the strength of 8% FAG PCPC also decreases with the increase of the wet-dry cycles. The compressive and flexural strength of 8% FAG PCPC under 12 wet-dry cycles in acid rain solution are decreased by 12.5% and 14.1%, respectively. The percentage of the strength reduction of 8% FAG PCPC is lower than that of the control PCPC (30.7% and 40.8%). The final compressive strength and the final flexural strength are higher 30.3% and 72.3% than that of control PCPC with 12 wet-dry cycles in the acid rain solution. The results show that 8% FAG can significantly improve the residual strength of PCPC subjected to the acid rain attack. FAG could reduce the void ratio of the hydrated cement paste and increase the apparent density of PCPC ,51. The As a road material, PCPC will be subjected to a long-term abrasion . However+ and SO42\u2212 could corrode the microstructure of concrete and decrease the bonding strength between the matrix and the aggregates. Chen et al. [It can be seen that the wear loss of PCPC with wet-dry cycles in the acid rain solution or in water is significantly higher than that of PCPC without the wet-dry cycles probably due to carbonatation of portlandite. For example, the wear loss of the control PCPC with 12 wet-dry cycles in acid rain solution is ~2.3 times that of the control PCPC without wet-dry cycles. Xie et al.  also repn et al.  found thHowever, 4% SF and 8% FAG decrease the wear loss of all PCPC with and without wet-dry cycles in the acid rain or in water. The wear loss of PCPC subjected to 12 wet-dry cycles in acid rain solution is decreased by 58.8% and 81.9% when 4% SF and 8% FAG are used to replace part of cement and the coarse aggregates, respectively. On the other hand, the addition of 4% SF and 8% FAG improve the abrasion resistance of PCPC subjected to wet-dry cycles in acid rain or in water. The results are consistent with the effect of 4% SF and 8% FAG on the strength of PCPC.The surface changes of PCPC subjected to 12 dry\u2013wet cycles followed by abrasion test are given in For PCPC mixed with 4% SF or 8% FAG, only the surface-hardened cement paste is abraded and the coarse aggregates at the edge do not spall off. The specimen\u2019s contours also remain relatively complete, as shown in + will cause a series of chemical reactions, as shown in Equations (2)\u2013(6).The microstructures of PCPC are observed to reveal the corrosion mechanism of acid rain. Compared with control PCPC without wet-dry cycle \u2013(6) cause the continuous changes of cement hydration products, which causes a serious damage to the microstructures of the hydrated cement paste . In addi of PCPC ,57.SO42The microstructures of 4% SF PCPC are given in The properties of PCPC subjected to wet-dry cycles in acid rain solution were investigated and the following conclusions are obtained.(1)The compressive strength and the flexural strength of control PCPC are decreased by 30.7% and 40.8%, respectively.(2)The final compressive and flexural strength of 4% SF PCPC are 6.9% and 25.4% greater than that of the control PCPC, respectively.(3)The final compressive and flexural strengths of 8% FAG are higher 30.3% and 72.3% than that of the control PCPC, respectively.(4)The wear loss of PCPC is decreased by 58.8% and 81.9% when 4% SF and 8% FAG are used to replace part of cement and coarse aggregates, respectively.(5)The addition of 4% SF and 8% FAG improves the acid rain resistance of PCPC. 4% SF increases the water permeability, but FAG reduces the water permeability of PCPC.For PCPC with 12 wet-dry cycles in acid rain solution:"}
+{"text": "In 2014, a first outbreak of chikungunya hit the Caribbean area where chikungunya virus (CHIKV) had never circulated before.We conducted a cross-sectional study to measure the seroprevalence of CHIKV immediately after the end of the 2014 outbreak in HIV-infected people followed up in two clinical cohorts at the University hospitals of Guadeloupe and Martinique. Study patients were identified during the first months of 2015 and randomly selected to match the age and sex distribution of the general population in the two islands. They were invited to complete a survey that explored the symptoms consistent with chikungunya they could have developed during 2014 and to have a blood sample drawn for CHIKV serology.The study population consisted of 377 patients , 182 of whom reported they had developed symptoms consistent with chikungunya. CHIKV serology was positive in 230 patients, which accounted for an overall seroprevalence rate of 61% [95%CI 56\u201366], with only 153 patients who reported symptoms consistent with chikungunya. Most frequent symptoms included arthralgia (94.1%), fever (73.2%), myalgia (53.6%), headache (45.8%), and skin rash (26.1%).This study showed that the seroprevalence of CHIKV infection was 61% after the 2014 outbreak, with one third of asymptomatic infections.NCT 02553369.ClinicalTrials.gov  After the termination of the first documented outbreak of chikungunya in the Caribbean in 2014, the seroprevalence rate of CHIKV infection in French West Indies was estimated at 61% [95% CI 56.0\u201365.8] in a population-matched cohort of HIV-infected patients. This high seroprevalence may explain the abrupt and persistent cessation CHIKV circulation in these territories. One third of participants had not developed clinical symptoms of chikungunya. That year the population sizes of the two territories were 403,750 and 381,326 inhabitants, respectively. After the outbreak terminated in January 2015, it was estimated that approximately 308,000 people had developed clinically overt chikungunya, i.e. approximately 40% of the population . The CHIKV seroprevalence rates were almost identical in Guadeloupe and Martinique. Seroprevalence rates were not significantly different in men and women, while there was a trend towards lower seroprevalence in youngest adults and higher seroprevalence in the oldest see .3) and of HIV viral loads (below vs above 50 HIV-RNA copies/mL) in both seropositive and seronegative patients , fever (73.2%), myalgia (53.6%), headache (45.8%), and skin rash (26.1%) . We alsopatients .The two main findings of this study are that the estimation of CHIKV seroprevalence was approximately 60% in both islands and a third of cases were asymptomatic. Both figures are higher than previously reported. Regarding seroprevalence, our figures are higher than those observed in volunteer blood donors at the end of the outbreak in the same area (48% in Guadeloupe and 41% in Martinique) \u20136 or in A genuine strength of our study is that we did our best to minimize any selection bias by analyzing a study population that matched the age and sex distribution of the two island populations.On the other hand, we acknowledge that our study has some limitations. As already mentioned, a recall bias may have led to underestimate the rate of symptomatic forms of chikungunya. Besides, since the most common symptoms of chikungunya are nonspecific and may be observed in other arboviral or flu-like diseases, some patients may have misreported such symptoms as chikungunya manifestations. Likewise, the fact that our study population was made of HIV-infected people could have introduced a bias. Although there is no data suggesting that HIV infection might alter host susceptibility to or clinical manifestations of CHIKV infection , one canThe high seroprevalence rate that we consistently found in both Caribbean islands probably explains the abrupt and persistent cessation CHIKV circulation in these territories. It also provides useful information for modelling the risk of development of a new outbreak in these territories. Given the long-term persistence and protective efficacy of anti-CHIKV antibodies , at leasS1 Checklist(DOC)Click here for additional data file.S1 Table(DOCX)Click here for additional data file.S2 Table(DOCX)Click here for additional data file.S1 Data(XLSX)Click here for additional data file.S1 Protocol(PDF)Click here for additional data file."}
+{"text": "Vascular tone plays a vital role in regulating blood pressure and coronary circulation, and it determines the peripheral vascular resistance. Vascular tone is dually regulated by the perivascular nerves and the cells in the inside lining of blood vessels . Only a few methods for measuring vascular tone are available. Because of this, determining vascular tone in different arteries of the human body and monitoring tone changes is a vital challenge. This work presents an approach for determining vascular tone in human extremities based on multi-channel bioimpedance measurements. Detailed steps for processing the bioimpedance signals and extracting the main parameters from them have been presented. A graphical interface has been designed and implemented to display the vascular tone type in all channels with the phase of breathing during each cardiac cycle. This study is a key step towards understanding the way vascular tone changes in the extremities and how the nervous system regulates these changes. Future studies based on records of healthy and diseased people will contribute to increasing the possibility of early diagnosis of cardiovascular diseases. The industrialized world is witnessing some common and costly diseases such as those related to cardiovascular issues.Cases of total cardiovascular diseases (CVD) nearly doubled from 271 million in 1990 to 523 million in 2019, and the number of CVD deaths steadily increased from 12.1 million in 1990 to 18.6 million in 2019 ,5.Factors affecting vascular tone are classified into two types: external factors and internal factors. External factors are originally from sources outside of the blood vessel. Internal factors are from the vessel itself. The external factors basically regulate blood pressure inside arteries by modifying the systemic resistance of blood vessels. Internal factors participate in regulating local blood flow inside a human organ .Vascular tone of resistance arteries and arterioles determine peripheral vascular resistance, contributing to the regulation of blood pressure and blood flow to and within the body\u2019s tissues and organs. In fact, there are two factors which determine vascular tone of the resistance arteries and arterioles. The first factor is blood pressure within the vessels. The other factor is the balance between vasoconstrictor and vasodilator signals which run into each other in these vessels. The wall of the resistant arteries and arteriole is made up of vascular smooth muscle cells (SMCs). These cells work as primary effectors in the minute-to-minute active regulation of vascular resistance. This operation is done via modulating the steady-state contraction of either these cells or the vascular tone. Myogenic tone is produced by blood pressure which stretches the SMCs activating signaling pathways. This tone distinguishes the resistant arteries and arterioles. Myogenic tone is the baseline smooth muscle cell contraction. When this contraction occurs, signals which express vessels expansion and constriction coming from different sources act. Sources of these signals are neurotransmitters, hormones, endothelium derived substances, local metabolites and ions ,10,11,12The plasma membrane and endoplasmic reticulum of SMCs in blood vessels contain ion channels. These channels play the most important role in regulating intracellular Ca2+ concentration. Moreover, these channels primarily determine both smooth muscle cell contractile activity and vascular tone .Some afferent nerves have an efferent (motor) function, and axon reflex control of vascular tone by these \u201csensory-motor\u201d nerves is more widespread than once thought. Endothelial cells arrange both vessel expansion (vasodilatation) and constriction (vasoconstriction). These endothelial cells are able to store and emit substances which are active in the vessels. These substances are called vasoactive substances. Acetylcholine (vasodilator) and endothelin (vasoconstrictor) are examples of these substances. Endothelial vasoactive substances may be more significant when blood vessels respond to local changes .There are many factors which affect vascular tone regulation. Some of these factors include aging and other conditions such as hypertension, trauma and surgery. Vascular tone has been studied in case of disease, after denervation, or after mechanical injury. In all of the cases, these studies showed possible alimental interactions between the perivascular nerves and the endothelial cells. Such alimental interactions may be important for growing and developing both of the control systems. This case is particularly clear in the microvasculature where the neural-endothelial separation is small .Saito et al. developed an ultrasonic probe . The proKellogg and Dean had focused on the neural and the local mechanisms that influence cutaneous vasodilatation and vasoconstriction when responding to heat and cold pressure in humans. There is no knowledge about non-neural mechanisms that mediate the prolonged response to local cooling. The involved mechanisms that may be included are changes of endothelial function, blood viscosity, receptor affinity, and/or coriaceous vascular smooth muscle function. None of these mechanisms have yet to be investigated in humans .Wang et al. performed a non-invasive estimation of the vascular tone changes. The estimation was performed by observing variations in response of a photoplethysmogram and a novel piezoelectric cardiovascular sensor. The results of tracking vascular resistance showed strong correlation with invasive systems that measure vascular resistance in swine subjects, altering muscle vascular tone: endothelial, neurogenic and myogenic, spatially localized in the microvasculature. They create fluctuations in blood flow in known frequency ranges (0\u20131.6 Hz). The software used for registering and processing the laser doppler-flowmetry-gram allows diagnosing activity of a certain regulatory mechanism. The aser doppler-flow-metry method makes it possible to assess components of microvessels\u2019 tone based on magnitudes of microcirculation oscillations amplitudes ,21.Impedance plethysmography (rheography) is a biophysical way for studying blood circulation non-invasively. This method is based on regista ering and medically analyzing changes in the variable component of electrical impedance to high-frequency current. Pulse fluctuations in blood flow under influence of an intra-arterial pressure gradient cause a change in the complex electrical resistance. This happens due to the arrival of a pressure wave generated by cardiac contractions into the studied area . The staPrevious studies of vascular tone focused on local measurement and specific arteries. However, the studies were not for several arteries or segments at the same time. Therefore, previous studies give answers about the change in the type of vascular tone in the studied artery, but they cannot give information about the changes in the vascular tone in the different arteries of the body at the same time. Bioimpedance technology using a multi-channel device when used to measure vascular tone will allow comprehensive monitoring of vascular tone changes associated with blood pressure in different arteries of the human body. The aim of this work is to present a methodology that allows for the monitoring of vascular tone changes in different parts of the human body  simultaneously.In this work, there are three main tasks to be accomplished. The main task is to identify the vascular tone in all parts of human body for each cardiac cycle. The second task is to determine whether this cycle is within inspiration or exhalation in order to know the relationship of the change in the type of vascular tone with the change in the breathing phase. The third task is to classify the main types of signals that can be obtained in human limbs over a long period of time, and then to create a graphical interface to demonstrate the vascular tone type during the whole record.In the bioimpedance signal in extremities, several points can be identified. These points are often found in each cycle and they are as follows. S is the beginning of systolic wave, C is the first systolic wave peak, I is the incisura, and D is the diastolic wave peak; In the ideal case, these points reflect the change in blood volume for specific arteries, veins, and blood capillaries for a specific part of the body and in a certain health condition. This means expansion and contraction of these points during the signal recording is compatible only with the pressure and volume of the blood flow. Blood flow in veins and capillaries is considered steady and not pulsating ,26. TherIn this work, a system for monitoring changes in vascular tone has been proposed. A monitoring process has been undertaken for all segments of the body\u2019s limbs simultaneously. The monitoring operation of the limbs has been linked to breathing and ECG. The purpose is forming a system for displaying changes in vascular tone simultaneously based on multi-channel bioimpedance. Using this system, the changes can be monitored. Moreover, this system can be used to better understand the nature of the change in blood vessel tone. The proposed system can be prepared to explain the mechanism according to which the nerve system behaves in various conditions. In these conditions, the nerve system must regulate vessel tone. Some examples of these conditions include cold, heat, exercise, stress, etc. Two parameters must be calculated in order to determine the type of vascular tone based on the bioimpedance signal. Each one of these two parameters depends on the systolic wave amplitude, the diastolic wave amplitude, and the incisura. The first systolic wave arises as a result of the interaction of the pumped volume of blood into the arterial bed and the resistance of this part of the vascular system. The second systolic wave is formed as a result of reflection from the aortic bifurcation, therefore it does not occur or is extremely weakened on the rheovasogram of the extremities. The diastolic wave is the result of reflection from the peripheral part of the arterial tree, the smallest arteries and arterioles. As the elasticity of the arteries is lost, the formation of the diastolic wave is increasingly affected by additional reflection waves from more distant, proximally located sections of the arterial bed. Incisura between the systolic and diastolic waves is formed as a result of their addition and its depth depends on the formation and interaction of these waves.It is required to determine the vascular tone type that expresses expansion of the blood vessel when a pressure wave passes. For this purpose, the dicrotic index (DKI), which reflects the level of tone of small vessels, and the diastolic index (DCI) which reflects the state of venous outflow, have been calculated using the following equations:AC, AI, AD are amplitudes of the systolic wave peak, incisura and diastolic wave peak, respectively. Based on DKI-DCI phase plane, type of the tone can be determined. This tone has three main types: normotonic, hypotonic, and hypertonic ,28. HoweThe point S expresses beginning of arterial blood wave arrival to the studied segment. By this point, the vessels begin to expand and the blood stream enters the small arteries and capillaries in the segment. At this time, processes of gas exchange and energy transfer to the tissues in the studied segment begin. In fact, the flow is at its beginning in arterial blood vessels section. In the veins and their branches, there is blood stream in the opposite direction. This stream is small in relation to the small ratio of venous pressure versus to arterial pressure. This point can be relied on to normalize baseline of the bioimpedance signal and to approximate the signal to the ideal state.The study included 14 volunteers  which, according to the Ethics Committee, is the minimum number of studied subjects to make a classification of bioimpedance signals types in human limbs. The volunteers, whose ages are in the range 25\u201333 years are non-smokers. They don\u2019t have diseases related to respiratory system or cardiovascular diseases.The body mass index (BMI) range of the subjects was 18.5\u201335. The blood pressure and heart rate of all volunteers were measured before the start of recording the signals and they were within the normal limits.The experiments have been conducted under supervision of the Medical and Educational Center of Bauman Moscow State Technical University.The study followed the World Medical Association\u2019s Declaration of Helsinki on Ethical Principles for Medical Research Involving Humans Subjects. All patients provided written consent before they participated in the study.During the experiments, the volunteers were lying down fully relaxed exactly imitating the patient\u2019s position under observation. Recording the bioimpedance signals had begun after 10 minutes of complete relaxation. The signals were recorded for 7\u201310 minutes in free breathing without interruptions.The equipment used in this research is the multi-channel electrical impedance research system REO-32. This system has the following characteristics: 30 precordial electrical impedance channels, one transthoracic bioimpedance channel, one ECG channel, channel sampling rate is 500 HZ, bioimpedance measurement method is tetropolar, probe current amplitude is 1 mA, probing frequency is 100 kHz, pulse impedance measurement range is (\u22122\u223c+2) Ohm, and bandwidth of the bioimpedance channel is (0.01\u223c117) Hz. Each electrode has been connected to contact point of the limb symmetrically from two sides. Thus, eight electrodes per channel are required. CERACARTA Top Trace ECG Electrodes 50 mm with Ag/AgCl sensors have been used in the experiments.In addition to the ECG signal, the signals have been recorded from 14 major segments of the body. Measurement points for these signals are shown in First of all, signals must be smoothed in one way to ensure that amplitude losses due to smoothing will be the same across all signals. Many methods can be used for smoothing the bioimpedance signal. The main methods for this purpose are fast Fourier transforms (FFT), Binomial smoothing, Locally Weighted Polynomial Regression Method (LOESS), and Savitsky-Golay. In this research, fast Fourier transforms have been used in addition to the use of Binomial smoothing in special cases. These cases were explained in detail in .Processing ECG and detecting R peaks were done by library Heartpy based on . InterpoAs shown in In the study, several smoothing methods have been tested. These methods are Savitzky-Golay, LOESS, fast Fourier transforms (FFT), and Binomial smoothing. All of these methods achieved the desired goal with some differences in terms of displacement of signal peaks from the original signal when using large values for smoothing coefficients.However, FFT ineffectiveness has been also observed in the presence of signals where the diastolic wave peak is very small. This peak can be lost due to excessive smoothing; the smoothing process was explained in our previous work .The signal baseline has been removed in three main stages, After smoothing the signal, removing the baseline and dividing the cycles into inhalation and exhalation, the type of vascular tone can be determined as shown in In order to track changes of vascular tone type with time, a chart has been created for this purpose. It determines the type of vascular tone for each cardiac cycle. Moreover, it determines whether a signal is within the inhalation phase or the exhalation phase  as shown in In all the studied subjects, it has been found that there are six basic types of signals which can appear clear and stable during the recording period. In order to visualize changes of the vascular tone type in all segments, the graphical interface shown in It was clarified earlier that this study aims at presenting a practical method for observing changes in vascular tone in the extremities. Observation has been done from the stage of recording the signal until the stage of showing the type of vessel tone. This study is based on the bioimpedance signals in segments of the limbs, in the entire limbs, and related to the respiration phase. Based on the signals obtained during recordings, main types of the signals which may appear have been indicated as clear from The followed method allows for the determination of the type of the vascular tone in the extremities. The challenges lie in finding one specific smoothing method suitable for all the signals that can be recorded. FFT shows good efficiency and can be adopted only in the presence of S-hyper type signals. Removal of the signal baseline has been done using an effective performance method. However, some errors may appear in some cases during long recording periods due to lack of signal stability, as when the patient moves, for example.The following ideas can be discussed when determining the type of the vascular tone and based on the DKI and DCI values see . If a poFor the recorded signals of subject 1, it is clear see , that thFuture studies should focus on gathering the bioimpedance data from healthy volunteers in different positions . Also, data from patients with specific diseases that affect the blood flow and the elasticity of blood vessels in the extremities should be acquired.Also, the effect of the breathing phase on the ratio between the systolic wave peak and the diastolic wave peak in every cycle should be evaluated. There is research in progress that is studying the relationship between pulse wave velocity and vascular tone type.In this research, signals have been recorded only on healthy subjects who have the ability to remain in a state of rest and relaxation for the entire duration of the recording period. In fact, the proposed method requires a high relaxation level of the volunteers . The used device needs to be developed so that the signal can be wirelessly transmitted without the need to use connecting cables between the device and the electrodes. The reason is that any movement of the patient during recording affects stability of the recorded signal. However, this remains technically difficult because of the large number of channels used.In this work, an approach has been presented to determine the vascular tone type and its temporal and spatial changes in all segments of human limbs. The study is based on the bio-impedance signals recorded using the multi-channel system Rio-32.The work elaborates on the steps of processing the acquired signal. It shows the methodology of detecting and dividing type of the vascular tone. It also identifies the main types of signals that can be found in the extremities and the places of appearance. In order to show the results in a simple way for non-specialists in signal processing, a graphical interface has been created. This interface displays the type of the vascular tone in each limb segment. It also identifies the breathing phase during the entire recording period of the subject. The effect of the breathing phase on the vascular type in the studied case (subject 1) has been discussed. Main limitations and difficulties of this research have been outlined.Future work is aimed at recording the signals of healthy volunteers in different conditions, and recording signals of patients with cardiovascular diseases. Finally, it also aims to determine changes that accompany the vascular tone of the limbs in healthy and pathological conditions."}
+{"text": "JCI, Zhang, Moorlag, and colleagues tackle this question by combining an in vitro model system of TI with single-cell RNA sequencing. The induction of TI in human monocytes resulted in three populations with distinct transcriptomic profiles. Interestingly, the presence of lymphocytes in the microenvironment of monocytes substantially impacted TI. The authors also identified a similar population of monocytes in various human diseases or in individuals vaccinated with bacillus Calmette-Gu\u00e9rin. These insights warrant in-depth analysis of TI in responsive versus nonresponsive immune cells and suggest that modulating TI may provide a strategy for treating infections and inflammatory diseases.Although the memory capacity of innate immune cells, termed trained immunity (TI), is a conserved evolutionary trait, the cellular and molecular mechanisms involved are incompletely understood. One fundamental question is whether the induction of TI generates a homogeneous or heterogeneous population of trained cells. In this issue of the  The dogma that only adaptive immune cells are able to generate immune memory has been challenged by studies in simple organisms , as well as complex organisms , defining the existence of memory in innate immune cells . TrainedJCI, Zhang, Moorlag, et al. elegantly investigated the effect of various training agents on the induction of TI in human monocytes/macrophages at single-cell resolution. Additionally, the authors showed the potential contribution of adaptive immune cells to the magnitude of induced TI. Finally, they validated their findings using recently published data sets in monocytes/macrophages isolated from the blood of patients with various illnesses  or BCG-vaccinated individuals  signaling after BCG vaccination (Mycobacteriumtuberculosis) are able to use the type I IFN signaling pathway to inhibit TI  that is required for the generation of bioactive lipids such as prostaglandin E2 (PGE2). This result agrees with a previous study demonstrating that NK cell\u2013derived IFN-\u03b3 induces a regulatory program in monocytes, including increased PGE2 production, prior to egress from the bone marrow  of TI, the study by Zhang, Moorlag, et al. provides the first evidence of the heterogeneity (responsive vs. nonresponsive) of TI in human monocyte and macrophage populations and hints at a functional role of these subsets in several human diseases . The aut"}
+{"text": "For most viral encephalitides, therapy is merely supportive. Intravenous immunoglobulins (IVIG) have been used as a prophylactic and therapeutic approach. We conduct a systematic review on the safety and efficacy of IVIG in viral encephalitis.We conducted a systematic review assessing PubMed, Cochrane Database, Biosis Previews and the ClinicalTrials.gov website to identify all reports on patients with viral encephalitis treated with IVIG as of May 31, 2019. The main outcomes assessed were therapeutic efficacy and safety. For an increased homogeneity of the population, atypical viral infections were excluded, as were reports on prophylactic IVIG use, intrathecal application of immunoglobulins, or use of antibody-enriched IVIG-preparations. Data were extracted from published studies. Descriptive statistics were used.p\u2009=\u20090.0027). None of the studies report significant differences in the number of serious adverse events.We included a total of 44 studies (39 case reports). The case reports cover a total of 53 patients. Our search retrieved two prospective and three retrospective studies. These show heterogeneous results as to the efficacy of IVIG therapy. Only one study reports a significant association between IVIG-use and death (odds ratio 0.032; 95% confidence interval 0.0033\u20130.3024; Data on the efficacy of IVIG-therapy is heterogeneous. While it seems generally safe, evident superiority compared to supportive treatment has not been demonstrated so far. Future trials should also investigate the optimal dosing and timing of IVIG and their benefit in the immunosuppressed. Encephalitis is an acute neurological syndrome characterized by altered mental status in combination with two or more secondary diagnostic criteria . The cause is unknown in approximately half of all cases. In the remainder, up to 50% are due to viral pathogens . While sPatients at particular risk for viral encephalitis are those with congenital, acquired, or iatrogenic immunodeficiencies. Severe courses of viral encephalitides have\u2014among others\u2014been described after therapy with CD20-depleting agents . These aIn autoimmune encephalitis, the use of intravenous immunoglobulins (IVIG) is backed by controlled trials and has explicitly been recommended , 6. TheyWe conducted a systematic review and report it according to the Preferred Reporting Items for Systematic Reviews and Meta-Analyses (PRISMA) standards . The maiWe performed a MEDLINE literature search using PubMed to identify all reports as of May 31, 2019 with no restrictions on start date using the search terms  AND \u201cImmunoglobulins, Intravenous\u201d (Mesh) and  and \u201cImmunoglobulins, Intravenous/therapeutic use\u201d (Mesh). Other databases searched include the Cochrane Database, Biosis Previews and the ClinicalTrials.gov website . Titles and abstracts of the reports obtained were screened for inclusion in the review using the following criteria: population with viral encephalitis ; outcome and safety of IVIG therapy . Exclusion criteria were based on the intention to increase the homogeneity of the population under investigation.Articles published in languages other than English, German, French or Spanish as well as duplicate studies, preclinical studies, editorials and reviews (except for secondary search) were excluded. Included were all case reports, case series, retrospective and prospective observational studies, and randomized controlled trials. A secondary search for other relevant articles was performed in the articles included after full-text analysis as well as in reviews on the topic.The main outcomes assessed for observational studies, case series and clinical trials were efficacy and safety of the therapy. Efficacy was defined as survival. Safety was defined as number of severe adverse events. Secondary outcome parameters are listed in the results section if available from the reports. For case reports, the clinical outcome as stated in the respective paper is listed in Table \u00ae. Descriptive statistics were used. Where available, statistical results from group comparisons were extracted from the paper. If unavailable, odds ratios (OR) including 95% confidence intervals (CI) were calculated using individual patient data reported by the authors. Statistical significance was assessed using Fisher\u2019s exact test.Statistics were performed by JW using MedCalcA systematic assessment of the available evidence was conducted using the GRADE  methodology , 10. A mThe study was exempt from ethical approval procedures by the Ethics Committee of Upper Austria.We screened a total of 377 studies, 44 of which were included see Fig.\u00a0: one proThe most common pathogens in adults (case reports) included West Nile virus (17 patients), enterovirus (four patients) and Epstein Barr virus (three patients), whereas, in children, enterovirus (eight patients), parvovirus B19 (three patients) and mumps virus (two patients) were most frequently reported. IVIG was used as monotherapy in seven patients and as add-on therapy in 46 patients in combination with acyclovir (21 patients), steroids (17 patients), interferon alpha-2b (nine patients), and ganciclovir (six patients). Other therapies applied included valganciclovir, plasma exchange, ribavirin, and pleconaril. In 13 patients, reduction of immunosuppression as part of the antiviral treatment was explicitly mentioned.Modalities of IVIG-administration varied widely. The most frequently reported dose was 400\u00a0mg/kg (16 patients). The number of patients in whom this dose was used may have been higher as some authors only report total doses or do not specify the amount of IVIG applied. Application frequency varied between a single infusion and a continuous therapy in patients with ongoing immunosuppression.IVIG-therapy was started between one and 101\u00a0days after symptom onset. For 28 patients, no information has been provided on the interval between symptom onset and the start of IVIG. For 20 patients, neither the interval between symptom onset nor hospital admission and the start of therapy was reported. Median treatment delay was 6.5\u00a0days  and ten days (from symptom onset) in those patients that died, and 4.5 respectively eight days in those that recovered completely. This difference was even greater for West Nile Virus encephalitis patients with a median treatment delay of ten days from symptom onset in those who died and four days in those in whom symptoms remitted completely. No adverse effects of IVIG were explicitly mentioned.p\u2009=\u20090.02) or enteroviral encephalitis . Unsurprisingly, more patients died in the ICU than in the non-ICU group . Of 53 patients, 44 were alive at the last follow-up. For 21 patients, full recovery was reported. In 20 patients, there were residual symptoms, in six of them severe ones . 9 patients had died \u2014all of them had been immunosuppressed. For three patients, no follow-up information was available. For details on all case reports see Table Intensive care (ICU) dependency was explicitly reported for 26 patients. Most of these had a diagnosis of West Nile Virus encephalitis  in Nepalese children with suspected JE  with a third group of 14 patients who did not receive IVIG [ patientsDetails on the trials, observational studies, and the case series including GRADE ratings are listed in Table Data on the efficacy of IVIG-therapy collected from case reports, case series, observational studies, and one RCT is heterogeneous. A clear superiority compared to supportive treatment could not be demonstrated. The data generated by the case series, observational studies and the RCT is of low-quality due to small and heterogeneous study populations and interventions, incomplete data, and possible selection, allocation, and detection bias. Most patients received IVIG as add-on therapy, thereby obscuring whether therapeutic effects were actually caused by this compound. Furthermore, the generalizability of the results to other pathogens and different socioeconomic settings is questionable. Hence, a general recommendation as to the use of IVIG in viral encephalitis cannot be made at this point.The case reports reveal a strong association of fatal outcomes with pre-existing immunosuppression. Many patients included received combinations of steroids, calcineurin inhibitors, mycophenolate acid, and anti-CD20 therapeutics, leading to a combined deficiency of the T- and B-cell lines. In these patients, close monitoring of serum immunoglobulin levels to identify those who might benefit from replacement therapy may be advisable. In a cohort study of 8633 patients receiving rituximab, approximately half of patients whose immunoglobulin levels were investigated had hypogammaglobulinaemia . The ratSide effects were reported in none of the case reports, case series, observational studies, or the RCT. This may be due to publication bias. In some patients, IVIG side effects may also have been mistaken for symptoms of the underlying disease.Considering the high mortality and morbidity of encephalitis and the paucity of specific treatment options, more studies are urgently needed. One clinical trial investigating the role of early IVIG treatment in children with encephalitis (NCT02308982) is underway, investigating the effect of this therapy on clinical outcome (primary outcome measure). Future trials should analyze the following parameters as well:IVIG are plasma products of pooled IgG derived from multiple donors. They contain immunoglobulins directed at a wide variety of pathogens. Their exact composition depends on the prevalence of infectants in the geographic area of the population that contributed to the pool . A twofo65\u201367 While their use seems intuitively convincing, data as to their efficiency is controversial: a recently published trial of 62 hospitalized WNV encephalitis patients randomized to receive Omr-IgG-am\u00ae (an IVIG containing antibodies specific for WNV), standard IVIG, or normal saline showed no significant differences between groups receiving Omr-IgG-am compared with IVIG or saline for either the safety or efficacy endpoints [Experiments in mice demonstrated a dramatically reduced mortality in mice treated with IVIG-batches obtained from donors from a region endemic for West Nilve virus (WNV) compared to those obtained from US-donors harvested before WNV was introduced in the US . Similarndpoints . ReasonsAlternative routes of immunoglobulin application that have been described include intramuscular, subcutaneous, and intrathecal administration. Although meningeal inflammation enhances IVIG penetration of the blood\u2013brain barrier, the amount of IVIG entering the CNS is unpredictable. Hence, direct installation of IVIG into the intrathecal space may be more efficient . While sMost articles included in this review report IVIG doses of 400\u00a0mg/kg. However, the approaches vary widely and are somewhat arbitrary as the ideal dosing has not yet been established. The mechanism of actions of IVIGs seems to be dose-dependent, with higher doses needed to obtain an immunomodulating effect, which may be desirable for some infections, but not for others . In a muThe same uncertainty applies to the timing of IVIG-therapy. We found a wide variation of the time span between symptom onset and therapeutic IVIG in the case reports included in this review. Delays to initiate therapy were most often associated with slowly progressive, unspecific clinical presentations that may occur with enteroviral or parvoviral infections, for example , 32. SevHowever, some effect on mortality by inoculation of IVIG was seen even after the virus had reached the brain , 36. UndThe data obtained for this review do not permit conclusions as to which kind of viruses are more susceptible to IVIG therapy than others. However, the observations detailed above suggest that IVIG may eradicate those pathogens more efficiently that either remain bloodborne for an extended period and/or cause a significant BBB disruption. Many vector-borne viruses are transmitted via inoculation into the bloodstream where they may be neutralized by IVIG. As discussed above, they only remain bloodborne for a few days, necessitating a high level of suspicion and early commencement of therapy to obtain optimal results. On the other hand, studies on imaging characteristics in tick-borne encephalitis and West Nile virus encephalitis show that intraparenchymal contrast-enhancement as a sign of BBB disruption is uncommon in these diseases , 42. HenContrasting with the pathophysiology of vector-borne viruses, herpes simplex encephalitis is thought to occur via neuronal transmission. This may render IVIG therapy less efficient if administered early. However, diagnostic imaging frequently shows contrast-enhancement, probably rendering these patients amenable for add-on immunoglobulin treatment at this stage . In thisIn conclusion, only very low-quality evidence as to the clinical benefit and adverse effects of IVIG treatment in viral encephalitis exists. While IVIG application seems generally safe, its efficacy is still unclear. Hence, the indication and minutiae of IVIG-therapy in patients with viral encephalitis continue to rest on individual, case-specific decisions. RCTs in selected patient populations are needed to clarify its role in this severely affected cohort. Shortcomings of our review include the low-quality data of the reported studies due to small and heterogenous study populations and a high risk of bias, as well as incomplete data on individual patients and the confounding effect of multiple therapies."}
+{"text": "The statistical inference of the reliability and parameters of the stress\u2013strength model has received great attention in the field of reliability analysis. When following the generalized progressive hybrid censoring (GPHC) scheme, it is important to discuss the point estimate and interval estimate of the reliability of the multicomponent stress\u2013strength (MSS) model, in which the stress and the strength variables are derived from different distributions by assuming that stress follows the Chen distribution and that strength follows the Gompertz distribution. In the present study, the Newton\u2013Raphson method was adopted to derive the maximum likelihood estimation (MLE) of the model parameters, and the corresponding asymptotic distribution was adopted to construct the asymptotic confidence interval (ACI). Subsequently, the exact confidence interval (ECI) of the parameters was calculated. A hybrid Markov chain Monte Carlo (MCMC) method was adopted to determine the approximate Bayesian estimation (BE) of the unknown parameters and the high posterior density credible interval (HPDCI). A simulation study with the actual dataset was conducted for the BEs with squared error loss function (SELF) and the MLEs of the model parameters and reliability, comparing the bias and mean squares errors (MSE). In addition, the three interval estimates were compared in terms of the average interval length (AIL) and coverage probability (CP). X denotes the strength and Y denotes the stress applied to the system. Birnbaum [X and Y have generalized Rayleigh distributions. These authors explained the influence of the mixed proportion parameters on the reliability of the model.The stress\u2013strength model is used extensively in mechanical engineering. The model plays a crucial role in designing and analyzing the reliability of system equipment. In the model, the reliability of a system is described by the relationship between the strength of the system and the stress applied to the system. If the strength of the system is unable to resist the stress applied to the system, the system fails. Therefore, Birnbaum  was the Birnbaum . Since tBirnbaum  proposedBirnbaum  studied Birnbaum  calculats-out-of-j system has gained extensive attention in the fields of engineering and precision equipment design; we call it multicomponent system in reliability analysis research. The system comprises j components, and the strength of each component Y. Such a system works when j solar panels. The power generation system would supply power only when at least s solar panels generate electricity normally. In irrigation techniques in agriculture, if the storage capacity of the reservoir in one month of the year exceeds that in the month of August of the previous year, it is considered that there would be no drought in that year. Therefore, the storage capacity of the reservoir in the month of August of the previous year is regarded as the stress, while the storage capacity of the reservoir between January and June of the next year is regarded as strength. Therefore, the stress\u2013strength model of the 1-out-of-6 system may be used for analyzing the problem. The reliability analysis for the MSS model under exponential distributions was studied by Kunchur and Munoli [n-component-standby system. Eryilmaz [In fact, various products have been developed as technology advances, ranging from simple single-component systems to complex multicomponent subsystems. Multi-component-system products are the mainstream in recent years. Therefore, studying the reliability of multicomponent systems in the stress\u2013strength model (MSS) has become the focus of reliability research. At present, the d Munoli ,8,9, on d Munoli  and Liu d Munoli  studied Eryilmaz  reportedX and Y obey two independent Weibull distributions. Mirjalili et al. [Censoring samples may be particularly difficult for statistical analysis work. If the sample is not accounted for and processed, the analytical results would be erroneous. In this context, different statistical techniques are employed to deal with the corresponding censoring methods. Using progressive type-II censored samples and the MSS model, Valiollahi et al. , Rezaei i et al.  discussei et al.  derived Most of the systems stated above assume that the stress and strength variables have the same distribution; accordingly, the characteristics of the stress\u2013strength model are analyzed. However, as stated in ,20, stre(1)Comparison between MLE and BE, in terms of the reliability estimation of the MSS model;(2)Influence of the GPHC scheme on the reliability estimation of the MSS model;(3)Theoretical basis for the exact interval of the model parameters and a comparison between the ECI, ACI, and HPDCI, in terms of AIL and CP.In the present study, to reduce the cost and time as much as possible, a stress\u2013strength model of a multicomponent system with wider application and more accurate reliability estimation is obtained. On the one hand, the stress and strength variables were assumed to have different distributions based on the GPHC scheme. On the other hand, the estimated values of the model parameters and reliability were obtained using the mathematical-statistical method. Specifically, the following issues were studied:R of the MSS model, determined under the GPHC scheme, are discussed. The derivation of the MLEs, ACIs, ECIs, BEs, and HPDCI for the parameters and the R of the MSS model are presented in The remaining portion of the paper is organized as follows. In Gompertz  was the l-Gohary , has shoChen  proposedh et al.  and othen units. We assumed (1)Setting the fixed integer (2)Setting the censoring scheme to (3)T. It is the test time limit and a bounded integer;Setting time (4)Calculating ioned in , T* is tTian  proposedJ is the number of failures before T, and s-out of -j system: the G system. Due to that, the sample size in the GPHC scheme is random. Basing on the scheme, the likelihood function is: Based on these preparations, the life tests are carried out as follows: the failure time of the first observation is Y is the common random stress, following Bhattacharyya and Johnson  developeFurthermore, According to the binomial theorem: Equation  can be rN identical systems are placed in a life testing experiment, each with K components. These components are independently and identically distributed, and their strength comes from To derive the maximum likelihood estimation (MLE) of This is a MSS system, and the likelihood function is given by: Thus, the likelihood equations are: Since Equation  is complFurther, the variance\u2013covariance matrix is expressed as: The To obtain the ACI of the reliability Lemma\u00a01.where Corollary\u00a01.Let \u03f5=where Proof\u00a0of\u00a0Corollary\u00a01.Using the delta method  and the The ACI of Based on the assumption in C obeys a D follows a C and D are independent. Then, we define: Then, It can be easily found that for Lemma\u00a02.For any Lemma\u00a03.Let:Then, Corollary\u00a02.If Proof\u00a0of\u00a0Corollary\u00a02.By Lemma 3, it is easy to show that Theorem\u00a01.Suppose that where Proof\u00a0of\u00a0Theorem\u00a01.Theorem\u00a02.Based on the assumption of Theorem 1, a where Proof\u00a0of\u00a0Theorem\u00a02.From Equation , we know\u25a1Z has a Q has a Z and Q are independent. We define: Let So, Lemma\u00a04.For any Lemma\u00a05.Let:Then, Corollary\u00a03.If:then the equation Proof\u00a0of\u00a0Corollary\u00a03.By Lemma 5, it is easy to show that Theorem\u00a03.Suppose that where Proof\u00a0of\u00a0Theorem\u00a03.From Equation , we know\u25a1Theorem\u00a04.Suppose that where Proof\u00a0of\u00a0Theorem\u00a04.From Equation , we know\u25a1In this section, we consider the BEs of unknown parameters from G, the BE of the parameters is the posterior mean. Therefore, the BE of any function The joint posterior distribution of The conditional posterior distributions of It can be seen that (1)Start with initial values of (2)Generate (3)Using the MH method, generate (4)Calculate (5)N times, and obtain Repeat steps 2 to 4 Below is a hybrid algorithm with Gibbs sampling steps for updating the parameters M is the burn-in period.The BEs of In this section, we show some results through numerical experiments and real data in order to compare the performance of the different methods described in the previous section.In this subsection, the performances of the MLEs and BEs under different GPHC schemes are investigated by a Monte Carlo simulation. For this purpose, the different estimates are compared in terms of bias and mean square errors . In addition, the different confidence intervals, namely, the ACI, ECI, and HPDCI, are compared in terms of AIL and the CP. The censoring schemes are given in In the simulation study, we set the parameter values as follows: Equation , R1,6=0.ethod of , GPHC saStep 1. Generate independent and identical random variables Step 2. Let Step 3. According to the scheme Step 4. Let Step 5. Let Step 6. Under the GPHC sample, there are three cases:(i)Case I: (ii)Case II: (iii)Case III: Based on the above method and the MSS model, and using the censoring scheme in We obtain the BEs based on 4000 MCMC samples and discard the burn period. We repeat the process 2000 times in each scheme, and then obtain the MLEs and BEs of the parameters according to the method described in From Here, we analyze a dataset that was first published in Musa  and discScheme 1: Scheme 2: X and Y, we first censor some elements from the Y by the method explained in Y, we remove the same row of the X sample. In the remaining sample of X, we apply the censoring scheme for each row. Comparing To obtain the censoring sample from For interval estimation, it is observed that the CPs of the exact interval and HPDCI for the parameters are close. Comparing scheme I with scheme II, s-out-of-j system) and the GPHC scheme, along with two point-estimation methods, namely, maximum likelihood and Bayesian methods, and three interval-estimation methods, namely, ACI, HPDCI, and ECI. Repeated numerical simulation tests were performed, which, together with a set of reservoir storage data, revealed that the GPHC scheme could ensure the accuracy of the reliability estimation of the MSS model. Moreover, limiting the distribution types of the stress and strength variables was not required in the setting of the model, and a further accurate reliability estimation value of the model could be obtained within a short life test duration and at a reduced cost. In addition, numerical experiments were conducted, the results of which indicated that the CPs of the ECI for the parameters were close to the HPDCI, and the HPDCI was better than the ACIs of the MSS model parameters and reliability, in terms of the AILs and CPs. In terms of AIL, there was little difference among the ACI, HPD, and ECI of the parameters, although the ECIs were better than the ACIs and HPDCIs in terms of CPs. In addition, Industrial safety accidents occur frequently, mainly because the accuracy of reliability estimations of industrial system equipment are unable to meet the specific requirements. Therefore, it is of great significance to select appropriate estimation methods, progressive censoring life tests, and estimation evaluation criteria to improve the accuracy of system reliability estimation in existing industrial systems. The present study utilized the extensively used multicomponent system stress\u2013strength model (also referred to as the The GPHC scheme is similar to the progressive type-II censoring scheme in a special case. This scheme is a generalization of the progressive and hybrid censoring schemes, due to which the results could be further extended. On the other hand, as the distribution types of the model variables were not limited in the present study, the reliability of the MSS model has complex forms, and there is no relevant mathematical and statistical theory support; thusm the ECI of the MSS model reliability could not be obtained. In the present study, the multicomponent system was limited to a non-repairable system, while industrial production often involves repairable multicomponent systems. Therefore, further research could involve the combination of the multicomponent repairable stress\u2013strength model and a censoring scheme."}
+{"text": "The results showed that when wheat, maize, cassava, mung bean and sweet potato amylopectins were mixed with ASG, the disulfide bond contents of alkali-soluble glutenin increased from 0.04 to 0.31, 0.24, 0.08, 0.18 and 0.29 \u03bcmol/g, respectively. However, after cold storage, they changed to 0.55, 0.16, 0.26, 0.07 and 0.19 \u03bcmol/g, respectively. The addition of wheat amylopectin promoted the most significant disulfide bond formation of ASG. Hydroxyproline only existed in the wheat amylopectin, indicating that it had an important effect on the disulfide bond formation of ASG. Glutathione disulfides were present, as mung bean and sweet potato amylopectin were mixed with ASG, and they were reduced during cold storage. Positive/negative correlations between the peak intensity of the angles at 2\u03b8 = 20\u00b0/23\u00b0 and the disulfide bond contents of ASG existed. The high content of hydroxyproline could be used as a marker for breeding high-quality wheat.Wheat, maize, cassava, mung bean and sweet potato starches have often been added to dough systems to improve their hardness. However, inconsistent effects of these starches on the dough quality have been reported, especially in refrigerated dough. The disulfide bond contents of alkali-soluble glutenin (ASG) have direct effects on the hardness of dough. In this paper, the disulfide bond contents of ASG were determined. ASG was mixed and retrograded with five kinds of amylopectins from the above-mentioned botanical sources, and a possible pathway of disulfide bond formation in ASGs by amylopectin addition was proposed through molecular weight, chain length distribution, FT-IR,  It can increase the viscoelasticity of cooked wheat-based food at a low cost in the food industry . Accordi07 g/mol . Further07 g/mol . Regardi07 g/mol . Further07 g/mol  showed tChen et al. 2021) reported that higher temperatures increased sulfhydryl\u2013disulfide bond (SH-SS) interchange to promote the aggregation of gluten 021 repor, thus pr13C solid-state NMR, IR and X-ray diffraction analyses.In this paper, the effects of mixing different amylopectins from wheat, maize, mung bean, tapioca and sweet potato starches with alkali-soluble glutenin on disulfide bond formation before and after retrogradation were investigated. The objective of the present study was to determine which amylopectin promotes the most significant glutenin disulfide bond formation and to deduce the possible interaction mechanism by comparing the results of molecular weight, chain length distribution, Wheat and maize starches were purchased from He Nan Enmiao Food Co., Ltd.  sweet potato starch was purchased from the Beijing Gusong Economic and Trade Company , mung bean starch was purchased from Hengshui Fuqiao Starch Co., Ltd.  and cassava starch was purchased from Guangxi Napoheshan Starch Co., Ltd. . Bacillus subtilis thermostable and mid-temperature \u03b1-amylase (12000 U/mL), microbial lipase  and neutral protease  were all produced by Beijing Solarbio Science & Technology Co. Ltd. . Sodium hydroxide, sodium chloride and hydrochloric acid were obtained from Tianjin Fengchuan Chemical Reagents Co., Ltd. . Sodium chloride  was purchased from Tianjin Hengxing Chemical Reagent Manufacturing Co., Ltd. . Pullulanase  was obtained from Beijing Solarbio Science & Technology Co., Ltd. The dialysis bags , MWCO 14,000 Da) were produced by the Union Carbide Corporation . Tris, glycine, disodium EDTA, urea, guanidine hydrochloride and DTNB reagents were all obtained from Beijing Soleibo Science & Technology Co. Ltd. The P120H Ultrasonic Cleaner was produced by Elma Schmidbauer GmbH in Germany.g for 3 min) to obtain the precipitates. Those precipitates were dissolved in 1% sodium chloride solution under constant stirring for 10 min to dissolve the amylose, and the precipitation (crude amylopectin) was obtained by centrifugation (4000\u00d7 g for 5 min), and the supernatant fraction was discarded. Crude amylopectin (21~26 g) was isolated by repeated dissolution in 1% NaCl solution and centrifuged several times, as mentioned above, until no blue color appeared in the precipitation\u2013iodine complex.Crude amylopectin was produced according to basic principle in the literature ,14, acco\u22121 NaOH. Finally, both the lipase and alkali proteases were inactivated by boiling for 10 min. The solutions were centrifuged (4000\u00d7 g for 10 min) to obtain the precipitates. The purified amylopectins  were prepared by washing the precipitates using deionized water several times until there was no turbidity when a drop in AgNO3 was added. The amylopectins for the IR, 13C solid-state NMR and X-ray diffraction analyses were obtained after the samples had been dried at 60 \u00b0C in an oven to obtain a constant weight.In order to completely remove a small amount of co-extracted or associated compounds, such as protein or lipid, from the crude amylopectins, the crude amylopectins were hydrolyzed by lipase and alkali protease in sequence, according to . After bg for 10 min. Again, the gliadin in the precipitate was extracted by above-mentioned method several times until no viscous gliadin was clearly present. Finally, the glutenin, at the weight of 114 g (wet weight)/49 g (dry weight), was obtained by centrifugation. Approximately 20 g of wet glutenin (8.5 g dry weight) was added to 200 mL of 0.1% NaOH and stirred to extract the ASG for 120 min at room temperature. Then, the solution was centrifugated at 4000\u00d7 g for 5 min to remove the alkali-insoluble glutenin. The above-mentioned supernatant was gently placed in beaker to obtain coagulation precipitates at 50 \u00b0C for 12 h. The coagulation precipitation was isolated by centrifugation at 4000\u00d7 g for 5 min. This precipitation was dialyzed to remove the sodium and hydroxide ions, and 21.5 g wet/2.2 g dry weight of ASG was obtained.Glutenin was separated from gluten using a reference method, with certain modification . Further13C solid-state NMR and X-ray diffraction were dried to a constant weight at 60 \u00b0C in an oven.The wheat, maize, potato, mung bean and cassava starches, at a wet weight of 1g, corresponding to dry weights of 0.090, 0.062, 0.075, 0.205 and 0.135 g, respectively, were mixed with ASG at a wet weight of 0.3 g (0.03g dry weight). The mixtures were stirred with a small bamboo skewer at 37 \u00b0C for 2 h. The wet mixtures were used to determine the contents of disulfide bonds, and the samples for IR, 3C solid-state 1NMR and X-ray diffraction were dried to a constant weight at 60 \u00b0C in an oven.The wet mixtures mentioned in The disulfide bond contents were determined according to the method described by Zhu et al. 2019) , with so , with s1) contents:Determining the free sulfhydryl group (SHg) for 10 min, and the supernatants were collected to determine the absorbance at 412 nm.The wet samples described in 2) contents:Determining the total sulfhydryl group (SHg) for 10 min, and the supernatants were gathered to determine the absorbance at 412 nm.The wet samples described in 1 and SH2 contents of each sample were calculated as shown in Formula 1, and the disulfide bond contents were calculated as shown in Formula (2):412 is the absorbance at 412 nm, D is the dilution factor, C is the sample concentration (mg/mL) and 73.53 is derived from 106/1.36 \u00d7 104, where 1.36 \u00d7 104 is the molar extinction coefficient.The SH\u00ae\u00ae HMW 6E DMF 250 and 1000, 7.8 mm \u00d7 300 mm, Waters, Milford, MA, USA) at 45 \u00b0C. Dimethyl sulfoxide (DMSO) with 50 mM NaNO3 was used as the mobile phase at a flow rate of 0.6 mL/min. The MALLS detector was calibrated by Dextran standards (T40 and T2000). Astra software  was used to handle the data in order to determine the molecular characteristics of the molecular weight.The molecular weight distribution of the five amylopectins was determined by high-performance size-exclusion chromatography (HPSEC) using a multi-angle laser light-scattering detector  and a refractive-index detector  . A totalg. The above-mentioned solutions were injected into the HPAEC-PAD system  after being filtered through a 0.5 \u03bcm membrane filter. Data were collected and managed using Chromeleon software .High-performance anion-exchange chromatography with pulsed amperometric detection (HPAEC-PAD) was used to determine the chain length distribution of the five amylopectins . The amyw/w) at the rate of 1:60 (w/w). The mixtures were pressed into sheets using a tablet press. Then, Fourier-transform infrared spectroscopy  was used to obtain the data in the transmission mode at 27 \u00b0C.KBr (spectroscopic grade) was dried at 120 \u00b0C for 2h and kept in the dryer after being cooled to room temperature. Then, every sample was blended with KBr  in the IR spectra, were calculated according to [\u22121, \u03b2-sheets at 1625\u20131642 cm\u22121, \u03b1-helices at 1650\u20131660 cm\u22121, \u03b2-turns at 1670\u20131680 cm\u22121 and antiparallel \u03b2-sheets at 1680\u20131695 cm\u22121. The content of each secondary structure of ASG was obtained by processing Csv-format infrared data with the Peakfit software.The secondary structures of glutenin in the samples, characterized by the amide I band  was from 3\u00b0 to 60\u00b0, and the step size was 0.02\u00b0. The counting time was 0.8\u2009s.The XRD patterns of dried samples were obtained using a D/MAX-2500 Advance diffractometer . The diffractometer was operated at 200\u2009mA and 40\u2009kV. The scanning region of the diffraction angle (2p < 0.05).The data presented in the paper are all expressed as the mean \u00b1 S.D. The statistical significance of differences between the control and treated samples was evaluated by two-sample t-tests of variance with Excel. Every sample was determined in triplicate. The significant differences between the means of all samples were calculated using a Dunnett\u2019s test  and 3298 cm\u22121  in \u22121 in the field for any of the samples. The smooth degrees of the infrared absorption peak at ~3301 cm\u22121 are reduced for the wheat, maize and sweet potato groups, increased for the cassava group and unchanged for the mung bean group.\u22121 and amide II  at ~1529 cm\u22121 are all very weak, and bands only appear at around ~1644 cm\u22121. Such bands are assigned to the H-O-H bending mode of water [The typical protein bands for amide I  at ~1633 cmof water , becauseof water . These a\u22121 are characteristic of aggregations with the \u03b2-sheet, extended \u03b2-sheet, \u03b1-helical, \u03b2-turn and extended \u03b2-sheet conformation structures, respectively [The secondary structure of protein can be determined by the analysis of the Fourier-deconvoluted data. Five bands at approximately 1605, 1632, 1652, 1680 and 1695 cmectively . The chaectively . ASG con\u22121 (trans-gauche-trans conformation), respectively [We therefore focused our attention on the symmetrical stretching vibration of the disulfide bonds at 500\u2013510 (assigned to gauche-gauche-gauche conformation), 515\u2013525 (gauche-gauche-trans conformation) and 535\u2013545 cmectively . There a\u22121 (marked with a dashed black arrow) in The characteristic band at ~432 cm13C solid-state NMR spectra of ASG mixed with and without different amylo-pectins, and those of mixed samples before and after retrogradation. 13C solid-state NMR spectra of the different amylopectins mixed with and without ASG. According to [The original intention of this paper was to explore the mechanism by which wheat amylopectin promotes the formation of disulfide bonds in gluten. The chemical bonds newly formed and certain secondary structure of ASG to enhance disulfide bonds would be identified by comparing the results of the rding to , resonanrding to .\u03b4), 172 ppm (backbone C=O), 60 ppm , 52 ppm , 48 ppm (P\u03b4), 42 ppm , 30 ppm  and 25 ppm  and the shoulders at 19\u201321 ppm  are all very weak or absent with respect to ASG, as shown in \u03b4 linked with N-glycosidic bond), 172.2 ppm (backbone C=O), 132.6 ppm (Y\u03b4), 131.4 ppm (Y\u03b3), 128.5 ppm (Y\u03b5), 103.4 + 95.1 and 82.1 ppm (C1 and C4 of the oligosaccharides in the amorphous region), as well as 31.9 ppm (Gln C\u03b2). The resonances for C2, 3, 5, 6 of the oligosaccharides in all the samples, as shown in \u03b4 linked with an N-glycosidic bond without Tyr), 171.5 ppm (hydrogen-bonded backbone C=O), 32.6 ppm (Gln C\u03b3) and 31.5 ppm (hydroxyproline (HYP) C\u03b2) show that, compared to ASG, wheat amylopectin combines with a kind of protein containing no Tyr and having a HYP in the side chains. When ASG is mixed with wheat amylopectin, as shown in \u03b4 and C=O shift to the lower and higher fields, respectively, and those of Y\u03b3 (131.4 ppm) in ASG and HYP C\u03b2 (31.5 ppm) in the wheat amylopectin disappear. The former may be caused by the formation of hydrogen bonds, and the latter may form a covalent bond between the two amino acids. Dough formation is a hydration process, and hydrogen bonds should form between the Q\u03b4/backbone C=O and water. According to the results in \u03b6 of ASG and HYP C\u03b3 in wheat amylopectin promote \u03b1-helix formation. The Y\u03b3 of ASG and HYP C\u03b2 are buried in the \u03b1-helix structures, which leads to the loss of their resonances. This is an important step through which wheat amylopectin promotes the disulfide bond formation of ASG. The resonances at 161.7/160.3/159.6/158.8ppm are assigned to Tyr C\u03b6 (Y\u03b6) [\u03b4 linked with the N-glycosidic bond shifts to a higher field, indicating that the hydrogen bonds between Q\u03b4 and water disappeared during retrogradation. This can also be proved by the precipitation of the water on the surface of the sample after retrogradation. The reappearance of resonances at 131.4 ppm (Y\u03b3) and loss of resonances at 132.5 ppm (Y\u03b4) suggest that they probably combine with sulfhydryl and are involved in disulfide bond formation. The resonance for the hydrogen-bonded backbone C=O at 171.3 ppm is always present, showing that the hydrogen bonds between C=O and water remain unchanged. It is noteworthy that the increase in the resonances for Y\u03b6 at 159.6/158.8 ppm appears in the retrograded wheat amylopectin + ASG group in \u03b6 that were originally involved in the formation of the covalent bonds return to their original hydroxyl state. The cleavage of the covalent bonds in the dough is probably caused by the autoclaving treatment before retrogradation. Compared with wheat amylopectin, maize amylopectin also combines with protein containing Gln, but no resonance at 31.5 ppm for HYP C\u03b3 appears in \u03b3, but there is an absence of resonance at 132.6 ppm for Y\u03b4, indicating that -S of the sulfhydryl of cysteine might combine with Y\u03b4, unlike that of wheat amylopectin, Y\u03b3. The change degree of the secondary structure of ASG in the maize amylopectin + ASG group is lower than that of the wheat amylopectin group, except for the \u03b2-turn contents. During the retrogradation of the maize amylopectin + ASG, the procedure leads to reductions in the disulfide bond contents from 0.24% to 0.16%, as shown in \u03b6 in this group, as shown in  C\u03b6 (Y\u03b6) , and the\u03b6 of ASG are converted to free ones. The sharply reduced content of intra-molecular aggregation extended \u03b2-sheet secondary structure for mung bean amylopectin + ASG from 60.47% to 48.32% before and after retrogradation implies that the formation of covalent bonds between tyrosines is a prerequisite for the formation of intramolecular disulfide bonds in ASG, which agrees well with the findings of [Whether in mixture or in retrogradation, the absence of resonances for Tyr shows that they are all buried in the secondary structures of the complexes. The enhancement of the resonances at 160.3 and 161.7 ppm for the retrograded mung bean amylopectin + ASG and sweet potato amylopectin + ASG groups, respectively, shows that the hydroxyls of the Ydings of . The fin\u03b8 at ~15o (strong), ~17\u00b0 (unresolved), ~18\u00b0 (unresolved) and ~23\u00b0 (strong); the B-type 2\u03b8 at ~5.6\u00b0, ~15\u00b0 , ~17o (strong), ~20\u00b0 , ~22\u00b0  and ~24\u00b0 ; and the C-type 2\u03b8 at ~17\u00b0 (strong), ~23\u00b0 (strong)~, 5.6\u00b0  and 15\u00b0  [\u03b8 13.32\u00b0, 15.58\u00b0, 17.74\u00b0, 18.16\u00b0, 20.16\u00b0 and 22.96\u00b0, and those of the wheat amylopectin are located at 2\u03b8 15.76\u00b0, 17.46\u00b0 and 20.16\u00b0 in \u03b8 17.38\u00b0 and 20.10\u00b0 remain, and retrogradation has little effect on them. For the maize amylopectin in \u03b8 15.62\u00b0, 17.50\u00b0 and 20.28\u00b0, and the same results as those of wheat amylopectin upon mixture and retrogradation are obtained. The cassava amylopectin in \u03b8 17.44\u00b0 and 23.00\u00b0, which are same as those of the sweet potato amylopectin purified by the hydrolysis of proteases and lipases [\u03b8 20.12\u00b0. For the mung bean amylopectin in \u03b8 17.14\u00b0 and 22.42\u00b0. After being mixed and retrograded with ASG, the diffraction angles for the complexes converted to 2\u03b8~17.14\u00b0, ~19.86\u00b0 and ~22.34\u00b0. Compared with the diffraction angles of ASG, the most obvious change is the absence of angles at 2\u03b8 13.32\u00b0 and 15.58\u00b0. For the sweet potato amylopectin in \u03b8~15\u00b0, and retrogradation causes it to disappear. If only the groups with significant differences are considered, there is a positive/negative correlation between the peak intensity at the diffraction angle of 2\u03b8~20\u00b0/23\u00b0 in It is well-known that the crystal patterns of different granules can be classified into A-, B- and C-types using XRD spectra, and the typical patterns have their own characteristic diffraction angles, with the A-type 2  . A- and   . Figure  lipases . Thus, i lipases . The mix13C solid-state NMR and IR results during the mixing and retrogradation of the different amylopectins and ASG, we speculated on the possible mechanism of the influence of wheat amylopectin on the disulfide bond formation of ASG, as shown in \u03b6 of the Tyr in glutenin and C\u03b3 of the Hyp in wheat amylopectin, as shown in \u03b3-C\u03b4, and this binding may be accomplished with the help of a certain thioltransferase. Based on this, disulfide bonds are formed at this binding site under the combined action of the mixing forces and the movement of the water molecules. These disulfide bonds should be formed in the structure of intra-molecular aggregation extended \u03b2-sheets and \u03b2-turns at this stage, because the increase in their contents coincides with the increase in the contents of the disulfide bonds. Additionally, we can thus speculate that, with the help of water movement, the newly formed \u03b1-helix structure of ASG originates from a random coil structure, which is pulled by the helix of the wheat amylopectin attached to ASG in a spiral movement, as shown in \u03b6 of Tyr in glutenin and C\u03b3 of Hyp in wheat amylopectin, as shown in \u03b4 of Tyr in glutenin. This difference is highly worthy of in-depth study. The increase in the intermolecular \u03b2-sheet and \u03b2-turn structure of ASG at the retrogradation stage is perfectly understandable, because the hydrogen bonds between the glutenin and wheat amylopectin molecules replace those between the glutenin/amylopectin and water. The straightening of these protein molecules provides the cysteine with a greater opportunity to oxidize and form disulfide bonds. The main limiting factors that determine the content of disulfide bonds include the activities of sulfhydryl transferase and sulfhydryl oxidase, the spatial distance between intramolecular or intermolecular cysteines, environmental pH, etc. High-molecular-weight amylopectin can promote and stabilize the formation of disulfide bond during retrogradation, while low-molecular-weight amylopectin may activate disulfide bond reductase in the stage, resulting in a sharp decrease in the disulfide bond contents, as shown in After the comprehensive analysis of the changes in disulfide bond formation, the distribution characteristics of the starch molecular weight and chain length and the changes in the For the mung bean and sweet potato amylopectins, being two commonly used starches, a surprising discovery is that their addition promotes the generation of glutathione dimers in ASG during the mixing treatment. However, these dimers depolymerize during starch retrogradation, as shown in Wheat amylopectin is the starch that promotes the most significant disulfide bond formation of ASG among the five amylopectins, and it is characterized by the presence of hydroxyproline, a molecular weight greater than 1.3 million Da, and the highest proportion of side chains with chain lengths of 9\u201312 glucose residues. The disulfide bonds formed by the interaction of ASG and mung bean or sweet potato amylopectin due to glutathione polymer linked by disulfide bonds in the mixing process will be partially reduced during cold storage. The characteristic crystal types of different starches are correlated with the amylopectin + glutenin complexes."}
+{"text": "The cell inhibition rate was detected using the CCK8 method, and the half-inhibitory dose was determined. Based on this, the dose of UVA irradiation for the follow-up experiment was selected to establish a photoaging model of the HSF cells. The cells were divided into a normal (N) group, UVA-irradiated (UVA) group, SPH low dose (SPHL) group, SPH medium dose (SPHM) group, and SPH high dose (SPHH) group. The photoaging model of HSF cells was established by UVA irradiation in the UVA, SPHL, SPHM, and SPHH groups; the SPHL, SPHM, and SPHH groups were treated with SPH at concentrations of 50, 100, and 200\u2009mg\u00b7L\u22121, respectively, at the same time. After 24 and 48\u2009h of culture, the reactive oxygen species (ROS) level of the HSF cells was detected by flow cytometry, and the required culture time of the HSF cells for the follow-up experiment was selected. The malondialdehyde and glutathione contents, as well as the activities of the superoxide dismutase, catalase, and glutathione peroxidase in the HSF cells, were detected by biochemical methods. The levels of expression of MMP-1 and collagen I protein in HSF cells were detected by the western blot test, the extent of aging of HSF cells was detected by \u03b2-galactosidase staining, and the apoptosis level of HSF cells was detected by flow cytometry. The results show that SPH inhibits the UVA-induced photoaging of HSF cells in a dose-dependent manner within a certain concentration range, and the effect of a concentration of 200\u2009mg\u00b7L\u20131 was the most significant. The mechanism is related to improving the antioxidant activity of photoaging HSF cells to eliminate excessive ROS. It can inhibit apoptosis, reduce the protein expression of MMP-1, and effectively control the degradation of collagen I protein in photoaging HSF cells. Therefore, SPH offers potential for use in sunscreen cosmetics.This study is an investigation into the inhibitory effect of seawater pearl hydrolysate (SPH) on the UVA-induced photoaging of human skin fibroblast (HSF) cells, and the mechanism thereof. HSF cells were cultured and irradiated with a UVA 0\u201350\u2009J\u00b7cm Skin photoaging is often caused by environmental factors, such as ultraviolet (UV) light, smoking, and chemicals. Among these, UV exposure is the most prominent and can trigger a series of molecular and cellular reactions in the skin, resulting in rapid dynamic disorder. Human skin is composed of layers, namely, the epidermis and dermis, and the wavelength penetration of UVA exceeds that of UVB. UVA not only penetrates the epidermis and damages keratinocytes but also is absorbed by human skin fibroblasts (HSF), causing damage to the entire dermis. A large fraction of the UVA can penetrate the dermis completely and cause skin photoaging, which is manifested by skin damage, loosening, and wrinkles . Skin phHepu pearl, also known as seawater pearl, is an important ingredient in Chinese herbal medicine that has been used extensively for thousands of years. According to the Pharmacopoeia of the People's Republic of China, it is effective in detoxification and muscle regeneration, calming nerves, brightening eyes, and eliminating pannus formation. It is mainly used to treat palpitations, insomnia, convulsive epilepsy, red eye, pannus, nonhealing sores and ulcers, and skin spots. Li Shizhen of the Ming Dynasty believed that pearls had a beautifying effect on the skin. According to the compendium of Materia Medica, \u201cpearls taste salty, sweet, cold, and non-toxic, calming the mind and eyes; pearls painted on the face make people moist and good color; painted on hands and feet to remove the skin; dropped phlegm, remove facial spots, detoxify acne, and make the luster white.\u201d In the last ten years, pearl has been widely used in the treatment of skin conditions such as skin injuries, wound ulceration, bedsores, pressure ulcers, and chloasma \u20135, and iIn the early stage, the research group selected seawater pearls for hydrolysis and obtained a series of products such as seawater pearl hydrolysate (SPH), hydrolyzed seawater pearl powder, and Zhenmi tablets and successfully developed the hydrolyzed pearl technology . It has been found that seawater pearl powder can prevent and treat skin photoaging in mice, and its mechanism involves the removal of excessive reactive oxygen species (ROS) from photoaging skin [HSF cells were purchased from the Kunming Cell Bank of Typical Culture Preservation Committee of Chinese Academy of Sciences; SPH  was provided by Beihai Baozhulin Marine Technology Co., Ltd.2 constant temperature incubator (Shell Lab); Cx-21 ordinary optical microscope (Olympus); and a Tgl-16 freezing centrifuge (Instrument of Hunan Xiangyi Laboratory).Determination kits for malondialdehyde (MDA), glutathione (GSH) content, superoxide dismutase (SOD), catalase (CAT), and glutathione peroxidase (GSH-PX) were purchased from Nanjing Jiancheng Bioengineering Institute. The other suppliers are DMEM high glucose medium (HyClone); P/S antibiotic (HyClone); fetal bovine serum ; trypsin EDTA ; Cell Counting Kit-8 (CCK8), cell proliferation detection kit (Biosharp); reactive oxygen species (ROS) detection kit (Beyotime); Annexin V-FITC/PI apoptosis detection kit ; a UVA lamp purchased from Philips Lighting (China) Investment Co., Ltd. ; Dr-200bs enzyme labeling detector (Diatek); FACSCalibur flow meter (BD); Sco6we CO\u22121 SPH was measured, and conventional HSF cell culture medium was added to make up the volume to 100\u2009mL. A batch of 600\u2009mg\u00b7L\u22121 mother liquor was prepared and sterilized through a microporous filter membrane, and conventional HSF cell culture medium was added to dilute it to 200, 100, and 50\u2009mg\u00b7L\u22121. HSF cells were grown using a conventional medium of DMEM high glucose +10% fetal bovine serum +1% P/S antibiotics. Cells were cultured at 37\u00b0C and 5% CO2 in the incubator. The medium was changed every 48\u2009h. HSF cells in a logarithmic growth phase at 1\u2009\u00d7\u2009105 cells\u00b7ml\u22121 were digested with trypsin, prepared as a single cell suspension, added to 96-well culture plate, and cultured for 48\u2009h. The culture medium was absorbed and discarded, cells were washed with PBS, and PBS was added to each well. The PBS was discarded, and the cells were treated with 50, 100, and 200\u2009mg\u00b7L\u22121 SPH medium and conventional medium, respectively, for 24 and 48\u2009h. The conventional medium was used as the control group.60 milliliters of 1\u2009g\u00b7L5 cells\u00b7ml\u22121 were digested with trypsin, prepared as a single cell suspension, added to six-well plates, and cultured for 24\u2009h. The culture medium was absorbed and discarded, cells were washed with PBS, and PBS was added to each well. The plates were irradiated under a UVA/UV lamp, and the irradiation distance was adjusted until the irradiation dose was 0/2.5/5/10/25/50\u2009J\u00b7cm\u22122. The 0\u2009J\u00b7cm\u22122 irradiation dose was used as the control group. After continuous culture for 24\u2009h, some cells were transferred to a 96-well culture plate, and a 10\u2009\u03bcL CCK-8 solution was added to all the wells, followed by incubation for another 2\u2009h in the incubator. The absorbance value at 450\u2009nm was measured using an enzyme labeling instrument. The culture medium without cells was used as the blank group. The inhibition rate was calculated according to the formula below to determine the optimal dose of UVA irradiation. The cell inhibition rate%\u2009=\u2009/(control group \u2013 blank group)\u2009\u00d7\u2009100%.In the experiment, HSF cells in a logarithmic growth phase at 1\u2009\u00d7\u200910\u22125cells\u00b7mL\u22121, digested with trypsin, prepared as a single cell suspension, and added to six-well plates, and cultured for 24\u2009h. The culture medium was absorbed and discarded, the cells were washed with PBS, and PBS was added to each well. The cells were divided into five groups, namely, normal (N) group, UVA-induced group (UVA), SPH low dose group (SPHL), SPH medium dose group (SPHM), and SPH high dose group (SPHH). Except for the N group, the groups were all irradiated under a UVA/UV lamp, and the irradiation distance was adjusted until the irradiation dose was 10\u2009J\u00b7cm\u22122. The PBS was discarded, the conventional medium was added to the N group and UVA group, and the SPHL, SPHM, and SPHH groups were treated with 50, 100, and 200\u2009mg\u00b7L\u22121 SPH medium, respectively, for 48\u2009h.In the experiment, HSF cells in the logarithmic growth phase were taken at 1\u00d710\u03bcL of DCFH-DA staining solution was added. The samples were inverted and mixed several times. The cells were incubated at 37\u00b0C for 20\u2009min and inverted to mix every 5\u2009min. After incubation at 37\u00b0C, the samples were centrifuged at 300\u2009g and 4\u00b0C for 3\u2009min, the cells were precipitated, and the supernatant was removed. The cells were washed in a serum-free medium thrice, centrifuged at 300\u2009g and 4\u00b0C for 3\u2009min, and precipitated, and the supernatant was removed. After resuspending the cells in a serum-free medium, the cells were analyzed by flow cytometry, with excitation at 488\u2009nm and emission at 525\u2009nm. The level of ROS was detected, and the best detection time was determined.After 24 and 48\u2009h of cell culture in six-well plates for each group, the cells were digested using trypsin, collected in 1.5\u2009mL centrifuge tubes, and centrifuged at 300\u2009g for 5\u2009min, and the supernatant was removed. Serum-free medium (0.5\u2009mL) was added to each tube, the cells were resuspended in the centrifuge tube, and 0.5\u2009The cells of each group were cultured for 48\u2009h in six-well plates, digested with trypsin, collected in 1.5\u2009mL centrifuge tubes, lysed, and centrifuged at 4\u00b0C and 2000\u2009g for 10\u2009min, and the supernatant was collected for analysis. Using the manufacturers' guidelines, the activities of SOD, CAT, and GSH-PX and the contents of GSH and MDA in the cells of each group were detected. The values were expressed in relative units per mg of soluble protein.\u03b2-actin, anti-MMP-1, and anti-collagen I were diluted with a suitable diluent and incubated at 4\u00b0C overnight. The diluted monoclonal antibodies were recovered and washed with TBST thrice, for 5\u2009min each time. The diluted goat anti-rabbit IgG-HRP secondary antibody was added and incubated at room temperature for 30\u2009min. TBST was used to wash the samples four times on a shaking table at room temperature for 5\u2009min each time. Freshly mixed ECL solution was added to the protein side of the membrane, which was then exposed in a dark room. The film was archived, analyzed, and scanned [After culturing for 48\u2009h in six-well plates, the cells in each group were washed twice with PBS solution, and the residual cells were dried as thoroughly as possible. An appropriate volume of total cell protein extraction reagent was added to lyse the cells for 3\u20135\u2009min. The cells and reagents were placed in a 1.5\u2009mL centrifuge tube, put in an ice bath for 30\u2009min, and blown repeatedly with a pipette to ensure complete cell lysis. The samples were centrifuged at 13000\u2009g and 4\u00b0C for 5\u2009min, and the supernatant, which was the complete protein solution, was collected. A separation gel and concentrated gel were prepared, and the protein samples were placed in the sampling hole. A transfer membrane filter paper and a methanol activated PVDF membrane were prepared, and current was passed through the membrane at a constant rate of 300\u2009mA. The transformed membrane was added to the sealing solution and sealed at room temperature for 1\u2009h. The blocking solution was removed, and the monoclonal antibodies anti-\u03b2-galactosidase staining fixative was applied at room temperature for 15\u2009min. The samples were washed three times with a PBS solution, an appropriate amount of \u03b2-galactosidase staining working solution was added to each hole, and the samples were incubated in a water bath at 37\u00b0C overnight. The cells were washed twice with PBS solution, and the senescence of the cells was observed under an optical microscope. The senescent cells were seen as dark blue. The average optical density of the \u03b2-galactosidase positive areas was measured using Image-Pro Plus software (Media Cybernetics).After 48\u2009h of culture in six-well plates, the cells in each group were washed twice with PBS solution, and a \u03bcL precooled binding buffer resuspended the precipitated material. Annexin V-FITC (5\u2009\u03bcL) was added, and the samples were mixed well and incubated in the dark for 10\u2009min. Then, 5\u2009\u03bcL PI was added, and the samples were mixed well and incubated in the dark for a further 5\u2009min. Subsequently, another 200\u2009\u03bcL precooled binding buffer was added. After mixing, the extent of apoptosis in each group was detected by flow cytometry.Cells belonging to each group were cultured for 48\u2009h in six-well plates, digested using trypsin, collected in 1.5\u2009mL centrifuge tubes, and centrifuged at 300\u2009g for 5\u2009min. Following this, the supernatant was removed and 1\u2009ml PBS was added to each tube. The cells were resuspended and centrifuged at 300\u2009g and 4\u00b0C for 5\u2009min, and the supernatant was discarded. The addition of 200\u2009P < 0.05 was considered significant. All the mathematical and statistical images were generated by Origin 8.6 software .The data are expressed as the mean\u2009\u00b1\u2009standard error (SE), and SPSS (version 17.0)  was used for statistical analysis. One-way analysis of variance (ANOVA) and the least significant difference (LSD) were used to analyze the differences between the different groups; \u22121 SPH significantly improved cell proliferation rate of HSF cells after 24\u2009h of culture (P < 0.05), but 50 and 100\u2009mg\u00b7L\u22121 SPH had no significant difference after 24\u2009h of culture (P > 0.05) (\u22121 SPH significantly improved cell proliferation rate of HSF cells after 48\u2009h of culture (P < 0.05)  . Compare < 0.05) . Thus, S\u22122  , and the ROS content decreased as SPH increased in a dose-dependent manner within a certain concentration range . Compared with the UVA group, the MDA content of the HSF cells in the SPHL, SPHM, and SPHH groups decreased significantly after 48\u2009h of culture (P < 0.05)  .P< 0.05), but there was no significant difference in the GSH content and SOD, CAT, and GSH-PX activity in the SPHM and SPHH groups (P > 0.05)  , but there was no significant difference in the relative expression of MMP-1 protein in the SPHH group (P > 0.05)        , and the SOD, CAT, and GSH-PX activities and the GSH content decreased (P < 0.05). The SPH treatment alleviated oxidative stress and inhibited apoptosis rate by increasing the SOD, CAT, and GSH-PX activities and the GSH content of photoaging HSF cells (P < 0.05) and by reducing the ROS and MDA content of photoaging HSF cells (P < 0.05). This results in a dose-dependent effect within a certain concentration range. The effect of a concentration of 200\u2009mg\u00b7L\u20131 was the most significant. Thus, SPH can effectively remove excess ROS and MDA, inhibit apoptosis, and enhance the ability of HSF cells to resist UVA by increasing the activities of SOD, CAT, and GSH-PX and the GSH content in photoaging HSF cells.Under in vivo conditions, SOD, CAT, and GSH-PX are enzymes that can remove ROS from the body, and GSH is a nonenzyme that can remove ROS, maintain the dynamic balance of oxidation and antioxidant systems, and protect skin tissue from oxidative damage , 17. Exc\u22121.Collagen is the main component of the human dermis. It is mainly composed of collagen I secreted by HSF cells and plays an important role in maintaining skin fullness . MMPs caSPH has an inhibitory effect on UVA-induced photoaging of HSF cells, which is expressed in a dose-dependent manner within a certain concentration range. The mechanism involves improving the antioxidant activity of photoaging HSF cells to eliminate the excessive presence of ROS. SPH can inhibit apoptosis, reduce the protein expression of MMP-1, and effectively control the degradation of collagen I in photoaging HSF cells. Therefore, taking into account the excellent skin protection capabilities, SPH can be considered in the development of sunscreen cosmetics."}
+{"text": "During the SARS-CoV-2 (COVID-19) pandemic, routine antenatal care was disrupted, and pregnant women positive for COVID-19 were at increased risk of caesarean section, intensive care admission or neonatal unit admission for their baby. Virtual care and telehealth can reduce barriers to care and improve maternity outcomes, and adoption has been encouraged by health authorities in the United Kingdom.Norfolk and Norwich University Hospitals Trust deployed a flexible maternity virtual ward (MVW) service using the Current Health platform to care for pregnant women during the pandemic. Patients were monitored either intermittently with finger pulse oximetry or continuously with a wearable device. We outline the MVW technology, intervention and staffing model, triage criteria and patient feedback, as an example of an operational model for other institutions.Between October 2021 and February 2022, 429 patients were referred, of which 228 were admitted to the MVW. Total bed-days was 1,182, mean length of stay was 6\u00a0days . Fifteen (6.6%) required hospital admission and one (0.4%) critical care. There were no deaths. Feedback alluded to feelings of increased safety, comfort, and ease with the technology.The MVW offered a safety net to pregnant women positive for COVID-19. It provided reassurance for staff, while relieving pressures on infrastructure. When setting up similar services in future, attention should be given to identifying clinical champions, triage criteria, technology and alarm selection, and establishing flexible escalation pathways that can adapt to changing patterns of disease. Pregnant women hospitalised with SARS-CoV-2 COVID-19) have been more likely to be admitted to critical care, and to require caesarean section or neonatal unit admission for their baby 9 have be. A disprVirtual care and telehealth have been shown to improve outcomes in certain areas of maternal-foetal medicine and have been suggested as a means of breaking down barriers to access in prenatal care during COVID-19 \u20137. The NNorfolk and Norwich University Hospitals Trust navigated these challenges, by deploying a flexible Virtual Ward service to care for vulnerable populations during the pandemic. A virtual ward is designed to provide patients with a period of intensive multidisciplinary management and monitoring, akin to an inpatient stay. Pre-pandemic, virtual wards had been shown to reduce mortality in heart failure, and they were widely deployed in COVID-19 at the behest of NHS England . A recenAt first the Maternity Virtual Ward (MVW) was offered to all pregnant women with confirmed COVID-19. As volumes increased, a system of triage was developed to cope with demand. We outline the Virtual Ward technology, intervention and staffing model, readmission rates, as well as the specific triage criteria and alarm settings used, as an example of an operational model for other institutions and as a contribution to the emerging consensus around best care .2), respiratory rate, pulse, motion, and skin temperature, and could integrate with a blood pressure cuff, axillary temperature patch and a spirometer. The kit connected to the Current Health cloud via a home internet connection, or a 3G network sim card for those without home internet.The MVW coordinated care through the Current Health platform . The Current Health platform was a cloud-based analytics system with a web dashboard for the monitoring teams to view the patients\u2019 vital signs and survey responses in real time. The web dashboard displayed the patients\u2019 observations in a format akin to the familiar hospital observation chart. Alarms were set Table  to alertThe MVW identified pregnant patients with confirmed-positive COVID-19 via three routes: discharge from hospital, direct contact from a patient in the community, and positive swabs in the community . Details of those with positive swabs were supplied via a dataset from NHS England, and cross referenced with the maternity database . Initially, all women were called by a member of the obstetric medical team to perform a risk assessment for complications from COVID-19 in pregnancy. As the pandemic progressed and numbers grew, midwives were trained to do these initial risk assessments, and the obstetric team only contacted the patients if there were concerns from the midwifery team. All patients continued in the MVW initially, but subsequently only patients meeting any of triage criteria were admitted, to cope with increasing case numbers and target those who would derive most benefit. The triage criteria included ethnicity, age, BMI, comorbidities, vaccination status and socioeconomic deprivation and social support  and imported into R . They included: age, admission dates and length of stay, clinical escalation rates  and patient feedback. Patient feedback was captured by the NNUH administrative support service after the patient had been discharged from the MVW as service evaluation. Patients were asked to rate the service from 0 (least/worst) to 5 (most/best) in the aspects listed in Table Between the 20 October 2021 and 7 Feb 2022, 429 patients were referred to the MVW. Following triage, 228 were admitted . Fifteen (6.6%) required escalation to hospital care, and one (0.4%) to critical care. There were no deaths.n\u2009=\u200924) are presented in Table The results of the feedback survey  and an escalation rate to inpatient care of 6.6% . HoweverThe key challenge was digital transformation. The initial set up and coordination of the MVW required dedication, and a degree of \u201cinternal marketing\u201d from enthusiastic individuals to bring the rest of team onboard. The key barrier to engagement was a lack of perceived importance of remote monitoring. Maternity services, especially during COVID-19, did not sit in isolation, so care pathways also had to be coordinated with respiratory, acute and general medicine. Healthcare professionals beyond the MVW team needed to understand that any temporary adjustments to their workflow would be rapidly offset by a reduction in demands on their time once the service had shouldered the load.The MVW also relied on a core group of midwives skilled in telephone triage and emotional support. Telephone triage is generally considered safe, though risks increase in step with patient acuity and triage protocols are key to its safe implementation . Even wiClinical leadership is essential for driving this kind of digital transformation . The panIn their evaluation of NHS Virtual Ward programs, Alboksmaty et al. noted the importance of adequate infrastructure and human resources to staff the program, patient education, and appropriate alarm thresholds, alongside the need to report escalation rates . We woul2 in hypoxic patients with darker skin, and the differences between commercial and clinical-grade pulse oximeters [2\u00a0[Technology should be chosen that can monitor the desired parameters accurately using validated, CE-marked sensors. Regarding pulse oximeters specifically, clinicians should be aware of the potential for overestimation of SpOximeters , 18. Faceters [2\u00a0. In the The Virtual Maternity Ward offered (and continues to offer) a safety net to pregnant women who were positive for COVID-19, and those who were struggling to access care. It provided reassurance for staff, while relieving pressures on infrastructure. When setting up similar services in future, attention should be given to identifying clinical champions, triage criteria, and technology selection, and establishing flexible pathways."}
+{"text": "Major transformations are taking place in the Kingdom of Saudi Arabia (KSA) to achieve the 2030 vision for the health sector. A key component in strengthening the health system is a strong research governance strategy that can support the decision-making process by providing timely and accurate evidence that reflects local context and needs. This paper sought to better understand governance structures and policies for health research systems and support clusters so that they function effectively. This paper outlines the findings of an in-depth baseline assessment of existing health research efforts, activities, and plans of eight research clusters in the KSA and identifies key gaps and strengths in health research governance and capabilities. A cross-sectional design was used to survey research clusters in KSA. A six-part survey was developed to better understand the research clusters\u2019 health research governance and capacities. The survey was sent to all KSA clusters and was completed in a group setting during meetings. Findings clearly show strong efforts to support research governance initiatives in health clusters in KSA. While some clusters are more advanced than others, there are plenty of opportunities to share knowledge and combine efforts to help achieve the goals set out for KSA health transformation. This baseline assessment also reflects the first attempt of its kind to understand the KSA experience and provide much-needed lessons on country-wide efforts to support the health system given the trickling effect of this sector on all others, enhancing and advancing national growth. Research governance comes from the process adopted by governments or institutions to ensure that activities are based on predetermined protocols to achieve accountability. Research must be governed at all stages, and research governance entails the implementation of the principles, standards, and requirements of a study, including the promotion of good research culture and practice [1\u20133]. England, Scotland, and Australia are some of the countries that have adopted a research governance act, others may also apply research governance principles, strategies, and frameworks to future projects , .In the UK, the National Institute for Health and Care Excellence (NICE) implemented its national research governance policy in 2018 ). The poIn the Kingdom of Saudi Arabia (KSA), major transformations are taking place in efforts to achieve the 2030 vision for the health sector, which requires urgent action and new initiatives to improve healthcare services focusing on reforms to ease health service, enhance the quality and efficiency of health-care services, and strengthen the prevention of health threats. Realizing such ambitious goals requires effective leadership to navigate the health sector and steer transformation at both the organization and system levels. A key component in strengthening the health system is a strong research governance strategy that can support the decision-making process by providing timely and accurate evidence that reflects local context and needs.As part of the KSA\u2019s national health strategy, one solution to facilitate and integrate health system solutions was to divide the country into health clusters, which was conducted in waves (starting 2018) to support the gradual implementation of health system reforms. Because these different clusters were established at different times, they have varying levels of capacity and preparedness for conducting health systems research. They also address the needs of different population groups, and as such, their research agenda must reflect context-specific needs .Health research funding. This includes funding sources for ongoing research including spending and processes for calls for proposals and the capacity to manage funding.Resources, training, and capacity building. This section includes questions on technical and human resources, and training and capacity building.Health research production and use. Questions in this section include the number of projects conducted, number of submitted proposals, number and types of publications, capacity for knowledge translation, and means of dissemination.Open-ended question. This section focuses on respondents\u2019 opinions on barriers to and facilitators of health research stewardship and governance, funding health research resources , and health research production and use.A six-part survey was developed to better understand the research clusters\u2019 health research governance and capacities. The tool was adapted from a framework developed by Pang et al.  for builThe survey was sent to all KSA clusters and was completed in a group setting during meetings coordinated by cluster leads between June and August 2021.The study was exempted from ethical review, as it gathered information regarding cluster performance and did not collect personal information or identifiers of individuals working in the clusters or receiving health-care services there .Data was encoded and analyzed using Microsoft Excel. To maximize the utility of the findings, we employed different data visualization methods to outline the survey results. Univariate analysis was used to report the findings, outlined in tables and charts.The qualitative component included thematic analysis, which summarized the collated responses. The team then examined the data more thoroughly to derive the main themes under barriers to and facilitators of the strengthening of health research systems within and across the clusters under each section outlined above.Surveys were collected from eight research clusters in KSA, and the results for each section are outlined below.The clusters were recently established, with the first dating back to 2015. The most prominent types of research undertaken by these clusters were clinical and health service research (100% for both), social research (87.5%), and basic research (75%). The most commonly reported topics researched by clusters included coronavirus disease 2019 (COVID-19), cancer , respiratory diseases ), and patient safety issues .This section discusses the results below, divided into five parts.As per Table Similarly, regarding research ethics, 50% of the clusters reported establishing several of these policies at the institutional level. Only one cluster had all policies at both cluster and institutional levels.Table As Table All clusters had an ethical review board, which was centralized for 50% and institution-specific for 37.5%. All clusters required researcher training on ethical conduct, and 62.5% had unified conflict-of-interest policies in research. As further detailed in Fig.\u00a0Four clusters (50%) reported adopting institution-specific M&E frameworks for the health research system. Regarding key performance indicators (KPIs) for assessing research outputs and outcomes, 25% had cluster-specific KPIs, while 37.5% had institution-specific KPIs. The M&E frameworks covered mostly primary outputs 62.5%) and research processes (50%)  and conference proceedings Fig.\u00a0. Three cThe survey\u2019s open-ended component grouped barriers and facilitators under four main sections: health research stewardship and governance, health research funding, resources , and health research production and use.Table In terms of health research funding, the main barriers according to the respondents were the lack of funding, grant management mechanisms, incentive policies, and academic collaborations. Facilitators to counteract these barriers included the development of funding mechanisms, dedicating research funds for staffing, developing and implementing policies to support research funding, providing staff incentives, and establishing partnerships with academia.With regard to resources, the main challenges included difficulties in identifying qualified staff, competing priorities of existing staff, limited resources, and lack of research facilities. Some facilitators to address these issues included recruiting qualified staff, allocating time and incentives for staff to conduct research, establishing research facilities, developing staffing plans, and developing mentorship opportunities.For health research production and use, reported obstacles included the lack of policies to support research, formal dissemination mechanisms, and translational strategy and the misalignment of research and priorities. To address these issues, measures included establishing formal dissemination channels, developing knowledge translation products, conducting cluster-wide priority-setting exercises, and promoting multicenter collaborations.This study summarizes the first efforts to assess the capacities, resources, and needs of KSA\u2019s research clusters at baseline. The findings can fill a significant knowledge gap on the requirements for establishing good research governance structures and evaluating the available groundwork to ensure their success. Research governance must be implemented at all stages of a study and apply research principles, standards, and requirements, as well as promote good research culture and practice .As discussed in the results section, in terms of resources, capacity, research portfolio, and policies, some clusters are more advanced than others. There is much that these clusters can do to help the newer clusters succeed in initiating their research agendas, expanding their research portfolios, and developing effective policies. One of the major hindrances preventing clusters from engaging in broader areas of research relates to funding. The majority of clusters obtained funding from local sources which may be limited and focused on specific issues. This may explain the reason why there is limited translational research and a greater focus on basic clinical research. Greater efforts should be made to support researchers in applying for international funding opportunities which focus on broader research topics, reflect priority research and policy areas, and engage multiple clusters. This can build upon existing capacities and fill important national evidence gaps.There is room to capitalize on the identified strengths in the capacity of health clusters. For instance, most clusters had policies in place on research ethics, and while some were at the cluster level, many were at the institutional level. There is room to expand and adapt these policies as well as share knowledge in this regard, particularly in areas where some clusters lack capacity or knowledge whereas others have more expertise. Most clusters had dedicated research unit in addition to space and infrastructure which can form an important focal point that can support other clusters. There is a rich and diverse cadre of staff that can support cluster research agendas. Clusters can capitalize on such resources locally and establish processes for exchange with universities and research institutions in other clusters. Clusters can also further invest in providing protected time for research and incorporating it in annual appraisals. Financial rewards and recognition can also be used as incentives to encourage researchers to disseminate research findings and support policy and decision making at the national level. Research evidence attests to the fact that providing researchers with such incentives can improve their productivity and support them in attracting additional funding .The results presented a need to develop unified health research guidelines, as several clusters lack some crucial procedures on quality assurance and improvement; bio-specimen access, use, and retention; risk management, privacy, and safety; clinical trials; research misconduct; sponsorship for health research; and research dissemination. Developing national guidelines can support the \u201cnewer\u201d clusters in advancing their research profiles and more effectively organizing and implementing research activities.For effectively governed research, projects should be performed consistently with recognized ethical principles, guidelines for accountable research behavior, applicable legislation and rules, and institutional policy. This also includes conducting research training and capacity building as well as providing them the necessary credentials to research and oversee institutional risks . In this context, clusters can work towards centralizing ethical review boards and making sure their guidelines and requirements are effectively communicated and uniformly implemented in all institutions.With respect to research ethics, all clusters had ethical boards, with most having guidelines in place to support and train staff in this aspect. However, one area that needs work is the conflict-of-interest policy. Issues around conflict of interest are gaining more attention, as they can influence research conduct and the reporting of results. Hence, the reporting of personal, political, industrial, academic, and other conflicts must be declared and managed .Regarding the setting of priorities, clusters reported using tools for conducting such exercises but no entities that would identify and fund such priorities. With the growing number of studies, ensuring the efficient and targeted funding of areas where research is actually needed is crucial. Installing structured prioritization processes and structures can help generate research evidence that would fill significant knowledge gaps and support the health policy and decision-making process . WorkingIn terms of M&E, few clusters had indicators for assessing outputs, which can provide much-needed information on accountability, efficiency, resource allocation, and improvement points . FurtherThe present findings clearly show strong efforts to support research governance initiatives in health clusters in KSA. While some clusters are more advanced than others, there are plenty of opportunities to share knowledge and combine efforts to help achieve the goals set out for KSA health transformation. The lessons learned from existing local efforts can be used to advance other clusters\u2019 efforts and allow them to reach their goals faster and with fewer resources. Addressing priority areas and generating research evidence to fill knowledge gaps can significantly improve the policymaking process and strengthen the health system in KSA. Clusters can start working on the findings generated from this study to support existing efforts to strengthen their respective research infrastructures.The results of this baseline assessment also reflect the first attempt of its kind to understand the KSA experience and provide much-needed lessons on country-wide efforts to support the health system given the trickling effect of this sector on all others, enhancing and advancing national growth. Countries in the region engaging in health reform or planning can benefit from this study\u2019s findings to support assessment efforts, identify available resources, and develop action-oriented plans for health reform."}
+{"text": "The detection of both enveloped and non-enveloped viruses decreased among periods (p < 0.001). After week 14, 2020, enveloped viruses were no longer detected until one year later, while non-enveloped viruses continued to be detected in children. Overall, a mean of 4946.8 (95% CI 4519.1\u20135374.4) pediatric emergency visits per month during the period 2018\u20132019 as compared to 2496.5 (95% CI 2086.4\u20132906.5) for 2020\u20132021 occurred (p < 0.001). The mean of pediatric hospitalizations also significantly decreased between periods, as follows: 346.6 (95% CI 313\u2013380.2) in 2018\u20132019 vs. 161.1 (95% CI 138.4\u2013183.8); p < 0.001; (4) Conclusions: Our study showed a remarkably reduction in pediatric hospitalizations and emergency visits and a change in the pattern of viral circulation during the COVID-19 pandemic in Asturias. The usual seasonal respiratory viruses, namely influenza or RSV were nearly absent in the pediatric population during the pandemic.(1) Background: The COVID-19 pandemic and the implementation of restrictions and nonpharmaceutical interventions (NPIs) changed the trends in respiratory viral circulation and the pattern in pediatric healthcare utilization; (2) Methods: A retrospective, multicenter observational study designed to analyze the impact of the pandemic on pediatric healthcare utilization and the viral circulation pattern in children in a region in Northern Spain was carried out. Viral diagnostics data from all nasal or pharyngeal swabs collected in children in Asturias during the periods of March 2018\u2013September 2019 and March 2020\u2013September 2021 were analyzed, as well as the number of pediatric hospitalizations and emergency visits; (3) Results: A total of 14,640 samples were collected during the pandemic period. Of these, at least one respiratory virus was detected in 2940 (20.1%) while 5568/10,298 samples were positive in the pre-pandemic period (54.1%);  The coronavirus disease 2019 (COVID-19) was declared a global pandemic on 11 March 2020, due to the rapid increase in cases and its spread throughout the world [On 14 March 2020, a total lockdown was declared in Spain . Most ofThese preventive measures useful in containing COVID-19 transmission were not specific to SARS-CoV-2 and seemed to affect the circulation of other respiratory viruses. Many countries have reported changes in viral seasonality during the pandemic, with the disappearance, among others, of enveloped viruses, such as influenza or respiratory syncytial virus (RSV) ,15,16,17The aims of this study were as follows: (1) to describe the respiratory viral circulation pattern in children in Asturias during the first 18 months of the COVID-19 pandemic, (2) to compare the respiratory viral circulation between the same time period in 2018\u20132019 and 2020\u20132021, and (3) to compare the number of pediatric hospitalizations and emergency visits per month among both periods.A retrospective, multicentre observational study designed to analyze the impact of the COVID-19 pandemic on the viral circulation pattern in children and the pediatric healthcare utilization in Asturias during the first 18 months of the pandemic was carried out. Asturias is a region in Northern Spain with a total population of 1,002,097 people and 95,698 children protected by the National Health System in 2021. Asturias is divided into eight health areas with a network of primary care centers as well as a reference hospital for each of the areas. In the region, 76% of the total population is concentrated into three major urban areas, namely Avil\u00e9s (III), Oviedo (IV), and Gij\u00f3n (V) .Viral diagnostics data from all nasal or pharyngeal swabs collected in children (up to 14 years old) in Asturias during the periods March 2018\u2013September 2019 and March 2020\u2013September 2021 were analyzed, as well as the number of pediatric hospitalizations and emergency visits per month and per hospital during both periods.\u00ae Fast Virus 1-Step Master Mix . Amplifications and data analysis were performed using either a 7500 or a QS5 Real Time PCR System . The following viral pathogens were identified: influenza virus, RSV, adenovirus, enterovirus, parainfluenza virus, metapneumovirus, rhinovirus, parechovirus, and human coronavirus . Repeated swabs from the same child collected within the same month were excluded.Viral diagnostics, except SARS-CoV-2, are centralized in Asturias and all the respiratory samples from the eight health areas were sent to the virology laboratory of the Hospital Universitario Central de Asturias, located in Oviedo. Viral diagnostics were performed for most children with acute respiratory infection (ARI). The swabs were placed in a viral transport medium  and nucleic acids were extracted by using the automated nucleic acid purifier MagNAPure 96 System  following the manufacturer\u2019s instructions. The identification of respiratory viruses was accomplished using an in-house multiplex real-time RT-PCR that has been validated for use. Viral genomes were amplified using TaqManIn order to avoid biased data from a unique area, SARS-CoV-2 data were analyzed from the centralized regional database in Asturias . Data frThis study was conducted in accordance with the 1964 Declaration of Helsinki and its subsequent amendments. It was approved by the Asturian Research Ethics Committee (Project 2020-315) in July 2020. No personal records were handled during the study.Respiratory viral circulation was analyzed weekly for each of the mentioned viruses and compared with the evolution of the COVID-19 pandemic in the pediatric population. Moreover, the detection rate was calculated by dividing the number of positive samples among the total number of pediatric samples in a period (%), globally and for each virus. Pediatric hospitalizations and emergency visits were calculated monthly in each hospital. Descriptive analysis was performed using frequencies and proportions for categorical variables and mean and 95% confidence interval (CI) for continuous variables.p-value cut-off of 0.05 was considered statistically significant. The analysis was carried out using R software Version 4.1  and the graphs were created with Microsoft Excel Version 16.62.Comparisons in viral detections rates, pediatric hospitalizations, and emergency visits between two periods (March 2018\u2013September 2019 and March 2020\u2013September 2021) were calculated. A chi-square test for categorical variables and Student\u2019s t-test for continuous variables were carried out for the comparative analysis. A n = 1266/8.6%), enterovirus (n = 370/2.5%), RSV (350/2.4%), rhinovirus (73/0.5%), and influenza (39/0.3%). As shown, the number of viral detections was lowest during the hard lockdown (March to June 2020) and it increased after, as the strict infection control and distancing measures were reduced. The COVID-19 pandemic affected the detection of most respiratory viruses. After week 14, 2020, enveloped viruses  were no longer detected until one year later, while non-enveloped viruses  continued to be detected in children . children .A total of 10,298 samples were collected during the period March 2018\u2013September 2019. Of these, at least one respiratory virus was detected in 5568 samples (54.1%). As shown in A total of 7849 children were admitted to the hospital during the period March 2018\u2013September 2019. As shown in p < 0.001). The mean of pediatric hospitalizations also significantly decreased between periods, as follows: 346.6 (95% CI 313\u2013380.2) in 2018\u20132019 vs. 161.1 (95% CI 138.4\u2013183.8); p < 0.001, as shown in Overall, a mean of 4946.8 (95% CI 4519.1\u20135374.4) pediatric emergency visits per month during the period 2018\u20132019 as compared to 2496.5 (95% CI 2086.4\u20132906.5) for 2020\u20132021 occurred . Therefore, this study provides information about a large number of collected swabs during two periods (pre-pandemic and pandemic) and allows us to have an up-to-date knowledge of the respiratory viral circulation. The number of pediatric hospitalizations and emergency visits are also described and compared between periods. This enables us to obtain an accurate snapshot of the implications of COVID-19 in our region.p < 0.001. This is in the range of the results from other studies, which have reported from 15% to 68% of viral detections within their samples [In this study, we found that 20.1% of the collected swabs during the period March 2020\u2013September 2021 were positive for at least one respiratory virus. This percentage was significantly lower when compared to the one found in the same time period in 2018\u20132019 (54.1%);  samples . The difDuring the hard lockdown, from 14 March to 21 June 2020, the viral circulation rapidly dropped and was the lowest of the pandemic period. Adenovirus was the only virus detected at this time and circulating during the whole period. Other studies have also described adenovirus as the only virus circulating during 2020 with similar characteristics to previous years, but with a lower incidence . After wAs described in the literature, influenza was detected at the beginning of March 2020 and, after week 12, disappeared, remaining undetected during the 2021 winter season ,12,13,14Although it is remarkably important to study the viral circulation in children because they have usually play a significant role in the transmission to the adult population, the COVID-19 pandemic has changed the paradigm. As shown in Our data show a significant decrease in pediatric emergency visits and hospitalizations during the COVID-19 pandemic in Asturias. This is consistent with other reports on the reduction in healthcare utilization during the pandemic ,21. AlthThis study has some limitations that should be acknowledged. First, this is an observational retrospective study. Although it allows us to describe what occurred with the viral circulation and pediatric healthcare utilization during the COVID-19 pandemic in Asturias, we cannot make conclusions on the contribution of NPIs or viral interference. Additionally, clinical or other laboratory information was not collected, so we cannot study individual clinical follow-up or analyze the causes of pediatric healthcare utilization. Nevertheless, a strength of this study is the great number of samples analyzed for viral detection from June 2020 to September 2021, as well as the whole number of pediatric emergency visits and hospitalizations in Asturias. Furthermore, 2020\u20132021 was compared with 2018\u20132019, to not only describe but also to analyze the changes over the past years.In conclusion, our study showed a remarkably reduction in pediatric hospitalizations and emergency visits, as well as a change in the pattern of viral circulation during the COVID-19 pandemic in Asturias. The usual seasonal respiratory viruses, such as influenza or RSV, were nearly absent in the pediatric population in our region during the time of the study. The reappearance of RSV transmission did not occur until the summer of 2021, outside of the typical seasonal cycle. As shown, respiratory viral circulation should be continuously monitored to guide further public health decisions."}
+{"text": "To elucidate the clinical, radiologic characteristics of Leber\u2019s hereditary optic neuropathy (LHON) associated with the other diseases.Clinical data were retrospectively collected from hospitalized patients with LHON associated with the other diseases at the Neuro-Ophthalmology Department at the Chinese People\u2019s Liberation Army General Hospital (PLAGH) from December 2014 to October 2018.A total of 13 patients, 24 eyes  with LHON mitochondrial DNA (mtDNA) mutations, were included in the cohort. 14502(5)11778(4)11778 &11696(1)12811(1)11696(1)3460(1). One patient was positive for aquaporin-4 antibody (AQP4-Ab), and two were positive for myelin oligodendrocyte glycoprotein antibody (MOG-Ab). Three patients were associated with idiopathic optic neuritis (ON). Two patients were with compression optic neuropathy. Three patients were with the central nervous system (CNS) diseases. One patient was with proliferative diabetic retinopathy (PDR) and one with idiopathic orbital inflammatory syndrome (IOIS). At the onset, visual acuity (VA) in eighteen eyes was below 0.1, one eye was 0.5, five eyes were above 0.5, while VA in sixteen eyes was below a 0.1 outcome, three eyes experienced moderate vision loss. MRI images showed T2 lesions and enhancement in nine patients who received corticosteroids treatment; additional immune modulators treatment was performed on two patients. None of the patients had relapse during the follow-up time.Leber\u2019s hereditary optic neuropathy can be accompanied with multiple-related diseases, especially different subtypes of ON, which were also exhibited with IOIS and compression optic neuropathy for the first time in this cohort. This condition may be a distinct entity with an unusual clinical and therapeutic profile. Leber\u2019s hereditary optic neuropathy (LHON) is an inherited optic neuropathy characterized by subacute painless vision loss . RetinalIn clinical, we noticed 13 patients who carried mitochondrial DNA (mtDNA) mutations that were accompanied with the other diseases, including ocular disorders and systemic diseases. We conducted the current study to describe the clinical, laboratory, imaging presentations of MRI, and associated diseases at a single center, using data collected in a retrospective fashion.The clinical records from December 2014 to October 2018 of hospitalized patients carried mtDNA mutations were selected from the Chinese People\u2019s Liberation Army General Hospital (PLAGH) in this study. The study protocol was approved by the institutional review board of the PLAGH and performed in accordance with the content of the Helsinki Declaration. All patients provided written informed consent to undergo examinations.Ophthalmological examinations included a test for relative afferent pupillary defect (RAPD), and a direct and indirect ophthalmoscopy to examine the retina. The best corrected visual acuity (BCVA) was tested using a Snellen chart, and a VA below 0.01 was documented with count finger (CF), hand motion (HM), perceived light, and no perceived light. The standard protocol for the Optic Disc Cube 200 \u00d7 200 circle scan and the Macular Cube 512 \u00d7 128 scan was performed using one of the two spectral-domain optic coherence tomography (SD-OCT) devices . Blood was collected at the Rheumatologic Research Center in the PLAGH. Cerebrospinal fluid (CSF) samples were collected for the routine testing of white cell counts, total protein levels, and concentrations of IgG. Patients with LHON were diagnosed by screening for mtDNA. Cell-based assays (CBA) to detect the serum aquaporin-4 antibody (AQP4-Ab) and the myelin oligodendrocyte glycoprotein antibody (MOG-Ab) were performed for the patients with ON.Magnetic resonance imaging was performed on a 3T system in eight patients with a T2-weighted image (T2WI) and a T1-weighted image (T1WI) sequences with fat suppression, and a gadolinium-enhanced T1. Proton Magnetic Resonance Spectroscopy (H-MRS) is performed when patients are accompanied with intracranial lesions.The following data were analyzed: age, sex, age at the onset, the involved eye, time between two eyes, family history, laboratory findings, associated diseases, treatment, and prognosis.A total of 182 patients (345 eyes) were diagnosed with LHON in our center, while 13 patients were diagnosed with LHON Plus; the frequency of LHON Plus in LHON was 7.14%. The age onset of LHON with other diseases and pure LHON were (25.9 \u00b1 3.1) and (22.1 \u00b1 0.9) years, respectively. In LHON Plus, 11 patients suffered simultaneous or sequential binocular involved, the time between two eyes from 1 month to 6 years; the average time was (30 \u00b1 17.16) days. There was no significant difference between the age onset, involved eyes, and the time between two eyes of LHON Plus and pure LHON. The BCVA was significant difference between two groups; the visual function was better in LHON Plus than pure LHON, and we suspected the reason was the plus disease accepted effective treatment. The data between the two groups are listed in Four patients were RAPD positive. Approximately, 76.92% (10/13) patients had pale fundus, especially the temporal side. One patient had edema disk. Two patients had normal fundus. Nine patients (14 eyes) had distinctive visual field (VF) defection, which showed central or eccentric scotoma especially. The results of the VEP examination in 10 patients showed the delayed implicit period and lower amplitude. SD-OCT imaging of the peripapillary nerve fiber layer (pRNFL) showed diffuse thinning in eight patients (14 eyes); SD-OCT imaging of the macular retinal ganglion cell and inner plexiform layers (RGC-IPL) revealed ganglion cell atrophy, more severe in the nasal quadrants. In this study cohort, 75% (18/24) of the eyes experienced severe vision loss (\u22640.1) at the onset, only one eye experienced moderate vision loss (0.1\u20130.5), five eyes experienced mild vision loss (\u22650.5). Steroid therapy was performed for nine patients with MRI changes. Two patients received immune modification therapy (azathioprine/rituximab) with AQP-Ab or MOG-Ab positive. Vision improved in seven patients, unchanged in four patients, and worse in two patients . The folLeber\u2019s hereditary optic neuropathy plus has been reported by many researchers; a systematic review of the literature was conducted on all publications on LHON plus since the original description by Approximately, 90% patients carry one of the three primary mtDNA mutations: 11778, 3460, or 14484 . While, The most common disease in our study is CNS inflammatory demyelination disease; MRI is the modality of choice for investigating ON, compressive lesions, and the other diseases. An MRI can be performed to evaluate a patient\u2019s potential benefit from intravenous methylprednisolone and disease-modifying therapy. Eleven patients presented with optic nerve or intracranial T2 lesions and (or) enhanced T1 lesions; nine patients received intravenous methylprednisolone therapy, two patients. So we suggest the patients who had diagnosed LHON should perform MRI examination.A few limitations existed in this cohort study. First, we only report the ratio of LHON Plus in-patients in a single neuro-ophthalmology center. Second, the study only found LHON accompanied with AQP4-Ab positive, but the pathogeny is unknown; we cannot clearly explain the reason of the visual loss. Another limitation was the follow-up timer was not enough; we cannot make sure whether the patients were diagnosed with LHON or carried mtDNA mutations, especially in some patients who had one eye involved.Leber\u2019s hereditary optic neuropathy plus may be a clinical syndrome associated with multiple diseases; even normal people will carry with mutations, which still need investigation. When field vision of the patient showed the blind spot in the temporal or SD-OCT imaging of the macular RGC-IPL revealed ganglion cell atrophy, more severe in the nasal quadrants; we suggested that the patient undergo LHON mutation examination. An MRI examination is necessary. The treatment should be dependent on the clinical and examination results; the prognosis is relatively ideal.The original contributions presented in this study are included in the article/supplementary material, further inquiries can be directed to the corresponding authors.Written informed consent was obtained from the individual(s), and minor(s)\u2019 legal guardian/next of kin, for the publication of any potentially identifiable images or data included in this article.H-FZ and S-HW designed and conducted the study. M-MS, QS, H-EL, H-LS, H-JL, MY, and DT collected, analyzed, managed, and interpreted the data. M-MS and H-FZ prepared the manuscript and conducted the statistical analysis. H-FZ and Q-GX performed critical revision of the manuscript. All authors reviewed and approved the final version of the manuscript."}
+{"text": "Isolated hyoid bone fractures are rare and account for a small percentage of all head and neck fractures. The anatomic location of the hyoid bone, which is between the jaw and the cervical spine, is its most essential protective mechanism. In addition to the anatomic protection provided by the mandible, the fusion of the hyoid's bone pieces and the bone\u2019s mobile capacity in all directions are other protective factors contributing to the rarity of these fractures. However, this defense mechanism can get compromised upon exposure to blunt traumas and hyperextension injuries.Injury to the neck by blunt trauma can induce fast deterioration, and a missed or delayed diagnosis can result in morbidity and fatality. The importance of early diagnosis and suggested management options are further discussed. We herein report an unusual case of an isolated hyoid bone fracture in a 26-year-old man who was hit by a car while crossing the street. The patient was otherwise asymptomatic and vitally stable\u00a0so he was managed successfully by conservative management only. Hyoid bone fractures are uncommon and rarely reported as an isolated entity ,2. They Injury to the hyoid bone can be overlooked if there are other life-threatening injuries present or if the patient is asymptomatic. This poses a challenge in picking up these subtle fractures when patients first present to the emergency department (ED).In this case report, we present a single hyoid bone fracture induced by blunt trauma in a pedestrian versus motor vehicle accident (PVMVA) along with a full description of the injury and treatment options.We hereby report a case of a 26-year-old male who presented to the ED as a case of a pedestrian car accident while he was crossing the street. The patient reported that he was hit by a car from his back and fell on the left side of his body. No loss of consciousness occurred. On presentation, the patient's vital signs were within the normal range; blood pressure was 120/67 millimeters of mercury, temperature was 37.1 degree Celsius, heart rate was 88 beats per minute, respiratory rate was 18 breaths per minute, and oxygen saturation was 100% on room air. The patient only complained of mild anterior neck pain.On examination, Glasgow Coma Scale (GCS) was 15/15. There were multiple abrasions and lacerations noticed on his face, in addition to a small cut wound on his left eyebrow. On inspection of the neck, there was no swelling, wounds, lacerations, abrasions, or any redness noted. There was only mild neck tenderness on palpation. Bedside flexible nasolaryngoscopy was done and showed a clear patent airway with no signs of obstruction, no masses or lacerations in the larynx, and mobile vocal folds bilaterally. The remaining physical examination was\u00a0normal.After that, a neck computed tomography (CT) scan was done and a hyoid bone fracture was established Figure . The patThe hyoid bone is a solitary horseshoe-shaped bone in the front of the neck, made up of a body and two bigger\u00a0and two lesser horns . It is lDifferent causes for hyoid bone fractures have been reported in the literature within different settings. According to Erdogan B et al. and\u00a0Chowdhury R\u00a0et al., the most common causes of hyoid injuries are strangulation and hanging ,11. SimiFractures of the hyoid bone are frequently combined with injuries to the mandible, cervical spine, larynx, and throat because of its proximity to the surrounding structures. Because these injuries are more urgent, hyoid fractures may not be recognized right away . Missed Patients with hyoid bone fractures may have a wide range of symptoms ,12. The A hyoid bone fracture can be diagnosed by physical examination, cervical radiography, a CT scan, or direct laryngoscopy . HoweverThe focus of this case is the management of a patient with an uncommon, isolated fracture of the right larger horn of the hyoid bone in a pedestrian versus motor vehicle accident (PVMVA).The treatment of a hyoid bone fracture is mostly determined by the severity of the symptoms. For closed or asymptomatic fractures, conservative therapy is usually sufficient, and surgical intervention is rarely required -8. AlthoOther cases of hyoid bone fractures reported in the literature by Dalati T et al. and Keerthi R et al. recommended that all patients be monitored for 48-72 hours because even asymptomatic individuals are at risk of developing hemoptysis, edema, ecchymosis, and spasm, which may require tracheostomy and retro-pharyngeal drainage ,6. HowevAlthough rare, hyoid bone fractures could be life-threatening, they do not require surgical intervention unless the patient has a compromised airway, is symptomatic, or becomes symptomatic during the hospital stay. Observation has traditionally been the primary management modality, with a 24-72-hour hospital stay followed by a two-week post-injury evaluation after discharge."}
+{"text": "Expansion of tuberculous preventive therapy (TPT) is essential to curb TB incidence and mortality among people with HIV (PWH), yet implementation has been slow. Innovative strategies to operationalize TPT are urgently needed. Here we present an evaluation of community-based identification and referral of PWH on completion of a six-month course of isoniazid in a highly prevalent region in rural South Africa. Using a community-based TB/HIV intensive case finding strategy, a team of nurses and lay workers identified community members with HIV who were without fever, night sweats, weight loss, or cough and referred them to the government primary care clinics for daily oral isoniazid, the only available TPT regimen. We measured monthly adherence and six-month treatment completion in the community-based identification and referral (CBR) group compared to those already engaged in HIV care. Adherence was measured by self-report and urine isoniazid metabolite testing. A multivariable analysis was performed to identify independent predictors of TPT completion. Among 240 participants, 81.7% were female, median age 35 years (IQR 30\u201344), and 24.6% had previously been treated for TB. The median CD4 count in the CBR group was 457 (IQR 301\u2013648), significantly higher than the clinic-based comparison group median CD4 of 344 . Independent predictors of treatment completion included being a woman  and community-based identification and referral for TPT . Among the CBR group, treatment completion was 90.0%, an absolute 10.8% higher than the clinic-based comparison group . Adherence was significantly greater in the CBR group than the clinic-based comparison group, as measured by self-report (p = 0.02) and urine isoniazid testing (p = 0.01). Among those not on ART at baseline, 10% of eligible PWH subsequently initiated ART. Community members living with HIV in TB endemic regions identified and referred for TPT demonstrated higher treatment completion and adherence compared to PWH engaged for TPT while receiving clinic-based care. Community-based identification and referral is an innovative adjunctive strategy to facilitate implementation of TB preventive therapy in people living with HIV. Tuberculosis (TB) is the leading cause of infectious death worldwide and among people living with HIV (PWH) . South ATPT implementation faces multiple patient-level and systemic barriers along the cascade of care; initiation, adherence, and completion rates are suboptimal \u201317. Comm\u00ae  and chest radiography, are only available at the district hospital [This study was conducted in the rural sub-district of Msinga in KwaZulu-Natal province, an area covering 2000 square kilometers, and a population of 180,000 traditional Zulu people. Msinga is among the most impoverished regions in the country , 38. Res3 to those with CD4<500 cells/mm3 in January 2015 [From 2013\u20132016, a team of health educators, nurses, and HIV counselors attended community-based congregate settings, such as bus stations, municipality events, and pension pay points , to provide integrated TB/HIV screening services . The teaary 2015 . TPT conary 2015 . PWH \u226518ary 2015 , 42 werePWH who were referred and subsequently linked to care, defined as a clinic visit for TPT, at one of five study clinics in Msinga were offered written informed consent. For every enrollee in this CBR group, a PWH \u226518 years initiating TPT in routine HIV care during the same week and clinic, was offered written informed consent to enroll into a clinic-based comparison (CBC) group. After providing consent, all participants received TPT education and medications were subsequently prescribed and dispensed by Department of Health personnel to be taken daily for six months, without routine pyridoxine supplementation or hepatic function monitoring, and integrated with HIV services . EnrollmThe primary outcome was six month TPT completion , definedDescriptive statistics were used to characterize the population and bivariate analyses were performed to identify factors associated with completing TPT. Comparisons between the two groups were made using parametric (t-test) or non-parametric equivalent (for continuous variables) or by chi-square . Variables that were significant at the p<0\u00b72 level in univariate logistic regression models predicting the primary outcome (TPT completion) were entered into a stepwise multivariable logistic regression analysis. Unadjusted and adjusted odds ratios and 95% confidence intervals were calculated. Self-reported adherence was defined as a participant reporting taking their pills. The five categories of self-reported adherence were assigned a score of 0  or 1 (\u2019Most/All TPT pills per day\u2019). Using urine metabolite testing, adherence was assessed as strong if the urine result was blue-purple, indicating isoniazid intake in the last 24-48hours. Strict adherence was defined as blue-purple urine at all of the six follow-up visits. Self-report was also correlated with urine testing scores. For all analyses, a p-value <0.05 was considered statistically significant. All statistical analyses were performed using SAS 9\u00b73 .Ethical approval was obtained from the institutional review boards at the South African Medical Association and Yale University School of Medicine. The protocol was also reviewed in accordance with the U.S. Centers for Disease Control and Prevention (CDC) human research protection procedures and was determined to be research, but CDC investigators did not interact with human subjects or have access to identifiable data or specimens for research purposes.3(IQR 238\u2013588). Women had a median CD4 count of 439 (IQR 255\u2013619), while men had a median CD4 count of 393 (IQR 205\u2013514), with no significant difference in CD4 based on gender (p = 0.47). Among the CBR group, the median CD4 count was 457 (IQR 301\u2013648), significantly higher than the clinic-initiated comparison group whose median CD4 cell count at baseline was 344 . Approximately one quarter of participants in the CBR group and comparison group had been previously diagnosed with TB (p = 0.65), and the proportion with harmful drinking was higher in those identified in the community (8.3%) as compared to persons identified at the clinic .During 334 community-based congregate site visits, 563 individuals were identified as HIV positive. Of those, 411 (73%) had a negative TB symptom screen, deemed eligible, and referred for TPT care . Among PThe majority of clinic TPT initiators (70.8%) were already on ART, and had been on treatment for a median of 442 days (IQR53-1223) days. Significantly fewer CBR participants (50%) were taking ART at baseline (p = 0.001), but were on treatment for a median 1398 days (IQR 970\u20132350).A comparison of the primary outcome of TPT completion was performed between the two groups . Among tStudy participants reported taking all or most of their pills during 97.9% (1228 of 1254) patient visits. Of the CBR group, 70% self-reported strict adherence, as compared to 54.2% of the comparison group (p = 0.02). Urine metabolite testing was performed in 97% (1216 of 1254) study visits, and of these, 95.8% (1165 of 1216) were blue-purple, demonstrating strong adherence to TPT. Strict adherence over the TPT course in the CBR group was demonstrated in 56.7% by urine testing, significantly greater than the 40.8% in the comparison group (p = 0.01). Self-reported adherence was positively correlated to urine testing .Among 60 CBR participants not receiving ART at baseline, 28 were eligible or became eligible during the course of the study, and among these, 12 (42.9%) participants initiated ART. Among 35 participants in the comparison group not on ART at enrollment, 14 were eligible or became eligible and 8 (57.1%) initiated ART prior to the end of the study. There was no significant difference in ART initiation between these groups.3, and community-based referral were associated with TPT completion, whereas concurrent ART, either at baseline (p = 0.90) or initiated over the course of the study (p = 0.34), was not associated with TPT completion. Multivariable stepwise regression analysis identified female gender and community-based referral as independent predictors of TPT completion while CD4 count \u2264 350 cells/mm3 dropped out of the model (Bivariate analyses demonstrated that gender, CD4 count \u2264 350 cells/mmhe model .We compared two strategies for initiating TPT in a high HIV and TB prevalence community in rural South Africa. We demonstrate that a community-based approach to identifying and referring TPT-eligible PWH resulted in a 10% absolute higher completion rate and significantly better adherence compared to those PWH who were already engaged in care. This observed effect was independent of CD4 count on entry into the study. This is among the first studies to successfully leverage a community-based approach for implementing TPT for PWH. The difference in TPT treatment adherence and completion between groups may be due to a number of factors. PWH identified in the community and referred for TPT, often not yet taking ART, may have different perspectives and motivations on their health status and how best to improve their health compared to PWH in the comparison group who were already engaged in HIV care and were largely already taking ART. A higher proportion of PWH engaged in clinic-based care were taking ART and may not prioritize TPT as highly as ART or were impacted by pill burden, resulting in selective adherence to ART over TPT , 52. ThuCommunity-based strategies have been successful in identifying individuals with previously unknown or known communicable and non-communicable diseases, and linking them to care , 55, 56.Gender had a large impact on outcomes in this study. Women were more successful in completing the TPT course, compared to men, independent of CD4 count. This is not unexpected given that women are more likely to undergo testing, link to care, initiate ART, and overall experience better TB and HIV outcomes than men, particularly in resource limited settings \u201369. ThisCommunity-based approaches may also likely support medication adherence. In contrast to other studies, adherence was excellent among all enrollees, potentially attributable to the education and counseling about TPT in both arms. National guidelines  do not sAmong those not receiving ART at enrollment, nearly 10% subsequently initiated ART during the study follow up period. In this instance, engaging community members for preventive therapy also contributed to ART initiation. While the proportion subsequently initiating ART was not statistically significant between both groups, the proportion of those referred from the community for TPT and then subsequently initiating ART was substantial. With the removal of CD4 criteria for ART eligibility and implementation of differentiated care strategies such as community-based ART provision, ART initiation would likely be higher. Another notable finding was the significantly higher CD4 count at enrollment among the CBR group, demonstrating entry into HIV care at an earlier stage of disease accompanied by the potential benefit of longer disease-free survival. This type of community-based \u2018hook\u2019 into the health care system can be a valuable tool to engaging individuals into clinical care. In the era of \u2018test and treat\u2019, the emphasis remains on rapid ART initiation, but TPT and ART are necessary companions in HIV care, and patients will benefit from bundled care , 73. LauThere are a number of limitations in this study. Community members referred for TPT were not traced to other than the five study sites, limiting ascertainment of TPT outcomes for referred community members who may have gone to a different facility. Study participants may also represent those particularly motivated to obtain TPT. Secondly, some PWH who were lost to follow-up due to moving out of the area may have continued TPT after relocating; it is possible that if all completed their TPT course, the completion rates would have been similar. Next, urine metabolite testing is limited by detection only over the prior 48\u201372 hours, and enrollees expecting to be tested may have altered their behavior just prior to an upcoming appointment , 50. RegTB preventive therapy is an effective strategy to reduce TB incidence in PWH and a WHO-recommended approach to reduce the global burden of TB. Despite being recommended for more than a decade, implementation has not reached optimal levels. Novel strategies such as community-based case finding and referral, designed here to engage individuals for TPT, can be implemented more broadly to engage individuals in care. With updated WHO recommendations on who should receive TPT, including HIV negative adult household contacts of TB patients and other immunosuppressed patients, community-based strategies can offer an innovative complementary approach to traditional TB contact tracing by identifying additional at risk individuals with and without HIV to expand implementation , 27, 75."}
+{"text": "Arnica montana L. (Asteraceae) has a long and successful tradition in Europe as herbal medicine. Arnica flowers  are monographed in the European Pharmacopoeia (Ph. Eur.), and a European Union herbal monograph exists, in which its use as traditional herbal medicine is recommended. According to this monograph, Arnica flowers (Arnicae flos Ph. Eur.) and preparations thereof may be used topically to treat blunt injuries and traumas, inflammations and rheumatic muscle and joint complaints. The main bioactive constituents are sesquiterpene lactones (STLs) of the helenanolide type. Among these, a variety of esters of helenalin and 11\u03b1,13-dihydrohelenalin with low-molecular-weight carboxylic acids, namely, acetic, isobutyric, methacrylic, methylbutyric as well as tiglic acid, represent the main constituents, in addition to small amounts of the unesterified parent STLs. A plethora of reports exist on the pharmacological activities of these STLs, and it appears unquestioned that they represent the main active principles responsible for the herbal drug\u2019s efficacy. It has been known for a long time, however, that considerable differences in the STL pattern occur between A. montana flowers from plants growing in middle or Eastern Europe with some originating from the Iberic peninsula. In the former, Helenalin esters usually predominate, whereas the latter contains almost exclusively 11\u03b1,13-Dihydrohelenalin derivatives. Differences in pharmacological potency, on the other hand, have been reported for the two subtypes of Arnica-STLs in various instances. At the same time, it has been previously proposed that one should distinguish between two subspecies of A. montana, subsp. montana occurring mainly in Central and Eastern Europe and subsp. atlantica in the southwestern range of the species distribution, i.e., on the Iberian Peninsula. The question hence arises whether or not the geographic origin of Arnica montana flowers is of any relevance for the medicinal use of the herbal drug and the pharmaceutical quality, efficacy and safety of its products and whether the chemical/pharmacological differences should not be recognized in pharmacopoeia monographs. The present review attempts to answer these questions based on a summary of the current state of botanical, phytochemical and pharmacological evidence. Arnica montana L. (Asteraceae) is a medicinal plant species that has been used for many centuries in European medicine. From the Middle Ages onwards, Arnica was shown and mentioned in various old herbal books and gained importance as a remedy up to the 18th and early 19th century  zygomorphic, female ray florets, on an upright, sparsely branched stem  in the context of medicinal use or preparations, while it will be italicized where the systematic genus name is meant. In spite of its name, the drug Arnica flower consists not only of the flowers (disc and ray florets in this case) but comprises the complete inflorescence, including the receptacle as well as involucral bracts [stem see  2]. All. AllA. mmisphere . Please Ph. Eur. . Consistl bracts ,8.A. montana is currently only listed in the IUCN red list as a species of \u201cleast concern\u201d at the European level [Although a protected species under the EU Habitats Directive and the EU regulation of trade of fauna and flora, an level  so that,an level ). The span level  is availArnica flowers are widely used in preparations based on alcoholic extracts such as the ethanolic tincture, which is also monographed in the Ph. Eur. as Arnica tincture (Arnicae tinctura) . Less frArnica montana L., flos\u201d, in which the legal status of Arnica and its preparations is defined: herbal preparations in semi-solid and liquid dosage forms for cutaneous use and produced on the basis of various defined ethanolic extracts are defined as herbal medicines in Traditional Use, meaning that they may be marketed after simplified registration. Traditional Use registration does not require clinical safety and efficacy trials but is accepted on grounds of sufficient safety data and plausible efficacy, mainly based on the literature, given that the drug has been in use for at least 30 years, including 15 years in the EU. In Germany, Latvia and Slovenia, certain Arnica preparations also have a market authorization due to \u201cWell established use\u201d [While Arnica was historically used internally as well as externally, the former was abandoned in the 20th century due to a certain degree of toxicity upon internal use ,15,16,17From this backdrop, in the obvious presence of sufficient data, it might be expected that any Arnica preparation produced and used in accordance with the CHM should be equally efficacious and safe. \u201cCase closed\u201d, one might think. But some existing evidence on rather conspicuous differences in the chemical composition of the bioactive constituents of Arnica flowers originating from different parts of Europe happens to make things more complicated.Arnica, as a whole, was comprehensively described by B. Maguire in his extensive monograph from 1943 [Arnica montana L. was recognized there as the type species of the subgenus Montana . A. montana is the sole Arnica species occurring in Europe south of Scandinavia. Its distribution was described, according to Maguire , as \u201cEurope, up north to northern France, Belgium, northwest Germany, Denmark, Scandinavia , Pomerania, Western Prussia, Eastern Prussia, North and East Poland, Lithuania, Livonia, Courland; in south Europe  up to Portugal, east and north Spain up to the Pyrenees, up to northern Italy, to the northern Balkan and south Russia\u201d (translated from German by the present author). Maguire recognized the considerable polymorphy of A. montana, which had previously led to several attempts to segregate the species  but, obviously, he did not adopt the view. He explicitly mentioned that A. montana had not been segregated into any pronounced geographical populations [A. montana subspecies, distinguished by morphological characteristics and delimited by their geographic origin, subspecies montana occurring in the central and east European ranges and subsp. atlantica, occurring only in the far (south) western range, i.e., on the Iberic peninsula with Portugal, Northern Spain and up to southwestern France [atlantica being less tall and more slender, with more lanceolate leaves and somewhat smaller flowerheads than subsp. montana. The existence of the two subspecies, thus proposed, has later been questioned, since the morphological characteristics/biometric data did not allow for a clear distinction [A. montana from the geographically distinct populations in Central/East Europe and such from Spain was genetically highly different. Schmiderer et al. [A. montana populations from different habitats in Galicia (NW Spain). Their results also suggested the presence of two different genetic groups and were also congruent with two chemotypes described [The genus rom 1943 . Arnica ulations . Obviousn France . The twor et al.  comparedr et al.  comparedescribed   of several structural types are found as a predominant feature in most of them [A. montana have been reviewed several times [A. montana are shown, and the abbreviations used further on for the various esters are explained in The chemistry of the genus  of them . The conal times ,5,6,7,24al times ,26. In aal times . The strIn addition to STLs, the flowerheads contain essential oil consisting of sesquiterpenes, thymol derivatives and further monoterpenes, as well as a plethora of flavone and flavonol aglycones and their glycosides, polyacetylenes, caffeic acid derivatives, coumarins, carotenoids and fatty acids ,8,12,24.A variety of methods have been used and published for the analytical characterization of Arnica by means of its STLs. These methods have recently been reviewed .Arnica montana flowers and their preparations  on specific inquiry concerning this issue in August 2022. The term SCF, as referred to in the present publication, means a factor for use in the numerator as in the Ph. Eur. monograph, i.e., for multiplication with the STL peak area. Inspecting the reciprocal values of the Kf data determined and published by the original authors [f = SCF values < 1, whereas in the case of DH derivatives, these values would be >1 in all cases where they could be determined. It thus follows that the simplistic method of calculating an \u201coverall content of STLs, determined as DHTG\u201d based on the SCF >1 of one particular DH ester would lead to realistic results only for other DH derivatives but would give results significantly too large for all derivatives of HEL, whose peak areas would actually have to be multiplied by a value < 1 in order to give a realistic value. The error of the Ph. Eur. method, i.e., the discrepancy of the results from the true content of STLs, will, thus, grow with the fraction of HEL derivatives in the overall mix. In other words, total STL contents determined with the Ph. Eur. method for Arnica samples containing more HEL than DH esters will yield results that are notoriously too high. An example to illustrate this problem is given in the footnote to A. montana (see below) are to be compared.It has been generally accepted for many years that the STLs are the constituents mainly responsible for the biological/pharmacological activity of  of DHTG ,11. The  of DHTG , who det content , while i the SCF ,11  as well as Spanish  locations  near Innsbruck, Austria [Most importantly in the context of the present communication, very conspicuous differences in the detailed profile of STLs in  Vayreda , have be Vayreda  reportedions see . While tted data . In a stn et al.  found non et al. ) and varn et al. . A simil Austria . An HPLCmontana and atlantica, respectively) was confirmed in the above-mentioned study on chloroplast DNA, in which the two different chemotypes were assigned based on HPLC analyses according to Ph. Eur. but without reporting detailed results of these analyses [Importantly, a correlation of the two different chemotypes with genotypic differences between CEA and SPA , peat bogs (n = 8), heathland (n = 3)) at varying altitudes in Spain. The authors used an HPLC-UV method detecting at 225 nm but with their own internal standard and response factors. It was found, quite surprisingly, that accessions from three investigated heathland areas at high altitude (1330\u20131460 m) showed a chemotype dominated by HEL derivatives. The mean RHD in the three accessions was 1.6 (0.93\u20132.63), while the populations growing in the other two types of habitats and at lower altitude (420\u20131215 m) showed a DH chemotype, as that reported by Willuhn et al. [montana and atlantica sensu de Bolos y Vayreda [A. montana [In addition to these various reports indicating that the HEL chemotype is a rather stable feature in the CEA, it has also been demonstrated, in at least two cases, that there may be exceptions, i.e., that flowers of ivatives  and, on ompounds . The latompounds  investig Vayreda  . However, the truth, as is often the case, appears to be more complicated than reflected by this simple a scenario. This becomes clear from the two examples just mentioned, where populations with the HEL chemotype occur in Spain [A. montana during plant development and ontogeny [A. montana plants obtained via in vitro propagation of nodal sections from in vitro seedlings and then cultivated in proving fields in Romania, irrespective of their germplasm origin in Germany or Ukraine, displayed a change from a DH chemotype (RHD \u2248 0.3\u20130.4) in the second year of cultivation to an HEL chemotype (RHD \u2248 1\u20133) in the third year. Flowerheads of plants obtained directly from seeds (same origin as in vitro propagated plants) and grown in the same environment did not show this phenomenon, i.e., had the expected HEL chemotype (RHD \u2248 2\u20135) in the second year (first year in which flower samples were taken) [A. montana [The question regarding the reasons for the major chemical differences between most CEA and SPA populations has been addressed various times. It would appear straightforward to explain the existence of different STL chemotypes with a fixed genetic difference also manifested in the existence of two geographically and morphologically distinguishable phenotypes. This would conveniently support the equivalence of the observed chemotypes with the proposed phenotypical subspecies , now alsin Spain  and wherin Spain . It becoontogeny ,37,38,39ontogeny ), that, ontogeny , using ae taken) . These o montana ) with a 11,13 unsaturated precursors. This conversion has been proven experimentally in the case of the simple germacranolide costunolide, which is converted by an oxygen-independent enoate reductase in an NADPH-dependent manner to 11(S),13-dihydrocostunolide [The biosynthetic sequence of STLs was proposed by early authors ,41 and, tunolide . The biotunolide ,41,42, wA. montana, it can be plausibly hypothesized that the activity or level of expression of this hydrogenase is higher in the flowerheads of most populations of SPA than in those of CEA. The reason for this differential activity most likely lies in differential levels of gene expression: the conversion of HEL to DH is not exclusive  in the DH chemotype but takes place to a different extent in both chemotypes. The extent of conversion  varies in each of the chemotypes  and with A. chamissonis, a North American species) were very recently published by Parafiniuk et al. [The hydrogenation of the helenalin derivatives to their 11\u03b1,13-dihydrohelenalin congeners (or the corresponding conversion at an earlier stage of biosynthetic precursors) would require at least one reducing/hydrogenating enzyme of the same type as responsible for the transformation of costunolide to 11,13-dihydrocostunolide . It is n2 in SPA ), and it2 in SPA  as well 2 in SPA . Highly k et al. . The autk et al. . While tk et al. ). It wouA. montana.Thus, detailed space-/organ-/tissue- and time-resolved analyses of the STL pattern in direct comparison with the transcriptome and taking into account various parameters, including geographic origin, other environmental factors as well as the investigated plants\u2019 ontogeny and developmental stage would be highly desirable to fully solve the enigma of why different chemotypes exist in As briefly mentioned above, STLs have long been accepted as the major pharmacologically relevant constituents in Arnica, which are held (and have in many cases been proven) responsible for the majority of the drugs\u2019 therapeutic effects, including unwanted ones ,14,15,43Even in early studies dating back to the 1970s, HEL and related STLs were found to be more active than DH and other congeners without the 11,13 double bond  with tincture made from SPA (DH chemotype) resulted in the finding that the inhibition of NF-\u03baB was about twice as strong in the case of the former than the latter [A study of very high relevance with regard to the present review\u2019s central question was conducted by Klaas et al. in 2002 . Investie latter . This wae latter . In addie latter . Inhibite latter , so thate latter . Howevere latter . DHMA, ae latter . UnfortuSimilar results were obtained by the same group when Arnica tinctures prepared from CEA and SPA Arnica flowers were reported to modulate the activity of the matrix metalloproteases MMP1 and MMP13 in human and bovine chondrocytes by inhibiting the transcription factors AP-1 and NF-\u03baB . SignifiIn addition to the inhibition of these transcription factors, further mechanisms of action have been shown for HEL-type STLs, which can also be considered important for the overall anti-inflammatory activity. Thus, it has been shown that HEL is an inhibitor of Leukotriene biosynthesis . The STL50 concentration for C/EBP\u03b2 inhibition is at least 10-times lower than that required for NF\u03baB inhibition so that the new mechanism may be even more important for the anti-inflammatory action of Arnica STLs than their effect on NF-\u03baB [50 values for cMyb inhibition (which later turned out to be C/EBP\u03b2 inhibition) determined for HELAC and DHAC were 0.7 and 18 \u00b5mol/L, respectively [Much more recently, and possibly more importantly, it was discovered that STLs like HEL and some other types inhibit the activity of yet another transcriptional system, namely, the MYB-C/EBP\u03b2-p300 transcription module . STLs won NF-\u03baB . Among aectively . Thus, aA relatively limited number of clinical studies on the therapeutic efficacy of Arnica preparations exist. The existing studies were summarized in the ESCOP monograph  and the However, based on many results from biological assays related to the anti-inflammatory potency of HEL and DH and their derivatives, including such (few) preparations of HEL and DH chemotypes being directly compared, it can be concluded that Arnica preparations with a higher content of HEL derivatives \u2014at least in the case of an approximately equal total STL content\u2014will be superior in efficacy to those that are characterized by a dominance of DH derivatives .Many plants of the family Asteraceae (=Compositae), including Arnica, are known to cause contact allergy ,64,65,66Arnica montana, only compounds of the HEL series possess this structure element. However, other enone moieties, including the cyclopentenone (CP) group occurring in HEL as well as DH derivatives, are also able to react with SH groups [either tincture or even with isolated HEL and DH esters , and the authors presented good evidence that the anti-inflammatory activity of the STLs indeed counteracts their sensitizing potential. Therefore, the authors classified Arnica as a weak allergen [Arnica species, including A. montana [A. sachalinensis, an east Asian Arnica species not containing any STLs at all [It is commonly accepted that allergenic STLs, including those of Arnica, undergo Michael-type addition reactions with proteins  with their electrophilic \u03b1,\u03b2-unsaturated carbonyl structures (\u201cenones\u201d) and, thereby, not only cause most of their wanted pharmacological effects, such as the inhibition of NF-\u03baB , determined via a fully validated LC-MS method [All this said, it is interesting to note that the skin toxic and irritant potential of Arnica tincture was very recently reported to be insignificant . In the S method ; RHD = 1montana and atlantica, is correct and accepted in the sense of systematic botany. The existence of two chemotypes within the species is an undeniable fact. This fact is obviously being ignored by the Ph. Eur. . Two rather different herbal drugs with conspicuous differences in chemical constituents and, thus, pharmacological potency as well as, possibly, a different level of risk are called the same name and treated as the same thing, which cannot be considered satisfactory in terms of the pharmaceutical quality, efficacy and safety of Arnica preparations.The present situation of Arnica as a drug and its preparations, in spite of its long tradition as a successful herbal remedy, is far from satisfactory. It is firmly established on the grounds of a large body of evidence from many chemical investigations that \u201cArnica flower\u201d, in terms of chemical profile and, thus, pharmacological potency, may mean different things. With respect to pharmaceutical/medicinal use, it is unimportant whether a taxonomic subdivision in two subspecies, A. montana of the HEL chemotype for a genuine medical purpose where it clearly is the anti-inflammatory potency that counts. In this regard, it should be mentioned again that an easily cultivable clone, A. montana Arbo, is available, which displays an HEL chemotype. The DH chemotype, on the other hand, could possibly be utilized more confidently in a cosmeceutical context  where the pharmacological potency is less important.On the grounds of pharmacological evidence, it would appear reasonable to use Arnica montana in the pharmacopoeia monograph. In this implementation, care should be taken of the mentioned analytical shortcoming of the Ph. Eur. method by prescribing at least a distinction between the two groups of STLs, which does not represent a technical problem. The distinction between two chemotypes must be demanded, given the background of all evidence and current knowledge presented in this review, for the sake of pharmaceutical quality, efficacy and safety, despite the fact that not all relevant questions are answered. It will be of significant interest to study, in more detail, the origin/reasons for the occurrence of the large quantitative differences between HEL and DH derivatives in the two chemotypes or putative subspecies. Such studies would best include very thorough time- and organ-resolved analyses of the STL pattern in A. montana, best grown under controlled environmental conditions, paralleled by analyses of gene expression/transcriptome in the same plants. Furthermore, detailed pharmacological comparisons at the in vitro as well as in vivo and, optimally even at the clinical, levels between the two chemotypes will have to be conducted in future in order to arrive at valid quantitative measures for the efficacy and safety of the two Arnica flower drugs of different provenance.In view of the presented evidence, it is now necessary to accept the facts and implement a distinction between a helenalin- and a dihydrohelenalin-rich chemotype of A. montana (chemo)types under debate. The current work is, hence, largely based on the author\u2019s literature collection on Arnica accumulated over the years. Additionally, literature searches in PubMed [https://pubmed.ncbi.nlm.nih.gov (accessed on 27 July 2023)) and SciFinder [https://scifinder-n.cas.org/ (accessed on 27 July 2023)) were conducted in July 2023. In order to exclude articles dealing with Arnica as a homeopathic remedy, the key word \u201cArnica montana NOT homeop*\u201d was used.Please note that this review is not meant as a comprehensive review on the topic \u201cArnica\u201d but is focused on the botanical, chemical and pharmacological differences between the two n PubMed   were then evaluated for direct relevance to the topic of the review, i.e., comparisons/differences between The author apologizes in advance for possibly having missed any relevant pieces of literature information and hereby also expresses his advance gratitude for being notified if any should be detected."}
+{"text": "Polybrominated diphenyl ethers (PBDEs) are commercially used flame retardants that bioaccumulate in human tissues, including breast milk. PBDEs produce endocrine and metabolic disruption in experimental animals and have been associated with diabetes and metabolic syndrome (MetS) in humans, however, their sex-specific diabetogenic effects are not completely understood. Our past works show glucolipid dysregulation resulting from perinatal exposure to the commercial penta-mixture of PBDEs, DE-71, in C57BL/6 female mice.As a comparison, in the current study, the effects of DE-71 on glucose homeostasis in male offspring was examined. C57BL/6N dams were exposed to DE-71 at 0.1 mg/kg/d (L-DE-71), 0.4 mg/kg/d (H-DE-71), or received corn oil vehicle (VEH/CON) for a total of 10 wks, including gestation and lactation and their male offspring were examined in adulthood.In vivo glucose challenge showed marked glucose intolerance (H-DE-71) and incomplete clearance (L- and H-DE-71). Moreover, L-DE-71-exposed mice showed altered glucose responses to exogenous insulin, including incomplete glucose clearance and/or utilization. In addition, L-DE-71 produced elevated levels of plasma glucagon and the incretin, active glucagon-like peptide-1 (7-36) amide (GLP-1) but no changes were detected in insulin. These alterations, which represent criteria used clinically to diagnose diabetes in humans, were accompanied with reduced hepatic glutamate dehydrogenase enzymatic activity, elevated adrenal epinephrine and decreased thermogenic brown adipose tissue (BAT) mass, indicating involvement of several organ system targets of PBDEs. Liver levels of several endocannabinoid species were not altered.Compared to VEH/CON, DE-71 exposure produced hypoglycemia after a 11\u00a0h fast (H-DE-71). An increased fast duration from 9 to 11\u00a0h resulted in lower blood glucose in both DE-71 exposure groups. Our findings demonstrate that chronic, low-level exposure to PBDEs in dams can dysregulate glucose homeostasis and glucoregulatory hormones in their male offspring. Previous findings using female siblings show altered glucose homeostasis that aligned with a contrasting diabetogenic phenotype, while their mothers displayed more subtle glucoregulatory alterations, suggesting that developing organisms are more susceptible to DE-71. We summarize the results of the current work, generated in males, considering previous findings in females. Collectively, these findings offer a comprehensive account of differential effects of environmentally relevant PBDEs on glucose homeostasis and glucoregulatory endocrine dysregulation of developmentally exposed male and female mice. Considerable evidence points to a potential contribution of endocrine- (EDCs) and metabolism-disrupting chemicals (MDCs) to the rapid increase in the incidence of these metabolic diseases . One claetration \u201314. Thervia exposed dams and accumulate in male and female offspring liver and brain  is informative in understanding the diabetic phenotype of T2D. The incretin GLP-1 is secreted by enteroendocrine L-cells and acts on pancreatic \u03b2-cells to promote postprandial insulin secretion. In T2D, this insulinotropic effect is either impaired or absent leading to hyperglycemia . ActivatHaving observed sexually dimorphic risk and susceptibility of perinatally exposed females to MetS , 29, thead libitum in glass water bottles. Procedures on the care and treatment of animals were performed in compliance with the National Institutes of Health Guide for the Care and Use of Laboratory Animals and approved by the University of California, Riverside, Institutional Animal Care and Use Committee (AUP#20170026 and 20200018).C57BL/6N mice were obtained from both Charles River Laboratories  and Taconic Biosciences . Mice were group housed 2-4 per cage and maintained in a non-specific pathogen free vivarium on a 12\u00a0h light/dark cycle at an ambient temperature of 20.6-23.9 \u00b0C and relative humidity of 20-70%. Mice were provided rodent chow  and municipal tap water Dosing solutions were prepared as described previously , 32. In via the dam was accomplished as described previously  and ex vivo analysis of hepatic, adipose, adrenal, and endocrine parameters (Cohort 2). The DE-71 exposure and testing paradigm is shown in Perinatal PBDE exposure eviously . In brieeviously Figure\u00a01eviously , 20, 38,ex ratio . Male ofITT, was calculated using the formula (0.693 x 100) x t1/2-1 to determine in vivo insulin sensitivity from 0-30\u00a0min post insulin injection. Fasting blood glucose was determined from baseline values (t=0) obtained in IPGTT (11h) and ITT (9h). GTT and ITT sample sizes were different because ITT effect size was expected to be less (as estimated by our previous work (Mice were fasted overnight (ON) for 11h and then injected with glucose . Glucose was measured directly from tail blood (~1 uL) at time 0, 15, 30, 60, and 120\u00a0min post-glucose challenge. A calibrated glucometer and test strips  were used to measure plasma glucose concentrations. Seven days following IPGTT, an insulin tolerance test (ITT) was performed with Humulin R (Eli Lilly) bolus  on mice fasted ON for 9h. Tail blood was collected, and glucose was sampled in the same manner as IPGTT . For area calculations, the area under (AUC) or above the glycemia curve (inverse AUC) from 0-120\u00a0min post injection was used. The percent blood glucose reduction rate after insulin administration, Kous work ) and, thDuring sacrifice, under terminal isoflurane anesthesia, cardiac blood (0.3-1 mL) was collected and centrifuged at 16,000 x g for 20\u00a0min at 4 \u00b0C. After the addition of a cocktail of protease inhibitors and EDTA, the plasma samples were stored at -80\u00b0C until further use. The following organs were excised and weighed: liver, pancreas, spleen, adrenal glands and interscapular brown adipose tissue (BAT). Plasma, liver and adrenal samples were snap-frozen over dry ice and stored at -80 \u00b0C for later analysis of plasma hormones, adrenal epinephrine, liver endocannabinoids and enzymatic activity.via cardiac puncture (ad libitum fed state) was analyzed for metabolic hormones using commercially available kits according to manufacturer\u2019s instructions. Plasma insulin was measured using commercial ELISA kits  as previously described , 10 pmol d4-oleoylethanolamide , and 500 pmol d5-2-arachidonoyl-sn-glycerol . Following homogenization of samples, 2 mL of chloroform and 1 mL of water were added, followed by centrifugation at 2000 x g for 15\u00a0min at 4\u00b0C. The organic phase was extracted and the pooled lower phases were dried under N2 gas followed by resuspension in 0.1 mL methanol:chloroform (9:1). Analysis of endocannabinoids (EC) was performed via ultra-performance liquid chromatography coupled to tandem mass spectrometry (UPLC/MS/MS) as previously described 6. The mixture was incubated at 0\u00b0C for 20\u00a0min and the oxidation reaction was stopped by the addition of 60 \u00b5L of a 9\u00a0N NaOH solution containing 4 mg/ml ascorbic acid . Fluorescence emission was determined at 520 nm (excitation wavelength at 420 nm) using a fluorescence plate reader (Promega). Epinephrine concentration  was converted from the mean fluorescence intensity units of each sample using calibration standards and polynomial curve fitting.Epinephrine content in adrenal glands was measured using a modification of the trihydroxyindole method as described previously . Brieflypost hoc testing for multiple group comparisons. For parametric ANOVAs, Tukey\u2019s post hoc test was used when both sample sizes and variance were equal, and a Dunnett\u2019s T3 test was used when sample size and variance were not equal. For non-parametric ANOVA, a Dunn\u2019s post hoc test was performed. For Two-way ANOVA, Tukey\u2019s, Sidak\u2019s and Holm-Sidak\u2019s post hoc tests were used. Differences were deemed significant at p<0.05. Data are expressed as mean \u00b1 standard error of the mean (s.e.m) unless indicated otherwise.Statistical analyses were performed using GraphPad Prism v.9.4.1. A one-way analysis of variance (ANOVA) was used to test the main effect of one factor. When normality assumption failed, as determined using a Shapiro-Wilk test, a Kruskal-Wallis H ANOVA was used. A Brown-Forsythe ANOVA was used if the group variances were significantly different. Data for fasting glycemia were analyzed by two-way ANOVA for main effects of exposure and fasting duration. ITT and GTT experiments were analyzed by repeated measures two-way or mixed model ANOVA to determine main effects of exposure and time. ANOVA was followed by Exposure effect F=9.34, p<0.001, Tukey\u2019s post-hoc VEH/CON vs L-DE-71, p=0.03 and lower in L-DE-71 vs H-DE-71, p=0.0003). Relative liver weight was 8% greater in H-DE-71 relative to L-DE-71 =2.824, p=0.0675, Tukey\u2019s post-hoc L-DE-71 vs H-DE-71 p<.05). The absolute and relative weights of pancreas and spleen were similar across groups.Exposure effect F= 6.65, p<0.01; Time effect F= 24.6, p<0.0001; Exposure x Time F= 0.76 ns; Sidak\u2019s post hoc test, 11\u00a0h: VEH/CON vs H-DE-71, p<0.01; 9\u00a0h vs 11\u00a0h, L-DE-71 p<0.01, H-DE-71, p<0.05 (We examined fasting blood glucose (FBG) after 9 and 11\u00a0h fasting using glycemia values from basal time points obtained in ITT and GTT experiments, respectively. , p<0.05 Figure\u00a02=4.767, p<0.05; Time effect F=330.2, p<0.0001; Time x Exposure F =3.112, p<0.01)  and 60\u00a0min post injection (p<0.05) and in L-DE-71 vs H-DE-71 at t=30 (p<0.01) and 60\u00a0min post injection (p<0.01).To investigate the effects of DE-71 on glucose tolerance, glycemia was measured during GTT over the 120\u00a0min post-injection time course =278.6, p<0.0001; Exposure effect F=9.39 p<0.001; Time x Exposure F=5.94, p<0.0001). Mean glycemia values for H-DE-71 were significantly different from VEH/CON at t=15 , 30 (p<0.01) and 60\u00a0min post injection (p<0.01) and from L-DE-71 at t=15 (p<0.01), t=30 (p<0.01) and 60\u00a0min post injection (p<0.001).Since FBG after an 11\u00a0h fast was lower in H-DE-71 relative to VEH/CON =5.21, p<0.05, Tukey\u2019s post-hoc VEH/CON vs H-DE-71, p<0.029, L-DE-71 vs H-DE-71, p<0.013; Percent basal glycemia AUC, Brown-Forsythe ANOVA: Exposure effect F=10.1, p<0.001, Dunnett\u2019s T3 post-hoc VEH/CON vs H-DE-71, p<0.004, L-DE-71 vs H-DE-71 p<0.0003 .The differences in magnitude and duration of glycemia are integrated using the area under the glucose curve, AUCTime effect F=56.2, p<0.0001; Exposure effect F=2.40, ns; Time x Exposure F=1.90, p<0.05) . When glycemia is expressed as a percent of baseline, L-DE-71 exposed mice displayed incomplete recovery or glucose clearance/utilization at 90 and 120\u00a0min after insulin injection =33.7, p<0.0001; Exposure effect F=8.014, p<0.001; Time x Exposure F=1.23, ns)  and 120\u00a0min (p<0.001). This is represented as a greater mean latency to reach the minimum insulin-induced hypoglycemia in L-DE-71 relative to VEH/CON =9.07, p<0.01; Dunn\u2019s post hoc VEH/CON vs L-DE-71, p<0.01)  was plotted using absolute =2.024, ns, Sidak\u2019s post-hoc VEH/CON vs L-DE-71, p<0.05) (ITTinsulin measured over the first 30\u00a0min post-injection (The inverse area under the glucose response curve (inverse AUCad libitum fed state) =3.684, p=0.0409; Dunnet\u2019s post-hoc VEH/CON vs L-DE-71 p=0.0473; Glucagon, One-way ANOVA: Exposure effect F=5.61, p=0.02; Dunnett\u2019s T3 post-hoc VEH/CON vs L-DE-71 p=0.0449) =16.06, p<.0001; Tukey\u2019s post-hoc VEH/CON vs L-DE-71 p=0.0001, VEH/CON vs H-DE-71 p=0.002). Adrenal weights were not different across experimental groups =6.82, p=0.061; Tukey\u2019s post-hoc VEH/CON vs L-DE-71 p=0.01, L-DE-71 vs H-DE-71 p=0.01) =19.51, p<.0001; Dunnett\u2019s post-hoc VEH/CON vs L-DE-71 p=0.002, VEH/CON vs H-DE-71 p<0.0001) (p=0.03).Exposure to DE-71 decreases glucose tolerance which may be due to enhanced hepatic glucose production. To examine this possibility, we tested the hypothesis that PBDEs increase the activity of GDH a hepatic gluconeogenic enzyme. We found that exposure to L- and H-DE-71 significantly <0.0001) Figure\u00a07Male F1 mice exposed to either dose of DE-71 displayed normal liver levels of the endocannabinoid (EC), anandamide , and related fatty acid ethanolamides, docosahexaenoyl ethanolamide (DHEA) and oleoylethanolamide (OEA), when compared to VEH/CON . The combination of DE-71 effects - exaggerated fasting hypoglycemia, glucose intolerance and incomplete glucose clearance/utilization in response to insulin challenge demonstrates the complex actions of PBDEs on glucose homeostasis in males. Previously, we have observed abnormal glucose metabolism and other parameters in their DE-71-exposed female siblings  activity increases energy expenditure by burning fat and increasing metabolic rate and can utilize glucose especially when stimulated by insulin . TherefoIt is important to note that developmental exposure to DE-71 ends at weaning, but that dysregulated glucoregulatory phenotypes in exposed male and female offspring are observed in adulthood . We specin vivo and ex vivo parameters measured in DE-71-exposed male offspring indicate broad, complex effects of developmental exposure to PBDEs on glucose homeostasis and glucoregulatory parameters involving various organ systems. Our results support human studies reporting the positive association between body burdens of PBDEs and T2D and MetS  (AUP# 20170026 and 20200018).Conceptualization, MC-C, EK. Methodology, MC-C, EK, ND, JK, BC. Validation, MC-C, EK, BC, PP, ND. Formal Analysis, EK, MC-C, PP, ND. Investigation, EK, BC, PP, JK, AB, MC-C, MD. Writing \u2013 Original Draft, EK, MC-C, AB. Writing \u2013 Review & Editing, MC-C, EK, AB. Visualization, EK. Resources, MC-C., ND. Data Curation, EK, MC-C. Supervision, MC-C, EK, ND. Project Administration, MC-C, EK. Funding Acquisition, MC-C, EK, ND. All authors contributed to the article and approved the submitted version."}
+{"text": "Energy management methods (EMMs) utilizing sensing, communication, and networking technologies appear to be one of the most promising directions for energy saving and environmental protection of fuel cell vehicles (FCVs). In real-world driving situations, EMMs based on driving cycle information are critical for FCVs and have been extensively studied. The collection and processing of driving cycle information is a fundamental and critical work that cannot be separated from sensors, global positioning system (GPS), vehicle-to-vehicle (V2V), vehicle-to-everything (V2X), intelligent transportation system (ITS) and some processing algorithms. However, no reviews have comprehensively summarized the EMMs for FCVs from the perspective of driving cycle information. Motivated by the literature gap, this paper provides a state-of-the-art understanding of EMMs for FCVs from the perspective of driving cycle information, including a detailed description for driving cycle information analysis, and a comprehensive summary of the latest EMMs for FCVs, with a focus on EMMs based on driving pattern recognition (DPR) and driving characteristic prediction (DCP). Based on the above analysis, an in-depth presentation of the highlights and prospects is provided for the realization of high-performance EMMs for FCVs in real-world driving situations. This paper aims at helping the relevant researchers develop suitable and efficient EMMs for FCVs using driving cycle information. Energy shortage and environmental pollution are urgent problems that all countries in the world need to face . AcademiPrevious studies have shown that driving cycle information can make a difference in vehicle energy management ,13,14. IDriving cycle information is very critical for the development of EMMs, mainly reflected in the current driving patterns and future driving characteristics. However, in real-world driving situations, the driving cycle changes in real time. Consequently, obtaining current and future driving cycle information is a difficult and inaccessible task. As a matter of fact, some papers have proposed some EMMs considering driving cycle information for FCVs, mainly based on driving pattern recognition and future driving characteristic prediction. It is noticed that recent reviews have stated the advances progress in energy management methods for fuel cell vehicles ,23,24,25Motivated by the literature gap, this review mainly focuses on the technologies and progress of EMMs for FCVs from the perspective of driving cycle information, and strives to be comprehensive and innovative. The main contributions of this review are as follows: (i) providing a state-of-the-art understanding of EMMs for FCVs from the perspective of driving cycle information; (ii) providing a detailed description for driving cycle information analysis, including driving cycle collection and processing; (iii) providing a comprehensive summary of the latest EMMs for FCVs, with a focus on EMMs based on driving pattern recognition and driving characteristic prediction; and (iv) providing an in-depth presentation of the important highlights and prospects regarding the innovation of EMMs for FCVs. This review hopefully accelerates the realization of high-performance EMMs for FCVs in real-world driving situations.The rest of this review is organized into several sections: As the driving cycle is discerned as the input of the EMMs for FCVs, its information would affect the control performance of EMM extremely ,26. In aWith the development of intelligent networking technology, information and communication technology and big data technology, it is no longer difficult to collect and analyze the driving cycle. In recent years, global positioning system (GPS) receivers , on boarDue to the influence of the driving environment, jamming signals, zero drift, and buildings, the driving information collected often exhibited bad data . Bad datThe preprocessed driving cycle can be divided into some kinematic segments to reduce the complexity of subsequent processing. This segmentation is performed for the driving cycle characteristics analysis . DrivingPrevious studies have shown that driving pattern can greatly influence the effectiveness of EMMs ,57,58. FIn other studies of this area, supervised algorithms are adopted to recognize the vehicle driving pattern , such asThe driving cycle of a vehicle can be predicted by driving characteristic prediction (DCP) techniques, and the results indicate the current or future driving characteristics of the vehicle, like velocity and acceleration ,71. The The other is DCP based on positioning, sensing, interaction-aware, and other traffic information service technologies, such as V2X, V2V, and ITS ,82,83. TAs mentioned above, FCVs are one of the most promising future vehicles , and suiPrevious studies have extensively studied the EMMs of FCVs to improve energy efficiency and durability. The EMMs of FCVs can be divided into three major categories: (i) rule based, (ii) optimization based, and (iii) other based, as shown in As a new research hotspot in the field of artificial intelligence (AI) and internet of vehicles (IOV), learning-based and cycle information-based EMMs have been applied to achieve the optimal fuel economy of FCVs in real time ,111. ProIn recent years, to improve the performance of the EMMs for FCVs, research on driving pattern recognition has been proposed ,119,120.Moreover, to further improve the comprehensive economy of FCVs and extend the life of the ESSs, optimization algorithms and learning algorithms were combined and adopted in the design of EMMs. In , a genetCompared to the related research on the EMMs for FCVs based on driving pattern recognition, research on the EMMs for FCVs based on driving characteristic prediction is more extensive and in-depth due to the promotion of the intelligent process of NEVs ,131,132.Accurate driving pattern recognition: The accuracy of driving pattern recognition is crucial for the development and implementation of EMMs. However, recognition accuracy and algorithm complexity are interrelated. Some advanced recognition algorithms in the existing literature have the problem of low recognition accuracy. In the future, the sampling time, the selection of characteristic parameters, and the recognition period can all be combined with advanced recognition algorithms to construct recognition methods with excellent recognition accuracy and efficiency.Short-term driving characteristic prediction: Affected by the impacts of real-world driving conditions, the driving characteristics of vehicles will change in real time. Therefore, short-term driving characteristic prediction remains a hot and challenging issue, as it depends on various factors like the prediction method and traffic conditions. In the future, with the help of V2V, V2X, ITS and predictive algorithms, driving characteristics like speed, mileage, slope, and traffic signal light states can be predicted in the short term.Real-time energy management optimization: Ideal energy management optimization methods can adaptively generate effective control decisions considering the DPR and DCP results. However, most current energy management optimization methods are difficult to apply to real vehicles. Advanced algorithms bring up more possibilities of real-time energy management optimization which are worth exploring. In the future, real-time/online/adaptive EMMs will be considered for supplying an excellent control effect.Integrated driving style recognition: Even the same driver can exhibit different driving styles under different road conditions, and different driving styles can directly affect the energy management of the FCVs. Therefore, introducing the influence of driving styles into the EMMs for FCVs will be valuable and crucial. However, driving style is often described qualitatively, and is not integrated into the EMMs. In the future, integrated driving style recognition of drivers in real social driving networks will improve the effectiveness of EMMs for FCVs.In order to improve the energy economy and prolong the powertrain system durability of FCVs, it is urgent and meaningful to develop suitable and efficient EMMs. As driving cycle information is extremely important in EMMs for FCVs, some studies have studied driving cycle information collection and processing, which lay the foundation for the development of EMMs based on driving cycle information. This paper provides a state-of-the-art understanding and a detailed overview of EMMs for FCVs from the perspective of driving cycle information. More specifically, this paper comprehensively reviews studies on driving cycle information analysis and the EMMs for FCVs, which mainly focuses on EMMs based on DPR and DCP. This paper can provide potential guidance for the design and development of EMMs for FCVs in real-world driving situations. Although great progress has been made in the EMMs based on driving cycle information for FCVs, there are still many challenges. The main prospects of this review are the following:Accurate driving pattern recognition algorithms, short-term driving characteristic prediction algorithms, real-time energy management optimization methods and integrated driving style recognition methods will improve the energy economy and prolong the powertrain system durability of FCVs. In the future, our work will focus on the development and application of EMMs for FCVs based on the ITS and DCP technologies."
\ No newline at end of file